Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
hereinafter , the present invention will be described in detail with reference to the accompanying drawings . fig1 is a block diagram showing the configuration of an adaptive frequency hopping apparatus according to the present invention . as shown in fig1 , the adaptive frequency hopping apparatus comprises a frequency table 10 for monitoring the current qualities of channels for 79 frequency bands , and storing and outputting information on the channel quality for each 1 mhz frequency band accumulated n scan times , a frequency hopping transceiver 11 for generating and outputting a frequency pattern in accordance with predetermined rules , a link controller 12 for generating an asynchronous connectionless ( acl ) link , which is text data , in accordance with output signals of the frequency table 10 and the frequency hopping transceiver 11 and controlling selection of an operating mode between a channel avoidance scheme and a channel selection scheme , a packet handler 13 for generating packet data by integrating a synchronous connection oriented ( sco ) link and the acl link inputted therein , a gaussian frequency shift keying ( gfsk ) modulator 14 for performing gfsk modulation for signals outputted from the packet handler 13 , a mode selector 15 for selecting the operating mode between the channel avoidance scheme and the channel selection scheme in accordance with the output signals of the frequency hopping transceiver 11 and the link controller 12 , a frequency synthesizer 16 for synthesizing frequencies in accordance with output signals of the mode selector 15 , a first multiplier 17 for mixing signals from outputted from the frequency synthesizer 16 and the gfsk modulator 14 , and for outputting the multiplied signals as transmission signals , a second multiplier 18 for multiplying the output signals of the frequency synthesizer 16 by the receiving signals , an rssi detector 19 for detecting the rssi from output signals of the second multiplier 18 , a gfsk demodulator 20 for performing gfsk demodulation for the output signals of the second multiplier 18 , a packet handler 21 for restoring packet - type data from output signals of the gfsk demodulator 20 , and a channel quality detector 22 for estimating the channel quality by using the output signals of the rssi detector 19 and the packet handler 21 and storing it in the frequency table 10 . in the adaptive frequency hopping apparatus of the present invention having the configuration as described above , upon transmission of the predetermined data , the link controller 12 performs the mode selection for the frequency hopping in accordance with the sco and acl links . in addition , the apparatus operates in a frequency - hopping manner corresponding to each link according to the contents stored in the frequency table 10 and the frequency generated at the frequency hopping transceiver 11 , as described above . further , the apparatus performs transmission of the signals at a hop frequency generated by means of the relevant frequency hopping method from the finally modulated signals . further , upon reception of the predetermined data , the second multiplier 18 multiplies the received signals by the output signals of the frequency synthesizer 16 to perform the modulation , and then outputs the multiplied signals to both the rssi detector 19 and the gfsk demodulator 20 . the rssi detector 19 and the gfsk demodulator 20 perform the rssi measurement and the gfsk demodulation for the signals outputted from the second multiplier 18 , respectively . the packet handler 21 receives the signals demodulated at the gfsk demodulator 20 and restores the data , which have been transmitted thereto , in accordance with the types of packets . then , the channel quality detector 22 estimates the channel quality using the restored data and the detected rssi value . the channel quality detector 22 operates as shown in fig2 . if the access code correlator is triggered , the channel quality detector 22 checks a header error check ( hec ). if there is not the hec , the channel quality detector 22 estimates the channel as a good channel , and if there is the hec , the channel quality detector 22 does the channel as a bad channel . meanwhile , if the access code correlator is not triggered , the channel quality detector 22 compares the rssi value with a threshold value th . as the result of the comparison , if the rssi value is larger than the threshold value th , the channel quality detector 22 estimates the channel as a bad channel , and if not , the channel quality detector 22 do not operate any longer . furthermore , even at a receiving end , a relevant frequency hopping method is selected by comparing the contents registered in the frequency table 10 with the frequency generated at the frequency hopping transceiver 11 in accordance with the types of the transmitted packets . the signals are restored at a hop frequency generated by means of the relevant frequency hopping method from the finally received signals . that is , in case of the acl link , the master unit and the slave units in the piconet adopt the channel selection scheme in which a long packet is assigned to a good channel and a short packet is assigned to a bad channel by using the registered frequency table 10 . meanwhile , in case of the sco link , the channel avoidance scheme , in which voice information is transmitted through a good channel by avoiding a bad channel where the interference exists , is adopted . the channel selection scheme maximizes the data throughput of total users by transmitting data of the users as little as possible using a segment type 1 or 2 packet for rf channels with high packet error probability , and transmitting a segment type 3 or 4 packet for rf channels with good quality . in a process of packetizing the data of the user to be transmitted , the acl link can generate a proper type of packet by comparing the sequence of the frequency hopping transceiver 11 with the quality of the rf channel stored in the frequency table 10 . that is , in case of the frequency band corresponding to the bad channel , a short packet of 1 time slot , such as dm 1 ( dm : data medium ) of segment type 1 , which ⅔ forward error check ( fec ) is applied is generated . in case of the good channel , a relatively long packet of 3 or 5 time slots such as dh 3 ( dh : data high ), dh 5 , dm 3 and dm 5 of segment type 3 and segment type 4 is assigned thereto . this channel selection scheme of the acl link is performed using a link manager and a link controller of the bluetooth unit which controls the generation of the packets . generally , while a connection is established , the transmitters and the receivers of the master unit and the slave units hop onto new frequencies at every 625 μs . a channel is divided into 625 μs time slots according to the clocks of the master unit , and each time slot is numbered . according to the tdd scheme , the master unit transmits the data in even - numbered time slot and the slave units transmit the data in odd - numbered time slot . the link controller of the master unit and the slave unit obtain the channel quality information from the frequency table for the hop frequency generated at the frequency hopping transceiver at each transmission time slot . the link controller transfers the information on the quality of the rf channel to the link manager . furthermore , the channel selection scheme may be used in association with a power control scheme of the bluetooth . a receiving bluetooth unit can request a counterpart unit to increase or decrease the transmission power if difference between the measured rssi value and the threshold value is large . this power control message is defined in the link manager protocol in the existing bluetooth specification . in the adaptive frequency hopping method of the acl link , if the rf channel quality is bad , the packets are transmitted using the channel selection scheme with the increased transmission power . however , the power controlling method is not applied to all bad channels . the power control scheme is used in association with the channel selection scheme when the interference level of the bad channel stored in the frequency table is lower than the threshold value . establishing the connection of sco links , the link manager assigns the slots at intervals of t sco ( t sco is a unit time in which the master unit and the slave units can hop onto all frequency bands ) based on acl link . accordingly , since the type of the packet to be used is predetermined , an rf channel changing scheme is more advantageous than the channel selection scheme which changes the type of the packet according to the channel condition . upon reception and transmission of the signals , if the rf channel generated at the frequency hopping transceiver 11 is a bad channel stored in the frequency table 10 , the frequency band used upon reception and transmission of the signals is determined by changing the hop frequency into the good channel . in the channel selection scheme of the acl link , a transmitting bluetooth unit determines the type of the packet by estimating the channel quality of the hop frequency . however , in the channel avoidance scheme , both the transmitting and receiving unit must estimate the channel quality and hop onto an identical rf channel among the good channels . at this time , a good channel mapper determines which channel among the good channels is to be used . the implementation complexity of the channel avoidance scheme is affected by an implementation method of the good channel mapper . in order to meet the characteristics of the bluetooth such as simplicity , the good channel mapper is also implemented as a simple architecture which can use the conventional bluetooth specification . when the hop frequency is a bad channel , the good channel mapper uses a hop frequency that last hopped onto the good channel . assuming that the frequency band of the interference signals which can interfere with the bluetooth system is 20 – 30 mhz , in practice , the probability in which the hop sequence generated at the frequency hopping transceiver 11 will consecutively be assigned to three or more bad channels is low . therefore , even if the frequency assigned to the bad channel is replaced with a hop frequency last assigned to the good channel , the random property of the hop sequence is rarely affected . upon implementation thereof , the link controller updates only a register for storing the hop frequency last assigned to the good channel , and if the rf channel generated at the frequency hopping transceiver is a bad channel as the result of the comparison with the frequency table , the link controller simply uses the channel stored in the register . the master unit transmits the dm x ( x = 1 , 2 , 3 ) packets , and the slave units transmit the dm y ( y = 1 , 2 , 3 ) packets . the throughput p sco of the conventional frequency hopping system and the adaptive frequency hopping system for the sco link is given in accordance with hv z ( hv : high - quality voice , z = 1 , 2 , 3 ) of each sco packet as follows : where p t is a probability of successful transmission of the packet . each p t for the conventional frequency hopping system and the adaptive frequency hopping system according to the present invention can be expressed as the following equations 2 and 3 , respectively . where nba is the number of occurrence of good channel erroneously estimated as bad channels and nga is the number of occurrence of bad channels erroneously estimated as good channels . meanwhile , the throughput p acl of the acl link can be expressed as follows : p acl =( 1600 / w )·( p t 2 + p t 3 ) ( 4 ) the probability of successful transmission of the packet is p t = ng / nh , and w for the conventional frequency hopping system and the adaptive frequency hopping system of the present invention can be expressed as the following equations 5 and 6 , respectively . w = 2 ·( nb − nga + nba )/ nh + ( x + y )·( nh − nb + nga − nba )/ nh ( 6 ) considering the length of the packet , the data rate can be expressed as follows : r acl =( 1600 / w )· p t ·( 1 + p t )·[( nba / nh )· l 1 +{( nh − nb − nba )/ nn }· l 3 / 5 ] ( 7 ) where l 3 / 5 means l 3 or l 5 , and li is data length of dm i packet ( i = 1 , 3 or 5 ). fig3 and 4 are graphs illustrating the respective performances of the sco and acl links . as shown in fig3 and 4 , the adaptive frequency hopping system represents the improved data rate for both the sco and acl links . furthermore , the graphs show that as the channel estimation error pg = nba / ng and pb = nga / nb increase , the data rate decreases . the proposed adaptive frequency hopping scheme monitors the frequency channel quality so that the transmission packet can be less affected by an interference component . therefore , the entire data rate can be improved .	7
accordingly , the present invention relates to the compounds of the general formula ( i ) represented below and their pharmaceutically acceptable salts , enantiomers and their diastereomers ; wherein , v , w , x , y & amp ; z independently represents , ‘ c ’ or ‘ n ’; r 1 , represents groups selected from hydrogen , keto , halogen , unsubstituted or substituted groups selected from cyano , alkyl , haloalkyl , aryl , alkoxy , acyloxy , aryloxy , arylalkyl , heteroaryl , heterocyclyl , heterocycloalkyl , cycloalkyl , cycloalkylalkyl , aryloxyaryl , aryloxyalkyl , aryloxyheteroaryl groups ; wherein r 3 at each occurrence is independently selected from hydrogen , haloalkyl , c 1 - 7 alkyl , c 2 - 7 alkenyl , c 2 - 7 alkynyl , aryl , cycloalkyl , heterocycloalkyl , cycloalkyl ( c 1 - 7 ) alkyl , heterocycloalkyl ( c 1 - 7 ) alkyl , c ( o ) nh ( c 1 - 7 ) alkyl , c ( o )— ch ═ ch 2 , c ( o )— ch ═ ch — r 4 , c ( o )— c ( cn )═ ch 2 , c ( o )— c ( cn )═ ch — r 4 , so 2 — nh ( c 1 - 7 ) alkyl , so 2 — ch ═ ch 2 , so 2 — ch ═ ch — r 4 groups ; r 4 is selected from —( ch 2 ) n - nr 5 r 6 ; wherein , n = 0 - 7 and each of r 5 and r 6 are independently selected from hydrogen , haloalkyl , c 1 - 7 alkyl , c 2 - 7 alkenyl , c 2 - 7 alkynyl , aryl , cycloalkyl , carbocycle , heterocycloalkyl , cycloalkyl ( c 1 - 7 ) alkyl , heterocycloalkyl ( c 1 - 7 ) alkyl ; ‘ u ’ represent unsubstituted or substituted groups selected from alkyl , alkenyl , alkynyl , alkoxy , acyloxy , aryl , aryloxy , arylalkyl , cycloalkyl , cycloalkylalkyl , biaryl , heteroaryl , heterocycle , heterocycloalkyl , o - aryl , o - cycloalkyl , o - heteroaryl , o - heterocycle , o - heterocycloalkyl , aryloxyaryl , aryloxyalkyl , aryloxyheteroaryl , heteroaryloxyaryl , heteroaryl oxyalkyl , heteroaryloxyheteroaryl , ph - co — n ( r 7 r 8 ), ph - n ( r 9 )— co — r 10 , wherein , r 7 , r 8 and r 10 are independently selected from hydrogen , halogen , alkyl , haloalkyl , alkoxy ; aryl , cycloalkyl , heteroaryl , heterocycloalkyl ; further substituted with halogen , alkyl , alkoxy , haloalkoxy groups and r 9 are independently selected from hydrogen , c 1 - 7 alkyl , c 2 - 7 alkenyl , c 2 - 7 alkynyl . in a preferred embodiment , the groups , radicals described above may be selected from : “ alkyl ”, as well as other groups having the prefix “ alk ”, such as alkoxy and alkanoyl , means a carbon chain which may further be substituted with an oxygen atom as is well understood by a skilled artisan , which may further be either linear or branched , and combinations thereof , unless the carbon chain is defined otherwise . examples of alkyl group include but not are limited to methyl , ethyl , propyl , isopropyl , butyl , sec - butyl , tert .- butyl , pentyl , hexyl etc . where the specified number of carbon atoms permits e . g . from c 3 - 10 , the term alkyl also includes cycloalkyl groups , and combinations of linear or branched alkyl chains combined with cycloalkyl structures . when no number of carbon atoms is specified , c 1 - 6 is intended . “ alkenyl ” means carbon chains which contain at least one carbon - carbon double bond , and which may be linear or branched or combinations thereof , unless the carbon chain is defined otherwise . examples of alkenyl include vinyl , allyl , isopropenyl , hexenyl , pentenyl , heptenyl , 1 - propenyl , 2 - butenyl , 2 - methyl - 2 - butenyl etc . where the specified number of carbon atoms permits , e . g ., from c 5 - 10 , the term alkenyl also includes cycloalkenyl groups and combinations of linear , branched and cyclic structures . when no number of carbon atoms is specified , c ( 2 - 6 ) is intended . “ alkynyl ” means carbon chains which contain at least one carbon - carbon triple bond , and which may be linear or branched or combinations thereof . examples of alkynyl include ethynyl , propargyl , 3 - methyl - 1 - pentynyl etc . when no number of carbon atoms is specified , c ( 2 - 6 ) is intended . as used herein , “ carbocycle ” or “ carbocyclic residue ” is intended to mean any stable monocyclic or bicyclic or tricyclic ring , any of which may be saturated , partially unsaturated , or aromatic . examples of such carbocycles includecyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl , adamantyl , cyclooctyl , [ 3 . 3 . 0 ] bicyclooctane , [ 4 . 3 . 0 ] bicyclononane , [ 4 . 4 . 0 ] bicyclodecane ( decalin ), [ 2 . 2 . 2 ] bicyclooctane , fluorenyl , phenyl , naphthyl , indanyl , adamantyl , or tetrahydronaphthyl ( tetralin ). in a broader perspective , the term carbocycle is intended to include , wherever applicable , the groups representing cycloalkyl , phenyl and other saturated , partially saturated or aromatic residues ; “ cycloalkyl ” is the subset of alkyl and means saturated carbocyclic ring having a specified number of carbon atoms , preferably 3 - 6 carbon atoms . examples of cycloalkyl include cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl etc . a cycloalkyl group generally is monocyclic unless otherwise stated . cycloalkyl groups are saturated unless and otherwise stated . the “ alkoxy ” refers to the straight or branched chain alkoxides of the number of carbon atoms specified . “ aryl ” means a mono - or polycyclic aromatic ring system containing carbon ring atoms . the preferred aryls are monocyclic or bicyclic 6 - 10 membered aromatic ring systems . phenyl and naphthyl are preferred aryls . the terms “ heterocycle ” or “ heterocyclyl ” refer to saturated or unsaturated non - aromatic rings or ring systems containing at least one heteroatom selected from o , s , n further optionally including the oxidized forms of sulfur , namely so & amp ; so 2 . examples of heterocycles include tetrahydrofuran ( thf ), dihydrofuran , 1 , 4 - dioxane , morpholine , 1 , 4 - dithiane , piperazine , piperidine , 1 , 3 - dioxolane , imidazoline , imidazolidine , pyrrolidine , pyrroline , tetrahydropyran , dihydropyran , oxathiolane , dithiolane , 1 , 3 - dioxane , 1 , 3 - dithiane , oxathiane , thiomorpholine , etc . the term “ heterocycloalkyl ” refers to a heterocyclic group as defined above connected to an alkyl group as defined above ; “ heteroaryl ” means an aromatic or partially aromatic heterocycle that contains at least one ring heteroatom selected from o , s and n . heteroaryls thus include heteroaryls fused to the other kinds of rings , such as aryls , cycloalkyls , and heterocycles that are not aromatic . examples of heteroaryl groups include ; pyrrolyl , isoxazolyl , isothiazolyl , pyrazolyl , pyridyl , oxazolyl , oxadiazolyl , thiadiazolyl , thiazolyl , imidazolyl , triazolyl , tetrazolyl , furyl , triazinyl , thienyl , pyrimidyl , benzisoxazolyl , benzoxazolyl , benzthiazolyl , benzothiadiazolyl , dihydrobenzofuranyl , indolinyl , pyridazinyl , indazolyl , isoindolyl , dihydrobenzothienyl , indolinyl , pyridazinyl , indazolyl , isoindolyl , dihydrobenzothienyl , indolizinyl , cinnolinyl , phthalazinyl , quinazolinyl , napthyridinyl , carbazolyl , benzodioxolyl , quinoxalinyl , purinyl , furazanyl , isobenzylfuranyl , benzimidazolyl , benzofuranyl , benzothienyl , quinolyl , indolyl , isoquinolyl , dibenzofuranyl etc . for heterocyclyl and heteroaryl groups , rings and ring systems containing from 3 - 15 carbon atoms are included , forming 1 - 3 rings . an “ aryloxy ” group used either alone or in combination with other radicals , is selected from groups containing an aryl radical , as defined above , attached directly to an oxygen atom , more preferably groups selected from phenoxy , naphthyloxy , tetrahydronaphthyloxy , biphenyloxy , and the like ; “ cycloalkylalkyl ” means an alkyl radical substituted with cycloalkyl group as defined herein . cycloalkylalkyl groups include cyclopropylmethyl , cyclobutylmethyl , cyclopentylmethyl , cyclohexylmethyl , and the like . an “ arylalkyl ” group as used herein is an aromatic substituent that is linked to an alkyl group having from one to about six carbon atoms . examples of arylalkyl groups include benzyl group , phenethyl and the like . the “ acyloxy ” group used either alone or in combination with other radicals , is selected from a suitable acyl group , directly attached to an oxygen atom ; more preferably such groups are selected from acetyloxy , propionyloxy , butanoyloxy , iso - butanoyloxy , benzoyloxy and the like ; the term “ haloalkyl “ means a alkyl structure in which at least one hydrogen is replaced with a halogen atom . in certain embodiments in which two or more hydrogen atoms are replaced with halogen atoms , the halogen atoms are all the same as one another . in certain other embodiment in which two or more hydrogen atoms are replaced with halogen atoms , the halogen atoms are not all the same as one another . “ aryloxyalkyl ” means an alkyl radical substituted with aryloxy group as defined herein . “ aryloxyaryl ” means an aryl radical substituted with aryloxy group as defined herein . “ aryloxyheteroaryl ” means a heteroaryl radical substituted with aryloxy group as defined herein . “ halo / halogen ” refers to fluorine , chlorine , bromine , iodine . chlorine and fluorine are generally preferred . suitable groups and substituents on the groups may be selected from those described anywhere in the specification . the term “ substituted ,” as used herein , means that any one or more hydrogens on the designated atom is replaced with a selection from the indicated group , provided that the designated atom &# 39 ; s normal valency is not exceeded , and that the substitution results in a stable compound . the term “ substituted ,” as used herein , means that any one or more hydrogens on the designated atom is replaced with a selection from the indicated group , provided that the designated atom &# 39 ; s normal valency is not exceeded , and that the substitution results in a stable compound . “ pharmaceutically acceptable salts ” refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof . examples of pharmaceutically acceptable salts include mineral or organic acid salts of the basic residues . such conventional non - toxic salts include those derived from inorganic and organic acids selected from 1 , 2 - ethanedisulfonic , 2 - acetoxybenzoic , 2 - hydroxyethanesulfonic , acetic , ascorbic , benzenesulfonic , benzoic , bicarbonic , carbonic , citric , edetic , ethane disulfonic , ethane sulfonic , fumaric , glucoheptonic , gluconic , glutamic , glycolic , glycollyarsanilic , hexylresorcinic , hydrabamic , hydrobromic , hydrochloric , hydroiodide , hydroxymaleic , hydroxynaphthoic , isethionic , lactic , lactobionic , lauryl sulfonic , maleic , malic , mandelic , methanesulfonic , napsylic , nitric , oxalic , pamoic , pantothenic , phenyl acetic , phosphoric , polygalacturonic , propionic , salicyclic , stearic , subacetic , succinic , sulfamic , sulfanilic , sulfuric , tannic , tartaric , and toluenesulfonic . the term ‘ optional ’ or ‘ optionally ’ means that the subsequent described event or circumstance may or may not occur , and the description includes instances where the event or circumstance occur and instances in which it does not . for example , ‘ optionally substituted alkyl ’ means either ‘ alkyl ’ or ‘ substituted alkyl ’. further an optionally substituted group includes an unsubstituted group . unless otherwise stated in the specification , structures depicted herein are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms . the novel compounds of the present invention can be prepared using the reactions and techniques described below , together with conventional techniques known to those skilled in the art of organic synthesis , or variations thereon as appreciated by those skilled in the art . the reactions can be performed in solvents appropriate to the reagents and materials employed and suitable for the transformations being affected . preferred methods include those described below , where all symbols are as defined earlier unless and otherwise defined below . the compounds of the formula ( i ) can be prepared as described in schemes below along with suitable modifications / variations which are well within the scope of a person skilled in the art . wherein ‘ u ’, r 2 and r 3 are as defined earlier . compound of formula ( i ) can be prepared by variety of methods familiar to those skilled in art . compound of formula ( i ) was transformed into compound ( ii ) by reacted with hydrazine hydrate ( scheme - i ). compound of formula ( ii ) was cyclized using formamide to afford the compound of formula ( iii ). compound ( iii ) was reacted with n - iodosuccinimide to get compound ( iv ). compound ( iv ) reacted with compound ( v ) using different base to furnish the compound of formula ( vi ). compound ( vi ) can subjected to suzuki type of reaction , with compound ( vii ) using suitable catalysts , base and appropriate solvents to obtain compound of formula ( viii ). the deprotection of compound ( viii ) gives compound ( ix ). compound ( ix ) is reacted with optionally substituted acid chlorides ( x ) to obtain compounds of formula ( i ). the examples and preparations provided below further illustrate and exemplify the compounds of the present invention and methods of preparing such compounds . in the following examples molecules with a single chiral center , unless otherwise noted , exist as a racemic mixture . those molecules with two or more chiral centers , unless otherwise noted , exist as a racemic mixture of diastereomers . single enantiomers / diastereomers may be obtained by methods known to those skilled in the art . the compounds of formula ( i ) may also be synthesized as described in scheme ii . wherein ‘ u ’, r 2 and r 3 are as defined earlier . compound ( i ) may be continently prepared by variety of methods familiar to those skilled in art . compound ( i ) was transformed into compound ( ii ) by reacting with dibenzyl amine using different bases . compound of formula ( ii ) was reacted with different protected cycloalkyl amines ( iii ) using suitable bases to furnish compound ( iv ). compound ( iv ) was reduced to amine to afford the compound ( v ). compound ( v ) was reacted with triphosgene to get the compound ( vi ). compound ( vi ) was deprotected to using pd ( oh ) 2 to afford compound ( vii ). compound ( vii ) was reacted with different boronic acid to obtain compound ( viii ). compound ( viii ) was deproted using suitable acid to get the compound ( ix ). compound ( ix ) was reacted with optionally substituted acid chlorides using base to obtain compound of formula ( i ). the compounds of formula ( i ) may also be synthesized as described in scheme iii wherein ‘ u ’, r 2 and r 3 are as defined earlier . compound ( i ) may be continently prepared by variety of methods familiar to those skilled in art . compound ( i ) was transformed into compound ( ii ) using ammonia . compound ( ii ) reacted with compound ( iii ) using different base to furnish the compound of formula ( iv ). compound ( iv ) can be subjected to suzuki type of reaction , with compound ( v ) using suitable catalysts , base and appropriate solvents to obtain compound of formula ( vi ). compound ( vi ) can be halogenated to afford compound ( vii ). the deprotection of compound ( vii ) gives compound ( viii ). compound ( viii ) is reacted with optionally substituted acid chlorides to obtain compounds of formula ( i ). compounds of the present invention can be isolated either as free amine form or as a salt corresponding to the acid used such as trifluoroacetic acid , hydrochloric acid , hydrobromic acid , oxalic acid , maleic acid , fumeric acid , succinic acid , p - toluene sulfonic acid or benzene sulfonic acid . the compounds can be purified where ever required , by recrystallization , trituration , precipitation , preparative thin layer chromatography , flash chromatography or by preparative hplc method . the compounds of the present invention can be used either alone or in combination with one or more therapeutic agents or pharmaceutically acceptable salts thereof . such use will depend on the condition of the patient being treated and is well within the scope of a skilled practitioner . the invention is further illustrated by the following examples which describe the preferred way of carrying out the present invention . these are provided without limiting the scope of the present invention in any way . 1 h nmr spectral data given in the examples ( vide infra ) are recorded using a 400 mhz spectrometer ( bruker avance - 400 ) and reported in δ scale . until and otherwise mentioned the solvent used for nmr is cdcl 3 using tms as the internal standard . synthesis of titled compound was carried out , as described in scheme - iv and step - wise procedure is described below . intermediate 1 ( 2 . 0 g , 7 . 66 mmol ), prepared as per general process disclosed in us 2012 / 0088912 and triphenylphosphine ( 6 . 53 g ) were mixed together , in thf ( 20 ml ). tert - butyl 5 - hydroxyhexahydrocyclopenta [ c ] pyrrole - 2 ( 1h )- carboxylate 2 ( 3 . 47 g , 15 . 32 mmol ) was added to the mixture followed by the addition of diisopropyl diazodicarboxylate ( 2 . 26 ml , 11 . 49 mmol ). the reaction mixture was stirred at room temperature overnight , filtered and concentrated . the residue obtained was purified by flash chromatography ( ch 2 cl 2 / meoh = 98 / 2 ) to get intermediate 3 as a white solid ( 2 . 75 g , 76 % yield ). 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 1 . 40 ( s , 9h ), 1 . 94 - 2 . 00 ( m , 2h ), 2 . 17 - 2 . 24 ( m , 2h ), 2 . 82 - 3 . 00 ( m , 2h ), 3 . 10 - 3 . 14 ( m , 2h ), 3 . 45 - 3 . 50 ( m , 2h ), 5 . 27 - 5 . 30 ( m , 1h ), 8 . 29 ( s , 1h ). ms ( esi - ms ): m / z 471 . 10 ( m + h ) + . to a stirred solution intermediate 3 ( 2 . 7 g , 5 . 74 mmol ), dissolved in dry dmf ( 27 ml ), pdcl 2 ( pph 3 ) 2 ( 0 . 4 g , 0 . 57 mmol ), 4 - phenoxyphenylboronicacid 4 ( 1 . 84 g , 8 . 61 mmol ) and khco 3 ( 3 . 44 g , 34 . 46 mmol ) was added . the reaction mixture was heated at 90 ° c . for 2 hrs , under n2 atmosphere . mixture was cooled to room temperature , diluted with water ( 50 ml ) and extracted with etoac ( 3 × 50 ml ). the combined organic layer was washed with water ( 2 × 25 ml ) and brine solution ( 25 ml ), dried over na 2 so 4 , and concentrated to dryness . the residue obtained was purified by column chromatography ( using 0 - 5 % methanol in dcm as a mobile phase ) to obtain intermediate 5 as an off white solid ( 2 . 2 g , 74 % yield ). 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 1 . 48 ( s , 9h ), 1 . 98 - 2 . 04 ( m , 2h ), 2 . 27 - 2 . 34 ( m , 2h ), 2 . 89 ( s , 2h ), 3 . 13 - 3 . 17 ( m , 2h ), 3 . 47 ( q , 2h , j = 8 . 0 hz ), 5 . 36 ( q , 1h , j = 8 . 0 hz ), 7 . 10 - 7 . 14 ( m , 4h ), 7 . 144 - 7 . 20 ( m , 1h ), 7 . 40 - 7 . 43 ( m , 2h ), 7 . 65 - 7 . 68 ( m , 2h ), 8 . 23 ( s , 1h ). esi - ms ( esi - ms ): m / z 535 . 23 ( m + na ) + . to a solution of intermediate 5 ( 2 . 1 g , 4 . 09 mmol ) in ch 2 cl 2 ( 40 ml ) was added tfa ( 1 . 25 ml , 16 . 37 mmol ). after stirring 2 hrs at room temperature , the solvent was removed and the residues were dissolved in a mixture of ethyl acetate ( 50 ml ) and dilute aq . k 2 co 3 . the organic layer was separated , dried over mgso 4 , filtered and concentrated to provide intermediate 6 as a white solid ( 1 . 2 g , 71 % yield ). 1 h nmr ( 400 mhz ) δ ppm : 1 . 92 - 1 . 96 ( m , 2h ), 2 . 31 - 2 . 39 ( m , 2h ), 2 . 74 - 2 . 78 ( m , 2h ), 2 . 89 - 2 . 30 ( m , 2h ), 3 . 12 - 3 . 20 ( m , 2h ), 5 . 43 - 5 . 37 ( m , 1h ), 7 . 11 - 7 . 20 ( m , 5h ), 7 . 41 - 7 . 45 ( m , 2h ), 7 . 64 - 7 . 66 ( m , 2h ), 8 . 24 ( s , 1h ); ms ( esi - ms ): m / z 413 . 20 ( m + h ) + . to a solution of intermediate 6 ( 1 . 1 g , 2 . 66 mmol ), dissolved in ch 2 cl 2 ( 30 ml ), tri - ethyl amine ( 1 . 11 ml , 8 . 00 mmol ) was added followed by addition of acryl chloride ( 0 . 2 ml , 2 . 53 mmol ). the reaction was stopped after 2 hrs . the reaction mixture was washed with water and then with brine . the organic layer was separated , dried over mgso 4 , filtered and concentrated . residue obtained was purified by flash chromatography ( using ch 2 cl 2 / meoh = 25 / 1 , as a mobile phase ) to get compound 1 as a white solid ( 0 . 75 g , 60 % yield ). 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 36 ( s , 1h ), 7 . 66 - 7 . 62 ( m , 2h ), 7 . 37 - 7 . 41 ( m , 2h ), 7 . 13 - 7 . 20 ( s , 3h ), 7 . 07 - 7 . 09 ( m , 2h ), 6 . 36 - 6 . 50 ( m , 2h ), 5 . 68 - 5 . 71 ( m , 1h ), 5 . 53 - 5 . 59 ( m , 3h ), 3 . 82 - 3 . 87 ( m , 2h ), 3 . 45 - 3 . 53 ( m , 2h ), 3 . 10 - 3 . 21 ( m , 2h ), 2 . 50 - 2 . 58 ( m , 2h ), 2 . 11 - 2 . 17 ( m , 2h ); esi - ms : (+ ve mode ) 467 . 20 ( m + h ) + ( 100 %); uplc : 98 . 09 %. synthesis of titled compound was carried out , as described in scheme - v and step - wise procedure is described below . intermediate 1 ( 0 . 22 g , 0 . 851 mmol ) and triphenylphosphine ( 0 . 71 g ) were mixed together in thf ( 10 ml ). tert - butyl 5 - hydroxyhexahydrocyclopenta [ c ] pyrrole - 2 ( 1h )- carboxylate 2 ( 0 . 38 g , 1 . 7 mmol ) was added to the reaction mixture followed by the addition of diisopropyl diazodicarboxylate ( 0 . 24 ml , 1 . 22 mmol ). the reaction mixture was stirred at room temperature overnight , filtered and concentrated . the residue obtained was purified by flash chromatography ( ch 2 cl 2 / meoh = 98 / 2 ) to get intermediate 3 as a white solid ( 0 . 3 g , 76 % yield ). 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 1 . 40 ( s , 9h ), 1 . 94 - 2 . 00 ( m , 2h ), 2 . 17 - 2 . 24 ( m , 2h ), 2 . 82 - 3 . 00 ( m , 2h ), 3 . 10 - 3 . 14 ( m , 2h ), 3 . 45 - 3 . 50 ( m , 2h ), 5 . 27 - 5 . 30 ( m , 1h ), 8 . 29 ( s , 1h ). ms ( esi - ms ): m / z 471 . 10 ( m + h ) + . to a stirred solution of intermediate 3 ( 0 . 3 g , 0 . 638 mmol ), dissolved in dry dmf ( 3 ml ) were added pdcl 2 ( pph 3 ) 2 ( 0 . 089 g , 0 . 127 mmol ), ( 4 -( pyridin - 2 - ylcarbamoyl ) phenyl ) boronic acid 4 ( 0 . 31 g , 0 . 95 mmol ) and khco 3 ( 0 . 340 g , 3 . 56 mmol ). the reaction mixture was heated at 90 ° c . for 2 hrs , under n2 atmosphere . mixture was cooled to room temperature , diluted with water ( 50 ml ) and extracted with etoac ( 3 × 50 ml ). the combined organic layer was washed with water ( 2 × 25 ml ) and brine solution ( 25 ml ), dried over na 2 so 4 and concentrated to dryness . the residue obtained was purified by column chromatography ( silica gel , 0 - 5 % methanol in dcm ) to obtain intermediate 5 as an off white solid ( 0 . 25 g , 72 . 56 % yield ). 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 1 . 59 ( s , 9h ), 2 . 11 - 2 . 17 ( m , 2h ), 2 . 49 - 2 . 57 ( m , 2h ), 3 . 07 - 3 . 09 ( m , 2h ), 3 . 28 ( bs , 2h ), 3 . 64 ( bs , 2h ), 5 . 55 ( q , 1h , j = 8 . 0 hz ), 7 . 11 ( q , 1h , j = 8 . 0 hz ), 7 . 78 - 7 . 81 ( m , 1h ), 7 . 82 ( m , 2h ), 8 . 10 ( d , 2h , j = 8 . 0 hz ), 8 . 35 ( m , 1h ), 8 . 41 - 8 . 43 ( m , 2h ), 8 . 63 ( s , 1h ). esi - ms ( esi - ms ): m / z 541 . 41 ( m + h ) + . to a solution of intermediate 5 ( 0 . 25 g , 0 . 462 mmol ) in ch 2 cl 2 ( 10 ml ), tfa ( 1 . 0 ml , 15 . 87 mmol ) was added and the reaction mixture was stirred for 2 hrs at room temperature . the solvent was removed and the residue obtained was dissolved in a mixture of ethyl acetate ( 50 ml ) and dilute aq . k 2 co 3 . the organic layer was dried over mgso 4 , filtered and concentrated to get intermediate 6 as a white solid ( 0 . 13 g , 63 . 85 % yield ). 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 1 . 15 - 1 . 23 ( m , 2h ), 2 . 32 - 2 . 37 ( m , 2h ), 2 . 54 - 2 . 58 ( m , 2h ), 2 . 93 - 2 . 97 ( m , 2h ), 3 . 24 - 3 . 29 ( m , 2h ), 5 . 33 - 5 . 37 ( m , 1h ), 7 . 16 - 7 . 19 ( m , 1h ), 7 . 77 ( q , 2h , j = 12 . 0 hz ), 7 . 84 - 7 . 88 ( m , 1h ), 8 . 18 - 8 . 20 ( m , 2h ), 8 . 22 - 8 . 24 ( m , 1h ), 8 . 25 - 8 . 30 ( m , 1h ), 8 . 40 - 8 . 41 ( m , 1h ), 10 . 83 ( s , 1h ); ms ( esi - ms ): m / z 441 . 15 ( m + h ) + . to a solution of intermediate 6 ( 0 . 13 g , 0 . 295 mmol ), dissolved in ch 2 cl 2 ( 30 ml ) and tri - ethyl amine ( 0 . 090 g , 0 . 886 mmol ), acryl chloride ( 0 . 026 g , 0 . 295 mmol ) was added and the reaction mixture was stirred for 2 hrs . the reaction mixture was washed with water and brine solution . the organic layer was dried over mgso 4 , filtered , concentrated and residue obtained was purified by flash chromatography , using ch 2 cl 2 / meoh ( 25 / 1 ) to get compound 13 as a white solid ( 0 . 03 g , 20 . 58 % yield ). 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 72 ( s , 1h ), 8 . 43 ( d , 1h , j = 6 . 4 hz ), 8 . 39 ( s , 1h ), 8 . 35 - 8 . 34 ( m , 1h ), 8 . 13 ( d , 2h , j = 8 . 4 hz ), 7 . 88 ( d , 2h , j = 8 . 4 hz ), 7 . 83 - 7 . 79 ( m , 1h ), 7 . 14 - 7 . 11 ( m , 1h ), 6 . 49 ( dd , 1h , j 1 = 10 . 0 hz , j 2 = 16 . 8 hz ), 6 . 42 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 72 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 10 . 0 hz ), 5 . 61 - 5 . 55 ( m , 3h ), 3 . 89 - 3 . 84 ( m , 2h ), 3 . 57 - 3 . 47 ( m , 2h ), 3 . 24 - 3 . 21 ( m , 1h ), 315 - 3 . 12 ( m , 1h ), 2 . 60 - 2 . 52 ( m , 2h ), 2 . 21 - 2 . 14 ( m , 1h ); esi - ms : (+ ve mode ) 495 . 4 ( m + h ) + ( 100 %); hplc : 99 . 09 . 1 h nmr : ( cdcl 3 , 400 mhz ): δ 9 . 11 ( s , 1h ), 8 . 41 ( s , 1h ), 8 . 34 - 8 . 30 ( m , 2h ), 7 . 87 ( dd , 1h , = 1 . 6 hz , j 2 = 8 . 4 hz ), 6 . 49 ( dd , 1h , = 9 . 6 hz , j 2 = 16 . 8 hz ), 6 . 42 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 16 . 8 hz ), 5 . 72 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 9 . 6 hz ), 5 . 64 - 5 . 57 ( m , 1h ), 5 . 50 ( bs , 2h ), 3 . 89 - 3 . 84 ( m , 2h ), 3 . 57 - 3 . 47 ( m , 2h ), 3 . 25 - 3 . 20 ( m , 1h ), 3 . 17 - 3 . 11 ( m , 1h ), 2 . 62 - 2 . 54 ( m , 2h ), 2 . 22 - 2 . 13 ( m , 2h ); esi - ms : (+ ve mode ) 431 . 9 ( m + h ) + ( 100 %); hplc : 96 . 04 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 27 ( s , 1h ), 8 . 11 - 8 . 09 ( m , 1h ), 7 . 63 - 7 . 61 ( m , 2h ), 7 . 44 - 7 . 40 ( m , 1h ), 7 . 48 - 7 . 44 ( m , 2h ), 7 . 19 - 7 . 17 ( m , 1h ), 7 . 13 - 7 . 09 ( m , 5h ), 6 . 56 - 6 . 49 ( m , 1h ), 6 . 44 - 6 . 41 ( m , 1h ), 6 . 11 - 6 . 06 ( m , 1h ), 5 . 64 - 5 . 61 ( m , 1h ), 5 . 39 ( s , 2h ), 4 . 41 - 4 . 39 ( m , 2h ), 3 . 81 - 3 . 80 ( m , 1h ), 3 . 64 - 3 . 57 ( m , 2h ), 3 . 46 - 3 . 45 ( m , 2h ), 3 . 19 - 3 . 16 ( m , 2h ); esi - ms : (+ ve mode ) 559 . 35 ( m + h ) + ( 100 %); hplc : 95 . 82 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 37 ( s , 1h ), 7 . 65 ( dd , 2h , j 1 = 2 . 0 hz , j 2 = 6 . 4 hz ), 7 . 40 ( t , 2h , j = 4 . 4 hz ), 7 . 18 - 7 . 13 ( m , 3h ), 7 . 09 ( d , 2h , j = 7 . 6 hz ), 6 . 37 - 6 . 27 ( m , 2h ), 5 . 61 ( dd , 1h , j 1 = 3 . 6 hz , j 2 = 9 . 2 hz ), 5 . 41 ( bs , 2h ), 3 . 79 - 3 . 68 ( m , 2h ), 3 . 35 ( dd , 1h , = 4 . 8 hz , j 2 = 12 . 8 hz ), 3 . 27 ( dd , 1h , = 4 . 8 hz , j 2 = 10 . 4 hz ), 3 . 08 - 3 . 05 ( m , 1h ), 2 . 96 ( t , 1h , j = 6 . 0 hz ), 2 . 89 - 2 . 86 ( m , 1h ), 2 . 77 - 2 . 75 ( m , 1h ), 2 . 70 - 2 . 57 ( m , 4h ); esi - ms : (+ ve mode ) 496 . 15 ( m + h ) + ( 100 %); hplc : 96 . 62 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 40 ( s , 1h ), 8 . 19 ( d , 1h , j = 2 . 0 hz ), 8 . 12 ( d , 1h , j = 8 . 4 hz ), 7 . 77 ( dd , 1h , = 2 . 0 hz , j 2 = 8 . 4 hz ), 6 . 49 ( dd , 1h , = 10 . 0 hz , j 2 = 16 . 8 hz ), 6 . 42 ( dd , 1h , = 2 . 8 hz , j 2 = 16 . 8 hz ), 5 . 72 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 9 . 6 hz ), 5 . 61 - 5 . 57 ( m , 1h ), 5 . 31 ( bs , 2h ), 3 . 89 - 3 . 83 ( m , 2h ), 3 . 56 - 3 . 47 ( m , 2h ), 3 . 24 - 3 . 22 ( m , 1h ), 3 . 14 - 3 . 12 ( m , 1h ), 2 . 91 ( s , 3h ), 2 . 59 - 2 . 55 ( m , 2h ), 2 . 19 - 2 . 14 ( m , 2h ); esi - ms : (+ ve mode ) 446 . 0 ( m + h ) + ( 100 %); hplc : 95 . 09 %. 1 h nmr : ( dmso , 400 mhz ): δ 8 . 24 ( s , 1h ), 8 . 16 ( dd , 2h , j 1 = 6 . 0 hz , j 2 = 4 . 4 hz ), 7 . 85 ( d , 1h , j = 5 . 6 hz ), 7 . 65 ( dd , 1h , j 1 = 8 . 4 hz , j 2 = 1 . 6 hz ), 7 . 56 ( d , 1h , j = 5 . 2 hz ), 7 . 62 ( dd , 1h , j 1 = 10 . 4 hz , j 2 = 16 . 8 hz ), 6 . 14 ( dd , 1h , j 1 = 16 . 8 hz , j 2 = 2 . 4 hz ), 5 . 67 ( dd , 1h , j 1 = 10 . 0 hz , j 2 = 2 . 4 hz ), 5 . 45 - 5 . 41 ( m , 1h ), 3 . 81 - 3 . 76 ( m , 1h ), 3 . 66 - 3 . 60 ( m , 1h ), 3 . 54 - 3 . 50 ( m , 1h ), 3 . 42 - 3 . 35 ( m , 1h ), 3 . 00 - 3 . 08 ( m , 1h ), 23 . 00 - 2 . 98 ( m , 1h ), 2 . 38 - 2 . 31 ( m , 2h ), 2 . 09 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 431 . 0 ( m + h ) + ( 100 %), 453 . 2 ( m + na ) + ( 25 %); uplc : 98 . 53 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 22 ( s , 1h ), 7 . 55 - 7 . 51 ( m , 2h ), 7 . 42 - 7 . 38 ( m , 2h ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 11 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 17 . 2 hz ), 5 . 68 - 5 . 66 ( m , 1h ), 5 . 64 - 5 . 39 ( m , 1h ), 3 . 42 - 3 . 40 ( m , 1h ), 3 . 39 - 3 . 37 ( m , 1h ), 3 . 35 - 3 . 35 ( m , 1h ), 3 . 32 - 3 . 30 ( m , 3h ), 3 . 10 - 2 . 83 ( m , 2h ), 2 . 82 - 2 . 80 ( m , 2h ), 2 . 33 - 2 . 29 ( m , 3h ), 2 . 04 - 2 . 03 ( m , 2h ); ( esi - ms ): (+ ve mode ) 433 . 05 ( m + h ) + ( 100 %), uplc : 95 . 80 %. 1 h nmr : ( dmso , 400 mhz ): δ 8 . 30 - 8 . 28 ( m , 1h ), 8 . 26 ( s , 1h ), 8 . 22 - 8 . 20 ( m , 1h ), 7 . 92 ( d , 1h , j = 0 . 8 hz ), 7 . 75 - 7 . 69 ( m , 2h ), 7 . 58 - 7 . 54 ( m , 1h ), 7 . 46 - 5 . 43 ( m , 1h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 14 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 67 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 46 - 5 . 43 ( m , 1h ), 3 . 82 - 3 . 77 ( m , 1h ), 3 . 65 - 3 . 61 ( m , 1h ), 3 . 55 - 3 . 51 ( m , 1h ), 3 . 39 - 3 . 35 ( m , 1h ), 3 . 17 - 2 . 92 ( m , 2h ), 2 . 41 - 2 . 33 ( m , 2h ), 2 . 11 - 2 . 05 ( m , 2h ); esi - ms : (+ ve mode ) 465 . 1 ( m + h ) + ( 100 %), 487 . 3 ( m + na ) + ( 10 %); uplc : 95 . 50 . 1 h nmr : ( dmso , 400 mhz ): δ 12 . 41 ( s , 1h ), 8 . 24 ( s , 2h ), 8 . 87 - 8 . 85 ( m , 1h ), 7 . 69 - 7 . 67 ( m , 1h ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 14 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 14 . 4 hz ), 5 . 66 ( dd , 1h , j 1 = 1 . 2 hz , j 2 = 10 . 4 hz ), 5 . 44 - 5 . 41 ( m , 1h ), 3 . 81 - 3 . 38 ( m , 3h ), 3 . 40 - 3 . 33 ( m , 1h ), 3 . 11 - 2 . 99 ( m , 2h ), 2 . 50 - 2 . 37 ( m , 2h ), 2 . 20 ( s , 3h ), 2 . 12 - 1 . 90 ( m , 2h ); esi - ms : (+ ve mode ) 489 . 3 ( m + h ) + ( 100 %), 511 . 0 ( m + na ) + ( 10 %); uplc : 95 . 29 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 23 ( s , 1h ), 8 . 17 ( s , 1h ), 7 . 79 ( m , 1h , j = 8 . 4 hz ), 7 . 67 - 7 . 65 ( m , 1h ), 6 . 64 - 6 . 58 ( m , 1h ), 6 . 30 - 6 . 11 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 70 - 5 . 65 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 45 - 5 . 42 ( m , 1h ), 4 . 19 ( s , 3h ), 3 . 80 - 3 . 76 ( m , 1h ), 3 . 62 - 3 . 53 ( m , 1h ), 3 . 40 - 3 . 38 ( m , 1h ), 3 . 10 - 2 . 83 ( m , 1h ), 2 . 82 - 2 . 80 ( m , 2h ), 2 . 36 - 2 . 32 ( m , 2h ), 2 . 06 - 2 . 05 ( m , 2h ); ( esi - ms ): (+ ve mode ) 462 . 05 ( m + h ) + ( 100 %), uplc : 95 . 22 %, ret . time = 3 . 09 min . 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 23 ( s , 1h ), 7 . 67 - 7 . 64 ( m , 2h ), 7 . 44 - 7 . 40 ( m , 2h ), 7 . 19 - 7 . 10 ( m , 5h ), 5 . 4 ( s , 1h ), 4 . 21 - 4 . 18 ( m , 1h ), 3 . 83 - 3 . 74 ( m , 1h ), 3 . 65 - 3 . 61 ( m , 2h ), 3 . 05 - 3 . 03 ( m , 2h ), 2 . 34 - 2 . 31 ( m , 2h ), 2 . 05 - 2 . 03 ( m , 2h ); esi - ms : (+ ve mode ) 465 . 50 ( m + h ) + ( 100 %); hplc : 99 . 12 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 38 ( s , 1h ), 7 . 37 - 7 . 33 ( m , 3h ), 7 . 22 ( dd , 1h , j 1 = 8 . 0 hz , j 2 = 2 . 0 hz ), 7 . 14 - 7 . 08 ( m , 2h ), 7 . 03 ( d , 2h , j = 8 . 0 hz ), 6 . 51 - 6 . 37 ( m , 2h ), 5 . 70 ( dd , 1h , j 1 = 10 . 0 hz , j 2 = 2 . 4 hz ), 5 . 65 ( bs , 2h ), 5 . 60 - 5 . 53 ( m , 1h ), 3 . 95 ( s , 3h ), 3 . 89 - 3 . 84 ( m , 2h ), 3 . 55 - 3 . 51 ( m , 2h ), 3 . 24 - 3 . 21 ( m , 1h ), 3 . 15 - 3 . 11 ( m , 1h ), 2 . 63 - 2 . 54 ( m , 2h ), 2 . 21 - 2 . 12 ( m , 2h ); esi - ms : (+ ve mode ) 497 . 1 ( m + h ) + ( 100 %), 519 . 25 ( m + na ) + ( 50 %); uplc : 95 . 90 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 41 ( s , 1h ), 8 . 27 ( d , 1h , j = 1 . 6 hz ), 8 . 23 ( d , 1h , j = 8 . 0 hz ), 8 . 15 - 8 . 13 ( m , 2h ), 7 . 82 ( dd , 1h , j 1 = 8 . 0 hz , j 2 = 2 . 0 hz ), 7 . 56 - 7 . 53 ( m , 3h ), 6 . 52 - 6 . 38 ( m , 2h ), 5 . 70 ( dd , 1h , j 1 = 10 . 0 hz , j 2 = 2 . 0 hz ), 5 . 63 - 5 . 59 ( m , 1h ), 5 . 49 ( bs , 2h ), 3 . 90 - 3 . 84 ( m , 2h ), 3 . 57 - 3 . 48 ( m , 2h ), 3 . 25 - 3 . 22 ( m , 1h ), 3 . 17 - 3 . 14 ( m , 1h ), 2 . 63 - 2 . 55 ( m , 2h ), 2 . 22 - 2 . 13 ( m , 2h ); esi - ms : (+ ve mode ) 507 . 6 ( m + h ) + ( 100 %), 530 . 1 ( m + no + ( 30 %); uplc : 97 . 51 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 21 ( s , 1h ), 7 . 15 - 7 . 13 ( m , 1h ), 7 . 12 - 7 . 10 ( m , 1h ), 7 . 09 - 7 . 07 ( m , 1h ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 12 ( m , 1h ), 6 . 11 ( s , 2h ), 5 . 68 - 5 . 64 ( m , 1h ), 5 . 42 - 5 . 35 ( m , 1h ), 3 . 83 - 3 . 81 ( m , 1h ), 3 . 80 - 3 . 75 ( m , 1h ), 3 . 65 - 3 . 60 ( m , 1h ), 3 . 50 - 3 . 49 ( m , 1h ), 3 . 08 - 3 . 06 ( m , 1h ), 2 . 99 - 2 . 96 ( m , 1h ), 2 . 36 - 2 . 82 ( m , 2h ), 2 . 07 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 419 . 58 ( m + h ) + ( 100 %); hplc : 96 . 33 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 25 ( s , 1h ), 8 . 13 - 8 . 11 ( d , 2h , j = 8 . 0 hz ), 7 . 89 - 7 . 87 ( d , 2h , j = 8 . 0 hz ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 11 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 16 . 8 hz ), 5 . 68 - 6 . 65 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 20 hz ), 5 . 46 - 5 . 41 ( m , 1h ), 3 . 78 - 3 . 76 ( m , 1h ), 3 . 64 - 3 . 61 ( m , 1h ), 3 . 54 - 3 . 50 ( m , 1h ), 3 . 39 - 3 . 34 ( m , 1h ), 3 . 23 - 3 . 08 ( m , 1h ), 3 . 07 - 3 . 00 ( m , 1h ), 2 . 61 ( s , 3h ), 2 . 38 - 2 . 32 ( m , 2h ), 2 . 07 - 2 . 05 ( m , 2h ); esi - ms : (+ ve mode ) 457 . 10 ( m + h ) + ( 100 %); uplc : 95 . 87 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 40 ( s , 1h ), 8 . 22 ( s , 1h ), 7 . 99 - 7 . 97 ( m , 2h ), 7 . 74 - 7 . 72 ( m , 1h ), 6 . 47 - 6 . 42 ( m , 1h ), 5 . 73 - 5 . 70 ( m , 1h ), 5 . 78 - 5 . 60 ( m , 2h ), 3 . 86 - 3 . 84 ( m , 2h ), 3 . 57 - 3 . 55 ( m , 2h ), 3 . 22 - 3 . 19 ( m , 2h ), 2 . 56 - 2 . 54 ( m , 2h ), 2 . 18 - 2 . 16 ( m , 2h ); esi - ms : (+ ve mode ) 416 . 78 ( m + h ) + ( 100 %); hplc : 96 . 12 %. 1 h nmr : ( dmso , 400 mhz ): δ 8 . 24 ( s , 1h ), 7 . 64 ( dd , 2h , j 1 = 6 . 8 hz , j 2 = 2 . 0 hz ), 7 . 44 - 7 . 40 ( m , 2h ), 7 . 19 - 7 . 10 ( m , 5h ), 6 . 94 - 6 . 87 ( m , 1h ), 6 . 21 ( d , 1h , j = 10 . 0 hz ), 6 . 15 ( d , 1h , j = 16 . 8 hz ), 5 . 41 - 65 . 30 ( m , 1h ), 3 . 29 - 3 . 24 ( m , 2h ), 3 . 04 - 3 . 01 ( m , 4h ), 2 . 34 - 2 . 32 ( m , 2h ), 2 . 10 - 1 . 90 ( m , 2h ); esi - ms : (+ ve mode ) 503 . 15 ( m + h ) + ( 100 %); uplc : 95 . 16 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 41 ( s , 1h ), 8 . 32 - 8 . 30 ( m , 2h ), 7 . 96 - 7 . 93 ( m , 2h ), 7 . 73 - 7 . 70 ( m , 1h ), 7 . 59 - 7 . 57 ( m , 3h ), 6 . 52 - 6 . 43 ( m , 1h ), 5 . 72 - 5 . 69 ( m , 1h ), 5 . 62 - 5 . 59 ( m , 1h ), 5 . 50 - 5 . 49 ( m , 1h ), 3 . 90 - 3 . 84 ( m , 2h ), 3 . 58 - 3 . 48 ( m , 2h ), 3 . 23 - 3 . 19 ( m , 2h ), 2 . 60 - 2 . 58 ( m , 2h ), 2 . 20 - 2 . 17 ( m , 2h ); esi - ms : (+ ve mode ) 492 . 35 ( m + h ) + ( 100 %); hplc : 95 . 63 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 22 ( s , 1h ), 7 . 82 ( d , 1h , j = 8 . 4 hz ), 7 . 70 - 7 . 68 ( m , 1h ), 7 . 56 - 7 . 53 ( m , 2h ), 7 . 49 - 7 . 47 ( m , 2h ), 7 . 42 - 7 . 40 ( m , 1h ), 6 . 65 - 6 . 61 ( m , 1h ), 6 . 16 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 14 . 4 hz ), 5 . 68 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 64 - 5 . 40 ( m , 1h ), 3 . 58 - 3 . 50 ( m , 1h ), 3 . 38 - 3 . 36 ( m , 1h ), 3 . 35 - 3 . 33 ( m , 1h ), 3 . 25 - 2 . 84 ( m , 2h ), 2 . 82 - 2 . 80 ( m , 2h ), 2 . 36 - 2 . 32 ( m , 2h ), 2 . 08 - 2 . 00 ( m , 2h ); ( esi - ms ): (+ ve mode ) 524 . 15 ( m + h ) + ( 100 %), uplc : 95 . 74 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 38 ( s , 1h ), 7 . 86 - 7 . 83 ( m , 1h ), 7 . 71 - 7 . 70 ( m , 3h ), 7 . 69 - 7 . 63 ( m , 2h ), 6 . 51 - 6 . 37 ( m , 2h ), 5 . 72 - 5 . 69 ( m , 1h ), 5 . 59 - 5 . 44 ( m , 2h ), 3 . 99 ( s , 1h ), 3 . 50 - 3 . 46 ( m , 2h ), 3 . 23 - 3 . 14 ( m , 2h ), 2 . 57 - 2 . 55 ( m , 2h ), 2 . 18 - 2 . 14 ( m , 2h ), 1 . 68 - 1 . 59 ( m , 2h ); ( esi - ms ): (+ ve mode ) 455 . 10 ( m + h ) + ( 100 %), hplc : 95 . 98 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 84 ( s , 1h ), 8 . 24 ( s , 1h ), 8 . 01 ( s , 1h ), 7 . 93 - 7 . 91 ( d , 1h , j = 8 . 0 hz ), 7 . 73 - 7 . 71 ( d , 1h , j = 8 . 0 hz ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 11 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 16 . 8 hz ), 5 . 68 - 5 . 65 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 11 . 2 hz ), 5 . 44 - 5 . 41 ( m , 1h ), 3 . 78 - 3 . 66 ( m , 2h ), 3 . 63 - 3 . 60 ( m , 2h ), 3 . 53 - 3 . 50 ( m , 1h ), 3 . 40 - 3 . 38 ( m , 1h ), 3 . 15 - 2 . 85 ( m , 2h ), 2 . 07 - 2 . 05 ( m , 2h ); esi - ms : (+ ve mode ) 416 . 10 ( m + h ) + ( 100 %); uplc : 95 . 64 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 24 - 8 . 27 ( m , 3h ), 8 . 02 - 8 . 01 ( d , 1h , j = 4 . 0 hz ), 7 . 95 - 7 . 93 ( d , 1h , j = 8 . 0 hz ), 7 . 73 - 7 . 70 ( m , 1h ), 7 . 67 - 7 . 63 ( m , 3h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 12 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 45 - 5 . 42 ( m , 1h ), 3 . 81 - 3 . 66 ( m , 1h ), 3 . 64 - 3 . 61 ( m , 1h ), 3 . 55 - 3 . 50 ( m , 1h ), 3 . 39 - 3 . 35 ( m , 1h ), 3 . 10 - 3 . 00 ( m , 2h ), 2 . 44 - 2 . 31 ( m , 2h ), 2 . 09 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 492 . 05 ( m + h ) + ( 100 %); uplc : 97 . 40 %. 1 h nmr : ( d 2 o , 400 mhz ): δ 8 . 38 ( s , 1h ), 7 . 65 ( d , 2h , j = 6 . 8 hz ), 7 . 62 - 7 . 47 ( m , 2h ), 7 . 46 - 7 . 45 ( m , 1h ), 7 . 29 - 7 . 16 ( m , 2h ), 6 . 81 - 6 . 69 ( m , 2h ), 5 . 56 - 5 . 52 ( m , 1h ), 3 . 99 - 3 . 91 ( m , 3h ), 3 . 80 ( dd , 1h , j 1 = 8 . 4 hz , j 2 = 13 . 2 hz ), 3 . 63 ( dd , 1h , j 1 = 4 . 4 hz , j 2 = 11 . 2 hz ), 3 . 50 ( dd , 1h , j 1 = 4 . 8 hz , j 2 = 13 . 2 hz ), 3 . 20 - 3 . 11 ( m , 2h ), 2 . 93 ( s , 6h ), 2 . 47 - 2 . 41 ( m , 2h ), 2 . 23 - 2 . 16 ( m , 2h ); esi - ms : (+ ve mode ) 525 . 7 ( m + h ) + ( 100 %); hplc : 97 . 25 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 12 ( s , 1h ), 7 . 45 - 7 . 41 ( m , 4h ), 7 . 20 - 7 . 17 ( m , 1h ), 7 . 15 - 7 . 11 ( m , 1h ), 6 . 63 - 6 . 56 ( m , 1h ), 6 . 15 ( dd , 1h , j 1 = 4 . 0 hz , j 2 = 16 . 0 hz ), 5 . 74 - 5 . 72 ( m , 2h ), 5 . 97 - 5 . 64 ( m , 1h ), 5 . 01 - 4 . 93 ( m , 1h ), 3 . 62 - 3 . 46 ( m , 3h ), 3 . 40 - 3 . 35 ( m , 2h ), 3 . 20 - 2 . 90 ( m , 3h ), 1 . 90 - 1 . 97 ( m , 2h ); ( esi - ms ): (+ ve mode ) 483 . 10 ( m + h ) + ( 100 %); hplc : 98 . 02 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 84 - 8 . 83 ( d , 1h , j = 4 . 0 hz ), 8 . 31 - 8 . 26 ( m , 4h ), 8 . 12 - 8 . 08 ( m , 1h ), 7 . 95 - 7 . 93 ( d , 2h , j = 8 . 0 hz ), 7 . 69 - 7 . 66 ( m , 1h ), 6 . 65 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 12 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 65 - 5 . 68 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 47 - 5 . 44 ( m , 1h ), 3 . 81 - 3 . 77 ( m , 1h ), 3 . 65 - 3 . 61 ( m , 1h ), 3 . 55 - 3 . 50 ( m , 1h ), 3 . 39 - 3 . 33 ( m , 1h ), 3 . 12 - 2 . 90 ( m , 2h ), 2 . 42 - 2 . 31 ( m , 2h ), 2 . 09 - 2 . 07 ( m , 2h ); esi - ms : (+ ve mode ) 520 . 20 ( m + h ) + ( 85 %); uplc : 95 . 96 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 13 ( s , 1h ), 7 . 46 - 7 . 41 ( m , 4h ), 7 . 21 - 7 . 19 ( m , 1h ), 7 . 15 - 7 . 13 ( m , 2h ), 7 . 11 - 7 . 09 ( m , 2h ), 6 . 65 - 6 . 54 ( m , 1h ), 6 . 16 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 68 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 35 - 5 . 33 ( m , 1h ), 3 . 52 - 3 . 50 ( m , 1h ), 3 . 38 - 3 . 34 ( m , 1h ), 3 . 33 - 3 . 31 ( m , 1h ), 3 . 12 - 2 . 83 ( m , 1h ), 2 . 81 - 2 . 80 ( m , 1h ), 2 . 67 - 2 . 65 ( m , 2h ), 2 . 37 - 2 . 35 ( m , 1h ), 2 . 33 - 2 . 00 ( m , 2h ); ( esi - ms ): (+ ve mode ) 546 . 15 ( m + h ) + ( 100 %); uplc : 95 . 60 %. 1 h nmr : ( cdcl 3 - d 1 , 400 mhz ): δ 8 . 38 ( s , 1h ), 7 . 67 - 7 . 65 ( m , 2h ), 7 . 42 - 7 . 32 ( m , 2h ), 7 . 19 - 7 . 15 ( m , 3h ), 7 . 11 - 7 . 09 ( m , 2h ), 6 . 87 - 6 . 84 ( d , 1h , j = 11 . 6 hz ), 5 . 59 - 5 . 53 ( m , 1h ), 5 . 41 ( s , 2h ), 4 / 05 - 3 . 88 ( m , 2h ), 3 . 68 - 3 . 54 ( m , 2h ), 3 . 23 - 3 . 12 ( m , 2h ), 2 . 62 - 2 . 52 ( m , 2h ), 2 . 17 - 2 . 08 ( m , 2h ), 1 . 44 - 1 . 26 ( m , 2h ), 0 . 98 - 0 . 93 ( m , 2h ), 0 . 89 - 0 . 87 ( m , 1h ); esi - ms : (+ ve mode ) 532 . 25 ( m + h ) + ( 100 %); uplc : 95 . 05 %. 1 h nmr : ( dmso , 400 mhz ): δ 10 . 42 ( s , 1h ), 8 . 26 ( s , 1h ), 8 . 23 - 8 . 21 ( m , 1h ), 8 . 16 - 8 . 10 ( m , 1h ), 8 . 07 ( d , 1h , j = 8 . 0 hz ), 7 . 45 - 7 . 42 ( m , 2h ), 7 . 03 - 7 . 02 ( m , 1h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 15 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 4 hz ), 5 . 67 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 10 . 4 hz ), 5 . 46 - 5 . 42 ( m , 1h ), 4 . 08 ( s , 3h ), 3 . 85 - 3 . 75 ( m , 1h ), 3 . 70 - 3 . 57 ( m , 1h ), 3 . 56 - 3 . 45 ( m , 2h ), 3 . 15 - 2 . 90 ( m , 2h ), 2 . 45 - 2 . 38 ( m , 5h ), 2 . 18 - 2 . 06 ( m , 2h ); esi - ms : (+ ve mode ) 539 . 2 ( m + h ) + ( 100 %); uplc : 96 . 93 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 59 ( bs , 1h ), 8 . 39 ( s , 1h ), 8 . 26 ( s , 2h ), 8 . 19 ( d , 1h , j = 5 . 2 hz ), 8 . 11 ( d , 2h , j = 8 . 0 hz ), 7 . 87 ( d , 2h , j = 8 . 0 hz ), 6 . 95 ( d , 1h , j = 5 . 2 hz ), 6 . 48 ( dd , 1h , = 10 . 0 hz , j 2 = 16 . 8 hz ), 6 . 40 ( dd , 1h , = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 70 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 12 . 4 hz ), 5 . 60 - 5356 ( m , 1h ), 5 . 44 ( bs , 2h ), 3 . 88 - 3 . 83 ( m , 2h ), 3 . 56 - 3 . 46 ( m , 2h ), 3 . 23 - 3 . 21 ( m , 1h ), 3 . 14 - 3 . 12 ( m , 1h ), 2 . 59 - 2 . 54 ( m , 2h ), 2 . 43 ( s , 3h ), 2 . 20 - 2 . 09 ( m , 2h ); esi - ms : (+ ve mode ) 509 . 1 ( m + h ) + ( 100 %); hplc : 96 . 67 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 8 . 16 ( s , 1h ), 7 . 45 - 7 . 41 ( m , 3h ), 7 . 15 - 7 . 13 ( m , 2h ), 6 . 70 - 6 . 66 ( m , 5h ), 6 . 86 - 6 . 59 ( m , 1h ), 6 . 16 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 10 . 4 hz ), 5 . 68 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 30 - 5 . 24 ( m , 1h ), 3 . 80 - 3 . 78 ( m , 1h ), 3 . 66 - 3 . 51 ( m , 2h ), 3 . 51 - 3 . 35 ( m , 1h ), 3 . 10 - 2 . 95 ( m , 1h ), 2 . 37 - 2 . 34 ( m , 1h ), 2 . 32 - 2 . 25 ( m , 3h ), 2 . 07 - 2 . 05 ( m , 2h ); ( esi - ms ): (+ ve mode ) 466 . 05 ( m + h ) + ( 100 %); uplc : 97 . 65 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ10 . 82 ( s , 1h ), 8 . 77 - 8 . 76 ( m , 1h ), 8 . 23 ( s , 1h ), 8 . 18 - 8 . 12 ( m , 1h ), 8 . 11 - 8 . 09 ( m , 3h ), 7 . 71 - 7 . 65 ( m , 3h ), 6 . 65 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 11 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 43 - 5 . 41 ( m , 1h ), 3 . 82 - 3 . 79 ( m , 1h ), 3 . 76 - 3 . 73 ( m , 1h0 , 3 . 50 - 3 . 48 ( m , 1h ), 3 . 37 - 3 . 35 ( m , 1h ), 3 . 23 - 3 . 19 ( m , 2h ), 2 . 35 - 2 . 32 ( m , 2h ), 2 . 08 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 495 . 15 ( m + h ) + ( 100 %); hplc : 98 . 31 %. 1 h nmr : ( dmso , 400 mhz ): δ 8 . 12 ( s , 1h ), 7 . 45 - 7 . 40 ( m , 4h ), 7 . 21 - 7 . 19 ( m , 1h ), 7 . 17 - 7 . 13 ( m , 4h ), 6 . 94 - 6 . 87 ( m , 1h ), 6 . 21 - 6 . 12 ( m , 2h ), 5 . 71 ( m , 1h ), 4 . 97 ( m , 1h ), 3 . 34 - 3 . 33 ( m , 1h ), 3 . 00 - 2 . 96 ( m , 4h ), 2 . 61 - 2 . 59 ( m , 2h ), 1 . 86 - 1 . 81 ( m , 2h ); esi - ms : (+ ve mode ) 519 . 15 ( m + h ) + ( 100 %); 541 . 35 ( m + na ) + ( 10 %); uplc : 95 . 21 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 13 . 0 ( s , 1h ), 8 . 32 - 8 . 30 ( m , 2h ), 8 . 26 ( s , 1h ), 8 . 19 - 8 . 17 ( m , 1h ), 7 . 86 - 7 . 84 ( m , 2h ), 7 . 82 - 7 . 80 ( m , 1h ), 7 . 49 - 7 . 47 ( m , 1h ), 7 . 36 - 7 . 34 ( m , 1h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 17 - 6 . 12 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 49 - 5 . 47 ( m , 1h ), 3 . 83 - 3 . 81 ( m , 1h ), 3 . 76 - 3 . 73 ( m , 1h ), 3 . 09 - 3 . 06 ( m , 1h ), 2 . 45 - 2 . 44 ( m , 2h ), 2 . 37 - 2 . 35 ( m , 2h ); esi - ms : (+ ve mode ) 551 . 78 ( m + h ) + ( 100 %); hplc : 97 . 74 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 10 . 92 ( s , 1h ), 9 . 32 ( s , 1h ), 8 . 95 ( s , 1h ), 8 . 84 - 8 . 83 ( m , 1h ), 8 . 23 ( s , 1h ), 8 . 11 - 8 . 09 ( d , 2h , j = 8 . 0 hz ), 7 . 69 - 7 . 67 ( d , 2h , j = 8 . 0 hz ), 6 . 65 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 11 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 16 . 8 hz ), 5 . 68 - 5 . 43 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 . 4 hz ), 5 . 43 - 5 . 40 ( m , 1h ), 3 . 81 - 3 . 76 ( m , 1h ), 3 . 66 - 3 . 61 ( m , 1h ), 3 . 54 - 3 . 50 ( m , 1h ), 3 . 38 - 3 . 34 ( m , 1h ), 3 . 10 - 3 . 08 ( m , 1h ), 3 . 00 - 2 . 98 ( m , 1h ), 2 . 37 - 2 . 32 ( m , 2h ), 2 . 08 - 2 . 03 ( m , 2h ); esi - ms : (+ ve mode ) 496 . 15 ( m + h ) + ( 100 %); uplc : 95 . 55 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 19 ( s , 1h ), 7 . 21 - 7 . 19 ( m , 1h ), 7 . 17 - 7 . 14 ( m , 1h ), 7 . 07 - 7 . 05 ( m , 1h ), 6 . 59 - 6 . 55 ( m , 1h ), 6 . 15 - 6 . 12 ( m , 1h ), 5 . 67 - 5 . 64 ( m , 1h ), 5 . 40 - 5 . 32 ( m , 1h ), 3 . 81 - 3 . 79 ( m , 1h ), 3 . 78 - 3 . 75 ( m , 1h ), 3 . 59 - 3 . 57 ( m , 1h ), 3 . 51 - 3 . 48 ( m , 1h ), 3 . 03 - 3 . 00 ( m , 1h ), 2 . 97 - 2 . 93 ( m , 1h ), 2 . 36 - 2 . 82 ( m , 2h ), 2 . 02 - 2 . 00 ( m , 2h ); esi - ms : (+ ve mode ) 455 . 78 ( m + h ) + ( 100 %); hplc : 96 . 22 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 11 . 22 ( s , 1h ), 9 . 45 ( s , 1h ), 8 . 50 - 8 . 49 ( m , 1h ), 8 . 44 - 8 . 43 ( m , 1h ), 8 . 23 - 8 . 22 ( m , 2h ), 7 . 83 - 7 . 81 ( m , 2h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 12 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 47 - 5 . 44 ( m , 1h ), 3 . 81 - 3 . 80 ( m , 1h ), 3 . 79 - 3 . 76 ( m , 1h ), 3 . 54 - 3 . 53 ( m , 1h ), 3 . 39 - 3 . 38 ( m , 2h ), 3 . 08 - 3 . 01 ( m , 2h ), 2 . 39 - 2 . 31 ( m , 2h ), 2 . 09 - 2 . 06 ( m , 2h ); esi - ms : (+ ve mode ) 496 . 25 ( m + h ) + ( 100 %); hplc : 96 . 38 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 10 . 44 ( s , 1h ), 8 . 24 ( s , 1h ), 7 . 98 ( d , 4h , j = 8 . 0 hz ), 7 . 65 ( d , 2h , j = 8 . 4 hz ), 7 . 60 - 7 . 53 ( m , 3h ), 6 . 62 ( dd , 1h , = 16 . 8 hz , j 2 = 10 . 2 hz ), 6 . 14 ( dd , 1h , = 16 . 8 hz , j 2 = 2 . 4 hz ), 5 . 67 ( dd , 1h , = 10 . 2 hz , j 2 = 2 . 4 hz ), 5 . 42 - 5 . 38 ( m , 1h ), 3 . 78 - 3 . 75 ( m , 1h ), 3 . 66 - 3 . 60 ( m , 1h ), 3 . 55 - 3 . 50 ( m , 1h ), 3 . 37 - 3 . 33 ( m , 1h ), 3 . 10 - 3 . 06 ( m , 1h ), 3 . 01 - 2 . 98 ( m , 1h ), 2 . 37 - 2 . 32 ( m , 2h ), 2 . 08 - 2 . 05 ( m , 2h ); esi - ms : (+ ve mode ) 494 . 1 ( m + h ) + ( 100 %); uplc : 96 . 83 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 74 - 8 . 76 ( m , 1h ), 8 . 33 - 8 . 35 ( m , 1h ), 8 . 22 - 8 . 26 ( m , 3h ), 8 . 08 - 8 . 15 ( m , 1h ), 7 . 87 - 7 . 89 ( m , 2h ), 7 . 62 - 7 . 64 ( m , 1h ), 6 . 59 - 6 . 66 ( m , 1h ), 6 . 12 - 6 . 17 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 65 - 5 . 68 ( m , 1h ), 5 . 41 - 5 . 48 ( m , 1h ), 3 . 75 - 3 . 90 ( m , 1h ), 3 . 58 - 3 . 68 ( m , 1h ), 3 . 55 - 3 . 58 ( m , 1h ), 3 . 35 - 3 . 37 ( m , 1h ), 2 . 90 - 3 . 10 ( m , 2h ), 2 . 35 - 2 . 37 ( m , 2h ), 2 . 07 - 2 . 08 ( m , 2h ); esi - ms : (+ ve mode ) 536 . 05 ( m + h ) + ( 100 %); uplc : 97 . 81 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 9 . 02 ( bs , 1h ), 8 . 73 ( s , 1h ), 8 . 51 ( d , 1h , j = 5 . 2 hz ), 8 . 39 ( s , 1h ), 8 . 14 ( d , 2h , j = 8 . 4 hz ), 7 . 89 ( d , 2h , j = 8 . 4 hz ), 7 . 33 ( dd , 1h , j 1 = 0 . 8 hz , j 2 = 5 . 2 hz ), 6 . 48 ( dd , 1h , j 1 = 10 . 0 hz , j 2 = 16 . 8 hz ), 6 . 40 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 69 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 9 . 6 hz ), 5 . 60 - 5 . 56 ( m , 3h ), 3 . 87 - 3 . 83 ( m , 2h ), 3 . 56 - 3 . 47 ( m , 2h ), 3 . 25 - 3 . 20 ( m , 1h ), 3 . 18 - 3 . 09 ( m , 1h ), 2 . 57 - 2 . 53 ( m , 2h ), 2 . 18 - 2 . 15 ( m , 2h ); esi - ms : (+ ve mode ) 563 . 3 ( m + h ) + ( 100 %); hplc : 99 . 55 %. 1 h nmr : ( cdcl 3 , 400 mhz ): δ 8 . 47 ( d , 2h , j = 8 . 4 hz ), 8 . 32 ( s , 2h ), 7 . 75 ( d , 2h , j = 8 . 4 hz ), 7 . 53 ( d , 1h , j = 6 . 4 hz ), 6 . 52 - 6 . 45 ( m , 2h ), 6 . 42 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 16 . 8 hz ), 5 . 72 ( dd , 1h , j 1 = 2 . 8 hz , j 2 = 10 . 0 hz ), 5 . 59 - 5 . 55 ( m , 1h ), 3 . 91 ( s , 3h ), 3 . 87 - 3 . 83 ( m , 2h ), 3 . 56 - 3 . 47 ( m , 2h ), 3 . 26 - 3 . 21 ( m , 1h ), 3 . 16 - 3 . 11 ( m , 1h ), 2 . 58 - 2 . 53 ( m , 2h ), 2 . 36 ( s , 3h ), 2 . 19 - 2 . 15 ( m , 2h ); esi - ms : (+ ve mode ) 523 . 2 ( m + h ) + ( 100 %); hplc : 98 . 58 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 10 . 77 ( s , 1h ), 8 . 26 - 8 . 25 ( m , 2h ), 8 . 19 - 8 . 17 ( m , 2h ), 8 . 08 ( m , 1h ), 7 . 80 - 7 . 78 ( m , 2h ), 7 . 03 - 7 . 02 ( m , 1h ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 16 - 6 . 12 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 48 - 5 . 43 ( m , 1h ), 3 . 81 - 3 . 79 ( m , 1h ), 3 . 77 - 3 . 74 ( m , 1h ), 3 . 61 - 3 . 58 ( m , 1h ), 3 . 22 - 3 . 18 ( m , 2h ), 3 . 13 - 3 . 07 ( m , 2h ), 2 . 35 ( s , 3h ), 2 . 08 - 2 . 06 ( m , 2h ); esi - ms : (+ ve mode ) 509 . 35 ( m ) + ( 100 %); hplc : 97 . 99 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 24 ( s , 1h ), 8 . 20 - 8 . 18 ( dd , 1h , j 1 = 8 . 0 hz , j 2 = 8 . 0 hz ), 7 . 90 - 7 . 86 ( m , 1h ), 7 . 71 - 7 . 69 ( d , 2h , j = 8 . 0 hz ), 7 . 29 - 7 . 27 ( d , 2h , j = 16 hz ), 7 . 18 - 7 . 15 ( m , 1h ), 7 . 11 - 7 . 09 ( d , 1h , j = 8 . 0 hz ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 11 ( dd , 1h , j 1 = 4 . 0 hz , j 2 = 8 . 0 hz ), 5 . 68 - 5 . 65 ( dd , 1h , j 1 = 2 . 4 hz , j 2 = 10 hz ), 5 . 44 - 5 . 40 ( m , 1h ), 3 . 80 - 3 . 76 ( m , 1h ), 3 . 65 - 3 . 50 ( m , 3h ), 3 . 08 - 3 . 07 ( m , 1h ), 3 . 00 - 2 . 97 ( m , 1h ), 2 . 38 - 2 . 32 ( m , 2h ), 2 . 08 - 2 . 03 ( m , 2h ); esi - ms : (+ ve mode ) 468 . 00 ( m + h ) + ( 100 %); uplc : 95 . 99 %. 1 h nmr ( dmso - d 6 , 400 mhz ) δ ppm : 10 . 89 ( s , 1h ), 9 . 83 - 9 . 81 ( m , 1h ), 8 . 35 - 8 . 29 ( m , 1h ), 8 . 28 - 8 . 23 ( m , 1h ), 8 . 22 - 8 . 20 ( m , 3h ), 7 . 89 - 7 . 81 ( m , 1h ), 7 . 80 - 7 . 78 ( m , 1h ), 6 . 72 - 6 . 70 ( m , 1h ), 6 . 66 - 6 . 64 ( m , 1h ), 5 . 53 - 5 . 50 ( m , 1h ), 3 . 91 - 3 . 89 ( m , 2h ), 2 . 79 ( d , 6h , j = 4 . 4 hz ); ( esi - ms ): (+ ve mode ) 552 . 40 ( m + h ) + ( 100 %); uplc : 98 . 02 %. 1 h nmr : ( d 2 o , 400 mhz ): δ 8 . 47 ( s , 1h ), 8 . 34 ( d , 1h , j = 6 . 4 hz ), 8 . 23 ( d , 2h , j = 8 . 4 hz ), 7 . 96 ( d , 2h , j = 8 . 4 hz ), 7 . 59 - 7 . 56 ( m , 2h ), 6 . 83 - 6 . 70 ( m , 2h ), 5 . 64 - 5 . 51 ( m , 1h ), 4 . 01 - 3 . 95 ( m , 3h ), 3 . 83 ( dd , 1h , j 1 = 8 . 4 hz , j 2 = 13 . 2 hz ), 3 . 67 ( dd , 1h , j 1 = 4 . 8 hz , j 2 = 11 . 2 hz ), 3 . 55 ( dd , 1h , j 1 = 4 . 8 hz , j 2 = 13 . 2 hz ), 3 . 27 - 3 . 23 ( m , 1h ), 3 . 21 - 3 . 18 ( m , 1h ), 2 . 91 ( s , 6h ), 2 . 65 ( s , 3h ), 2 . 54 - 2 . 47 ( m , 2h ), 2 . 30 - 2 . 24 ( m , 2h ); esi - ms : (+ ve mode ) 566 . 3 ( m + h ) + ( 100 %); hplc : 96 . 24 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 9 . 53 ( s , 1h ), 8 . 87 - 8 . 85 ( m , 2h ), 8 . 27 - 8 . 25 ( m , 3h ), 7 . 90 - 7 . 88 ( d , 2h , j = 8 . 0 hz ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 17 - 6 . 12 ( m , 1h ), 5 . 68 - 5 . 65 ( m , 1h ), 5 . 47 - 5 . 42 ( m , 1h ), 3 . 80 - 3 . 78 ( m , 1h ), 3 . 56 - 3 . 52 ( m , 1h ), 3 . 37 - 3 . 33 ( m , 1h ), 3 . 10 - 2 . 90 ( m , 3h ), 2 . 39 - 2 . 32 ( m , 2h ), 2 . 10 - 2 . 07 ( m , 2h ); esi - ms : (+ ve mode ) 537 . 20 ( m + h ) + ( 100 %); hplc : 97 . 71 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 24 ( s , 1h ), 8 . 21 - 8 . 19 ( m , 1h ), 7 . 90 - 7 . 86 ( m , 1h ), 7 . 71 - 7 . 69 ( m , 2h ), 7 . 30 - 7 . 28 ( m , 2h ), 7 . 19 - 7 . 15 ( m , 1h ), 7 . 12 - 7 . 10 ( d , 1h , j = 8 . 0 hz ), 6 . 66 - 6 . 60 ( m , 1h ), 6 . 42 - 6 . 38 ( d , 1h , j = 16 hz ), 5 . 44 - 5 . 41 ( m , 1h ), 3 . 77 - 3 . 74 ( m , 1h ), 3 . 62 - 3 . 59 ( m , 1h ), 3 . 52 - 3 . 48 ( m , 1h ), 3 . 37 - 3 . 36 ( m , 1h ), 3 . 09 - 2 . 99 ( m , 4h ), 2 . 36 - 2 . 31 ( m , 2h ), 2 . 15 ( s , 6h ), 2 . 08 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 525 . 45 ( m + h ) + ( 100 %); hplc : 96 . 91 %. 1 h nmr : ( cd 3 od , 400 mhz ): δ 8 . 43 ( s , 1h ), 8 . 09 ( d , 2h , j = 6 . 4 hz ), 7 . 45 - 7 . 41 ( m , 2h ), 7 . 22 - 7 . 16 ( m , 3h ), 7 . 13 - 7 . 11 ( m , 2h ), 6 . 87 ( d , 1h , j = 15 . 2 hz ), 6 . 77 ( dd , 1h , j 1 = 6 . 8 hz , j 2 = 14 . 0 hz ), 5 . 69 - 5 . 64 ( m , 1h ), 3 . 98 ( d , 2h , j = 6 . 8 hz ), 3 . 97 - 3 . 92 ( m , 1h ), 3 . 83 - 3 . 78 ( m , 1h ), 3 . 67 - 3 . 64 ( m , 4h ), 3 . 54 ( dd , 1h , j 1 = 4 . 8 hz , j 2 = 13 . 2 hz ), 3 . 32 - 3 . 28 ( m , 1h ), 3 . 21 - 3 . 17 ( m , 1h ), 2 . 93 ( s , 6h ), 2 . 55 - 2 . 50 ( m , 2h ), 2 . 24 - 2 . 19 ( m , 2h ); esi - ms : (+ ve mode ) 524 . 3 ( m + h ) + ( 100 %); hplc : 97 . 39 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 11 . 25 ( s , 1h ), 9 . 45 ( s , 1h ), 8 . 51 - 8 . 50 ( m , 1h ), 8 . 44 ( m , 1h ), 8 . 26 ( s , 1h ), 8 . 23 - 8 . 21 ( m , 2h ), 7 . 83 - 7 . 81 ( m , 2h ), 6 . 64 - 6 . 61 ( m , 1h ), 6 . 43 - 6 . 39 ( m , 1h ), 5 . 48 - 5 . 45 ( m , 1h ), 3 . 81 - 3 . 78 ( m , 1h ), 3 . 76 - 3 . 72 ( m , 1h ), 3 . 68 - 3 . 62 ( m , 1h ), 3 . 20 - 3 . 18 ( m , 1h ), 3 . 04 - 3 . 02 ( m , 3h ), 2 . 99 - 2 . 97 ( m , 1h ), 2 . 37 - 2 . 15 ( m , 2h ), 2 . 15 ( m , 6h ), 2 . 08 ( m , 2h ); esi - ms : (+ ve mode ) 553 . 45 ( m + h ) + ( 100 %); hplc : 95 . 44 %. 1 h nmr : ( cd 3 od , 400 mhz ): δ 8 . 73 ( d , 1h , j = 6 . 4 hz ), 8 . 47 ( s , 1h ), 8 . 31 ( d , 2h , j = 8 . 4 hz ), 8 . 13 ( s , 1h ), 7 . 98 ( d , 2h , j = 8 . 4 hz ), 7 . 77 - 7 . 76 ( m , 1h ), 6 . 87 ( d , 1h , j = 15 . 2 hz ), 6 . 78 ( dd , 1h , j 1 = 6 . 8 hz , j 2 = 13 . 6 ), 5 . 72 - 5 . 68 ( m , 1h ), 4 . 31 ( s , 3h ), 3 . 98 ( d , 2h , j = 7 . 2 hz ), 3 . 96 - 3 . 93 ( m , 1h ), 3 . 81 ( dd , 1h , j 1 = 8 . 0 hz , j 2 = 12 . 8 hz ), 3 . 68 ( dd , 1h , = 4 . 8 hz , j 2 = 11 . 2 hz ), 3 . 53 ( dd , 1h , = 4 . 8 hz , j 2 = 13 . 2 hz ), 3 . 31 - 3 . 26 ( m , 2h ), 2 . 70 ( s , 3h ), 2 . 57 - 2 . 52 ( m , 2h ), 2 . 26 - 2 . 24 ( m , 2h ); esi - ms : (+ ve mode ) 580 . 5 ( m + h ) + ( 100 %); hplc : 96 . 62 %. 1 h nmr : ( cd 3 od , 400 mhz ): δ 8 . 68 ( d , 1h , j = 5 . 6 hz ), 8 . 55 ( s , 1h ), 8 . 48 ( s , 1h ), 8 . 30 ( d , 2h , j = 8 . 4 hz ), 7 . 94 ( d , 2h , j = 8 . 4 hz ), 7 . 65 ( dd , 1h , = 1 . 2 hz , j 2 = 5 . 6 hz ), 6 . 9 ( d , 1h , j = 15 . 2 hz ), 6 . 80 - 6 . 75 ( m , 1h ), 5 . 69 - 5 . 66 ( m , 1h ), 4 . 09 ( d , 2h , j = 7 . 2 hz ), 4 . 00 - 3 . 94 ( m , 1h ), 3 . 81 ( dd , 1h , j 1 = 8 . 0 hz , j 2 = 12 . 8 hz ), 3 . 69 ( dd , 1h , j 1 = 4 . 4 hz , j 2 = 11 . 2 hz ), 3 . 53 ( dd , 1h , j 1 = 4 . 4 hz , j 2 = 13 . 2 hz ), 3 . 32 - 3 . 27 ( m , 2h ), 2 . 93 ( s , 6h ), 2 . 57 - 2 . 52 ( m , 2h ), 2 . 28 - 2 . 23 ( m , 2h ); esi - ms : (+ ve mode ) 620 . 4 ( m + h ) + ( 100 %); hplc : 97 . 87 %. 1 h nmr : ( cdcl 3 - d 1 , 400 mhz ): δ 8 . 50 - 8 . 46 ( m , 2h ), 8 . 35 ( s , 1h ), 7 . 70 - 7 . 68 ( d , 2h , j = 8 . 0 hz ), 7 . 43 - 7 . 7 . 34 ( m , 2h ), 7 . 21 - 7 . 19 ( d , 2h , j = 8 . 0 hz ), 6 . 47 - 6 . 39 ( m , 2h ), 5 . 73 - 5 . 70 ( m , 1h ), 5 . 59 - 5 . 55 ( m , 1h ), 3 . 88 - 3 . 83 ( m , 2h ), 3 . 61 - 3 . 47 ( m , 4h ), 3 . 23 - 3 . 13 ( m , 2h ), 2 . 57 - 2 . 52 ( m , 2h ), 2 . 18 - 2 . 16 ( m , 2h ); esi - ms : (+ ve mode ) 468 . 15 ( m + h ) + ( 100 %); hplc : 95 . 64 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 47 - 8 . 48 ( m , 1h ), 8 . 41 - 8 . 39 ( m , 1h ), 8 . 23 ( s , 1h ), 7 . 70 - 7 . 67 ( m , 2h ), 7 . 58 - 7 . 55 ( m , 1h ), 7 . 48 - 7 . 45 ( m , 1h ), 7 . 23 - 7 . 21 ( m , 2h ), 6 . 64 - 6 . 59 ( m , 1h ), 6 . 42 - 6 . 38 ( m , 1h ), 5 . 43 - 5 . 40 ( m , 1h ), 3 . 77 - 3 . 74 ( m , 1h ), 3 . 64 - 3 . 61 ( m , 1h ), 3 . 52 - 3 . 49 ( m , 1h ), 3 . 09 - 2 . 96 ( m , 5h ), 2 . 35 - 2 . 30 ( m , 2h ), 2 . 15 ( s , 6h ), 2 . 06 - 2 . 04 ( m , 2h ); esi - ms : (+ ve mode ) 525 . 45 ( m + h ) + ( 100 %); hplc : 95 . 44 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 23 ( s , 1h ), 8 . 21 - 8 . 20 ( m , 1h ), 7 . 58 ( d , 1h , j = 8 . 4 hz ), 7 . 12 - 7 . 10 ( m , 1h ), 7 . 04 - 7 . 02 ( m , 1h ), 6 . 65 - 6 . 58 ( m , 1h ), 6 . 16 - 6 . 11 ( m , 1h ), 5 . 40 - 5 . 38 ( m , 1h ), 3 . 77 - 3 . 75 ( m , 1h ), 3 . 62 - 3 . 59 ( m , 1h ), 3 . 53 - 3 . 49 ( m , 1h ), 3 . 43 ( s , 3h ), 3 . 11 - 3 . 08 ( m , 1h ), 2 . 98 - 2 . 96 ( m , 1h ), 2 . 34 - 2 . 29 ( m , 3h ), 2 . 21 ( s , 3h ), 2 . 06 - 2 . 03 ( m , 2h ); esi - ms : (+ ve mode ) 523 . 35 ( m + h ) + ( 100 %); hplc : 98 . 29 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 22 ( s , 1h ), 8 . 20 ( d , 1h , j = 8 . 4 hz ), 7 . 57 - 7 . 55 ( m , 2h ), 7 . 43 - 7 . 41 ( m , 2h ), 7 . 11 - 7 . 09 ( m , 1h ), 7 . 03 - 7 . 02 ( m , 1h ), 6 . 63 - 6 . 59 ( m , 1h ), 6 . 41 ( m , 1h ), 5 . 39 ( m , 1h ), 3 . 79 - 3 . 72 ( m , 1h ), 3 . 59 - 3 . 57 ( m , 2h ), 3 . 43 - 3 . 42 ( m , 2h ), 3 . 08 ( s , 3h ), 3 . 05 - 3 . 03 ( m , 2h ), 2 . 32 - 2 . 30 ( m , 2h ), 2 . 16 - 2 . 09 ( m , 3h ), 2 . 09 - 2 . 06 ( m , 3h ), 2 . 04 - 2 . 02 ( m , 6h ); esi - ms : (+ ve mode ) 580 . 55 ( m + h ) + ( 100 %); hplc : 96 . 27 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 9 . 54 ( s , 1h ), 8 . 88 - 8 . 86 ( m , 2h ), 8 . 27 - 8 . 25 ( m , 3h ), 7 . 90 - 7 . 88 ( d , 2h , j = 8 . 0 hz ), 6 . 66 - 6 . 59 ( m , 1h ), 6 . 43 - 6 . 39 ( d , 2h , j = 16 hz ), 5 . 47 - 5 . 43 ( m , 1h ), 3 . 80 - 3 . 75 ( m , 1h ), 3 . 65 - 3 . 60 ( m , 1h ), 3 . 53 - 3 . 51 ( m , 1h ), 3 . 83 - 3 . 33 ( m , 1h ), 3 . 09 - 3 . 00 ( m , 4h ), 2 . 40 - 2 . 32 ( m , 2h ), 2 . 15 ( s , 6h ), 2 . 09 - 2 . 07 ( m , 2h ); esi - ms : (+ ve mode ) 594 . 40 ( m + h ) + ( 100 %); hplc : 97 . 57 %. 1 h nmr : ( dmso - d 6 , 400 mhz ): δ 8 . 85 - 8 . 84 ( m , 1h ), 8 . 32 - 8 . 27 ( m , 4h ), 8 . 13 - 8 . 09 ( m , 1h ), 7 . 95 - 7 . 93 ( m , 2h ), 7 . 69 - 7 . 67 ( m , 1h ), 6 . 50 - 6 . 61 ( m , 1h ), 6 . 43 - 6 . 39 ( m , 1h ), 5 . 47 - 5 . 44 ( m , 1h ), 3 . 77 - 3 . 75 ( m , 1h ), 3 . 62 - 3 . 60 ( m , 1h ), 3 . 52 - 3 . 50 ( m , 1h ), 3 . 17 - 3 . 03 ( m , 5h ), 2 . 37 - 2 . 32 ( m , 2h ), 2 . 15 ( s , 6h ), 2 . 12 - 2 . 08 ( m , 2h ); esi - ms : (+ ve mode ) 577 . 55 ( m + h ) + ( 100 %); hplc : 99 . 24 %. using the above procedures , following compounds ( table - 2 ) can be prepared , using different boronic acids and finally reacting with optionally substituted acid chlorides . in vitro btk inhibitory activity of test compounds were screened using btk kinase assay on adp glo platform ( li , h ., totoritis , r . d ., lor , l . a ., schwartz , b ., caprioli , p ., jurewicz , a . j and zhang , g ., assay drug dev . technol ., 2009 , 7 ( 6 ), 598 - 605 ). briefly , fixed amount of recombinant purified human btk ( 3 ng / reaction from signalchem , usa ) were incubated with increasing concentration of test compounds , in 1 × kinase reaction buffer ( 40 mm tris - cl , ph7 . 5 , 20 mm mgcl 2 , 2 mm mncl 2 , 0 . 1 mg / ml bsa and 50 μm dtt ). enzymatic reaction was initiated by adding a substrate cocktail containing 50 μm of atp ( final concentration ) and 5 μg of polygln4tyr1 ( signal chem ) in total 25 μl of reaction , in round bottom white 96 well plate . the reaction mixture was incubated at room temperature for 2 hr . after 2 hr of incubation , 10 μl of the reaction mix was mixed with 10μ of adp glo reagent , in another round bottom white 96 well plate and incubated at room temperature for 40 min . this was followed by addition of kinase detection reagent ( 20 μl per reaction ) and incubation at room temperature for 30 min . finally , plate was read for luminescence at an integration time of 500 millisecond per well . data were plotted taking enzyme with no inhibitor set as the 100 % kinase activity and for dose response curve , % kinase activity was plotted against conc on log scale and ic 50 was determined by non linear curve fitting method using graphpad prism software 6 . the invitro btk inhibitory activity ( ic 50 ) for representative compounds are listed in cyp inhibition studies were performed with test compounds , at two concentrations ( 2 μm and 10 μm ), using human liver microsomes ( yao , m ., zhu , m ., sinz , m . w ., zhang , h ., humphreys , w . f ., rodrigues , a . d and dai , r ., journal of pharmaceutical and biomedical analysis , 2007 , 44 , 211 - 223 ; walsky , r . l and obach , r . s ., drug metab . dispos ., 2004 , 32 , 647 - 660 ). human liver microsomes were mixed with 100 mm phosphate buffer ( ph 7 . 4 ) and probe substrate and warmed to 37 ° in microcentrifuge tubes . aliquots of this mixture ( 499 μl ) were transferred to each pre - labeled microcentrifuge tubes , followed by addition of the 1 μl of inhibitors ( test compound / cyp - specific positive control inhibitor ) or control solvent ( dmso ). aliquots of this mixture ( 90 μl ) were transferred to each pre - labeled microcentrifuge tubes in duplicate . final solvent concentrations were 0 . 2 % ( v / v ) or less . incubations were commenced with the addition of 10 μl nadph stock ( assay concentration , 1 mm ) to a final incubation volume of 100 μl and incubated in shaking water bath ( at 37 ° c . and 100 rpm ), for the period defined in tables 1 . incubations were terminated by addition of 400 μl of termination solvent ( ch 3 cn ) containing internal standard . the terminated samples were vortex - mixed , centrifuged at 10000 rpm for 5 min and supernatant transferred into hplc vials for lc - ms / ms analysis to monitor metabolites produced by marker cyp reactions . cyp inhibitory activity (% inhibition ) of test compounds is listed in table 3 . demonstration of in vivo efficacy of test compounds in rats mice , oral routes of administration . all the animal experiments were carried out in female rats and mice , bred in - house . animals were housed in groups of 6 animals per cage , for a week , in order to habituate them to vivarium conditions ( 25 ± 4 ° c ., 60 - 65 % relative humidity , 12 : 12 h light : dark cycle , with lights on at 7 . 30 am ). all the animal experiments were carried out according to the internationally valid guidelines following approval by the ‘ zydus research center animal ethical committee ’. female sprague dawley ( sd ) rats were primed with an intra - articular injection of 20 μl of peptidoglycan polysaccharide ( pgps ), at 0 . 5 mg / ml of rhamnose in the right ankle . at 2 weeks the paw swelling were measured using a plethysmometer and rats assigned to groups based on initial paw swelling . on day 14 after model initiation , rats were dosed orally ( po ) with the test compounds . following the dose administration , 1 h later , the rats received a booster dose of 0 . 5 ml of pgps ( 0 . 5 mg / ml of rhamnose ) via i . v . injection using their tail vein . compounds were dosed for the following two more days and their paw volumes were measured for 3 more days . the efficacy of the compound was determined as percentage inhibition of paw swelling verses the control ( untreated ) group . representative data of some of the test compounds are listed in table - 4 . female scid mice were inoculated sc with 10 × 10 6 tmd - 8 cells in 0 . 1 ml of pbs to the right flank . animals were observed twice weekly for occurrence of tumor . once the tumors became palpable ( around 100 mm 3 ) around 14 days after injection , treatment was initiated via oral route . tumor volume was determined every alternate day using digital calipers and the tumor volume was calculated using the formula : [ length / 2 ]×[ width 2 ]. body weights of the animals were also recorded 3 times a week as a measure of treatment related side effect . treatment was continued for two more weeks and inhibition of tumor volume compared to vehicle control was considered as efficacy endpoint . representative data of some of the test compounds are listed in table - 4 . cia is a frequently used animal model of human ra ( courtenay , j . s ., dallman , m . j ., dayan , a . d ., martin , a . and mosedale , b ., nature , 1980 , 283 , 666 - 668 ; bevaart , l ., vervoordeldonk , m . j ., tak , p . p ., methods mol . biol ., 2010 , 602 , 181 - 192 ). following 7 days acclimation , mice were randomly assigned to groups according body weight . mice were immunized subcutaneously in the tail using bovine type ii collagen mix in complete freund &# 39 ; s adjuvant ( cfa ). twenty - one days after the first immunization , mice were given booster dose of collagen in incomplete freund &# 39 ; s adjuvant ( ifa ). mice were monitored every other day after the booster dose for the development of arthritis . mice were recruited for the study once clinical signs were visible . eight animals were assigned each of three groups [ vehicle , positive control and test compounds ] and treatment was continued for four weeks and percentage inhibition in clinical score is recorded as per graded score . body weights of the animals were also recorded 3 times a week as a measure of treatment related side effect , paw thickness measured twice a week and blood serum are collected at termination for cytokines profile . representative data of some of the test compounds are listed in table - 4 . the novel compounds of the present invention can be formulated into suitable pharmaceutically acceptable compositions by combining with suitable excipients by techniques and processes and concentrations as are well known . the compounds of formula ( i ) or pharmaceutical compositions containing them are useful as a medicament for the inhibition of btk activity and suitable for humans and other warm blooded animals , and may be administered either by oral , topical or parenteral administration . thus , a pharmaceutical composition comprising the compounds of the present invention may comprise a suitable binder , suitable bulking agent & amp ;/ or diluent and any other suitable agents as may be necessary . optionally , the pharmaceutical composition may be suitably coated with suitable coating agents . the compounds of the present invention ( i ) are btk inhibitors and are useful in the treatment of disease states mediated by btk enzyme , preferably cancer , arthritis and related disorders . in one of the embodiments the present invention of formula ( i ) in combination with one or more suitable pharmaceutically active agents selected from following therapeutic agents in any combination . immunosuppressants ( e . g ., methotrexate , mercaptopurine , cyclophosphamide ), glucocorticoids , non - steroidal anti - inflammatory drugs , cox - 2 specific inhibitors , tnf - binding proteins ( eg ., infliximab , etanercept ), interferon - 13 , interferon - , interleukin - 2 , antihistamines , beta - agonist , anticolinergics , anti - cancer agents or their suitable pharmaceutically acceptable salts . further examples of anticancer agents for use in combination with btk inhibitors include chemotherapy or a targeted therapy , alkylating agents , platinum compounds , dna altering agents , topoisomerase inhibitors , microtubule modifiers , antimetabolites , anticancer antibiotics , hormones , aromatase inhibitors , antibodies , cytokines , vaccines , drug conjugates , inhibitors of mitogen - activated protein kinase signaling ( ex : bay 43 - 9006 ), syk inhibitors , mtor inhibitors , antibodies ( rituxan ), other anticancer agents that can be employed in combination include , vinblastin , bleomycin , cisplatin , acivicin , azacitidine , decitabine , doxorubicin , enloplatin , flurouracil , methotrexate , vinblastin , vincristine and bcr / abl antagonist the quantity of active component , that is , the compounds of formula ( i ) according to this invention , in the pharmaceutical composition and unit dosage form thereof may be varied or adjusted widely depending upon the particular application method , the potency of the particular compound and the desired concentration . generally , the quantity of active component will range between 0 . 5 % to 90 % by weight of the composition .	0
as summarized above , described herein are novel methods for providing liposomal formulations of camptothecins , camptothecin prodrugs , and analogs thereof , and compositions formulated thereby . it will be understood that the term camptothecin as used herein is intended to refer collectively to various camptothecins , camptothecin prodrugs , and camptothecin analogs as are well known in the art . the methods and compositions described herein may be accomplished by various means which are illustrated in the examples below . these examples are intended to be illustrative only , as numerous modifications and variations will be apparent to those skilled in the art . it is known that at ph ranges which favor the lactone - form camptothecin , during liposomal encapsulation the drug preferentially partitions into liposomal membranes . this minimizes exposure to the aqueous environment , resulting in a decrease in ring opening of the active lactone . accordingly , conventional liposomal formulations for camptothecins employ a low ph in liposomes to stabilize camptothecins in the active lactone form . however , this strategy requires use of an aqueous buffer to dissolve the drug prior to preparation of liposomes by conventional hydration - extrusion , sonication , or drug - lipid film techniques . because of the low water - solubility of neutral camptothecins and the concomitant reductions in retention time for liposomal formulations of neutral camptothecins ( see table 1 ), such conventional strategies are more favorable to liposomal encapsulation of cationic camptothecins than neutral camptothecins . camptothecins , including neutral camptothecins , exist predominantly in the active lactone form in aqueous solution at ph less than 6 . 0 , whereas the inactive carboxylate species dominates in aqueous solution at ph above 6 . 0 . at physiological ph ( 7 . 4 ), approximately 70 % of camptothecin is in the carboxylate form . thus , in plasma , approximately 70 % of the drug is in carboxylate ( inactive ) form and 30 % in lactone ( active ) form . the half - life of lactone - form camptothecin in rat plasma is approximately 40 min . encapsulating the lactone form of a representative neutral camptothecin , db - 67 , in pegylated liposomes at low ph ( 4 ) prolongs the half - life of the drug . however , at this ph it was not possible to retain the drug in liposomes in aqueous buffers for long periods of time . it has been found that preparing liposomes containing entrapped camptothecins , prodrugs , or analogs thereof , including neutral camptothecins , at a ph sufficient to keep substantially an entirety of the intraliposomal drug in the inactive carboxylate form significantly increased the half - life for retention in liposomes . this is because the release of the carboxylate form from the liposomes is negligible . surprisingly , however , slow conversion of the entrapped , ring - opened carboxylate occurs , providing a low , steady - state concentration of lactone form drug which is then slowly released from the liposome . thus , the present invention provides a slow and prolonged release of the active lactone form from the liposome . this release rate can be varied by changing the intraliposomal ph . that is , an increase in the intraliposomal ph slows the release of active lactone from the liposome , and vice - versa . the compositions contemplated herein may be formulated for delivery to patients in need thereof using methods and formulations well within the skill in the art . for example , the compositions may be prepared for direct delivery , or as pharmaceutical formulations along with suitable carriers or excipients as are well known to the skilled artisan . for example , one or more additives may be included with the compositions , such as one or more stabilizers , buffers , salts , preservatives , fillers , and the like . suitable buffers include without limitation phosphates , carbonates , citrates , and others . suitable preservatives include without limitation edta , egta , bha , bht , and others . the skilled artisan will also readily appreciate that pharmaceutical formulations comprising the present compositions will be highly dependent on the route of administration chosen . by way of non - limiting example , injectable formulations of the compositions may be provided as aqueous solutions , typically in physiologically compatible buffers such as hank &# 39 ; s solution , ringer &# 39 ; s solution , or physiological saline buffer . pharmaceutical formulations intended for parenteral injection , e . g ., by bolus injection or continuous infusion , may be provided in unit dosage form , e . g ., in ampoules or in multi - dose containers , typically with an added preservative as set forth above . set forth in greater detail below are specific details related to selected modes for carrying out the methods and compositions of the present invention . the examples set forth herein are in no way intended to limit the scope of the invention . those of skill in the art will realize that , given the teachings provided herein , many variations of the methods are possible that will fall within the scope of the present invention . unless otherwise indicated , all citations of literature are specifically incorporated by reference herein in their entirety . phospholipids and pegylated phospholipids were purchased as powders from avanti polar lipids ( alabaster , ala .). a representative neutral camptothecin , db - 67 , was from novartis pharmaceutical corp . ( east hanover , n . j .). sprague - dawley rat plasma was from bioreclamation , inc . ( east meadow , n . y .). centricon ® ( mwco : 100000 ) centrifugal filter devices from millipore ( billerica , mass .) and sephadex ® g - 25 m prepacked size exclusion columns ( ge healicare bio - sciences corp ., piscataway , n . j .) were used in liposome studies . all other reagents were from fisher scientific ( florence , ky .). liposomes were prepared by conventional hydration - extrusion technique . however , the skilled artisan will appreciate that any suitable method for preparing liposomes having a desired particle size and lamellarity is contemplated . in one aspect , liposomes having a particle size range of from about 50 to about 300 nm are contemplated for use in the present invention . methods for preparing liposomes falling within a predetermined size range are known in the art ( see drummond et al ., 1999 ). for the hydration - extrusion technique , films of the desired lipid mixtures were prepared in test tubes by dissolving weighed amounts of lipids in chloroform , evaporating the solvent under nitrogen , and drying overnight in vacuo . a stock solution of drug ( db - 67 ) in a buffer providing the desired ph was added to hydrate the lipids , followed by shaking and extrusion through polycarbonate membranes at 60 ° c . to obtain unilamellar vesicles containing entrapped drug . thus , intraliposomal ph of the final liposome - entrapped drug preparation prepared as described was substantially in accordance with the ph of the buffer / db - 67 solution in which phospholipid mixtures were hydrated . the liposomal permeability of db - 67 in aqueous solution was measured over a ph range of 4 . 5 to 9 . 5 using a dynamic dialysis method [ v . joguparthi and b . d . anderson , liposomal delivery of hydrophobic weak acids : enhancement of drug retention using a high intraliposomal ph , j . pharm . sci . 97 , 433 - 454 ( 2008 )]. liposome - encapsulated db - 67 solutions were prepared at varying ph values as described above . for liposome solutions at each ph evaluated , liposome - entrapped drug was separated from free drug by passing liposomes through a sephadex ® column followed by 5 ml of the same buffer added in 1 ml increments . the liposome - containing eluent was dialyzed at 37 ° c . in the same buffer . at intervals , 100 μl of liposome suspension was removed from the dialysis tube and added to 900 μl cold methanol / acetonitrile ( 2 : 1 , v / v ). these samples were dried under nitrogen and stored (− 25 ° c .) prior to analysis . with reference to table 2 , db - 67 was retained in liposomes ( prepared by hydration - extrusion ) in aqueous solution for increased periods of time when liposomes were prepared at high ph . in aqueous solution , the half - life for retention of db - 67 in liposomes increased from 3 hours at ph 4 to about 90 hours at ph 9 . 5 . without being restricted to any particular theory , this may be due to conversion of db - 67 lactone to the carboxylate form in the intraliposomal space . as shown in fig2 , when intraliposomal ph was maintained whereby the carboxylate species of db - 67 predominated , release of the drug from liposomes was negligible . for release to occur , ph conditions allowing formation of the active , lactone species were required . the efflux of db - 67 from liposomes in plasma was monitored . aliquots of liposome suspension containing db - 67 ( with unentrapped drug separated as described above ) were added to plasma and incubated at 37 ° c . at intervals , an aliquot of plasma was withdrawn , added to cold methanol / acetonitrile ( 2 : 1 v / v ), centrifuged ( 14000 rpm ) and stored frozen (− 25 ° c .) for hplc analysis . hplc analyses used herein have been previously described in detail ( joguparthi et al ., 2006 ). db - 67 carboxylate standards ( 10 - 100 nm ) were prepared in 10 mm carbonate buffer ( ph 10 . 4 ). db - 67 lactone standards ( 5 - 30 nm ) were prepared in acidified methanol . all standards were diluted into the desired concentration range using cold methanol / acetonitrile ( 2 : 1 v / v ). hplc retention times were 1 . 6 and 5 . 2 min for db - 67 carboxylate and lactone , respectively . fig3 shows liposomal release of db - 67 in plasma at ph 4 . 5 and ph 9 . 5 . in plasma , the half - life for retention in liposomes was 3 . 5 hours when intraliposomal ph was 4 . 5 and 6 . 3 hours when intraliposomal ph was 9 . 5 . the half - life for retention at intraliposomal ph 9 . 5 was less in plasma than in aqueous solution due to a decrease in intraliposomal ph observed after adding liposomes to plasma . however , even in plasma , preparing liposomes at ph 9 . 5 and maintaining intraliposomal ph at levels which preserve the carboxylate form of the entrapped neutral camptothecin prolonged intraliposomal retention . thus , the potential for exposure of healthy tissue to the drug was reduced . this improved intraliposomal retention enables the drug to remain in the liposomes while they are circulating in the bloodstream . after the liposomes collect in solid tumors due to their enhanced permeation across the tumor vasculature and their improved retention within the tumor tissue ( drummond et al ., 1999 ), the entrapped drug will be slowly released as the active , lactone form of the drug directly at the tumor site , providing a significant enhancement in efficiency of delivery . a 10 mg / ml solution of db - 67 was prepared in ph 9 . 5 sodium carbonate buffer and filtered through a 0 . 2 μm syringe filter . the drug solution was used to hydrate phospholipids ( dspc + 5 mol % m - peg dspe ) with shaking at 60 ° c . to form a 30 mg / ml suspension of multilamellar vesicles . the suspension was extruded through a high pressure extruder to form unilamellar vesicles . the vesicles were then cooled at room temperature and stored below 5 ° c . until use . prior to use , liposomes were separated from unentrapped db - 67 by passing through a gel filtration column which was pre - equilibrated with ph 7 . 4 phosphate buffered saline . 100 μl of liposomes collected from gel filtration were immediately added to 4 ml of plasma to study the release of liposome - entrapped db - 67 carboxylate from plasma as described above . samples were taken at various time intervals and db - 67 was extracted from 100 μl of plasma using 300 μl of ice - cold methanol solution and acetonitrile ( 2 : 1 v / v ) at − 9 ° c . the concentration of db - 67 was determined by hplc as described above . a 10 mg / ml solution of db - 67 was prepared in ph 9 . 5 sodium carbonate buffer and filtered through a 0 . 2 μm syringe filter . the drug solution was used to hydrate phospholipids ( dspc + 5 mol % m - peg dspe ) with shaking at 60 ° c . to form a 30 mg / ml suspension of multilamellar vesicles . the suspension was extruded through a high pressure extruder to form unilamellar vesicles . the vesicles were then cooled at room temperature and stored below 5 ° c . until use . prior to use , liposomes were separated from unentrapped db - 67 by passing through a gel filtration column which was pre - equilibrated with ph 9 . 5 sodium carbonate buffer . the liposomes collected from gel filtration were immediately loaded into a dialysis tube and dialyzed ( 37 c ) against 1000 ml of ph 9 . 5 sodium carbonate buffer . db - 67 analysis was by hplc as described above . a 20 mg / ml solution of db - 67 is prepared in ph 10 . 5 sodium carbonate buffer and filtered through a 0 . 2 μm syringe filter . the drag solution is used to hydrate phospholipids ( dspc + 5 mol % m - peg dspe ) with shaking at 60 ° c . to form a 30 mg / ml suspension of multilamellar vesicles . the suspension is extruded through a high pressure extruder to form unilamellar vesicles . the vesicles are then cooled at room temperature and stored below 5 ° c . until use . prior to use , liposomes are warmed to room temperature and separated from unentrapped db - 67 by gel filtration as described . 10 mg of db - 67 is added to 60 mg of a phospholipid mixture in 2 ml of a 2 : 1 mixture of chloroform : ethanol . the solution is evaporated under nitrogen to form a drug - lipid film . the film is hydrated with ph 10 . 5 carbonate buffer with shaking to form multilamellar vesicles . the suspension is extruded to form unilamellar vesicles . the vesicles are cooled to room temperature and unentrapped drug is separated from entrapped drug as described . the liposomes are then stored below 5 ° c . until use . drug is loaded in vesicles as described in examples 6 and 7 , except the drug and phospholipids are dissolved in pure chloroform , pure acetone , pure methanol , or a suitable combination of those solvents . subsequently , solvent is evaporated to form a drug - lipid film . unilamellar vesicles are prepared as described in examples 4 - 8 using ph 9 . 5 borate buffer . unilamellar vesicles are prepared as described in examples 4 - 8 using ph 9 . 5 tris - hcl buffer . unilamellar vesicles are prepared as described in examples 4 - 8 using ph 9 . 3 ammonium hydroxide . unilamellar vesicles are prepared as described in examples 4 - 8 using ph 9 glycine . unilamellar vesicles are prepared as described in examples 4 - 12 , with the exception that the vesicles are formed by sonication rather than extrusion . unilamellar vesicles are prepared as described in examples 4 - 13 , except the drug used is sn - 38 . unilamellar vesicles are prepared as described in examples 4 - 13 , except the drug used is karenitecan . unilamellar vesicles are prepared as described in examples 4 - 13 , except the drug used is gimatecan . unilamellar vesicles are prepared as described in examples 4 - 13 , except the drug used is 9 - nitro camptothecin . unilamellar vesicles are prepared as described in examples 4 - 17 , with the exception that during separation of entrapped from unentrapped drug , the extraliposomal buffer is exchanged for ph 7 . 4 phosphate with the proviso that intraliposomal ph is maintained the same as that used in liposome preparation . unilamellar vesicles are prepared as described in examples 4 - 17 , with the exception that during separation of entrapped from unentrapped drug , the extraliposomal buffer is exchanged for a desired concentration of nacl solution with the proviso that intraliposomal ph is maintained the same as that used in liposome preparation . unilamellar vesicles are prepared as described in examples 4 - 17 , with the exception that during separation of entrapped from unentrapped drug , the extraliposomal buffer is exchanged for a desired concentration of sucrose solution , with the proviso that intraliposomal ph is maintained the same as that used in liposome preparation . unilamellar vesicles are prepared as described in examples 4 - 20 , using a lipid mixture comprising 80 % dspc , 15 % cholesterol , and 5 % m - peg dspe . unilamellar vesicles are prepared as described in examples 4 - 20 , using a lipid mixture comprising 80 % hspc , 15 % cholesterol , and 5 % pegylated pe . unilamellar vesicles are prepared as described in examples 4 - 20 , using a lipid mixture comprising 55 % dspc , 40 % cholesterol , and 5 % m - peg dspe . the skilled artisan will readily appreciate that the present disclosure sets forth an efficient and efficacious method for preparing a liposomal formulation of a camptothecin , in one aspect being a neutral camptothecin , camptothecin prodrug , or analog thereof . advantageously , the compositions formulated by the present method provide a stable liposomal camptothecin in therapeutically effective amounts , wherein the drug is retained in the liposome under physiological conditions for increased periods of time . this allows accumulation of the liposomal camptothecin formulations at a tumor site , with limited side effects on healthy cells and tissue , and further allows in situ delivery of the active lactone form of the drug to directly to tumor tissue in adequate concentrations for effective tumor cell killing and / or growth inhibition . by increasing intraliposomal ph and maintaining that ph prior to administration and during in vivo delivery to a tumor site , it has been surprisingly found that liposomal retention of a camptothecin may be prolonged , reducing the potential for exposure of healthy tissue to the drug when administered in vivo . this improvement in retention allows the drug to accumulate at tumor tissue , i . e ., an in vivo enhanced permeation and retention effect ( drummond et al ., 1999 ). as the liposomes accumulate within the tumor tissue , over time the drug is released as the lactone form in situ , thus achieving release of drug in the active form directly at the tumor site , rather than drug residing in the bloodstream at physiological conditions favoring conversion to the inactive carboxylate form . accordingly , the problems of enhanced liposomal retention and delivery of the active lactone form camptothecin to a tumor site are simultaneously solved . the foregoing description of preferred embodiments has been presented for purposes of illustration and description . it is not intended to be exhaustive or limiting to the precise forms disclosed . obvious modifications or variations are possible in light of the above teachings . the embodiments were chosen and described to provide the best illustration of the principles described herein and their practical application to thereby enable one of ordinary skill in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . all such modifications and variations are within the scope of the invention as determined by the appended claims when interpreted in accordance with the breadth to which they are fairly , legally and equitably entitled .	0
the invention is applicable in general to polar amplification stages . in the following description the invention is described with specific reference to the example of an amplification stage incorporating an envelope tracking ( et ) polar modulation technique . however this is for the purposes of illustrating an exemplary implementation of the invention , and to aid in understanding the invention , and the invention is not limited to such a specific technique . the skilled person will appreciate the invention may also be implemented in other polar transmitter technologies including , for example , envelope elimination and restoration technologies . one skilled in the art will appreciate that the invention and its embodiments may be utilised in a broader range of polar transmitters than is set forth herein . in the following description , where an element of one figure corresponds to an element of another figure , like reference numerals are used to denote a correspondence . the presentation of a combination of features in an embodiment does not represent a limitation that the combination of features is necessarily essential to an embodiment , nor exclude the possibility that elements of an embodiment may be used without other illustrated elements or with other non - illustrated elements . the invention will now be described with further reference to the exemplary rf amplification architecture of fig2 , which modifies the arrangement of fig1 in accordance with exemplary embodiments of the invention . the invention , and its embodiments , is not however limited in its applicability to the exemplary architecture and implementation as illustrated in fig2 . with reference to fig2 , the rf amplification architecture is adapted to include a calibration control stage 142 including the signal generation block 122 , a programmable delay adjustment block 124 , and a measurement block 120 , in accordance with an exemplary implementation of the present invention . as illustrated in the embodiment of fig2 , the envelope signal , i component of the input signal , and q component of the signal for the respective digital - to - analogue converters 126 a to 126 c are generated on lines 125 a , 125 b and 125 c respectively by the signal generation block 122 via the programmable delay adjustment block 124 . the signal generation block 122 optionally generates signals to the measurement and correlation block 120 on lines 156 , and the measurement block 120 generates signals to the programmable delay adjustment block 124 on lines 157 . a diode 114 is connected to the output of the power amplifier 102 on line 140 in order to provide the functionality of a power detector . the diode 114 is further connected to a filter 118 , which in turn is connected to an analogue - to - digital converter 116 to provide a digital and filtered representation of the signal detected by the diode 114 to the measurement block 120 on line 121 . the implementation shown is exemplary , and the invention is not limited to the use of a diode as a power detector to provide feedback to the measurement block 120 . in general , the diode 114 represents a functional block for providing a signal representing the amplitude or power of the signal at the output of the rf power amplifier 102 on line 140 . in an alternative implementation , the detection could for example be implemented using a receiver chain including an analogue to digital converter , with detection of the envelope being implemented in the digital domain . the adaptation of an rf power amplification stage in accordance with the exemplary arrangement of fig2 provides for a calibration system that reduces the delay uncertainty in the envelope path and the rf path , and that can be implemented as a self - calibration . in accordance with the principles of this invention the power amplifier is driven in and out of compression , such that it operates in both a linear mode of operation ( without compression ) and a saturated mode of operation ( with compression ). this is preferably achieved by providing a signal for the rf input path which has an increasing and decreasing slope , whilst at the same time the envelope path is driven with a signal with opposite slopes to that of the signal on the rf input path . this is illustrated with respect to fig3 , which shows a triangular signal in fig3 ( a ) and 3 ( b ) which may be applied to the input envelope path , and an inverse triangular signal applied to the rf input path as shown in fig3 ( b ). the signal to the input envelope path is denoted by reference numeral 308 , and the signal to the rf input path is denoted by reference numeral 310 . as illustrated in fig3 ( a ) and 3 ( b ), the signals contain two distinct slopes , one increasing and one decreasing , and one signal is the inverse of the other . as noted above , the levels of the signal applied to the rf input path and the envelope path must be set such that both linear and saturation modes of operation are obtained in the power amplifier . the effect of this is that when the signal in the rf input path is small enough , i . e . lower than the power supply voltage provided to the power amplifier as determined by the signal in the envelope path , the power amplifier operates in a linear mode of operation . in a linear mode of operation , the power amplifier output power is a strong function of the power amplifier input level . when the rf input path signal becomes large enough , i . e . higher than the power supply voltage provided to the power amplifier by the signal in the envelope path , the power amplifier operates in saturation mode and the power amplifier output level becomes a strong function of the signal in the envelope path to the power amplifier supply voltage . this means that due to the opposite signal slopes on each path , there will be a peak of the power amplifier output voltage at the point when the power amplifier transitions from a linear mode of operation to a saturated ( non - linear ) mode of operation and a peak where the power amplifier transitions from a saturated ( non - linear ) mode of operation to a linear mode of operation . this will occur both during the up and down slopes of the input signals , which therefore generate two power amplifier output voltage peaks . for the simple example of the input signals of fig3 ( a ) and 3 ( b ), the rf output signal is illustrated in fig3 ( c ), and denoted by reference numeral 312 . as can be seen , the rf output signal has two peaks . the first peak represents the transition point from saturated operation to linear operation , and the second point represents the transition from linear operation to saturated operation . although in the example of fig3 ( a ) to 3 ( c ) the input signals are shown as triangular waves , the invention is not limited to the input signals being of any particular shape . the input signals can be , for example , sine waves or any other type of signal . the only characteristic required of the input signals is that they contain two distinct slopes , one increasing and one decreasing , and that the signal in one path is the inverse of the other . with reference to fig4 there is illustrated a further example . in fig4 waveform 302 represents the input voltage on the rf input path , which as illustrated is a sinusoidal signal . waveform 304 represents the supply voltage provided by the et modulator . waveform 306 represents the voltage at the output of the power amplifier . as illustrated in fig4 , between times t 0 and t 1 the amplifier operates in non - linear or saturated mode , between times t 1 and t 2 the amplifier operates in linear mode , and between times t 2 and t 3 the amplifier operates in saturated or non - linear mode . at the time at which the amplifier changes from non - linear to linear mode , at time t 1 , a peak in the output signal is generated . similarly at the time that the amplifier transitions from linear to non - linear mode , time t 2 , a peak in the output signal occurs . if there is a timing misalignment in either the first or second peak at times t 1 and t 2 one peak would be larger than the other , due to the transition in power amplifier operating mode occurring at a slightly different operating condition . for example if the envelope path to the power amplifier supply voltage has a signal which is slightly earlier than the signal on the rf input path , then its rising flank will cause the transition into linear mode to occur earlier , and the first peak will be larger than the second peak . similarly the transition out of linear mode also occurs slightly earlier and therefore non - linear mode will occur earlier and the second peak will be slightly less in amplitude . reference is made to fig5 ( a ) and 5 ( b ) to help further understand the occurrence of one peak being larger than the other when a timing misalignment is present . fig5 ( a ) illustrates as a main plot a typical device transfer characteristic of a transistor of the amplifier stage , comprising numerous plots 550 of amplifier output voltage against amplifier input voltage . the numerous plots 550 reflect the sweeping of the power amplifier supply voltage , such that the higher the output voltage the higher the supply voltage . such a transfer characteristic as represented by waveforms 550 is well - known in the art . also illustrated in fig5 ( a ) is a plot 552 of supply voltage to the amplifier in a calibration mode of operation in accordance with an embodiment of the invention . in the illustration of fig5 ( a ) there is represented a condition , in the calibration mode of operation , where there is no delay between the envelope path signal and the rf input path signal . as shown 552 illustrates a falling supply voltage as the input voltage increases . further illustrated is a plot 554 of output voltage against the input voltage in association with the falling supply voltage 552 . as illustrated in fig5 ( a ), the output voltage increases in accordance with the normal behaviour of the transistor device characteristics , following the input voltage . however at some point denoted by time t a the output voltage peaks and starts to fall , as the amplifier has reached saturation due to the decreasing supply voltage 552 in combination with the increasing input voltage . the output voltage the slopes off as the input voltage continues to rise and the supply voltage continues to decrease . with reference to fig5 ( b ), there is illustrated the effect on the amplitude of the peak of waveform 554 of fig5 ( a ) as a result of relative delays between the envelope signal and the input signal , which results in the differences in peak amplitudes which are detected in the circuit of fig2 . as illustrated by arrow 558 , for the device transfer characteristics waveforms 550 the output voltage of the amplifier increases as the input voltage increases , for increasing supply voltages . as denoted by arrow 560 , during a calibration operation in accordance with the invention the slope of the supply voltage relative to the input voltage will vary in dependence on the relative delay in the input signal path and the envelope signal path . as denoted by arrow 560 , for a given input voltage the instantaneous supply voltage will vary in dependence on the relative delay . the supply voltage waveform 552 of fig5 ( a ) is thus replaced by supply voltage waveforms 552 a and 552 b in fig5 ( b ). fig5 ( b ) represents a timing misalignment with respect to fig5 ( a ). the output voltage waveform 554 of fig5 ( a ) is also replaced by the output voltage waveforms 554 a and 554 b . the output voltage waveform 554 a is associated with the supply voltage 552 a , and the output voltage waveform 554 b is associated with the supply voltage 552 b . these output voltage waveforms 554 a and 554 b show the effect of timing misalignment between the envelope and input signal paths on the size of the peaks in the output . for the supply voltage waveform 552 a , the corresponding output voltage waveform is 554 a , which peaks at an output voltage level a . for the supply voltage waveform 552 b , the corresponding output voltage waveforms is 554 b , which peaks at output voltage level b . the voltage peak b is less than voltage peak a . the output voltage 554 b is not able to reach as a high a level as the output voltage 554 a , because the decreasing supply voltage 552 b results in saturation being reached at a lower input voltage than for supply voltage 552 a . for supply voltage 552 b the amplifier enters saturation for a lower input voltage , and is thus not able to achieve as a high a peak as for supply waveform 554 a . in general , the later the supply voltage is in comparison to the input waveform , the higher the associated peak at a transition from linear mode to saturation will be . in summary , the supply drops down to a certain level and then the amplifier output is dominated by the supply . the supply goes down as the input increases , due to the inverse nature of the signals . if the supply is early , then a low peak is obtained . if the supply is late , then a high peak is obtained . the peaks also provide information about the direction of delay . if the first peak is larger than the second peak then the signal on the envelope path to the power amplifier supply voltage needs to be delayed , or alternatively the signal on the rf input path needs to be advanced , and if the second peak is larger than the first peak then the signal on the envelope path to the power amplifier voltage supply needs to be advanced ( or the signal on the rf input path needs to be delayed ). the principles of the present invention as exemplified by the arrangement of fig2 are now further described with reference to an exemplary procedure as set out in the flow diagram of fig6 . as denoted in step 502 , the signal generation block 122 is arranged to generate first and second signals for the envelope path and the rf input path . one signal is a signal with increasing and decreasing slopes , and the second signal is the inverse of the first signal , with opposite slopes . the first and second signals may be generated independently by the signal generation block 122 , or one signal may be generated for one path and then inverted for the other path . in a step 504 the first and second signals are applied to the envelope path and the input path respectively . it should be noted that there is no requirement for the signals to be applied to a particular one of the paths , it is merely a requirement that the signal applied to the two paths have opposite slopes . in this exemplary arrangement , the first signal is processed by the envelope path and the second signal is processed by the input path . the diode detector 114 , as denoted by step 506 , detects the power of the output of the rf amplifier , which is delivered to the measurement block 122 through the feedback path formed by the diode 114 , the filter 118 , and the analogue - to - digital converter 116 . the measurement block 120 detects and measures a first peak , as denoted by step 508 . the measurement block then detects and measures a second peak as denoted by step 510 . as indicated in fig2 , the measurement block 120 may receive a signal from the signal generation block 122 , so that the measurement block 120 can associate detected peaks with a particular pair of input signals generated for the input path and envelope paths . for example , a signal on line 156 may provide a trigger to the measurement block 102 to associate two detected peaks with a single input sequence . as denoted by step 512 , the measurement block then compares the first and second detected peaks . as discussed hereinabove , the measurement block makes a determination as to which of the input and envelope paths contains a signal which is more advanced than the other . in dependence upon determination of one signal being more advanced than the other , then an appropriate delay or adjustment is made as denoted by step 514 . in the event of the first peak being detected as greater than the second peak , the first signal is delayed ( or the second signal advanced ). in determination of the second peak being greater than the first peak , the second signal is delayed ( or the first signal advanced ). in detection of the first and second peaks being equal , no adjustment is made . the adjustment is preferably made by the measurement block 120 providing an appropriate adjustment to the programmable delay adjustment block 124 on lines 157 in dependence on the measured difference of the peaks and if appropriate the direction of the measured difference . the process may then be applied iteratively , until the measurement block 120 determines that the delay between the two paths is determined to fall within an acceptable tolerance . the measurement timing resolution restrictions of the adc 116 may be relaxed by post - processing the peak information to interpolate the peaks . the technique as described for reducing delay between the signals in the rf input path and the envelope path has a number of advantages . the main advantage of the technique described herein is that the delay is detected based on very large power amplifier output signals . on this basis there is no requirement for a particularly sensitive detection device . the technique is relatively insensitive to quantisation , noise or isolation effects . a second advantage of the described technique is that the direction of required delay adjustment can be seen from the signal generated at the power amplifier output by comparing the two peaks generated when entering linear mode and exiting linear mode . this means that the detection of the correction direction of delay adjustment is not needed . detection of the correction direction may take additional time and processing effort , which is not a problem incurred by the present techniques . thirdly , it is possible to calculate the amount of delay adjustment required due to the amplitude difference ( or ratio , or some other characteristic of signal peak differences ). if the delay can be calculated from the peak amplitudes then the requirement for a search algorithm is negated . however , tolerances , timing setup and other real world effects may make it impractical to directly calculate the delay requirement absolutely . nevertheless the ability to provide some measurement of the delay is provided . the invention is described herein with reference to particular examples and embodiments , which are useful for understanding the invention and understanding a preferred implementation of the invention . the invention is not , however , limited to the specifics of any given embodiment , nor are the details of any embodiment mutually exclusive . the scope of the invention is defined by the appended claims .	7
referring now to fig1 a and 1b , there is shown an all - metal ultra - high vacuum ( uhv ) o - ring seal arrangement 10 in accordance with one embodiment of the invention having an o - ring 12 with a strong tendency to increase in outside diameter and reduce in inside diameter . the o - ring is comprised of a heat - recoverable material such as nitinol , for example , an alloy of 55 weight percent nickel and 45 weight percent titanium , which can be annealed in the austenitic phase , transformed by cooling into a martensitic phase , and then strained to as much as 10 percent deformation . upon reheating it transforms again to austenite and energetically tries to return to its original austenitic dimensions . for the uhv sealing arrangements disclosed herein , the o - ring is preferably fabricated by means such as extrusion or machining into a tubular shape with an outside diameter approximately 21 / 2 percent larger and an inside diameter approximately 21 / 2 percent smaller than the surfaces against which the o - ring will seal , such as an inner metallic tube 14 and a concentric axially aligned outer metallic tube or sleeve 16 . the seal tube 12 is then transformed to a relatively low strength martensite by chilling through the transformation temperature range of the heat - recoverable material . while it remains in the martensitic temperature range it is stretched axially , as in a tensile test , approximately 10 percent . when a tube is strained axially in this manner , the mean diameter is unchanged , but the outside diameter is reduced and the inside diameter is increased , in this case approximately 5 percent of the radial thickness each . while still in the martensitic condition the tube is cut into short rings of given length by any process , well known in the art , which does not raise the metal temperature into the transformation range . the o - rings 12 can be stored at this low temperature until installation . for installation , the o - ring 12 is placed between the tubular cylinders 14 , 16 which are preferably prechilled to the o - ring 12 temperature , with clearances approximately twice as large as would normally be provided for similar seal assemblies . the assembly is then allowed to warm through the transformation temperature range and , as the o - ring 12 transforms , its radial dimensional changes establish the seal zones . while the o - ring can merely be so transformed so as to contact , plastically deform and circumferentially seal against the tubular surfaces , preferred orientations for uhv application seal against specific protruding circumferential rings . in fig1 a and 1b the inner tube 14 is provided with two preferably integral external seal rings 18 and 20 , and the outer sleeve 16 is provided with a singular internal seal ring 22 . the seal rings are oriented such that the internal seal ring 22 is longitudinally positioned between the external seal rings 18 , 20 . additionally , radial holes 24 are provided through the wall 26 of the inner tube 14 , also positioned longitudinally between the external seal rings 18 , 20 , to provide fluid communication between an annular area 28 bounded by the external rings 18 , 20 and the cylindrical surfaces of the o - ring 12 and inner tube 14 between the rings 18 , 20 . the radial holes 24 allow the annulus 28 to be pumped down , and the arrangement thus alleviates the virtual leaks often associated with ultra - high vacuum system sealing arrangements . the o - ring 12 , initially a short cylinder of uniform wall thickness ( fig1 a ) is of a length such that at initial installation the ends of the o - ring are in contact with locating shoulders 30 , 32 of the inner tube 14 and sleeve 16 . with the sleeve internal sealing ring 22 centered between the tube external sealing rings , this configuration forces the o - ring 12 to deflect under the seal loads rather than rotate about its centroid . the o - ring dimensions can be determined as follows , the illustrative example being an o - ring seal with a mean diameter of two inches . the allowance &# 34 ; a &# 34 ; between a plug and a bore recommended by v . l . maleev in &# 34 ; machine design ,&# 34 ; international textbook company , 1939 , page 156 , for a loose interchangeable assembly is a = 0 . 0025 3 √ d 2 , where d is the mean diameter of the mating components in inches . to assure ease of assembly for rapid and remote installation , the allowance between the o - ring and the seal rings is made twice the recommended allowance and the tolerance on each diameter is made equal to the recommended allowance . thus , the total resolved strain of a two - inch mean diameter o - ring may be eight times the maleev recommended allowance , or 0 . 03175 inch . resolved strain with respect to heat recoverable alloys and this application refers to the mechanically induced strain upon axial tensioning in the martensitic phase , as opposed to unresolved strain which is the strain of the nitinol following the martensite to austenite transformation , restrained by the surrounding structures . plastic deformation of aisi 305 stainless steel by a nitinol uhv seal contact requires a radial force of approximately 4 , 000 pounds per inch of seal length . for such forces to be generated by hoop stress in the nitinol o - ring , reasonably assumed to be distributed as shown in fig2 the o - ring thickness &# 34 ; t &# 34 ; must be 0 . 2 inch for a mean seal diameter of two inches and a maximum hoop stress of , for example , 50 , 000 psi . however , the total radial strain of 10 percent for such a ring is a deformation of only 0 . 020 inch , which is less than the possible clearance . thus , the minimum thickness o - ring with satisfactory stress is too thin , and must be increased . according to a stress - strain curve for austenitic nitinol published in raychem corporation &# 39 ; s brochure numbered me - 005 , the unresolved strain equivalent to 50 , 000 psi stress is 0 . 75 percent . the 10 percent initial strain of the o - ring should therefore be : using conventional rounded - off dimensions , the thickness of the o - ring is therefore taken to be 3 / 8 inch or 0 . 375 inch . the seal element dimensions determined as described above are accordingly shown in fig3 . these dimensions result in the unresolved strain ranging from 0 . 79 percent to 1 . 95 percent , with the corresponding hoop stresses ranging from 52 , 000 psi to 69 , 000 psi . the depth of the seal ring protrusions can be varied , and in this example is five mils . another sealing arrangement 40 is shown in fig4 a and 4b . here an o - ring 42 is positioned between an inner tube 44 and outer sleeve 46 , each of which have only one protruding sealing surface . a protruding internal sealing ring 48 on the sleeve is here positioned in the same plane as an external sealing ring 50 on the inner tube . the alignment is arranged at installation by the contact of the ends of the ring with the shoulders 52 , 54 of the tube and sleeve . while this arrangement provides a shorter and lighter o - ring , if the seal ring 48 , 50 are not properly aligned , moments may be created which would tend to rotate the o - ring about its centroid , lessening the integrity of the arrangement for uhv application . the alignment of the seal rings 48 , 50 can be further assured by contact between the tube end and the sleeve - locating shoulder as shown at 56 in fig5 but a virtual leak could result from the volume 58 , through the contact 56 , and into the ultra - high vacuum zone 60 . it will be apparent that many alternatives and equivalents are possible in view of the above teachings . for example , all available grades of nitinol can be utilized , with transformation temperature ranges compatible with the specific uhv system employed . additionally , the shape of the seal rings can be of various configuratons , such as flat , wedged , truncated or rounded , among others . ohter alternates are possible . it therefore is to be understood that within the scope of the appended claims , the invention may be practiced other than as specifically described .	1
as shown in the drawings , the steam engine of the present invention comprises a high pressure boiler 11 surrounded by a low pressure feedwater tank 13 . supported on top of the boiler 11 and feedwater tank 13 is a low pressure water storage tank 15 . rainwater , which should be used in this system whenever possible , is supplied through a pipe 17 into the storage tank 15 . cold water may be caused to flow from the tank 15 through a valve 19 into the low pressure feedwater tank 13 . the valve 19 is controlled by a valve control 21 in response to the water level in the tank 13 . a water level detector 23 is provided in the tank 13 comprising a float 25 , a lower limit detector 27 , and an upper limit detector 29 . when the water level in the tank 13 drops to the lower limit level , the float 25 will come adjacent to the detector 27 , which will then send a signal to the valve control 21 . in response to this signal , the valve control 21 will open the valve 19 and allow cold water to flow from the tank 15 by gravity into the tank 13 . water will then continue flowing into the tank 13 until the tank 13 becomes filled , at which time the float 25 will come adjacent to the upper limit sensor 29 . the upper limit sensor will then send to the valve control 21 a signal , in response to which the valve control 21 will close the valve 19 . the water level in the tank 15 is sensed by a water level detector 30 and indicated by a meter 32 . in the tank 13 , the water is kept at temperatures ranging from 205 ° to 210 ° f ., that is just below the boiling point . from the tank 13 , preheated water is pumped into the boiler 11 by a high pressure pump 31 . the pump 31 is controlled to keep an adequate level of water in the boiler 11 in response to a water level detector 34 , similar to the detector 23 , in the boiler 11 . in the boiler 11 , the water is speedily converted into steam and enters a turbine 33 driving a revolving output shaft 35 . the rate of flow of steam from the boiler to the turbine is controlled by a throttle 36 . the decompressed exhaust steam from the turbine has two paths out of the system . if the temperature in the tank 13 drops below 205 ° f ., a valve control 37 comes into action opening the valve 39 and closing the valve 41 so that the exhaust steam from the turbine will enter a long open ended pipe 43 which is coiled in several turns around the boiler in the bottom of the tank 13 . the pipe 43 is replete with small holes throughout its length and the exhaust steam enters directly into the water in the tank 13 through the holes in the pipe 43 and rapidly dissipates raising the water temperature in the tank 13 and adding to the water volume . any overflow of water is discharged through a pipe 44 . when the water temperature reaches 210 ° f ., the valve control 37 will move the valve 39 back into its closed position and open the valve 41 letting steam out into the atmosphere surrounding the steam engine , or , if desired , into a condenser for returning the condensed steam back into the storage tank 15 . it is only at the point at which the water in tank 13 has been heated up to 210 ° and the valve 41 is opened and the valve 39 is closed that the system loses thermal energy . however , such loss occurs with minimal expense and fuel consumption . instead of having to heat cold water from about 60 ° up to about 215 ° or a full 155 °, heating of only 5 ° to 10 ° is required . the valve control 37 controls the valves 39 and 41 to open and close in response to the temperature in the tank 13 by means of a thermocouple 42 which senses the temperature in the tank 13 and applies a signal to the valve control 37 representing the temperature . if desired , the heat energy in the exhausted steam may be recovered and used to provide heat for the building in which the steam engine is located . to enable the engine to respond to variable demand , the engine has been furnished with a special kind of fuel burner 45 , which has an adjustable position with respect to the boiler 11 and which has a regulated fuel supply provided by an electronically controlled fuel pump 47 . the burner can be moved up or down , closer or further from the boiler , by means of a drive 49 depending on the workload that the machine experiences at any given instant . the workload demand is reflected in changes of the steam pressure in the boiler , which is sensed and converted into an electric signal representing the pressure by a pressure monitoring device 51 . the present monitoring device 51 includes a pressure meter 52 to indicate the pressure in the boiler . the pressure monitoring device 51 also functions as a safety valve for the boiler 11 . any change in the boiler pressure due to a change in workload demand for steam is promptly communicated by the device 51 to an electronic pressure control 53 which controls the fuel pump 47 and a burner positioner 55 . the burner positioner 55 , which may be a conventional servo mechanism , operates the drive 49 to position the burner at a position corresponding to the signal received from the electronic pressure control 53 and thus corresponding to the pressure sensed by the pressure monitoring device 51 . if the boiler pressure drops , the control 53 will cause the fuel pump 47 to increase the fuel flow rate to the burner 45 and at the same time cause the burner positioner 55 to lower the burner 45 so that the higher burner flame will be properly positioned relative to the boiler 11 . conversely , when the boiler pressure increases , the control 53 will cause the fuel pump 47 to decrease the fuel flow rate to the burner 45 and at the same time cause the burner positioner 55 to raise the burner 45 . control of the fuel flow rate in this manner effectively diminishes the danger of a boiler blowup . combustion products from the boiler are drawn out through a stack 57 , which passes up through the middle of the tank 15 , by means of a fan 59 , which is driven by a variable speed fan drive 61 . the fan drive 61 is controlled by the electronic pressure control 53 , which will apply a signal to the fan drive 61 to cause it to operate at a higher speed in response to lower boiler pressure signalled by the pressure monitoring device 51 and at lower speeds in response to higher boiler pressure signalled by the device 51 . thus , when the burner flame is increased in response to lower boiler pressure , the exhaust fan speed will be increased to handle the increased combustion products and also to draw increased air flow to the burner for combustion . rather heavy insulation 63 , 64 , 65 and 67 is applied to the water tanks 13 and 15 , the boiler 11 and the turbine 33 , respectively . the insulation serves to reduce the dissipation of heat from the system and provides protection against severe environmental temperature to which the system might be subjected . the above described engine is of relatively simple , low cost construction , and yet it achieves high efficiency and high economy in fuel consumption with very little environmental pollution or operating noise and full safety of operation .	5
the problems set forth above as well as further and other problems are solved by the present teachings . these solutions and other advantages are achieved by the various embodiments of the teachings described herein below . the system and method of the present embodiment automatically minimize delay in updating time at a client computer . referring now to fig1 , ntp version 4 packet 10 is a user datagram protocol ( udp ) datagram including a basic header — leap indicator 11 , version number 13 , mode 15 , stratum 17 , poll exponent 21 , precision exponent 25 , root delay 27 , root dispersion 29 , reference identification 31 , reference timestamp 33 , origin timestamp 35 , receive timestamp 37 , and transmit timestamp 39 . ntp packet 10 also includes optional extension fields 41 and 43 including , for example , but not limited to , a destination timestamp . finally , ntp packet includes an optional message authentication code including key identification 45 and message digest field 49 . leap indicator 11 warns of an impending leap second , version number 13 is the ntp version number , and mode 15 indicates , among other things , whether or not ntp packet 10 is part of a time broadcast . stratum 17 indicates the reliability of the time source , poll 21 is the maximum interval between successive messages , and precision is the precision of the system clock of the computer creating ntp packet 10 . root delay 27 is the total round - trip delay to the reference clock , root dispersion 29 is the total dispersion to the reference clock , reference identification 31 identifies a particular server computer or reference clock , and reference timestamp 33 is the time when the system clock of the system identified by reference identification 31 was last set or corrected . origin timestamp 35 is the time at the client computer when the request departed for the server computer , receive timestamp 37 is the time at the server computer when the request arrived from the client computer , and transmit timestamp 39 is the time at the server computer when the response left for the client computer . destination timestamp , possibly located in optional extension field 41 , is the time at the client computer when the reply arrived from the server computer . destination timestamp is determined upon arrival of ntp packet 10 . key identifier 45 is used by the client and server computers to designate a secret 128 - bit md5 algorithm key defined in rfc 1321 and used to verify data integrity . message digest 49 is calculated over the ntp header and optional extension fields , but not including key identifier 45 and message digest 49 . referring now to fig2 , protocol 20 can include , but is not limited to including , server computer 19 sending set - up options 135 to client computer 102 , which executes set - up processor 101 receiving and processing set - up options 135 including , for example , but not limited to , a security option and a time format . packet processor 103 sends client packet 123 that is a time request , and that can include , but is not limited to including , ntp packet 10 ( fig1 ) including origin timestamp 35 ( fig1 ), and client identification information . server packet creator 51 creates and sends server packet ( or packets ) 128 that can include , but is not limited to including , client identification information , server identification information , ntp packet 10 ( fig1 ) including receive timestamp 37 ( fig1 ) and transmit timestamp 39 ( fig1 ). time processor 107 computes , by client computer 102 , a time difference between client time 131 ( fig7 ) and at least one of the server times ( receive timestamp 37 ( fig1 ) and transmit timestamp 39 ( fig1 )). the measured time difference is calculated as 0 . 5 *( sr + st − cr − ct ), where sr is receive timestamp 37 ( fig1 ), st is transmit timestamp 39 ( fig1 ), cr is the destination timestamp , and ct is origin timestamp 35 ( fig1 ). secure packet processor 109 receives secure packet 111 which is an encrypted and optionally signed version of server packet 128 . secure packet processor 109 decodes secure packet 111 with a public key and compares server packet 128 with the unencrypted version of secure packet 111 . identification bits can be compared as well . if secure packet 111 and server packet 128 are signed , secure packet processor verifies the signatures . should the packets pass verification test , update processor 105 can compute an updated time 119 ( fig7 ) by updating the client time 131 ( fig7 ) based on the measured time difference and via the client &# 39 ; s time computation system &# 39 ; s parameters . if the packets do not pass verification tests , spoof processor 23 can test for spoofing and can set spoof indication 127 ( fig7 ) if a spoof has been attempted . referring now to fig3 , in an alternative embodiment , in configuration 30 , server 1 computer 19 a sends server packet 128 ( fig2 ) to client computer 102 . processing as above occurs in client computer 102 . however , the subsequent transmission of secure packet 111 is generated by server 2 computer 19 b and sent to client computer 102 . server 1 computer 19 a can have a relationship with server 2 computer 19 b such as , for example , but not limited to , being directly wired to server 2 computer 19 b as indicated in fig3 by dashed lines , or can involve some form of electronic communications 124 such as a router . referring now to fig4 , protocol 40 , which operates in the context of configuration 30 ( fig3 ), can include , but is not limited to including , more than one server — server 1 computer 19 a and server 2 computer 19 b in the depicted embodiment — and client computer 102 . in protocol 40 , server 1 computer 19 a sends set - up options 135 to client computer 102 which processes are similar to client computer 102 processes in protocol 20 ( fig2 ). however , server 1 computer 19 a executes server unencrypted packet creator 51 a to send server packet 128 to client 102 , which server 2 computer 19 b executes server encrypted packet creator 51 b to send secure packet 111 to client 102 . server 1 computer 19 a can also share server packet 128 with server 2 computer 19 b , forming a relationship between server 1 computer 19 a and server 2 computer 19 b . referring now to fig5 , method 150 of the present embodiment can include , but is not limited to including , receiving 151 , by the client computer , set - up information including options and possibly defaults from at least one server computer . the options could , for example , but not limited to , be indirectly available via such means as public web pages or internal computation . method 150 can also include transmitting 153 , by the client computer to at least one server computer , a client packet including client identification information , timing information , and selected options from the options . if 152 the server computer is operating in broadcast mode , no transmitting step is required from the client . method 150 can also include receiving 155 , by the client computer , a server packet including at least one server time formatted based on the selected options and possibly the default options , computing 157 , by the client computer , a time difference between the at least one server time and the client time , receiving 159 , by the client computer , a secure version of the server packet , the secure version including secure time data , and updating 161 , by the client computer , the client time based on the time difference only if the secure time data and the server data associated with at least one server time match . referring now to fig6 , method 250 for circumventing spoofing of time - critical data can include , but is not limited to including , receiving 251 , by the client computer , set - up information including options from at least one server computer . the options could , for one example , be indirectly available via such means as public web pages or internal computation . method 250 can also include transmitting 253 , by the client computer to at least one server computer , a client packet including client identification information , timing information , and selected options from the options . if 252 the server computer is operating in broadcast mode , no transmitting step by the client is required . method 250 can also include receiving 255 , by the client computer , a server packet including server data formatted based on the options or the selected options , computing 257 , by the client computer , at least one difference between the server data and the time - critical data , receiving 259 , by the client computer , a secure version of the server packet , the secure version including secure time - critical data , and updating 261 , by the client computer , the time - critical data based on the at least one difference only if the secure data and the server data match . the options can include an encryption method and a decryption key . method 250 can optionally include decrypting the secure version according to the decryption key , the decrypted secure version including decrypted client information , updating , by the client computer , the data based on the at least one difference only if the decrypted data and the server data match , and if the received client identification information and the decrypted client identification information match , and indicating , by the client computer , a possible spoof when the secure version and the server packet do not match . referring now to fig7 , system 100 for minimizing delay in updating client time 131 at client computer 102 can include , but is not limited to including , set - up processor 101 receiving , by client computer 102 , set - up information including options 135 from at least one server computer 19 . the options could also be indirectly available by , for example , but not limited to , such means as public web pages or internal update mechanisms . system 100 can also include packet processor 103 optionally transmitting , by client computer 102 to at least one server computer 19 , client packet 123 including client identification information , timing information , and selected options from options 135 . packet processor 103 can also receive , by client computer 102 , server packet 128 including sever time data and at least one server time 47 formatted based on the options or the selected options . system 100 can also include time processor 107 computing , by client computer 102 , a time difference between at least one server time 47 and client time 131 , and secure packet processor 109 receiving , by client computer 102 , a secure version 111 of server packet 128 , secure version 111 including secure time data . system 100 can also include update processor 105 updating , by client computer 102 , time 131 , creating updated time 119 , based on the time difference only if the secure time data and the server time data associated with the at least one server time 47 match . security options 133 can include an encryption method and a decryption key . secure packet processor 109 can also decrypt the secure version according to the decryption key . the decrypted secure version can include decrypted client information . update processor 105 can update , by client computer 102 , time 131 based on the time difference only if the decrypted time and at least one server time 47 match , and if the received client identification information and the decrypted client identification information match indicated by , for example , but not limited to , update switch 132 . system 100 can optionally include spoof processor 23 indicating , by client computer 102 , a possible spoof using , for example , but not limited to , spoof indication 127 , when the secure version 111 and server packet 128 do not match indicated by , for example , but not limited to , update switch 132 . options can include an encryption method , a decryption key , and time format 134 . secure packet processor 109 can optionally decrypt secure version 111 according to the decryption key . the decrypted secure version can include decrypted client identification information . update processor 105 can optionally update , by client computer 102 , client time 131 based on the time difference only if the decrypted time and at least one server time 47 match , and if the received client identification information and the decrypted client identification information match . referring now to fig8 , system 200 for circumventing spoofing of time - critical data 138 at client computer 102 can include , but is not limited to including , set - up processor 101 receiving , by client computer 102 , set - up information including options 135 from at least one server computer 19 . the options could also be indirectly available by , for example , but not limited to , such means as public web pages or internal update mechanisms . system 200 can also include packet processor 103 optionally transmitting , by client computer 102 to at least one server computer 19 , client packet 123 including client identification information , timing information , and selected options from options 135 . packet processor 103 can also receive , by client computer 102 , server packet 128 including sever time data and server data 48 formatted based on the options or the selected options . system 200 can also include server data processor 142 computing , by client computer 102 , at least one difference between server data 48 and time - critical data 138 , and secure packet processor 109 receiving , by client computer 102 , a secure version 111 of server packet 128 , secure version 111 including secure time - critical data . system 200 can also include update processor 105 updating , by client computer 102 , time - critical data 138 , creating updated data 120 , based on the at least one difference only if the secure data and server data 48 match . security options 133 can include an encryption method and a decryption key . secure packet processor 109 can also decrypt the secure version according to the decryption key . the decrypted secure version can include decrypted client information . update processor 105 can update , by client computer 102 , time - critical data 138 based on the at least one difference only if the decrypted time and server data 48 match , and if the received client identification information and the decrypted client identification information match indicated by , for example , but not limited to , update switch 132 . system 200 can optionally include spoof processor 23 indicating , by client computer 102 , a possible spoof using , for example , but not limited to , spoof indication 127 , when the secure version 111 and server packet 128 do not match indicated by , for example , but not limited to , update switch 132 . options can include an encryption method , a decryption key , and data format 136 . secure packet processor 109 can optionally decrypt secure version 111 according to the decryption key . the decrypted secure version can include decrypted client identification information . update processor 105 can optionally update , by client computer 102 , time - critical data 138 based on the at least one difference only if the decrypted data and server data 48 match , and if the received client identification information and the decrypted client identification information match . embodiments of the present teachings are directed to computer systems such as system 100 ( fig7 ) and system 200 ( fig8 ) for accomplishing the methods such as method 150 ( fig5 ) and method 250 ( fig6 ) discussed in the description herein , and to computer readable media containing programs for accomplishing these methods . the raw data and results can be stored for future retrieval and processing , printed , displayed , transferred to another computer , and / or transferred elsewhere . communications links such as electronic communications 124 ( fig7 ) can be wired or wireless , for example , using cellular communication systems , military communications systems , and satellite communications systems . in an exemplary embodiment , the software for the system is written in fortran and c . the system can operate on a computer having a variable number of cpus . other alternative computer platforms can be used . the operating system can be , for example , but is not limited to , linux ®. the present teachings are also directed to software for accomplishing the methods discussed herein , and computer readable media storing software for accomplishing these methods . the various modules described herein can be accomplished on the same cpu , or can be accomplished on different computers . in compliance with the statute , the present embodiment has been described in language more or less specific as to structural and methodical features . it is to be understood , however , that the present embodiment is not limited to the specific features shown and described , since the means herein disclosed comprise forms of putting the present teachings into effect . methods such as method 150 ( fig5 ) and method 250 ( fig6 ) of the present teachings can be , in whole or in part , implemented electronically . signals representing actions taken by elements of the system and other disclosed embodiments can travel over at least one live communications network 124 ( fig7 ). control and data information can be electronically executed and stored on at least one computer - readable medium . system 100 ( fig7 ) and system 200 ( fig8 ) can be implemented to execute on at least one computer node in at least one live communications network 124 ( fig7 ). common forms of at least one computer - readable medium can include , for example , but not be limited to , a floppy disk , a flexible disk , a hard disk , magnetic tape , or any other magnetic medium , a compact disk read only memory or any other optical medium , punched cards , paper tape , or any other physical medium with patterns of holes , a random access memory , a programmable read only memory , and erasable programmable read only memory ( eprom ), a flash eprom , or any other memory chip or cartridge , or any other medium from which a computer can read . further , the at least one computer readable medium can contain graphs in any form including , but not limited to , graphic interchange format ( gif ), joint photographic experts group ( jpeg ), portable network graphics ( png ), scalable vector graphics ( svg ), and tagged image file format ( tiff ). although the present teachings have been described with respect to various embodiments , it should be realized these teachings are also capable of a wide variety of further and other embodiments .	7
referring more particularly to the drawings , fig1 and 2 show the first embodiment of the exercise apparatus 10 according to the present invention . the exercise apparatus 10 comprises a dynamic means 12 , a framework means 14 and a resistance means 16 . the dynamic means 12 comprises an upper frame 40 which is pivotally attached to a lower frame 60 . the dynamic means 12 further comprises arm rests 80 which are attached to lateral members 41 of the upper frame 40 , a seat 50 which is pivotally mounted to a top frame member 62 of the lower frame 60 , and a foot rest 70 . the framework means 14 comprises a vertical frame 20 which is maintained in an upright position by a horizontal frame 30 . horizontal frame 30 is configured to lie on a flat surface . however , there are other ways known in the art to stabilize the dynamic means 12 such as bolting the vertical frame 20 to the ceiling . both the upper frame 40 and the lower frame 60 are pivotally mounted to the vertical frame 20 . additionally , the upper frame 40 is slideably mounted to the vertical frame 20 . as shown in fig3 pivotal attachments 42 on the upper frame 40 are mounted on linear bearings 44 which slide along rods 46 secured to flanges 48 which in turn are secured to the lateral members 24 of the vertical frame 20 . as shown in more detail in fig2 arms 72 of the foot rest 70 are pivotally attached to a cross frame member 32 of the horizontal frame 30 in a manner well known in the art . the components of the present invention are constructed of commercially available materials , the selection of which is within the ability of the ordinary skilled worker . as shown in fig2 and 3 , the arm rests 80 have hand grips 87 attached to elbow rests 83 which in turn are attached to sleeves 84 that fit around and slide along the lateral members 41 of the upper frame 40 , enabling the arm rests 80 to be adjusted to the heights of different users . the arms rests 80 also have adjustment pins 86 which fit through holes 85 of the sleeves 84 and two of a plurality of adjustment holes 88 on the lateral members 41 of the upper frame 40 , thereby securing the arm rests 80 to the upper frame 40 . alternatively , the arm rests may be configured such that the arm rests are connected to each other so that the user need make only one adjustment . as shown in fig2 and 4 , the lower frame 60 has a projecting member 66 attached to a bottom frame member 64 of the lower frame 60 such that the projecting member 66 remains at a fixed angle with respect to the plane defined by the lower frame 60 . rollers 68 attached to the end of the projecting member 66 contact the foot rest 70 such that the pivoting motion of the lower frame 60 with respect to the vertical frame 20 effects a concurrent pivoting motion in the foot rest 70 about the cross frame member 32 . in the embodiment shown in fig1 resistance to both the forward folding movement and the return straightening movement is provided by a fly wheel - fan resistance mechanism 90 which is known in the art . as seen in more detail in fig2 cables 92 are attached to the pair of cable connections 49 attached to each side of the top member 43 of the upper frame 40 . one of the cables 92 runs up to the top member 22 of the vertical frame 20 , within the top member 22 of the vertical frame 20 , then down within the lateral member 24 of the vertical frame 20 to the base of the vertical frame 20 . the other one of the cables 92 runs to the lateral member 24 of the vertical frame 20 to the base of the vertical frame 20 . the cables 92 are guided by a system of pulleys 94 to the fly wheel - fan resistance mechanism 90 having a drum 96 , a shaft 97 and a fly wheel - fan 98 . the cables 92 are wrapped around the drum 96 so that movement of the upper frame 40 causes the cables 92 to rotate the drum 96 . the drum 96 is ratchet mounted on and drives the shaft 97 , which in turn drives resistance means such as the fly wheel - fan 98 . in order to use this apparatus , the user first stands on the foot rest 70 , leans back against the seat 50 and places his arms in the arm rests 80 . as described above , a user may adjust the arm rests 80 along the lateral members 41 of the upper frame 40 to suit his particular height . in addition , the hand grips 87 of the arm rests 80 are curved such that any user may grip the hand grips 87 while resting his elbows in the elbow rests 83 regardless of the length of his forearms . exercise on this apparatus essentially comprises two movements , a forward folding movement as illustrated in fig5 and a return straightening movement as illustrated in fig6 . the angle θ , which is defined by the upper frame 40 and the lower frame 60 as shown in fig5 constantly changes during exercise , decreasing steadily during the forward folding movement and increasing steadily during the return straightening movement . during the forward folding movement , the user exerts his abdominal muscles to pull the arm rests 80 toward the foot rest 70 , thereby rocking or pivoting the upper frame 40 toward the lower frame 60 . as the lower frame 60 pivots , the rollers 68 at the end of the projecting member 66 push against and roll along the foot rest 70 , causing it to pivot about the foot pivots 74 as shown in fig5 and 6 . the pivoting action of the foot rest 70 causes the knees to bend as θ decreases . then during the return straightening movement , the user exerts his back muscles to pull the arm rests 80 away from the foot rest 70 , rocking or pivoting the upper frame 40 away from the lower frame 60 . the apparatus stops as soon as the user stops exerting his muscles . stops 26 may be provided on the vertical frame 20 as shown in fig5 and 6 to control the range of movement of this apparatus . the stops 26 prevent θ from exceeding 180 °, thereby reducing the chance of physical injury to the user by preventing him from extending his pelvic region beyond his feet in a vertical stance . of course , the stops 26 may be designed such that the upper limit of θ is less than 180 ° in a manner known in the art . the cables 92 may also be used to control the range of θ or movement of this apparatus . persons of ordinary skill in the art will appreciate that resistance means other than the fly wheel - fan resistance mechanism described above may be readily adapted to the present invention . for example , as shown in fig7 the apparatus may employ an electro - magnetic resistance mechanism 90a . as seen more fully in fig8 chains 92a , 92b connected to the upper and lower frame 40 , 60 respectively , traverse around sprockets 99a , 99b , which are mounted concentrically with sprocket 99c on shaft 97a . shaft 97a is mounted to the horizontal frame 30 . the chains 92a , 92b then continue in a parallel arrangement around a system of pulleys 94a ( not shown ) to connect with return springs 95a . chain 92c is wound around the associated sprocket of the electromagnetic resistance mechanism 90a , the operation of which is understood by persons skilled in the art . a further alternative embodiment of the present invention is illustrated in fig9 . in this embodiment , resistance is provided only against the forward folding movement , and not against the return straightening movement . in this embodiment , only one cable 92 runs from one cable connection 49 , up to the top member 22 of the vertical frame 20 , within the top member 22 of the vertical frame 20 , then down within the lateral member 24 of the vertical frame 20 to the base of the vertical frame 20 . the cable 92 is guided by pulleys 94 to the fly wheel - fan resistance mechanism 90 having a drum 96 , a shaft 97 and a fly wheel - fan 98 . the fly wheel - fan resistance mechanism 90 functions as previously set forth in connection with the description of the first embodiment . the drum 96 is further provided with torsion springs to rewrap the cable during the return straightening movement . an additional , optional spring , such as extension spring 95 can be provided for greater resistance and faster return . a further alternative embodiment of the present invention is illustrated in fig1 . in this embodiment , resistance is provided only against the return straightening movement , and not against the forward folding movement . the resistance mechanism of this embodiment is the same as the resistance mechanism of the alternative embodiment illustrated in fig7 and 8 except that the former lacks the chain 92b and the sprocket 99b . a weight stack also may be used for resistance in a manner known in the art . fig1 schematically illustrates the apparatus in which resistance against the forward folding movement is provided by a weight stack . cable 92d is secured to upper frame 40 and traverses around pulleys 94b to weight stack 100 . the user may select the amount of weight desired . it is contemplated that a resistance mechanism which employs a weight stack also may be configured by a person of ordinary skill such that resistance may be provided against the return straightening movement . a further alternative embodiment of the present invention is illustrated in fig1 . in this embodiment , the upper frame 40 and the lower frame 60 are pivotally mounted to the vertical frame 20 in a manner well known in the art . in this embodiment , the lower frame 60 is also slideably mounted to the vertical frame 20 . whereas , in the first embodiment of the present invention , the user pulls the arm rests 80 toward the foot rest 70 in order to effect the forward folding movement , in this embodiment , the user pulls the foot rest 70 toward the arm rests 80 to effect the forward folding movement . this embodiment increases the force required by the user &# 39 ; s muscles and provides a more strenuous workout . in this embodiment , the foot rest 70 is additionally provided with foot stirrups 76 . any of the resistance means previously discussed may be easily adapted to this embodiment . in addition , the resistance means may be adapted to provide resistance against both the forward folding movement and the return straightening movement or either of the two . it is also contemplated that each of the embodiments described above will include an adjustment means known in the art for providing varying degrees of resistance . the present invention may be embodied in other forms without departing from its spirit or essential characteristics . the described embodiments are to be considered only as illustrative and not as restrictive . the scope of the invention is , therefore , indicated by the appended claims .	0
the present invention is illustrated with an implementation utilizing a touch pad as the medium . the touch pad , a pressure sensitive surface that can sense a contact point , which is the point impressed upon its surface by the user &# 39 ; s motion , transmits the coordinates of the contact point to an operating system . the operating system is a collection of various software and hardware subsystems tailored for a specific apparatus where the input device is to be applied . fig1 shows the layout of the perimeter regions 2 , and center regions 3 on a standard touch pad . the input device can be in four different modes : alphanumeric mode , standard 12 - key telephone keypad mode , pointing device mode , and symbol mode . the system interprets the movement of the contact point within and across the regions to determine the appropriate signal for the selected mode . dtmf and pulse dialing subsystems can also be incorporated for applications on telephones . fig2 shows a heads - up display 4 , when mounted in an appropriate position , serves as a visual aid to the user by displaying the state of the virtual keypad . fig3 shows a standard setup of the system which includes a collection of perimeter regions 2 , a collection of center regions 3 , a label 5 displaying the characters each region in the perimeter regions 2 can be assigned to , a heads - up display 4 , and a collection of auxiliary keys 6 positioned above and below the touch pad . the touch pad 1 is connected to an appropriate interface ( not shown ) where communication with an appropriate software driver ( not shown ) occurs , which in turn communicates with the operating system ( not shown ). similarly , heads - up display 4 is connected to an appropriate interface ( not shown ) to receive instructions from the operating system to display the state of the touch pad 1 . the auxiliary push button keys can be programmed for standard input functions such as mouse left , mouse right , mode , escape , delete , insert , shift , enter , and cursor navigation . the character set used in this set up is made up of the following character groups similar to the arrangement found on a standard 12 - key telephone keypad , with an “-” character indicating unavailability , a null value or an alternative character : group 1 [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 0 ] group 2 [ _ , a , d , g , j , m , p , t , w , _ ] group 3 [ _ , b , e , h , k , n , r , u , x , _ ] group 4 [ _ , c , f , i , l , o , s , v , y , _ ] when in alphanumeric mode , each of the perimeter regions represents no more than one character from the currently selected character group . when a signal to increment the character group that the perimeter regions are representing is received , each of the perimeter regions is assigned a character from the succeeding character group specified . similarly , when a signal to decrement the character group that the perimeter regions are representing is received , each of the perimeter regions is assigned a character from the preceding character group specified . when the first or the last group is reached , the system can be programmed to wrap around to the last or first character groups respectively . alternative schemes can also be arranged to customize the character assigned to a region according to the current state of the system . an alternative character set which contain the characters “ q ” and “ z ” can be arranged as follows : group 1 [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 0 ] group 2 [ _ , a , d , g , j , m , p , t , w , _ ] group 3 [ _ , b , e , h , k , n , q , u , x , _ ] group 4 [ _ , c , f , i , l , o , r , v , y , _ ] group 5 [ _ , _ , _ , _ , _ , _ , s , _ , z , _ ] the actions by the user on the touch pad are fed into the driver , a subsystem of the operating system , and an algorithm translates them and generates an appropriate signal . communication between the touch pad and the driver takes place for each of the following events : the user touching down on the touch pad ; the user lifting off from the touch pad , and the user moving across the touch - pad surface . the driver organizes the information received from the touch pad and transmits it to the operating system as follows : a flag indicating that the center regions have received focus ; a flag indicating that the center regions have lost focus ; the previous contact region ; the current contact region ; a single tap as a single click or a single select ; two successive taps as a double click or a double select ; two successive taps and holding down after the second tap as a click and hold ; a touch down followed by movement as moving the pointer ; a click and hold followed by movement as a hold and drag ; and a lift off as a mouse button release . a flag indicating that the perimeter regions have received focus ; a flag indicating that the perimeter regions have lost focus ; the previous contact region ; the current contact region ; the direction of movement — clockwise or counter clockwise ; and a single tap as a single click . the operating system can be in one of the following four modes when interpreting the information from the driver : alphanumeric mode ; standard 12 - key telephone keypad mode ; pointing device mode ; and symbol mode . the operating system interprets the information received from the driver and acts depending on the current mode . the contact point traversing across the touch pad with a substantially sliding motion is interpreted as a swiping or a tracing motion . the contact point touching down and lifting off within a certain time interval is interpreted as a single tap , and two successive taps within a certain time interval is interpreted as a double tap . a double tap without a lift off after the second touch down motion followed by a lateral movement of the contact point is interpreted as a drag and hold action . fig4 shows the heads - up display in alphanumeric mode , where the first group of characters is assigned to the 10 perimeter regions . a circle is displayed on region 40 a where the current contact point is positioned . character group 1 is assigned to the perimeter regions at this stage . tapping on a perimeter region sends the character that it is currently assigned to the region to the operating system . circular sliding movements , clockwise or counterclockwise , on the perimeter regions respectively increment or decrement the character group assignment to the perimeter regions . the number of character groups changed equals the number of adjacent perimeter regions that the contact point moves into in the process of traversing the perimeter regions . the character group assignment is also arranged to wrap around . fig5 shows the state after the user makes a clockwise swipe one region . the circle indicates that the contact point is now positioned on perimeter region 40 b . character group 2 is assigned to the perimeter regions at this stage . fig6 shows the state after the use makes a clockwise swipe three regions . the circle indicates that the contact point is now positioned on perimeter region 40 d . character group 4 is assigned to the perimeter regions at this stage . fig7 shows the state after the user makes a counterclockwise swipe one region from the state shown in fig4 . the circle is now positioned on perimeter region 40 j . character group 4 is assigned to the perimeter regions at this stage . the character groups wrapped around backward to the last character group in this case , since the previously selected character group was the first of the four character groups . the resulting character assignment is the same as making a clockwise swipe spanning three consecutive regions , as shown in fig6 . fig8 shows the heads - up display in the standard 12 - key telephone keypad mode , where the nine center regions 50 , and the three perimeter regions 40 e , 40 f and 40 g represent the alphanumeric keys found on a standard 12 - key telephone keypad . the numeric digit or the character displayed on the region that the user taps is fed into the operating system for further processing as required . the rest of the perimeter regions remain inactive in this mode . fig9 shows the heads - up display in pointing device mode , where the collection of the center regions acts as a regular touch pad . the contact point 50 e on the touch pad is displayed in a darker shade . the usual actions such as tapping , moving and dragging as it is on a typical touch pad are transmitted to the operating system for appropriate processing as required . fig1 and fig1 show the heads - up display in symbol mode , where the collection of center regions acts as a trace pad for drafting symbols . the adjacent regions 50 a , 50 b and 50 c , where the contact point moves across with a tracing motion are marked as line segments , and the region 50 h where the contact point briefly rests or tapped once , depending on how the system is configured , is marked as a dot . repeating the same actions on the marked regions erases the markings . if a significant pause where no contact is detected , the system assumes that the user has completed drawing the symbol and tries to match it with the patterns stored in its memory . the system can be configured to recognize alphanumeric characters from standard english or other languages , and can also be trained to recognize custom symbols . fig1 shows the letter “ t ” and fig1 shows the “!” mark , drawn on the collection of center regions . alphanumeric mode can be simultaneously active with pointing device mode and symbol mode , but it cannot be simultaneously active with standard 12 - key telephone keypad mode , since the lower three regions 40 e , 40 f and 40 g as shown in fig8 are used to represent the characters “#,” “ 0 ” and “*” respectively in this mode , unless alternative arrangements have been made . fig1 shows the virtual keypad system on a corded ( cord not shown ) desktop telephone unit . fig1 shows the virtual keypad system on a mobile telephone unit . due to the limited space available , the heads - up display 4 is positioned on the display and the character labels 5 are positioned inside the perimeter regions . one possible configuration is to have the heads - up display show up only when the user touches the keypad . it would also be possible to dim the material currently displayed to give the heads - up display greater visibility . another possibility is to use a touch - screen , which is not only pressure sensitive like a touch pad , but also capable of displaying information , and display the state of the keypad on the touch - screen itself . a number of alternative embodiments are illustrated to demonstrate potential improvements for ergonomics or aesthetics . fig1 shows an alternative embodiment with ridges 70 around the regions for improved tactile feedback . when the user moves her contact point across the touch pad surface , the ridges give a tactile feed back of the movement across the regions . fig1 shows another alternative embodiment with recessed center regions and downward sloping perimeter regions 72 for improved tactile feedback . when the user moves the contact point across the touch pad surface , the angular edge where the sloping surface of the perimeter regions and the flat center regions meet , gives a tactile feed back of which set of regions the contact point is positioned in . fig1 shows another alternative embodiment with dimpled regions 74 for improved tactile feedback . when the user moves the contact point across the touch pad surface , the dimples snuggly lodge the contact point on the touch pad surface and gives the user extra assurance that the contact point is inside a region . fig1 shows another alternative embodiment with raised regions 76 for improved tactile feedback . when the user moves her contact point across the touch pad surface , sensation of ascending the raised side of a region and reaching the crown of the raised surface gives the user extra assurance that the contact point is inside and in the center of a region . fig1 shows another alternative embodiment with a circular perimeter region 78 for improved appearance . a circular groove ( not shown ) can be implemented in the area of the perimeter regions for improved tracking when making a swiping motion . when the user makes a swiping motion on the perimeter regions , the groove helps the contact point to remain in the perimeter regions . fig1 shows another alternative embodiment with asymmetric perimeter regions 80 to aid one - handed operations . in one - handed operations , the user would most likely hold the device with one hand with the scale - downed side of the regions located next to the base of her thumb , and operate the device with her thumb . in this case , the scaled down regions would better accommodate the more restrictive movement of the thumb when it is folded closer to its base or the palm . fig2 shows another alternative embodiment where a subset of regions 82 , regions in the positions of numerals 1 , 2 , 3 , 4 , 6 , 7 , 8 and 9 in a standard 12 - key telephone keypad layout , serve as common regions . in alphanumeric mode , when the contact point moves across the regions designated to double as perimeter regions , the character assignment to each region is changed in a fashion similar to the operation of the device with a layout with separate perimeter and center regions . fig2 shows another alternative embodiment where push button keys 86 are covered by a flexible pressure sensitive touch pad 84 . the push button keys capture the distinct downward pressure , and the pressure sensitive surface captures the movement of the contact point across regions , offering the capability of fast character input while retaining the familiar tactile sense of the push button keys to the device . the reader will see that the present invention provides a means to enter text with speed and ease , and at the same time is intuitive and compact . it also effectively quadruples as an alphanumeric input device , a standard 12 - key telephone keypad , a regular touch pad , and a symbol input device . while the above description contains many specifications , these should not be construed as a limitation of the scope of the invention , but rather as an exemplification of a few embodiments thereof . many other variations are possible . for example , other embodiments with more or less regions , different character sets or label sets , various symbol libraries , a combination of features from different embodiments , a combination of surface textures and shapes , and arrangements where the center and perimeter regions are designed to work in coordination . variants of the present design can also be implemented with push button keys , or a combination of a pressure sensitive touch pad and push button keys . in addition , touch sensitive mediums implemented by optical , thermal , chemical , or organic means , in addition to the type of mediums implemented by tactual means , could also be employed . accordingly , the scope of the invention should be determined not by the embodiments illustrated , but by the appended claims and their legal equivalents .	6
an embodiment of the invention leverages key information captured by the invention disclosed in the following document , and provides an extension from persons and systems to track request scope in terms of affected record types . this document is incorporated herein in its entirety by this reference thereto : [ pa3697us ], u . s . patent application ser . no . 11 / 505 , 537 , systems and methods for utilizing an enterprise map to determine affected people and systems , filed . an embodiment of the invention creates , manages , and maintains a list of external sources that are able to provide a list of affected people , based upon specific litigation context parameters . communication protocols are provided that enable the import of a list of affected elements from the external sources . a user interface triggers or executes the import of the affected list using the communication protocol . conflicts between different affected lists imported in the same request scope are resolved , as are conflicts between different affected lists from the same external source which are imported at different points in time . external systems are tracked , displayed , and reported with regard to where each element in the affected list originated , modifications that occurred after the initial import , and all reasons provided by the operator or the external source to justify the initial import or the follow - up changes . affected lists that could be tracked in external sources include , for example : persons who are not part of the enterprise , e . g . contractors and service providers ; hosted systems or repositories that are not managed and maintained within the company ; persons , systems , and classes of information that were jointly involved in the same project , where a project describes any temporary association of persons from one or multiple organizations , using specific systems to store information in the form of a specific set of information classes , as used in the specific context of the project ; persons catalogs in ldap , active directory , and other it data stores of person information ; persons catalogs from hr systems , financial systems , and other information systems that maintain employee information via web services calls / apis ; persons lists defined based on an access list of structured applications via application specific apis . for example , an application administrator knows the people accessing the application and the context . this embodiment provides a list of persons , and their unique id , that accessed a certain file in a document management systems or a source control system ; persons from mail servers , e . g . distribution lists and aliases . those that reflect a common functional context and access to information ; isolated partial lists of data sources . systems are dynamically provisioned in a company , i . e . some new systems become available and old systems go offline . it is difficult to keep any single source of truth updated to the extent of complete confidence because there is a time lag between it implemented changes to the inventory list and tracking by legal applications that manage the business process of litigation . provisioning such external systems and people responsible for such systems , data and evidence , makes it possible to capture them into the request scope within the context of litigation , for example csv lists of assets , e . g . data storage systems , can be imported into the request scope ; asset lists can be imported using more tighter integration mechanisms with applications that manage it assets via web service calls / apis ; and any repository of data and evidence , e . g . not restricted to building , warehouse , garage or file cabinet address , can be imported into the request scope . a similar tracking and conflict resolution problem exists in enterprises that have started a retention management program , but still suffer from large gap between the creation and the classification of the data . this means that a large amount of data may not yet be classified or tracked in the central retention management program . as the process for identification of potential evidence progresses , some specific silo of unclassified data may be investigated and classified . at this point the relevant classes of information become immediately known and should be imported into the request scope through , for example , the following steps : csv import of record types into the request scope ; manage association of such record types with external data sources imported ; and inclusion of such data sources into the request scope when external record types are included . an implementation of a mechanism for creating , managing , and maintaining a list of external sources containing people , systems or classes of information is provided in the following example : integration with ldap , where a list of sources of affected elements is described as ldap server details , e . g . hostname , port number , and security credentials . import of affected list can be performed as a single ldap lookup . web service urls can be managed as a source of affected elements . import of affected elements can be performed as a single web service call . connector configuration urls can be managed for connector type integration , where the connector provides a range of services that can be discovered through a single configuration services . this can support a more sophisticated ui integration , as different functionality accesses specific services ( see details below ). examples of communication protocols that enable the import of a list of affected elements from the external sources include : systems that have the affected element related information can export the list to a file . the file can be formatted to the csv format or the list can be exported in csv format itself . the list of elements can be imported into the request scope of an ongoing litigation or an impending litigation context . an ldap browser - like interface searches people details and imports a list via ldap protocol integration . for external sources that expose web services interfaces , implementing a web services client and importing a list of affected elements returned . an example web service operation is : list returnlist getelements ( list filterlist ). this is a generic operation and depends on source side implementations , i . e . web services exposed . filterlist is a generic list of filter criteria that can be sent to the source service provider . returnlist is a list of elements returned and element type . for external sources exposing other non - standard interfaces , implementing integration glue code , i . e . connectors , that bridge between standard web services apis and native source side service provider apis to extract and import the list of affected elements . examples of user interface actions to trigger or execute the import of the affected list using the above communication protocols include the following : fig1 is screen shot showing an import through csv files according to the invention . in fig1 , an element type can comprise a person , system , or record type . the file to import is selected from the file system . a preview of the imported list is provided . the legal team can then decide which items in the imported list are to be included in the request scope . this decision can also be deferred until all elements are imported . the list of elements in the csv file can be created or filtered based on any appropriate litigation specific parameters , but in that case those parameters are enforced by the user creating the csv file content . fig2 is screen shot showing an import using a mailing list lookup according to the invention . in fig2 , a distribution list is selected . a preview of the imported list is provided . this list includes all elements ( email addresses ) included in the distribution list . any filtering based on litigation context specific parameter can be applied at that point . the legal team can decide which items in the imported list are to be included in the request scope . this decision can also be deferred until all elements are imported . fig3 is a screen shot showing an import using a web service lookup according to the invention . in fig3 , a list of web services that are available for access in the context of litigation can be pre - configured , so it is easily accessible to a user after that . a preview of the imported list is provided . in this case , a number ( potentially all ) of the parameters known about the litigation context were passed as input parameters to the web service , which means that the system had the other end at the ability to filter the list down to reflect only the appropriate affected elements . the legal team can also decide which items in the imported list are to be included in the request scope . this decision can also be deferred until all elements are imported . fig4 is a screen shot showing an import using a web service based lookup via connectors . connectors provide additional filters , defined per connector , that allow the end user to refine a selection further before importing the affected list , through a simple iterative process of trial and error . the user can apply specific filters , and the web service will provide both the corresponding list and additional comments on how the filters were understood ( or not ) and applied . a selection may be made from a list of connectors that are configured with external sources of information on affected people , systems , and record types that are accessible in the context of litigation . this model may support continuous mode for certain systems , where the affected list source systems regularly provide any update to the lists that are being imported . if the mode is continuous , then the search results and selection area are not shown . the search criteria are stored in the continuous mode . conflict resolution is automatically performed based on configured rules . a filter area provides query templates to use for search based upon connector configuration . the criteria are saved if the system is in the continuous mode . the user can refine the filter criteria . fig5 is a screen shot showing an import using an ldap lookup according to the invention . in fig5 , a configured list of ldap servers that are accessible in the context of litigation is shown . if the mode is continuous , then the search results and selection area are not shown . the search criteria are stored in the continuous mode . conflict resolution is automatically performed based on configured rules . a filter area provides query templates to use for search based upon connector configuration . the criteria are saved if the system is in the continuous mode . the user can refine the filter criteria . in any of the examples of fig1 - 5 , described above , an additional user interface can be added to setup automatic refresh of the affected list lookup by configuring a start date allowing the user to select a date , defaulting to today ; a refresh period expressed in , for example , days , weeks , months ; and an end date , which can be empty , which indicates refresh indefinitely . once these three parameters are configured , the corresponding affected elements lookup source is refreshed using the pre - configured parameters on the following dates : the affected list is automatically refreshed on the following dates : 6 / 2 / 08 , 6 / 9 / 08 , 6 / 16 / 08 . 6 / 23 / 08 , 6 / 30 / 08 . implementation of conflict resolution between different affected lists imported in a request scope includes the following example : keep the union of all elements ; always add external elements , or any other similar rule driven by rules engine that doesn &# 39 ; t require any human review or approval . initially , keep the union of all elements , but trigger workflows to resolve conflicts based on configured rule sets . trigger workflows before the external elements are included into request scope . in this case , the imported elements stay in a pending state and are added to the request scope only when approved . elements are added only after completion of the workflow . keep the union of all elements , but allow manual override and track where the inclusion , modification , or deletion of elements from external sources happened . keep the union of all elements , and track external sources when the same element came from multiple sources . for example , if person a is added because of a list imported by attorney a , as well as by attorney b . it is useful to know and record this fact . additional implementations of conflict resolution between different affected lists , where the same external source is imported at different point in time include the following example : use a reference count to keep track of which source added which elements , and remove elements that are no longer included in any of their original sources of affected elements . such change should be tracked and auditable , and may require review by a user or it may be fully automated , depending the audit and check and balance level used by the legal team an implementation of a mechanism for tracking , displaying , and reporting on the change history of each element is provided in the following example : last name , first name , email , login identifier , date of inclusion , date of modification , reason , litigation context identifier , request scope identifier name , unique identifier , date of inclusion , date of modification , reason , list of related record types , list of related people , litigation context identifier , request scope identifier record type , date of inclusion , date of modification , reason , litigation context identifier , request scope identifier people master list comprising a union of affected people across all request scopes associated with an ongoing litigation or an impending litigation context . people can be included because of explicit inclusion ; and people can be included because of their association with systems . the master list also indicates which follow - up actions have already been taken regarding an affected person , for example sending a legal hold , setting a preservation plan , setting and fulfilling collections , interviewing the person , etc . this additional context may also be critical to decide how to manage the lifecycle of that person in the affected list . system master list comprising a union of affected systems across all request scopes associated with an ongoing litigation or an impending litigation context . systems can be included because of explicit inclusion . systems can also be included because of their association with record types . the master list also indicates which follow - up actions have already been taken regarding an affected system , for example setting a preservation plan , setting and fulfilling collections , and interviewing the system steward . this additional context may be critical to also decide how to manage the lifecycle of that system in the affected list . record type master list comprising a union of affected record types across all request scopes associated with an ongoing litigation or an impending litigation context . the record type list can also be included because of an association with systems . various reports , including for example : list of external request scopes per legal matter ( litigation context ), across selected legal matters ( litigation contexts ). drill down to details of the external request scope , i . e . source of inclusion . external request scope with the following details : litigation context identifier ; request scope identifier ; external element reference with drill down to details , including affected people details , affected system details , and affected record type details ; and affected element details that may include the history of changes , and reasons for inclusion , including which source of affected elements they were referred from , and when . filter criteria , including : litigation context identifier ; selected time duration ; and element type , i . e . affected people , system , and record type . fig6 is a screen shot showing an example of implementation of the ability to alert on the change of request scope according to the invention . in the example of fig6 , the head of litigation for legal matter xyz vs . pqr wants to know when new affected people are added to the request scope , and the resulting scope change is indicated with regard to three added people : jane ho , joe blow , and alice chang , connection with two external sources : distribution list : dev - all and ldap server 3 , in the form of an alert . each request scope change includes a mode , e . g . manual or continuous ; an operator , e . g . john smith or the system ; and a type of notification to be sent to those individuals on the list , e . g . a legal hold notice lh1 and an individual collection notice ic1 , ic2 . fig7 is a screen shot showing an example implementation of the overall solution according to the invention . the solution comprises of a software layer , called the external data sources adapters . these adapters are integration components that interact with various disparate external data sources and aggregate the data ( people , system and classes of information ) into the application that manages the business process around a litigation context . there are various ways of communicating with the sources of data as indicated in the diagram ( but not restricted to the only ones shown ). for example the file can be a formatted file generated by the source of data , system , the application managing the data or manually constructed file by a human being . the connector can practically integrate with any external system . some of the interfaces shown in the diagram just represent the interaction with some well know data sources of information ( like ldap , mail servers ) as examples . 1 . collects and persists the data from various adapters and associates the elements ( person , systems and classes of information ) with request scopes and litigation contexts . 2 . transforms the data if needed ( transformation engine ) a . example : cleaning the data to make it suitable for being processed by the application 3 . the rules engine manages all the configured rules in the application driving the request scoping business process in the context of a litigation . 4 . events engine generates and tracks change in the request scope because of the import of data from external sources ( or changes by the application or users ). 5 . preference engine manages the preferences of the users of the application managing the business processes around the litigation . for example the legal head of legal matter xyz vs . pqr wants to receive alerts via emails when the request scope changes 6 . escalation engine converts change events into alerts based on preferences and configured rules . 7 . the delivery engine make sure the alerts are delivered to the appropriate users based on preferences . for example the legal head of legal matter xyz vs . pqr wants to receive alerts only on the application dashboard when the request scope changes and keep them around for a specified interval of time . the delivery engine makes sure that the alert is delivered to the users dashboard . the rules engines ensures that the alert stays on the dashboard only for the specified interval of time as configured by the user and then cleans them up . 8 . alert engine manages the life cycle of the alert 9 . the business process management engine manages the workflows and interaction between the various software components and users of the system . it allows the users of the system to manage the request scope life cycle in the context of litigation . 10 . the user interface layer exposes all the functionality of the application managing the business process around the litigation context for creating and managing request scope for ongoing litigations or impending ones . i . managing the adapter configurations ii . managing the search filters selected by the users for different adapters iii . managing the frequency of import of data by various adapters iv . managing the changes in the request scope because of import of data by various adapters v . managing changes in the request scope manually after the imports are done or configuring automated rules that take care of the changes vi . managing conflicts and escalation based on configured rules 11 . the reporting engine generates the different reports for the users to get insight into changes in the request scope and various other analytics that are possible with the aggregated data for the request scopes . although the invention is described herein with reference to the preferred embodiment , one skilled in the art will readily appreciate that other applications may be substituted for those set forth herein without departing from the spirit and scope of the present invention . accordingly , the invention should only be limited by the claims included below .	6
referring now to the drawings , in which like numerals indicate like elements throughout the several figures , fig1 illustrates an optical chromakey field shown generally at 10 according to a preferred embodiment of the present invention , in the environment of a television studio . the optical chromakey field 10 is placed in the field of view of the video camera 5 . as illustrated , a television personality 7 such as a weather reporter , stands in front of the optical chromakey field 10 in the field of view of the video camera 5 . the optical chromakey field 10 is transparent and allows the television personality 7 , when facing the optical chromakey field , to see through the optical chromakey field to the monitor or teleprompter 6 which is located behind the optical chromakey field . fig2 illustrates the preferred embodiment in greater detail . a perspective view of the optical chromakey field 10 is shown in fig2 from its front side 11 , which is the side placed in the field of view of the video camera 5 . the optical chromakey field 10 includes a transparent assembly 29 and an illumination apparatus 20 . the transparent assembly 29 is in the field of view of the video camera 5 . the transparent assembly 29 of the preferred embodiment comprises a plurality of transparent horizontal members 30 , which are supported in a vertical array by a support structure 40 . in the preferred embodiment , these transparent members 30 are flat louvers of equal length , width and thickness . however , the length , width , thickness and number of the members used in the optical chromakey field 10 may be varied according to the particular needs of the video presentation . for example , for a weather report a wall - size optical chromakey field 10 may be used to present the special effect of a weather map across the entire background of the video presentation . the optical chromakey field 10 may have a smaller configuration and be placed in different locations depending upon the intended special effects . for instance , for a window effect such as is used in showing news clips over a reporter &# 39 ; s shoulder during a newscast , shorter and fewer transparent members 30 would be necessary to achieve the desired effect within the apparent window . the optical chromakey field 10 for such a newscast would be placed in the camera &# 39 ; s field of view so that the news clips appear in the correct place . the thickness of each transparent member in the preferred embodiment is 3 / 4 of an inch , but thicker members may be necessary in other embodiments to prevent bowing where the optical chromakey field 10 is large and the length of each transparent member is long . the transparent members 30 of the preferred embodiment are made of plexiglass , but they may be made of other transparent materials known to those skilled in the art , such as glass , acrylic or other plastics . as illustrated in fig2 the transparent members 30 of the preferred embodiment are arranged in a vertical array and supported by a support structure 40 . the support structure 40 of the preferred embodiment comprises two vertical walls 41a and 41b connected at their respective interior rear upper corners to a spacing rod 42 . for additional support , the vertical walls 41a and 41b may be connected at their respective interior rear lower corners or elsewhere so long as such support does not interfere with the transparency of the optical chromakey field 10 . each of the vertical walls 41a and 41b is further supported in the preferred embodiment by a stabilizer , 43a and 43b , which is connected along the base width of each wall to lend greater vertical stability . alternate forms of supporting the transparent members 30 without interfering with the transparency of the optical chromakey field 10 are well known to those skilled in the art . each of the transparent members 30 of the preferred embodiment has a front surface 31 , a leading edge 32 and a trailing edge 35 . the transparent members 30 are supported by the support structure 40 so that the front surface 31 of each transparent member 30 is at an angle with respect to the vertical axis 44 of the structure 40 . the transparent members 30 are angled so that they operate together with the illumination apparatus 20 to present light of a certain color for reception by the video camera 5 . fig3 illustrates the angled transparent members 30 in greater detail . the transparent members 30 of the preferred embodiment are angled at approximately 45 degrees with respect to the vertical axis 44 of the support structure 40 , with the front surface 31 of each transparent member facing downwardly . however , this angle may be varied in a manner well known to those skilled in the art according to the circumstances necessary to present light of a certain color for reception by the video camera 5 . fig3 also illustrates the illumination apparatus 20 of the preferred embodiment . the depicted illumination apparatus 20 comprises a light source 21 and a reflector panel 25 . the reflector panel 25 is positioned to lie flat in front of the angled transparent members 30 at the foot of the vertical array so as to receive light from the light source 21 and to reflect light to the transparent assembly 29 . although the light source 21 of the preferred embodiment is an array of fluorescent tubes , any other kind of lighting means may be used if it satisfies the requirements of the present invention . the light source 21 is positioned between the vertical walls 41a and 41b and behind the lowermost transparent member 30 , and directs illumination forwardly through the lowermost transparent member to strike the reflector panel 25 . the angular relation between the downwardly - facing front surface 31 of each angled transparent member 30 , the flat reflective panel 25 , and the light source 25 is chosen so that each front surface 31 receives reflected illumination from the light source 25 whenever that source is turned on . the reflector panel 25 of the preferred embodiment is a blue reflector panel which receives light from the light source 21 , but reflects only blue light towards the front surfaces 31 of the transparent members 30 . the front surfaces 31 in turn reflect the blue light for reception by the video camera 5 . this causes the video camera 5 to produce a characteristic video signal operative to cue special effects . thus , in operation , the optical chromakey field is 10 placed in the field of view of the video camera 5 where it does not interfere with the video presentation because of its transparency . in the preferred embodiment , the light source 21 directs light towards the blue reflector panel 25 . the blue reflector panel 25 receives the light , but reflects only blue light towards the front surfaces 31 of the transparent members 30 . the transparent members 30 of the preferred embodiment are angled at approximately 45 degrees with respect to the vertical axis 44 of the support structure 40 . each front surface 31 faces downwardly . thus , blue light directed by the reflector panel 25 towards the angled front surfaces 31 of the transparent members 30 is reflected by the front surfaces for reception by the video camera 5 . when special effects are desired , the video control apparatus substitutes a special effect signal for the corresponding blue light signal presented by the transparent assembly 29 . the viewer of the video presentation sees special effects in place of the optical chromakey field 10 . nevertheless , the transparency of the transparent assembly 29 allows the on - camera television personality 7 to see through the optical chromakey field 10 to view a teleprompter or monitor 6 as necessary . it will be understood to those skilled in the art that the light source 21 may be specialized so as to provide blue light to the reflector panel 25 to be reflected to the transparent assembly 29 . alternatively , the light source 21 may provide blue light directly illuminating the transparent assembly 29 without requiring a reflector panel 25 . as another alternative , the front surfaces 31 of the transparent members 30 may be configured or treated so as to reflect only blue light . while the preferred embodiment uses blue light , it will be understood to those skilled in the art that other colors may be designated to cue special effects . blue and green colors are chosen generally because they are most opposite flesh tones on the color wheel , and thus allow for the greatest flexibility in creating special effects . further , fig3 illustrates that the transparent members 30 are spaced so as to prevent irregularities in the presentation of the light of a certain color for reception by the video camera . gaps between the transparent members 30 may pass through some of the light from the illumination apparatus 20 . this may result in the presentation of a striped or otherwise irregular pattern of light of a certain color for reception by the video camera 5 . the transparent members 30 of the preferred embodiment are spaced along the vertical axis 44 of the support structure 40 so that the leading edge 32 of each transparent member 30 overlaps the front surface 31 of the next transparent member 30 in the array . this overlap provides that the optical chromakey field 10 presents a uniform surface to the video camera 5 without any gaps which might cause stripes or other aberrations to appear in the video presentation . fig4 a and 4b illustrate two embodiments of a leading edge 32 or a trailing edge 35 of a transparent member 30 . the leading edge 34 of the preferred embodiment is shown in fig4 a . the leading edge 34 is beveled and its flatness is perpendicular with respect to the plane of the array . the beveled edge 34 thus is substantially parallel to the sight lines of the video camera 5 , and any light reflected from those edges will not strike the camera lens . if the leading edge 34 is beveled , the trailing edge 35 should also be beveled and perpendicular to the plane of the array . this prevents stripes or other irregularities from appearing in the presentation . fig3 illustrates beveled leading edges 34 and beveled trailing edges 35 . an alternative embodiment utilizing a rounded leading edge 33 is shown in fig4 b . a rounded leading edge 33 requires a rounded trailing edge ( not shown ). the rounded edges lack any plane surface which could reflect light to the camera . rounded or beveled leading edges thus are provided by the present invention to minimize the amount of light which is scattered away from its directed path towards the video camera 5 . a rounded or a beveled edged will also minimize the problems of reflection or glare created by ambient light which may affect the quality of the video presentation . the preferred embodiment of the present invention has been disclosed by way of example and it will be understood that other modifications may occur to those skilled in the art without departing from the scope and the spirit of the appended claims .	7
in general terms , the present invention seeks to detect airborne particles and / or to provide discrimination according to particle size using apparatus that has low cost , small size , low weight , high ruggedness , high reliability , low maintenance and long service life , and is suitable for high production volumes . this is achieved with the use of only a single sensor , together with at least two inexpensive light sources . use of a single sensor and its associated electronic amplifier necessarily designed for high sensitivity with low noise , simplifies the design and reduces the cost of the system . it also avoids any lack of consistency that could occur in the sensitivity and linearity of additional sensors and it avoids the possibility of the incremental addition of noise contributions from plural sensors . discrimination of airborne particle size could be achieved in a number of ways . the two or more light sources may differ in wavelength , polarization , position ( specifically the solid angle of incidence to the detection zone axis ), or a combination of these . in the preferred embodiment of the invention , two light emitting diodes ( led &# 39 ; s ) operating at different wavelengths are employed . this permits the use of wavelengths as distant as 430 nm ( blue ) and 880 nm ( infrared ) such that the wavelengths are separated by a full octave . such a large difference in wavelength can produce a significantly different strength of signal when light of alternate wavelength is scattered off particles toward the sensor . alternative combinations such as 430 nm ( blue ) with 660 nm ( red ) are possible . closer - spaced wavelengths such as 525 nm ( green ) with 660 nm ( red ) could be used , accompanied by a reduction in size discrimination and sensitivity to small particles . it is known from rayleigh theory that the intensity of the scattered light reduces according to the fourth power of wavelength , for particles smaller than the wavelength of light . this has proven relevant to smoke detection in experiments using xenon lamps which produce a complete spectrum embracing infrared , visible and ultraviolet wavelengths , where it was found that wavelengths in the blue region are necessary for the detection of certain kinds of fires liberating small particles . therefore , a particular advantage of being able to employ a blue light source is that its short wavelength provides high resolution of small particles that become invisible at longer wavelengths . whereas a blue or violet laser diode may be preferable to a blue led , the former are expensive , have increased alignment complexity , require automatic power control and have a lower tolerance of elevated temperatures . the combination of readily available red and infrared laser diodes could be used , but in addition to the difficulties presented by using lasers , these longer wavelengths fail to adequately resolve small particles . accordingly the preferred embodiment of the invention is configured to utilize the broad beam spread of a high - intensity led ( approx 12 deg ). although the broad spread of the led beam could be confined by focusing with a lens , this adds cost , complexity in alignment and size to the product . whereas the led does not have the localized high light intensity of a collimated laser beam , the aggregate intensity of the led light scattered from the large volume of the detection zone when integrated on the sensor is of comparable magnitude . therefore the sensitivity of the led based system is comparable with laser , but the cost is reduced without compromising reliability . nevertheless , the same invention could be configured to use laser diodes as alternative light sources of differing wavelength , polarization or position ( angle ). such arrangements can provide particle size discrimination also , but at a higher cost and greater temperature intolerance than led designs . the ability to use led &# 39 ; s is achieved by the novel configuration of the optical chamber which accommodates the broad projector beam angle of each led , opposite a specially designed light trap located beyond the detection zone , to completely absorb the remnant projected light , thereby preventing its detection at the sensor . the chamber also contains a further light trap opposite the sensor and beyond the detection zone , to eliminate stray projected light from being detected . thus the signal - to - noise ratio caused by remnant projected light compared with the detected scattered light , is maximized to ensure very high sensitivity of the system . this is further ensured by the close mutual proximity of the led &# 39 ; s and the sensor to the detection zone , so that inverse - square light intensity losses are minimized . moreover , a lens is preferably used in conjunction with the sensor to gather scattered light from throughout the detection zone while minimizing visibility of chamber wall surfaces as a result of focusing . control irises are used to further minimize stray light reaching the sensor . through the combination of all these methods the system sensitivity is on the order of 0 . 01 to 0 . 1 %/ m equivalent smoke obscuration . it should be noted that the ability to utilize a broad projector beam enables the use of laser diodes without costly collimation optics . in one preferred embodiment of the invention , each light source is pulsed in sequence for a short period such as 10 ms . at the sensor , a signal is generated in response to each pulse of scattered light at each wavelength . the system is pre - calibrated to account for the sensitivity of the sensor at each wavelength , preferably by adjusting the intensity of the led projections during manufacture . the signals are amplified using digital filtering to improve the signal - to noise ratio , and both the absolute and relative amplitudes of the pulse signals are stored . the absolute value indicates the particle concentration whereas the relative value indicates the particle size or the average size of a group of particles . from rayleigh theory , at a given mass concentration of airborne particles , the long wavelength light will produce a low amplitude signal in the case of small particles , or a large amplitude signal in the case of large particles . the short wavelength light will produce a relatively equal amplitude signal in the case of both small and large particles . by comparing the ratio of the signals it is therefore possible to determine whether the particles are large or small . signals produced over a period of time are analyzed according to trend . a slow increase in the concentration of large particles is indicative of pyrolysis and eventually a smoldering condition . alternatively , a rapid increase in small particles is indicative of a fast flaming fire and , in the absence of a prior period of pyrolysis and smoldering , could indicate the involvement of accelerants ( such as with arson ). this information is used to produce separate alarm outputs in the case of smoldering and flaming fires , or alternatively , to reduce the alarm activation threshold ( i . e ., provide earlier warning ) in the case of flaming fires ( which are more dangerous ). it should be noted that the concentration of smoke alone , does not necessarily indicate the level of danger of an incipient fire . the concentration detected will depend upon the degree of smoke dilution by fresh air , and the proximity of the incipient fire to the detector . by characterizing the smoke in accordance with our invention it becomes possible to determine the level of smoke concentration necessary for an alarm , that is appropriate to the protected environment , thereby providing early warning with minimum false alarms . moreover , the low cost of the system encourages its comprehensive use throughout a facility . in a further embodiment of the invention , particle size discrimination is used to determine the airborne dust content for the purpose of avoiding false alarms or for dust level monitoring within the protected environment . two led &# 39 ; s may be used , but by the use of additional led &# 39 ; s it is possible to discriminate within differing particle size ranges . preferred embodiments of the present invention will now be described with reference to the accompanying drawings . in one embodiment of the invention , and referring to fig1 , the smoke detector housing 10 is produced by the molding of two substantially identical halves 10 a , 10 b ( see fig4 ). two led lamps 11 are positioned to project light across the detection chamber 12 into a region that is viewed by the sensor 13 . smoke 14 is drawn across the chamber 12 in the direction of arrows 15 so that it can be irradiated by the projectors 11 in sequence . some light 16 scattered off the airborne smoke particles is captured by a focusing lens 17 onto the receiving sensor 13 . a series of optical irises 18 confine the spread of the projector beams and another series of irises 19 confine the field of view of the sensor 13 . an absorber gallery 39 / 40 ( light trap ) is provided opposite each projector 11 to absorb essentially all of the remaining essentially unscattered light and thereby prevent any swamping of the scattered light 16 at the sensor 13 by the projected light . a further light trap 20 is provided opposite the sensor to further ensure that essentially no projector light is able to impinge on the sensor . the smoke detector housing 10 preferably incorporates pipework 21 to provide airflow through the detector chamber 12 . this pipework 21 may incorporate a nozzle 22 opposite a collector 23 , to direct the airflow across the chamber 12 , such that the chamber is quickly purged of smoke in the event that the smoke level is reducing . included in the pipework pathway is a dust filter 33 . coupling to the dust filter cavity is by inlet and outlet diffusers 24 , 25 designed to minimize head loss ( pressure drop ) in the airflow through the detector , and to facilitate the use of a large filter 33 for long service life . over a period of years , a small quantity of fine dust may pass through the filter . to prevent or minimize soiling , the arrangement of the nozzle and collector is such as to minimize deposition of dust on the chamber walls and optical surfaces . fig1 b and 1 c illustrate alternative positioning of the light source ( s ) 11 of fig1 a . this has necessitated the re - positioning of the light trap 39 , 40 . in many other respects , the features of fig1 b and 1 e are identical to the illustration of fig1 and the accompanying description . fig1 b and 1 c do not show all the detail of fig1 a , only as a matter of clarity . it is to be noted that fig1 b and 1 c allow for backscatter detection or a combination of back and forward scatter , i . e ., different angles . fig2 illustrates a sectional elevation view taken along line 2 - 2 of the smoke detector body of fig1 . again , many features shown in fig1 a are numbered identically . fig2 indicates the preferred position of the main electronics printed circuit board pcb 1 for efficient and low - interference electrical connection to the projecting light sources and the receiving sensor including its pre - amplifier printed circuit board pcb 2 . conveniently the upper half of the smoke detector body 10 b may be removed without disturbing the connections to pcb 1 for the purposes of setup and maintenance . referring to fig3 , there is shown a cross - sectional view taken along line 3 - 3 of fig1 and showing the gas sample inlet pipework including socket and bends . a cross - sectional view taken on line 4 - 4 of fig1 shows its filter chamber and is represented in fig4 . the filter element is preferably of open - cell foam construction with a relatively large filter pore size such as 0 . 1 mm . this causes dust particles to be arrested progressively throughout the large depth of the element . use of such a large pore size means that smoke particles are not arrested in the filter , even when the filter becomes loaded with dust , which if it occurred would reduce the sensitivity of the detector to smoke . this element is easily removed for cleaning or renewal . in fig5 , there is a sectional view taken long line 5 - 5 of the smoke detector body of fig6 . this indicates how the detector body and the detector housing are secured with screws , and in exploded view shows where the housing may be attached to the duct such as a circular ventilation duct ( which is more challenging than a flat - sided duct ). for example , attachment may be achieved by screws , magnets or adhesive tape . fig6 illustrates a sectional view taken on line 6 - 6 of fig5 of the smoke detector body . fig1 a also shows line 6 - 6 . in fig6 a view of the outer casing , mounted on a pcb pcb 11 , together with a gasket 31 is shown . this particular arrangement is suitable for mounting to a duct , although the present invention should not be limited to only such an application . fig7 is an end view of the inlet / outlet gas port to the smoke detector body showing gasket 31 in plan view . this gasket provides a releasable seal to a duct such as a round ventilation duct of unspecified radius the following description relates to one preferred arrangement of the invention , and with reference to fig8 a , 8 b , 8 c and 9 . it is to be noted that the following description equally applies to the alternative high volume and low volume embodiments shown in fig1 a , 11 b , 12 a to 12 k , and 13 a and 13 b . the same numeral references have been used in the various figures to avoid duplication . the high volume embodiment is used when fluid flow in the duct is relatively high . thus the inlet and outlet openings 28 and 29 , respectively are designed to be smaller , so with a high volume of fluid flow , a smaller sample area is captured and substantially the same volume of fluid to the detector of the present invention . equally , the low volume embodiment is designed with relatively larger openings 28 and 29 , as the fluid flow is lower , a larger opening is provided to present substantially the same amount of fluid flow to the detector of the present invention . the pipework is configured with appropriate bends and sockets suitable for attachment to a probe 26 , which draws smoke from the ventilation duct 27 . the probe 26 is preferably of unit construction containing an inlet port 28 and an outlet port 29 , so that only one penetration hole 30 need be cut into the duct wall to provide access for the probe 26 . this hole is releasably sealed using a closed - cell foam gasket 31 to prevent leakage . fig8 shows a view along line c - c from fig8 b . fig1 a also shows a view along line c - c of fig1 c and 12 h . fig8 a shows a view along line d - d of fig8 . fig1 b shows a view along line d - d of fig1 a for the high volume embodiment . fig1 g shows a view along line d - d of fig1 a for the low volume embodiment . fig8 b shows a sectional view along line e - e of fig8 indicating that it comprises a stem with a detachable head . fig1 c and 12 h show , respectively , high volume and low volume embodiments of the probe viewed along line e - e of fig1 a . p fig8 c shows a view along line f - f . fig1 e and 12 j show plan views of the , respective , high volume and low volume probes . fig1 d and 12 l show sectional views of the heads of the , respective high and low volume probes . the probe 26 is suitable for being inserted into a duct by requiring only a single round penetration of the duct . the probe is inserted so that its inlet faces upstream and its outlet faces downstream . the probe is designed to provide an adequate airflow rate through the detection chamber 12 , driven by the dynamic head associated with the airflow in the ventilation duct 27 . this dynamic head produces a pressure drop across the inlet port 28 and outlet port 29 of the probe 26 , sufficient to overcome the combined restriction of the detection chamber 12 , pipework 21 and dust filter 33 . the efficiency of the probe is maximized by the use of rounding of the inlet orifice followed by a bend to change the direction of the sampled flow with minimum loss . this is repeated at the outlet . the inlet and outlet bends are incorporated without any requirement to enlarge the duct penetration . this high efficiency enables the use of an effective dust filter to ensure a long service interval for the product , such as 10 years in a typical office environment . given such a long interval , it is considered appropriate ( but not essential ) that the detector body 10 can be easily dismantled for cleaning and re - calibration , avoiding the need for a removable filter cartridge that is costly and difficult to make airtight . the high efficiency of the probe also facilitates its use in ventilation ducts operating at relatively low air velocity such as 4 m / sec . for use at low ventilation duct velocities , an alternative probe head is provided . this uses an enlarged air scoop design which incorporates a diffuser to efficiently accelerate the inlet air and ensure that the detector &# 39 ; s rapid response to smoke is maintained . in a preferred embodiment of the invention , with reference to fig8 b and 9 , the probe 26 is constructed with an elliptical or similar cross - section that will minimize drag ( to minimize restriction to flow in the ventilation duct ), as well as minimizing forced vibration at the strouhal frequency caused by the duct flow . in the particular embodiment illustrated by fig8 b and 9 , the aerodynamic coefficient of drag is reduced by a factor of ten compared with a pair of round pipes of similar dimensions . fig1 b to 12 k show similar features , but in respect of the high and low volume probes . the advantages of using an elliptical shape instead of an aerofoil are that the probe may be installed in either direction , and that the overall width of the probe is reduced , without unduly compromising the reduction in drag . by the addition of further stem sections , the probe 26 may be extended in length to meet the needs of different sized ductwork , ensuring adequate flow without the need of an aspirator . the pressure inside the duct 27 can be significantly different from the ambient atmosphere outside the duct ( where the detector is usually mounted ). in a preferred embodiment of the invention best shown in fig1 and 6 , the halves of the chamber are releasably joined in an airtight manner by means of only one continuous o - ring seal 34 . this sets the detector chamber internal pressure to approximate that of the ventilation duct and avoids any leakage to or from ambient atmosphere . leakage into the detector could cause an unwanted alarm from smoke in the ambient environment . leakage of smoke from the detector to the ambient environment could cause an unwanted alarm in other smoke detection equipment protecting that environment . alternatively , with reference to fig1 if a relatively small duct or pipe is used such that the probe in inappropriate , then this duct may be configured to produce a venturi which develops the necessary pressure drop to ensure an adequate flow rate through the detector chamber , filter and pipework . again only a small proportion of the smoke need be passed through the detector and this proportion is minimized in order to minimize the rate of detector soiling and filter loading , thereby to maximize the service interval .	6
generally speaking , the invention features a transaction printer that encodes and reads micr indicia at a point - of - sale . a sensor is provided in the micr encoding portion of the printer to detect the edge of the check and allow precise registration of the edge for subsequent printing of the micr characters . the sensor also provides check location information to the printer control electronics for various other operations required in the encode print sequence or other printer functions . referring to fig1 a check processing apparatus 10 is shown . a check ( not shown ) is inserted into the check processing apparatus 10 at point a with a face down orientation . the check is fed into the apparatus 10 , along the check feed path 11 . the apparatus 10 is designed to encode the check with micr indicia at the point - of - sale . to provide the micr characters , a micr encoder print head 16 and a micr verifying read head 19 are disposed along feed path 11 . a pressure pad 20 is located above the micr read head 19 . this pressure pad presses the check , or other printed media , against the read head 19 to ensure good contact . a link 22 is connected to the pressure pad 20 through a pivot pin 21 . a slot 12 at the distal end of the link 22 causes the link to be guided by link pin 24 , which is fixedly attached to the end of the print head arm 14 . the print head arm 14 is biased upwardly ( arrow 33 , fig2 ) via spring 18 that is anchored to the housing pin 26 . the pin 24 , which rides in slot 12 , is biased against the upper end of slot 12 by the tension spring 23 that is attached at its other end to pin 25 . the spring 23 provides the contact force for pressure pad 20 , as pin 24 moves away from pin 25 guided by the slot in link 22 . the check , or other media , is driven by feed rollers 27 and 28 , which are part of the point - of - sale printer ( not shown ), which is positioned to the rear of the check processing apparatus 10 . a reflective optical sensor 29 disposed at point a stages the check for the various positions of the micr print mechanism . in the home position 1 , shown in fig1 the cam 6 holds the print head 16 away from the platen 30 by bearing against pin 15 . pressure pad 20 is also held away from the micr read head 19 in the home position , as previously mentioned . therefore , a check or other media can now be inserted into the print zone b of the check processing apparatus 10 . feed rollers 27 and 28 , which are normally separated , are now clamped together to grip the inserted check , and feed it into the main printer unit for validation of account information on the check using a second micr read head ( not shown ). the feed rollers 27 and 28 are rotated by a stepper motor ( not shown ). the check is driven back out ( arrow 32 ) when the account validation operation is complete . the feed rollers 27 and 28 stop feeding the check when the lead edge of the check is detected by the reflective optical sensor 29 at point a . the check is now positioned for printing ( encoding ) of the micr characters in the amount field of the check . referring to fig2 the second position of the check processing apparatus 10 is illustrated . in this position , also known as the micr encode position , cam 6 rotates clockwise ( arrow 34 ), so that there is now clearance between the cam 6 and pin 15 . this allows the print head 16 to press a print ribbon ( not shown ) and the check against platen 30 . a detent spring 7 engages in a suitable notch 6b in the cam , to hold the cam position . the cam 6 and platen 30 are both rotatively fixed upon the power input shaft 1 . the cam 6 or platen 30 are selectively driven by the shaft 1 , when the shaft 1 rotates either clockwise ( arrow 34 ) to drive cam 6 , or counter - clockwise ( arrow 36 , fig2 ) to drive the platen 30 . this is accomplished by a bi - directional clutch mechanism 50 disposed within the cam 6 , as is explained hereinafter with reference to fig4 a , 4b , and 5 . shaft 1 is driven in the counter - clockwise direction 36 , in order to drive the platen 30 in the same direction . the edge of the check is detected by the reflective optical sensor 29 at point a . this commands the control electronics of the check processing apparatus 10 to start energizing the heater elements on the print head 16 , which melts and transfers a wax - based ink from the ribbon to the check , thereby forming the micr characters . it should be noted that feed rollers 27 and 28 are disengaged ( opened ) before platen 30 starts rotating . pressure pad 20 and micr read head 19 are also held apart . referring to fig3 the third position of apparatus 10 is shown . in this position , the micr indicia printed upon the check are read . feed rollers 27 and 28 are clamped together and grip the check after the micr indicia has been printed . power input shaft 1 rotates clockwise and drives the cam 6 half - way to its high point . in this position , there is clearance between the print head 16 and platen 30 , and also between pressure pad 20 and the micr read head 19 . the check is then driven back out of the apparatus 10 , where it is detected by the reflective optical sensor 29 , which stops the feed rollers 27 and 28 . shaft 1 continues rotating clockwise and drives cam 6 to its high point against pin 15 , and stops . this allows pressure pad 20 to contact and press the check against the micr read head 19 . feed rollers 27 and 28 then drive the check past the micr read head 19 , which verifies the printed micr characters . cam 6 is then rotated clockwise back to position 1 , so that there is again clearance between print head 16 and platen 30 , and pressure pad 20 and the micr read head 19 . feed rollers 27 and 28 then drive the check back out of the check processing apparatus 10 , and present it to the operator . feed rollers 27 and 28 open to allow removal of the check . the mechanism is now back at the home position ( fig1 ), and is now ready for another point - of - sale transaction . it can be observed that the optical sensor 29 plays a very important role in the processing of micr imprinting and reading . the amount field must be precisely and accurately ascertained for both operations . sensing the leading edge of the check precisely locates the amount field upon the check being processed . it then becomes a simple matter to advance the check by a stepper drive and print motor a fixed number of step increments in order to start the printing or read sequences . now referring to fig4 a and 4b , respective frontal cut - away and side views are shown of the bi - directional clutch 50 , which drives cam 6 and platen 30 . a drive dog 2 is fixedly coupled to the input shaft 1 via set screws 3 . a drive pawl 4 is pivotally attached to the drive dog 2 via pivot pin 5 . the pawl tooth 4a ramps away from the angular detent surface of notch 8a disposed in clutch surface 8 , when the shaft 1 is rotated in the clockwise direction ( arrow 34 , fig2 ). the tooth 4a then engages in notch 6a disposed on cam 6 . the cam 6 is normally held in position by leaf spring 7 , which engages detent notch 6b . as the drive dog 2 continues to rotate in the clockwise direction ( arrow 34 ), the detent force of leaf spring 7 is overcome , and the cam 6 rotates to the micr encode position shown in fig2 . the pawl tooth 4b ramps away from the angular detent surface 6a in cam 6 , when the shaft 1 rotates in the counterclockwise direction ( arrow 36 , fig2 ). the leaf spring 9 normally disposed in the detent 8b of the clutch surface 8 , and which holds same in position , is overcome by the counter - rotative force , allowing the check processing apparatus 10 to achieve the micr read position , shown in fig3 . the clutch 50 is driven by a stepper motor 40 , whose shaft 1 supports platen 30 via bearings 41 , shown in fig4 b . an arm 42 attached to shaft 1 passes through an optical sensor 43 , as shown . the optical sensor 43 detects a home position of stepper motor 40 , and hence the position of the cam 6 . referring to fig5 an exploded , perspective view of the actual check processing apparatus 10 , is shown . a cassette 70 contains a roll 71 of thermal ribbon 72 . the ribbon 72 is moved across the stage 73 of cassette 70 , as the roll 71 is rotated by shaft 1 . the ribbon 72 is threaded through the printing stage 74 . the platen 30 , which is influenced by the bi - directional clutch 50 , acts to control the encoding of micr indicia by forcing the ribbon 32 into contact with the printing head 16 . the read head 19 comes into contact with the pad 20 via a pivot arm 75 that pivots about pivot 76 . the pivot arm 75 has a finger 77 that rests in detent 8b . movement of the bi - directional clutch 50 to the micr read position forces the arm 75 to pivot , causing the read head 19 to come into contact with pad 20 . the pivot arm 75 is biased against contact with pad 20 by leaf spring 78 . since other modifications and changes varied to fit particular operating requirements and environments will be apparent to those skilled in the art , the invention is not considered limited to the example chosen for purposes of disclosure , and covers all changes and modifications which do not constitute departures from the true spirit and scope of this invention . having thus described the invention , what is desired to be protected by letters patent is presented in the subsequently appended claims .	6
the embodiments below explain the invention more specifically . however , it should be construed that such embodiments are only for explaining the invention by examples , instead of limiting the scope of the invention in any forms . the steps are : add diethyl methylmalonate and anhydrous dmf into a reaction flask , stir well , t = 40 , add nah , after 1 - hour consecutive reaction dip the dmf solution of 3 -( 1 - bromopropyl ) anisole while stirring , stir at 85 for 18 hours , track that the reaction is substantially completed by tlc ( developer : petroleum ether / ethyl acetate ( 8 : 1 )), pour the reaction product in the water , perform extraction by ethyl acetate until the water layer is not fluorescent , wash the organic layer twice by water without drying to obtain a yellow oily product after decompression and concentration , i . e ., diethyl 2 -( 3 - methoxphenyl ) propylmalonate . molecular formula : c 18 h 26 o 5 , molecular weight : 322 . 4 , ms ( m / z ): 322 . elementary analysis : theoretical values : c : 67 . 06 %, h : 8 . 13 %; measured values : c : 67 . 16 %, h : 8 . 19 %. the steps are : add diethyl 2 -( 3 - methoxphenyl ) propylmalonate , ethanol and water into a reaction flask , adjust the ph value to 14 by sodium hydroxide after stirring them well , perform heating reflux reaction , track the reaction by tlc , keep the ph value of the solution at 14 , ( developer : petroleum ether / ethyl acetate ( 4 : 1 )), distil ethanol by decompression , and perform extraction twice by ethyl acetate to separate an organic layer out ; adjust the ph value of the water layer to 2 to 3 by an acid , perform extraction by ethyl acetate , separate organic layers out , combine the organic layers , and perform drying by anhydrous magnesium sulphate to obtain a yellow oily product after decompression and concentration ; add the yellow oily production in a three - neck flask , reflux and heat it in an oil bath of 15 for 5 hours , pour the resultant into the sodium hydroxide solution to make the ph become alkaline , and exact the undissolved substance by ethyl acetate ; and adjust the ph of the water layer to 3 by hydrochloric acid , perform extraction by ethyl acetate , and distil a solvent out after drying and decompression to obtain a yellow liquid , i . e ., 2 - methyl - 3 -( 3 - methoxyphenyl ) valeric acid . molecular formula : c 13 h 18 o 3 , molecular weight : 222 . 3 , ms ( m / z ): 223 ( m + + h ). elementary analysis : theoretical values : c : 70 . 24 %, h : 8 . 16 %; measured values : c : 70 . 32 %, h : 8 . 09 %. δ : 7 . 09 ( t , j = 8 . 5 hz , 1h , ar — h ), 6 . 77 ( d , j = 8 . 5 hz , 2h , ar — h ), 6 . 77 ( d , j = 8 . 5 hz , 1h , ar — h ), 3 . 90 ( s , 3h , — och 3 ), 3 . 10 ( m , 1h , ar — ch ), 2 . 90 ( m , 1h , ar — ch — ch — cooh ), 1 . 62 ( m , 2h ), 1 . 19 ( d , j = 6 . 5 hz , 3h ), 0 . 73 ( d , j = 6 . 0 hz , 3h ); 13 c - nmr ( cdcl 3 , 125 mhz ) δ : 176 . 0 , 160 . 1 , 139 . 6 , 127 . 3 , 123 . 1 , 116 . 3 , 113 . 1 , 60 . 3 , 56 . 8 , 55 . 8 , 44 . 5 , 26 . 5 , 14 . 3 , 11 . 2 . the steps are : add 2 - methyl - 3 -( 3 - methoxyphenyl ) valeric acid into a reaction flask , add hydroiodic acid , and perform heating and reflux for 12 hours ; detect the reaction process by tlc ; after that , cool the resultant to the room temperature , pour it into an alkaline solution to make the ph become 9 , perform extraction by ethyl acetate , reversely adjust the ph of the water layer to about 3 . 0 after the water layer is separated out , and add ethyl acetate for extraction ; and dry the ethyl acetate extracting solution by anhydrous magnesium sulphate , and recycle the solvent by decompression to obtain a light yellow liquid , 2 - methyl - 3 -( 3 - hydroxyphenyl ) valeric acid . molecular formula : c 18 h 26 o 5 , molecular weight : 208 . 3 , ms ( m / z ): 209 ( m + + h ). elementary analysis : theoretical values : c : 69 . 21 %, h : 7 . 74 %; measured values : c : 65 . 35 %, h : 7 . 56 %. the steps are : add 2 - methyl - 3 -( 3 - hydroxyphenyl ) valeric acid into a three - neck flask , add thionyl chloride , perform reflux for 4 hours , detect that the reaction is substantially completed by tlc , ( developer : petroleum ether / ethyl acetate ( 4 : 1 )); and distil a solvent by decompression to obtain valeryl 2 - methyl - 3 -( 3 - methoxyphenyl ) chloride ( compound 1 ). molecular formula : c 13 h 17 clo 2 , molecular weight : 240 . 7 , ms ( m / z ): 240 ( m + ). elementary analysis : theoretical values : c : 64 . 86 %, h : 7 . 12 %; measured values : c : 65 . 02 %, h : 7 . 24 %. the steps are : add compound 1 and methanol into a three - neck flask , perform reflux for 5 hours , detect that the reaction is substantially completed by tlc , distil a solvent by decompression to obtain a light yellow oily product , valeryl 2 - methyl - 3 -( 3 - methoxyphenyl ) chloride ( compound 2 ). molecular formula : c 14 h 20 o 3 , molecular weight : 236 . 3 , ms ( m / z ): 236 ( m + ). elementary analysis : theoretical values : c : 71 . 16 %, h : 8 . 53 %; measured values : c : 71 . 09 %, h : 8 . 39 %. the step are : add the aqueous solution of dimethylamine ( 33 %) into a three - neck flask , t = 10 , dip compound 1 and naoh to make ph = 12 to 14 ; after that , keep performing the reaction at the room temperature for 2 hours ; perform extraction twice by ethyl acetate , prepare the organic phase , rinse twice by 10 % hydrochloric acid , and perform drying by anhydrous magnesium sulfate ; recycle the solvent by decompression to obtain a light yellow oily product which is dissolved by isopropanol ; and add a seed crystal to obtain a white solid , n , n - dimethyl - 2 - methyl - 3 -( 3 - methoxyphenyl ) valeramide ( compound 7 ). molecular formula : c 15 h 23 no 2 , molecular weight : 249 . 4 , ms ( m / z ): 249 ( m + ). elementary analysis : theoretical values : c : 72 . 25 %, h : 9 . 30 %, n : 5 . 62 %; measured values : c : 72 . 31 %, h : 9 . 35 %, n : 5 . 73 %. the steps are : add compound 7 into a reaction flask , add hydroiodic acid , perform heating and reflux for 5 hours ; detect the reaction process by tlc ; after that , cool the resultant to the room temperature , pour it to an alkaline solution to make the ph become 9 , and perform extraction by ethyl acetate and rinse by water ; and recycle the solvent after drying and decompression to obtain a light yellow liquid , n , n - dimethyl - 2 - methyl - 3 -( 3 - hydroxyphenyl ) valeramide ( compound 9 ). molecular formula : c 14 h 21 no 2 , molecular weight : 235 . 3 , ms ( m / z ): 235 ( m + ). elementary analysis : theoretical values : c : 71 . 46 %, h : 8 . 99 %, n : 5 . 95 %; measured values : c : 71 . 33 %, h : 9 . 05 %, n : 5 . 92 %. 1 h - nmr ( cdcl 3 , 500 mhz ) δ : 7 . 11 ( t , j = 8 . 0 hz , 1h , ar — h ), 6 . 74 ( d , j = 8 . 0 hz , 2h , ar — h ), 6 . 62 ( d , j = 8 . 0 hz , 1h , ar — h ), 3 . 03 ( m , 2h , ar — ch , ar — ch — ch — cooh ), 2 . 86 ( s , 6h , n ( ch 3 ) 2 ), 1 . 66 ( m , 2h ), 1 . 12 ( d , j = 6 . 5 hz , 3h ), 0 . 75 ( d , j = 6 . 0 hz , 3h ); 13 c - nmr ( cdcl 3 , 125 mhz ) δ : 176 . 0 , 158 . 3 , 140 . 6 , 129 . 3 , 121 . 8 , 114 . 9 , 113 . 6 , 59 . 2 , 42 . 7 , 39 . 4 , 26 . 5 , 15 . 2 , 11 . 1 . compound 11 can be obtained by replacing dimethylamine in embodiment 6 with diethylamine . molecular formula : c 17 h 27 no 2 , molecular weight : 277 . 4 , ms ( m / z ): 277 ( m + ). elementary analysis : theoretical values : c : 73 . 61 %, h : 9 . 81 %, n : 5 . 05 %; measured values : c : 73 . 43 %, h : 9 . 75 %, n : 5 . 09 %. compound 12 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with dipropylamine . molecular formula : c 19 h 31 no 2 , molecular weight : 305 . 5 , ms ( m / z ): 305 ( m + ). elementary analysis : theoretical values : c : 74 . 71 %, h : 10 . 23 %, n : 4 . 59 %; measured values : c : 74 . 68 %, h : 10 . 21 %, n : 4 . 61 %. compound 13 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with diisopropylamine . molecular formula : c 19 h 31 no 2 , molecular weight : 305 . 5 , ms ( m / z ): 305 ( m + ). elementary analysis : theoretical values : c : 74 . 71 %, h : 10 . 23 %, n : 4 . 59 %; measured values : c : 74 . 74 %, h : 10 . 30 %, n : 4 . 56 %. compound 14 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with piperidine . molecular formula : c 18 h 27 no 2 , molecular weight : 289 . 4 , ms ( m / z ): 289 ( m + ). elementary analysis : theoretical values : c : 74 . 70 %, h : 9 . 40 %, n : 4 . 84 %; measured values : c : 74 . 79 %, h : 9 . 35 %, n : 4 . 77 %. compound 15 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with 4 - methylpiperidine . molecular formula : c 19 h 29 no 2 , molecular weight : 303 . 45 , ms ( m / z ): 304 ( m + + 1 ). elementary analysis : theoretical values : c : 75 . 21 %, h : 9 . 63 %, n : 4 . 62 %; measured values : c : 75 . 19 %, h : 9 . 57 %, n : 4 . 76 %. compound 16 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with morpholine . molecular formula : c 17 h 25 no3 , molecular weight : 291 . 39 , ms ( m / z ): 291 ( m + ). elementary analysis : theoretical values : c : 70 . 07 %, h : 8 . 65 %, n : 4 . 81 %; measured values : c : 70 . 11 %, h : 8 . 57 %, n : 4 . 79 %. compound 17 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 6 with pyrrolidine . molecular formula : c 17 h 25 no 2 , molecular weight : 275 . 39 , ms ( m / z ): 275 ( m + ). elementary analysis : theoretical values : c : 74 . 14 %, h : 9 . 15 %, n : 5 . 09 %; measured values : c : 74 . 12 %, h : 9 . 17 %, n : 4 . 98 %. compound 18 can be obtained according to the operation of the method by replacing 3 -( 1 - bromopropyl ) anisole in embodiment 1 with 3 -( 1 - bromopropyl ) chlorobenzene . molecular formula : c 14 h 20 clno , molecular weight : 253 . 77 , ms ( m / z ): 253 ( m + ). elementary analysis : theoretical values : c : 66 . 26 %, h : 7 . 94 %, n : 5 . 52 %; measured values : c : 66 . 32 %, h : 8 . 05 %, n : 5 . 56 %. compound 19 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with diethylamine . molecular formula : c 16 h 24 clno , molecular weight : 281 . 83 , ms ( m / z ): 281 ( m + ). elementary analysis : theoretical values : c : 68 . 19 %, h : 8 . 58 %, n : 4 . 97 %; measured values : c : 68 . 22 %, h : 8 . 65 %, n : 4 . 86 %. compound 20 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with dipropylamine . molecular formula : c 18 h 28 clno , molecular weight : 309 . 88 , ms ( m / z ): 309 ( m + ). elementary analysis : theoretical values : c : 69 . 77 %, h : 9 . 11 %, n : 4 . 52 %; measured values : c : 69 . 83 %, h : 9 . 21 %, n : 4 . 56 %. compound 21 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with isopropylamine . molecular formula : c 17 h 24 clno , molecular weight : 293 . 84 , ms ( m / z ): 294 ( m + ). elementary analysis : theoretical values : c : 69 . 77 %, h : 9 . 11 %, n : 4 . 52 %; measured values : c : 69 . 84 %, h : 9 . 23 %, n : 4 . 59 %. compound 22 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with piperidine . molecular formula : c 17 h 24 clno , molecular weight : 293 . 84 , ms ( m / z ): 294 ( m + ). elementary analysis : theoretical values : c : 69 . 49 %, h : 8 . 23 %, n : 12 . 07 %; measured values : c : 69 . 44 %, h : 8 . 31 %, n : 4 . 75 %. compound 23 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with 4 - methylpiperidine . molecular formula : c 18 h 26 clno , molecular weight : 307 . 87 , ms ( m / z ): 307 ( m + ). elementary analysis : theoretical values : c : 70 . 23 %, h : 8 . 51 %, n : 4 . 55 %; measured values : c : 70 . 22 %, h : 8 . 65 %, n : 4 . 62 %. compound 24 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with morpholine . molecular formula : c 18 h 26 clno , molecular weight : 307 . 87 , ms ( m / z ): 307 ( m + ). elementary analysis : theoretical values : c : 64 . 97 %, h : 7 . 50 %, n : 4 . 73 %; measured values : c : 65 . 02 %, h : 7 . 55 %, n : 4 . 68 %. compound 25 can be obtained according to the operation of the method by replacing dimethylamine in embodiment 12 with pyrrolidine . molecular formula : c 16 h 22 clno , molecular weight : 279 . 81 , ms ( m / z ): 279 ( m + ). elementary analysis : theoretical values : c : 68 . 68 %, h : 7 . 93 %, n : 5 . 01 %; measured values : c : 68 . 70 %, h : 7 . 02 %, n : 5 . 12 %. the steps are : add anhydrous ether into a reaction flask , and add lithium aluminum hydride under the condition of ice bath ; dip compound 7 , control the temperature within 10 , after the dipping detect the reaction process by tlc ; after the reaction is ended , pour the reaction liquid in the ice water slowly , separate the ether layer out , rinse by water , perform drying , and recycle the solvent by decompression to obtain a light yellow liquid , 3 -( 3 - methoxy - phenyl )- n , n , 2 - trimethyl pentylamine . yield : 85 %. molecular formula : c 15 h 25 no , molecular weight : 235 . 4 , ms ( m / z ): 235 ( m + ). the steps are : add 3 -( 3 - methoxy - phenyl )- n , n , 2 - trimethyl pentylamine into a reaction flask , add hydroiodic acid , and perform heating and reflux for 5 hours ; detect the reaction process by tlc ; after that , cool the resultant to the room temperature , pour it to an alkaline solution to make the ph become 9 , perform extraction by ethyl acetate and rinse by water ; recycle the solvent by drying and decompression to obtain a light yellow liquid , 3 -( 3 - hydroxy - phenyl )- n , n , 2 - trimethyl pentylamine ; and separate the mother solution by a separator , form the salt by the acidification of hydrochloric acid to obtain tapentadol hydrochloride . hplc : 99 . 56 %, ee %& gt ; 99 . 5 %. molecular formula : c 14 h 23 no . hcl , molecular weight : 257 . 8 , ms ( m / z ): 221 ( m + - hcl ). elementary analysis : theoretical values : c : 65 . 23 %, h : 9 . 38 %, n : 5 . 43 %; measured values : c : 65 . 31 %, h : 9 . 35 %, n : 5 . 31 %. 1 h - nmr ( d 2 o , 500 mhz ) δ : 7 . 15 ( t , j = 8 . 0 hz , 1h , ar — h ), 6 . 69 ( dd , j = 8 . 0 hz , 2h , ar — h ), 6 . 65 ( d , j = 8 . 0 hz , 1h , ar — h ), 2 . 71 ( m , 2h , — ch 2 ), 2 . 62 ( s , 6h , n ( ch 3 ) 2 ), 2 . 20 ( m , 1h , — ch — ch 3 ), 2 . 04 ( m , 1h , — ch —), 1 . 73 , 1 . 42 ( m , 2h , — ch 2 ch 3 ), 0 . 96 ( d , 3h , — chch 3 ), 0 . 54 ( t , 3h , — ch 2 ch 3 ). 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - diethyl pentylamine can be obtained by compound 11 according to embodiment 23 . molecular formula : c 17 h 29 no , molecular weight : 263 . 4 , ms ( m / z ): 264 ( m + + h ). elementary analysis : theoretical values : c : 77 . 51 %, h : 11 . 09 %, n : 5 . 31 %; measured values : c : 77 . 39 %, h : 11 . 15 %, n : 5 . 42 %. ( 1r , 2r )- 3 -( 3 - diethylamine - 1 - ethyl - 2 - methylpropyl )- phenol hydrochloride can be obtained by 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - diethyl pentylamine according to embodiment 24 . molecular formula : c 16 h 27 no . hcl , molecular weight : 285 . 8 , ms ( m / z ): 249 ( m + - hcl ). elementary analysis : theoretical values : c : 71 . 21 %, h : 10 . 46 %, n : 5 . 19 %; measured values : c : 71 . 11 %, h : 10 . 35 %, n : 5 . 21 %. 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - dipropyl pentylamine can be obtained by compound 12 according to embodiment 23 . molecular formula : c 19 h 33 no , molecular weight : 291 . 5 , ms ( m / z ): 290 ( m + - h ). elementary analysis : theoretical values : c : 78 . 29 %, h : 11 . 41 %, n : 4 . 81 %; measured values : c : 78 . 33 %, h : 11 . 52 %, n : 4 . 76 %. ( 1r , 2r )- 3 -( 3 - dipropylamine - 1 - ethyl - 2 - methylpropyl )- phenol hydrochloride can be obtained by 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - dipropyl pentylamine according to embodiment 24 . molecular formula : c 18 h 31 no . hcl , molecular weight : 313 . 9 , ms ( m / z ): 277 ( m + - hcl ). elementary analysis : theoretical values : c : 68 . 87 %, h : 10 . 28 %, n : 4 . 46 %; measured values : c : 68 . 74 %, h : 10 . 33 %, n : 4 . 36 %. 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - isopropyl pentylamine can be obtained by compound 13 according to embodiment 23 . molecular formula : c 19 h 33 no , molecular weight : 291 . 5 , ms ( m / z ): 290 ( m + - h ). elementary analysis : theoretical values : c : 78 . 29 %, h : 11 . 41 %, n : 4 . 81 %; measured values : c : 78 . 33 %, h : 11 . 52 %, n : 4 . 76 %. ( 1r , 2r )- 3 -( 3 - isopropylamine - 1 - ethyl - 2 - methylpropyl )- phenol hydrochloride can be obtained by 3 -( 3 - methoxy - phenyl )- 2 - methyl - n , n - dipropyl pentylamine according to embodiment 24 . molecular formula : c 18 h 31 no . hcl , molecular weight : 313 . 9 , ms ( m / z ): 277 ( m + - hcl ). elementary analysis : theoretical values : c : 68 . 87 %, h : 10 . 28 %, n : 4 . 46 %; measured values : c : 68 . 74 %, h : 10 . 33 %, n : 4 . 36 %. 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- piperidine can be obtained by compound 14 according to embodiment 23 . molecular formula : c 18 h 29 no , molecular weight : 275 . 4 , ms ( m / z ): 275 ( m + ). elementary analysis : theoretical values : c : 78 . 49 %, h : 10 . 61 %, n : 5 . 09 %; measured values : c : 78 . 42 %, h : 10 . 55 %, n : 5 . 21 %. ( 1r , 2r )- 3 -( 1 - ethyl - 2 - methyl - 3 - piperidin - 1 - yl - propyl )- phenol hydrochloride can be obtained by 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- piperidine according to embodiment 24 . molecular formula : c 17 h 27 no . hcl , molecular weight : 297 . 9 , ms ( m / z ): 261 ( m + - hcl ). elementary analysis : theoretical values : c : 72 . 44 %, h : 10 . 01 %, n : 4 . 97 %; measured values : c : 72 . 36 %, h : 10 . 15 %, n : 5 . 02 %. 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- 4 - methyl - piperidine can be obtained by compound 15 according to embodiment 23 . molecular formula : c 19 h 33 no , molecular weight : 291 . 5 , ms ( m / z ): 291 ( m + ). elementary analysis : theoretical values : c : 78 . 29 %, h : 11 . 41 %, n : 4 . 80 %; measured values : c : 78 . 31 %, h : 11 . 35 %, n : 4 . 82 %. ( 1r , 2r )- 3 -[ 1 - ethyl - 2 - methyl - 3 -( 4 - methyl - piperidin - 1 - yl )- propyl ]- phenol hydrochloride can be obtained by 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- 4 - methyl - piperidine according to embodiment 24 . molecular formula : c 18 h 29 no . hcl , molecular weight : 311 . 89 , ms ( m / z ): 275 ( m + - hcl ). elementary analysis : theoretical values : c : 69 . 31 %, h : 9 . 70 %, n : 4 . 49 %; measured values : c : 69 . 42 %, h : 9 . 72 %, n : 4 . 46 %. 4 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- morpholine can be obtained by compound 16 according to embodiment 23 . molecular formula : c 17 h 27 no 2 , molecular weight : 277 . 4 , ms ( m / z ): 277 ( m + ). elementary analysis : theoretical values : c : 73 . 60 %, h : 9 . 81 %, n : 5 . 05 %; measured values : c : 73 . 71 %, h : 9 . 85 %, n : 5 . 01 %. ( 1r , 2r )- 3 -( 1 - ethyl - 2 - methyl - 3 - morpholin - 4 - yl - propyl )- phenol hydrochloride can be obtained by 4 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- morpholine according to embodiment 24 . molecular formula : c 16 h 27 no 2 . hcl , molecular weight : 299 . 8 , ms ( m / z ): 263 ( m + - hcl ). elementary analysis : theoretical values : c : 64 . 09 %, h : 8 . 74 %, n : 4 . 67 %; measured values : c : 64 . 12 %, h : 9 . 79 %, n : 4 . 71 %. 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- pyrrolidine can be obtained by compound 17 according to embodiment 23 . molecular formula : c 17 h 27 no , molecular weight : 261 . 4 , ms ( m / z ): 261 ( m + ). elementary analysis : theoretical values : c : 78 . 11 %, h : 10 . 41 %, n : 5 . 35 %; measured values : c : 78 . 24 %, h : 10 . 35 %, n : 5 . 29 %. ( 1r , 2r )- 3 -( 1 - ethyl - 2 - methyl - 3 - pyrrolidin - 1 - yl - propyl )- phenol hydrochloride can be obtained by 1 -[ 3 -( 3 - methoxyphenyl )- 2 - methyl - pentalkyl ]- pyrrolidine according to embodiment 24 . molecular formula : c 14 h 23 no . hcl , molecular weight : 283 . 8 , ms ( m / z ): 247 ( m + - hcl ). elementary analysis : theoretical values : c : 67 . 70 %, h : 9 . 23 %, n : 5 . 64 %; measured values : c : 67 . 76 %, h : 9 . 31 %, n : 5 . 59 %. the steps are : under the condition of ice bath , add methanol and 3 -( 3 - methoxyphenyl )- 2 - pentanol into a reaction flask , stir , introduce n 2 , after the system is reduced about 0 add 96 % sodium borohydride for four times , keep performing the reaction at the temperature for 30 minutes , track that the reaction is substantially completed by tlc , distil the solvent by decompression , pour the reaction product in the water , and perform extraction by ethyl acetate and drying by anhydrous magnesium sulfate to obtain 3 -( 3 - methoxyphenyl )- 2 - pentanol after decompression and concentration , yield : 99 %. molecular formula : c 12 h 18 o2 , molecular weight : 194 . 3 , ms ( m / z ): 195 ( m + + h ). elementary analysis : theoretical values : c : 74 . 19 %, h : 9 . 34 %; measured values : c : 74 . 22 %, h : 9 . 32 %. the steps are : under the protection of n 2 , add 3 -( 3 - methoxyphenyl )- 2 - pentanol and dichloromethane into a reaction flask , lower the temperature to about − 5 by ice bath , dip pbr 3 , keep the temperature , stir at the temperature for 1 hour , track that the reaction is substantially completed by tlc , pour the reaction product in the ice water , perform extraction by dichloromethane , rinse the organic layer by the aqueous solution of sodium bicarbonate and then by water , and perform drying by anhydrous magnesium sulfate to obtain 1 -( 2 - bromopentane )- 3 - methoxybenzene after decompression and concentration , yield : 95 %. molecular formula : c 12 h 17 bro , molecular weight : 256 . 2 , ms ( m / z ): 257 ( m + + h ). elementary analysis : theoretical values : c : 56 . 04 %, h : 6 . 66 %; measured values : c : 56 . 11 %, h : 6 . 62 %. the steps are : add sodium cyanide and dmf into a reaction flask , rise the temperature to 85 , dip the dmf solution of 1 -( 2 - bromopentane )- 3 - methoxybenzene , keep the temperature , stir at the temperature for 8 hours , track that the reaction is substantially completed by tlc , and lower the temperature to the room temperature ; and pour the reaction liquid in the water , perform extraction by ethyl acetate until the water layer is not fluorescent , and rinse the organic layer twice by water without drying to obtain 2 - methyl - 3 -( 3 - methoxyphenyl ) pentanenitrile after decompression and concentration . molecular formula : c 13 h 17 no , molecular weight : 203 . 3 , ms ( m / z ): 204 ( m + + h ). elementary analysis : theoretical values : c : 76 . 81 %, h : 8 . 43 %; measured values : c : 76 . 75 %, h : 8 . 46 %. the invention has been described in connection with the embodiments . it should be construed that the description and embodiments above are only used for explaining the invention by examples . various replacements and improvements of the invention can be made by those skilled in the art within the spirit and scope of the invention and should be construed to be within the protection scope of the invention	2
as a preliminary matter , it will readily be understood by one having ordinary skill in the relevant art (“ ordinary artisan ”) that the present invention has broad utility and application . furthermore , any embodiment discussed and identified as being “ preferred ” is considered to be part of a best mode contemplated for carrying out the present invention . other embodiments also may be discussed for additional illustrative purposes in providing a full and enabling disclosure of the present invention . moreover , many embodiments , such as adaptations , variations , modifications , and equivalent arrangements , will be implicitly disclosed by the embodiments described herein and fall within the scope of the present invention . accordingly , while the present invention is described herein in detail in relation to one or more embodiments , it is to be understood that this disclosure is illustrative and exemplary of the present invention , and is made merely for the purposes of providing a full and enabling disclosure of the present invention . the detailed disclosure herein of one or more embodiments is not intended , nor is to be construed , to limit the scope of patent protection afforded the present invention , which scope is to be defined by the claims and the equivalents thereof . it is not intended that the scope of patent protection afforded the present invention be defined by reading into any claim a limitation found herein that does not explicitly appear in the claim itself . thus , for example , any sequence ( s ) and / or temporal order of steps of various processes or methods that are described herein are illustrative and not restrictive . accordingly , it should be understood that , although steps of various processes or methods may be shown and described as being in a sequence or temporal order , the steps of any such processes or methods are not limited to being carried out in any particular sequence or order , absent an indication otherwise . indeed , the steps in such processes or methods generally may be carried out in various different sequences and orders while still falling within the scope of the present invention . accordingly , it is intended that the scope of patent protection afforded the present invention is to be defined by the appended claims rather than the description set forth herein . additionally , it is important to note that each term used herein refers to that which the ordinary artisan would understand such term to mean based on the contextual use of such term herein . to the extent that the meaning of a term used herein — as understood by the ordinary artisan based on the contextual use of such term — differs in any way from any particular dictionary definition of such term , it is intended that the meaning of the term as understood by the ordinary artisan should prevail . furthermore , it is important to note that , as used herein , “ a ” and “ an ” each generally denotes “ at least one ,” but does not exclude a plurality unless the contextual use dictates otherwise . thus , reference to “ a picnic basket having an apple ” describes “ a picnic basket having at least one apple ” as well as “ a picnic basket having apples .” in contrast , reference to “ a picnic basket having a single apple ” describes “ a picnic basket having only one apple .” when used herein to join a list of items , “ or ” denotes “ at least one of the items ,” but does not exclude a plurality of items of the list . thus , reference to “ a picnic basket having cheese or crackers ” describes “ a picnic basket having cheese without crackers ”, “ a picnic basket having crackers without cheese ”, and “ a picnic basket having both cheese and crackers .” finally , when used herein to join a list of items , “ and ” denotes “ all of the items of the list .” thus , reference to “ a picnic basket having cheese and crackers ” describes “ a picnic basket having cheese , wherein the picnic basket further has crackers ,” as well as describes “ a picnic basket having crackers , wherein the picnic basket further has cheese .” referring now to the drawings and , in particular , fig4 - 6 , one or more preferred embodiments of the present invention are next described . the following description of one or more preferred embodiments is merely exemplary in nature and is in no way intended to limit the invention , its implementations , or uses . in this regard , fig4 is a perspective view of an elbow orthotic 400 in accordance with a preferred embodiment of the present invention , wherein the arm is in an extended position ; and fig5 is a perspective view of the elbow orthotic 400 wherein the arm is in a flexed position . additionally , fig6 is a perspective view of an elbow orthotic 600 in accordance with another preferred embodiment of the present invention that is similar in construction and design to orthotic 400 , but that further includes a padding component 602 as part of the orthotic 600 . in general , an orthotic of the present invention preferably comprises : an upper arm component that is configured to be secured to the upper arm above the elbow ; and a lower arm component that is configured to be secured to the lower arm below the elbow . in particular , the lower arm section is secured to the wrist ; to the wrist and hand ; or to the wrist , hand , and fingers , as shown in fig4 . in the orthotics 400 , 600 , the upper arm section preferably is in the form of a cuff 402 that is approximately 4 to 6 inches in length . as shown in fig4 and 7 , upper cuff 402 may have either a anterior or lateral opening in order to secure the cuff to the user &# 39 ; s upper arm . the cuff is secured to the arm with one or more attachments such as straps , clasps , buckles , or the like . the lower arm component itself comprises forearm - wrist - hand orthotics 404 substantially as shown and described in u . s . pat . no . 7 , 001 , 352 , which is hereby incorporated herein by reference ; however , other designs of the lower arm component are certainly with the scope of the present invention , and the invention is not limited to use only of orthotics 404 of this patent . in accordance with the present invention , upper arm component 402 and lower arm component 404 are connected by one or more elongate members 406 . in contrast to conventional elbow orthotics , the upper and lower arm components are not hinged together . in the illustrated embodiments of fig4 - 6 , the elongate members comprise elastic cords 406 each of which provides a line of tension in the orthotic that tends to bias the upper and lower arm components toward a particular orientation relative to one another . in particular , elastic cord 406 is attached both to upper arm component 402 and to lower arm component 404 . the attachments of elastic cord 406 can be accomplished , for example , using hooks , cleats , cams , clips , and the like . in the embodiment shown in fig4 , cleats 407 and 409 are used . furthermore , an outrigger 408 is attached to the posterior and / or lateral aspects of cuff 402 and can be adjustably mounted in the proximal and / or distal directions via additional attachment openings in the cuff . outrigger 408 serves to guide each elastic cord 406 from cuff 402 to a point located below the apex of the elbow , from which elastic cord 406 extends and is attached to lower arm component 404 . this arrangement assists with pulling the elbow into an extension position . outrigger 408 thus defines a point of tensional redirection that is located below the elbow . in a variation not shown , but which will be apparent to the ordinary artisan over the drawings disclosed and described herein , another attachment to the cuff may be provided that locates the point of tensional redirection above the apex of the elbow in order to assist the elbow into a flexed position . the tensional redirection of an elastic cord is achieved in the preferred embodiment by means of a pulley 410 , i . e ., a freely rotatable wheel mounted at the distal end of the outrigger . fig7 - 16 shows another embodiment where redirection is achieved by a fixed end of outrigger 408 . when using elastic / shock cords to facilitate elbow extension , it is preferred that the cord or cords attach to outrigger 408 on upper component 402 , with a cord ( or more cords if using more than one cord ) passing down outrigger 408 , passing behind and being redirected below the apex of the elbow , and extending and attaching to lower component 404 . the adjustable force generated in various flexed positions will help pull the elbow back into an extension position . in this case , the tension / force mimics the non - functioning muscle ( triceps ) that moves the elbow into extension . it also provides resistance to the weakened non - functioning muscle ( biceps ) that moves the elbow into flexion , thus assisting with strengthening . when using elastic / shock cords to facilitate elbow flexion , it is preferred that the cord or cords attach to a site on the posterior or lateral aspect of upper arm component 402 , with a cord ( or more cords if using more than one cord ) passing above and being redirected above the apex of the elbow , and extending to attach to lower arm component 404 . the adjustable force then generated will help pull the elbow into a flexed position . in this case , the tension / force mimics the non - functioning muscle ( biceps ) that moves the elbow into flexion . it also provides resistance to the weakened non - functioning muscle ( triceps ) that moves the elbow into extension , thus assisting with strengthening . the attachment sites on the lower component may also allow for force / tension adjustments , such as when cleats / cams 407 are used in conjunction with elastic / shock cords ( e . g . when pulling the elastic cord further through the cleat thus increasing the tension / force ). as an alternative to elastic - cord 406 and - pulley 410 , an elongate energy storing material like spring steel or a flex rod may be used as the elongate member for connecting and biasing the upper and lower arm sections toward a particular orientation relative to one another . various energy storing materials may be used , and different forces will be generated depending on the respective physical properties of such materials ( e . g . a ⅛ of an inch diameter elastic / shock cord will offer less force than a 3 / 16 of an inch diameter elastic / shock cord ). outrigger 408 may also incorporate a padding component 602 at the posterior aspect of the elbow , as shown in fig6 . padding component 602 helps maintain the position of upper cuff 402 and lower cuff 404 is moved . still yet , fig7 - 11 are different perspective views of an orthotic 700 in accordance with another preferred embodiment of the invention . this orthotic 700 is similar to orthotic 400 in that it has an upper cuff 702 , lower arm component 704 that attaches to the forearm and hand and further spans the wrist . an outrigger 708 is releasably coupled to upper cuff 702 similar to that in the embodiments shown in fig4 - 6 . elastic cord 706 coupled upper cuff 702 to lower cuff 704 . in contrast , fig1 - 13 are different perspective views of another orthotic 1200 in accordance with a preferred embodiment of the invention , wherein lower arm component 704 attaches only to the forearm . in this embodiment , upper cuff 1202 has two outriggers 1208 that redirect elastic cords 1206 . cords 1206 connect to lower cuff 1204 by cleats 1207 ( only one is shown in the figure ). a pad 1210 is coupled to outrigger 1208 to provide additional upper arm support . as shown in fig1 , pad 1210 is secured to outrigger 1208 by an adjustable spring clamp 1212 . fig1 - 16 illustrate variations of the upper arm component . in fig1 , upper arm component 1400 has conduit guides 1402 that are attached to cuff 1404 by adjustable spring plates 1408 and 1414 and that receive therethrough the elastic cords ( not shown for clarity ). moreover , the elastic cords are guided by bent or curved sections outrigger end sections 1406 located proximate to the end of the conduit guides as shown in fig1 . for reference , upper arm component 1400 of fig1 is utilized in the orthotic 700 of fig7 - 11 . in contrast , fig1 is intended to illustrate an upper arm component 1500 having telescoping conduit guides , in that the bent or curved sections 1506 located at the end of the conduit guides 1502 actually extend within the conduit guides 1502 in frictional fit therewith and may pulled out to lengthen the protraction of the curved sections 1506 from cuff 1504 , whereby the point of tensional redirection can be adjusted and positioned as desired along the direction of the axes of the conduit guides . in the structural design of the upper arm component 1400 , 1500 of fig1 and 15 , the conduit guides are removably attached to the cuff by spring plate 1408 , which includes curved sides 1410 that receive and retain the conduit guides against the cuff but that may be raised so as to release and remove the conduit guides from the cuff . furthermore , as shown , a padding component 1412 is adjustably attached to the conduit guides via a second spring plate 1414 . fig1 illustrates another upper arm component 1600 in accordance with another preferred embodiment thereof . in this embodiment , outriggers 1602 are provided with pulleys 1604 attached at their distal ends . proximal ends of the outriggers ( i . e ., the opposite ends thereof ) include retention members 1606 for receiving and retaining ends of the elastic cords ( not shown for clarity ) that are used to connect the upper and lower components together in an orthotic , which elastic cords are engaged and redirected by the pulleys . outriggers 1602 is secured to the cuff by a mounting member 1608 and the outrigger preferably is adjustable along the axis thereof by sliding frictional engagement through bores formed in mounting member 1608 . a padding component 1610 also is releasably mounted to outriggers 1602 using a spring plate 1612 and , in fig1 , spring plate 1612 and padding component 1610 are actually shown in a disengaged state with padding component 1610 disposed below outriggers 1602 . padding component 1610 is secured to spring plate 1612 using conventional fasteners , such as screws . based on the foregoing description , it will be readily understood by those persons skilled in the art that the present invention is susceptible of broad utility and application . many embodiments and adaptations of the present invention other than those specifically described herein , as well as many variations , modifications , and equivalent arrangements , will be apparent from or reasonably suggested by the present invention and the foregoing descriptions thereof , without departing from the substance or scope of the present invention . accordingly , while the present invention has been described herein in detail in relation to one or more preferred embodiments , it is to be understood that this disclosure is only illustrative and exemplary of the present invention and is made merely for the purpose of providing a full and enabling disclosure of the invention . the foregoing disclosure is not intended to be construed to limit the present invention or otherwise exclude any such other embodiments , adaptations , variations , modifications or equivalent arrangements , the present invention being limited only by the claims appended hereto and the equivalents thereof .	0
the compounds of this invention are useful in the inhibition of farnesyl - protein transferase and the farnesylation of certain proteins . in a first embodiment of this invention , the farnesyl - protein transferase inhibitors are illustrated by the formula i : ## str2 ## wherein : b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o )-- nr 10 --; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , n ( r 10 ) 2 , no 2 , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , r 11 oc ( o ) nr 10 -- and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocycle and c 3 - c 10 cycloalkyl ; or r 3a and r 3b are combined to form --( ch 2 ) s -- wherein one of the carbon atoms is optionally replaced by a moiety selected from : o , s ( o ) m , -- nc ( o )--, and -- n ( cor 10 )--; b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 10 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 -- c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nh --, cn , h 2 n -- c ( nh )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 10 oc ( o ) nh --; b ) alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c --( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, -- nr 10 c ( o )--, o , -- n ( r 10 )--, -- s ( o ) 2 n ( r 10 )--, -- n ( r 10 ) s ( o ) 2 --, or s ( o ) m ; d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; in a second embodiment of this invention the prodrugs of compounds of formula i are illustrated by the formula ii : ## str4 ## wherein : b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o )-- nr 10 --; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 20 alkyl , c 2 - c 20 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , n ( r 10 ) 2 , no 2 , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , r 11 oc ( o ) nr 10 -- and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocycle and c 3 - c 10 cycloalkyl ; or r 3a and r 3b are combined to form --( ch 2 ) 3 -- wherein one of the carbon atoms is optionally replaced by a moiety selected from : o , s ( o ) m , -- nc ( o )--, and -- n ( cor 10 )--; a ) substituted or unsubstituted c 1 - c 8 alkyl or substituted or unsubstituted c 5 - c 8 cycloalkyl , wherein the substituent on the alkyl is selected from : b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 10 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nh --, cn , h 2 n -- c ( nh )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 10 oc ( o ) nh --; b ) alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c --( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and ( c ) c 1 - c 6 alkyl unsubstituted or substituted by perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; r 12 is independently selected from hydrogen and c 1 - c 6 alkyl ; r 13 is independently selected from c 1 - c 6 alkyl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, -- nr 10 c ( o )--, o , -- n ( r 10 )--, -- s ( o ) 2 n ( r 10 )--, -- n ( r 10 ) s ( o ) 2 --, or s ( o ) m ; d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; in a third embodiment of this invention , the inhibitors of farnesyl transferase are illustrated by the formula iii : ## str7 ## wherein : b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o )-- nr 10 --; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 10 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nh --, cn , h 2 n -- c ( nh )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 10 oc ( o ) nh --; b ) alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c --( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, -- nr 10 c ( o )--, o , -- n ( r 10 )--, -- s ( o ) 2 n ( r 10 )--, -- n ( r 10 ) s ( o ) 2 --, or s ( o ) m ; d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; in a fourth embodiment of this invention the prodrugs of compounds of formula iii are illustrated by the formula iv : ## str9 ## wherein : b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocyclic , cycloalkyl , alkenyl , alkynyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o )-- nr 10 --; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 10 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nh --, cn , h 2 n -- c ( nh )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 10 oc ( o ) nh --; b ) alkenyl , alkynyl , perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c --( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by perfluoroalkyl , f , cl , br , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, -- nr 10 c ( o )--, o , -- n ( r 10 )--, -- s ( o ) 2 n ( r 10 )--, -- n ( r 10 ) s ( o ) 2 --, or s ( o ) m ; d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; in a more preferred embodiment of this invention , the ras farnesyl transferase inhibitors are illustrated by the formula ia : ## str11 ## wherein : r 1a is independently selected from : hydrogen or c 1 - c 6 alkyl ; b ) aryl , heterocycle , cycloalkyl , r 10 o --, -- n ( r 10 ) 2 or alkenyl , c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, or -- n ( r 10 ) 2 ; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , no 2 , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , r 11 oc ( o ) nr 10 -- and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocycle and c 3 - c 10 cycloalkyl ; b ) c 1 - c 6 alkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl , c 2 - c 6 perfluoroalkyl , r 10 o --, r 10 c ( o ) nr 10 --, ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; b ) c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, o , -- n ( r 10 )--, or s ( o ) m ; b ) heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl , d ) c 1 -- c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; w is a heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , or isoquinolinyl ; r is 0 to 5 , provided that r is 0 when v is hydrogen ; and in a second more preferred embodiment of this invention , the prodrugs of the preferred compounds of formula i are illustrated by the formula iia : ## str13 ## r 1a is independently selected from : hydrogen or c 1 - c 6 alkyl ; b ) aryl , heterocycle , cycloalkyl , r 10 o --, -- n ( r 10 ) 2 or alkenyl , c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, or -- n ( r 10 ) 2 ; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) an oxidized form of a side chain of a naturally occurring amino acid which is : c ) substituted or unsubstituted c 1 - c 10 alkyl , c 2 - c 10 alkenyl , c 3 - c 10 cycloalkyl , aryl or heterocyclic group , wherein the substituent is selected from f , cl , br , no 2 , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , r 11 oc ( o ) nr 10 -- and c 1 - c 20 alkyl , and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocycle and c 3 - c 10 cycloalkyl ; a ) substituted or unsubstituted c 1 - c 8 alkyl or substituted or unsubstituted c 5 - c 8 cycloalkyl , wherein the substituent on the alkyl is selected from : b ) c 1 - c 6 alkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl substituted by c 1 - c 6 perfluoroalkyl , r 10 o --, r 10 c ( o ) nr 10 --, ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; b ) c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; and c ) c 1 - c 6 alkyl unsubstituted or substituted by c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; r 12 is independently selected from hydrogen and c 1 - c 6 alkyl ; r 13 is independently selected from c 1 - c 6 alkyl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, o , -- n ( r 10 )--, or s ( o ) m ; b ) heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl , d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; w is a heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , or isoquinolinyl ; r is 0 to 5 , provided that r is 0 when v is hydrogen ; and in a third more preferred embodiment of this invention , the inhibitors of farnesyl transferase are illustrated by the formula iia : ## str16 ## wherein : r 1a is independently selected from : hydrogen or c 1 - c 6 alkyl ; b ) aryl , heterocycle , cycloalkyl , r 10 o --, -- n ( r 10 ) 2 or alkenyl , c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, or -- n ( r 10 ) 2 ; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m , r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 oc ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) c 1 - c 6 alkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 , and c ) c 1 - c 6 alkyl substituted by c 1 - c 6 perfluoroalkyl , r 10 o --, r 10 c ( o ) nr 10 --, ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; b ) c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, o , -- n ( r 10 )--, or s ( o ) m ; b ) heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl , d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; w is a heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , or isoquinolinyl ; r is 0 to 5 , provided that r is 0 when v is hydrogen ; and in a fourth more preferred embodiment of this invention , the prodrugs of the preferred compounds of formula iii are illustrated by the formula iva : ## str18 ## wherein : r 1a is independently selected from : hydrogen or c 1 - c 6 alkyl ; b ) aryl , heterocycle , cycloalkyl , r 10 o --, -- n ( r 10 ) 2 or alkenyl , c ) c 1 - c 6 alkyl unsubstituted or substituted by aryl , heterocycle , cycloalkyl , alkenyl , r 10 o --, or -- n ( r 10 ) 2 ; b ) c 1 - c 6 alkyl unsubstituted or substituted by alkenyl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , n 3 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, c ) aryl , heterocycle , cycloalkyl , alkenyl , r 10 )--, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, n 3 , -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and d ) c 1 - c 6 alkyl substituted with an unsubstituted or substituted group selected from aryl , heterocyclic and c 3 - c 10 cycloalkyl ; b ) c 1 - c 6 alkyl , c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 10 c ( o ) nr 10 --, cn , no 2 , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl substituted by c 1 - c 6 perfluoroalkyl , r 10 o --, r 10 c ( o ) nr 10 --, ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; b ) c 2 - c 6 alkenyl , c 2 - c 6 alkynyl , c 1 - c 6 perfluoroalkyl , f , cl , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , no 2 , r 11 oc ( o ) nr 10 --, and c ) c 1 - c 6 alkyl unsubstituted or substituted by c 1 - c 6 perfluoroalkyl , f , cl , r 10 o --, r 11 s ( o ) m --, r 10 c ( o ) nr 10 --, cn , ( r 10 ) 2 n -- c ( nr 10 )--, r 10 c ( o )--, r 10 oc ( o )--, -- n ( r 10 ) 2 , or r 11 oc ( o ) nr 10 --; r 10 is independently selected from hydrogen , c 1 - c 6 alkyl , benzyl and aryl ; r 11 is independently selected from c 1 - c 6 alkyl and aryl ; a 1 and a 2 are independently selected from : a bond , -- ch ═ ch --, -- c . tbd . c --, -- c ( o )--, -- c ( o ) nr 10 --, o , -- n ( r 10 )--, or s ( o ) m ; b ) heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , isoquinolinyl , and thienyl , d ) c 1 - c 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a a heteroatom selected from o , s , and n , and provided that v is not hydrogen if a 1 is s ( o ) m and v is not hydrogen if a 1 is a bond , n is 0 and a 2 is s ( o ) m ; w is a heterocycle selected from pyrrolidinyl , imidazolyl , pyridinyl , thiazolyl , pyridonyl , 2 - oxopiperidinyl , indolyl , quinolinyl , or isoquinolinyl ; r is 0 to 5 , provided that r is 0 when v is hydrogen ; and n -( 1 ( s )- carboxy - 3 - methylthiopropyl )- 3 -[ n , n - bis -( 4 - nitrophenylmethyl ) aminomethyl ] benzamide ## str20 ## n -( 1 ( s )- carbomethoxy - 3 - methylthiopropyl )- 3 -[ n , n - bis -( 4 - nitrophenylmethyl ) aminomethyl ] benzamide ## str21 ## n -( 1 ( s )- carboxy - 3 - methylthiopropyl )- 3 -[ n , n - bis ( 4 - imidazolemethyl ) aminomethyl ] benzamide ## str22 ## n -( 1 ( s )- carbxomethoxy - 3 - methylthiopropyl )- 3 -[ n , n - bis ( 4 - imidazolemethyl ) aminomethyl ] benzamide ## str23 ## n -( 1 ( s )- carboxy - 3 - methylthiopropyl )- 3 -[ n -( 4 - imidazolylymethyl )- n -( 4 - nitrobenzyl ) aminomethyl ] benzamide ## str24 ## n -( 1 ( s )- carbomethoxy - 3 - methylthiopropyl )- 3 -[ n -( 4 - imidazolylymethyl )- n -( 4 - nitrobenzyl ) aminomethyl ] benzamide ## str25 ## or the pharmaceutically acceptable salts thereof . in the present invention , the amino acids which are disclosed are identified both by conventional 3 letter and single letter abbreviations as indicated below : ______________________________________alanine ala aarginine arg rasparagine asn naspartic acid asp dasparagine or asx baspartic acidcysteine cys cglutamine gln qglutamic acid glu eglutamine or glx zglutamic acidglycine gly ghistidine his hisoleucine ile ileucine leu llysine lys kmethionine met mphenylalanine phe fproline pro pserine ser sthreonine thr ttryptophan trp wtyrosine tyr yvaline val v______________________________________ the compounds of the present invention may have asymmetric centers and occur as racemates , racemic mixtures , and as individual diastereomers , with all possible isomers , including optical isomers , being included in the present invention . as used herein , &# 34 ; alkyl &# 34 ; is intended to include both branched and straight - chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms . as used herein , &# 34 ; cycloalkyl &# 34 ; is intended to include non - aromatic cyclic hydrocarbon groups having the specified number of carbon atoms . examples of cycloalkyl groups include cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl and the like . &# 34 ; alkenyl &# 34 ; groups include those groups having the specified number of carbon atoms and having one or several double bonds . examples of alkenyl groups include vinyl , allyl , isopropenyl , pentenyl , hexenyl , heptenyl , cyclopropenyl , cyclobutenyl , cyclopentenyl , cyclohexenyl , 1 - propenyl , 2 - butenyl , 2 - methyl - 2 - butenyl , isoprenyl , farnesyl , geranyl , geranylgeranyl and the like . as used herein , &# 34 ; aryl &# 34 ; is intended to include any stable monocyclic , bicyclic or tricyclic carbon ring ( s ) of up to 7 members in each ring , wherein at least one ring is aromatic . examples of aryl groups include phenyl , naphthyl , anthracenyl , biphenyl , tetrahydronaphthyl , indanyl , phenanthrenyl and the like . the term heterocycle or heterocyclic , as used herein , represents a stable 5 - to 7 - membered monocyclic or stable 8 - to 11 - membered bicyclic or stable 11 - 15 membered tricyclic heterocycle ring which is either saturated or unsaturated , and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of n , o , and s , and including any bicyclic group in which any of the above - defined heterocyclic rings is fused to a benzene ring . the heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure . examples of such heterocyclic elements include , but are not limited to , azepinyl , benzimidazolyl , benzisoxazolyl , benzofurazanyl , benzopyranyl , benzothiopyranyl , benzofuryl , benzothiazolyl , benzothienyl , benzoxazolyl , chromanyl , cinnolinyl , dihydrobenzofuryl , dihydrobenzothienyl , dihydrobenzothiopyranyl , dihydrobenzothio - pyranyl sulfone , furyl , imidazolidinyl , imidazolinyl , imidazolyl , indolinyl , indolyl , isochromanyl , isoindolinyl , isoquinolinyl , isothiazolidinyl , isothiazolyl , isothiazolidinyl , morpholinyl , naphthyridinyl , oxadiazolyl , 2 - oxoazepinyl , 2 - oxopiperazinyl , 2 - oxopiperidinyl , 2 - oxopyrrolidinyl , piperidyl , piperazinyl , pyridyl , pyridyl n - oxide , pyridonyl , pyrazinyl , pyrazolidinyl , pyrazolyl , pyrimidinyl , pyrrolidinyl , pyrrolyl , quinazolinyl , quinolinyl , quinolinyl n - oxide , quinoxalinyl , tetrahydrofuryl , tetrahydroisoquinolinyl , tetrahydro - quinolinyl , thiamorpholinyl , thiamorpholinyl sulfoxide , thiazolyl , thiazolinyl , thienofuryl , thienothienyl , and thienyl . as used herein , the terms &# 34 ; substituted aryl &# 34 ;, &# 34 ; substituted heterocycle &# 34 ; and &# 34 ; substituted cycloalkyl &# 34 ; are intended to include the cyclic group which is substituted with 1 or 2 substitutents selected from the group which includes but is not limited to f , cl , br , cf 3 , nh 2 , n ( c 1 - c 6 alkyl ) 2 , no 2 , cn , ( c 1 - c 6 alkyl ) o --, -- oh , ( c 1 - c 6 alkyl ) s ( o ) m --, ( c 1 - c 6 alkyl ) c ( o ) nh --, h 2 n -- c ( nh )--, ( c 1 - c 6 alkyl ) c ( o )--, ( c 1 - c 6 alkyl ) oc ( o )--, n 3 , ( c 1 - c 6 alkyl ) oc ( o ) nh -- and c 1 - c 20 alkyl . when r 3a and r 3b are combined to form --( ch 2 ) s --, cyclic moieties are formed . examples of such cyclic moieties include , but are not limited to : ## str26 ## in addition , such cyclic moieties may optionally include a heteroatom ( s ). examples of such heteroatom - containing cyclic moieties include , but are not limited to : ## str27 ## the pharmaceutically acceptable salts of the compounds of this invention include the conventional non - toxic salts of the compounds of this invention as formed , e . g ., from non - toxic inorganic or organic acids . for example , such conventional non - toxic salts include those derived from inorganic acids such as hydrochloric , hydrobromic , sulfuric , sulfamic , phosphoric , nitric and the like : and the salts prepared from organic acids such as acetic , propionic , succinic , glycolic , stearic , lactic , malic , tartaric , citric , ascorbic , pamoic , maleic , hydroxymaleic , phenylacetic , glutamic , benzoic , salicylic , sulfanilic , 2 - acetoxy - benzoic , fumaric , toluenesulfonic , methanesulfonic , ethane disulfonic , oxalic , isethionic , trifluoroacetic and the like . it is intended that the definition of any substituent or variable ( e . g ., r 10 , z , n , etc .) at a particular location in a molecule be independent of its definitions elsewhere in that molecule . thus , -- n ( r 10 ) 2 represents -- nhh , -- nhch 3 , -- nhc 2 h 5 , etc . it is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art as well as those methods set forth below . the pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods . generally , the salts are prepared by reacting the free base with stoichiometric amounts or with an excess of the desired salt - forming inorganic or organic acid in a suitable solvent or various combinations of solvents . the compounds of the invention can be synthesized from their constituent amino acids by conventional peptide synthesis techniques , and the additional methods described below . standard methods of peptide synthesis are disclosed , for example , in the following works : schroeder et al ., &# 34 ; the peptides &# 34 ;, vol . i , academic press 1965 , or bodanszky et al ., &# 34 ; peptide synthesis &# 34 ;, interscience publishers , 1966 , or mcomie ( ed .) &# 34 ; protective groups in organic chemistry &# 34 ;, plenum press , 1973 , or barany et al ., &# 34 ; the peptides : analysis , synthesis , biology &# 34 ; 2 , chapter 1 , academic press , 1980 , or stewart et al ., &# 34 ; solid phase peptide synthesis &# 34 ;, second edition , pierce chemical company , 1984 . the teachings of these works are hereby incorporated by reference . abbreviations used in the description of the chemistry and in the examples that follow are : ______________________________________ac . sub . 2 o acetic anhydride ; boc t - butoxycarbonyl ; dbu 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ; dmap 4 - dimethylaminopyridine ; dme 1 , 2 - dimethoxyethane ; dmf dimethylfoffnamide ; edc 1 -( 3 - dimethylaminopropyl )- 3 - ethyl - carbodiimide - hydrochloride ; hobt 1 - hydroxybenzotriazole hydrate ; et . sub . 3 n triethylamine ; etoac ethyl acetate ; fab fast atom bombardment ; hoobt 3 - hydroxy - 1 , 2 , 2 - benzotriazin - 4 ( 3h )- one ; hplc high - performance liquid chromatography ; mcpba m - chloroperoxybenzoic acid ; mscl methanesulfonyl chloride ; nahmds sodium bis ( trimethylsilyl ) amide ; py pyridine ; tfa trifluoroacetic acid ; thf tetrahydrofuran . ______________________________________ compounds of this invention are prepared by employing the reactions shown in the following reaction schemes a - j , in addition to other standard manipulations such as ester hydrolysis , cleavage of protecting groups , etc ., as may be known in the literature or exemplified in the experimental procedures . some key bond - forming and peptide modifying reactions are : ______________________________________reaction a amide bond formation and subsequenmt generation of the amino methyl moiety using standard solution or solid phase methodologies . reaction b preparation of a reduced peptide subunit by reductive alkylation of an amine by an aldehyde using sodium cyanoborohydride or other reducing agents . reaction c alkylation of the amino moiety of the central phenyl ring . reaction d peptide bond formation and protecting group cleavage using standard solution or solid phase methodologies . ______________________________________ these reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are subsequently joined by the alkylation reactions described in the reaction schemes . ## str28 ## where x l is a leaving group , e . g ., br -, i - or mso -;. reaction schemes e - m illustrate reactions wherein the non - sulfhydryl - containing moiety at the n - terminus of the compounds of the instant invention is attached to an aminomethylbenzamide subunit which may be further elaborated to provide the instant compounds . these reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are subsequently joined by the reactions described in reaction schemes a - d . the intermediates whose synthesis are illustrated in reaction schemes a - d can be reductively alkylated with a variety of aldehydes , such as i , as shown in reaction scheme e . the aldehydes can be prepared by standard procedures , such as that described by o . p . goel , u . krolls , m . stier and s . kesten in organic syntheses , 1988 , 67 , 69 - 75 , from the appropriate amino acid ( reaction scheme e ). the reductive alkylation can be accomplished at ph 5 - 7 with a variety of reducing agents , such as sodium triacetoxyborohydride or sodium cyanoborohydride in a solvent such as dichloroethane , methanol or dimethylformamide . the product ii can be deprotected to give the final compounds iii with trifluoroacetic acid in methylene chloride . the final product iii is isolated in the salt form , for example , as a trifluoroacetate , hydrochloride or acetate salt , among others . the product diamine iii can further be selectively protected to obtain iv , which can subsequently be reductively alkylated with a second aldehyde to obtain v . removal of the protecting group , and conversion to cyclized products such as the dihydroimidazole vii can be accomplished by literature procedures . alternatively , the aminomethylbenzamide subunit can be reductively alkylated with other aldehydes such as 1 - trityl - 4 - carboxaldehyde or 1 - trityl - 4 - imidazolylacetaldehyde , to give products such as viii ( reaction scheme f ). the trityl protecting group can be removed from viii to give ix , or alternatively , viii can first be treated with an alkyl halide then subsequently deprotected to give the alkylated imidazole x . alternatively , the aminomethylbenzamide subunit can be acylated or sulfonylated by standard techniques . the imidazole acetic acid xi can be converted to the acetate xiii by standard procedures , and xiii can be first reacted with an alkyl halide , then treated with refluxing methanol to provide the regiospecifically alkylated imidazole acetic acid ester xiv . hydrolysis and reaction with the aminomethylbenzamide subunit in the presence of condensing reagents such as 1 -( 3 - dimethylaminopropyl )- 3 - ethylcarbodiimide ( edc ) leads to acylated products such as xv . if the aminomethylbenzamide subunit is reductively alkylated with an aldehyde which also has a protected hydroxyl group , such as xvi in reaction scheme h , the protecting groups can be subsequently removed to unmask the hydroxyl group ( reaction schemes h , i ). the alcohol can be oxidized under standard conditions to e . g . an aldehyde , which can then be reacted with a variety of organometallic reagents such as grignard reagents , to obtain secondary alcohols such as xx . in addition , the fully deprotected amino alcohol xxi can be reductively alkylated ( under conditions described previously ) with a variety of aldehydes to obtain secondary amines , such as xxii ( reaction scheme j ), or tertiary amines . the boc protected amino alcohol xviii can also be utilized to synthesize 2 - aziridinylmethylpiperazines such as xxiii ( reaction scheme k ). treating xviii with 1 , 1 &# 39 ;- sulfonyldiimidazole and sodium hydride in a solvent such as dimethylformamide led to the formation of aziridine xxiii . the aziridine reacted in the presence of a nucleophile , such as a thiol , in the presence of base to yield the ring - opened product xxiv . in addition , the aminomethylbenzoate subunit can be reacted with aldehydes derived from amino acids such as o - alkylated tyrosines , according to standard procedures , to obtain compounds such as xxx , as shown in reaction scheme l . when r &# 39 ; is an aryl group , xxx can first be hydrogenated to unmask the phenol , and the amine group deprotected with acid to produce xxxi . alternatively , the amine protecting group in xxx can be removed , and o - alkylated phenolic amines such as xxxii produced . reaction scheme m illustrates a one pot synthesis of an instant compound wherein the n - terminus nitrogen is substituted with two different non - sulfhydryl - containing moieties . thus , the aminomethylbenzamide subunit is treated with one equivalent of an appropriate aldehyde and , after the reductive adduct has been formed , the in situ intermediate is treated with an equivalent of a different aldehyde . similar procedures as are illustrated in reaction schemes e - m may be employed using other intermediates such as those whose synthesis is illustrated in reaction schemes b - d . ## str29 ## the -- nr 4 r 5 moiety of the compounds of the instant invention may provide advantages over a cysteinyl moiety that is incorporated in other types of molecules that are known to be inhibitors of farnesyl protein transferase . in particular , modification of the benzodiazepine compounds described in published pct application wo 26723 with the such -- nr 4 r 5 substituents as described herein will provide inhibitors of farnesyl protein transferase of the following formulae a and b : ## str30 ## wherein the substituents r , r &# 39 ; and r 25 are as defined in wo 94 / 26723 , r 4benz , r 4 &# 39 ; benz , r 7benz and w benz are r 4 , r 4 &# 39 ;, r 7 and w respectively as defined in wo 94 / 26723 and r a and r b are defined as r 4 and r 5 are defined herein respectively . preferably , the following combinations of r a and r b are selected for incorporation into the compounds of formulae a and b : most preferably , the benzodiazepine compound would be selected from the following formulae : ## str31 ## wherein r and r &# 39 ; are as defined in wo 94 / 26723 and w &# 39 ; benz is w &# 39 ; as defined in wo 94 / 26723 and r a and r b are defined as r 4 and r 5 are defined herein respectively . such benzodiazepine analogs may be synthesized by techniques well known in the art , as well as procedures outlined in wo 26723 . general methods of synthesis of the benzediazapine analogs of this invention are shown in schemes n , p and q . typically a convergent route is employed , which joins the key intermediate 9 ( scheme n ) with suitably functionalized amine and r a and r b components ( schemes p and q ) using standard amide bond - forming procedures . as shown in scheme n , the protected amino acid 9 may be prepared from a suitably substituted 2 - aminobenzophenone ( 1 ). many 2 - aminobenzophenones are known in the art or are available form commercial sources such as aldrich chemical co . general methods for the synthesis of new 2 - aminobenzophenones may be found in the literature ( c . f . walsh , d . a . synthesis , 677 - 688 ( 1980 ). acylation of 1 with a haloacetyl halide , such as bromoacetyl bromide in a suitable solvent mixture , such as water / ch 2 cl 2 , typically at temperatures ranging from 0 ° c . to 24 ° c ., produces amide 2 . reaction of 2 with ammonia in a polar solvent such as methanol at 25 ° to 75 ° c . then gives the 1 , 4 - benzodiazepin - 2 - one 3 , after evaporation of the solvent . alkylation of 3 with a substituted organic ester ( 4 ), preferably tert - butyl bromacetate , in the presence of a base , preferably cs 2 co 3 in 1 - methyl - 2 - pyrrolidinone at ambient temperature , gives 5 . alternatively , 3 may be alkylated at n - 1 with a variety of other alkylating agents , for instance , esters of substituted or unsubstituted acrylates , 4 - bromobutanoates , etc . branched compounds ( i . e . r 4benz and / or r 4 &# 39 ; benz ≠ h ), may be prepared by generation of the polyanion of 5 with base and alkylation with an appropriate alkyl halide . subsequent to alkylation , the ester of 5 may be cleaved with an acid such as tfa ( for the tert - butyl esters ) or under mild aqueous base hydrolysis ( for other alkyl esters ) at temperatures between 0 ° and 25 ° c . the acid 6 is converted to amino acid 8 via reaction of the dianion , generated with at least two equivalents of a strong base with an electrophilic aminating agent . alternatively , 6 may be halogenated and reacted with an amine source such as azide ( followed by reduction ) or ammonia . preferably , 6 is reacted with 4 equivalents of potassium tert - butoxide in glyme at - 5 ° c . for 30 min and treated with 1 . 1 equivalents of isobutyl nitrite . the resulting oxime 7 can then be reduced to the racemic amino acid 8 using a variety of reductants , preferably hydrogenation at 40 psig in the presence of ruthenium on carbon or raney nickel in methanol at 50 ° to 70 ° c . for 1 - 4 days . amino acid 8 is then suitably protected for selective coupling at the carboxyl terminus . for example , 8 can be converted to the n - boc derivative 9 using standard amino acid protection conditions , preferably , reaction with equimolar amounts of di - tert - butyl dicarbonate and triethyl amine in dmf / water at ambient temperature . for compounds where r a ≠ h , 9 can be alkylated at nitrogen with a wide variety of alkylating agents including n - alkyl , branched alkyl , and benzyl , according to the standard procedure of benoiton , et al ., can . j . chem . 1977 , 55 , 906 . for example , reaction of 9 with at least 2 equivalents of base and an alkylating agent in a polar , aprotic solvent at 0 ° to 50 ° c . for 0 . 5 to 48 h give 10 . also , the reactions shown in schemes e - m may be utilized with the compound 9 . ## str32 ## compounds 9 and 10 can be further elaborated according to schemes p . in general , the carboxylic acid function of 9 and 10 is reacted with a suitably protected amine component using standard solid phase ( scheme p ) or solution phase peptide synthesis procedures . the boc or other protecting group of n - 3 of the benzodiazepinone is removed and the amine function then coupled with a third component , for example , a suitably protected amino acid , and then deprotected , again employing standard procedures . the resulting product is subsequently purified by chromatography or crystallization . ## str33 ## alternatively , 3 may be directly alkylated with the &# 34 ; top &# 34 ; sidechain in one intact piece , as shown in scheme q . reaction of 3 with an alkyl halide such as a suitably substituted benzyl bromide , alkyl bromide , in the presence of a base , preferably nah or cs 2 co 3 , gives 11 , which may be processed according to the reactions illustrated in scheme i to provide the desired fptase inhibitors . ## str34 ## wherein p . g . is a suitably selected protecting group which is utilized if necessary . the compounds of this invention inhibit ras farnesyl transferase which catalyzes the first step in the post - translational processing of ras and the biosynthesis of functional ras protein . these compounds are useful as pharmaceutical agents for mammals , especially for humans . these compounds may be administered to patients for use in the treatment of cancer . examples of the type of cancer which may be treated with the compounds of this invention include , but are not limited to , colorectal carcinoma , exocrine pancreatic carcinoma , and myeloid leukemias . the compounds of this invention may be administered to mammals , preferably humans , either alone or , preferably , in combination with pharmaceutically acceptable carriers or diluents , optionally with known adjuvants , such as alum , in a pharmaceutical composition , according to standard pharmaceutical practice . the compounds can be administered orally or parenterally , including the intravenous , intramuscular , intraperitoneal , subcutaneous , rectal and topical routes of administration . for oral use of a chemotherapeutic compound according to this invention , the selected compound may be administered , for example , in the form of tablets or capsules , or as an aqueous solution or suspension . in the case of tablets for oral use , carriers which are commonly used include lactose and corn starch , and lubricating agents , such as magnesium stearate , are commonly added . for oral administration in capsule form , useful diluents include lactose and dried corn starch . when aqueous suspensions are required for oral use , the active ingredient is combined with emulsifying and suspending agents . if desired , certain sweetening and / or flavoring agents may be added . for intramuscular , intraperitoneal , subcutaneous and intravenous use , sterile solutions of the active ingredient are usually prepared , and the ph of the solutions should be suitably adjusted and buffered . for intravenous use , the total concentration of solutes should be controlled in order to render the preparation isotonic . the present invention also encompasses a pharmaceutical composition useful in the treatment of cancer , comprising the administration of a therapeutically effective amount of the compounds of this invention , with or without pharmaceutically acceptable carriers or diluents . suitable compositions of this invention include aqueous solutions comprising compounds of this invention and pharmacologically acceptable carriers , e . g ., saline , at a ph level , e . g ., 7 . 4 . the solutions may be introduced into a patient &# 39 ; s intramuscular blood - stream by local bolus injection . when a compound according to this invention is administered into a human subject , the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age , weight , and response of the individual patient , as well as the severity of the patient &# 39 ; s symptoms . in one exemplary application , a suitable amount of compound is administered to a mammal undergoing treatment for cancer . administration occurs in an amount between about 0 . 1 mg / kg of body weight to about 20 mg / kg of body weight per day , preferably of between 0 . 5 mg / kg of body weight to about 10 mg / kg of body weight per day . the compounds of the instant invention are also useful as a component in an assay to rapidly determine the presence and quantity of farnesyl - protein transferase ( fptase ) in a composition . thus the composition to be tested may be divided and the two portions contacted with mixtures which comprise a known substrate of fptase ( for example a tetrapeptide having a cysteine at the amine terminus ) and farnesyl pyrophosphate and , in one of the mixtures , a compound of the instant invention . after the assay mixtures are incubated for an sufficient period of time , well known in the art , to allow the fptase to farnesylate the substrate , the chemical content of the assay mixtures may be determined by well known immunological , radiochemical or chromatographic techniques . because the compounds of the instant invention are selective inhibitors of fptase , absence or quantitative reduction of the amount of substrate in the assay mixture without the compound of the instant invention relative to the presence of the unchanged substrate in the assay containing the instant compound is indicative of the presence of fptase in the composition to be tested . it would be readily apparent to one of ordinary skill in the art that such an assay as described above would be useful in identifying tissue samples which contain farnesyl - protein transferase and quantitating the enzyme . thus , potent inhibitor compounds of the instant invention may be used in an active site titration assay to determine the quantity of enzyme in the sample . a series of samples composed of aliquots of a tissue extract containing an unknown amount of farnesyl - protein transferase , an excess amount of a known substrate of fptase ( for example a tetrapeptide having a cysteine at the amine terminus ) and farnesyl pyrophosphate are incubated for an appropriate period of time in the presence of varying concentrations of a compound of the instant invention . the concentration of a sufficiently potent inhibitor ( i . e ., one that has a ki substantially smaller than the concentration of enzyme in the assay vessel ) required to inhibit the enzymatic activity of the sample by 50 % is approximately equal to half of the concentration of the enzyme in that particular sample . examples provided are intended to assist in a further understanding of the invention . particular materials employed , species and conditions are intended to be further illustrative of the invention and not limitative of the reasonable scope thereof . the standard workup referred to in the examples refers to solvent extraction and washing the organic solution with 10 % citric acid , 10 % sodium bicarbonate and brine as appropriate . solutions were dried over sodium sulfate and evaporated in vacuo on a rotary evaporator . to a solution of ( s ) methionine methyl ester hydrochloride ( 10 . 56 g , 52 . 9 mmol ) and 4 - n - methylmorpholine ( 21 . 34 g , 211 . 6 mmol ) under nitrogen in 200 ml of methylene chloride at o ° c . was added 3 - chloro - methyl benzoyl chloride ( 10 . 00 g , 52 . 9 mmol ) dropwise via syringe . after addition the cooling bath was removed and the resulting solution was stirred for 16 h at 20 ° c . the methylene chloride solution was extracted with 125 ml each of water , 2 % potassium hydrogen sulfate , saturated sodium hydrogen carbonate , and saturated sodium chloride . the methylene chloride was dried over magnesium sulfate and concentrated in vacuo to the title compound as an oil . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 85 ( 1h , s ), 7 . 76 ( 1h , d , j = 8 hz ), 7 . 56 ( 1h , d , j = 8 hz ), 7 . 45 ( 1h , t , j = 8 hz ), 6 . 96 ( 1h , d , j = 7 hz ), 4 . 94 ( 1h , q , j = 5 hz ), 4 . 62 ( 2h , s ), 3 . 81 ( 3h , s ), 2 . 60 ( 2h , t , j = 8 hz ), 2 . 30 ( 1h , m ), 2 . 15 ( 1h , m ), 2 . 12 ( 3h , s ). to a stirred solution of the product from step a ( 13 . 52 g , 42 . 80 mmol ) in 50 ml of dimethylsulfoxide under nitrogen was added lithium azide ( 2 . 3 g , 47 . 10 mmol ). the solution was stirred for 2 h . the reaction mixture was then partitioned with 300 ml of ethyl acetate and 200 ml of water . the ethyl acetate layer was washed with 125 ml of saturated sodium chloride , dried over magnesium sulfate and concentrated in vacuo to afford the title compound as an oil . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 75 ( 2h , m ), 7 . 47 ( 2h , m ), 7 . 02 ( 1h , d , j = 8 hz ), 4 . 94 ( 1h , q , j = 5 hz ), 4 . 41 ( 2h , s ), 3 . 80 ( 3h , s ), 2 . 60 ( 2h , t , j = 6 hz ), 2 . 30 ( 1h , m ), 2 . 15 ( 1h , m ), 2 . 11 ( 3h , s ). to a solution of the product from step b ( 11 . 8 g , 35 . 08 mmol ) in 150 ml of methanol under nitrogen was added 1 . 5 g 10 % palladium on carbon . hydrogen was applied to the mixture at 1 atmosphere for 1 . 5 h . the reaction mixture was filtered and concentrated in vacuo to obtain 10 . 3 g ( 34 . 76 mmol ) of crude product as an oil . the crude product was chromatographed on 500 g of silica gel with chloroform / methanol 95 / 5 as eluant to afford the title compound as an oil . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 78 ( 1h , s ), 7 . 68 ( 1h , d , j = 7 hz ), 7 . 47 ( 1h , d , j = 7 hz ), 7 . 40 ( 1h , t , j = 8 hz ), 7 . 02 ( 1h , d , j = 7 hz ), 4 . 93 ( 1h , q , j = 5 hz ), 3 . 92 ( 2h , s ), 3 . 79 ( 3h , s ), 2 . 59 ( 2h , t , j = 8 hz ), 2 . 24 ( 1h , m ), 2 . 12 ( 1h , m ), 2 . 10 ( 3h , s ), 1 . 85 ( 2h , s ). to a solution of the product from step c ( 0 . 228 g , 0 . 767 mmol ) in 10 ml of 1 , 2 - dichloroethane was added glacial acetic acid dropwise until a ph 5 . 5 was achieved . to this mixture at 20 ° c . was added 0 . 5 g of crushed 4 å molecular sieves , sodium triacetoxyborohydride ( 0 . 487 g , 2 . 30 mmol ), and 1 -( triphenylmethyl )- 4 - imidazole carboxaldehyde ( 0 . 130 g , 0 . 384 mmol ). the resulting solution was stirred for 12 - 72 h . the reaction mixture was filtered through celite and partitioned with 125 ml of water and 150 ml of ethyl acetate . the ethyl acetate layer was washed with 125 ml each of saturated sodium hydrogen carbonate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield 0 . 363 g of crude product . the crude product was chromatographed on silica gel eluting with chloroform / methanol 95 / 5 to afford the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 83 ( 1h , s ), 7 . 71 ( 1h , d , j = 7 hz ), 7 . 40 ( 4h , m ), 7 . 32 ( 8h , m ), 7 . 25 ( 1h , s ), 7 . 12 ( 7h , m ), 6 . 71 ( 1h , s ), 4 . 93 ( 1h , q , j = 5 hz ), 3 . 85 ( 2h , s ), 3 . 77 ( 3h , s ), 3 . 71 ( 2h , s ), 2 . 58 ( 2h , t , j = 8 hz ), 2 . 25 ( 1h , m ), 2 . 10 ( 1h , m ), 2 . 09 ( 3h , s ). to a solution of the product from step d ( 0 . 220 g , 0 . 356 mmol ) in 10 ml of methylene chloride was added triethylsilane ( 0 . 165 g , 1 . 42 mmol ) and 5 ml of trifluoroacetic acid . the solution was stirred for 45 min , evaporated in vacuo , and partitioned with hexane and 0 . 1 % trifluoroacetic acid in water : methanol 2 : 1 . the 0 . 1 % trifluoroacetic acid / water - methanol solution was injected directly onto a delta - pak ( c - 18 , 100 å , 15 mm , 40 mm × 100 mm ) prep hplc column 40 ml / min . was 100 % 0 . 1 % tfa / water for 5 min . followed by 95 % 0 . 1 % tfa / water : 5 % 0 . 1 % tfa / acetonitrile to 70 % 0 . 1 % tfa / water : 30 .% 0 . 1 % tfa / acetonitrile over a period of 40 min . the pure fractions were pooled , evaporated in vacuo to near dryness , and then taken up in 5 ml of water . this water solution was passed through a 1 . 2 gm . column of bio - rad ag 3 - x 4 chloride anion exchange resin . the resulting aqueous column eluant was lyophillized overnight to yield the title compound as a solid . 1 hnmr ( 300 mhz , cd 3 od ) δ9 . 04 ( 1h , s ), 8 . 06 ( 1h , s ), 7 . 96 ( 1h , d , j = 8 hz ), 7 . 83 ( 1h , s ), 7 . 76 ( 1h , d , j = 8 hz ), 7 . 63 ( 1h , t , j = 8 hz ), 4 . 81 ( 1h , q , j = 5 hz ), 4 . 52 ( 2h , s ), 4 . 42 ( 2h , s ), 3 . 77 ( 3h , s ), 2 . 63 ( 2h , m ), 2 . 22 ( 1h , m ), 2 . 16 ( 1h , m ), 2 . 13 ( 3h , s ). fab mass spectrum m / e 377 ( m + 1 ). analysis calculated for c 18 h 24 n 4 o 3 s . 3 . 3 hcl : c , 43 . 57 ; h , 5 . 55 ; n , 11 . 29 . found : c , 43 . 56 ; h , 5 . 54 ; n , 11 . 82 . the product from step e ( 0 . 030 g , 0 . 067mmol ) was dissolved in 5 ml of methanol and 3 ml of 5 % sodium hydroxide and stirred for 1 h under nitrogen . the reaction mixture was injected directly onto a preparative reverse phase hplc column with conditions identical as in the preparation of the compound in step e . pure fractions were pooled , evaporated in vacuo , and the sample was converted to the hydrochloride salt as before . lyophillization overnight afforded 0 . 022 g ( 0 . 051 mmol ) of the title compound as a solid . 1 hnmr ( 300 mhz , cd 3 od ) δ9 . 06 ( 1h , s ), 8 . 06 ( 1h , s ), 7 . 96 ( 1h , d , j = 8 hz ), 7 . 83 ( 1h , s ), 7 . 76 ( 1h , d , j = 8 hz ), 7 . 61 ( 1h , t , j = 8 hz ), 4 . 78 ( 1h , q , j = 5 hz ), 4 . 53 ( 2h , s ), 4 . 47 ( 2h , s ), 2 . 63 ( 2h , m ), 2 . 25 ( 1h , m ), 2 . 15 ( 1h , m ), 2 . 13 ( 3h , s ). fab mass spectrum m / e 363 ( m + 1 ). analysis calculated for c 17 h 22 n 4 o 3 s . 3 . 3 hcl . 0 . 5 h 2 o : c , 41 . 57 ; h , 5 . 40 ; n , 11 . 41 . found : c , 41 . 54 ; h , 5 . 42 ; n , 11 . 05 . to a solution of the product from example 1 , step c ( 0 . 100 g , 0 . 357 mmol ) in 10 ml of 1 , 2 - dichloroethane was added glacial acetic acid dropwise until the ph was 5 . 5 . to this mixture at 20 ° c . was added 0 . 5 g of crashed 4 å sieves , sodium triacetoxyborohydride ( 0 . 226 g , 2 . 30 mmol ), and 1 -( triphenylmethyl )- 4 - imidazole carboxaldehyde ( 0 . 130 g , 1 . 07 mmol ). the resulting solution was stirred for 12 - 72 h . the reaction mixture was filtered through celite and partitioned with 125 ml of water and 150 ml of ethyl acetate . the ethyl acetate layer was washed with 125 ml each of saturated sodium hydrogen carbonate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . to a solution of the product from step a ( 0 . 320 g , 0 . 341 mmol ) in 10 ml of methylene chloride was added triethylsilane ( 0 . 159 g , 1 . 36 mmol ) and 5 ml of trifluoroacetic acid . the solution was stirred for 45 min , evaporated , and partitioned between hexane and 0 . 1 % tfa in water - methanol 2 : 1 . the 0 . 1 % tfa / water : methanol solution was injected directly onto a delta - pak ( c - 18 , 100 å , 15 mm , 40 mm × 100 mm ) preparative hplc column . the gradient at 40 ml / min was 100 % 0 . 1 % tfa / water for 5 min followed by 95 % 0 . 1 % tfa / water to 60 % 0 . 1 % tfa / water : 40 % 0 . 1 % tfa / acetonitrile over 40 min . the pure fractions were pooled , evaporated to near dryness , and then taken up in 5 ml of water . the aqueous solution was passed through a 1 . 2 gm . column of bio - rad ag 3 - x4 chloride anion exchange resin . the resulting aqueous column eluant was lyophillized overnight to yield the title compound as a solid . 1 hnmr ( 300 mhz , cd 3 od ) δ8 . 92 ( 2h , s ), 7 . 94 ( 1h , s ), 7 . 78 ( 1h , d , j = 8 hz ), 7 . 62 ( 2h , s ), 7 . 58 ( 1h , d , j = 8 hz ), 7 . 44 ( 1h , t , j = 8 hz ), 4 . 81 ( 1h , q , j = 5 hz ), 4 . 06 ( 4h , s ), 3 . 93 ( 2h , s ), 3 . 77 ( 3h , s ), 2 . 63 ( 2h , m ), 2 . 22 ( 1h , m ), 2 . 16 ( 1h , m ), 2 . 13 ( 3h , s ). fab mass spectrum m / e 457 ( m + 1 ). analysis calculated for c 22 h 28 n 6 o 3 s . 4 . 8 hcl . 0 . 2 h 2 o : c , 41 . 66 ; h , 5 . 28 ; n , 13 . 25 . found : c , 41 . 62 ; h , 5 . 27 ; n , 13 . 02 the compound from step b ( 0 . 035 g , 0 . 052 mmol ) was dissolved in 5 ml of methanol and 3 ml of 5 % sodium hydroxide and stirred for 1 hr under nitrogen . the reaction mixture was injected directly onto a preparative hplc column with conditions identical as in step b . pure fractions were pooled , evaporated , and the sample converted to the hydrochloride salt as before . lyophilization overnight afforded the title compound as a solid . 1 hnmr ( 300 mhz , cd 3 od ) δ8 . 88 ( 2h , s ), 7 . 87 ( 1h , s ), 7 . 75 ( 1h , d , j = 8 hz ), 7 . 55 ( 1h , s ), 7 . 50 ( 1h , d , j = 8 hz ), 7 . 42 ( 1h , t , j = 8 hz ), 4 . 78 ( 1h , q , j = 5 hz ), 3 . 88 ( 4h , s ), 3 . 77 ( 2h , s ), 2 . 63 ( 2h , m ), 2 . 25 ( 1h , m ), 2 . 15 ( 1h , m ), 2 . 13 ( 3h , s ). fab mass spectrum m / e 443 ( m + 1 ). analysis calculated for c 21 h 26 n 6 o 0 s . 5 . 4 hcl . 1 . 5 h 2 o : c , 37 . 91 ; h , 5 . 21 ; n , 12 . 63 . found : c , 37 . 97 ; h , 5 . 22 ; n , 12 . 37 . to a solution of triethylamine ( 11 . 0 ml ) in methanol ( 150 ml ) at 0 ° c . was added 3 - chloromethylbenzoyl chloride ( 5 . 0 g ) dropwise . after stirring at 20 ° c . for 0 . 5 h the solution was concentrated in vacuo . the residue was partitioned with 125 ml of water and 150 ml of ethyl acetate . the ethyl acetate layer was washed with 125 ml each of saturated sodium hydrogen carbonate , 2 % potassium hydrogen sulfate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ8 . 07 ( 1h , s ), 7 . 99 ( 1h , d , j = 8 hz ), 7 . 59 ( 1h , d , j = 8 hz ), 7 . 43 ( 1h , t , j = 8 hz ), 4 . 62 ( 2h , s ), 3 . 92 ( 3h , s ). starting with the product from step a the method used in step b of example 1 was used to prepare the title compound . starting with the product from step b the method used in step c of example 1 was used to prepare the title compound . to a solution of the product from step c ( 1 . 14 g ) in methylene chloride ( 50 ml ) was added triethylamine ( 2 . 90 ml ) and di - tert - butyl dicarbonate ( 1 . 67 g ) and the mixture was stirred 16 h . the solution was partitioned with water and methylene chloride . the methylene chloride layer was washed with saturated sodium hydrogen carbonate , 2 % potassium hydrogen sulfate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield 1 . 71 g of the crude product . chromotography on silica gel with hexane / ethyl acetate 9 / 1 yielded the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 95 ( 1h , s ), 7 . 93 ( 1h , d , j = 8 hz ), 7 . 49 ( 1h , d , j = 8 hz ), 7 . 41 ( 1h , t , j = 8 hz ), 4 . 90 ( 1h , b ), 4 . 37 ( 2h , d , j = 6 hz ), 3 . 92 ( 3h , s ), 1 . 45 ( 9h , s ). to a solution of the product from step e ( 1 . 42 g ) in dimethylformamide ( 30 ml ) at 0 ° c . was added sodium hydride ( 0 . 43 g , 60 % dispersion in minerol oil ). after stirring for 0 . 5 h methyl iodide ( 0 . 40 ml ) was added and the mixture was stirred 16 h at 20 ° c . the solution was concentrated in vacuo and the residue was partitioned between ethyl acetate and water . the ethyl acetate layer was washed with saturated sodium hydrogen carbonate , 2 % potassium hydrogen sulfate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the crude product . chromotography on silica gel with hexane / ethyl acetate 9 / 1 yielded 0 . 35 g of the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 93 ( 2h , m ), 7 . 42 ( 2h , m ), 4 . 45 ( 2h , s ), 3 . 92 ( 3h , s ), 2 . 83 ( 3h , d ), 1 . 47 ( 9h , s ). to a solution of the product from step e ( 0 . 35 g ) in methanol was added 5 % sodium hydroxide . after stirring for 2 h the methanol was evaporated and the aqueous layer was adjusted to ph 3 with 2 % potassium hydrogen sulfate . the aqueous layer was extracted with ethyl acetate several times . the ethyl acetate layer was washed with saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . to a solution of the product from step f ( 0 . 27 g ) in dimethylformamide ( 10 ml ) was added hydroxybenzotriazole ( 0 . 16 g ), edc ( 0 . 19 g ), n - methylmorpholine ( 0 . 40 ml ), and ( s ) methione methyl ester hydrochloride ( 0 . 203 mg ). after stirring for 2 h the solution was concentrated in vacuo and the residue was partitioned with water and ethyl acetate . the ethyl acetate layer was washed with saturated sodium hydrogen carbonate , 2 % potassium hydrogen sulfate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 70 ( 2h , s ), 7 . 40 ( 2h , m ), 6 . 95 ( 1h , d , j = 7 hz ), 4 . 94 ( 1h , q , j = 7 hz ), 4 . 45 ( 2h , s ), 3 . 81 ( 3h , s ), 2 . 82 ( 3h , d ), 2 . 59 ( 2h , m ), 2 . 30 ( 1h , m ), 2 . 13 ( 1h , m ), 2 . 12 ( 3h , s ), 1 . 46 ( 9h , s ). to a solution of the product from step g in methylene chloride was added trifluoroacetic acid ( 33 % by volume ). after stirring for 1 h the solution was concentrated in vacuo to yield the title compound . starting with the product from step h ( 0 . 18 g ) the method described in step d of example 1 was used to prepare the title compound . starting with the compound from step i ( 0 . 24 g ) the method described in step e of example 1 was used to prepare the title compound . fab mas spectrum m / e 391 ( m + 1 ). analysis for c 19 h 26 n 4 o 3 s . 5 . 0 hcl . 0 . 5 h 2 o : starting with the compound from step j ( 0 . 035 g ) the method described in step f of example 1 was used to prepare the above title compound . fab mas spectrum m / e 377 ( m + 1 ). analysis for c 18 h 24 n 4 o 3 s . 3 . 70 hcl . 0 . 2 h 2 o : starting with 4 - aminobenzoic acid ( 2 . 00 g ) dissolved in tetrahydrofuran ( 50 ml ) and 5 % sodium hydroxide ( 15 ml ) the method described in step d of example 3 was used to prepare the title compound . after extractive work up obtained the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ8 . 04 ( 2h , d , j = 9 hz ), 7 . 46 ( 2h , d , j = 9 hz ), 6 . 75 ( 1h , s ), 1 . 46 ( 9h , s ). to a solution of the product from step a ( 0 . 5 g ) in dimethylformamide ( 20 ml ) was added hydroxybenzotriazole ( 0 . 37 g ), edc ( 0 . 51 g ), n - methylmorpholine 0 . 8 ml ), and ( s ) methione methyl ester hydrochloride ( 0 . 49 g ). after stirring for 16 h the solution was concentrated in vacuo and the residue was partitioned with water and ethyl acetate . the ethyl acetate layer was washed with saturated sodium hydrogen carbonate , 2 % potassium hydrogen sulfate and saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . to a solution of the product from step b in methylene chloride was added trifluoroacetic acid ( 33 % by volume ). after stirring for 1 h the solution was concentrated in vacuo to yield the trifluoroacetate salt of the product ( 0 . 59 g ). this product was partioned between ethyl acetate and saturated sodium bicarbonate . the ethyl acetate layer was washed with saturated sodium chloride , dried over magnesium sulfate , and concentrated in vacuo to yield the title compound . 1 hnmr ( 300 mhz , cdcl 3 ) δ7 . 64 ( 2h , d , j = 8 hz ), 6 . 75 ( 1h , d , j = 8 hz ), 6 . 65 ( 2h , d , j = 8 hz ), 4 . 90 ( 1h , q , j = 5 hz ), 3 . 78 ( 3h , s ), 2 . 57 ( 2h , m ), 2 . 27 ( 1h , m ), 2 . 08 ( 4h , m ). starting with the product from step c ( 0 . 07 g ) the method described in step d of example 1 was used to prepare the title compound . starting with the product from step d ( 0 . 24 g ) the method described in step e of example 1 was used to prepare the title compound . fab mas spectrum m / e 363 ( m + 1 ). analysis for c 17 h 22 n 4 o 3 s . 2 . 8 hcl : starting with ( 5 ) ( 0 . 035 g ) the method described in step f of example 1 was used to prepare the title compound . fab mas spectrum m / e 349 ( m + 1 ). analysis for c 16 h 20 n 4 o 3 s . 3 . 10 hcl . 1 . 2 h 2 o : using the appropriate starting materials the methods described above for example 4 were used to prepare examples 5 - 7 . analysis for c 16 h 20 n 4 o 3 s . 3 . 2 hcl : analysis for c 19 h 26 n 4 o 3 s . 2 . 4 hcl . 1 . 3 h 2 o : analysis for c 18 h 24 n 4 o 3 s . 3 . 0 hcl . 0 . 5 h 2 o : n -( 1 ( s )- carbomethoxy - 3 - methylthiopropyl )- 3 - aminomethylbenzamide ( 0 . 104 g , 0 . 352 mmol ) was dissolved in dichloroethane ( 5 ml ). crushed molecular sieves ( 0 . 209 g ) and sodium triacetoxyborohydride ( 0 . 186 g , 0 . 881 mmol ). the ph was about 7 . 5 . 4 - nitrobenzaldehyde ( 0 . 0533 g , 0 . 352 mmol ) was added plus 0 . 5 drop of acetic acid to bring the ph to about 7 . the reaction was stirred 2 h under nitrogen at 20 ° c . 1 - triphenylmethylimidazolyly - 4 - carboxaldehyde ( 0 . 119 g , 0 . 352 mmol ) was added to the reaction mixture with additional sodium triacetoxyborohydride and dichloroethane ( 2 ml ). triethylamine ( 5 drops ) brought the ph to about 7 . the reaction continued to stir at 20 ° c . under nitrogen overnight . the reaction was quenched with saturated sodium bicarbonate solution and let stir 20 min . it was then removed to a separatory funnel with copious amounts of ethyl acetate . the aqueous layer was removed and the organic phase was washed with saturated brine and dried over magnesium sulfate . the crude product was chromatographed on silica gel with 50 % ethyl acetate in hexane . this chromatographed product was dissolved in dichloromethane ( 7 ml ); triethylsilane ( 0 . 5 ml , 3 . 13 mmol ) was added and then trifluoroacetic acid ( 3 . 5 ml ). after 0 . 5 h at 20 ° c ., the solvent was evaporated and the residue partitioned between hexane and water . the aqueous solution was purified by preparative reverse phase hplc using a 100 mm waters preppak ® reverse phase column ( deltapak ™ c18 , 50 μm , 100 å ) and pure product isolated by gradient elution using 80 % 0 . 1 % trifluoroacetic acid in water ( solvent a ) and 20 % 0 . 1 % trifluoroacetic acid in acetonitrile ( solvent b ) to 55 % solvent a and 45 % solvent b . the pure fractions were combined and the solvent evaporated , and the pure product was dissolved in water and lyophilized to give the title compound as a clear , pale yellow solid . 1 hnmr ( cd 3 od , 400 mhz ) δ8 . 78 ( 1h , br s ), 8 . 18 ( 2h , d , j = 8 . 6 hz ), 7 . 86 ( 1h br s ), 7 . 74 ( 1h , br d , j = 8 hz ), 7 . 64 ( 2h , d , j = 8 . 6 hz ), 7 . 56 ( 1h , br d , j = 8 hz ), 7 . 46 ( 1h , br s ), 7 . 44 ( 1h , dd j = 8 , 8 hz ), 4 . 8 ( 1h , m ), 3 . 74 to 3 . 79 ( 9h , m ), 2 . 58 to 2 . 66 ( 2h , m ), 2 . 23 ( 1h , m ), 2 . 12 ( 1h , m ), 2 . 10 ( 3h , s ). fab ms ( m + 1 ) 512 . anal . calc . for c 25 h 29 n 5 o 5 s . 0 . 70 h 2 o . 3 . 30 tfa . found : c , 42 . 12 ; h , 3 . 75 , n , 7 . 91 . the product from step a ( 0 . 045 g , 0 . 0608 mmol ) was dissolved in methanol ( 4 ml ) and 0 . 5 ml of 10 % naoh solution was added to take ph to about 12 . water ( 4 ml ) was added . at 3 h reaction was purified and lyophilized according to the procedure described in step a to the title compound as a white solid . 1 hnmr ( cd 3 od , 400 mhz ) δ8 . 78 ( 1h , br s ), 8 . 18 ( 2h , d , j = 8 . 6 hz ), 7 . 88 ( 1h , br s ), 7 . 75 ( 1h , br d , j = 8 hz ), 7 . 65 ( 2h , d , j = 8 . 6 hz ), 7 . 55 ( 1h , br d , j = 8 hz ), 7 . 46 ( 1h , br s ), 7 . 43 ( 1h , dd , j = 8 , 8 hz ), 4 . 8 ( 1h , m ), 3 . 80 ( 4h , br s ), 3 . 75 ( 2h , br s ), 2 . 58 to 2 . 68 ( 2h , m ), 2 . 27 ( 1h , m ), 2 . 13 ( 1h , m ), 2 . 11 ( 3h , s ). fab ms ( m + 1 ) 498 , anal calc . for c 24 h 27 n 5 o 5 s . 1 . 40 h 2 o + 3 . 20 tfa . found : c , 41 . 16 ; h , 3 . 72 ; n , 8 . 11 . the product from example 1 , step 3 ( 0 . 100 g , 0 . 337 mmol ) was dissolved in dichloroethane ( 5 ml ). p - nitrobenzaldehyde , sodium triacetoxyborohydride ( 0 . 214 g , 1 . 01 mmol ) and crushed molecular sieves were added , and the ph adjusted to 5 . 5 with acetic acid and triethylamine . the reaction was stirred at 20 ° c . overnight , quenched with saturated sodium bicarbonate , and partitioned between ethyl acetate and saturated sodium bicarbonate . the organic phase was washed with 2 % potassium hydrogen sulfate , saturated sodium bicarbonate , saturated brine , and dried over magnesium sulfate . the crude product was purified by silica gel chromatography using 40 % ethyl acetate in hexane . this product was further purified by preparative reverse phase hplc using a gradient elution from 85 % water , 15 % acetonitrile to 20 % water over a period of 40 min . ( solvents contained 0 . 1 % trifluoroacetic acid ). 1 hnmr ( 300 mhz , cdcl 3 ) d 8 . 25 ( 4h , d , j = 8 . 5 hz ), 7 . 92 ( 1h , s ), 7 . 80 ( 1h , d , j = 7 . 6 hz ), 7 . 63 ( 4h , d , j = 8 . 5 hz ). 7 . 53 ( m , 2h ), 7 . 35 ( 1h , d , j = 7 . 3 hz ), 4 . 94 ( 1h , bq , j = 6 . 2 hz ), 3 . 98 ( 4h , s ), 3 . 95 ( 2h , s ), 3 . 82 ( 3h , s ), 2 . 61 ( 2h , t , j = 7 . 3 hz ), 2 . 30 ( 1h , m ), 2 . 19 ( 1h , dt , j = 15 , 7 . 5 hz ), 2 . 11 ( 3h , s ). analysis calculated for c 28 h 30 n 4 o 7 s . 2 . 1 cf 3 co 2 h . 0 . 5 h 2 o : c , 47 . 45 ; h , 4 . 09 ; n , 6 . 87 . found : c , 47 . 44 ; h , 4 . 01 ; n , 6 . 91 . the product from step 1 ( 0 . 025 g ) was hydrolyzed to the acid according to the procedure described in example 1 , step 6 . the title compound was obtained after purification by preparative reverse phase hplc . fab ms m / e ( m + 1 ) 553 ). analysis calculated for c 27 h 28 n 4 o 7 s . 1 . 6 cf 3 co 2 h . 0 . 2 h 2 o : c , 49 . 11 ; h , 4 . 09 ; n , 7 . 59 . found : c , 49 . 10 ; h , 3 . 93 ; n , 7 . 55 . assays of farnesyl - protein transferase . partially purified bovine fptase and ras peptides ( ras - cvls , ras - cvim and ras - cail ) were prepared as described by schaber et al ., j . biol . chem . 265 : 14701 ∞ 14704 ( 1990 ), pompliano , et al ., biochemistry 3l : 800 ( 1992 ) and gibbs et al ., pnas u . s . a . 86 : 6630 - 6634 ( 1989 ), respectively . bovine fptase was assayed in a volume of 100 μl containing 100 mm n -( 2 - hydroxy ethyl ) piperazine - n &# 39 ;-( 2 - ethane sulfonic acid ) ( hepes ), ph 7 . 4 , 5 mm mgcl 2 , 5 mm dithiothreitol ( dtt ), 100 mm [ 3 h ]- farnesyl diphosphate ([ 3h ]- fpp ; 740 cbq / mmol , new england nuclear ), 650 nm ras - cvls and 10 μg / ml fptase at 31 ° c . for 60 min . reactions were initiated with fptase and stopped with 1 ml of 1 . 0m hcl in ethanol . precipitates were collected onto filter - mats using a tomtec mach ii cell harvestor , washed with 100 % ethanol , dried and counted in an lkb [ β - plate counter . the assay was linear with respect to both substrates , fptase levels and time ; less than 10 % of the [ 3 h ]- fpp was utilized during the reaction period . purified compounds were dissolved in 100 % dimethyl sulfoxide ( dmso ) and were diluted 20 - fold into the assay . percentage inhibition is measured by the amount of incorporation of radioactivity in the presence of the test compound when compared to the amount of incorporation in the absence of the test compound . human fptase was prepared as described by omer et al ., biochemistry 32 : 5167 - 5176 ( 1993 ). human fptase activity was assayed as described above with the exception that 0 . 1 % ( w / v ) polyethylene glycol 20 , 000 , 10 μm zncl 2 and 100 nm ras - cvim were added to the reaction mixture . reactions were performed for 30 min ., stopped with 100 μl of 30 % ( v / v ) trichloroacetic acid ( tca ) in ethanol and processed as described above for the bovine enzyme . the compounds of the instant invention were tested for inhibitory activity against human fptase by the assay described above and were found to have ic 50 of & lt ; 100 μm . the cell line used in this assay is a v - ras line derived from either rat1 or nih3t3 cells , which expressed viral ha - ras p21 . the assay is performed essentially as described in declue , j . e . et al ., cancer research 51 : 712 - 717 , ( 1991 ). cells in 10 cm dishes at 50 - 75 % confluency are treated with the test compound ( final concentration of solvent , methanol or dimethyl sulfoxide , is 0 . 1 %). after 4 hours at 37 ° c ., the cells are labelled in 3 ml methionine - free dmem supple - meted with 10 % regular dmem , 2 % fetal bovine serum and 400 mci [ 35 s ] methionine ( 1000 ci / mmol ). after an additional 20 hours , the cells are lysed in 1 ml lysis buffer ( 1 % np40 / 20 mm hepes , ph 7 . 5 / 5 mm mgcl 2 / 1 mm dtt / 10 mg / ml aprotinen / 2 mg / ml leupeptin / 2 mg / ml antipain / 0 . 5 mm pmsf ) and the lysates cleared by centrifugation at 100 , 000 x g for 45 min . aliquots of lysates containing equal numbers of acid - precipitable counts are bought to 1 ml with ip buffer ( lysis buffer lacking dtt ) and immunoprecipitated with the ras - specific monoclonal antibody y 13 - 259 ( furth , m . e . et al ., j . virol . 43 : 294 - 304 , ( 1982 )). following a 2 hour antibody incubation at 4 ° c ., 200 ml of a 25 % suspension of protein a - sepharose coated with rabbit anti rat igg is added for 45 min . the immunoprecipitates are washed four times with ip buffer ( 20 nm hepes , ph 7 . 5 / 1 mm edta / 1 % triton x - 100 . 0 . 5 % deoxycholate / 0 . 1 %/ sds / 0 . 1m nacl ) boiled in sds - page sample buffer and loaded on 13 % acrylamide gels . when the dye front reached the bottom , the gel is fixed , soaked in enlightening , dried and autoradiographed . the intensities of the bands corresponding to farnesylated and nonfarnesylated ras proteins are compared to determine the percent inhibition of farnesyl transfer to protein . to determine the biological consequences of fptase inhibition , the effect of the compounds of the instant invention on the anchorage - independent growth of ratl cells transformed with either a v - ras , v - raf , or v - mos oncogene is tested . cells transformed by v - raf and v - mos maybe included in the analysis to evaluate the specificity of instant compounds for ras - induced cell transformation . rat 1 cells transformed with either v - ras , v - raf , or v - mos are seeded at a density of 1 × 10 4 cells per plate ( 35 mm in diameter ) in a 0 . 3 % top agarose layer in medium a ( duibecco &# 39 ; s modified eagle &# 39 ; s medium supplemented with 10 % fetal bovine serum ) over a bottom agarose layer ( 0 . 6 %). both layers contain 0 . 1 % methanol or an appropriate concentration of the instant compound ( dissolved in methanol at 1000 times the final concentration used in the assay ). the cells are fed twice weekly with 0 . 5 ml of medium a containing 0 . 1 % methanol or the concentration of the instant compound . photomicrographs are taken 16 days after the cultures are seeded and comparisons are made .	2
a preferred embodiment of the present invention will be described with reference to fig3 . the moving optical component ( henceforth referred to as “ lens ”) 1 , is suitably affixed inside the bore of a precisely machined tubular member 2 ( henceforth called “ tube ”). the tube 2 , is suspended from the main support 4 , using stacks 3 , of flat circular flexures 3 a . normally , two stacks 3 , of flexures 3 a , separated by a suitable distance are used . an lvdt ( linear variable differential transducer ) 7 , consisting of a stationary coil assembly 7 a , and a moving ferromagnetic core 7 b , is used as a position sensor . any other sensor such as a capacitive , inductive or optical sensor may be suitably used in place of the lvdt . two views of a flexure stack 3 , are shown in fig4 a and 4 b , and its constituent parts are shown in fig4 c , 4 d and 4 e . two views of another flexure stack 3 , are shown in fig5 a and 5 b , and its constituent parts are shown in fig5 c , 5 d and 5 e . each stack 3 , consists of one or more flexures 3 a , interspersed with spacers 5 , 6 . each rim spacer 5 , is shaped to cover that part of the flexure 3 a , meant to be stationary . it has holes 5 a , which are used to mount the stacks 3 , on the main housing , 4 . each central spacer 6 , has a hole 6 a , which mates with the moving tube 2 . it is shaped to cover that portion of the flexure 3 a , which moves but does not flex . those portions 3 b , ( henceforth called “ flex - arms ”), of the flexure disc 3 a , that are not covered by any of the spacers 5 , 6 , can flex to yield the desired axial motion . the mutual coupling of the flex - arms 3 b , within a flexure 3 a , and also within different flexures 3 a , in the stacks 3 , imparts a very high radial stiffness to the entire assembly , while keeping the axial stiffness relatively low . referring back to fig3 the flexure stacks are spaced apart by the coil mount 8 , of the voice coil 9 , in the moving section and by the main support 4 , in the stationary section . the moving core 7 b , of the lvdt 7 , is then mounted on the moving tube 1 , via core mount 7 c , and the whole moving sub - assembly is clamped tight using nut , 10 . the lvdt core 7 b , is ensured to be nominally co - axial with the lvdt coil assembly 7 a . an axially magnetized permanent magnet 11 , in the shape of a ring is glued into the main housing 4 . the permanent magnet 11 , is made of a high energy density material such as neodymium ferrous boron . a ring shaped pole piece 12 , of magnetically permeable iron alloy , is glued on the magnet . the main housing 4 , which is also made from magnetically permeable iron alloy , acts as the outer pole . thus the annular air gap 13 , between the inner pole piece 12 , and the main housing 4 , contains a radial magnetic field . when the coil 9 , appropriately positioned in the magnetic air gap 13 , is energized by an electrical current , an axial force is induced on it . when the direction of the current is reversed , the force on the coil is also reversed . the above described voice coil motor is thus used to move and position the tube 2 , and the lens 1 , contained in the tube 2 . alternative topologies of a voice coil motor or a multiphase linear motor may be used in place of the voice coil motor described above another lens 14 , meant to be stationary , is affixed inside a precisely machined bore of the lens mount 15 . the bore of the lens mount 15 , is accurately sized such that when assembled properly , the moving tube 2 , enters inside it without touching it . in other words , there exists a very small annular gap 16 , of the order of 10 - 20 micrometers , between the outer cylindrical surface of the moving tube 2 , and the inner cylindrical surface of the bore in the stationary lens mount 15 . firstly , this ensures that the stationary lens 14 , is adequately co - axial with the moving lens 1 , thus facilitating proper optical function . secondly , this simple arrangement also introduces desired damping in the system as follows . when the moving tube 2 , moves towards the stationary lens 14 , the air trapped in between the two lenses 1 and 14 , is compressed . the rise in air pressure above ambient , drives out the air through the narrow annular gap between the moving tube 2 , and the stationary lens mount 15 . the friction generated during the passage of air leads to damping . when the moving tube 2 , moves away from the stationary lens 14 , the air trapped in between the two lenses 1 and 14 , is expanded leading to reduced pressure . this forces air from the ambient into the space between the lenses 1 and 14 , leading to friction damping as explained above . thus any motion of the moving tube leads to flow of air either into or away from the space enclosed between the lenses 1 and 14 , leading to friction damping in proportion to the velocity of the tube . this helps in speeding up the attenuation of the vibration at the end of each stroke , reducing the settling time and speeding up overall operation . it will thus be seen that , at least in its preferred forms , the present invention provides a mechanism for moving an optical component such as a lens using flexure bearings , for use in a wire bonding machine in particular and also in other machines in general . the mechanism is intended to achieve straight line motion of a lens relative to another co - axial lens thus yielding a means whereby the focus of the optical assembly can be altered without manual intervention . the moving part of the mechanism is actuated by a voice coil motor in such a way , that the effective actuating force is nominally co - axial with the moving lens . another object of the present invention is to provide a simple method of damping down undesirable vibrations of the mechanism at the end of its stroke thus facilitating faster operation . the principle features of the present invention may be employed in various embodiments not covered herein , without departing from the scope of the invention .	6
as can be seen in fig1 and 2 , the hanger 1 consists of a monolithic structure of an item made from plastic suitable for its purpose including a body 2 , equipped at the two ends with a clip structure 2 . 1 , suitable for holding one or more lingerie , underwear and similar clothing items , and a hook 3 , which extends upwards from the mid - point of the body 2 and with a lower portion 3 . 1 oriented with an angle to the body 2 which is less than 90 °. the hook 3 has a rear portion which is smooth and coplanar with the rear part of the body 2 and a front part where there is a channel - shaped groove 4 , which extends for the entire longitudinal length of the hook 3 . the groove also extends for the entire length of the body 2 . a tab 5 in the form of an integral protrusion is disposed in the groove 4 at the inclined portion 3 . 1 . the tab 5 extends across the entire width of the channel - shaped groove 4 and is positioned parallel to the body 1 with a lower wall 5 . 1 and , possibly also an upper wall 5 . 2 flat ( see fig7 ). a sizer 10 is fitted onto the hook 2 and blocks itself on the body 1 being kept in position by the tab 5 , in a manner described hereafter . as can be seen in fig5 , the sizer 10 comprises a peripheral wall which defines an open base “ b 1 ” in the lower part and a further open base “ b 2 ” in the upper part to allow the hook 3 of the hanger 1 to pass inside the sizer 10 . the peripheral wall of the sizer 10 is defined by two preferably trapezium - shaped longitudinal walls 11 and by two rectangle - shaped transverse walls 12 , the longitudinal walls 11 having a greater height than the two transverse walls 12 , so as to define a recess 13 suitable for receiving the body 2 of the hanger 1 through lock coupling , when the sizer is positioned . the sizer 10 is equipped with two protrusion bosses 14 and 15 protruding inside the two longitudinal walls 11 which are in contact with the tab 5 of the hook 2 , when the sizer 10 is in position , ensuring , in such a way , that the sizer 10 is blocked onto the hanger . the two protruding bosses 14 and 15 are on the upper part of the two longitudinal walls 11 and are arranged opposite one another and symmetrically with respect to the mid - point “ k ” ( fig6 ) of the upper opening “ b 2 ”. each of the two bosses 14 and 15 has a profile which is tapered towards the lower base “ b 1 ” in order to facilitate the sliding of the sizer 10 over the sides of the hook 3 into the groove 4 as well as over the tab 5 of the hook 2 during the movement towards the body 2 of the sizer 10 . in order to mount the sizer 10 onto the hanger 1 , the open lower base “ b 1 ” of the sizer is positioned above the free tapered part 3 . 2 ( fig3 ) of the hook 3 , which has a thickness which is less than the distance between the projections of the two bosses 14 and 15 of the sizer , which is thus free to move sideways . once a boss 14 of the sizer 10 is positioned inside the channel - shaped groove 4 of the hook 3 , the sizer 10 is guided by the channel - shaped groove 4 . with the continuous movement along the hook 3 , the sizer 10 comes into contact , slides and snaps under the tab 5 , which crosses the channel - shaped groove 4 . in such a final position , the upper surface 14 . 1 of the boss 14 of the sizer is positioned below the lower wall 5 . 1 of the tab 5 of the hook ; in such a way the sizer 10 cannot be moved backwards any longer due to the presence of the tab 5 , which is in the groove 4 and which blocks any upward movement of the sizer 10 . moreover , when the sizer 10 has been snapped into its location , as indicated in fig4 , the body 1 of the hanger is arranged inside the recess 13 , i . e ., the sizer 10 is locked or mounted “ astride ” over the body 1 thus impeding any twisting and / or rotation relative to the aforementioned body 1 . referring to fig8 to 17 , in a second embodiment , the sizer 20 is constructed so as to be slid over the hook 3 of a hanger 1 and then slid laterally into a blocked condition on the hanger . referring to fig1 , the sizer 20 is made up of a peripheral wall defined by two , preferably trapezium - shaped longitudinal walls 21 , and two , rectangular - shaped transverse walls 22 , the two transverse walls 22 having a shorter height than the two longitudinal walls 21 , so as to define a lower recess 23 . 1 , suitable for receiving through lock coupling the body 2 , as shown in fig8 , and an upper recess 23 . 2 , to allow the inclined portion 3 . 1 of the hook 3 to come off , as shown in fig8 , all whilst the sizer 20 is snapped into position . referring to fig8 to 10 , the sizer 20 is equipped with two bosses 24 and 25 protruding inside the two longitudinal walls 21 . when the sizer 20 is in position , one or the other of the two protruding bosses 24 , 25 is in contact with the underside of the tab 5 of the hook 2 , as shown in fig1 , ensuring in such a way that the sizer 20 is blocked onto the hanger body 2 . the two protruding bosses 24 and 25 are on the upper part and at the ends of the two longitudinal walls 21 and are arranged opposite one another and symmetrically with respect to the mid - point “ k ” of the upper opening “ b 2 ” ( see fig1 ). as indicated in fig8 , the protrusion bosses 24 and 25 are spaced apart at a greater distance than the width of the hook 3 of the hanger so that when the sizer 20 is initially slid over the hook 3 , the protrusion bosses 24 and 25 are each disposed outside of the hook as indicated in fig1 . each of the two bosses 24 and 25 has a profile which is tapered in opposite directions to facilitate the sliding on the side of the hook 3 during the side movement of the sizer 20 . as can be seen in fig1 to 17 , in order to mount the sizer 20 onto the hanger 1 , the free end of the hook 3 is fitted onto the sizer , between the two bosses 24 and 25 ; for such a purpose the inner distance between the two longitudinal walls 21 is slightly greater than the thickness of the hook 3 , for which reason the sizer is guided during its sliding along the hook . with the continuous movement along the hook 3 , the sizer 20 comes into contact and locks into the recess 23 . 1 on the body 1 ( fig1 and 16a ) and this prevents any twisting and / or rotation relative to the aforementioned body 1 . with the subsequent horizontal sliding along the body 1 , the sizer 20 slides along the hook 2 and snaps into the tab 5 , which crosses the channel - shaped groove 4 ( fig1 and 17a ). in such a final position , the boss 24 is contained inside the channel - shaped groove 4 and its upper surface is positioned below the lower wall 5 . 1 of the tab 5 of the hook . in this way , the sizer 10 can no longer slide , due to the presence of the tab 5 , which blocks the sizer 20 from above and due to the channel - shaped groove 4 , which blocks the sizer 20 sideways . referring to fig1 , in another embodiment , the sizer 30 sizer is constructed so as to be slid onto a hook of a hanger and blocked in place as in the first embodiment or to be slid onto a hook of a hanger and laterally moved into place as in the second embodiment . as illustrated , the sizer 30 is made up of a peripheral wall defined by two , preferably trapezium - shaped longitudinal walls 31 and made up of two , rectangle - shaped transverse walls 32 , the transverse walls 32 having a shorter height than the two longitudinal walls 31 , so as to define a lower recess 33 . 1 and an upper recess 33 . 2 . the sizer 30 is also equipped with two bosses 34 and 35 that protrude inside the two longitudinal walls 31 and that have a tapered profile 36 towards the lower base and a further tapered profile 37 with a reciprocally opposite direction to facilitate the sliding of the sizer 30 respectively , over the tab 5 of the hook 2 , during movement downward and on the side of the hook 2 , during lateral movement . the invention thus provides a sizer with the preferably trapezium - shaped longitudinal walls 11 , 21 or 31 that have a substantial width and therefore provide a surface that allows indicia thereon to show clearly the size of the garment hanging on the hanger . the sizer 10 , 20 or 30 can be made from any suitable material , preferably from plastic material and the thickness of the longitudinal walls 11 , 21 and 31 , in particular at the bosses 14 , 15 and 24 , 25 as well as 34 , 35 is such as to allow the walls to flex outwards , to allow the bosses to slide over the tab 5 or over the hook 2 , respectively , to snap into the channel - shaped groove 4 of the hook . moreover , since the sizer 10 , 20 , 30 has the bosses 14 , 15 and 24 , 25 , as well as 34 , 35 , opposite each other , the sizer is able to slide above the portion 3 . 1 of the hook 3 which extends angularly from the body 1 , at an angle less than 90 ° and , can be positioned on a hook in either of the two possible positions for display purposes . finally , from what has been described thus far it should be understood that once the sizer 10 , 20 , 30 , has been snapped into its foreseen position , the sizer cannot be easily removed from the hanger . in order to do so , a tool must be inserted inside the sizer , in order to allow the bosses 14 , 15 and 24 , 25 , as well as 34 , 35 of the sizer itself to come out of the groove 4 of the hook 2 . the sizer 10 , 20 , 30 is illustrated and described with respect to a lingerie or underwear hanger ; however , the plastic hanger can be of any suitable construction for various types of garments . the invention further provides a sizer that can easily be mounted on any type of hook or “ nail ”, which extends and takes on its form angularly from any plastic hanger body .	0
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . fig4 illustrates a graph showing an lev 8 opening pulse value vs . compressor starting time period in an lev 8 controlling method for an air conditioner with two compressors 2 , and 4 in accordance with a preferred embodiment of the present invention . in a case of an air conditioner system with two compressors 2 , and 4 , the initial pulse value of the lev 8 in an initial starting of the compressors 2 , and 4 is selected such that the introduction of liquid refrigerant into the compressors 2 , and 4 is minimized , and a target value of the lev pulse to be reached at completion of the initial starting control of the system , and a time period required for reaching to the target value are fixed according to designed . referring to fig4 in a first step 100 when a compressor operation time period reaches to ts - a after the compressors are put into operation , the pulse value of the lev is changed from the initial value to p 1 , where ts denotes a value obtained by multiplying a capacity ratio of the small compressor to a total capacity to a time period t 1 required for reaching to the target value , and ‘ a ’ denotes a time period the pulse of the lev is changed from the initial value to the p 1 . p 1 is a value obtained by multiplying the capacity ratio of the small compressor to a total capacity to the target value of the lev , and adding the initial value thereto . in a second step 200 when the compressor operation time period reaches to tm - b , the pulse value of the lev is changed from p 1 to p 2 , where tm denotes a value obtained by multiplying a capacity ratio of the large compressor to a total capacity to a time period t 1 required for reaching to the target value , and ‘ b ’ denotes a time period the pulse of the lev is changed from the p 1 to p 2 . p 2 is a value obtained by multiplying the capacity ratio of the large compressor to a total capacity to the target value of the lev , and adding the initial value thereto . in a third step 300 when the compressor operation time period reaches to t 1 - c , the pulse value of the lev is changed from p 2 to the target value , where ‘ c ’ denotes a time period the pulse of the lev is changed from p 2 to the target value . in a fourth step 400 , when a preset time period is passed after the pulse value of the lev reaches to the target value , the starting control is ended , and a superheat control is started , to control the pulse of the lev . as has been explained , the method for controlling a linear expansion valve in an air conditioner with two compressors of the present invention requires only two steps of pulse changes during the pulse reaches from the initial value to the target value by controlling the lev by using compressor capacity ratios . variation of compressor suction pressure vs . time in an air conditioner system controlled according to the method of the present invention is illustrated in a solid line in fig3 . it can be known from fig3 that the method of the present invention shows a smaller initial suction pressure drop than the related art , to permit the suction pressure to reach to a proper suction pressure faster than the related art after the compressors are started . thus , the method for controlling a linear expansion valve in an air conditioner with two compressors of the present invention can prevent drop of the suction pressure , and reduction of cooling performance during starting because opening of an lev is varied from an initial value to a target value according to an operation time period of the compressors with reference to capacity ratios of the small compressor , and the large compressor . moreover , as the system can reach to a stable state within a short period after the starting , a system efficiency can be enhanced . it will be apparent to those skilled in the art that various modifications and variations can be made in the method for controlling a linear expansion valve in an air conditioner with two compressors of the present invention without departing from the spirit or scope of the invention . thus , it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .	5
a device and a method for switching processes selectable by keys on a human interface device ( hid ) are described hereinafter for addressing the foregoing problems . for purposes of brevity and clarity , the description of the invention is limited hereinafter to applications related to switching processes selectable by keys on hids ( or key function switching ). this however does not preclude various embodiments of the invention from other applications that require similar operating performance . the fundamental operational and functional principles of the embodiments of the invention are common throughout the various embodiments . exemplary embodiments of the invention described hereinafter are in accordance with fig1 to 7 of the drawings , in which like elements are numbered with like reference numerals . according to an embodiment of the invention , a system for switching processes of a software application executing in a computing device , for instance a personal computer is disclosed hereinafter . the processes are selectable through keys on human interface devices ( hids ) or input devices such as a keyboard 100 shown in fig1 and a mouse 200 shown in fig2 is described hereinafter . the keyboard 100 comprises any key 102 . a user ( not shown ) then uses a switch incorporated on the mouse 200 , such as a switch 202 , to switch the key 102 from a first function to a second function for switching from a first process to a second process of the software application . the first and second functions are preferably already pre - defined and pre - configured to the key 102 . additionally , the first and second functions may be pre - determined by the user before being configured to the key 102 . the keyboard 100 is one of wired and wireless types . a wired keyboard 100 preferably couples and communicates to a computer system ( not shown ) via a communication interface being one of ps / 2 and universal - serial - bus ( usb ). on the other hand , a wireless keyboard 100 preferably couples and communicates to the computer system via a communication interface being one of bluetooth , infrared ( ir ), radio - frequency ( rf ) and wireless usb . further , the keyboard 100 is preferably an ibm - compatible keyboard with a qwerty keyboard layout design . as shown in fig2 , the switch 202 is preferably ergonomically located on the mouse 200 so as to be easily accessible by the user , such as along a side portion of the mouse 200 . alternatively , other usable hids include a trackball , touchpad , digitizing pen , gamepad , graphics tablet and joystick . additionally , the mouse 200 is one of type wired and wireless . a wired mouse 200 preferably couples and communicates to the computer system via a communication interface being one of ps / 2 and universal - serial - bus ( usb ). a wireless mouse 200 however preferably couples and communicates to the computer system via a communication interface being one of bluetooth , infrared ( ir ), radio - frequency ( rf ) and wireless usb . alternatively , the mouse 200 may be coupled directly to the keyboard 100 via one of the wired and wireless means . further , the switch 202 is preferably operable on any computer systems without having to install additional software drivers for the operating systems ( os ) installed on the computer systems . the os is preferably one of microsoft windows , linux , unix and mac osx . typically , different primary functions of the keys 102 arc already pre - associated with different primary processes of a pc game . according to the embodiment of the invention , the user initially uses a software application ( not shown ) for pre - defining and configuring secondary functions corresponding to secondary processes of the pc game to any one of the keys 102 . the user then switches to the secondary functions of the keys 102 whenever required by actuating the switch 202 . hence , the secondary functions of the keys 102 are selected instead when the user actuates the keys 102 . to switch the keys 102 back to the primary functions , the user actuates the switch 202 . alternatively , the secondary functions of the keys 102 are selected when the switch 202 is actuated together with the keys 102 . when the switch 202 is released , the keys 102 revert to the primary functions . additionally , the switch 202 is preferably and alternatively usable in conjunction with any processor - based devices ( not shown ) that have buttons or keys . processor - based devices include gamepads , video gaming consoles , joysticks and the like . the switch 202 then enables functions switching ( from primary functions to secondary functions ) of the buttons or keys of the computer peripheral devices to be achieved by actuating the switch 202 together with the buttons or keys . alternatively , functions switching of the buttons or keys of the processor - based devices are achievable by actuating the switch 202 once to switch to the secondary functions . subsequently , when the primary functions are required again , the switch 202 is then actuated to switch the buttons or keys back to the primary functions . an example illustrating the usage of the switch 202 with the keyboard 100 is as shown in fig3 . in a typical pc game , in - game processes such as shoot , jump , crouch , cast - spell - a , cast - spell - b and cast - spell - c are configurable to any keys 102 of the keyboard 100 . hence , the user may configure the aforementioned six in - game processes to key - one 302 , key - two 304 , key - three 306 , key - four 308 , key - five 310 and key - six 312 , respectively . however , during play of the pc game , key - four 308 , key - five 310 and key - six 312 are not easily accessible by the user . according to the embodiment of the invention , the user can however use the software application to configure shoot , jump and crouch as primary processes and cast - spell - a , cast - spell - b and cast - spell - c as secondary processes to key - one 302 , key - two 304 and key - three 306 , respectively . thus , when the user is playing the pc game , the user simply actuates key - one 302 , key - two 304 and key - three 306 for selecting the shoot , jump and crouch processes , respectively . by actuating the switch 202 , the user then activates the secondary functions of key - one 302 , key - two 304 and key - three 306 . as a result , when the user presses key - one 302 , key - two 304 and key - three 306 during play of the pc game , the cast - spell - a , cast - spell - b and cast - spell - c processes are now respectively selected instead of the shoot , jump and crouch processes . the primary functions of key - one 302 , key - two 304 and key - three 306 may be reverted by actuating the switch 202 again . alternatively , the cast - spell - a , cast - spell - b and cast - spell - c processes arc selectable by actuating the switch 202 together with one of key - one 302 , key - two 304 and key - three 306 , respectively . thus for example , when the switch 202 is actuated together with key - one 302 , the cast - spell - a process is now selected instead of the shoot process . however , when the switch 202 is released , key - one 302 then selects the shoot process again . additionally , the switch 202 also allows alternative processes to be provided to at least one button of the mouse 200 . the alternative processes are preferably programmable by the user . fig4 shows a left button 400 , a scroll button 402 and a right button 404 of the mouse 200 . for example , in a typical pc game , the user is able to configure in - game processes such as attack , jump , cast - spell - a and cast - spell - b to buttons of the mouse 200 . however , due to the lack of buttons available on the mouse 200 , only two of the aforementioned in - game processes are configurable to the buttons of the mouse 200 . according to the embodiment of the invention , the user can however use the software application to configure all four of the aforementioned in - game processes to the buttons of the mouse 200 , in which the four in - game processes are used in conjunction with the switch 202 . the user then configures attack and jump as primary processes to the left button 400 and right button 404 , respectively and cast - spell - a and cast - spell - b as secondary processes to the left button 400 and right button 404 , respectively . by default , when the user actuates the left button 400 or right button 404 on the mouse 200 , the attack or jump process is selected respectively . however , when the user actuates the switch 202 , the secondary processes associated with the left button 400 and right button 404 respectively are selected instead . thus , the cast - spell - a or cast - spell - b process is respectively selected when the user either actuates the left button 400 or right button 404 . yet alternatively , the cast - spell - a and cast - spell - b processes are selectable by actuating the switch 202 together with either the left button 400 or right button 404 , respectively . thus for example , when the switch 202 is actuated together with the left button 400 , the cast - spell - a process is now selected instead of the attack process . however , when the switch 202 is released , the left button then selects the attack process again . fig5 shows another keyboard 500 of the conventional type . the keyboard 500 is an enhanced version of the keyboard 100 of fig1 in which the keyboard 500 is incorporated with multimedia function buttons 502 such as volume buttons , a play button , a fast - forward button and a reverse button , in addition to the available conventional keys 504 . typically , a conventional keyboard such as the keyboard 500 is pre - built with modifier keys such as “ ctrl ”, “ alt ” and “ shift ” keys 506 . the switch 202 of the mouse 200 is programmable and configurable to take on functionality of one of the “ ctrl ”, “ alt ” and “ shift ” keys 506 . hence , when the user actuates the switch 202 on the mouse 200 , the switch 202 now emulates the functionality of one of the “ ctrl ”, “ alt ” and “ shift ” keys 506 . the switch 202 is then usable in combination with the keys 504 to form shortcut keys for accessing different pre - defined in - game processes . configuring the shortcut keys allows the user quicker access to the in - game processes without having to position their hands in a non - ergonomic manner on the keyboard 500 during game play . in addition , due to the ergonomic positioning of the shortcut keys , the user is less likely to incur computer - related injuries resulting from prolong usage of the computer system such as carpal tunnel syndrome ( cts ). alternatively , the switch 202 is usable in combination with the keys 504 to form shortcut keys for accessing different pre - defined in - program processes of a computer animation application . examples of the in - program processes are drawing , colouring , animating and sound effects features of the computer animation application . in this manner , the in - program processes are configured such that each of the in - program processes is activated through actuating a corresponding pre - defined key 504 on the keyboard 500 in conjunction with the switch 202 . additionally , the switch 202 is also programmable using a software application 600 as shown in fig6 . the software application 600 enables the configuration of the switch 202 together with keys of a hid such as the keyboard 500 of fig5 . hence , a unique code corresponding to the configuration of actuating at least one of the keys 504 in conjunction with the switch 202 is pre - definable by the user . the unique code is then stored in a “ shortcut - key ” profile on the computer system . alternatively , the “ shortcutkey ” profile is stored on the mouse 200 . additionally , the unique code is also associated with a software application . whenever the computer system detects an activation corresponding to the unique code , the software application is then activated by the computer system . the unique code is activatable by the keyboard 500 whenever the user actuates the switch 202 in conjunction with a pre - defined key selected from one of the keys 504 . the software application 600 comprises the respective options : a key , a launch - application and a load -“ shortcut - key ”- profile respectively . the key option specifies one of the keys 504 . the launch - application option allows the user to define a software application to be activated upon detection of the unique code corresponding to the usage of the shortcut keys . lastly , the load -“ shortcut - key ”- profile option allows the user to decide whether the “ shortcut ” profile is to be loaded into computer memory by the computer system upon system startup . according to another embodiment of the invention , a hardware implementation 700 for the mouse 200 is shown in fig7 . the hardware implementation 700 comprises a signal detector 702 , a first controller 704 , memory 706 , a microprocessor 708 , a second controller 710 and a signal transmitter 712 . the signal detector 702 contains sensing circuitry to detect if the mouse 200 receives any input signals . the received input signals are then forwarded to the first controller 704 , which processes requests of sending and storing of received input signals into the memory 706 . the memory 706 serves as a storage space to temporarily store the received input signals before subjecting the received input signals to further processing by the microprocessor 708 . the memory 706 is preferably one of semiconductor memory devices such as static and dynamic random access memory ( ram ) and flash devices . the microprocessor 708 is responsible for processing the received input signals to derive digital information such as coordinates of current position of the mouse 200 . subsequently , the microprocessor 708 sends the digital information to the second controller 710 , which processes organization of the digital information before transmitting the digital information as output signals . lastly , the signal transmitter 712 transmits the digital information to the computer system via the communication interface to which the mouse 200 couples and communicates . in the foregoing manner , a system and a method for switching processes selectable by keys on human interface devices are described according to embodiments of the invention for addressing at least one of the foregoing disadvantages . although a few embodiments of the invention are disclosed , it will be apparent to one skilled in the art in view of this disclosure that numerous changes and / or modification can be made without departing from the scope and spirit of the invention . example 1 is a method for switching processes performable by the computing device in a human interface device communicable with a computing device , the method comprising the steps of : detecting actuation of a switch on the human interface device ; and communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch , wherein each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key . in example 2 , the subject matter of example 1 can optionally include that the step of detecting actuation of the switch on the human interface device comprises the step of detecting actuation of a switch on an input device . in example 3 , the subject matter of example 2 can optionally include that the step of detecting actuation of the switch on the input device comprises the step of detecting actuation of a switch on a mouse . in example 4 , the subject matter of example 1 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of an input device . in example 5 , the subject matter of example 4 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of a keyboard . in example 6 , the subject matter of example 1 can optionally include the step of detecting deactuation of the switch . in example 7 , the subject matter of example 6 can optionally the step of communicating with the computing device for switching from the second process selectably performable by the computing device to the first process selectably performable by the computing device in response to the deactuation of the switch . in example 8 , the subject matter of example 1 can optionally include that the step of communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch comprises the step of communicating with the computing device for switching from a first in - game process selectably performable by the computing device to a second in - game process selectably performable by the computing device in response to the actuation of the switch . in example 9 , the subject matter of example 8 can optionally include the step of detecting deactuation of the switch . in example 10 , the subject matter of example 9 can optionally include the step of communicating with the computing device for switching from the second in - game process selectably performable by the computing device to the first in - game process selectably performable by the computing device in response to the deactuation of the switch . in example 11 , the subject matter of example 1 can optionally include that the switch is disposed on a mouse and the at least one process selection key is disposed on a keyboard . in example 12 , the subject matter of example 11 can optionally include that the first and second processes selectably performable by the computing device are switchable by actuation of one of shift ( shift ), alternate ( alt ) and control ( ctrl ) keys disposed on the keyboard and selectable by actuation of the at least one process selection key . in example 13 , the subject matter of example 1 can optionally include the step of communicating with the computing device for configuring at least one of the first and second processes selectably performable by the computing device for selection by actuation of the at least one process selection key , wherein an association between the at least one of the first and second processes and the at least one process selection key is definable in a configuration profile storable on at least one of the human interface device and the computing device . example 14 is a human interface device communicable with a computing device , the human interface device comprising : a switch actuable by a user of the human interface device ; and a communication interface for communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch , wherein each of the first and second processes selectably performable by the computing device is configurably selectable by at least one process selection key actuable by the user of the human interface device . in example 15 , the subject matter of example 14 can optionally include that the human interface device is an input device . in example 16 , the subject matter of example 15 can optionally include that the input device is a mouse . in example 17 , the subject matter of example 14 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by at least one process selection key of an input device actuable by the user of the human interface device . in example 18 , the subject matter of example 17 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by at least one process selection key of a keyboard actuable by the user of the human interface device . in example 19 , the subject matter of example 14 can optionally include that the switch is deactuable by the user of the human interface device . in example 20 , the subject matter of example 19 can optionally include that the communication interface is for communicating with the computer device for switching from the second process selectably performable by the computing device to the first process selectably performable by the computing device in response to the deactuation of the switch . in example 21 , the subject matter of example 14 can optionally include that the communication interface for communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch is for communicating with the computing device for switching from a first in - game process function selectably performable by the computing device to a second in - game process selectably performable by the computing device in response to the actuation of the switch . in example 22 , the subject matter of example 21 can optionally include that the switch is deactuable by the user of the human interface device . in example 23 , the subject matter of example 22 can optionally include that the communication interface is for communicating with the computing device for switching from the second in - game process selectably performable by the computing device to the first in - game process selectably performable by the computing device in response to the deactuation of the switch . in example 24 , the subject matter of example 14 can optionally include that the switch is disposed on a mouse and the at least one process selection key is disposed on a keyboard . in example 25 , the subject matter of example 24 can optionally include that the first and second processes selectably performable by the computing device are switchable by actuation of one of shift ( shift ), alternate ( alt ) and control ( ctrl ) keys disposed on the keyboard and selectable by actuation of the at least one process selection key . in example 26 , the subject matter of example 14 can optionally include that the communication interface communicates with the computing device providing a software interface for configuring at least one of the first and second processes selectably performable by the computing device for selection by actuation of the at least one process selection key , wherein an association between the at least one of the first and second processes and the at least one process selection key is definable in a configuration profile storable on at least one of the human interface device and the computing device . example 27 is a method for switching processes performable by the computing device , in a computing system comprising a computing device communicatively couplable to a human interface device , the method comprising the steps of : detecting actuation of a switch on the human interface device ; and providing communication between the human interface device and the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch , wherein each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key . in example 28 , the subject matter of example 27 can optionally include that the step of detecting actuation of the switch on the human interface device comprises the step of detecting actuation of a switch on an input device . in example 29 , the subject matter of example 28 can optionally include that the step of detecting actuation of the switch on the input device comprises the step of detecting actuation of a switch on a mouse . in example 30 , the subject matter of example 27 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of an input device . in example 31 , the subject matter of example 30 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of a keyboard . in example 32 , the subject matter of example 27 can optionally include that the method for switching processes performable by the computing device further comprises the step of detecting deactuation of the switch . in example 33 , the subject matter of example 32 can optionally include that the method for switching processes performable by the computing device further comprises the step of communicating with the computing device for switching from the second process selectably performable by the computing device to the first process selectably performable by the computing device in response to the deactuation of the switch . in example 34 , the subject matter of example 27 can optionally include that the method for switching processes performable by the computing device having the step of communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch comprises the step of communicating with the computing device for switching from a first in - game process selectably performable by the computing device to a second in - game process selectably performable by the computing device in response to the actuation of the switch . in example 35 , the subject matter of example 34 can optionally include that the method for switching processes performable by the computing device further comprises the step of detecting deactuation of the switch . in example 36 , the subject matter of example 35 can optionally include that the method for switching processes performable by the computing device further comprises the step of communicating with the computing device for switching from the second in - game process selectably performable by the computing device to the first in - game process selectably performable by the computing device in response to the deactuation of the switch . in example 37 , the subject matter of example 27 can optionally include that the switch is disposed on a mouse and the at least one process selection key is disposed on a keyboard . in example 38 , the subject matter of example 37 can optionally include that the first and second processes selectably performable by the computing device are switchable by actuation of one of shift ( shift ), alternate ( alt ) and control ( ctrl ) keys disposed on the keyboard and selectable by actuation of the at least one process selection key . in example 39 , the subject matter of example 27 can optionally include that the method for switching processes performable by the computing device further comprises the step of communicating with the computing device for configuring at least one of the first and second processes selectably performable by the computing device for selection by actuation of the at least one process selection key , wherein an association between the at least one of the first and second processes and the at least one process selection key is definable in a configuration profile storable on at least one of the human interface device and the computing device . example 40 is a machine readable medium having stored therein a plurality of programming instructions , which when executed , the instructions cause a computing device to perform the step of : detecting actuation of a switch on a human interface device communicable with the computing device ; and providing communication between the human interface device and the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch , wherein each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key . in example 41 , the subject matter of example 40 can optionally include that the instructions cause the computing device to perform the step of detecting actuation of the switch on the human interface device comprises the step of detecting actuation of a switch on an input device . in example 42 , the subject matter of example 41 can optionally include that the instructions cause the computing device to perform the step of detecting actuation of the switch on the input device comprises the step of detecting actuation of a switch on a mouse . in example 43 , the subject matter of example 40 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of an input device . in example 44 , the subject matter of example 43 can optionally include that each of the first and second processes selectably performable by the computing device is configurably selectable by actuation of at least one process selection key of a keyboard . in example 45 , the subject matter of example 40 can optionally include that the instructions cause the computing device to further perform the step of detecting deactuation of the switch . in example 46 , the subject matter of example 45 can optionally include that the instructions cause the computing device to further perform the step of communicating with the computing device for switching from the second process selectably performable by the computing device to the first process selectably performable by the computing device in response to the deactuation of the switch . in example 47 , the subject matter of example 40 can optionally include that the instructions cause the computing device to perform the step of communicating with the computing device for switching from a first process selectably performable by the computing device to a second process selectably performable by the computing device in response to the actuation of the switch comprises the step of communicating with the computing device for switching from a first in - game process selectably performable by the computing device to a second in - game process selectably performable by the computing device in response to the actuation of the switch . in example 48 , the subject matter of example 47 can optionally include that the instructions cause the computing device to further perform the step of detecting deactuation of the switch . in example 49 , the subject matter of example 48 can optionally include that the instructions cause the computing device to further perform the step of communicating with the computing device for switching from the second in - game process selectably performable by the computing device to the first in - game process selectably performable by the computing device in response to the deactuation of the switch . in example 50 , the subject matter of example 40 can optionally include that the switch is disposed on a mouse and the at least one process selection key is disposed on a keyboard . in example 51 , the subject matter of example 50 can optionally include that the first and second processes selectably performable by the computing device are switchable by actuation of one of shift ( shift ), alternate ( alt ) and control ( ctrl ) keys disposed on the keyboard and selectable by actuation of the at least one process selection key . in example 52 , the subject matter of example 40 can optionally include that the instructions cause the computing device to further perform the step of communicating with the computing device for configuring at least one of the first and second processes selectably performable by the computing device for selection by actuation of the at least one process selection key , wherein an association between the at least one of the first and second processes and the at least one process selection key is definable in a configuration profile storable on at least one of the human interface device and the computing device .	6
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which some examples of the embodiments of the inventions are shown . indeed , these inventions may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided by way of example to better describe the present invention . “ vibrato device ” as used herein refers to a device that may be used to change the tension of strings in a musical instrument . in some embodiments of the present invention , the vibrato device can include a pivoting bridge element and a mounting plate that may be attached to the flat surface of a telecaster style guitar . “ whammy bar ” as used herein refers to a device component of a vibrato device that can facilitate the application of force to pivoting bridge mechanical element of said vibrato device . for example , it can include a protruding bar that is conveniently located in proximity to the playing surface of the musical instrument . in some embodiments , the whammy bar may incorporate electrical components or additional mechanical components , such as an electrical switch that can act as a locking mechanism or a tune / pitch control . for example , an electrical strain gage that could electrically change the tone of the guitar . referring now to fig1 , an exemplary vibrato device of the present invention is illustrated 101 . at 102 , the mounting of said exemplary vibrato device is depicted . preferably , the mounting plate can be a metal piece , carbon fiber or composite that can be attached to the existing holes of a generally flat surface of the instrument using a plurality of screws as depicted in fig2 . fig1 shows pivot bolts may include one or more jacking pivot axis bolts that allow for the mounting and / or adjustment of a pivoting bridge element 103 ( further described in fig2 and 5 ) of the vibrato device . further , the bolts depicted may be inserted in holes 108 in the mounting plate 102 which are aligned with existing holes in some musical instruments so that no permanent modification to the instrument is required . in other embodiments , the four mounting screws for the telecaster can be hidden under the bridge . at 104 , one or a plurality of saddles used to attach the individual strings of the instrument is depicted . in the exemplary embodiment , traditional saddles that can allow for individual height adjustments and intonation adjustments are depicted being attached to the pivoting bridge element . however , they may be attached to another piece that can accommodate the individual saddles and additionally be easily fixed to the pivoting bridge element . this would facilitate the replacement or the pivoting bridge element for another that has different a different tension and affects pitch differently , as it may be desired . at 111 , a plurality screws are depicted . the screws can function in some embodiments as tension spring adjustment screws . the tension spring adjustment screws can attach the fixed portion , in relation to the metal plate , of the pivoting bridge element to the mounting plate . additionally , by fastening the screws at a different level , the degree of pivoting and “ whammy ” tension may be controlled to a certain degree . for example , each saddle can support an individual string centered in each saddle utilizing a shallow notch , preferably 1 mm . said saddle can include means for adjusting its height above said bridge element . this feature can be two or more threaded holes through the surface perpendicular to the musical instrument &# 39 ; s mounting surface , to receive the threaded fasteners allowing individual height adjustment of the said saddles . the said spring tension adjustment screws are fastened to the said springs in the said mounting plates through the clearance holes of the said pivoting bridge element . these screws adjust the tension of the said tension springs , counteracting the musical instrument &# 39 ; s strings tension . the head of the fastener can be an adjustment feature such as a socket head , slot or phillips screw head allows for spring tension adjustment . attached to a pivoting element within the pivoting bridge element of the vibrato system , at 107 a whammy bar is depicted . the whammy bar can include any desired feature , such as the geometric shape depicted at 106 , to enable or facilitate the use of the whammy bar while playing the musical instrument . in some embodiments , the whammy bar may be metal or any rigid material . the whammy bar may be inserted into a tension bushing feature . this bushing feature can be utilized for mechanically changing the pitch of the said pivoting bridge element . therefore changing the pitch , tune or note of the all of the said strings of the musical instrument . when the whammy bar is released the said tension springs return the said pivoting bridge element to it &# 39 ; s original position . thus bringing the musical instrument back into tune . referring now to fig2 , the underside of a pivoting bridge element is depicted . at 205 , two flush tension springs are depicted in the exemplary embodiment . however , the pivoting bridge element may include one , or three or more to provide a desired tension . the tension may also be varied by the thickness or material used for the pivoting bridge element springs . at 209 and 210 , two pivot bolts are depicted with threaded apertures next to them for existing wood screws of the guitar . the apertures may go through both the mounting plate and pivoting bridge element or only in the mounting plate depending on the configuration desired . referring now to fig3 , a cross section side view of the exemplary device of fig1 is depicted . at 315 , intonation holes are depicted . said intonation holes can be threaded in the saddle and adjusted by a screw or bolt from the back of the bridge or as the exemplary embodiment depicts a threaded hole in the bridge and with each saddle has a clearance hole and a button head socket screw inside the saddle which adjust the intonation . additionally , in some embodiments one of the holes in the saddle may have a small pin going through it so when the bridge is rotated forward , the string can stay seated . a tension spring that can also help intonation going through the pivoting bridge element 303 is depicted at 311 . the pivoting bridge element includes a saddle 304 supporting an individual string centered and utilizing a shallow notch . also depicted in the cross section , at holes in the plate 308 can accommodate said bolts in fig1 at 108 wherein a feature , such as the v - cut depicted , can allow the pivoting element to move with minimal friction in relation to the fixed mounting plate . one or more other holes may also be designed to receive the said friction bushing which is non - rigidly attached to constrains the whammy bar in rotation from the holes axis and in translation from the holes axis allowing rotation around an axis . this one or more holes are located on the surface perpendicular to the musical instrument &# 39 ; s mounting surface with a threaded hole intersecting the said friction bushing hole from aft surface perpendicular to the orientation of the strings . the forward edge of the said pivoting bridge element which contacts the said jacking pivot axis bolts , can utilize two notched knife edge features to allow minimal friction and a single degree of freedom for a pivotal motion . the said pivoting bridge element is designed to utilize side walls parallel the orientation of the said strings to prevent lateral motion of the said saddles . further , the saddles can be used as a string suspension system and are attached to the said pivoting bridge element constrained by the said intonation and / or mounting screws and said flush tension spring ( s ). the said saddle allows enough clearance to use a standard tool to adjust the axial saddle position parallel with the string . the said saddle is designed to receive the spool end of a musical instrument &# 39 ; s string . this can be accomplished by a double notch feature for said string ends . as a result , this vibrato device can eliminate the threading of strings through the musical instrument &# 39 ; s body . referring to fig4 , in one exemplary embodiment , the mounting plate 405 comprises a rearward walled section and a forward open center section . the rear walled section can assist in the positioning of the pivoting bridge element to prevent it from snapping out of place . in some embodiments , it may be required that the forward section of the mounting plate does not include the side wall feature to prevent it from interfering with the strings ( not depicted ) which are positioned right above it from the pivoting bridge element 401 . additionally , as it will be apparent to a person in the ordinary skill in the art , the whammy bar 415 and the saddles 410 may include many already commercially available parts as they may be easily removed in some embodiments . further , it will also be apparent to a person of the ordinary skill in the art , that in some embodiments of the present invention it may just be a plate holding the pivot bolts , mounting screws and springs allowing it to be a one piece device which may be desirable for some stringed musical instruments . however , in the preferred embodiments , the vibrato system device can include the two piece device system depicted in fig4 or one with more pieces as it may be desired , to provide a bendable part and a rigid spring piece . referring now to fig5 , an exemplary embodiment of the pivoting bridge element , 505 and 510 , of the vibrato device is depicted separated from the mounting plate 501 . at 510 a fixed plate is depicted . in this particular exemplary embodiment the fixed plate can be glued or fixed to a spring plate 505 . however , one plate may comprise both the fixed plate and the spring plate as depicted in fig5 a at 500 a . other variations can include separate plates which may be attached , screwed , glued or welded . for example , other separate plate configurations that may be used can include configurations depicted in fig5 b and 5c at 500 b and 500 c respectively . referring back to fig5 , the exemplary two piece component can allow the apparatus to pivot on the said jacking pivot axis bolts allowing the musical instrument &# 39 ; s strings to change tune or pitch . the said pivoting bridge element is equipped with clearance holes through the aft surface parallel to the orientation of the said string through the surface parallel to the musical instrument &# 39 ; s mounting surface . these holes can allow for the attachment of the spring tension adjustment screws to the pivoting bridge element . also in some embodiments , another set of threaded holes through the aft surface perpendicular to the orientation of the said string with the said hole axis being parallel to the axis of the said string may be included . these holes can be designed to receive intonation / mounting screws and said compression springs to constrain the said saddles in the axis being parallel to the axis of the said string . on a surface parallel to the musical instrument &# 39 ; s mounting surface there may be clearance holes to allow the said wood screws clearance for head protrusion .	6
detailed descriptions of the preferred embodiment are provided herein . it is to be understood , however , that the present invention may be embodied in various forms . therefore , specific details disclosed herein are not to be interpreted as limiting , but rather as a basis for the claims and as a representative basis for teaching one skilled in the art to employ the present invention in virtually any appropriately detailed system , structure or manner . turning first to fig1 there is shown a typical chlorosilane production reactor , 100 , which produces an effluent , 101 , comprising a mixture of solids and gases including , but not limited to , powdered silicon and other solids , chlorosilanes , hydrogen , hydrogen chloride , aluminum chloride and other metal chlorides . this stream , 101 , enters a solid removal means , 102 , such as a cyclone or filter system , from which most of the solids are discharged in a stream , 103 . however , sufficient solids , which serve as an external source of seeds , remain in a cleaned gas stream , 104 . the cleaned gas , 104 , is then cooled by a heat removal means , 105 , such as a heat exchanger or cooling system , wherein a portion of the cleaned gas stream , 104 , is condensed to form a stream , 106 , which contains solids , liquids and gases . this stream , 106 , then enters an initial gas separator / crystallizer , 107 . a gas stream , 112 , is cooled in a heat removal system , 113 , which has a coolant supply , 118 , and a return , 119 . the gas stream , 112 , now comprising mostly hydrogen and hydrogen chloride , leaves the initial gas separator / crystallizer , 107 , to be recycled . the liquids and solids are collected in the bottom of the initial gas separator / crystallizer , 107 , where they are mixed by an agitator , 108 , to keep the solids suspended in the liquid and to mix in a possible recycle stream , 152 , which can provide additional seed if needed . the mixture of liquid and solids in a stream , 120 , exits the initial gas separator / crystallizer 107 and enters a further heat removal means , 121 , such as a heat exchanger or cooling system , resulting in the formation of a supersaturated solution , 122 , and further crystallization on the seeds suspended in the solution , 122 . the supersaturated solution , 122 , then passes through a control valve , 123 , and exits as a lower pressure stream , 124 , which enters a second gas separator / crystallizer , 125 . any released gas and vapor , 128 , goes overhead , and then through a control valve , 129 , which maintains the pressure in the second gas separator / crystallizer , 125 . a reduced pressure gas stream , 170 , then enters a first chlorosilane distillation column , 160 . the liquids and solids entering the second gas separator / crystallizer , 125 , are retained in its bottom section and mixed with an agitator , 126 . a slurry , 127 , leaves the second gas separator / crystallizer , 125 , and enters a first solids separation means , such as a liquid cyclone or filter , 130 . the majority of the solids exit in a solids stream , 131 , together with some liquid chlorosilanes . this stream is then further processed in a second solids separation means , such as a liquid cyclone or filter , 132 , to further concentrate the solids in a high solids stream , 140 , and additional useful chlorosilanes are recovered in a primarily liquid stream , 133 . the high solids stream , 140 , is discharged through a valve , 141 , directly into a waste tank , 142 , which is agitated by an agitator , 143 , and heated by a jacket , 147 , which in turn has a heating supply , 148 , and a return stream , 149 . a liquid and solids stream , 144 , is sent for disposal or further treatment . a vapor stream , 145 , can also be sent for disposal or further treatment . an additional waste stream , 146 , is shown entering the tank from elsewhere in the facility . a recovered liquid chlorosilanes with reduced solids stream , 136 , exits the first solid separation means , 130 , and passes through a control valve , 137 , to form a lower pressure stream , 138 . the recovered liquid chlorosilanes with reduced solids stream , 133 , exits the second solid separation means , 132 , and passes through a control valve , 134 , to form a lower pressure stream , 135 . both streams merge to form a liquid feed stream , 139 , for the distillation column , 160 , which typically operates at 2 - 10 bar . the purified trichlorosilane , with a typical aluminum concentration of less than 1 ppb , exits in a stream 161 , the remaining alcl 3 exits in a bottoms stream , 162 , with a typical concentration of 30 - 100 ppm . the feed stream , 139 , may be heated by an optional feed heater , 163 , to form a heated stream , 159 , prior to entry into the column , 160 , as is common distillation practice . it is also possible to recycle some of the slurry from the second gas separator / crystallizer , 125 , by the provision of an additional suction line , 150 , a pump , 151 , and a discharge line , 152 . further modifications are possible to serve the same purposes . for example , a compressor , 164 , may be used to reduce the pressure in the second gas separator / crystallizer , 125 , and thus cause cooling as the liquid is evaporated ; this would also require the use of a pump ( not shown ) to pressurize the slurry stream , 127 . the control valve , 123 , may be located in front of the cooling means , 121 . in an example of the application of the process according to fig1 , there is shown a mass balance in table 1 . the reactor , 100 , operates at 30 bar and the solid removal means , 102 , is a cyclone with an efficiency of 96 % which produces 0 . 03 kg / hr of seed in the effluent . the mixture of gas and seed is cooled in a shell and tube heat exchanger , 105 , which recovers heat for the process and then enters the initial degasser / crystallizer , 107 , which is a pressure vessel with one hour residence time with a magnetic drive agitator , 108 . the outlet liquid stream , 120 , typically contains impurities in concentrations as shown in table 2 in addition to the chlorosilanes and methyl chlorosilanes . the heat removal means , 121 , is a shell and tube heat exchanger with internally polished or teflon coated tubes to reduce sticking . the outlet temperature is preferably maintained between 40 - 60 ° c . to ensure it is below the melting point of the alcl 3 . ph 3 adduct , which is 83 ° c . the second degasser / crystallizer , 125 , is a pressure vessel also of one hour residence time with a lower pressure of 10 bar and is agitated with a similar magnetic drive agitator , 126 . it should be noted that both agitators also generate seed by causing impact of the existing seed crystals with the agitator blade , the vessel wall and the seeds themselves . the crystal size distribution can thus be controlled within the preferred size range of 5 to 200 microns . the slurry , 127 , is fed to the first solids removal device , 130 , which is a liquid cyclone or hydroclone , which uses the liquid pressure to spin the liquid and remove the solids in a manner analogous to the more common gas cyclones . in order to achieve the high efficiency of about 98 %, four 1 inch diameter liquid cyclones are manifolded together in a common pressure vessel . operation is continuous and controlled by the control valves 137 and 134 which adjust the pressure differential and hence the flow splits . erosion in the cyclones is reduced by use of very hard alumina ceramics on the walls and / or the exit nozzles and provision of easily replaceable wear parts . the second solids removal device , 132 , is also a hydroclone but has only one liquid cyclone of ½ inch diameter and a solids accumulator which allows the build up of a high solids concentration ( typically 40 % by weight ) with periodic discharge of the solids , typically every 4 - 16 hours . the liquid discharge is still continuous even during solids discharge . the waste tank , 142 , receives some other waste , 146 , which is low in solids but has other impurities such as titanium tetrachloride and boron trichloride . the jacket , 147 , is heated by 150 psig steam , 148 , and there is a condensate stream , 149 . a vapor stream , 145 , and liquid / solids stream , 144 , are sent for further processing . the waste tank , 142 , isolates the solids which can contain the phosphorus adducts and prevents the return of phosphorus to the system even if some phosphorus is released . it can be seen from table 1 that the solids stream , 140 , has only 1 kg / hr of solids . therefore , even if the hydroclone , 132 , is only emptied at the maximum discharge time period , once every 16 hours , the maximum solids content is only 16 kg ; thus the chance of a significant phosphorus spike is minimized . turning to fig2 it can be seen that the solubilities of aluminum chloride , alcl 3 , are fairly linear when the log of the mole fraction is plotted against the reciprocal absolute temperature . it is of importance that the solubility in trichlorosilane ( tcs ) is one - third to one - quarter of the solubility in silicon tetrachloride ( stc ). thus the solubility of alcl 3 is dependent on the temperature and the mole fractions of tcs and stc in the mixture of chlorosilanes . it is important to establish that the alcl 3 stays in solution throughout the distillation column , 160 , when fed with the calculated feed concentration of alcl 3 . a convenient way to do this is to first use a stage by stage distillation column program , with standard properties for chlorosilane and aluminum chloride based on the assumption that the alcl 3 is dissolved , in order to establish the ideal alcl 3 , tcs and stc concentrations at every stage . second , confirm that the alcl 3 concentration remains below the solubility limit based on temperature and composition . it is important to note that the solid phase alcl 3 exerts its full vapor pressure while the dissolved alcl 3 exerts its vapor pressure based on its concentration multiplied by the full vapor pressure of the liquid alcl 3 . a simple check is to ensure that the bottoms stream 162 , which contains essentially all the alcl 3 in the column , can keep it in solution . from stream 159 the amount of alcl 3 is 1 . 35e − 3 kg moles and the stc is 28 . 8 kg moles . this is a concentration of 4 . 69e − 5 . the minimum temperature , from the equations in fig2 , is as follows . therefore , the minimum temperature of the bottoms stream , 162 , is 73 . 8 ° c . thus the tower operating pressure can be set to ensure the bottoms temperature is above this minimum temperature . the pressure in this example is 8 bar and the bottom temperature would be between 140 - 150 ° c . which is well above the required temperature . the minimum required pressure would be 1 . 6 bar assuming 100 % stc in the bottoms stream , 162 . it will be obvious to one skilled in the art that similar calculations can be performed for other column designs , such as using side draws . a further step is to check that the incoming feed stream , 159 , is free of suspended solids . at the feed stream temperature of 81 . 7 ° c . ( 354 . 85 k ) the solubility , from the equations in fig2 , is as follows . the further step is to multiply the respective molar solubility by the number of moles of stc and tcs ( see table 1 , stream 139 ), then sum those results to obtain the maximum number of moles of alcl 3 that can be dissolved in the stream . kg moles alcl3 dissolved in stc = 5 . 14 e − 5 * 28 . 8 = 1 . 48 e − 3 kg moles alcl3 dissolved in tcs = 1 . 43 e − 5 * 10 . 8 = 1 . 54 e − 4 turning to table 1 , stream 139 , there is a suspended alcl 3 content of 2 . 28 e − 4 kg moles and a dissolved alcl 3 content of 1 . 12e − 3 kg moles for a total alcl 3 content of 1 . 348 e − 3 kg moles . the ratio of the maximum alcl 3 dissolved content for composition of stream 139 at 81 . 7 ° c ., 1 . 634e − 3 kg moles , to actual alcl 3 content in stream 139 , 1 . 348 e − 3 kg moles , is 1 . 21 which provides sufficient driving force to dissolve the very fine particles which have carried through the solids separation devices within the residence time provided by the heater , 163 and the connecting piping to the distillation column , 160 . lower driving forces may be sufficient with longer residence times and vice versa . while the invention has been described in connection with a preferred embodiment , it is not intended to limit the scope of the invention to the particular form set forth , but on the contrary , it is intended to cover such alternatives , modifications , and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims . ** these may be present in the copper catalyst which is usually added to the metallurgical grade silicon , in which case the concentrations could be higher .	2
advantages of the present invention will become more apparent from the detailed description given hereinafter . however , it should be understood that the detailed description and specific examples , while indicating preferred embodiments of the invention , are given by way of illustration only , since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description . the invention provides a process for production and purification of rubusoside . in one embodiment of present invention , the process of the isolation and purification begins with providing stevioside derived from stevia rebaudiana extract , containing 90 - 100 %, preferably 95 - 99 % ( on dry basis ) stevioside . stevioside is dissolved in water to obtain a solution with 1 - 50 %, preferably 5 - 30 %, more preferably 8 - 10 % ( wt / vol ) concentration . the ph of the solution is adjusted to ph 3 . 0 - 8 . 0 preferably ph 4 . 5 - 6 . 5 and the temperature is maintained at 28 - 50 ° c ., preferably 35 - 45 ° c . an enzyme with glycosyl hydrolase activity is added to solution to make reaction mixture . non - limiting examples of enzymes include , rhamnosidase , β - glucosidase , hesperidinase , naringinase , pectinase , cellulase , and others , in free or immobilized forms . the reaction mixture is maintained at ph 3 . 0 - 8 . 0 preferably ph 4 . 5 - 6 . 5 and the temperature is maintained at 28 - 50 ° c ., preferably 35 - 45 ° c ., for about 12 - 24 hours , or long enough to allow the desired degree of conversion of stevioside to rubusoside occur . upon completion the reaction mixture is boiled at 100 ° c . for 10 - 30 min to inactivate the enzyme and then filtered with activated carbon and spray dried . alternatively the mixture can be additionally treated with ion exchange resins , purified by macroporous adsorption resins , membranes etc . the spray dried reaction mixture can be used “ as - is ” or subjected to further purification to prepare high purity rubusoside . for further purification the spray dried reaction mixture is admixed with a first aqueous alcoholic solution containing 70 - 100 %, more preferably 75 - 99 % alcohol to obtain a first mixture . the ratio ( wt / vol ) of spray dried reaction mixture to aqueous alcohol is 1 : 1 to 1 : 5 , more preferably 1 : 2 to 1 : 4 . the alcohol is selected from the group comprising ethanol , methanol , 1 - propanol , 2 - propanol or combinations thereof , more preferably ethanol and methanol . in another embodiment the first mixture is incubated at a temperature 10 - 100 ° c . more preferably 30 - 80 ° c . for 0 . 5 - 30 min more preferably for 1 - 10 min . in another embodiment the first mixture is then cooled to 0 - 40 ° c . preferably 10 - 20 ° c . at a rate of 8 - 11 ° c . per hour , and incubated at final temperature for 1 - 72 hours , preferably 1 - 24 hours to facilitate the crystallization of rubusoside . in another embodiment the crystallized rubusoside is separated from first mixture to become a first precipitate , and the remaining solution becomes a first filtrate . in another embodiment the first precipitate has 75 - 99 %, preferably 90 - 95 % ( on dry basis ) rubusoside content . in another embodiment the first precipitate is admixed with a second aqueous alcoholic solution containing 60 - 100 %, more preferably 70 - 90 % alcohol to obtain a second mixture . the ratio ( wt / vol ) of first precipitate to aqueous alcohol is 1 : 1 to 1 : 5 , more preferably 1 : 2 to 1 : 4 . the alcohol is selected from the group comprising ethanol , methanol , 1 - propanol , 2 - propanol or combinations thereof , more preferably ethanol and methanol . in another embodiment the second mixture is heated till full dissolution of first precipitate and 1 - 5 %, preferably 1 - 2 % of activated carbon is added and the mixture is incubated for 20 min at 60 - 70 ° c . subsequently the activated carbon is removed by means of press filter to obtain decolorized second mixture . in another embodiment the decolorized second mixture is incubated at a temperature 10 - 100 ° c . more preferably 30 - 80 ° c . for 0 . 5 - 30 min more preferably for 1 - 10 min . in another embodiment the decolorized second mixture is then cooled to 0 - 40 ° c . preferably 10 - 20 ° c . at a rate of 8 - 11 ° c . per hour , and incubated at final temperature for 1 - 72 hours , preferably 1 - 24 hours to facilitate the crystallization of rubusoside . in another embodiment the crystallized rubusoside is separated from decolorized second mixture to become a second precipitate , and the remaining solution becomes a second filtrate . in another embodiment the second precipitate has 90 - 100 %, preferably 95 - 100 % ( on dry basis ) rubusoside content . in another embodiment the second precipitate is further suspended in a third aqueous alcoholic solution containing 70 - 100 %, more preferably 90 - 99 % alcohol to obtain a third mixture . the ratio ( vol / vol ) of second filtrate to aqueous alcohol is 1 : 0 to 1 : 5 , more preferably 1 : 0 to 1 : 2 . the alcohol is selected from the group comprising ethanol , methanol , 1 - propanol , 2 - propanol or combinations thereof , more preferably ethanol and methanol . in another embodiment the third mixture is then incubated at 0 - 40 ° c . preferably 10 - 30 ° c . for 1 - 144 hours , preferably 24 - 72 hours . in another embodiment the third mixture is separated into a third precipitate and a third filtrate , where the third precipitate has & gt ; 98 % rubusoside content ( on dry basis ). in another embodiment the third precipitate is dried by any means known to art to provide dry crystalline powder . the hplc analysis of steviol glycosides was carried out as described in fao jecfa monographs 10 ( 2010 ), using an agilent technologies ( usa ) “ 1200 series ” chromatograph , equipped with luna c18 ( 2 ) 100 a ( phenomenex , usa ) column ( 4 . 6 × 250 mm , 5 μm ), using 32 : 68 ( v / v ) mixture of acetonitrile and 10 mmol / l sodium phosphate buffer ( ph 2 . 6 ) as mobile phase , and uv detector at 210 nm . the obtained rubusoside preparations can be used as sweetness enhancer , flavor enhancer and sweetener in various food and beverage products . non - limiting examples of food and beverage products include carbonated soft drinks , ready to drink beverages , energy drinks , isotonic drinks , low - calorie drinks , zero - calorie drinks , sports drinks , teas , fruit and vegetable juices , juice drinks , dairy drinks , yoghurt drinks , alcohol beverages , powdered beverages , bakery products , cookies , biscuits , baking mixes , cereals , confectioneries , candies , toffees , chewing gum , dairy products , flavored milk , yoghurts , flavored yoghurts , cultured milk , soy sauce and other soy base products , salad dressings , mayonnaise , vinegar , frozen - desserts , meat products , fish - meat products , bottled and canned foods , tabletop sweeteners , fruits and vegetables . additionally the highly purified rubusoside preparations can be used in drug or pharmaceutical preparations and cosmetics , including but not limited to toothpaste , mouthwash , cough syrup , chewable tablets , lozenges , vitamin preparations , and the like . the highly purified rubusoside preparations can be used “ as - is ” or in combination with other sweeteners , flavors and food ingredients . non - limiting examples of sweeteners include steviol glycosides , stevioside , rebaudioside a , rebaudioside b , rebaudioside c , rebaudioside d , rebaudioside e , rebaudioside f , dulcoside a , steviolbioside , as well as other steviol glycosides found in stevia rebaudiana bertoni plant and mixtures thereof , stevia extract , luo han guo extract , mogrosides , high - fructose corn syrup , corn syrup , invert sugar , fructooligosaccharides , inulin , inulooligosaccharides , coupling sugar , maltooligosaccharides , maltodextins , corn syrup solids , glucose , maltose , sucrose , lactose , aspartame , saccharin , sucralose , sugar alcohols . non - limiting examples of flavors include lemon , orange , fruity , banana , grape , pear , pineapple , bitter almond , cola , cinnamon , sugar , cotton candy , vanilla flavors . non - limiting examples of other food ingredients include flavors , acidulants , organic and amino acids , coloring agents , bulking agents , modified starches , gums , texturizers , preservatives , antioxidants , emulsifiers , stabilisers , thickeners , gelling agents . 20 g of stevioside extract produced by “ purecircle sdn bhd ” ( malaysia ), containing 98 . 1 % ( on dry basis ) stevioside , and 1 . 2 % rebaudioside a was dissolved in 200 ml of water and mixture was heated to 80 ° c . and maintained for 10 min until complete dissolution . then the mixture was cooled to 37 ° c . and the ph was adjusted to ph 5 . 0 . 20 units ( about 6 g ) of “ hesperidinase from aspergillus niger ” ( sigma - aldrich pn h8137 ) was added and the reaction mixture was incubated at 37 ° c . under continuous agitation . after 24 hrs the hplc analysis of reaction mixture sample , showed 98 % of stevioside conversion to rubusoside . the reaction mixture was boiled at 100 ° c . for 15 min and then cooled down to 80 ° c . 2 g of activated carbon was added and the reaction mixture was incubated for 30 min at 80 ° c . and then the carbon was separated by filtration . the obtained filtrate was evaporated under vacuum to about 30 % total solids and spray dried to produce about 24 g powder containing about 59 . 9 % rubusoside ( dry basis ). 10 g of spray dried reaction mixture prepared as per example 1 and containing 59 . 9 % rubusoside was dissolved in 200 ml of water and the solution was passed through a column packed with 200 ml amberlite xad 7 hp macroporous adsorbent . the column was washed with 3 bv of water and the adsorbed rubusoside was eluted with 300 ml 70 % ethanol . the ethanol was evaporated and the obtained aqueous solution was dried to yield about 6 g of dry matter with 96 . 3 % rubusoside content ( dry basis ). 10 g of spray dried reaction mixture prepared as per example 1 and containing 59 . 9 % rubusoside , was dissolved in 30 ml of 98 % methanol and the mixture was heated to 60 ° c . and maintained for 10 min . then the mixture was cooled to 10 ° c . at a rate of 10 ° c . per hour . during the cooling the mixture was subjected to continuous moderate agitation . starting from about 15 ° c . fine crystals were formed . the amount of crystals subsequently increased . the mixture was incubated at 10 ° c . during 24 hrs . the crystals were separated by filtration and washed on the filter by pure methanol preliminarily chilled to 4 ° c . the obtained crystals were dried under vacuum at 80 ° c . to yield about 6 . 1 g crystals with 94 . 5 % rubusoside content ( dry basis ). 5 g of rubusoside prepared as per example 3 was suspended in 1000 ml of 92 % methanol at room temperature . the mixture was heated and maintained at 30 ° c . during 48 hours . the crystals were separated by filtration and washed on the filter by pure methanol . the obtained crystals were dried under vacuum at 80 ° c . to yield about 4 . 1 g crystals with 98 . 5 % rubusoside content ( dry basis ).	0
tone mapping is a process of taking a hdr image with a high dynamic range and with typically 16 bit or 32 bit , and converting such an image into an image that has contrast that was optimally adjusted for the screen or for a printer . the simplest class is called monotonic tone mapping , defined as in equation 1 , j is the tone mapped image , i . e ., the image the contrast of which as adjusted for screen or print , i is the original hdr image , and t is a function that is strictly monotonic increasing . this means that if pixel j xy is darker than pixel j x ′ y ′ in the contrast adjusted image , the piece of surface in the original scenario corresponding to ( x , y ) was also darker than the piece of surface corresponding to ( x ′, y ′). hence , the name monotonic . a preferred class of tone mapping functions , called adaptive tone mappings , is as it can be seen , t is dependent from i and the current location , so that the contrast change of a pixel can be dependent on the surrounding image structure . this is done to lighten up structures in dark areas more than structures in bright areas . imagine a person photographed against a bright sky , then all pixels in the face in i will be darker than most pixels in the sky in i . however , if t is adaptive , some pixels in the face in j may be brighter than some pixels in the sky in j . this enables better viewing . however , local contrast should be kept , so that j xy & gt ; j x ′ y ′ i xy & gt ; i x ′ y ′ if ( x ′, y ′) is spatially close to ( x ′, y ′). this condition is called “ locally monotonic mapping ”, and while this condition may be violated in a small percentage of pixels in an image , it is an important condition to ensure that the resulting image contains meaningful details . j xy = t ( i , x , y , p xy1 , p xy2 . . . p xyn ) [ equation 03 ] p xyn are n different local parameters . for instance , ashikmin suggests a tone mapping that is based upon a kernel of variable size , where the size of the kernel is based upon the local image contrast ( parameter “ s ” in [ ash02 ]). this can be written as : where s is the radius of the convolution kernel used at the location x , y . alternatively , this can be written as : where p is a matrix that resulted in convolving i with a variable radius . note that [ ahs02 ] processes p not by processing different convolution radii for every pixel , but by blending differently convolved images into one another based on a local parameter , which results in the same effect . there is a major difference between equations 04 and 05 : to compute t ( i , x , y , s xy ) with given parameters , a kernel needs to be convolved with i at every location ( x , y ), but computing j xy = t ( i , x , y , p xy ), where the matrix p is provided as an input parameter , will require much less computing power , once p is given . this is an important observation , since tone mapping is a computational time - intense process . in the following sections we will disclose how to enhance the process of converting a matrix i of hdr data into an enhanced resulting image j . in the following sections well introduce some general forms of the algorithms first for a better understanding , and then fill in additional variations later and point out where the advantages of the suggested algorithms lie . receive hdr image i , so that min ( i ) = 0 . 0 and max ( i ) = 1 . 0 calculate p 1 , p 2 , ... based on data in i approaching a hdr conversion in this sense provides an attack point for an acceleration . as said earlier , computing p out of i ( for instance by applying a convolution kernel on i , or a local contrast detection on i ) may be computing intense and calculating j in line 40 may be a lot faster , depending on the actual hdr conversion . one way of accelerating the procedure is to calculate p ( when we say p we mean p 1 , p 2 , p 3 , . . . ) at a lower resolution , e . g ., sub - sampling the p matrix . if i and j have dimensions of 1000 × 1000 pixels , p might be sub - sampled to a resolution of 100 × 100 pixels . then the function t in line 40 would need to up - scale p to a size of 1000 × 1000 pixels for calculating j out of i and p . however , this is a non - time - consuming process , particularly if a nearest - neighbor interpolation is used . fig1 shows the relation of the matrixes i , p , j mentioned in [ routine 1 ] and [ equation 5 ]. fig2 shows the same matrixes where a lower resolution of p is illustrated . fig3 shows four images : fig3 . 1 represents a matrix i containing unmapped hdr data . fig3 . 2 shows an image j derived from i using a routine as in [ routine 01 ] where a full resolution matrix p was used . fig3 . 3 shows an image j derived from i using a routine like routine 01 , where p was used at a very low resolution . fig3 . 4 shows an image j derived from i using a routine like routine 01 where all matrixes j , p , and i were kept at a low resolution . as it can be seen by comparing fig3 . 3 and fig3 . 4 , downsizing only p leads to much less loss in quality than downsizing all data i . of course , fig3 . 3 and fig3 . 4 are exaggerated ; in the real world , the blocking should be much less visible . a method embodying this technique comprises starting a processing thread by calculating p at a very low resolution , and then allowing for fast display of the image , so that the user can see a result very quickly . when the thread is finished calculating p at a very low resolution , another thread can be started to calculate p at a finer resolution and so forth until p is calculated at a sufficiently high resolution . this allows for a conversion that is extremely responsive , where the user sees first results extremely quickly and where calculating the full resolution image will take place shortly later . this can be extended to a system where the user can influence the tone mapping locally . local adjustment of tone mapping is feasible using the invention disclosed since we have a system that allows for a speedy feedback of changes to the user via a quick preview . fig4 shows an overview over such an enhanced workflow , featuring sets of matrixes c , u and p . note that when we say p , we always refer to a set of matrices p 1 , p 2 , p 3 . . . , same for c and u . each set of matrices can consist of one or more matrices . in fig4 , i refers to the hdr data , c refers to data derived from the image i , such as a i convolved with a kernel , a calculated convolution kernel radius , wavelet coefficients , an edge - detection and the like . z refers to data that the user has input . this can be for instance brush stroke information , such as note : the variable “ effect ” is described later in this disclosure . please note also that depending on the implementation , the brush stroke receiving routine may be implemented in a way that produces a matrix of data instead of single brush stroke coordinates . also , please note that z may contain other selective user input , such as a gradient effect , a “ magic wand ” selection connected with an effect , an irp or an irr ( with reference to u . s . pat . no 7 , 031 , 547 , u . s . pat . no . 6 , 865 , 300 , and u . s . pat . no . 6 , 728 , 421 , which are incorporated herein ). as it can be seen in fig4 , u ( id est : u 1 , u 2 . . . ) is derived both from z and from i . this is one aspect of this invention . this is explained in the following sections . first , to define u : u is a matrix or matrices that contain adapted data based on a user input and adapted to the image , providing information to succeeding algorithms on what the user wants where to which intensity on a pixel - by - pixel - basis . for instance , assume that in an image containing a sky a user has drawn a brush stroke extending from the top left to the top right . then z contains the brush stroke coordinates , i contains hdr data representing an image with said sky , and u could be calculated as follows : set pixels at the coordinates provided in z to 1 . 0 in r find all pixels neighboring values of 1 . 0 in r , store those in r ′ delete those pixels in r ′ corresponding to a detected edge of i ( see in other words , routine 02 finds a matrix of pixels u that contain a value of j for all those pixels in i ( respectively j ) where the user appears to desire a certain effect . note that the advantage in routine 02 is that the data z are adapted to the image using hdr values of i . remember that hdr values have a very high dynamic range . so for instance , imagine an image containing ( a ) shadows , ( b ) dark objects , ( c ) bright objects , ( d ) a bright sky , ( e ) white clouds , and ( f ) a light source . then i will due to its nature show strong luminance differences between a and b , b and c , c and d , d and e and e and f . in a tone - mapped / compressed image j , these differences cannot be present to the same extent due to the nature of tone - compressed images . therefore the data in i will be much more suitable to be used for an adaptive routine like routine 02 than any other non - hdr data , for instance because detail differences , colour differences and edges are a lot stronger in i . please note that parallel to routine 02 , there are other techniques that can take user input and adapt / refine the area of user input based on the image data , such as the smart eraser tool in photoshop ®, irp &# 39 ; s described in u . s . pat . no . 7 , 031 , 547 , u . s . pat . no . 6 , 865 , 300 , and u . s . pat . no . 6 , 728 , 421 ; irr &# 39 ; s described in “ user definable image reference regions ” u . s . application ser . no . 11 / 832 , 599 , incorporated herein ; and “ self - adaptive brush for digital images ” u . s . application ser . no . 11 / 674 , 080 , incorporated herein . all of these adaptive routines will benefit in their selectivity if the reference image has a high differentiation of its details . fig4 further shows that the adapted data provided in u and the hdr - related data in c are merged to a matrix / matrices p . for instance , let us assume for now that the data in c contain a suggested luminosity adaptation factor , for instance so that : would be a simple tone mapping , where i is any constant . this states simply that multiplying the pixels in i with the ( scalar ) factors in c yields in an adapted , tone - compressed version of j . the multiplication symbol “” here refers to a scalar multiplication . which means that p can be calculated by simply adding c and u , or in other words : the function f is a simple addition . note that more complex implementations of f are possible and will be discussed later . note that the tone mapping is here just a multiplication of i with a value in p . speaking in imaging terms , this means that through input z the user can provide ( adapted ) input to the system to further define where the brightness adaptation of the tone mapping should be increased or decreased to his or her desire . note that the effect of p need not be limited to brightness changes only , p ( respectively p 1 , p 2 . . . ) can also represent other parameter ( s ) of the tone mapping that are suitable to be separated from the process and stored in a matrix , the user may desire having influence over , or affect the visual appearance of the result . the process depicted in fig4 is also shown in routine 03 : receive hdr image i , so that min ( i ) = 0 . 0 and max ( i ) = 1 . 0 note that i would typically be a 16 bit or 32 bit image . i can be derived from merging a variety of input images of different exposures into one image , or it can be simply a 8 bit , 12 bit or 16 bit image coming from a camera with a good dynamic range , which includes good digital cameras , scientific , or medical cameras . the function a ( ) can be a function that derives pre - calculated data from the hdr image i . for instance , if the herein disclosed implementation is based upon the algorithm suggested by [ ash02 ], a xy , 1 ( i ) can represent a suggested radius for each coordinate in i , or a xy , 2 ( i ) can represent the value obtained by convolving i at the coordinate ( x , y ) with a suitable kernel . or , in a more general case , a xy ( i ) can provide a suggested brightness - adjustment value derived from the image i . keep in mind that the luminosity component of all tone mapping routines can be brought to the form j xy = c xy i xy , where c xy is a brightness adjustment factor for the luminosity . b ( ) is a function that calculates u out of z and i in a suitably fashion , and examples for how to do this were given in [ routine 02 ] and in the section following routine 02 . f ( ) is a function that combines u and c into p . imagine that if p represents radii for all x , y for a convolution kernel to be used for the tone mapping in t ( ), then c could contain radii of a convolution kernel suggested by an algorithm , and u could contain data where the user would wish a radius increase or decrease . terms as “ brightness ”, “ contrast ”, “ halo - protection ”, “ detail sensitivity ”, may be more user - friendly terms for internal parameters . t ( ) was already discussed , see equations 03 , 04 and 05 . fig5 represents in an abbreviated graphical form the desired hdr conversion details that the user may communicate to the disclosed system . as shown , there are general hdr conversion parameters that the user may chose for the whole image , and there are local hdr conversion parameters provided to the system . fig6 displays a graphical user interface (“ ui ”) of a system using one embodiment of the invention . as shown , it features brushes with which the user can influence the hdr conversion parameters . note that in the concept depicted in fig6 the user has a radio button where he can select whether to edit the main tone mapping parameters or the tone mapping parameters of a currently selected region . depending on the setting of that radio button the user can adjust the settings of that according area via the control sliders to the bottom right of the interface . additionally the user is offered to use brushes to increase or decrease a certain effect . note that the selection line displays a region that the user has selected , the boundaries of which could be stored in z . also note that there is a striped area around the selected region , indicating the area of “ image adaptation .” in other words , z represents only the selected region , while u represents an area as large as the striped area and the selected region together . it is a design choice whether the effect of the brushes is supposed to override the adjustments that the user has made within a region or vice versa . in this case , for better handling , editing of certain parameters via brushes and editing of unrelated parameters via regions was allowed . fig7 displays different matrices . fig7 . 1 represents a ( un - mapped ) hdr image , id est where no details were adapted to the dynamic range of a computer screen or printer . fig7 . 2 shows an image as it could result from an hdr tone mapping process , and fig7 . 3 shows such a tone - mapped image where the user has taken some selective control over the tone mapping process . here , the user has desired to keep the sky dark while rendering the house bright . fig7 . 4 represents two matrices as they may occur in c , fig7 . 5 may represent the matrix u , and 7 . 6 may represent the matrix p . as you can see , the user input represented in matrix u , fig7 . 5 , has influenced the matrix p . note that the white pixels in fig7 . 5 may represent “ zero ” or “ nil ” or “ transparent ”, depending on how the function f is designed . those skilled in the art may know that many methods are possible to ensure that the areas in u where the user wishes to not influence the given results do not affect p . for instance , if f follows the principle of p = c + u , then areas of no user influence can be represented with zeros . if values in u are meant to overwrite c , then u should have transparency data ( an “ alpha channel ”) ensuring that u does not overwrite c everywhere . in general , any such tone mapping parameter that would in the end of the process be stored in p ( p 1 , p 2 , . . . ) could refer to , e . g ., the brightness of the resulting pixels in j , the contrast of the resulting pixels in j , the haloing strength in a region in j , the detail retention in a region in j , a color temperature adjustment of resulting pixels in j , a color brilliance adjustment of resulting pixels in j , a sharpness of resulting pixels in j , or a number representing which tone mapping algorithm is preferred in what area in j . it will be evident to those skilled in the art that various implementations of z , u and f can be programmed that allow the user for instance to increase or to decrease any such parameter in an image region , or it can be forced to a fixed value . as an example for now , let us focus on brightness changes . if a system is implemented as discussed in this disclosure , the user might initially see an image j as shown in fig7 . 2 . the user could then communicate to the system using for instance a pointing device such parameters z that are suitable to communicate to the system that the user wishes a darker sky . such a system could be for instance a brush engine , or an irp system or an irr system or a lasso - like selection or anything the like . then this user input is converted into u , then u and c are merged into p , and p is used to display a new version j of the image on the screen , as shown in fig7 . 3 , allowing the user to either accept the result or to refine it further . in another embodiment , the user may not only be allowed to take influence over parameters that are necessarily required for tone mapping , but also other parameters such as color change , noise reduction , and unsharp mask sharpening , etc . if these parameters are also stored in p , the suggested system ( for instance as shown in fig4 ) can allow for both a tone - mapping and other local adjustments in a fashion where the user has influence over all important image parameters , and where the user has the benefit that selection precision is enhanced since the original hdr data can be used to automatically adapt user input to the image , for example , function b . if the hdr conversion function t that is supposed to be implemented does not provide support for additional color or detail changing parameters , such function can easily be constructed as t = t 1 ∘ t 2 = t 1 ( t 2 ) where either t 1 or t 2 is the original tone mapping and the other is an image change function supporting additional color and detail changes . in another embodiment , i may not be a perfectly merged hdr image . it is common to create hdr images out of a series of images with different exposure , shot on a tripod . if this process was done poorly , or with a bad tripod , or without a tripod , the resulting image may show poor overlays in j . in such case the system provided herein may keep the hdr data as a series of 8 bit or 16 bit images ( the original images ) and only merge them by the time the function t is executed , overlaying them either using a so - called image registration technique , or allowing the user to overlay the images manually , or to first overlay the images using an image registration technique and to further allow the user to further register the images himself . in any case , it may be advisable to allow the user to provide registration input via z , so that some matrixes u n , u n + 1 . . . may contain spatial offset information used to adapt source images to one another to enhance the rendered image . fig8 shows how a poor image registration might not match two details , leading to some sort of “ double vision ” effect in j . here the user can place two marks on the details to communicate to the system what objects need to be overlaid . note that the user may have difficulties in communicating to the system which detail of which source image he is referring to . therefore , the system may not receive information from the user which of the two marks refers to which original image — which means that the two marks define the required correction vector , but the signature of this vector will be unknown . in this case , the correction vector should be used that leads locally to a better match , id est within a radius r ≈ 10 . . . 30 pixels . in another embodiment , the scene may contain moving objects such as people or vehicles . if that is the case , the hdr data matrix i will contain details that do not entirely match . in this case , there is a benefit from a system where i is kept as individual images i 1 , i 2 . . . and where they are merged into one image later in the process , which is when t is applied . as will be known to one of ordinary skill in the art , it is possible to register images , even if they have different brightnesses , so that it such functionality can be added into t . fig9 illustrates a system where the user can take influence over image details . if the user spots an object that moved or changed while the series of images were being taken , the user may point in a system to that object with his pointing device cursor ( see fig9 , 9 . 1 ), and the system can then analyse which two or more images i n , i n + 1 . . . out of the series of original images i 1 , i 2 . . . contributed to the detail in this area . then a second user interface area can be shown to the user ( 9 . 2 ) where the user can select which of the images i n , i n + 1 . . . contains the optimal detail . once the user has provided this information , the system can allow the user to brush in the wanted detail ( respectively : the “ desired version ” of a face / an object ). this information can then be stored in u and be fed into function f , so that t can then render the final result , fig9 . 3 , based upon what detail the user wanted at the given location . in order to build a system that supports the feature named above , the system needs to be able to assign weights ω 1 , ω 2 , . . . to the pixels in i 1 , i 2 . . . . it is known in the art to implement weights as a function of the brightness of pixels in the images i 1 , i 2 . . . , so that the extremely dark and bright pixels contribute less to the result . it would be possible to enable the user to further influence these weights in certain areas , so that certain elements of an individual source image i i do not contribute to the final result . with relation to fig9 , the user would select a preferred “ face version ”, id est a preferred in , and then perform some brush strokes in the desired area . the algorithm would then set ω n for that area to 1 . 0 and all other ω to zero . of course , the system needs to ensure that no pixel exists that is assigned with zero weights in all i 1 , i 2 . . . . an image response function can be calculated as a function of zij . it is feasible to calculate the image response function based upon only those zij the related weights of which were not influenced by the user . ( with relation to fig9 , this means that the image response function is calculated based on the pixels that the user has not applied a brush stroke to , id est all pixels that don &# 39 ; t belong to the face ). the precision of calculation of such an image response function will benefit if the user excludes pixels via weights ω 1 , ω 2 , . . . belonging to objects that moved while the series of images was taken . note that the image response function can be calculated based on a subset of pixels of the image , and once the image response function is calculated , a 32 bit hdr image can be constructed from all given pixels and their assigned weights . currently , it is common to create hdr shoots with a camera mounted onto a steady tripod . however , since image registration is a widely known technique in image processing , it is technically feasible to allow for hdr shooting without a tripod and with registering the images automatically . registration means to calculate offsets between images based on their contents , so that images can be overlaid so that same image details match . fig1 shows a series of registered images . as can be seen , the user has shaken the camera significantly between the shots . as it can also be seen , a cloud has moved while the series of images was taken . fig1 . 4 illustrates in its gray area the portion of pixels that can be kept . this is a considerably small area . fig1 . 1 illustrates with numbers ( 1 , 2 , 3 ) how many pixels from i 1 , i 2 , i 3 are available to reconstruct the merged , tone - mapped image j at each location . if via the weighting system introduced above a hdr merging and tone mapping system is implemented that is capable of processing input images i 1 , i 2 . . . that feature weights ω n = 0 for certain pixels , the reconstructed image area can be larger than the area covered by all three images by assigning a weight ω = 0 . 0 to nonexistent pixels . essentially , the input images are padded so that they have the same dimensions after registration , and the pixels added during padding are assigned zero weight . as illustrated in fig1 . 5 , the image area may increase dramatically if the final image can now be reconstructed from the area where pixels from only two out of three images were available . many routines exist that are capable of registering images that were not only shifted , but also rotated and enlarged ( zoomed ) in relation to one another , so that the system shown herein works also if the user has rotated or moved the camera between the shoots or changed the zoom or moved his own position . fig1 . 1 shows what a result would look like without the padding and weighting system introduced herein , and fig1 . 2 shows how the total image area can increase and how the cloud can benefit if said padding and weighting system is implemented . it is possible to combine the manual weighting with area maximization . note the oval marked “ 1 ” in illustration 10 . 1 , indicating that the user has assigned a weight of 1 . 0 to one of the images within that oval and weights of 0 . 0 to the other images , ensuring that no inferences of various clouds occur in the result . this relates to the feature depicted in fig9 . in another embodiment , a color filter can be applied to the tone - mapped image j that receives as an input the corresponding brightness in the original scenario , id est in i . for instance , imagine an image taken within a room with low - temperature illumination of around 3000 ° k . the image also contains an outdoor scene seen through a window , illuminated by 6800 ° k . while fixing this solely based on a tone - mapped image j is possible using conventional adaptive color filters , it may be easier to apply a color correction filter to j as a function of values in i — id est before the tone mapping was applied . in other words : color - correcting those pixels in j that relate to dark pixels in i , as opposed to color - correcting the pixels that are dark in j . in other words , even after the tone mapping was applied and the image j is created , further image processing routines may benefit in their selectivity if the values of i are provided as input parameters for color filters , sharpness filters , or selectivity filters . as an almost equal alternative , pre - processing of the images i 1 , i 2 , . . . is possible , which leads to the same effect . if the darkest image i 1 contains colors mainly illuminated with 3000 ° k , and if the brightest image i v contains colors mainly illuminated with 6800 ° k , the color temperature of all i v , 1 & lt ;= v & lt ;= v , can be fixed as a function of v . note that for optimal results this colour change in i 1 , i 2 , . . . , i v should take place after an image response function has been calculated ( to not introduce errors through the color correction ), but before merging and tone - mapping the images i 1 , i 2 , . . . , i v into j . fig1 illustrates a hard drive , a system memory , and a display device . it is illustrated that at the beginning of a retouching session of a user , there may be an “. exr ” file on the hard drive which contains ( by its very definition ) hdr data , typically in 32 bit . current systems allow the user to either modify the hdr data and save it back , or to tone - map the hdr data and save a jpg , tiff or the like . in fig1 it is illustrated that this invention disclosed herein allows for fast displaying of a tone - mapped image j on a screen to the user , while receiving refined tone - mapping related input from the user via z , so that a process can save back i , u , c , z , etc . to a file , as illustrated . if , for instance , the system would allow the user to save back i , c , u , and z ( c and u possibly in low resolutions ), the user would be able to open the file later , maybe even on a different computer , and see the edited on - screen - result j in fast time , while still working on the original hdr data i . alternatively , it may be sufficient to store i and z on the hard drive , since the invention disclosed herein allows for calculating first results of j on the screen very quickly . alternatively , the system may store i and z , plus any of the matrices u , i , p at whatever resolution they were present in memory by the time of saving data to the hard drive , or any lower resolution of u , i , p may be stored for saving hard drive space . all features disclosed in the specification , and all the steps in any method or process disclosed , may be combined in any combination , except combinations where at least some of such features or steps are mutually exclusive . each feature disclosed in the specification , including the claims , abstract , and drawings , can be replaced by alternative features serving the same , equivalent or similar purpose , unless expressly stated otherwise . thus , unless expressly stated otherwise , each feature disclosed is one example only of a generic series of equivalent or similar features . this invention is not limited to particular hardware described herein , and any hardware presently existing or developed in the future that permits processing of digital images using the method disclosed can be used , including for example , a digital camera system . a computer readable medium is provided having contents for causing a computer - based information handling system to perform the steps described herein . the term memory block refers to any possible computer - related image storage structure known to those skilled in the art , including but not limited to ram , processor cache , hard drive , or combinations of those , including dynamic memory structures . preferably , the methods and application program interface disclosed will be embodied in a computer program ( not shown ) either by coding in a high level language . any currently existing or future developed computer readable medium suitable for storing data can be used to store the programs embodying the afore - described interface , methods and algorithms , including , but not limited to hard drives , floppy disks , digital tape , flash cards , compact discs , and dvd &# 39 ; s . the computer readable medium can comprise more than one device , such as two linked hard drives . this invention is not limited to the particular hardware used herein , and any hardware presently existing or developed in the future that permits image processing can be used . any currently existing or future developed computer readable medium suitable for storing data can be used , including , but not limited to hard drives , floppy disks , digital tape , flash cards , compact discs , and dvd &# 39 ; s . the computer readable medium can comprise more than one device , such as two linked hard drives , in communication with the processor .	6
in the description of the present invention , it should be noticed , orientation or position relation indicated by terms such as “ at the center of ,” “ on ,” “ below ,” “ in front of ,” “ behind ,” “ at the left of ,” “ at the right of ” are orientation or position relation in connection with the figures . these terms are used to simplify the description of the present invention , and are not intended to indicate or suggest a specific configuration or orientation in operation for the device or element being described . therefore , these terms cannot be construed as limitations to the present invention . in addition , terms such as “ first ” and “ second ” are used for descriptive purpose and shall not be construed as indicating or suggesting an element is more significant than another . in the description of the present invention , it should be noticed , unless otherwise specified , terms such as “ mounted ,” “ joined ,” and “ connected ” should be construed in their broad sense . for example , “ connected ” includes “ fixedly connected ,” “ detachably connected ,” or “ integrally connected ”; it also includes “ mechanically connected ” or “ electrically connected ”; it further includes “ directly connected ,” “ connected via an intermediate element ,” or implies the inner connection of two elements . the meaning of each of these terms in the present invention shall be construed by the persons having ordinary skills in the art based on the specific context . in addition , unless otherwise specified , in the description of the present invention , “ a plurality of ,” or “ several ” means two or more than two . fig1 to fig6 disclose a first embodiment of a large current female connector for high - speed transmission . referring to fig1 to fig3 first , the insulating body includes an upper insulating body 21 , a middle insulating body 23 , a lower insulating body 22 , an upper terminal group 31 disposed on the upper insulating body 21 , and a lower terminal group 32 disposed on the lower insulating body 22 . the corresponding two power terminals in the upper terminal group 31 and the lower terminal group 32 are connected to form a big power terminal 4 . insulating body trenches 5 are disposed respectively on the upper insulating body 21 , the middle insulating body 23 , and the lower insulating body 22 . when the upper terminal group 31 is disposed on the upper insulating body 21 and the lower terminal group 32 is disposed on the lower insulating body 22 , the big power terminals 4 are disposed correspondingly in the insulating body trench 5 on the upper insulating body 21 and in the insulating body trench 5 on the lower insulating body 22 . when the upper insulating body 21 and the lower insulating body 22 are engaged with the middle insulating body 23 , the big power terminal 4 should be correspondingly disposed in the insulating body trench 5 formed from the middle insulating body 23 . then the upper insulating body 21 , the middle insulating body 23 , and the lower insulating body 22 are engaged tightly to form an integrated device . then the integrated device is mounted in the case 1 . a rib 11 is disposed on the case 1 . the rib 11 makes the case 1 more robust , preventing the dovetail connection from being popped out . the case 1 further includes a welding foot 12 so as to mount the connector on a pcb . therefore , as the corresponding two power terminals in the upper terminal group 31 and the lower terminal group 32 are connected together , the current capacity of the big power terminal 4 combining two power terminals increases significantly . a large current carrying connector can thus be realized . the charging speed of a battery with high electrical capacity can thus be accelerated . to achieve the high frequency transmission of the terminal group , the upper terminal group 31 and / or the lower terminal group 32 at least includes a high frequency terminal pair 312 . the thickness of the contact portion 3121 of the high frequency terminal pair 312 is smaller than the thickness of the portion 3122 adjacent to the contact portion 3121 ( as shown in fig4 to fig6 ). to reduce the signal interference between the upper and lower terminal groups , a shielding sheet 7 is further included . a shielding sheet trench 6 for accommodating the big power terminal 4 is disposed on the shielding sheet 7 . the shielding sheet 7 is disposed in the middle insulating body 23 . when the upper insulating body 21 and the lower insulating body 22 are engaged with the middle insulating body 23 , the big power terminal 4 is correspondingly disposed in the insulating body trenches 5 and simultaneously disposed in the corresponding shielding sheet trench 6 . to improve the shielding effect of the shielding sheet , the shielding sheet 7 includes an upper spring plate 71 and a lower spring plate 72 . the upper spring plate 71 is physically and electrically connected to the upper ground terminal 311 disposed on the upper insulating body 21 . the lower spring plate 72 is physically and electrically connected to the lower ground terminal 321 disposed on the lower insulating body 22 . to improve the engagement between the upper insulating body 21 and the lower insulating body 22 , a first shielding engaging case 81 and a second shielding engaging case 82 are further included . a first hook 811 is disposed on the first shielding engaging case 81 . a second hook 821 is disposed on the second shielding engaging case 82 . meanwhile , a first hooking portion 231 and a second hooking portion 232 are disposed on the upper surface and the lower surface of the middle insulating body 23 , respectively . the first shielding engaging case 81 is engaged with the upper surface of the middle insulating body 23 , wherein the first hook 811 is interlocked with the corresponding second hooking portion 232 on the middle insulating body . then , the second shielding engaging case 82 is engaged with the lower surface of the middle insulating body 23 , wherein the second hook 821 is interlocked with the corresponding first hooking portion 231 on the middle insulating body 23 . the present invention can be implemented as a second embodiment ( not shown in the figures ). the second embodiment is essentially the same as the first embodiment , except that the insulating body includes an upper insulating body and a lower insulating body , in which the upper terminal group is disposed on the upper insulating body , and the lower terminal group is disposed on the lower insulating body . insulating body trenches are disposed respectively on the upper insulating body and the lower insulating body . when the upper terminal group is disposed on the upper insulating body and the lower terminal group is disposed on the lower insulating body , the big power terminal is disposed correspondingly in the insulating body trench on the upper insulating body and in the insulating body trench on the lower insulating body . the upper insulating body and the lower insulating body are engaged with each other to form an integrated device . to reduce the signal interference between the upper and lower terminal groups , a shielding sheet is further included . a shielding sheet trench for accommodating the big power terminal is disposed on the shielding sheet . the shielding sheet is disposed between the upper insulating body and the lower insulating body . when the upper terminal group is disposed on the upper insulating body and the lower terminal group is disposed on the lower insulating body , the big power terminal is correspondingly disposed in the insulating body trenches and simultaneously disposed in the corresponding shielding sheet trench . the present invention can be implemented as a third embodiment ( not shown in the figures ). the third embodiment is essentially the same as the first embodiment , except that the insulating body is integrally formed . the upper terminal group and the lower terminal group are disposed on the insulating body . an insulating body trench for accommodating the big power terminal is disposed on the insulating body . when the upper terminal group and the lower terminal group are disposed in the insulating body , the big power terminal is disposed correspondingly in the insulating body trench . the insulating body is then disposed into the case . to reduce the signal interference between the terminal groups , a shielding sheet is further included . the shielding sheet is inserted in the insulating body in advance . a shielding sheet trench for accommodating the big power terminal is disposed on the shielding sheet . when the upper terminal group and the lower terminal group are disposed in the insulating body , the big power terminal is correspondingly disposed in the insulating body trench and simultaneously disposed in the corresponding shielding sheet trench . to improve the shielding effect of the shielding sheet , the shielding sheet includes an upper spring plate and a lower spring plate . the upper spring plate is physically and electrically connected to the upper ground terminal located at an upper layer of the insulating body , and the lower spring plate is physically and electrically connected to the lower ground terminal located at a lower layer of the insulating body .	7
an embodiment for barrel - binding and packaging articles by the use of packaging film , which embodies a method and a device according to the present invention , will now be described with reference to the drawings . referring to a fixed - side seal cutting assembly 1 shown in fig1 and 2 which is standing in the initial state of operation , a fixed seal plate 3 equipped with a heater is secured on the under side of a fixed base 2 , and the point of the seal plate 3 facing a packaging station 101 forms a pinching portion 3a . a pair of arms 5 is supported by supporting portions 4 projecting on the laterally - spaced sides of the fixed base 2 via support shafts 6 so as to tilt vertically above the fixed seal plate 3 , a fixed - side pinching roller 7 is supported between the points of the two arms 5 via a one - way clutch 8 so as to rotate only in the direction of the arrow 201 of fig1 and coupling rollers 9 are supported on the respective outsides of the arms 5 . leaf springs 10 are secured to the laterally - spaced sides of the fixed base 2 and engaged with a coupling lever 11 stretched between the two arms 5 at a position between the fixed base 2 and the pinching roller 7 . by the urging force of leaf springs 10 against the coupling lever 11 , the pinching roller 7 is always in contact with the pinching portion 3a of the fixed seal plate 3 . a slide plate 12 is placed on the fixed seal plate 3 between it and the pinching roller 7 , and a saw blade 13 attached to the slide plate 12 along the pinching roller 7 is confronted with an abutting station between the fixed plate 3 and the pinching roller 7 . both laterally - spaced ends of the slide plate 12 project outward beyond the respective arms 5 , each end having a hole 12a . a rotary shaft 14 stretched above the pinching roller 7 has rods 15 extending downward on the respective outsides of the arms 5 as shown in fig2 and 8 , and an angle lever 16 secured to each rod 15 is fitted in the hole 12a of the corresponding slide plate 12 . as the rods 15 tilt in response to rotation of the rotary shaft 14 as shown in fig1 , 12 , and 14 , the slide plate 12 and the saw blade 13 move on the fixed seal plate 3 via the angle levers 16 so as to approach and separate from the pinching roller 7 . referring to a movable - side seal cutting assembly 17 shown in fig1 and 2 which is standing in the initial state of operation , a base plate 20 is secured via brackets 19 to the upper ends of laterally - spaced movable levers 18 of a pair , the point of the base plate 20 facing the packaging station 101 forms a pushing - in portion 21 , and this pushing - in portion 21 has a laterally - extending cutting groove 21a . a movable seal plate 22 is supported in a lower accommodation chamber 20a of the base plate 20 and urged by a compression coil spring 23 so as to move toward the packaging station 101 , and the point of the movable seal plate 22 adjacent to the pushing - in portion 21 of the base plate 20 forms a pinching portion 22a . a supporting plate 24 is supported in an upper accommodation chamber 20b of the base plate 20 and urged by a compression coil spring 25 so as to move toward the packaging station 101 , and the point of the supporting plate 24 adjacent to the pushing - in portion 21 of the base plate 20 supports a movable - side pinching roller 26 . as will be seen , the pinching portion 22a of the movable seal plate 22 projects toward the packaging station 101 far more than either the pushing - in portion 21 of the base plate 20 or the movable - side pinching roller 26 . guide levers 27 are provided on the laterally - spaced sides of the base plate 20 projecting toward the packaging station 101 , and as shown in fig8 the point of each guide lever 27 adjacent to the pushing - in portion 21 of the base plate 20 has an inclined coupling surface 27a . the laterally - spaced sides of the movable seal plate 22 have respective coupling pins 28 projecting closely to the pinching portion 22a . between the movable - side seal cutting assembly 17 and the fixed - side seal cutting assembly 1 thus configured , a pair of supporting levers 30 is secured with some inclination toward the packaging station 101 to the upper ends of laterally - spaced movable levers 29 of a pair disposed below the movable - side seal cutting assembly 17 standing in the initial state of operation shown in fig1 and a guide roller 31 is stretched between the upper ends of both supporting levers 30 above the movable - side seal cutting assembly 17 . an angular presser plate 33 is supported pivotably by a support shaft 32 stretched between the supporting levers 30 below the movable - side seal cutting assembly 17 , and urged by a spring ( not shown ) in the direction of the arrow 202 of fig1 so that it is close to the movable - side seal cutting assembly 17 . a film take - up roll 35 is attached to an attaching shaft 34 stretched oblique above the movable - side seal cutting assembly 17 , and a pulley 36 secured to the attaching shaft 34 is interlinked through a belt 37 with a reversible electric motor 38 . a packaging film 102 pulled out from the take - up roll 35 is guided by an intermediate roller 39 and the guide roller 31 so as to pass above the movable - side seal cutting assembly 17 in the initial state of operation shown in fig1 and its one end 103 is held in the fixed - side seal cutting assembly 1 , or between the pinching portion 3a of the fixed seal plate 3 and the fixed - side pinching roller 7 . since this fixed - side pinching roller 7 is supported by means of the one - way clutch 8 , it cannot rotate in the direction of the film end 103 being pulled out ( in the direction opposite to that of the arrow 201 ) and the end 103 is surely held . a receiving plate 41 is supported by a rotary shaft 40 stretched below the packaging station 101 and tilted upward above an ejecting plate 42 in the initial position of operation shown in fig1 . and , this receiving plate 41 tilts upward and downward in response to rotation of the rotary shaft 40 as shown in fig1 and 14 . the two sets of movable levers 18 and 29 are interlinked at their lower ends with a disc cam ( not shown ) and can come close to the fixed - side seal cutting assembly 1 until either the movable levers 29 abut on stoppers 129 or the movable levers 18 abut on stoppers 118 , and thereafter , they can again move back up to the respective initial positions of operation shown in fig1 . the rotary shaft 14 of the fixed - side seal cutting assembly 1 and the rotary shaft 40 of the receiving plate 41 are also rotatable in interlinked relation with the disc cam . the electric motor 38 is energized so as to rotate forward and backward by means of limit switches ( not shown ) which are changed over in response to rotation of the disc cam . in the initial state of operation shown in fig1 first , the electric motor 38 is energized so as to rotate forward for a time interval set in a timer , as a result , a desired length of packaging film 102 compatible with articles 104 is pulled out from the take - up roll 35 . the packaging film 102 hangs down between the fixed - side seal cutting assembly 1 and the guide roller 31 into the form of a concavity , and then the articles 104 are thrown into this concave section . then , as both the movable levers 18 and 19 move so as to approach the fixed - side seal cutting assembly 1 as shown in fig3 the movable - side seal cutting assembly 17 , guide roller 31 , and presser plate 33 also move . as both the movable levers 18 and 29 move further , one set of movable levers 29 only abut on the stoppers 129 as shown in fig4 so that the guide roller 31 and the presser plate 33 come close to the fixed - side pinching roller 7 of the fixed - side seal cutting assembly 1 and stop there . since the other set of movable levers 18 only move further without interruption , the presser plate 33 is pushed downward ( in the direction opposite to that of the arrow 202 ) by the movable seal plate 22 of the movable - side seal cutting assembly 17 in opposition to the urging force applied thereto and comes into contact with the packaging film 102 as shown in fig5 . in synchronization with the above action the electric motor 38 is energized so as to rotate backward , the packaging film 102 is pulled back onto the take - up roll 35 , and the articles 104 bound by the packaging film 102 is lifted up . on the other hand , the movable seal plate 22 of the movable - side seal cutting assembly 17 is moving continuously while passing over the presser plate 33 , and the presser plate 33 is tilted further downward to press the articles 104 ; thus , the articles 104 are prevented from moving upward . at this time , since the electric motor 38 is rotating continuously backward , the packaging film 102 is pulled backward to bind tightly the articles 104 . then , as the movable seal plate 22 of the movable - side seal cutting assembly 17 abuts on the fixed seal plate 3 of the fixed - side seal cutting assembly 1 as shown in fig6 through 8 , one end 103 and the other coupling end 105 of the packaging film 102 are pinched together by the pinching portions 3a and 22a of these plates . up to the time of this pinching action , the electric motor 38 is rotated reversely , the action of pulling back the packaging film 102 is continued , and binding tightly the articles 104 takes place . as the movable levers 18 move further , while keeping the contacted state with the fixed seal plate 3 of the fixed - side seal cutting assembly 1 the movable seal plate 22 of the movable - side seal cutting assembly 17 plunges into the accommodation chamber 20a in opposition to the urging force of the compression coil spring 23 , and with a little delay from the abutment between the fixed seal plate 3 and the movable seal plate 22 , the movable - side pinching roller 26 of the movable - side seal cutting assembly 17 comes into abutment on the fixed - side pinching roller 7 of the fixed - side seal cutting assembly 1 in opposition to the urging force applied thereto , as a result , between these rollers is pinched the coupling end 105 of the packaging film 102 . in synchronization with this pinching action , the inclined coupling surfaces 27a of both guide levers 27 of the movable - side seal cutting assembly 17 abut on the corresponding coupling rollers 9 of the fixed - side seal cutting assembly 1 , as a result , both the guide levers 27 lift up both the coupling rollers 9 as well as the fixed - side pinching roller 7 in opposition to the urging force of the leaf springs 10 , the pushing - in portion 21 of the movable - side seal cutting assembly 17 eats into between the pinching portion 3a of the fixed seal plate 3 and the fixed - side pinching roller 7 , and the movable - side seal cutting assembly 17 stops when the movable levers 18 abut on the stoppers 118 . in the thus attained state , the coupling end 105 of the packaging film 102 is bent by the pushing - in portion 21 into the shape of a &# 34 ; u &# 34 ;, one end 103 and the coupling end 105 of the packaging film 102 are interposed in the mutually - piled state with some looseness between the pinching portion 3a of the fixed seal plate 3 and the pushing - in portion 21 , and the coupling end 105 of the packaging film 102 is pinched between the fixed - side pinching roller 7 and the pushing - in portion 21 . one end 103 and the coupling end 105 of the packaging film 102 pinched in the mutually - piled state between the pinching portion 3a of the fixed seal plate 3 and the pinching portion 22a of the movable seal plate 22 are fusion - bonded together under the pinched condition by means of the heat of the fixed seal plate 3 equipped with the heater . then , as shown in fig1 and 12 , in response to rotation of the rotary shaft 14 , the rods 15 tilt and the slide plate 12 comes close to the pushing - in portion 21 , so that the saw blade 13 is inserted in the cutting groove 21a of the pushing - in portion 21 and the coupling end 105 of the packaging film 102 is cut off thereat . before this cutting action , the receiving plate 41 has been tilted down to realize continuity with the ejecting plate 42 . at the time of cutting , the lower end of each rod 15 abuts on the corresponding coupling pin 28 of the movable seal plate 22 , the movable seal plate 22 plunges into the accommodation chamber 20a in opposition to the urging force of the compression coil spring 23 , the pinching portion 22a of the movable seal plate 22 separates a little from the pinching portion 3a of the fixed seal plate 3 , and as shown in fig1 , the articles 104 thus barrel - bound and packaged fall onto the ejecting plate 42 owing to its own weight . after completion of packaging , both the movable levers 18 and 29 move in the manner completely reverse to the foregoing manner of operation , and the movable - side seal cutting assembly 17 , guide roller 31 , and presser plate 33 return to their respective initial states of operation shown in fig1 . although the packaging film is used in the embodiment described above , the present invention can be applied to a system utilizing a tape in lieu of the film . in this case , either and portion of the articles is bound by the tape . further , the saw blade 13 of the foregoing embodiment may be made movable with respect to the fixed seal plate 3 and the cutting groove 21a of the pushing - in portion 21 may be made to be pressed against this saw blade 13 . as many different modifications may be made without departing from the spirit and scope of the present invention , it is not intended to have the present invention limited to the specific embodiment thereof , except as defined in the appended claims .	1
with reference to fig5 , in accordance with an embodiment of the present invention a method of non - coherent ultrawideband communication is provided , the method including the steps of , receiving an ultrawideband signal comprising a plurality of transmitted symbols at a plurality of parallel correlators , the signal having a predetermined pulse - to - pulse duration 50 , correlating the ultrawideband signal with a delayed version of the ultrawideband signal using the plurality of parallel correlators 60 , integrating the correlated signal utilizing a plurality of parallel integrators to establish a plurality of integrator outputs , each of the plurality of parallel integrators having an predetermined adaptable integration interval 70 , sampling the integrator outputs and averaging the sampled outputs to provide a plurality of power estimates of the signal 80 , estimating a noise power of the ultrawideband channel from the power estimates of the signal 90 , estimating a maximum excess delay of the ultrawideband channel from the power estimates of the signal 100 and combining the sampled integrator outputs based upon the estimated maximum excess delay and the estimated noise power of the channel to identify the transmitted symbols 110 . the output of a single integrator is not sufficient to estimate maximum excess delay of channel and noise variance . in accordance with the present invention , multiple parallel integrators ( with shorter integration times ) can be employed to estimate the maximum excess delay of the channel and the noise variance . the integrators are adapted to cover different parts of the multipath delays . also , an integrator is allowed to cover beyond the maximum excess delay of the channel ( mainly for noise variance estimation ). from these integrator outputs , decision is made about the maximum excess delay of the channel and noise variance . note that these decisions are specific to the receiver type . for example , the decision will be different for tr - based scheme than the energy detector . however , the idea can be applied to various types of non - coherent receivers . to make a decision on maximum access delay of the channel , the sampled outputs of the parallel integrators are averaged over several pulses and possible symbols . the averaging will reduce the effect of noise and the integrator outputs will have distributions ( different distribution depending on the receiver implementation ) with different means ( nonzero means ). the means are identified by averaging . the mean values provide information about the energy / power of the signal over the parallel integrators . these power / energy estimates are then used to make a decision on noise variance and maximum excess delay estimate . for noise power estimation , two possible embodiments are provided in accordance with the present invention . in one approach , illustrated in fig6 , where the maximum excess delay of the channel is always less than the pulse - to - pulse duration , an integrator is used that integrates the signal power from the maximal excess delay ( at the point where the signal is no longer exists ) to the beginning of the next pulse 91 . this way , only the noise power is integrated . it is necessary to average this over many pulses and for many symbols to obtain a more reliable estimate of the noise power 92 . in a second approach for estimating the noise power , illustrated in fig7 , if the pulse - to - pulse duration is adapted and on - off keying modulation is used at the transmitter , then regularly inserted training symbols of zero ( off ) can be inserted to the transmitted signal 95 . when the transmitter is off ( i . e . transmitting zero ), then the outputs of the integrators over this symbol time can be used to estimate the noise power 96 . once the noise power is determined , this information can also be used to help the calculation of the maximum excess delay of the channel . the maximum excess delay can be determined based solely from all the integrator outputs without the knowledge of the noise power estimate . however , a more reliable decision can be made if the noise power estimation is also used in the decision . once a decision on maximum excess delay of the channel is made , the performance and data rate of the transceiver can be improved by adapting the pulse - to - pulse duration . if the pulse - to - pulse duration is shorter than the maximum excess delay of the channel ipi ( inter - pulse interference ) will be observed . if it is too large , then the maximal data rate for a user will not be high . adaptive design will make sure that high data rates are obtained while keeping the ipi at a minimum . the symbol decisions will be based on the combination of these integrator outputs . note that since digital samples are being used for the combining , optimal combining techniques can be employed , such as maximal ratio combining , interference rejection combining , etc . the power differences at the correlator outputs will be used for efficient combining . note that as well as the total power , the noise power over all these correlator outputs can be estimated by using 00k modulation and the second noise variance estimation technique mentioned above . this way , the signal - to - noise - ratio in each correlator output can be estimated and maximal ratio combining can be employed efficiently . taking this one step further , the noise correlation can be estimated across the parallel correlator outputs if the noise also includes interference . the noise correlation can be used for interference rejection combining . the present invention also provides for the tracking of the timing position using the parallel integrator approach . the single integrator approach does not allow for tracking of the timing position . however , a parallel integration approach that includes additional short time integrations beyond the multipath components of the received signal period ( i . e . the total combined integration time is larger than the maximum excess delay of channel ) will be able to track the fine timing position . note that additional integrators “ early ” ( before the estimated first multipath component ) and “ late ” ( after the last multipath component ) are required for efficient tracking . in accordance with the present invention , adaptation is inherent on the collection of multipath components . the multiple energy components , due to the integration of the multipath , are combined adaptively depending on the energy on each of these components and also depending upon the noise as well as the interference power . in general terms , instead of having a single correlator and integrator for the whole maximum excess delay of the channel , the present invention provides for multiple correlators and integrators . each of these correlator / integrators will try to capture part of the signal that is being received . then , the multiple signal contributions are coherently combined to arrive at the decision result . in addition , the present invention also adapts the maximum excess delay of the channel . the overall integration is adapted and with the present invention even if the location where the energy block starts and ends in the received signal is unknown , the proposed method in accordance with the present invention automatically adjusts the location . as such , the proposed method also automatically synchronizes with the signal . also , the interference rejection combining of the integrator outputs provides additional benefits . interference rejection combining has been applied to multiple antenna systems . the outputs of the integrators are interpreted as antenna elements ( which is a very realistic assumption ), similar approaches can be implemented here as well . as a result , multiple access interference and narrowband interference capabilities can be introduced . it will be seen that the advantages set forth above , and those made apparent from the foregoing description , are efficiently attained and since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described , and all statements of the scope of the invention which , as a matter of language , might be said to fall there between .	7
as shown in the exemplary drawings for the purposes of illustration , an embodiment of an integrated system made in accordance with the principals of the present invention , referred to generally by the reference numeral 10 , is provided for simplified setup and operation of an electrophysiology amplifying and switching system during an electrophysiology procedure . more specifically , as shown in fig1 the front panel of the system 10 of the present invention includes a standard twelve lead ecg input terminal 11 which allows attachment of any well known ecg lead cable through which leads extend from electrodes attached to the chest of a patient in a well known manner for transferring ecg signals into the system 10 . similarly , intracardiac input terminals 12 are positioned on the front panel , and include intervention / input terminals 13 which can be used as intracardiac input terminals or intervention ( stimulation ) terminals . the intervention / input terminals 13 are hard wired to corresponding intervention / output terminals 17 ( as shown in fig2 ). the intracardiac input terminals 12 are adapted to receive leads from the intracardiac catheters which have been placed within the patient &# 39 ; s heart to sense the electrical signals passing therethrough . the intervention / input terminals 13 are designed to pass electrical stimulation signals ( originating from an electrical stimulator , not shown ) through the system 10 into the intracardiac catheters . the intervention / input terminals 13 are also designed to receive electrical signals ( originating in the heart ) from the intracardiac catheters in the same manner as the input terminals 12 . also included on the front panel are four pressure channel input terminals 14 which are designed for receipt of pressure sensor leads which have been attached to pressure sensors positioned at desired points on or within the patient &# 39 ; s body from which blood pressure information is desired . the dominant feature of the front panel of the system 10 is an operator interactive &# 34 ; touch &# 34 ; display 15 which is programmed by an onboard microprocessor 27 ( see fig6 ) to operate as a labelling area for the input terminals 11 , 12 , 13 , 14 , and the auxiliary input terminals 16 ( see fig2 ). the display 15 is also configured by the microprocessor 27 to define touch areas thereon as &# 34 ; soft keys &# 34 ; for use in initiating setup and operation commands as will be explained below , and also to display messages related to setup and operation of the system 10 . further , the display 15 is driven by a microprocessor 27 ( see fig7 ) to display assignments of the output channels 17 ( see fig2 ) and the labels , poles , gains , filter , and clamp settings through which each channel of entering data must pass when entered into the system 10 . the display 15 is designed to simplify setup and operation of the system 10 as will be explained momentarily . software preprogrammed into the onboard microprocessor 27 , such as by a rom , is directly responsible for the operation of the display 15 and input &# 34 ; soft keys &# 34 ; thereof . the display 15 is preferably a single 640 × 480 pixel pressure responsive display commonly referred to as a &# 34 ; touch screen &# 34 ;. although the present invention is not limited to the following , it is intended that the preferred embodiment of the present invention include the ability to receive twelve leads of ecg signals as input into the input terminal 11 . further , it is preferred that sixteen or thirty - two intracardiac input terminals 12 and eight intervention or intracardiac input terminals 13 be included in the system 10 . further , it is preferred that four pressure channel input terminals 14 be included with four auxiliary input channels 16 ( see fig2 ). the display 15 is used to specify and setup labels associated with each input terminal 12 , 13 , 14 , and 16 . to describe the labeling process it is first necessary to define some terms . a label 28 ( see fig4 ( b )) is the alphanumeric assigned to an input terminal to identify the catheter or sensor and the lead attached thereto . a catheter group , or simply &# 34 ; group &# 34 ; is a group of labels 28 that have the same prefix letters but different numbers . an example of a catheter group would be : &# 34 ; rva1 , rva2 , rva3 , rva4 &# 34 ; ( see fig4 ( c )), where the prefix letters &# 34 ; rva &# 34 ;, are common to each label 28 . any intracardiac or intervention labels 28 with the same base letters , regardless of their location on the display 15 , belong to the same group . a field 29 ( see fig4 ( a )) is a label location on the display 15 . there are two basic screens which can be called to the display 15 by the operator to assist in arranging the setup configuration of the system 10 . the first is the &# 34 ; catheter placement screen &# 34 ; 43 as shown in fig4 ( a ). the second is the &# 34 ; signals screen &# 34 ; as shown in fig5 ( a ). once the electrophysiology catheters have been placed in the patient , setup of the system 10 only requires the steps of : 1 ) specifying the signal inputs by producing a label 28 for each one , and then 2 ) specifying the desired signal output parameters . the first step is accomplished through the use of the catheter placement screen 43 , the second step is accomplished with the assistance of the signals screen 44 . referring to fig4 ( a ), the catheter placement screen 43 is programmed to preferably form the following soft keys : a twelve lead key 31 , a restore key 34 , a catheter key 32 , a signals key 33 , a mark key 35 , a channels key 36 , a calibrate key 37 , a chart key 38 , an intervention key 39 , an intracardiac key 40 , an auxiliary key 41 , and a pressure key 42 . briefly , to specify an input , the operator need only touch the key describing the input type , such as the intracardiac key 40 , the auxiliary key 41 , or the pressure key 42 , then use the resulting directory 30 ( see fig4 ( b ) to assign each label 28 to the field 29 that corresponds to the correct lead input connector 12 , 13 , 14 , or 16 . to quickly assign a multiple of fields 29 to a single label 28 , the operator touches the desired label 28 in the directory 30 , then touches as many fields 29 as desired . operating in this fashion to assign labels is hereafter referred to as the batch edit mode of operation . to make a single assignment of a label 28 to a field 29 , the operator first touches the desired field 29 and then touches the desired label 28 in the directory 30 . assigning a single label 28 at a time in this fashion is referred to hereafter as the single edit mode of operation . in batch edit mode , when the user chooses which field or fields 29 to apply the label 28 to by touching in succession each desired field 29 , the plural leads of the catheter or sensor will be automatically numbered appropriately . the operator can continue in this way indefinitely . if a field 29 was empty prior to this operation , the field 29 will be filled in appropriately . however , if there was already a label 28 present in the field 29 , all associated labels 28 will be updated with the new label 28 and each lead connector will be numbered appropriately . when the operator is finished with one label 28 , another label 28 may be chosen . when all desired labels 28 are assigned , the operator chooses &# 34 ; done &# 34 ; from the touch screen , in which case the directory will disappear . if the operator selects a field 29 which cannot possibly be assigned ( such as choosing a pressure field while entering the title &# 34 ; intracardiacs &# 34 ;) an error message will be presented . if the operator chooses an empty field 29 directly from the catheter placement screen 43 , the directory 30 will appear , immediately placing the operator in the single select mode of the setup operation . when the operator then makes a label selection , the locations directory 30 disappears and the new information is displayed in the previously empty field 29 . to move a catheter label 28 in the single edit mode , the operator chooses any one of the fields 29 containing the name of the catheter to be moved . all lead names of the catheter will then be highlighted , and the directory 30 will appear . the operator can then choose the new field 29 for the catheter , after which the directory 30 will disappear and the fields 29 will automatically be updated to show the new label 28 . to remove a particular catheter in batch edit mode , the user selects &# 34 ; delete &# 34 ; from the directory 30 and then selects a field 29 associated with the particular catheter to be removed . as shown in fig4 ( c ), a popup containing the question &# 34 ; delete xxxx catheter ?&# 34 ; will appear . if the operator selects &# 34 ; yes &# 34 ;, all leads of the associated catheter will be removed . if the operator selects an invalid field 29 , such as an empty field or fields 29 from pressure or auxiliary input terminals 14 or 16 , an error message will appear . in single select mode , the operator will have first chosen the field 29 of interest , which will cause all similar fields 29 to be highlighted , then will choose &# 34 ; delete &# 34 ; from the directory 30 . all leads of the catheter will then be removed as well as the confirmation question and the directory 30 . as shown in fig4 ( d ), the softkey &# 34 ; new &# 34 ; is available under the auxiliary and pressure directory 30 when in the batch edit mode . when the &# 34 ; new &# 34 ; key is touched , it will be highlighted , and the directory 30 containing a keyboard popup will be presented . the operator may then type in the desired new label 28 and touch &# 34 ; done &# 34 ; to save the entry to the directory 30 . the operator may then select this label 28 for use as input channel label . while working with the auxiliary or pressure channels , the softkey &# 34 ; delete &# 34 ; will also remove a label 28 from the directory 30 to do so , the operator selects &# 34 ; delete &# 34 ;, which will be highlighted , and then chooses the desired label 28 from the directory 30 . a question confirming the operator &# 39 ; s intent will appear and the label 28 will be removed if the operator answers &# 34 ; yes &# 34 ; to the confirming question . zeroing of the pressure channels 14 will also be available to the operator under the pressure directory 30 . the system 10 will zero a pressure channel 14 upon request from the user . if in the single edit mode , the pressure sensor will be open to atmosphere prior to touching the &# 34 ; zero &# 34 ; softkey . the system 10 will then record the pressure signal for one second after the &# 34 ; zero &# 34 ; key is touched and compute an offset value to be used to calibrate the channel . while zeroing is taking place the softkey will be highlighted . in the batch edit mode , the operator chooses the &# 34 ; zero &# 34 ; key and then choose the desired input to be zeroed . the field 29 will then be highlighted while zeroing is taking place . after completion , in either batch or single edit mode , the letter &# 34 ; z &# 34 ; will appear to indicate that the channel has been zeroed as shown in fig4 ( e ). calibration is available while setting up the pressure channels . the &# 34 ; cal &# 34 ; key acts in a similar fashion as the &# 34 ; zero &# 34 ; key as explained above . once &# 34 ; cal &# 34 ; has been touched , a numeric keypad directory 30 as shown in fig4 ( f ) will appear . the directory 30 will preferably contain four preprogrammed &# 34 ; fast cal &# 34 ; keys 45 . the user then applies the calibrating pressure to the transducer and either enters the desired value or choose one of the &# 34 ; fast cal &# 34 ; keys 45 . once calibrated , a &# 34 ; c &# 34 ; will appear in the box beside the label 28 corresponding to the calibrated channel as shown in fig4 ( g ). to select the desired output parameters to be associated with each channel label 28 , the operator selects the &# 34 ; signals &# 34 ; softkey . at this point as shown in fig5 ( a ), the second of the two basic screens called the &# 34 ; signals screen &# 34 ; 44 will appear . the signal screen 44 contains a list of all assigned channels , their pole pairs , gains , filters , limiter level , and the output name of the channel which is to be used by the system 10 for display purposes . the signals screen 44 will behave in a manner similar to the catheter placement screen 43 described above . the signals screen 44 is preferably preprogrammed with the following soft keys : channel key 47 , leads key 48 , gain key 49 , filter key 50 , limiter key 51 , and name key 52 . also , the twelve lead key 31 , catheters key 32 , signals key 33 and restore key 34 are preprogrammed on the signals screen 44 in the identical manner as the catheter placement screen 43 . when a soft key is chosen , the operator is immediately placed in the batch edit mode of the setup operation . as shown in fig5 ( b ), a small &# 34 ; items &# 34 ; popup 46 , displaying information relative to the chosen soft key will appear . the operator must then choose the particular item 53 or label 28 from the popup 46 desired to be used and then choose which field or fields 29 to apply it to . the operator can continue in this way indefinitely . when the operator is finished , &# 34 ; done &# 34 ; can be chosen from the screen and the items popup 46 will disappear . alternatively , if the operator chooses one of the fields 29 directly , the field 29 will be highlighted , and the items popup 46 will appear and place the setup operation into the single edit mode . once the operator selects the desired item 53 , the items popup 46 disappears . at any time the operator can choose the &# 34 ; catheters &# 34 ; key 32 from the signals screen 44 and return to the catheter placement screen 43 , if desired . similarly , at any time in the catheter placement screen 43 , the operator can choose the &# 34 ; signals &# 34 ; key 33 and return to the signals screen 44 . to begin filling out the desired combination of leads for output from the system 10 , the operator first touches the leads key 48 . the items popup 46 for leads will appear as shown in fig5 ( b ) and contain a list of all available ecg , intracardiac , pressure and auxiliary channels . additionally , the ground leads &# 34 ; wct &# 34 ; and &# 34 ; rl &# 34 ; will appear along with the softkeys &# 34 ; delete &# 34 ; and &# 34 ; done &# 34 ;. in single edit mode the user will have previously chosen the desired field 29 to edit and can now choose the label 28 to use to complete an output channel . by touching the desired label 28 , the label 28 will appear in the highlighted field 29 previously selected ( ie . &# 34 ; rva 1 &# 34 ;). the operator &# 39 ; s next touch will complete the lead pair and the label 28 therefore . if the completing pair is of similar type , then the label 28 will be automatically abbreviated to appear as a single prefix and a pair of lead numbers , such as &# 34 ; rva 1 - 2 &# 34 ;. otherwise the second half of the pair will just be appended and the label 28 will appear such as &# 34 ; rva1 - hra1 &# 34 ;. when the operator selects an ecg , auxiliary or pressure channel , the label 28 will appear instantly . once a pairing has been completed , the settings as previously indicated on the signals screen 44 associated with particular cardiac locations will be applied to the gain , filter , and limiter settings . to edit the lead pair in single edit mode , the operator touches the desired field 29 ( which will be highlighted ) and the items popup 46 immediately appears . the operator then touches the desired new labels 28 from the items popup 46 . of course , both labels 28 must be chosen again to complete the new lead pair . to remove a label 28 in batch edit mode , the operator chooses the softkey &# 34 ; delete &# 34 ; from the items popup 46 . this will be highlighted and the operator then chooses the desired label 28 . the label 28 will be removed from the screen as well as all other information for that channel . &# 34 ; delete &# 34 ; will unhighlight after being used once . in single edit mode the desired label 28 will already be highlighted and will be removed once &# 34 ; delete &# 34 ; has been touched . the gains and filters are pre - set to default values which can be changed by the operator if desired . to change the default gains or filters , the operator touches the desired gain key 49 or filter key 50 , and an items popup 46 appears as shown in fig5 ( c ) with all available gains or filter settings respectively . in single edit mode , the operator will have previously chosen the field 29 to be edited and can now select the new item 53 from the presented list . the item popup 46 will then disappear . in batch edit mode the operator first selects the item 53 desired from the item popup 46 and then selects all fields 29 it is desired to apply it to . the operator may continue in this manner until &# 34 ; done &# 34 ; is finally selected . while adjusting filter settings , more than one item 53 may be chosen by the operator . these items 53 include high , low and notch filter settings . each item 53 is highlighted as it is touched to indicate which items 53 have been chosen . if more than one item 53 in a particular section is touched , the highlight moves to the new item 53 . as shown in fig5 ( d ), the limiter setting items popup 46 presents a sliding scale to indicate the relative amount of limiting . to adjust the limiter setting , the operator touches the direction arrows 54 to choose the desired amount . the numbers placed in the appropriate filed 29 on the signals screen 44 corresponding to the limiter reflect percentages of full scale . in single edit mode there is a &# 34 ; done &# 34 ; key on the popup 46 for the operator to indicate when the current level is correct . in batch edit mode , the operator selects the amount of limiting and then applies it to the desired field or fields 29 . &# 34 ; done &# 34 ; is used to indicate when the operator has finished applying new limiting levels to all the desired channels . limiting is applied in a bipolar fashion and is a ± limit . every channel preferably includes a name . the name fields are filled out with predetermined default names as the lead pairs are formed , the default name being the same as the label 28 . however , the user can edit the name using the keyboard presented in the name selection popup 46 , as shown in fig5 ( e ). once completed , the operator can select &# 34 ; done &# 34 ; and the keyboard popup 46 will disappear . in batch edit mode , the operator types in the desired name and then chooses the desired field 29 . whatever is in the keyboard buffer 55 at the time the operator touches the desired field 29 will be used as the name . the operator then touches &# 34 ; done &# 34 ; to remove the popup 46 and exit batch edit mode . single edit mode is operated in a similar manner according to the general format explained above for single edit mode operation . channel editing will only take place in single edit mode . as shown in fig5 ( f ) the operator selects the desired channel number to edit and the items popup 46 appears with all the channels and their names , and the selected channel number is highlighted . upon choosing a new channel which is not already in use , the popup 46 will disappear and the channel will be moved to it &# 39 ; s new position . the old position is initialized to an unused channel . if the operator selects a channel position from the popup 46 which is already occupied , the popup 46 will disappear , and the two channels will swap their configurations . to remove a channel the operator selects &# 34 ; delete &# 34 ; from the popup 46 and the previously selected channel will be removed . an example of a completed signals screen 44 is shown in fig5 ( g ). referring again to the catheter placement screen 43 , as shown in fig6 ( a ), the &# 34 ; catheter placement name &# 34 ; area 56 not only displays the currently invoked catheter placement name but is also active to the touch . once the operator has completed preparations of the system 10 for an electrophysiological procedure , the entire setup may be saved for recall later . to do this the operator simply touches the &# 34 ; catheter placement name &# 34 ; area 56 . if there is already a setup invoked , that setups &# 39 ; name will be present in the area 56 , otherwise the word &# 34 ; setup &# 34 ; will appear . the operator is then presented with the directory 30 containing a list of all available preset catheter setups as well as the softkeys &# 34 ; new &# 34 ;, &# 34 ; delete &# 34 ;, &# 34 ; save &# 34 ;, and &# 34 ; done &# 34 ;. upon selecting &# 34 ; save &# 34 ; the operator is presented with the keyboard directory 30 as shown in fig6 ( b ) and is prompted to fill in the name of the current setup . if a previous catheter placement had been invoked , the operator is prompted to overwrite the old one or to create a new name . &# 34 ; save &# 34 ; will be highlighted while active . the catheter placement setup will be saved both to the system 10 memory and the computer processing unit if attached . to finish saving the operator selects &# 34 ; done &# 34 ; from the keyboard directory 30 . to invoke an old catheter placement the user touches the &# 34 ; catheter placement name &# 34 ; area 56 and is presented with the directory 30 containing the list of currently stored catheter setups as again shown in fig6 ( a ). the operator then chooses the desired catheter setup by touching the desired name on the directory 30 . the catheter placement screen 43 will then be filled with that catheter setups &# 39 ; configuration such as shown in fig6 ( c ). if this is the correct catheter setup , the operator selects &# 34 ; done &# 34 ; and the directory 30 disappears and the hardware is automatically reset with the new catheter setup configuration . to remove a catheter setup configuration , the operator again initiates the catheter placement directory 30 and chooses &# 34 ; delete &# 34 ;. the operator then selects the setup to be removed , and the system 10 asks for confirmation . upon answering &# 34 ; yes &# 34 ;, the setup is removed to return to normal operation the operator selects &# 34 ; done &# 34 ;. to initialize the catheter placement screen 43 , the user selects &# 34 ; new &# 34 ; which will clear all inputs and uninvoke the current catheter setup . the &# 34 ; twelve lead &# 34 ; softkey 31 , and the &# 34 ; restore &# 34 ; softkey 34 are preferably located on opposite sides of the catheter placement name area 56 on the catheter placement screen 43 as shown in fig6 ( a ). by touching the &# 34 ; twelve lead &# 34 ; softkey 31 the operator can toggle the first twelve outputs of the output terminals 17 to receive all twelve ecg leads attached at the input ecg terminal 11 . a directory 30 indicating that the twelve lead ecg is being acquired will appear . the directory 30 contains a softkey containing the previous catheter placements name . to return to the previous placement the operator touches this softkey . if the placement has not yet been named , the softkey will contain &# 34 ; return &# 34 ;. the &# 34 ; restore &# 34 ; softkey 34 is used in the case that signals have drifted off of the computer display monitor on the chart recorder , either from movement of the patient or from a defibrillation , and the operator wishes to remove the dc offset and place the signals back into the middle of the monitor . the restore key 34 will be highlighted for appropriately one second to indicate that the signal placement is automatically being done . the &# 34 ; mark &# 34 ; key 35 is used to mark specific events in time during an electrophysiology procedure . &# 34 ; mark &# 34 ; will be highlighted for appropriately one second after it is pressed to indicate to the operator that the mark is automatically being placed in the time record . the &# 34 ; calibrate &# 34 ; key 37 is used to send a square wave of 1 mv . 5 hz ( rtt ) to all channels . once pressed the key will be highlighted . to stop the calibration pulse the operator presses calibrate key 37 again and the calibration stops . the highlight will also be removed . the &# 34 ; record &# 34 ; key 57 is used to initiate storage of data . recording will start from five seconds previous to when the record key 57 is touched , and storage thereafter is continuous . the operator will be able to stop storage by touching the record key 57 again . the &# 34 ; chart &# 34 ; key 38 delivers a ttl level to the chart recorder if attached to the system . while active , the &# 34 ; chart &# 34 ; key 38 will remain highlighted . to stop the chart recorder , the operator simply presses chart key 38 again . referring now to fig7 if the gain or phase response of the front - end amplifiers 18 are not identical , then the digital signal processor ( dsp ) 22 will not eliminate all of the common mode signal during the common mode signal rejection operation . therefor , an automatic calibration system is included in the system 10 of the present invention to automatically digitally calibrate the front - end amplifiers 18 prior to the initial use of the system 10 in order to correct for any nonuniform phase or gain performance between the front - end amplifiers 18 . the automatic calibration is performed by attaching a cable ( not shown ) from the output channels 17 to all of the intracardiac input channels 12 in parallel . the operator then enters the &# 34 ; calibration mode &# 34 ; of the system 10 and the dsp 22 automatically enters a known signal at each input channel 12 through the attached cable . the dsp 22 then samples the gain and phase of the signal it receives from each of the front - end amplifiers 18 . the difference between the gain and phase value of the known signal and the gain and phase value of the signal as received by the dsp 22 after passing through each front - end amplifier 18 is then digitally stored by the system 10 in a table . thereafter , during normal ( non - calibration mode ) operation of the system 10 , each signal received by the dsp 22 from the front - end amplifiers 18 is corrected by the stored digital value corresponding to the difference between the known calibration mode signal and the received signal of each front - end amplifier 18 . in this manner , any common mode signal received into the dsp 22 will be completely rejected regardless of which inputs 12 are used . since the automatic calibration values are stored digitally in a table in the system 10 , they do not experience any significant drift over the normal life of the system 10 . calibration of the front - end amplifiers 18 therefore is intended to be necessary only as an initial calibration , i . e . one time calibration before initial use of the system 10 . since this automatic calibration need be performed only once , it can be performed by the manufacturer of the system 10 and the subsequent operator will have no need to be concerned with it during normal use . the block diagram of fig7 shows the architecture of the most important internal electronics of the present invention . up to sixty - four electrical inputs from the input terminals of the system 10 are passed through front - end amplifiers 18 and directly into a multiplexer 19 . the signals are multiplexed into four output channels carrying sixteen input channels each and passed through a / d converters 20 and fiberoptics links 21 into the dsp switching board 22 . the dsp 22 operates as a switching matrix , such as in the manner of prior art analog switching matrixes , except that instead of switching analog signals electronically into differential amplifiers , the dsp 22 of the present invention switches digital signals and operates itself as a &# 34 ; differential amplifier &# 34 ;. this is done by electronically combining the digital representations of each signal , such as by subtraction , which results in sixteen output channels ( or thirty - two output channels if desired ) which pass directly into a dsp processing board 23 ( or two dsp processing boards in the case of thirty - two channel outputs from the dsp switching board 22 ). as is readily evident , the dsp switching board 22 of the present invention has been configured for operation to eliminate common mode signals from raw , digitized analog input signals . in this manner , the present invention is distinguished from any prior art use of digital signal processors since common mode signal noise is removed by prior art systems before any digital signal processors are utilized . the prior art use of digital signal processors has been simply to process signals which have previously been passed through an analog switching matrix . in these prior art systems , the common mode rejection function on the analog signals has already been performed through known techniques using differential amplifiers . in the present invention however , the dsp switching board 22 itself operates as a differential amplifier to perform the signal switching operation and to do common mode rejection on the raw digital signals . the signals received by the dsp processing board 23 are processed for gain , signal limiting and the application of a plurality of filters thereto . each dsp processing board 23 ( one in the case of sixteen output channels from the dsp switching board 22 , and two in the case of thirty - two output channels from the dsp switching board 22 ) outputs a single multiplexed channel to a d / a converter 24 which is then passed through a de - multiplexer 25 to restore sixteen channels . these are then passed through an analog filter 26 to the output 17 of the system 10 . the dsp switching board 22 and dsp processing board or boards 23 are driven by an onboard microprocessor 27 which is also operationally attached to the display 15 . in constructing the system 10 of the present invention using the dsp switching board 22 , a large amount of bulk is eliminated therefrom , thus allowing the system 10 to be significantly reduced in size compared to prior art hardware . also , the utilization of the dsp processing board 23 for filter , limiter , and gain application significantly aids in downsizing the overall physical dimensions of the system 10 by allowing elimination of the prior art type filter blocks which commonly include five different capacitors and an analog switch for each signal channel . the result is a system 10 which is significantly smaller than prior art hardware and which is therefore conveniently positionable directly at the patient &# 39 ; s bedside to allow bedside control of the system 10 by the operator during setup and electrophysiology procedures . the system 10 of the present invention can be attached through its output ports 17 by a cable to a computer processing unit , analog monitor , and / or chart recorder . an example of a computer processing unit usable with the system 10 of the present invention is manufactured by quinton electrophysiology corp . of markham , ontario , canada , and is presently being marketing under the trademark &# 34 ; eplab &# 34 ;. since the dsp switching board 22 is used for common mode rejection , it is very advantageous in the present invention to employ a / d converters having very high resolution , such as sixteen bit resolution . the preferred gain ranges for the system 10 include gain ranges of 100 to 5000 for ecg , intracardiac and pressure channels , and gain ranges between 1 and 5000 for the auxiliary channels . the system 10 employs three different filters , including high pass filters in the range of dc , 0 . 05 hz , 1 . 0 hz , 10 hz , and 30 hz , low pass filters in the range of 40 hz , 100 hz , 200 hz , and 400 hz , and notch filters in the range of 50 or 60 hz . the common mode rejection level is preferably set at greater than 100 db . it will be apparent from the foregoing that , while particular embodiments of the invention have been illustrated and described , various modifications can be made thereto without departing from the spirit and scope of the invention . accordingly , it is not intended that the invention be limited , except as by the append claims .	0
fig1 and 2 show an hydraulic fastener 10 which engages a screw threaded bolt 20 . fastener 10 has a body 11 with a screw threaded bore 12 which engages threads 21 on bolt 20 . body 11 has six flat faces 13 to provide purchase for a tensioning tool . the external profile of body 11 can be varied to suit the different types of tensioning tools available . annular recess 14 is formed in body 11 and opens outwards to end face 15 and inwards to bore 12 of body 11 . the lower portion of body 11 has a peripheral skirt 16 which surrounds annular recess 14 . a thrust member 17 in the form of an annular washer fits into annular recess 14 and has a curved upper face 18 . an annular chamber 30 is defined by annular recess 14 in body 11 , thrust washer 17 and the outer thread of bolt 20 . nipple 40 has a one - way valve 41 and screws into peripheral skirt 16 of body 11 and is connected to annular chamber 30 by passage 31 . nipple 40 can be connected to a source of charging medium 50 such as a particulate solid which is injected under pressure through nipple 40 into annular chamber 30 to expand the working volume of annular chamber 30 . connector body 11 moves in a direction opposite to thrust washer 17 to apply tension to bolt 20 . when the required tension has been applied to bolt 20 , the source of charging medium 50 is disconnected from nipple 40 and backflow is prevented by one - way valve 41 . charging medium 50 may also be a viscous paste which cures to become solid , a suspended solid in a self - setting compound , or a particulate solid which behaves as a fluid . if the source of the charging medium incorporates a media exchanger , solid injectable media such as graphite may also be used . particulate solids of a granular nature such as lead , copper or steel balls may also be used as charging materials . charging medium 50 sets and forms a solid block which prevents movement of body 11 relative to thrust washer 17 , an so prevents any reduction of the tension applied by hydraulic fastener 10 to bolt 20 . by using any of the above charging media , the need for seals between thrust washer 17 and the adjacent contact wall of annular recess 14 in body 11 is removed . accordingly any reduction of the tension applied to bolt 20 due to seal deterioration is avoided . fig2 to 6 show a second hydraulic tensioning device 110 used to join pipe flanges pf 1 and pf 2 of respective pipes p 1 and p 2 at a flange joint . for ease of manufacture , hydraulic tensioning device 110 has a device body in the shape of a ring formed of upper and lower annular discs 111 , 112 . upper disc 111 has a plurality of downwardly convergent bores 113 through it to receive bolts 120 which extend above pipe flange pf 1 . each conical bore 113 is shaped to receive a trifurcated nut cone 122 which engages screw threads 121 on bolt 120 . cone 122 is prevented from escaping from conical bore 113 by spring clip 123 . lower disc 112 has bores of larger diameter than bore 113 through it which form , with upper disc 111 , annular recess 114 which house thrust washers 117 so that upper 111 and lower 112 discs , thrust washer 117 and bolt 120 form an annular chamber 130 to receive charging medium 150 . each annular chamber 130 surrounding bolt 120 is interconnected by distribution galleries 151 extending around upper 111 and lower 112 discs . by manufacturing the connector body as two discs , distribution galleries 151 can be machined and upper 111 and lower 112 discs can be locked together by a plurality of joining bolts 119 . as illustrated in fig6 , charging medium 150 is injected under high pressure using media exchanger 160 which is screwed into passage 131 connecting to distribution gallery 151 . passage 131 contains non return valve 141 which operates the same way as non return valve 41 in nipple 40 in fig1 and 2 . media exchanger 160 has a body 161 which is connected to a source of hydraulic oil 162 via a hydraulic line 163 . hydraulic oil 162 is forced into media exchanger 160 under pressure to cause separator piston 164 to move in body 161 of media exchanger 160 thus causing expelling medium 150 from media exchanger 160 . this increases the effective volume of annular chambers 130 and discs 111 and 112 move relative to thrust washers 117 to tension bolts 120 to the required amount . when the required tension has been achieved in bolts 120 , media exchanger 160 is disconnected from passage 131 and non - return valve 141 prevents the release of charging medium 150 from device 110 . as described above charging medium 150 sets to prevent movement of discs 111 and 112 relative to thrust washers 117 thereby preventing any reduction in tension applied to bolts 120 . it will be apparent to the skilled addressee that manufacture of hydraulic tensioning device 110 is relatively simple and inexpensive since no complex machining operations nor tooling is required . the upper and lower discs 111 and 112 of the connector body are bolted together by bolts 119 to enclose distributor gallery 151 and so no intricate drilling operations are required . each trifurcated nut 122 is inserted in its conical bore 113 and retained with spring clip 123 which provides both retaining and closing forces for the nut 122 assembly . to install , hydraulic tensioning device 110 is fitted over bolts 120 protruding from pipe flange pf 1 as shown in fig4 . the action of pushing hydraulic tensioning device 110 over bolts 120 allows cone nuts 122 to ratchet over the bolt threads , and eliminates the need to screw the nuts into place . as described above , charging medium 150 flows to each annular chamber 130 via distributor gallery 151 forcing thrust washers 117 to react against adjacent pipe flange pf 1 . this creates tensile forces which are evenly and simultaneously distributed to each bolt 120 . one way valve 141 automatically activates and the pressure pumping apparatus is removed with full pressure remaining in the assembly . where setting paste is used as the charging medium it will cure rapidly preventing any leakage and subsequent loss of tensile load on bolts 120 . when a particulate solid is used as the charging medium it will retain the tensile load indefinitely as it is already at a high density . fig7 illustrates a third embodiment of the present invention where a standard form of hydraulic nut 210 is charged with charging medium 250 using media exchanger 260 in the same manner described with reference to fig3 to 7 . in this case , the pressure of the charging medium is not required to be maintained since the force generated is maintained by locking ring 216 which is screwed into nut 211 and engaged with piston 217 which cooperates with nut 211 to form annular chamber 230 . when this type of hydraulic nut needs to be removed intact at a later time , the charging medium used will be of a fluid nature in order to assist with re - pressurisation for loosening lock ring 216 . owing to the nature of the charge medium used , the sealing capacity of fasteners 10 , 210 of tensioning devices 110 need only be rudimentary . as illustrated in fig8 and 9 the leading edges of components and sliding engagement may be altered in order to enhance the sealing ability when viscous materials are used as the charging media . the use of charging media 50 , 150 , 250 , and in particular , the use of solid injectable media such as graphite and of particulate solids of a granular nature such as steel balls will allow the hydraulic tensioning fasteners and hydraulic tensioning devices of the present invention to be used in high temperature applications . in these situations it may be desirable to use the hydraulic nut of fig7 to 9 which has a locking ring 216 to retain the required toad . removal of fastener 210 would require injection of charging medium 250 to loosen locking ring 216 and to release the pressure to allow device 210 to be unscrewed from bolt 220 . it will be realized that the foregoing has been given by way of illustrative example only and that all other modifications and variations as would be apparent to persons skilled in the art are deemed to fall within the broad scope and ambit of the invention as herein set forth . throughout the description and claims to this specification the word “ comprise ” and variation of that word such as “ comprises ” and “ comprising ” are not intended to exclude other additives components integers or steps .	8
fig1 - 10 illustrate details of a cooking table 10 according to an embodiment of the disclosure . the cooking table 10 is in essence a mobile cooking station . according to the depicted embodiment , the cooking table 10 includes a table top 12 supported by a suitable supporting base including a plurality of legs 22 . in one arrangement , the base , including the legs 22 , is made of aluminum for lightness and strength . as can be seen in the figures , the bottom of the legs 22 include wheels 24 to enable the cooking table 10 to be wheeled to suitable locations for cooking , eating , and / or storage . electric power is delivered to the cooking table 10 via power cord 29 for cooking and for height adjustment as is described hereinafter . as shown in fig1 - 3 , the table top 12 may be substantially planar . one part of the table top 12 includes a cooking device . the cooking device is preferably an hob 42 and may be made from a glass ceramic surface for easy cleaning . in one embodiment , the hob 42 is an induction hob with three cooking zones 44 a , 44 b , and 44 c . the induction system is beneficial because it is a low - energy consumption system . additionally , it minimizes heat retained on the surface which is beneficial should the user want to utilize the cooking table 10 for a surface for dining or serving shortly after cooking . however , alternative cooking devices may be used in lieu of the induction system . the table top 12 also includes a food warming zone 45 at the corner edge of the surface . this can be used to keep food at the right temperature after cooking . this warming zone 45 may be created by any low heat emitting device . for example , it could be formed by an electric heating system or it can be part of the induction based system . the table top 12 also includes a control interface region 48 with smart touch sensitive controls 49 . the controls 49 can be configured in any desirable arrangement to control the cooking areas 44 a , 44 b , and 44 c and the warming zone 45 . it is recognized that the controls 49 may be mapped within the region 48 to correspond to the configuration of the heating elements 44 a , 44 b , 44 c , and 45 with respect to each other . the controls 49 may also be labeled with suitable indicia associating the controls 49 with the heating elements 44 a , 44 b , 44 c , and 45 . the table top 12 further includes a tray or cutting board 50 on the side of the table opposite the hob 42 . as shown in fig4 , the cutting board 50 has an upper planar surface and is removable from the table 10 . the tray or cutting board 50 can be supported to be part of the table top 12 in any desirable way . for example , the cutting board 10 may sit inside and on a portion of a frame 20 . the supporting surface , not shown , for the cutting board 50 may extend across and span the entire area within the frame . this enables the user to place items on that surface with the cutting board removed . in one embodiment , the removable cutting board 50 is heat and / or bacteria resistant . further , the removable cutting board 50 may be highly durable and may be made from a high - density polyethylene . in one arrangement , the table top 12 may be 900 mm ( 35 . 4 inches ) long and 550 mm ( 21 . 7 inches ) wide . however , it is recognized that the table top 12 may be of other dimensions and configurations . as is evident from fig5 - 7 , the table 10 is of adjustable height so that the table top 12 can be moved to the desired height for food preparation , food cooking , and for eating regardless of whether the user chooses to eat on a couch , chair , or stool . in one arrangement , the table top 12 is adjustable in height between the range of first height ( h 1 ) ( shown in solid lines ) of 550 mm ( 21 . 7 inches ) to a second height ( h 2 ) ( shown in dashed lines ) of 800 mm ( 31 . 5 inches ). accordingly , the table top 12 is vertically adjustable within a range of 250 mm ( 9 . 84 inches ) to accommodate different cooking , eating , and serving activities and preferences and can be fully adjusted within that range . the vertical adjustability of the table top 12 can be provided by any desirable arrangement . in one arrangement , the table 10 includes jacks ( not shown ) integrated in the legs 22 . the jacks may be electrically operable . this arrangement is schematically shown in fig7 . in such an arrangement , the legs 22 include an upper portion 22 a and a lower portion 22 b . the lower portion 22 b is telescopically movable relative to upper portion 22 a . the jacks cause the effective height of the legs 22 to change , which also causes the height of the table top 12 to change relative to the supporting surface on which the wheels 24 rest . the height adjustability can be controlled by any suitable user - operable switch , such as a toggle switch , operative coupled to the jacks to raise the height of the table top 12 . in one arrangement , as schematically shown in fig8 , a switch 27 can be provided on the underside of the table top 12 to enable the user to adjust the height of the table and the switch 12 may be a toggle switch . as previously described , the table 10 is connected to an electronic power source by an external power cord 29 . more specifically , the power cord 29 may be coupled to one of the wheels 24 of the cooking table 10 . such an arrangement is depicted in fig9 - 10 . in this arrangement , the wheels 24 include a rotating portion 25 a which can roll on a supporting surface , and a stationary portion 25 b . as shown , there may also be a rotating portion 25 a on the opposite side of the stationary portion 25 b . the end of the power cord 29 is coupled to a plug 28 . the plug 28 also includes coupling prongs 30 . the exterior of the wheels 24 includes a socket , not shown , with forgiving receptacles that substantially match the shape of the prongs 30 . additionally , a portion the plug 28 is magnetic so as to create a magnetic coupling between the plug 28 and the wheel 24 in lieu of a friction fit coupling of a typical power connection . one advantage of the magnetic coupling between the plug 28 and the wheel 24 is that should a person accidently trip on or pull the wire 29 , the plug 28 will easily disconnect from the socket on the wheel 28 . this minimizes the possibility of disrupting cooking utensils on the hob 42 that may be in the process of cooking . additionally , when connected , a portion of each of the prongs 30 preferably fits in the stationary portion 25 b of the wheel 24 but an extended portion fits into an aligned annular opening in the rotating part of the wheel 25 a . this , prevents the rotation of the rotating portion 25 a of the wheel 24 relative to the stationary portion 25 a , and serves as a wheel lock to keep the cooking table 10 safe . accordingly , the mobile cooking table 10 has dimensions , features , and / or characteristics that make it desirable in the interior environment . it is highly adaptive and mobile and becomes an extension of the dinner table , coffee table , desk , etc according to the situation . it also allows the user to cook and eat at the same place , alone or with guests . it also provided the user with more flexibility to eat what they want , when they want , and where they want . it also provided convenience and comfort to enjoy cooking for themselves or their guests . the induction hob maintains little residual head after the cooking process , so the table top can quickly be converted from a cooking surface to a serving and / or eating surface . the height adjustability enables use of it as an eating surface when the user is sitting on the floor or a chair , and enables the user to use it while standing during food preparation . the power attachment coupling to a wheel provides additional benefits for use in living quarters . while the present invention has been described with reference to exemplary embodiments , it will be understood by those of ordinary skill in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the scope thereof . therefore , it is intended that the invention not be limited to the particular embodiments disclosed , but that the invention will include all embodiments falling within the scope of the appended claims .	5
a method for manufacturing a substrate of erbium - doped optical fibers using the mcvd method will now be described in conjunction with fig1 and 2 . in accordance with the mcvd method , a connecting tube 22 is first clamped at one end thereof on a clamping chuck 24 of a lathe ( not shown ), as shown in fig2 . a quartz tube 10 , which is called &# 34 ; a supporting tube &# 34 ;, is connected at the other end of connecting tube 22 . quartz tube 10 is used to manufacture an erbium - doped optical fiber substrate . thereafter , raw material 38 such as sicl 4 or gecl 4 transported from a raw supply system ( not shown ) by a flow of oxygen is supplied to the interior of quartz tube 10 . subsequently , quartz tube 10 is heated by an external heating source 26 ( for example , an oxygen / hydrogen burner ) while rotating . during the heating process , an oxidation reaction occurs in the interior of quartz tube 10 . the oxidation reaction is expressed by the following formula : in accordance with the oxidation reaction , particles of quartz - based oxides containing impurities are produced . the oxide particles exist in the form of a deposition 32 on the inner surface of quartz tube 10 . as the heating process is further carried out while heating source 26 reciprocates in a longitudinal direction on quartz tube 10 , particulate deposition 32 is sintered on the inner surface of quartz tube 10 while being transparentized . as a result , a thin glass layer is formed on the inner surface of quartz tube 10 . thereafter , the above procedure is repeated until the glass layer on the inner surface of quartz tube 10 has a desired thickness . during the formation of the glass layer , a portion of the glass layer corresponding to a clad layer 14 is first formed , and a portion of the glass layer corresponding to a core layer 16 is then formed . in order to manufacture erbium - doped optical fibers capable of directly amplifying optical signals to a desired high level without requiring a complicated signal processing by use of quartz tube 10 formed with clad layer 14 and core layer 16 , quartz tube 10 is separated from clamping chuck 24 after being closed at its one end . thereafter , a solution containing erbium and other additive elements is injected into the interior of quartz tube 10 closed at one end thereof . quartz tube 10 is then maintained in the above - mentioned condition for a desired period of time so as to allow erbium 18 to be absorbed in core layer 16 to a desired amount . after a desired period of time elapses , the solution is removed from quartz tube 10 . at this time , core layer 16 has absorbed the solution containing erbium 18 and other additive elements . subsequently , quartz tube 10 is clamped again on clamping chuck 24 , and its closed end is then opened . clamping chuck 24 then rotates to rotate quartz tube 10 so as to prevent the solution absorbed in core layer 16 from being sporadically concentrated in core layer 16 , as shown in fig2 . thereafter , quartz tube 10 is maintained for a long period of time as it is , so that the solution absorbed in quartz tube 10 can be air - dried . after the erbium absorbed in quartz tube 10 is completely dried in the above process , quartz tube 10 is heated again at a high temperature using heating source 26 , so that it is softened . thereafter , both ends of quartz tube 10 are completely sealed . thus , an erbium - doped optical fiber substrate having a hollow cylindrical structure is obtained . however , the above - mentioned method involving the step of drying the solution containing erbium 18 and other additive elements absorbed in quartz tube 10 is problematic in that a long period of time is required to carry out the drying step because the drying step is processed in a natural air - dried state . this results in a lengthened manufacturing time of erbium - doped optical fiber substrates . as a result , the manufacturing productivity of erbium - doped optical fiber substrates is degraded . furthermore , the costs of erbium - doped optical fiber substrates increase . in addition , a sporadic undrying phenomenon may occur because quartz tube 10 is dried in a natural air - dried state . such a sporadic undrying phenomenon results in a non - uniform refractivity distribution . another method for manufacturing a substrate of erbium - doped optical fibers using the mcvd method will now be described in conjunction with fig1 and 3 . in fig3 elements respectively corresponding to those in fig2 are denoted by the same reference numerals . in accordance with this conventional method using the mcvd method , a connecting tube 22 is first clamped at one end thereof on a clamping chuck 24 , as shown in fig3 . a quartz tube 10 , which is called &# 34 ; a supporting tube &# 34 ;, is connected at the other end of connecting tube 22 . quartz tube 10 is used to manufacture an erbium - doped optical fiber substrate . thereafter , raw material 38 such as sicl 4 or gecl 4 transported from a raw supply system by a flow of oxygen is supplied to the interior of quartz tube 10 . subsequently , quartz tube 10 is heated by an external heating source 26 ( for example , an oxygen / hydrogen burner ) while rotating . during the heating process , an oxidation reaction occurs in the interior of quartz tube 10 . the oxidation reaction is expressed by the following formula : in accordance with the oxidation reaction , particles of quartz - based oxides containing impurities are produced . the oxide particles exist in the form of a deposition 32 on the inner surface of quartz tube 10 . as the heating process is further carried out while heating source 26 reciprocates in a longitudinal direction on quartz tube 10 , particle deposition 32 is sintered on the inner surface of quartz tube 10 while being transparentized . as a result , a thin glass layer is formed on the inner surface of quartz tube 10 . thereafter , the above procedure is repeated until the glass layer on the inner surface of quartz tube 10 has a desired thickness . during the formation of the glass layer , a portion of the glass layer corresponding to a clad layer 14 is first formed , and a portion of the glass layer corresponding to a core layer 16 is then formed . in order to manufacture erbium - doped optical fibers capable of directly amplifying optical signals to a desired high level without requiring a complicated signal processing by use of quartz tube 10 formed with clad layer 14 and core layer 16 , quartz tube 10 is separated from clamping chuck 24 after being closed at its one end . thereafter , a solution containing erbium and other additive elements is injected into the interior of quartz tube 10 closed at one end thereof . quartz tube 10 is then maintained in the above - mentioned condition for a desired period of time so as to allow erbium 18 to be absorbed in core layer 16 to a desired amount . after a desired period of time elapses , the solution is removed from quartz tube 10 . at this time , core layer 16 has absorbed the solution containing erbium 18 and other additive elements . subsequently , quartz tube 10 is clamped again on clamping chuck 24 , and its closed end is then opened . clamping chuck 24 then rotates to rotate quartz tube 10 so as to prevent the solution absorbed in core layer 16 from being sporadically concentrated in core layer 16 , as shown in fig3 . during the rotation of quartz tube 10 , the outer surface of quartz tube 10 is slowly heated by a heater 30 at a low temperature while heater 30 reciprocates in a longitudinal direction on quartz tube 10 , thereby causing the solution absorbed in quartz tube 10 to be slowly dried . after the erbium absorbed in quartz tube 10 is completely dried in accordance with the above process , quartz tube 10 is heated again by a heating source 26 at a high temperature , so that it is softened . thereafter , both ends of quartz tube 10 are completely sealed . thus , an erbium - doped optical fiber substrate having a hollow cylindrical structure is obtained . where the solution containing erbium 18 and other additive elements absorbed in quartz tube 10 is dried in accordance with the above - mentioned method shown in fig3 it is possible to greatly reduce the drying time , as compared to the method of fig2 using the natural air - drying process . this is because the outer surface of quartz tube 10 is slowly heated by heater 30 at a warm temperature while heater 30 reciprocates in a longitudinal direction on quartz tube 10 , thereby causing the solution absorbed in quartz tube 10 to be dried . even in this case , however , several hours are required to dry quartz tube 10 . as a result , this method is also problematic in that a long period of time is taken to manufacture erbium - doped optical fiber substrates . as a result , the manufacturing productivity of erbium - doped optical fiber substrates is degraded . furthermore , the costs of erbium - doped optical fiber substrates increase . in addition , a sporadic undrying phenomenon may occur because quartz tube 10 is dried using heat generated by heater 30 . such a sporadic undrying phenomenon results in a non - uniform refractivity distribution . since heater 30 is used to dry quartz tube 10 , additional time and costs are required to install heater 30 . moreover , an erroneous installation of heater 30 may cause errors in the manufacture of erbium - doped optical fiber substrates . referring now to fig4 an apparatus for manufacturing erbium - doped optical fibers in accordance with an embodiment of the present invention is illustrated . in fig4 elements respectively corresponding to those in fig2 and 3 are denoted by the same reference numerals . in particular , the apparatus is used to dry a solution containing erbium and other additive elements absorbed in a quartz tube in the manufacture of an erbium optical fiber substrate using the mcvd method in accordance with the present invention . as shown in fig1 and 4 , the apparatus includes a chuck 24 which serves to fix a quartz tube 10 deposited with a clad layer 14 and a core layer 16 in accordance with the mcvd method and to rotate the fixed quartz tube 10 . a connecting tube 22 is fixedly mounted to one end of chuck 24 . connecting tube 22 serves to connect quartz tube 10 to chuck 24 . beneath connecting tube 22 , a heating source 26 is disposed to generate heat for slowly drying quartz tube 10 which is absorbed with a solution containing erbium 18 and other additive elements . in quartz tube 10 , a desired amount of gas from gas source 20 is also introduced . in order to increase the efficiency in drying the interior of quartz tube 10 , oxygen is used as the gas . for heating source 26 , an oxygen / hydrogen burner is used which is supplied only with hydrogen during ignition , and a mixture of hydrogen and oxygen during a heating process . now , a method for fabricating erbium - doped optical fibers using the above - mentioned apparatus in accordance with the present invention will be described in detail in conjunction with fig1 and 4 and flow diagram fig5 . in accordance with the method of the present invention using the mcvd process , quartz tube 10 , which is used to manufacture an erbium - doped optical fiber substrate , is first connected to connecting tube 22 ( step 510 ). this connecting tube 22 is then clamped on clamping chuck 24 ( step 520 ), as shown in fig4 . thereafter , raw material 38 such as a sicl 4 gas or a gecl 4 gas transported from a raw supply system by a flow of oxygen o 2 is supplied to the interior of quartz tube 10 , such that the flow rate of the oxygen controls the feeding of the raw material into quartz tube 10 . additionally , the sicl 4 gas may be doped with a gecl 4 gas and transported by the o 2 carrier . subsequently , quartz tube 10 is heated by external heating source 26 , namely , the oxygen / hydrogen burner , while rotating it by clamping chuck 24 . during the heating process , an oxidation reaction occurs in the interior of quartz tube 10 . the oxidation reaction is expressed by the following formula : in accordance with the oxidation reaction , particles of quartz - based oxides containing impurities are produced . the oxide particles exist in the form of a deposition 32 on the inner surface of quartz tube 10 . as the heating process is further carried out while heating source 26 reciprocates in a longitudinal direction on quartz tube 10 , particle deposition 32 is sintered on the inner surface of quartz tube 10 while being transparentized . as a result , a thin glass layer is formed on the inner surface of quartz tube 10 . thereafter , the above procedure is repeated until the glass layer on the inner surface of quartz tube 10 has a desired thickness . during the formation of the glass layer , a portion of the glass layer corresponding to a clad layer 14 is first formed ( step 530 ), and a portion of the glass layer corresponding to a core layer 16 is then formed ( step 540 ). the formation of core layer 16 is achieved by varying the amount of raw material 38 from that used in the formation of clad layer 14 . additionally , the amount of raw material used to form the core layer can be varied as each layer of the core layer is varied . in order to manufacture erbium - doped optical fibers capable of directly amplifying optical signals to a desired high level without requiring a complicated signal processing by use of quartz tube 10 formed with clad layer 14 and core layer 16 , quartz tube 10 is first closed at its one end ( step 550 ). the reason why quartz tube 10 is closed at its one end is because when a solution containing erbium 18 and other additive elements is injected into the interior of quartz tube 10 , the solution and erbium 18 may leak from the interior of quartz tube 10 . quartz tube 10 is then separated from clamping chuck 24 ( step 555 ). thereafter , a solution containing erbium and other additive elements is injected into the interior of quartz tube 10 closed at one end thereof ( step 560 ). quartz tube 10 is then maintained in the above - mentioned condition for a desired period of time so as to allow the erbium 18 to be absorbed in core layer 16 to a desired amount . at this time , core layer 16 has particles of an incomplete glass structure in order to allow the solution containing erbium 18 and other additive elements to penetrate easily therein . after a desired period of time elapses , the solution is removed from quartz tube 10 ( step 565 ). at this time , core layer 16 has absorbed the solution containing erbium 18 and other additive elements . subsequently , quartz tube 10 is clamped on clamping chuck 24 ( step 570 ), and its closed end is then opened ( step 575 ). a large amount of gas from gas source 20 is then fed into the interior of quartz tube 10 , as shown in fig4 and using heating source 26 , connecting tube 22 is uniformly heated at a temperature equal to or lower than the volatilization point of nitric acid . oxygen is used as the gas to increase the drying efficiency . during the heating , clamping chuck 24 rotates to rotate quartz tube 10 so as to uniformly heat connecting tube 22 to uniformly heat the gas , namely , oxygen , while preventing the solution absorbed in core layer 16 from being sporadically concentrated in core layer 16 ( step 580 ). by this heating , the solution containing erbium 18 and other additive elements is slowly dried . after the erbium absorbed in quartz tube 10 is completely dried in the above process , quartz tube 10 is heated again at a high temperature using heating source 26 , so that it is softened . thereafter , quartz tube 10 may be collapsed ( step 585 ) into a condensed erbium - doped optical fiber preform , or both ends of quartz tube 10 may be completely sealed to form an erbium - doped optical fiber preform having a hollow cylindrical structure . in accordance with the above - mentioned method and apparatus of the present invention , it is possible to greatly reduce the time taken to manufacture erbium - doped optical fibers for optical amplifiers . in the manufacture of erbium - doped optical fibers using a solution adding method , the time taken to dry the solution is dependent on the condition of the core layer . where it is assumed that the same core layers are formed using the same erbium - containing solutions , respectively , the method of fig2 using a heater can reduce the drying time to about 1 / 5 of the drying time taken in the natural air - drying method of fig2 . in accordance with the present invention , it is possible to reduce the drying time to about 1 / 2 of the drying time taken in the method of fig3 using a heater . accordingly , the present invention provides an effect of reducing the time taken to manufacture an erbium - doped optical fiber substrate . this results in a greatly reduced manufacturing time of erbium - doped optical fiber substrates . as a result , the manufacturing productivity of erbium - doped optical fiber substrates is improved . furthermore , the costs of erbium - doped optical fiber substrates are greatly reduced . since oxygen is supplied to the interior of the quartz tube and heated at an appropriate temperature , the erbium solution absorbed in the quartz tube can be uniformly dried in the rotation direction of the quartz tube and in the longitudinal direction of the quartz tube . accordingly , it is possible to prevent a sporadic undrying phenomenon from occurring in the interior of the quartz tube . in addition , it is not required to use any additional heating device such as a heater because the interior of the quartz tube is dried by the heating source used for the deposition of the clad and core layers . accordingly , it is possible to eliminate a loss of time and process errors resulting from the installation of a separate heating device . although the preferred embodiments of the invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims .	2
referring to fig5 the memory device comprises a power level detector 120 , an internal voltage converter ( ivc ) 600 and internal circuits 60 . the internal circuits 60 will be understood to be the same as those of fig1 . upon power up , a power level detector 120 generates a power - up signal pdt . the signal pdt activates the ivc 600 to produce internal supply voltage vint . the ivc 600 provides the required internal supply voltage vint to internal circuits 60 . power - up is used broadly herein to refer to any intended ramping up of power from a nominal zero volts to a nominal supply voltage , whether such occurs at initial power - up or start - up , for example , of a hand - held , flash memory - based device such as a digital camera or after initial start - up but after a dormant ( or so - called sleep ) period wherein the power supplied to the device &# 39 ; s internal circuits has been either diminished ( e . g . to a standby level ) or removed . [ 0031 ] fig6 is a block diagram illustrating a first embodiment of this invention . fig6 comprises a power level detector 120 , a ce buffer 140 , a cmd register 160 , a voltage regulator 400 and an ivc 600 . in accordance with the prior art , the active ivc controller 650 is activated only when the ce buffer . 140 or the cmd register 160 is enabled . the ce buffer 140 provides chip enable information and the cmd register 160 provides read , program , and erase information . the power - up signal pdt of the power level detector 120 does not input to the ivc controller 650 but inputs instead to the cmd register 160 and internal circuits 60 only for resetting the memory device . in contrast to the prior art teachings by which no power up signal pdt inputs to the ivc controller 650 , in accordance with the present invention , the signal pdt inputs to the ivc controller 650 during the power up period . in other words , novel ivc controller 650 is activated whenever one of the three signals , the chip enable signal from ce buffer 140 , the chip busy signal from cmd register 160 or the power up signal from power level detector 120 , is active . the power level detector 120 of the present invention is shown in fig7 . there are many types of power level detectors . although other power level detectors are contemplated as being within the spirit and scope of the invention , the featured power level detector 120 has a p - mos and an n - mos depletion transistor that are serially connected to each other , in accordance with the present invention . the gates of the two transistors are connected in common to ground . the source of the p - mos transistor mp 3 is connected to the external voltage vext , and the drain thereof is connected to node n 1 and to the drain of the n - mos transistor mn 3 . an n - type well which is used for the bulk of the p - mos transistor mp 3 is connected to the external supply voltage vext having high potential . the source of the n - mos transistor mn 3 is connected to ground . the n - mos transistor mn 3 connected between the node n 1 and ground is a depletion type and has a long channel , thus providing high resistance . as shown in fig7 and 8 , the level of node ni is ground level because of an n - mos depletion transistor mn 3 . when the external supply voltage vext reaches to the threshold voltage vth of p - mos transistor mp 3 , the p - mos transistor mp 3 turns on at t 1 . after time t 1 , the node n 1 ramps up from ground to the external supply voltage but does not reach the voltage vext because of the n - mos depletion transistor mn 3 . at the same time , the power up signal pdt ramps up from ground to the voltage vext and reaches the voltage vext in a short time because n - mos transistor ( not shown ) of inverter inv 1 is turned off . when the gate - to - source voltage vgs of n - mos and p - mos transistor ( not shown ) in the inverter inv 1 are the same , the power up signal pdt goes down toward ground level . in other words , when the node n 1 level reaches a certain trip - point level va at t 2 , the pdt goes logical low level . in general , the pdt is logical high level before t 2 and logical low level after t 2 . as a result , the power up period is finished after time t 2 . during the power - up period , the power - up signal pdt goes high and inputs to the ivc controller . the ivc ( 600 in fig6 )— which comprises an active ivc controller ( 650 ), active ivc drivers ( 300 ) and standby ivc driver ( 200 )— receives the power - up signal pdt from power level detector ( 120 ). as shown in fig5 and 9 , the active ivc controller 650 ( see fig9 ) receives the power - up signal pdt which is a logic high . the active ivc controller 650 generates an active ivc enable signal aivcen . the active ivc controller 650 comprises control logic 800 ( coupled to the internal supply voltage vint ) and a level shifter 850 . the control logic 800 includes a nor gate 101 and an inverter 103 . the nor gate 101 receives a power - up signal pdt , a chip enable signal chipenable and chip busy signal chipbusy . according to this invention , because the power level detector ( 120 in fig5 ) generates a power - up signal pdt at a logic high , the output of the nor gate 101 goes to a logic low . the level of the gate of the n - mos transistor 106 is a logic high , which turns on the transistor 106 when the output of the inverter 103 goes high . so the node n 4 goes low and turns on the p - mos transistor 107 . as a result , the external supply voltage vext is provide to the node n 5 . specifically , the output of the control logic 800 is shifted to the other level vext , the same as the level of the active ivc enable signal aivcen through the level shifter 850 . there are many types of level shifters 850 . in this invention , the level shifter uses an external voltage vext as a voltage source . namely , the active ivc enable signal aivcen is raised to the level of vext . those of skill in the art will appreciate that , within the spirit and scope of the invention , other types may be used . when the active ivc enable signal aivcen ( which is the output of the active ivc controller 650 ) inputs to the active ivc drivers ( 300 in fig6 ), the drivers ( 300 ) generate an internal voltage vint at node n 7 . a representative one of the active ivc drivers is shown in fig1 . there are many types of active ivc drivers . in this invention , two such driver types will be described . those of skill in the art will appreciate that , within the spirit and scope of the invention , other types may be used . one of the active ivc drivers is shown in fig1 and the other is shown in fig1 . the active ivc driver 310 of fig1 operates as follows . the external supply voltage vext is supplied to the node n 7 as an internal supply voltage vint through the p - mos transistor p 1 . similarly , the external supply voltage vext is supplied to node n 7 in active ivc driver 320 of fig1 as an internal supply voltage vint through the n - mos transistor m 1 . each of the two active ivc drivers ( 310 of fig1 , 320 of fig1 ) receives and is controlled by the active ivc enable signal aivcen . in both cases , the driver ( 310 , 320 ) receives a reference voltage signal vref as well as the active ivc enable signal aivcen . the reference voltage signal is generated by a voltage regulator 400 , as illustrated in fig1 . because any one of many known voltage regulators 400 can be used in this invention , it will not be further explained . referring next to fig1 , it will be appreciated that the active ivc driver ( 310 of fig1 , 320 of fig1 ) has a high charge driving capability compared with the standby ivc driver ( 200 in fig6 ). accordingly , when the internal supply voltage vint passes the external supply voltage vext by way of the active ivc driver , the slope of the internal supply voltage vint is greater than that of the standby ivc driver ( 200 ). moreover , the slope of the internal supply voltage vint is nearly as great as that of the external supply voltage vext . it is possible to use several active ivc drivers ( 300 in fig6 ) to provide the internal supply voltage to the node n 7 . preferably , plural active ivc drivers ( 300 ) are used to provide the internal supply voltage vint . this increases the internal supply voltage ramping - up speed ( slope ) and minimizes the speed difference between the external supply voltage vext and the internal supply voltage vint . thus , the internal supply voltage vint can be provided to the internal circuits within the required shorter time in the newer and more demanding hand - held systems . indeed , the invention makes it possible to achieve power - up voltage ramp slopes up to at least two orders of magnitude higher than has been conventionally possible , rendering memory device turn - on times far less than the required 1 μs maximum . this permits use of the invention in the most demanding digital camera applications , which may require as low as 1 microsecond power - up timing , rather than the several microsecond to millisecond ramp - up timing that conventional standby power techniques provided . in fig6 and 13 , during the power - up operation , the power level detector ( 120 in fig6 and 7 ) generates the power - up signal pdt of a logic high . according to the level of the power level detector , the ivc generates the internal supply voltage . the internal supply voltage vint ramps up quickly , closely following the ramp of the external supply voltage vext , until the internal supply voltage reaches the minimum operating voltage vdet , as shown in fig1 . as a result , the internal supply voltage rapidly goes to the vdet level . after the power level detector ( 120 of fig7 ) generates a logic low and the level of the node ni of fig7 exceeds the va level , the ivc driver ( 310 of fig1 , 320 of fig1 ) stops providing the internal supply voltage vint to the node n 7 . thereafter , the internal supply voltage connected to the node n 7 is supplied only the external supply voltage vext from the standby ivc driver . as shown in fig1 , after passing the time t 1 when the level of vdet is reached , the slope of supplied voltage is equal to the slope of the internal supply voltage vint from the standby ivc driver ( 200 of fig6 ). even though the slope of the internal supply voltage vint after time t 1 follows that of the standby ivc driver , because the internal supply voltage vint already has achieved the minimum operating voltage vdet within the required time , the system operates properly and without errors . in contrast , the active ivc driver of the prior art operates only when the memory device receives the chip enable signal or chip busy signal ( see fig1 ). moreover , the standby ivc driver ( 200 of fig1 ) provides only an internal voltage to the internal circuits during the power - up period . so , it is impossible to provide the internal supply voltage to the internal circuits within 1 μs , which is the required time in recent systems . in this embodiment , the ivc 600 further comprises a vint / vext short circuit 130 . the power - up signal pdt of the power level detector 120 does not input to the active ivc controller 650 but it does input to the vint / vext short circuit 130 . the active ivc controller is activated by the ce buffer 140 and cmd register 160 , as in the prior art . but , in important contrast , the internal supply voltage vint is supplied to the node n 7 by way of the vint / vext short circuit controlled by the power - up signal pdt . the vint / vext short circuit is shown in fig1 . as may be seen from fig1 , the power - up signal powerup ( pdt ) inputs to an inverter inv 2 to turn on p - mos transistor mp 4 , effectively shorting vext to vint . ( during the power - up period , the power - up signal powerup ( pdt ) goes to a logic high . the gate of the p - mos transistor goes to logic low via an inverter inv 2 . the p - mos transistor mp 4 turns on and the external supply voltage vext is connected to the internal supply voltage vint via the on transistor , effectively shorting vext to vint . ). within the spirit and scope of the invention , the p - mos transistor mp 4 may change to an n - mos transistor ( depletion or enhancement type .) the beneficial result of electrically shorting the two voltages vext and vint is illustrated in fig1 . during the power up , the internal supply voltage vint ramps up and precisely tracks the external supply voltage vext until time t 1 . at that time , the internal supply voltage reaches the minimum operating voltage vdet . after the power - up signal pdt goes to a logic low , as described above in connection with the first embodiment of invention , the slope of the internal supply voltage vint tracks that of the standby ivc driver ( 200 of fig1 ). as a result , it is possible to provide a quickly ramped - up internal supply voltage vint within the system required time . [ 0052 ] fig1 is a third embodiment of the present invention . in this figure , the power - up signal pdt of the power - up detector 120 inputs to the active wvc controller and vext / vint short circuit 130 . according as the power - up signal pdt concurrently inputs to the active ivc controller and vext / vint short circuit 130 , the internal supply voltage vint generated from the external supply voltage vext ramps up more rapidly . in this hybrid embodiment , active ivc controller 650 has three inputs , powerup , chipenable and chipbusy , as shown in fig9 and as described above . a person skilled in the art will be able to practice the present invention in view of the description present in this document , which is to be taken as a whole . numerous details have been set forth in order to provide a more thorough understanding of the invention . in other instances , well - known features have not been described in detail in order not to obscure unnecessarily the invention . while the invention has been disclosed in its preferred embodiments , the specific embodiments as disclosed and illustrated herein are not to be considered in a limiting sense . indeed , it should be readily apparent to those skilled in the art in view of the present description that the invention may be modified in numerous ways . the inventor regards the subject matter of the invention to include all combinations and sub - combinations of the various elements , features , functions and / or properties disclosed herein . the following claims define certain combinations and sub - combinations , which are regarded as novel and non - obvious . additional claims for other combinations and sub - combinations of features , functions , elements and / or properties may be presented in this or a related document .	6
the following description of the preferred embodiments is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . for example , the present invention is hereafter described in the context of a fuel cell fueled by reformed gasoline . however , it is to be understood that the principles embodied herein are equally applicable to fuel cells fueled by other reformable fuels . furthermore , the present invention hereafter described in the context of a self contained fuel cell system having a reforming system and a fuel cell system . however , it is to be understood that the principles embodied herein are equally applicable to a reforming system only . referring to fig1 , a fuel processor system , generally indicated as 10 , according to a first embodiment of the present invention is illustrated , which provides rapid startup capabilities . fuel processor system 10 generally includes a fuel processor 12 , a fuel cell stack 14 , a catalytic combustor reactor 16 , and a vaporizer reactor 18 . fuel processor 12 would typically include a primary reactor 12 . 2 such as a steam reformer or an autothermal reformer , a water gas shift ( wgs ) reactor 12 . 4 and a preferential oxidation ( prox ) reactor 12 . 6 . fuel processor system 10 is arranged such that a first fuel inlet stream 20 and a first water inlet stream 22 are introduced into fuel processor 12 to produce a reformate stream 24 according to conventional principles . during a startup cycle , an anode bypass valve 26 directs reformate stream 24 to an anode bypass passage 28 . it is necessary to initially bypass fuel cell stack 14 until “ stack grade ” ( having co content less than about 100 ppm ) reformate is produced . in order to produce such stack grade reformate , it is necessary to heat the various components of fuel processor system 10 to their respective operating temperatures . recirculated reformate in passage 30 from anode bypass passage 28 is drawn into a recirculation compressor 32 together with a first inlet air stream 34 . first fuel inlet stream 20 is then introduced into fuel processor 12 . reactions may be initiated in fuel processor 12 via a spark lit burner or by an electrically heated catalyst section ( not shown ). heat produced by the reaction of first fuel inlet stream 20 and first inlet air stream 34 warms fuel processor 12 . first fuel inlet stream 20 and first inlet air stream 34 are introduced in proportions slightly rich of stoichiometric . this ensures that there is no excess oxygen , which could damage the catalysts within fuel processor 12 . ordinarily , reactions near stoichiometric conditions produce damagingly high temperatures ; however , with a large excess of recirculated reformate 30 acting as a diluent , the gas temperature within fuel processor 12 is maintained at an appropriate level . a portion , generally indicated at 36 , of the flow through anode bypass passage 28 is exhausted to catalytic combustor reactor 16 . under steady flow , this exhausted reformate 36 is equal to the total mass flow of first fuel inlet stream 20 , first inlet air stream 34 , first water inlet stream 22 and vaporizer steam 38 that passes through fuel processor 12 . this exhausted reformate 36 is reacted with a second inlet air stream 40 in catalytic combustor reactor 16 . second inlet air stream 40 is directed to catalytic combustor reactor 16 via a stack air compressor 42 , a cathode bypass valve 44 , a cathode bypass passage 46 , and an exhaust passage 48 . second inlet air stream 40 is bypassed around fuel cell stack 14 during startup to prevent drying of the membranes within fuel cell stack 14 . heat from the reaction in catalytic combustor reactor 16 is integrated back into fuel processor 12 by vaporizing second water inlet stream 50 in vaporizer reactor 18 to produce vaporizer steam 38 , which typically is delivered to the prox - vaporizer or steam lines within fuel processor 12 . exhaust gases from combustor 16 exits vaporizer reactor 18 through exhaust outlet 66 . during the startup cycle , the fuel and air are completely consumed ( stoichiometric conditions ) for maximum heat release within fuel processor system 12 for rapid heating without excessively high temperatures . however , it is important to note that the temperature within the prox 12 . 6 may initially be relatively high at about 357 ° c . however , once the prox is heated , normal operation is such that cooling of the prox according to conventional methods can be used . referring again to fig1 , once the various reactors within fuel processor 12 are warmed to their operating temperature , anode bypass valve 26 routes reformate stream 24 to fuel cell stack 14 via passage 52 . second inlet air stream 40 is then directed by cathode bypass valve 44 to the cathode side of fuel cell stack 14 via passage 54 . the hydrogen from reformate stream 24 reacts with the oxygen from second air inlet stream 40 across a membrane electrode assembly within fuel cell stack 14 to produce electricity . anode exhaust or stack effluent 56 from the anode side of fuel cell stack 14 includes a portion of hydrogen that is directed back to catalytic combustor reactor 16 to provide heat recovered in vaporizer 18 . cathode exhaust 58 from the cathode side of fuel cell stack 14 includes oxygen also for use in catalytic combustor reactor 16 . anode exhaust 56 and cathode exhaust 58 are combined in exhaust passage 48 and react in catalytic combustor reactor 16 . vaporizer reactor 18 continues to provide vaporizer steam 38 to fuel processor 12 . note that the prox air , within fuel processor 12 , is drawn from recirculation compressor 32 which contains only first inlet air stream 34 when anode bypass valve 26 directs reformate stream 24 to fuel cell stack 14 . preferably , a reformate check valve 60 is disposed in exhausted reformate passage 36 to ensure that anode exhaust 56 and cathode exhaust 58 in exhaust passage 48 are not drawn into fuel processor 12 by recirculation compressor 32 . as is well known in the art , catalysts , such as that which is often used in water gas shift reactors ( i . e . cuzn ), are often sensitive to oxygen and condensed water . therefore , this is particularly important after shut down when the fuel processor cools and any water vapor condenses . that is , the reformate gases within fuel processors often have a very high water ( steam ) content ( typically 30 %), which condense when the fuel processor cools after shut down . additionally , as the fuel processor cools the condensation of water and the cooling of gases within the fuel processor may cause a reduction in gas pressure sufficient to pull a vacuum even if valves at the inlet and exit seal a fuel processor . at this point , any leaks present in the various valves , fittings , or flanges may allow air into the fuel processor and potentially damage the water gas shift catalyst . therefore , additional features are illustrated in fig2 to address these shut down issues . the fuel processor system 10 ′, shown in fig2 , is the same as that described in reference to fig1 , where like reference numerals are used to indicate like components . referring to fig2 , a recirculation valve 102 is positioned in recirculated reformate passage 30 and an exhaust valve 104 is positioned in exhaust reformate passage 36 . recirculation valve 102 and exhaust valve 104 are used in conjunction to control the recirculation ratio ( i . e ., the ratio of recirculated reformate stream to the total reformate stream ). that is , by opening recirculation valve 102 the flow of recirculated reformate 30 is increased , while opening exhaust valve 104 the flow of recirculated reformate 30 is decreased . furthermore , opening both valves 102 , 104 decreases the pressure within fuel processor 12 . recirculation valve 102 and / or exhaust valve 104 may be closed to prevent anode exhaust 56 and cathode exhaust 58 from being drawn into fuel processor 12 by recirculation compressor 32 . the transition to normal operation for fuel processor system 10 ′, shown in fig2 , is the same as described in reference to fig1 . fuel processor system 10 ′, shown in fig2 , further provide a means to shut down fuel processor 12 without water condensation or air ingestion . for shut down , reformate stream 24 is circulated to anode bypass passage 28 via anode bypass valve 26 . exhaust valve 104 remains closed to cause higher pressures within fuel processor 12 . recirculation valve 102 is then slightly opened to maximize pressure within the capacity of recirculation compressor 32 . during shut down , water is condensed and separated from reformate stream 24 in a condenser 106 , which is connected to the system coolant loop ( not shown ). in normal operation , condenser 106 is used as an anode pre - cooler before fuel cell stack 14 . to further increase the pressure within fuel processor 12 during shut down , recirculation compressor 32 draws in first inlet air stream 34 . preferably , the inlet to recirculation compressor 32 and the downstream side of circulation valve 102 are small in volume such that after recirculation compressor 32 is stopped , the pressure will remain high . subsequently , the oxygen within first inlet air stream 34 will react with the hydrogen in recirculated reformate 30 within fuel processor 12 to produce additional heat , thereby increasing the pressure within fuel processor 12 . however , if necessary , additional fuel from first fuel inlet stream 20 may be added during shut down to consume the oxygen in first inlet air stream 34 in order to provide sufficient reactants ( h 2 and co ) within fuel processor 12 . an oxygen sensor 108 is used in the fuel processor 12 as feedback to ensure that excess oxygen is not present . if the pressure within fuel processor 12 is higher than a predetermined level , exhaust valve 104 may be opened to reduce such pressure . once the water has been condensed from reformate stream 24 and a high pressure condition has been achieved within fuel processor 12 , fuel processor air mass flow controller 62 is closed to seal the inlet , anode bypass valve 26 remains in the bypass position , and exhaust valve 104 remains closed to seal the exit . recirculation compressor 32 is then stopped . the resident gases within fuel processor 12 are dry and at an elevated pressure , which is desired for shut down condition , particularly with a cuzn water gas shift catalyst . during the shut down cycle , the fuel and air are completely consumed ( stoichiometric conditions ) without water injection and without excessively high reactor temperatures to allow the gases to be dried by condenser 106 . as is well known in the art , conventional fuel processors suffer from various disadvantages when operating at reduce power and reduced flow , such as auto - ignition in the inlet , reverse water gas shift in the prox , cell reversal in the fuel cell stack , and water collection in the fuel cell stack . furthermore , the transition between power levels are often slow to react due to the time necessary to pressurize or vent reactor volumes so as to achieve steady flow conditions at the new power level . within the primary reactor temperatures in the inlet region increase such that there is a limited amount of time before undesirable auto - ignition of the fuel will occur . as the flow through the fuel processor is reduced at low power , the residence time within the inlet is increased . thus , the rate of reduction in flow and power is limited by the auto - ignition condition in the inlet . within the prox reactor , after the oxygen is consumed , reformate that is exposed to catalyst will undergo reverse water gas shift reactions , thereby consuming desirable h 2 and creating undesirable co . at reduced flow , the oxygen is consumed earlier in the prox reactor , thereby leaving a larger section of catalyst and a longer residence time for reverse water gas shift reactions to occur . within the fuel cell stack , the current flow through each fuel cell is limited by the fuel cell provided the lowest quantity of h 2 . that is , the fuel cell with the lowest h 2 flow limits the current through all of the remaining fuel cells . therefore , a portion of the available quantity of h 2 ( typically 10 to 20 %) leaves the fuel cell stack unused . at reduced flows , the portion of h 2 leaving the fuel cell stack needs to be higher for stable operation , which is likely the result of less uniform flow distribution at reduced flows . also contributing to the minimum flow for stable fuel cell stack operation is the need to clear condensed water to prevent it from collecting in and blocking passages within the gas distribution plates . in conventional systems , the flow rate through the fuel processor system varies with power level , thus the associated pressure drop necessitates a change in reactor pressure between power levels . however , a change in reactor pressure requires time for flow to fill or vent to the downstream reactors in order to achieve the steady pressure at the new power level . the numerous aforementioned disadvantages are overcome in the present invention by maintaining a higher flow rate , even during low power operation , by recirculating gases through the fuel processor and stack . fuel processor system 10 ″, shown in fig3 , illustrates a system having reformate circulation through the fuel processor for startup , means for water condensation and pressurization for shut down , and circulation through the fuel processor and anode for turn down and transients . the fuel processor system 10 ″, shown in fig3 , is the same as that described in reference to fig1 and 2 , where like reference numerals are used to indicate like components . more particularly , for startup , anode bypass valve 26 directs reformate stream 24 to anode bypass passage 28 . first fuel inlet stream 20 is introduced into fuel processor 12 . first inlet air stream 34 is delivered to fuel processor 12 by a fuel processor air compressor 202 . fig3 shows first inlet air stream 34 being delivered to three locations in fuel processor 12 in the form of pox air stream 204 , start air stream 206 and prox air stream 208 . pox and prox air streams 204 , 208 would normally be part of fuel processor 12 . heat produced by the reactions of fuel inlet stream 20 and inlet air stream 34 warms fuel processor 12 . by staging the inlet air to provide multiple heating locations , the startup time is reduced by improving heat distribution within fuel processor 12 . to initiate reactions in each of these locations , a spark lit burner or an electrically heated catalyst section ( not shown ) is used . the overall oxygen to carbon ( o / c ) ratio ( i . e . ratio of first inlet air stream 34 to first fuel inlet stream 20 ) is introduced in proportions slightly rich of stoichiometric to ensure that no excess oxygen is present , which could damage the catalyst within fuel processor 12 . the recirculated reformate 30 acts as a diluent so that all the available first inlet air stream 34 is reacted without excessively high temperatures within fuel processor 12 . exhaust reformate passage 36 is employed to exhaust excess reformate to catalytic combustor reactor 16 . under steady flow , this exhausted reformate in passage 36 is equal to the total mass flow of first fuel inlet stream 20 , first inlet air stream 34 , first water inlet stream 22 and vaporizer steam 38 that passes through fuel processor 12 . this exhausted reformate in passage 36 is reacted with second inlet air stream 40 in catalytic combustor reactor 16 . second inlet air stream 40 is directed to catalytic combustor reactor 16 via stack air compressor 42 , cathode bypass valve 44 , cathode bypass passage 46 , and exhaust passage 48 . second inlet air stream 40 is bypassed around fuel cell stack 14 during startup to prevent drying of the membranes within fuel cell stack 14 . heat from the reaction in catalytic combustor reactor 16 is integrated back into fuel processor 12 by vaporizing second water inlet stream 50 in vaporizer reactor 18 to produce vaporizer steam 38 , which typically is delivered to the prox - vaporizer or steam lines within fuel processor 12 . an anode check valve 210 and a cathode check valve 212 are shown to prevent back flow of reformate exhaust 48 into fuel cell stack 14 . preferably , a reformate check valve 60 is also disposed in exhausted reformate passage 36 to ensure that anode exhaust 56 and cathode exhaust 58 in exhaust passage 48 are not drawn into fuel processor 12 by recirculation compressor 32 . once the various reactors within fuel processor 12 are warmed to their operating temperature , anode bypass valve 26 routes reformate stream 24 to fuel cell stack 14 via anode inlet passage 52 . second inlet air stream 40 is then directed by cathode bypass valve 44 to the cathode side of fuel cell stack 14 via cathode inlet passage 54 . the hydrogen from reformate stream 24 reacts with the oxygen from second air inlet stream 40 across a membrane electrode assembly within fuel cell stack 14 to produce electricity . anode exhaust or stack effluent 56 from the anode side of fuel cell stack 14 includes a portion of hydrogen that is directed back to catalytic combustor reactor 16 where it is oxidized to provide heat . cathode exhaust 58 from the cathode side of fuel cell stack 14 includes oxygen which may also be used in catalytic combustor reactor 16 . anode exhaust 56 and cathode exhaust 58 are combined in exhaust passage 48 and react in catalytic combustor reactor 16 . vaporizer reactor 18 continues to provide vaporizer steam 38 to fuel processor 12 . a back pressure regulator 214 is used to set the pressure within fuel processor system 10 ″, while recirculation compressor 32 determines the amount of reformate recirculated . as additional flow from first fuel inlet stream 20 , first inlet air stream 34 , first water inlet stream 22 , and vaporizer steam 38 is added to fuel processor 12 , additional reformate flow will split to exhausted reformate passage 36 to maintain the system pressure . therefore , at high power , the system 10 ″ operates at a low recirculation ratio , whereby a larger portion of reformate stream 24 is “ fresh ” having a relatively high h 2 content . at low power , the system 10 ″ operates at a high recirculation ratio , whereby a larger portion of reformate stream 24 is re - circulated and having a relatively low h 2 content . it is important to note that recirculation compressor 32 according to the present embodiment need only overcome the pressure drop through fuel processor 12 and fuel cell stack 14 during normal operation , unlike the system shown in fig2 where the pressure would drop to atmospheric pressure downstream of recirculation valve 102 to allow first inlet air stream 34 to be drawn in . to this end , fuel processor system 10 ″ illustrated in fig3 requires an additional fuel processor air compressor 202 . alternatively , stack air compressor 42 can be used to deliver air to fuel processor 12 . as best seen in fig3 , fuel processor system 10 ″ maintains a flow rate that is approximately equal to a fuel processor system operating at an optimum power level . this higher flow rate helps overcome many of the disadvantages described above . during the shut down cycle of fuel processor system 10 ″, anode bypass valve 26 routes reformate stream 24 to anode bypass passage 28 . second inlet air stream 40 is then directed by cathode bypass valve 44 through cathode bypass passage 46 to catalytic combustor reactor 16 . this will provide air to catalytic combustor reactor 16 to react with any exhausted reformate in passage 36 from the recirculation loop . backpressure regulator 214 is adjusted to indirectly produce the highest possible pressure within the capacity of recirculation compressor 32 . as reformate stream 24 recirculates through fuel processor 12 , water is condensed and separated in condenser 106 . to further increase the pressure within fuel processor 12 prior to shut down , fuel processor air compressor 202 draws in first inlet air stream 34 . subsequently , the oxygen within first inlet air stream 34 will react with the hydrogen in circulated reformate 30 within fuel processor 12 to produce additional heat , thereby increasing the pressure within fuel processor 12 . however , if necessary , additional fuel from first fuel inlet stream 20 may be added during shut down to consume the oxygen in first inlet air stream 34 in order to provide sufficient reactants ( h 2 and co ) within fuel processor 12 . an o 2 sensor 108 is used in fuel processor 12 as feedback to ensure that excess oxygen is not present . once the water has been condensed from reformate stream 24 and a high pressure condition has been achieved within fuel processor 12 , fuel processor air mass flow controllers 216 , 218 , 220 and stack air mass flow controller 64 are closed to seal the inlets , anode bypass valve 26 and cathode bypass valve 44 remain in the bypass position , and back pressure regulator 214 remains closed to seal the exit . recirculation compressor 32 , fuel processor air compressor 202 , and stack air compressor 42 are stopped . the resident gases within fuel processor 12 are dry and at an elevated pressure , which is desired for shut down condition , particularly with a cuzn water gas shift catalyst . yet another alternative system is illustrated in fig4 wherein a compressor may be eliminated from the fuel processor system , generally indicated at 10 ′″. fuel processor system 10 ′″ is operated at sub - atmospheric pressures such that potential for air ingestion exists . otherwise , the startup , shut down , turn down and transient operation are similar to fuel processor system 10 ″ illustrated in fig3 . an additional benefit of fuel processor system 10 ′″ is that a recirculated exhaust 302 can be made inert by providing just enough cathode exhaust 58 to catalytic combustor reactor 16 using a combustor air mass flow controller 304 for stoichiometric operation in catalytic combustor reactor 16 . a cathode back pressure regulator 306 is needed to match the pressure set by a back pressure regulator 308 downstream of catalytic combustor reactor 16 to ensure cathode exhaust 58 can be directed to catalytic combustor reactor 16 . an o 2 sensor 310 may be used in exhaust 312 to ensure stoichiometric operation . a unique capability of the aforementioned systems is the potential to operate without water addition . this is an advantage for a system that is to be started in ambient temperatures below o ° c ., where water is not available . because the system 10 ′″ operates at a high recirculation , this mode of operation is relatively inefficient at about 62 %, however it may be used for short duration . it should be understood that features of the fuel processor systems illustrated in fig1 - 4 can be combined as needed for system requirements . for example , prox air 208 may preferably be delivered from stack air compressor 42 . that is , various combinations of the various systems described herein might be made depending upon the specific application . as should be appreciated from the foregoing discussion , the fuel processor systems of the present invention all include recirculation of fuel processor gases , such as reformate , anode exhaust , or combustor exhaust . this feature provides numerous advantages that are not present in conventional fuel processor systems . for example , the fuel processor systems of the present invention are capable of providing a large mass flow rate through the fuel processor to aid in heating the fuel processor components to the proper operating temperatures during startup . moreover , during shut down , the fuel processor systems of the present invention enable the fuel processor to run dry and condense water from the reformate to avoid condensation on the catalysts and subsequently be shut down at an elevated pressure to prevent air ingestion upon cooling of the fuel processor . still further , during turn down , the fuel processor systems of the present invention enable higher flow rates through the fuel processor and fuel cell stack to avoid auto - ignition in the inlet , reverse water gas shift in the prox , cell reversal in the fuel cell stack , and water collection in the fuel cell stack , all of which occur at reduced flow rates . during transient response , the fuel processor systems of the present invention , by circulating gases , enables the flow rate and pressure in the fuel processor to remain nearly constant , thereby minimizing the lag in transient response associated with filling or venting volumes in the fuel processor system . the ability to use recirculated gases , which contain water vapor as a product of reaction , enables the fuel processor to run without water injection . the fuel processor systems of the present invention enable rapid thermal start of the fuel processor without the complexity of multiple stages or risk of oxygen exposure . the description of the invention is merely exemplary in nature and , thus , variations that do not depart from the gist of the invention are intended to be within the scope of the invention . such variations are not to be regarded as a departure from the spirit and scope of the invention .	2
in fig1 an up / down counter generally designated as 10 has two up count inputs or increment inputs having leads 12 and 14 connected thereto and being supplied with positive pulse ( pp ) and bias 1 frequency pulses respectively . up / down counter 10 additionally has two decrement or down inputs with leads 16 and 18 connected thereto . lead 16 has negative sets of pulses applied thereto while lead 18 has the feedback pulses applied thereto . an output 20 of the up / down counter 10 provides apparatus digital high - pass output words to further circuitry as well as to a low - pass filter 22 . filter 22 provides an output on a lead 24 to a summing means 26 having a bias 2 input 28 . the summing means 26 and the bias 2 signal in one embodiment of the invention was designed into the low - pass filter function of block 22 . an output of summing means 26 is supplied on a lead 30 to a digitally controlled oscillator or divider or counter 32 . counter 32 receives a clock or reference frequency input on a lead 34 and has a feedback output previously labeled as 18 . in one embodiment of the invention , the reference frequency on lead 34 was 51 . 84 megahertz while the frequency of the bias signal on lead 14 was four kilohertz . the bias signal on lead 28 was 4d60 hex which equates to a decimal number of 12 , 959 . in a stable or non - input state , the counter 32 would count from 12 , 959 to 32 , 767 and output a pulse fb . it would then load a new digital word which would again be 12 , 959 as modified by any outputs from low - pass filter 22 and count to its maximum limit of 32 , 767 before outputting a further feedback pulse . in fig2 an or gate 41 receives bias 1 and positive ( pp ) signals on leads 43 and 45 . leads 43 and 45 correspond to 14 and 12 in fig1 . a further or gate 47 receives negative ( np ) pulses and feedback ( fb ) pulses on leads 49 and 51 respectively . these signals correspond to similarly labeled leads in fig1 . an output of or gate 41 is applied to an input of an and gate 53 and to an inverting input of a further and gate 55 . an output of or gate 47 is supplied to an inverting input of and gate 53 and to an input of and gate 55 . an output of and gate 53 is supplied to a d input a flip - flop generally designated as 57 while an output of and gate 55 is supplied to d input of a further flip - flop 59 . a clock input is supplid on a lead 61 to the clock ( ck ) inputs to both flip - flops 57 and 59 . an output of flip - flop 57 is shown in lead 63 and would be an increment signal supplied to the counter portion of counter 10 while an output of flip - flop 59 is labeled 65 and would be supplied to a decrement input of up / down counter 10 . although a preferred embodiment utilized nand gates and nor gates for cost effectiveness , it was believed that the circuit illustrated in fig2 would be simpler to explain and functionally performs the identical function to that utilized in the circuit reduced to practice . the combinational circuit of fig2 is designed to provde an increment output when there is either a bias 1 or pp input signal and there is neither an np or fb signal . on the other hand , a decrement output is provided on lead 65 when there is either an np or fb signal and there is not a bias 1 or pp signal . the waveform of fig3 shows an output representative of that appearing on lead 20 of fig1 in response to a single isolated input on lead 12 . a single set of inputs causes the output to reach some maximum value designated as 70 . at a time 72 the output drops to a value 74 . the time between 70 and 72 is shorter than the time between 72 and a next time 76 . at time 76 , the output drops to a value 78 . further times 80 , 82 , 84 , 86 , and 88 are illustrated . each of the values 90 , 92 , 94 , and 96 remain at their given levels for a longer time period . the digital output representation is equivalent to and representative of the analog waveform produced by r - at . such a curve is commonly referred to as an rc time constant curve . a value substantially equivalent to e - 3 would produce a digital word zero output since at that point the output would be equal to or less than 5 % of the initial value . since one embodiment of the inventive concept utilized eight discrete steps from any given maximum to a minimum , eight levels are shown in fig3 . in fig4 a waveform illustrative of the pp signal on lead 12 of fig1 is provided as waveform 100 . a logic &# 34 ; 1 &# 34 ; is designated as 102 , and in one embodiment of the invention , comprises eight clock periods . the waveform 100 contains several segments 104 , 106 , 108 , and 110 to illustrate time compression . the separate segments are broken but are intended to illustrate that the pp sets of pulses cannot occur any more often than once every fourth bias 1 pulse . the bias 1 pulses are shown on waveform representation 112 and illustrates pulses 114 , 116 , 118 , 120 , and 122 . one embodiment of the inventive concept divided a 51 . 84 megahertz signal by 32767 - 12959 to produce the bias 1 signal . the eight pp pulses 102 are thus representative of the time for eight 51 . 84 megahertz clock signals to occur . it should also be noted that the logic is designed such that the pp pulses and the bias 1 pulses cannot occur at the same time . the breaks between the various segments of the waveforms of fig4 is due to the fact that there are 12 , 959 clocks between adjacent bias 1 pulses such as 114 and 116 . fig5 illustrates a waveform pp with pulses 130 , 132 , 134 , 136 , and 138 . each one of these is a logic &# 34 ; 1 &# 34 ; for a period of eight clock pulses . a further waveform np is shown with a single negative pulse 140 which also is representative of being a logic &# 34 ; 1 &# 34 ; for eight clock pulses . a final waveform designated as 20 &# 39 ; starts at ground potential and has a first peak 142 responsive to pp pulse 130 , a second peak 144 responsive to pp pulse 132 , a third peak 146 responsive to pp pulse 136 , a fourth peak 148 responsive to pp pulse 136 and a final positive peak 150 responsive to pp pulse 138 . after point 150 , the output declines to a point coincident with pulse 140 at which time the output decreases to a negative value designated as 152 . the waveform 20 &# 39 ; is a series of step functions similar to that shown in fig3 . the very basic concept of the high - pass filter should be somewhat obvious to anyone skilled in the art from the information contained in the background and detailed description . as will be realized , the up / down counter 10 in a stable apparatus condition where no inputs have been received on leads 12 or 16 for a long period of time , will have an output digital word at lead 20 which is effectively or substantially zero . thus , the output of low - pass filter 22 will be a digital zero and the signal on lead 30 going into divider 32 will be identical to the bias 2 word appearing on leading 28 . since the digitally controlled oscillator or divider 32 is , in actuality , in one embodiment of the invention , merely a further counting device , the clock signals appearing on lead 34 continuously increment counter 32 . each time the counter 32 reaches a limit such as 32 , 767 as it did in one embodiment of the invention , an output pulse is supplied on the feedback line 18 . if the clock or reference frequency on lead 34 is 51 . 84 megahertz and the digital word on lead 28 is equivalent to 12 , 959 , the frequency of occurrence of pulses on lead 18 would be exactly four kilohertz . thus , if the signal on lead 14 is also a four kilohertz pulse , the system will remain in a stable condition with no outputs appearing on lead 20 . even if the signals on leads 28 and 34 are such that the signal on lead 18 is not exacty the same as that on lead 14 , the apparatus of fig1 will still provide an output on lead 20 which has an average value of zero for the long term . if , when the apparatus of fig1 is in a stable condition , a signal if supplied on lead 12 as is shown by 102 in fig4 a new digital word will appear on lead 20 . if the signal 102 remains in a logic &# 34 ; 1 &# 34 ; condition for a period of eight clock pulses of counter 10 , an output digital word of the equivalent of eight will appear on output 20 . the low - pass filter 22 will pass the integral of this signal to output 24 so that the summation digital word at output 30 will change and will used as the starting count point by divider 32 after the issuance of the next feedback pulse . thus , a period of time from 70 to 72 in fig3 is required before there is enough difference in the frequency of signals on lead 18 as compared to that on lead 14 to reduce the output of counter 10 to the level shown as 74 in fig3 . during this time , the output of low - pass filter 22 is increasing in steps if it is a digital low - pass filter , and is continuously increasing if it is in analog - type filter . it should be mentioned that although this concept is being described as being a completely digital high - pass filter including all of its components , the apparatus can be a hybrid assembly of analog and digital circuits if there is a desire to have a hybrid system . in such a case , the device 32 may be a controlled oscillator and the filter 22 may be an analog rc - type filter while the bias 2 on lead 28 may be a stable reference voltage . in any event , the output of filter 22 continues to provide an output until the system again stabilizes . if further pulses are received on either leads 12 or 16 , then a signal such as shown as 20 &# 39 ; in fig5 may result , assuming the input pulses on leads 12 and 16 are as shown by waveforms pp and np in fig5 . the waveforms of fig4 are shown to reference the fact that as designed , the system was restricted from having more than one set of pulses or logic &# 34 ; 1 &# 34 ; values on either 12 or 16 any more often than every four occurrences of the lead 14 logic &# 34 ; 1 &# 34 ; condition . while this is merely a design parameter , it was believed that any more frequent occurrences of the negative or positive position pulses would require undue digital number size and thus , commercially , costly component complexity and substrate area .	7
in fig1 the aligned antenna is represented by three sensors c 1 , c 2 and c 3 and the misaligned antenna is shown by the sensors c 1 , c 2 and c 2 , the position of the sensor c 2 resulting from a translation of the central sensor c 2 of the aligned antenna along a vector of misalignment ε having its ends identical with the positions of the sensor c 2 and of the sensor c 2 p . according to this configuration , the vector ε may occupy any direction of the space around the ideal position of the sensor c 2 , its modulus remaining relatively small compared with the distance l between two consecutive sensors c 1 , c 2 or c 2 , c 3 of the aligned antenna . in considering only what happens with an aligned antenna , the distance r between the central sensor c 2 and the target and the relative bearing θ of the target with respect to the direction of alignment of the sensors c 1 , c 2 and c 3 are obtained simply from the differences of propagation times τ 12 and τ 23 or time difference of each wave front coming from the target and reaching the sensors c 1 - c 2 and c 2 - c 3 . these time differences are defined by the relationships : ## equ1 ## where r 1 and r 3 are the respective distances between the sensors c 1 and the target , and c is the velocity of propagation of sound in the medium in which the antenna is submerged . taking only second order terms , θ and r are defined as a function of the differences in propagation times τ 12 and τ 23 by the relationships ## equ2 ## naturally , in the presence of a misaligned antenna , the differences in propagation times obtained are no longer equal to the time differences τ 12 and τ 13 . taking only terms of the first order in ## equ3 ## the distance r p between the sensor c 2 p and the target is then defined by an expression of the form : where u represents the standardized vector of the direction of the target and & lt ;,& gt ; symbolizes the scalar product . the differences in propagation times τ 12 p and τ 23 of the sound wave coming from the target between , respectively , sensors c 1 - c 2 p and c 2 p - c 3 are defined by relationships of the form : the relationships 6 and 7 show that the misalignment of the sensors on the antenna has an effect on the propagation times measured by the sensors and that , consequently , it should have an effect also on the computation of the position of the target . in particular , the appreciation of the distance r should be considered to be biased by the value : ## equ4 ## if both the alignment fault ε and the direction u are perfectly known , the biased value of the distance can be perfectly determined by the relationship 8 . however , in practice , only ε can be perfectly determined , and there always remains an error of appreciation of the direction u of the target . if we consider an orthonormal reference ( o , x , y , z ), the relationship 8 should be considered as a resultant of the sum of a distance biased in the horizontal plane ( o , x , y ) and a distance biased in a vertical direction oz normal to this plane such that : ## equ5 ## when the target is localized in the horizontal plane , the components of the vector u in this plane u x and u y can be estimated properly . the errors δu x and δu y are very close to 0 , and the bias on the distance is above all determined by the uncertainty on δu z . the bias ( r ) is expressed as a function of the bias of 1 according to the relationship : ## equ6 ## by way of indication , a vertical misalignment of 10 cm , for a target depth of 400 meters , may give rise to a bias on the distance of about 11 %. the result of the foregoing is that it is indispensable to take the depth of the target into account , to determine a precise tracking of these targets when the antennas used are not perfectly linear . according to the invention , the depth of the target is either determined by a computation or , again , measured by a sonar antenna that is directional in elevation . in the following computations , it is assumed that the target shifts at constant velocity v in a horizontal plane of submersion z . according to the first method , the angle of elevation is estimated on the basis of all the measurements of the differences in the trajectory times . the coordinates are all given in a geographic cartesian reference system of any origin . the target is determined at each instant by a state vector x such that : where x ( t ) and y ( t ) define the components of distance of the vector in a horizontal plane and v x and v y determine its components of velocity in this same plane . this vector naturally relates to the instant of estimation t * and is used to reconstruct the trajectory x t , y t of the target by integration . at any instant , the time difference between the sensors c k and c 1 , for example , is determined by a relationship of the form : ## equ7 ## the distance r k ( t ) between the target and the sensor c k is given by a relationship of the form : ## equ8 ## where d k which represents the horizontal distance of the target from the sensor , is defined by : the submersion term is computed by making the submersion of the central sensor c 2 take place at the instant t . it is defined by the relationship : ## equ9 ## the foregoing formulae ( 14 ) to ( 17 ) enable the prediction of the time differences τ ( x ) as a function of the state vector x to be estimated . the estimation algorithm is defined in the manner shown in fig2 . it consists , at the step 1 , in making a prediction , by means of the relationships ( 14 ), of the time differences as a function of each state vector x and then in making a computation , at the step 2 , of the residues of estimation between the values of time differences measured between each sensor and the predicted time differences . these computations use likelihood maximum and least square estimators in a known way . these likelihood maximum and least square estimators give an estimated value x of the state vector x when the values of the measured and predicted time differences τ ( x ) are minimum . this minimizing is achieved , for example , by using a known iterative algorithm of the gauss newton type , shown in the steps 3 and 4 . according to this algorithm , the estimated value x i + 1 of the state vector obtained at the i + 1th iteration is defined on the basis of the estimated value xi obtained at the i th by a relationship of the form : where d i is a value of descent obtained by resolving a least squares problem which minimizes the criterion such that : ## equ10 ## where j i is the jacobian matrix of the function τ ( x ) evaluated at each estimated vector x i . γ is a scalar between - 1 and + 1 chosen at each iteration so as to minimize the criterion . the iterations stop when the criterion no longer decreases significantly . in the method that has just been described , the gauss newton algorithm is initialized by a pseudo - linear estimator derived from the method of trajectography by azimuths described , for example , in s . c . nardone , a . g . lindgren and k . f . gong , &# 34 ; fundamental properties and performance of conventional bearings - only motion analysis &# 34 ; in ieee transactions on automatic control , vol . ac - 29 , no . 9 , september 1984 . this method consists , in a first step , in computing the value of the angle ak made by the direction of a meridian of the terrestrial geoid with the half - line joining the middle of the space between the sensors c k and c 1 and the target . according to a second step , the value of the azimuth is put into an equation according to the relationship : ## equ12 ## and , finally , in a third step , the three pairs of sensors and the n measuring instants are considered to resolve a linear system obtained from the previous relationship , the resolution of which is done by the least squares method , weighted by σ - 1 . this pseudo - linear estimation enables the initializing of the gauss - newton algorithm in position and velocity , the initial elevation being arbitrarily chosen as zero . the method that has just been described may also , if necessary , be adapted to the situations in which the elevation can be measured by an independent sonar antenna . for , if in addition to the antenna device that has just been described , a sonar , at each instant , delivers a measurement taken of the elevation of the target , it may be judicious to use these items of data to compute the trajectography of the target . in this case , the method of computation uses a method very similar to the previous one . in then referencing the elevation values in relation to the central sensor , the equation of prediction of the elevation values is then : ## equ13 ## the predicted elevations then have to be included in the vector of the time differences τ ( x ) while the elevations measured have to be included in the vector of time differences measured . to initialize the gauss newton algorithm , the elevation that is taken into account is equal to the mean of the elevation values obtained , giving : ## equ14 ## this elevation value is then taken into account for the computation of the azimuths according to the relationship : ## equ15 ## the implementation of the method of the invention could advantageously be done by means of one or more suitably programmed signal processing microprocessors . this implementation is within the scope of those skilled in the art .	6
the following description refers to the accompanying drawings . among the various drawings the same reference numbers may be used to identify the same or similar elements . while the following description provides a thorough understanding of the various aspects of the claimed invention by setting forth specific details such as particular structures , architectures , interfaces , and techniques , such details are provided for purposes of explanation and should not be viewed as limiting . moreover , those of skill in the art will , in light of the present disclosure , appreciate that various aspects of the invention claimed may be practiced in other examples or implementations that depart from these specific details . at certain junctures in the following disclosure descriptions of well known devices , circuits , and methods have been omitted to avoid clouding the description of the present invention with unnecessary detail . fig4 a is a partial top view of an active device array substrate of a liquid crystal display panel according to an embodiment of the present invention . fig4 b is a cross - sectional view of a partial structure of the liquid crystal display panel according to an embodiment of the present invention . the cross - sectional view of the active device array substrate in fig4 b is taken along the sectional lines a - a ′ and b - b ′ in fig4 a . referring to fig4 a and 4b together , the liquid crystal display panel 400 is , for example , but not limited to , an mva lcd . the liquid crystal display panel 400 may include a plurality of pixel units 410 arranged in an array . each pixel unit 410 may have a plurality of sub - pixel regions 411 and includes a plurality of active devices 413 , a plurality of liquid crystal capacitors 415 , and a plurality of storage capacitors 417 . one of the active devices 413 may be disposed in one of the sub - pixel regions 411 and electrically connected to a scan line 420 and a data line 430 . the liquid crystal capacitors 415 are respectively disposed in the sub - pixel regions 411 , and each liquid crystal capacitor 415 is electrically connected to the corresponding active device 413 . the storage capacitors 417 are respectively disposed in the sub - pixel regions 411 , and each storage capacitor 417 is electrically connected to the corresponding active device 413 . in the same pixel unit 410 , the ratio of the capacitance of the storage capacitor 417 to that of the liquid crystal capacitor 415 of any sub - pixel region 411 is unequal to the ratio of the capacitance of the storage capacitor 417 to that of the liquid crystal capacitor 415 of any other sub - pixel regions 411 . for the convenience of illustrating the structure of the liquid crystal display panel 400 , in this embodiment , each pixel unit 410 only has two sub - pixel regions 411 a and 411 b , and only includes two active devices 413 a and 413 b , two liquid crystal capacitors 415 a and 415 b , and two storage capacitors 417 a and 417 b in one embodiment of the invention . other embodiments of the invention may include more or fewer of any or all of these devices . the active device 413 a is disposed in the sub - pixel region 411 a , the active device 413 b is disposed in the sub - pixel region 411 b , and both the active device 413 a and the active device 413 b are electrically connected to the same scan line 420 and the same data line 430 . the liquid crystal capacitor 415 a is disposed in the sub - pixel region 411 a and electrically connected to the active device 413 a , and the liquid crystal capacitor 415 b is disposed in the sub - pixel region 411 b and electrically connected to the active device 413 b . the storage capacitor 417 a is disposed in the sub - pixel region 411 a and electrically connected to the active device 413 a , and the storage capacitor 417 b is disposed in the sub - pixel region 411 b and electrically connected to the active device 413 b . the ratio of the capacitance of the storage capacitor 417 a to that of the liquid crystal capacitor 415 a of sub - pixel region 411 a is unequal to the ratio of the capacitance of the storage capacitor 417 b to that of the liquid crystal capacitor 415 b of the sub - pixel region 411 b . each pixel unit 410 further includes two pixel electrodes 419 a and 419 b in one embodiment of the invention . more or fewer electrodes may be included in other embodiments of the invention . the pixel electrodes 419 a and 419 b are disposed in the sub - pixel region 411 a and 411 b respectively . the part of each of the pixel electrodes 419 a , 419 b that extends to a storage capacitor line 440 serves as storage capacitor opposite electrode 419 c , 419 d respectively . the storage capacitor opposite electrodes 419 c , 419 d are respectively coupled with the storage capacitor line 440 to form the storage capacitor 417 a and the storage capacitor 417 b respectively . the pixel electrodes 419 a , 419 b further have a plurality of main slits l for defining four alignment domains i , ii , iii , iv respectively . for example , a plurality of protrusions p 10 is disposed above the pixel electrodes 419 a , 419 b . when the pixel unit 410 is not driven , the liquid crystal molecules in the liquid crystal layer 450 are arranged vertically . when the pixel unit 410 is driven , the liquid crystal molecules in the liquid crystal layer 450 are inclined towards the horizontal direction . particularly , in one of the specific alignment domains i , ii , iii , iv , the inclined directions of the liquid crystal molecules are consistent . however , in different alignment domains i , ii , iii , iv , the inclined direction of the liquid crystal molecules are different from one another . by means of making the liquid crystals inclined towards different directions , the liquid crystal molecules in different alignment domains can compensate for the optical effects generated by a change of viewing angles , such that the liquid crystal display panel 400 has a wider viewing area . in view of the above , the active devices 413 a , 413 b are , for example , tfts , switching elements with three terminals or another suitable switch element ( e . g ., diode ). the storage capacitor line 440 may be parallel to the scan line 420 and arranged between two adjacent scan lines ( e . g ., 420 ). furthermore , pixel electrode 419 a , liquid crystal layer 450 , and common electrode 460 help form a liquid crystal capacitor 415 a , and pixel electrode 419 b , liquid crystal layer 450 , and common electrode 460 help form liquid crystal capacitor 415 b . fig4 c is an equivalent circuit diagram of a liquid crystal display panel according to an embodiment of the present invention . referring to fig4 a and 4c , in each pixel unit 410 the active device 413 a has a parasitic capacitor 414 a of a capacitance c gd ( a ), and the active device 413 b has a parasitic capacitor 414 b of a capacitance c gd ( b ). the capacitance c gd ( a ) may be equal to or different from the capacitance c gd ( b ). it should be mentioned that in the liquid crystal display panel 400 of this embodiment , each pixel unit 410 includes two sub - pixel regions 411 a and 411 b and the ratio of the storage capacitance c st ( a ) to the liquid crystal capacitance c lc ( a ) of the sub - pixel region 411 a is unequal to the ratio of the storage capacitance c st ( b ) to the liquid crystal capacitance c lc ( b ) of the sub - pixel region 411 b , i . e ., c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ). other embodiments of the invention may include more or fewer subpixel regions . if the characteristic that the ratio of the capacitance of the sub - pixel region 411 a is unequal to that of the sub - pixel region 411 b is utilized together with an appropriate driving method , the voltage v a on the pixel electrode 419 a can be adjusted to be different from the voltage v b on the pixel electrode 419 b . if the pixel electrode voltage v a and the pixel electrode voltage v b are different , the voltage difference at both ends of the liquid crystal capacitor 415 a may be different from that at both ends of the liquid crystal capacitor 415 b . therefore , the liquid crystal molecules in the sub - pixel region 411 a and that in the sub - pixel region 411 b may be inclined to different extents . in other words , the liquid crystal molecules in a same pixel unit 410 may have , for example , eight inclining angles based on the number of different alignment domains . consequently , the light transmittances of the sub - pixel region 411 a and the sub - pixel region 411 b may be different ( e . g ., 411 a has a high gray level and 411 b has a low gray level ), and the liquid crystal molecules in two sub - pixel regions 411 a , 411 b can compensate the optical effects ( e . g ., form a middle gray level ), thereby eliminating or reducing the color shift phenomenon of the liquid crystal display panel 400 . in order to achieve c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ), in one embodiment , the storage capacitance c st ( a ) of the storage capacitor 417 a is different from the storage capacitance c st ( b ) of the storage capacitor 417 b . the method of achieving c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ), however , is not limited to the above method . in another embodiment , the liquid crystal capacitance c lc ( a ) of the liquid crystal capacitor 415 a may be unequal to the liquid crystal capacitance c lc ( b ) of the liquid crystal capacitor 415 b , so as to achieve c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ). there are various methods for making the liquid crystal capacitance c lc ( a ) unequal to the liquid crystal capacitance c lc ( b ). for example , the layout of the mask may be changed to make the pixel electrode 419 a and the pixel electrode 419 b have different areas . furthermore , an insulating layer ( not shown ) may be formed below the pixel electrode 419 a or the pixel electrode 419 b , such that the sub - pixel region 411 a and the sub - pixel region 411 b have different cell gaps . in other embodiments , c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ) may be obtained by having c st ( a )≠ c st ( b ) and c lc ( a )≠ c lc ( b ). hereinafter , the driving method for the liquid crystal display panel 400 is described . fig4 d is a schematic view of a drive waveform in a certain time sequence of the liquid crystal display panel in fig4 c . referring to fig4 c and 4d , in the driving method , firstly , a scan signal v s is applied to the scan line 420 . then , a data signal v d is applied to the data line 430 . after that , a compensation signal v st remains applied to the storage capacitor line 440 . furthermore , a common voltage v com is applied to the common electrode 460 , and the high level voltage of the data signal v d is greater than the value of the common voltage v com . fig4 d further shows a relation curve between the pixel electrode voltage v a of the pixel electrode 419 a and the pixel electrode voltage v b of the pixel electrode 419 b . the relation curve is shown below the drive waveform and does not share , for example , a y axis ( v ) with the drive waveform plot . it can be seen from fig4 d that when the scan signal v s is switched from a high level to a low level , the compensation signal v st is switched to a high level . specifically , when the scan signal v s is switched from the high level to the low level , the pixel electrode voltage v a and the pixel electrode voltage v b are slightly dropped due to a feed - through effect of the parasitic capacitor 414 a and the parasitic capacitor 414 b . however , after the compensation signal v st is switched from a low level to a high level , the pixel electrode voltage v a and the pixel electrode voltage v b rises due to the feed - through effects . also , since c st ( a )/ c lc ( a )≠ c st ( b )/ c lc ( b ), the amounts of rising respectively for the pixel electrode voltage v a and the pixel electrode voltage v b due to the feed - through effect caused by the variation of the compensation signal v st are different , and the magnitude of the rising voltage δv ( i . e ., “ feedthrough voltage ”) for either δv a or δv b is expressed by the following equation : where v sth is a high level voltage of the compensation signal , v stl is a low level voltage of the compensation signal . it can be seen from equation 1 that as the storage capacitance c st ( a ) and the storage capacitance c st ( b ) are different , the extent of rising ( e . g ., δv a , δv b ) of the pixel electrode voltage v a and the pixel electrode voltage v b respectively in different sub - pixel regions is different . therefore , the voltage difference at two ends of the liquid crystal capacitor 415 a is different from that at two ends of the liquid crystal capacitor 415 b , such that the liquid crystal molecules in the sub - pixel region 411 a and the sub - pixel region 411 b are inclined to different extents . as a result , the light transmittance of the sub - pixel region 411 a is different from that of the sub - pixel region 411 b . if the above driving method is used to adjust the pixel electrode voltage v a and the pixel electrode voltage v b to change the light transmittances of the sub - pixel region 411 a and the sub - pixel region 411 b , the color shift phenomenon of the liquid crystal display panel 400 can be eliminated or reduced . it should be noted that the above driving method is suitable for the circumstance when the value of the high level voltage of the data signal v d is greater than the value of the common voltage v com . however , if the value of the high level voltage of the data signal v d is smaller than the common voltage v com , the switching of the compensation signal v st may be different , in one embodiment of the invention , from that described above . for example , fig4 e is a schematic view of a drive waveform of the liquid crystal display panel in fig4 c under another circumstance . when the value of the high level voltage of the data signal v d is smaller than the value of the common voltage v com and after the scan signal v s is switched from the high level to the low level , the pixel electrode voltage v a and the pixel electrode voltage v b are dropped due to the feed - through effect of the parasitic capacitor 414 a and the parasitic capacitor 414 b . then , the compensation signal v st is switched to the low level , and the pixel electrode voltage v a and the pixel electrode voltage v b are dropped again , instead of rising . the dropping extents of the pixel electrode voltage v a and the pixel electrode voltage v b are different , so that the light transmittance of the sub - pixel region 411 a is different from that of the sub - pixel region 411 b , which further eliminates the color shift phenomenon of the liquid crystal display panel 400 . however , when taking the frame with a positive polarity ( e . g ., fig4 d ) and the frame with a negative polarity ( e . g ., fig4 e ) into account , if the feedthrough voltage is different in different sub - pixel regions due to the parasitic capacitor ( i . e ., parasitic capacitance ), the sub - pixel regions cannot have the same common voltage v com . in each sub - pixel region , the feedthrough voltage equation caused by the parasitic capacitor is expressed by equation 1 . in one embodiment of the present invention , the capacitance c gd ( a ) and the capacitance c gd ( b ) may be adjusted to be different according to the above equation 1 , such that the pixel electrode voltage v a and the pixel electrode voltage v b respectively located in different sub - pixel regions have the same feedthrough voltage regardless of whether the frame has a positive polarity ( e . g ., fig4 d ) or a negative polarity ( e . g ., fig4 e ). that is , δv a1 ( positive frame ) is equal to δv a2 ( negative frame ), and δv b1 ( positive frame ) is equal to δv b2 ( negative frame , as shown in fig4 f ), thereby making each of the sub - pixel regions have the same common voltage v com . if a frame with a low gray level is displayed in the liquid crystal display , the frame with a low gray level must be ensured to have a minimum dark - state brightness , so as to achieve a frame with a high contrast . fig4 g is a schematic view of a drive waveform of the liquid crystal display panel in fig4 c according to another embodiment of the present invention . in a frame with a low gray level , the data signal v d with a low gray level of a positive polarity can be adjusted to be smaller than the value of the common voltage v com . as the compensation signal v st is switched from a low level to a high level , the pixel electrode voltage v a and the pixel electrode voltage v b can be increased such that the pixel electrode voltage v a is greater than the common voltage v com , and the pixel electrode voltage v b is still smaller than the common voltage v com . therefore , the average visual effect may be equal to the original low gray level display of a positive polarity and thereby achieve a low color shift effect . fig4 h is a schematic view of a drive waveform of the liquid crystal display panel in fig4 c according to still another embodiment of the present invention . in the low gray level display of a negative polarity , the low gray level data signal v d of a negative polarity can be adjusted to be greater than the value of the common voltage v com . the compensation signal v st may be switched from a high level to a low level and the pixel electrode voltage v a and the pixel electrode voltage v b may be dropped as a result , the pixel electrode voltage v a may be lower than the common voltage v com and the pixel electrode voltage v b may still be higher than the common voltage v com . therefore , the average visual effect is equal to the original low gray level display of a negative polarity , thereby achieving a low color shift effect . the above liquid crystal display panel 400 can be used to assemble a liquid crystal display . fig5 is a schematic structural view of an lcd according to an embodiment of the present invention . referring to fig5 , the liquid crystal display 600 may include a liquid crystal display panel 400 , a backlight module 510 , and an optical film 520 . the backlight module 510 may be a cold cathode fluorescence lamp ( ccfl ) backlight module , and may include a back frame 512 , a reflector 514 , a plurality of cold cathode fluorescence lamps ( ccfls ) 516 , and a diffuser 518 . the diffuser 518 may be disposed above the back frame 512 , the ccfls 516 may be disposed between the diffuser 518 and the back frame 512 , and the reflector 514 may be disposed between the ccfls 516 and the back frame 512 . similarly , the liquid crystal display panel 400 may be disposed above the backlight module 510 . the optical film 520 may be disposed between the liquid crystal display panel 400 and the backlight module 510 . in this embodiment , the backlight module 510 is a ccfl backlight module , but in another embodiment , the backlight module 510 can also be a light emitting diode ( led ) backlight module or another suitable backlight source . since the liquid crystal display 600 is assembled using the liquid crystal display panel 400 , the liquid crystal display 600 not only has a relatively large viewing angle , but the color shift phenomenon can also be eliminated . in one embodiment of the invention , the liquid crystal display panel may employ a row inversion driving method . in other words , in the same frame time data signals applied to the pixel units 410 in the same row have the same polarity and data signals applied to the pixel units 410 in two adjacent rows have opposite polarities . in a liquid crystal display panel 400 adopting a driving method of row inversion , the storage capacitor line 440 may be parallel to the scan line 420 and arranged between two adjacent scan lines 420 in one embodiment of the invention . in other words , pixel units 410 sharing the same common scan line 420 may also share the same common storage capacitor line ( s ) 440 . particularly , any two adjacent pixel units 410 in the same row may share the same common storage capacitor line ( s ) 440 . thus , as for two adjacent pixel units 410 , the compensation signals v st may have the same value , and the writing voltage of the two pixel units 410 may have the same polarity . the storage capacitor line 440 is not limited to the shape as shown in fig4 b . for example , in another embodiment of the invention ( fig6 ), the driving method of the liquid crystal display panel may also be the row inversion mode . the storage capacitor line 440 may extend on the liquid crystal display panel in a direction substantially the same as that of the data line 430 . also , the storage capacitor line 440 may further have a plurality of extension lines 440 a ′ disposed along the main slit l of the pixel electrode 410 . since the area above the main slit l is a “ no effect ” area and the extension line 440 a ′ is made of an opaque material , the aperture ratio of the pixel unit 410 may not be reduced after the extension line 440 a ′ is disposed along the main slit l of the pixel electrodes 419 a , 419 b . also , the driving method is not limited to the row inversion mode , but can also be , for example but without limitation , column inversion , pixel inversion , dot inversion mode or “ many dot ” inversion mode . specifically , the liquid crystal display panel of fig6 can adopt the driving method of dot inversion . in this embodiment of the invention , the compensation signals v st can be different since the pixel units 410 in any two adjacent columns use different storage capacitor lines 440 . therefore , the writing voltages of two pixel units 410 can have opposite polarities . in addition , the liquid crystal display panel 400 may be a normally dark display apparatus . that is , when no voltage is applied to the liquid crystal capacitor 415 a and the liquid crystal capacitor 415 b , the display is normally dark . when the pixel unit 410 is lightened abnormally , one can weld the pixel electrode 419 a ( or the pixel electrode 419 b ) and the storage capacitor line 440 together by means of , for example , a laser . considering the characteristic that the average compensation signal v st of the storage capacitor line 440 equals the common voltage v com , coupling the storage capacitor or line to the pixel electrode 419 a , 419 b may make the lightened pixel unit 410 become a dark dot so as to reduce the sensation of human eyes to dead spots and thereby enhance the display quality . the process for manufacturing the aforementioned liquid crystal display panel and the liquid crystal display of the present invention is compatible with the current manufacturing processes in this field , without requiring additional manufacturing equipments . also , the driving method of the present invention is not limited to be applied to the mva lcd , but can also be applied to other kinds of liquid crystal displays , for example , twisted nematic ( tn ) lcd , in - plane switching ( ips ) lcd , optically compensated bend ( ocb ) lcd , etc . while the present invention has been described with respect to a limited number of embodiments , those skilled in the art will appreciate numerous modifications and variations therefrom . it is intended that the appended claims cover all such modifications and variations as fall within the true spirit and scope of this present invention .	6
the low dielectric constant materials of the present invention are prepared by subjecting a borazine derivative as a starting material , i . e ., an inorganic or organic compound containing a borazine skeleton structure of the formula ( 1 - 1 ) in its molecule or a substituted borazine ( 1 - 2 ), to a condensation reaction to produce an oligomer or polymer containing the borazine skeleton structure . the preparation of the low dielectric constant materials is carried out , for example , according to the procedures as described in yoshiharu kimura , senni - to - kogyo ( fiber and industry ), vol . 52 , no . 8 , 341 - 346 ( 1996 ); paine & amp ; sneddon , recent developments in borazine - based polymers , “ inorganic and organometallic polymers ”, american chemical society , 358 - 374 ( 1994 ); and fazen et al ., chem . mater ., vol . 7 , p1942 ( 1995 ). that is , the low dielectric constant materials can be obtained by heating a borazine derivative as the starting material to undergo a condensation reaction , or by firstly synthesizing a prepolymer in such a manner and then polymerizing it . in general , the condensation reaction is carried out by heating the starting material in an organic solvent at a temperature of 50 to 400 ° c ., preferably 70 to 180 ° c . for 1 to 240 hours , preferably in an inert gas atmosphere such as argon . in the preparation of low dielectric constant materials is used an organic solvent which can homogeniously disperse or dissolve borazine , borazine derivatives as mentioned above or borazine - based prepolymers , e . g ., an alcohol such as methanol , ethanol , propanol or butanol , acetone , benzene , toluene , xylene , glyme and others . an example of the substituted borazine ( 1 - 2 ) is b - triethylaminoborazine . b - triethylaminoborazine can be prepared , for example , by reacting b - trichloroborazine with ethylamine in toluene at an elevated temperature , e . g ., 70 ° c ., for several hours , e . g ., 4 hours , and removing ethylamine hydrochloride and the solvent . in the inorganic or organic compound containing a borazine skeleton structure of the formula ( 1 - 1 ) in its molecule , the inorganic compound to which the substituted borazine ( 1 - 2 ) is bound includes , for instance , silicate , silazane , silsequioxane , siloxane , silane and the like . the organic compound to which the substituted borazine ( 1 - 2 ) is bound includes , for instance , poly ( aryl ether ), parylene , polyphenylene , polyphenylenevinylene , polybenzocyclobutene , polyimide , polyester , polystyrene , polymethylstyrene , polymethyl acrylate , polymethyl methacrylate , polycarbonate , adamantane , norbornene , and the like . the low dielectric constant materials of the present invention can also be obtained by a chemical vapor deposition method , as described after , using a boron source , a nitrogen source and a carbon or the like source such as methane , a chemical vapor deposition method using a substituted borazine such as methylborazine or ethylborazine , or by methods as disclosed in c . k . narula et al ., j . am . chem . soc ., vol . 109 , p5556 ( 1987 ) and y . kimura et al ., composites science and technology , vol . 51 , p173 ( 1994 ). the low dielectric constant materials of the present invention prepared from the inorganic or organic compound containing in its molecule the borazine skeleton structure shown by the formula ( 1 - 1 ) are inorganic or organic oligomers or polymers containing a borazine skeleton structure shown by the formula ( 2 ), ( 3 ) or ( 4 ) in the molecule thereof . these oligomers and polymers have a lower dielectric constant than silicon oxide and fluorine - containing silicon oxide , and an excellent water resistance . they are composed of , as a main component , boron nitride which has a copper diffusion preventing function and accordingly can prevent diffusion of copper . examples of the borazine skeleton structures included in the oligomers or polymers are those having the formulas ( 5 ) to ( 116 ) shown below . the low dielectric constant materials according to another embodiment of the present invention are condensates of the substituted borazine ( 1 - 2 ), in other words , compounds having a third borazine skeleton - based structure formed by bonding a first borazine skeleton structure represented by any one of the formulas ( 2 ) to ( 4 ) with a second borazine skeleton structure represented by any one of the formulas ( 2 ) to ( 4 ) with elimination of hydrogen atoms from each of the molecules of a substituted borazine to form the third borazine skeleton structure . examples of the condensates are , for instance , compounds having borazine skeletone structures shown by the above formulas ( 25 ) to ( 28 ). the reason why the low dielectric constant material of the present invention can achieve a low dielectric constant is considered that the electronic polarization is decreased by an ionic electronic structure of the borazine skeleton . also , a high heat resistance can be achieved by the low dielectric constant materials of the present invention , since inorganic polymeric materials which have of course a higher heat resistance than organic polymeric materials are used . further , the reason why the low dielectric constant materials of the present invention have a high water resistance is considered that if r 1 to r 4 is substituents other than hydrogen atom in the formulas ( 2 ) to ( 4 ), they firmly bond to boron atom or nitrogen atom in the borazine skeleton and are prevented from reacting with water . since a hydrogen atom bonding to a boron atom or a nitrogen atom is easily hydrolyzed , it is necessary that in the low dielectric constant material of the present invention , at least one of r 1 to r 4 in the formulas ( 2 ) to ( 4 ) is not a hydrogen atom , but a substituent . in particular , since a hydrogen atom bonding to a boron atom causes a hydrolysis reaction more easily as compared with that bonding to a nitrogen atom , it is preferable that a substituent is bonded to a boron atom . as to the degree of substitution , preferred from the viewpoint of water resistance , of hydrogen atoms on the borazine skeletons included in a molecule which constitutes the low dielectric constant material , assuming that the degree of substitution is 100 % if all hydrogen atoms on the borazine skeletons are substituted by a substitutent or substituents shown in the formulas ( 2 ) to ( 4 ), water resistance equivalent to that for a degree of substitution of 100 % is obtained when 30 to 40 % of all hydrogen atoms are substituted by a substitutent or substituents shown in the formulas ( 2 ) to ( 4 ), namely when the degree of substitution is 30 to 40 %. the dielectric constant can be further lowered by introducing fluorine atom ( f ) into boron nitride . thus , an insulation layer having a lower dielectric constant can be obtained thereby . the insulating films of the present invention are obtained by forming the low dielectric constant materials of the present invention into thin films . the insulating films of the present invention are applicable as an interlayer insulating film of semiconductor devices , whereby excellent semiconductor devices can be obtained . in case of using the low dielectric constant materials in the form of a film , for example , as an interlayer insulating film for semiconductor devices , the film can be formed by coating a solution or dispersion of the low dielectric constant material in a solvent . in that case , the low dielectric constant material may be used in combination with other materials such as other insulating materials which are used preferably in an amount of at most 20 % by weight based on the total weight of the low dielectric constant material of the present invention and other materials . examples of the other materials are , for instance , a known interlayer insulating material for semiconductor devices such as silicate , silazane , silsequioxane , siloxane , silane , polyaryl ether , parylene or polybenzocyclobutadiene , a general insulating material such as adamantane , norbornene , polyimide , polyester , polystyrene , polymethylstyrene , polymethyl acrylate , polymethyl methacrylate or polycarbonate , an amine such as cyclohexylamine , aniline or ethylamine , a surface active agent , and the like . the coating to a substrate can be conducted by spray coating , dip coating , spin coating or other known coating methods . the solvent or dispersing medium includes , for instance , acetone , benzene , glyme , tetrahydrofuran , chloroform and other organic solvents capable of dissolving or dispersing the low dielectric constant materials . the concentration is preferably from 10 to 30 % by weight . preferably , after drying the coated film , the dried film is further heat - treated to cure the film at a temperature of 300 to 450 ° c ., preferably 350 to 400 ° c . the thickness of the insulating film is preferably from 0 . 3 to 0 . 8 μm . in case of using the low dielectric constant materials as a film such as an interlayer insulating film for semiconductor devices , thin films can also be formed according to procedures as described for example in s . v . nguyen , t . nguyen , h . treichel and o . spindler , j . electrochem . soc ., vol . 141 , no . 6 , 1633 - 1638 ( 1994 ); w . f . kane , s . a . cohen , j . p . hummel and b . luther , j . electrochem . soc ., vol . 144 , no . 2 , 658 - 663 ( 1997 ); and m . maeda and t . makino , japanese journal of applied physics , vol . 26 , no . 5 , 660 - 665 ( 1987 ). for example , the insulating film or layer can be obtained by subjecting a mixture of diborane ( b 2 h 6 ), ammonia ( nh 3 ) and methane or a mixture of borazine ( b 3 h 3 n 6 ), nitrogen ( n 2 ) and methane as a raw material a chemical vapor deposition method ( cvd method ), thereby causing a condensation reaction . in case that the low dielectric constant materials are used in the form of a bulk body as a low dielectric constant substrate , the materials are molded by casting into a mold and heat - treating the resulting molded article . the low dielectric constant material to be cast may be used in combination with other materials as mentioned above . the content of other materials is at most 20 % by weight . the insulating films of the present invention applicable to various electronic parts as an interlayer insulating film for semiconductor devices , as a barrier metal layer or etch stopper layer , is and as an ic substrate . thus , the present invention provides semiconductor devices including an insulating layer or film made of the low dielectric constant materials of the present invention . in an embodiment of the semiconductor devices according to the present invention , a first insulating layer having a first copper conductive layer disposed to form a lower wiring and a third insulating layer having a third copper conductive layer disposed to form an upper wiring are stacked on the surface of a semiconductor substrate through a second insulating layer interposed therebetween and having a second copper conductive layer communicating with both the first copper conductive layer and the third copper conductive layer so as to electrically connect the lower wiring with the upper wiring . in this embodiment , at least one of the first , second and third insulating layers is made of an insulating material containing the low dielectric constant material of the present invention . in another embodiment of the semiconductor devices according to the present invention , a first insulating layer having a first copper conductive layer disposed to form a lower wiring and a second insulating layer having a third copper conductive layer disposed to form an upper wiring and having a second copper conductive layer communicating with both the first copper conductive layer and the third copper conductive layer so as to electrically connect the lower wiring with the upper wiring are stacked on the surface of a semiconductor substrate through an insulating film interposed therebetween , the second copper conductive layer also extending through the insulating film . in this embodiment , the insulating film interposed between the first and second insulating layers is made of an insulating material containing the low dielectric constant material of the present invention . since the insulating layer or film made of an insulating material containing the low dielectric constant material of the present invention is used in the above semiconductor devices instead of conventional built - up films of silicon oxide and silicon nitride , the wiring capacitance can be reduced . also , since the insulating layer or film is made of an insulating material containing the low dielectric constant material of the present invention which has a copper diffusion preventing function , it is not needed to use a barrier metal layer at connecting hole portions and , therefore , a low resistant wiring can be obtained and it is possible to operate the semiconductor devices at high speed . in the above embodiments , the first , second and third conductive layers are made of copper and , therefore , the wiring delay can be decreased as compared with the use of aluminum , but the materials of the conductive layers are not limited copper . an example of the wiring structure of semiconductor devices according to the present invention is shown in fig1 . in the figure , numeral 1 denotes a semiconductor substrate made of silicon , and numeral 19 denotes an insulating layer made of silicon oxide . on the silicon oxide insulating layer 19 is formed an insulating layer 20 having a thickness of 0 . 3 μm and made of a crosslinked poly ( b - methylaminoborazine ) which is a low dielectric constant material according to the present invention . the insulating layers 19 and 20 constitute the first insulating layer . in the insulating layer 20 is formed a first trench 3 having a width of 0 . 2 μm and a depth of 0 . 2 μm in the pattern of a first wiring . a first copper conductive layer 5 is filled in the trench 3 . a second insulating layer 21 having a thickness of 0 . 5 μm made of the crosslinked poly ( b - methylaminoborazine ) is formed on the insulating layer 20 and the first copper conductive layer 5 . in the second insulating layer 21 is formed a hole 8 having a diameter of 0 . 15 μm and extending to the first copper conductive layer 5 , and the hole 8 is filled with copper to form a second copper conductive layer 10 so as to contact the first copper conductive layer 5 . on the insulating layer 21 is formed a third insulating layer 22 having a thickness of 0 . 2 μm made of the crosslinked poly ( b - methylaminoborazine ). in the third insulating layer 22 is formed a second trench 12 having a depth of 0 . 2 μm in the pattern of a second wiring . the bottom of the trench 12 extends to the insulating layer 21 , and copper is filled in the trench 12 to form a third copper conductive layer 13 . an insulating film 23 made of the crosslinked poly ( b - methylaminoborazine ) is formed on the insulating layer 22 and the third copper conductive layer 13 . in semiconductor devices having such a structure , all copper conductive layers , that is , the first copper conductive layer 5 , the second copper conductive layer 10 and the third copper conductive layer 13 , are in contact with the insulating layers 20 , 21 and 22 and film 23 made of an insulating material comprising the low dielectric constant material of the present invention . thus , copper diffusion from the conductive layers can be prevented from occurring . furthermore , since the insulating layers 20 , 21 , 22 and 23 have a dielectric constant of 2 . 2 and also do not require a barrier metal layer , the wiring capacitance can be reduced as compared with conventional wiring structure shown in fig6 whereby high speed operation of semiconductor devices can be ensured . [ 0073 ] fig2 is a sectional view of a semiconductor device showing a further embodiment of the present invention . an insulating layer 19 made of silicon oxide is formed on a silicon semiconductor substrate 1 . on the silicon oxide insulating layer 19 is formed an insulating layer 20 a having a thickness of 0 . 3 μm and made of an amorphous crosslinked poly ( b - methylaminoborazine ) which is a low dielectric constant material according to the present invention . the insulating layers 19 and 20 a constitute the first insulating layer . in the insulating layer 20 a is formed a first trench 3 having a width of 0 . 2 μm and a depth of 0 . 2 μm in the pattern of a first wiring . a first copper conductive layer 5 is filled in the trench 3 . a second insulating layer 21 b having a thickness of 0 . 5 μm made of a mixture of microcrystalline and amorphous crosslinked poly ( b - methylaminoborazine ) is formed on the insulating layer 20 a and the first copper conductive layer 5 . in the second insulating layer 21 b is formed a hole 8 having a diameter of 0 . 15 μm and extending to the first copper conductive layer 5 , and the hole 8 is filled with copper to form a second copper conductive layer 10 so as to contact the first copper conductive layer 5 . on the insulating layer 21 b is formed a third insulating layer 22 a having a thickness of 0 . 2 μm made of the same material as the insulating layer 20 a , namely amorphous crosslinked poly ( b - methylaminoborazine ). in the third insulating layer 22 a is formed a second trench 12 having a depth of 0 . 2 μm in the pattern of a second wiring . the bottom of the trench 12 extends to the insulating layer 21 b , and copper is filled in the trench 12 to form a third copper conductive layer 13 . an insulating film 23 b made of the same material as the insulating layer 21 b is formed on the insulating layer 22 a and the third copper conductive layer 13 . in semiconductor devices having such a structure , all copper conductive layers , that is , the first copper conductive layer 5 , the second copper conductive layer 10 and the third copper conductive layer 13 , are in contact with the insulating layers 20 , 21 and 22 and film 23 made of an insulating material comprising the low dielectric constant material of the present invention . thus , copper diffusion from the conductive layers can be prevented from occurring . furthermore , since the insulating layers 20 , 21 , 22 and 23 have a dielectric constant of 2 . 3 and also do not require a barrier metal layer , the wiring capacitance can be reduced as compared with conventional wiring structure shown in fig6 whereby high speed operation of semiconductor devices can be ensured . [ 0077 ] fig3 is a sectional view of a semiconductor device showing another embodiment of the present invention . an insulating layer 19 made of silicon oxide is formed on a silicon semiconductor substrate 1 . on the silicon oxide insulating layer 19 is formed an insulating layer 25 having a thickness of 0 . 2 μm and made of a poly ( aryl ether ). the insulating layers 19 and 25 constitute the first insulating layer . in the insulating layer 25 is formed a first trench 3 having a width of 0 . 2 μm and a depth of 0 . 2 μm in the pattern of a first wiring . a first copper conductive layer 5 is filled in the trench 3 . a first conductive film ( barrier metal film ) 4 having a diffusion preventive function is formed so as to cover the surface of the trench 3 . the barrier metal film 4 is made of tantalum nitride and has a thickness within the range of 10 to 20 nm . copper is filled in the trench 3 covered with the barrier metal film 4 to form a first copper conductive layer 5 . a second insulating layer 21 b having a thickness of 0 . 5 μm made of a mixture of microcrystalline and amorphous crosslinked poly ( b - methylaminoborazine ), which is the low dielectric constant material of the present invention , is formed on the insulating layer 25 and the first copper conductive layer 5 . in the second insulating layer 21 b is formed a hole 8 having a diameter of 0 . 15 μm and extending to the first copper conductive layer 5 , and the hole 8 is filled with copper to form a second copper conductive layer 10 so as to contact the first copper conductive layer 5 . on the insulating layer 21 b is formed a third insulating layer 27 made of the same material as that of the insulating layer 25 , i . e ., poly ( aryl ether ), and having a thickness of 0 . 2 μm . in the third insulating layer 27 is formed a second trench 12 having a depth of 0 . 2 μm in the pattern of a second wiring . the bottom of the trench 12 extends to the insulating layer 21 b . a second conductive film ( barrier metal film ) 11 having a diffusion preventive function against copper is formed so as to cover the inner surface of the trench 12 . the barrier metal film 11 has the same composition and the same thickness as those of the barrier metal film 4 . copper is filled in the trench 12 covered with the barrier metal film 11 to form a third copper conductive layer 13 . an insulating film 23 b made of the same material as the insulating layer 21 b is formed on the insulating layer 27 and the third copper conductive layer 13 . in semiconductor devices having such a structure , the first copper conductive layer 5 is in contact with the barrier metal film 4 and the insulating layer 21 b , and the third copper layer 13 is in contact with the barrier metal film 11 and the insulating layer 23 b . further , the second copper conductive layer 10 is in contact with the barrier metal 11 and the insulating layer 21 b . because of having such a structure , diffusion of copper from the conductive layers can be prevented . moreover , since the insulating layers 25 and 27 made of poly ( aryl ether ) have a dielectric constant of 2 . 8 and the insulating layers 21 b and 23 b made of crosslinked poly ( b - methylaminoborazine ) have a dielectric constant of 2 . 2 , the wiring capacitance can be reduced to a level lower than that achieved by a conventional wiring structure shown in fig6 whereby a high speed operation of semiconductor devices is made possible . further , since the insulating layers 25 and 27 are made of poly ( aryl ether ) and the insulating layers 21 b and 23 b are made of crosslinked poly ( b - methylaminoborazine ), the etching selective ratio is high and accordingly it is possible to form wiring having a good shape . in this embodiment , the layer in which second copper conductive layer 10 is provided , i . e ., insulating layer 21 b , is formed from a crosslinked poly ( b - methylaminoborazine ). substantially the same effect can be obtained also when the layer provided with the first or third copper conductive layer 5 or 13 , i . e ., insulating layer 25 or 27 , is formed from the crosslinked poly ( b - methylaminoborazine ). another example of the wiring structure of semiconductor devices using the low dielectric constant material of the present invention as an insulating film or layer is shown in fig4 . a first insulating layer 29 made of silicon oxide is formed on a silicon semiconductor substrate 1 . in the insulating layer 29 is formed a trench 3 having a width of 0 . 2 μm and a depth of 0 . 2 μm in the pattern of a first wiring . a first conductive film ( barrier metal film ) 4 having a diffusion preventive function is formed so as to cover the surface of the trench 3 . the barrier metal film 4 is made of tantalum nitride and has a thickness within the range of 10 to 20 nm . copper is filled in the trench 3 covered with the barrier metal film 4 to form a first copper conductive layer 5 . an insulating layer 30 b having a thickness of 0 . 05 μm made of a mixture of microcrystalline and amorphous crosslinked poly ( b - methylaminoborazine ), in other words , microcrystals - containing amorphous crosslinked poly ( b - methylaminoborazine ), which is the low dielectric constant material of the present invention , is formed on the insulating layer 29 and the first copper conductive layer 5 . on the insulating layer 30 b is formed a second insulating layer 31 made of silicon oxide . in the second insulating layer 31 are formed a hole 8 having a diameter of 0 . 15 μm and a trench 12 having a depth of 0 . 2 μm and a second wiring pattern . the hole 8 extends from the first conductive layer 5 to the trench 12 formed in the surface region of the insulating layer 31 through the insulating layer 30 b and the insulating layer 31 . second and third conductive films ( barrier metal films ) 9 and 11 made of tantalum nitride having a diffusion preventive function are formed so as to cover the surfaces of the hole 8 and the trench 12 . copper is filled in the hole 8 and the trench 12 to form second copper conductive layer 10 and third copper conductive layer 13 , respectively . the barrier metal film is also formed at the interface between the first copper conductive layer 5 and the second copper conductive layer . an insulating film 23 b made of the same material as the insulating layer 30 b is formed on the insulating layer 31 and the third copper conductive layer 13 . in semiconductor devices having such a structure , the first , second and third copper conductive layers 5 , 10 and 13 are in contact with the barrier metal films 4 , 9 and 11 and the insulating layers 23 b and 30 b . thus , diffusion of copper from the conductive layers 5 , 10 and 13 can be prevented . moreover , since the insulating layers 23 b and 30 b have a dielectric constant of 2 . 2 and the insulating layers 29 and 31 have a dielectric constant of 4 . 2 , the wiring capacitance can be reduced to a level lower than that achieved by a conventional wiring structure shown in fig6 whereby a high speed operation of semiconductor devices is made possible . the present invention is more specifically described and explained by means of the following examples . soluble poly ( b - trimethylborazilene ) was synthesized according to fazen et al &# 39 ; s method disclosed in fazen et al ., chem . mater ., vol . 7 , p1942 , 1995 . tetraglyme was used as a solvent , and b - trimethylborazine was heated in an ar gas at 220 ° c . for two weeks with stirring and degassing to give a highly viscous liquid . the liquid was evaporated to give a white powder of a low dielectric constant material according to the present invention . this material had a chemical structure shown by the following formula ( 117 ): the obtained low dielectric constant material was dissolved in acetone and coated by spin coating method onto a quartz plate on which gold was deposited to form a counter electrode . the coated film was then dried at 100 ° c . for 10 minutes and heated at 400 ° c . for 10 minutes to give an insulating film according to the present invention . the thus heat - treated film was made of a partially crosslinked poly ( b - methylboradine ). gold was deposited onto the obtained insulating film as a main electrode . synthesis of soluble poly ( b - triethylborzilene ) was carried out in the same manner as example 1 . tetraglyme was used as a solvent , and b - triethylborazine was heated in an ar gas at 220 ° c . for two weeks with stirring and degassing to give a highly viscous liquid . the liquid was evaporated to give a white powder of a low dielectric constant material according to the present invention . this material had a chemical structure shown by the following formula ( 118 ): an insulating film was formed from the obtained low dielectric constant material by conducting the spin coating in the same manner as in example 1 and drying at 100 ° c . for 10 minutes . gold was then deposited onto the insulating film as a main electrode . a white powder of poly ( methylborazinylamine ) was prepared according to narula et al &# 39 ; s method disclosed in c . k . narula , r . schaeffer , r . t . paine , a . k . datye and w . f . hammetter , j . am . chem . soc ., vol . 109 , p5556 ( 1987 ). the thus obtained low dielectric constant material was dispersed into acetone , and the dispersion was coated by spin coating and dried at 100 ° c . for 10 minutes in the same manner as in example 1 to give an insulating film . gold was then deposited thereon as a main electrode . a white powder of poly ( b - methylaminoborazine ) was prepared according to kimura et al &# 39 ; s method disclosed in y . kimura et al ., composites science and technology , vol . 51 , p173 ( 1994 ). the thus obtained low dielectric constant material was dispersed into acetone , and the dispersion was coated by spin coating and dried at 100 ° c . for 10 minutes in the same manner as in example 1 to give an insulating film . gold was then deposited thereon as a main electrode . dielectric constants of the insulating films obtained in examples 1 to 4 were measured at 25 ° c . and 1 mhz by using an impedance analyzer ( model 4191a made by hewlett packard ). in order to evaluate the water resistance , the dielectric constant was also measured with the lapse of time . an insulating film was formed from polyboradilene in the same manner as in example 1 , and the dielectric constant thereof was measured . the result is shown in table 1 . the insulating films obtained in examples 1 to 4 have a dielectric constant of at most 2 . 4 . from these results , it is understood that a substrate having a low dielectric constant can be obtained . also , these polymeric borazine compounds can be graphitized by heating at a temperature of 1 , 000 to 1 , 200 ° c . ( application view of inorganic polymer , p70 , 1990 , supervised by naruyuki kajiwara ). thus , these insulating films have a thermal resistance of at least 450 ° c . further , as apparent from the results shown in table 1 , the films obtained in examples 1 to 4 show no or little change in dielectric constant with the lapse of time . thus , it is understood that these films have an excellent water resistance .	7
the present invention ( hereinafter “ system ”) aims to monitor the cattle breeding season , under extensive livestock farming conditions , through the bull activity . the system allows knowing whether the said bull has performed mounting activities , and which cows it has mounted , date and time the said mountings happened and their effectiveness ( i . e ., whether there was ejaculation or not ). since the system is based on placing electronic devices on each animal of the herd , in order to be applicable in extensive livestock farming , the device placed on the cow must be simple , cheap , easy to install , comfortable for the animal and cannot require maintenance of any kind ( not even changing batteries ). on the other hand , the device placed on the bull has more freedom ( since there are 30 times less bulls than cows ). therefore , it can be more complex , be subject to sporadic maintenance routines , and it does not need to be so cheap , provided that the average cost per animal is within acceptable limits . the system provides the veterinarian and the rancher , in a centralized , systematic and friendly manner , the necessary information for controlling the activity of all bulls and cows during the breeding season , accounting for the herd evolution . by way of example , if the system informs that a cow was never mounted after a certain period of time ( that can be set ) it is to be expected that there is a problem in its ovulation process , which needs to be studied and treated . if the cow is still breastfeeding , this can surely be solved by temporarily or definitively suspending breastfeeding . in other cases , this can be corrected by changing her diet . should the problem be more serious , it can even be determined that the cow leave the herd and go to the slaughterhouse . on the contrary , if the cow was mounted several times and then stopped being mounted , it could be an indication of pregnancy . another example is when the system informs about a bull that has not mounted any cow after a certain period of time ( that can be set ). this situation can be indicative of the bull having a physiological problem ( for example , an injured leg ) or that another bull assumed a dominant behavior in the herd and does not allow the first bull to mount cows . in this sense , the system allows an accurate determination of the relationships within the herd , for example , it allows the easy detection of a bull always mounting the same cow ( phenomenon known as “ dominant cow ”). in these instances , the problem is solved by removing the dominant bull and / or cow from the herd . the system provides real - time information allowing taking preventive and corrective actions on the herd , both on cows and bulls . the rancher and / or the veterinarian have information that allows them to make better decisions in time , which translates to an increase of the breeding season productivity . fig1 shows that the system is characterized by placing an electronic device 3 ( hereinafter “ device ”) in each bull 1 , by a radio - frequency identification tag 4 ( hereinafter “ tag ”) placed on each cow 2 and having a number that uniquely identifies the cow having it , and a central system 6 ( hereinafter “ cs ”) that concentrates and manages information while functioning as the user interface server . the device 3 reports the information to the cs 6 in order to allow the user 7 ( hereinafter “ user ”) to monitor the herd activity on a mobile device ( e . g ., laptop , cellphone or tablet ) or on a personal computer via links 104 and 106 within the network 105 ( hereinafter “ network ”). the information the device 3 reports to the cs 6 will pass through the network 105 and can send it directly via link 101 and link 104 , or through a hand - held electronic device 5 ( hereinafter “ hand - held ”) via link 102 and links 103 and 104 . each animal will have a unique identification number , which will be stored in the corresponding tag 4 , for cows , and it will be stored in the corresponding device 3 for bulls . as can be appreciated in fig2 , device 3 is comprised by a low - cost microcontroller or standard microprocessor 8 ( hereinafter “ microcontroller ”), having internal peripherals : memories , timers , analog - to - digital converters , etc . ; and it controls a set of external peripherals : a real - time clock rtc 9 , an acceleration sensor 10 ( hereinafter “ sensor ”), a device 11 for tag 4 reading ( hereinafter “ reader ”), a long - range wireless communication interface 12 to communicate with cs 6 , and a short - range wired or wireless communication interface 13 to communicate with hand - held 5 . all circuits of device 3 are powered by a battery 14 which can be charged with a charger 15 . in addition , the microcontroller 8 can have an external memory 16 . microcontroller 8 is in charge of generating the information of each mounting that will be transmitted . in the first place , it has the algorithms that allow to recognize , from the signal acquired by sensor 10 , mounting and ejaculation patterns . secondly , through the reader 11 and link 100 , it obtains the identification number of the mounted cow 2 . in third place , it obtains the date and hour of the mounting through the rtc 9 . through communication interfaces 12 and 13 , and the corresponding links 101 and 102 , parameters of device 3 can be read , written and configured , and information regarding the state of the herd is reported to cs 6 . collected information can be reported from device 3 to cs 6 directly through a long - range wireless communication technology ( link 101 ) such as , for example : mobile phone , wifi , wimax , satellite link , etc . at the same time , it can be performed using a public data network ( such as , for example , internet ) or though a private data network ( for example , using rf links and repeater radios ), both options are depicted by network 105 . on the other hand , device 3 can report the collected information indirectly via hand - held 5 . communication between device 3 and hand - held 5 can be made through a short - range wireless communication technology , such as nfc , bluetooth , wifi , etc . ; or using a wired communication technology , such as usb , i2c , spi , ethernet , etc . data from sensor 10 are sampled at a rate that can be configured . mounting is detected when this information indicates that the position of the animal has sufficiently changed with respect to predefined and configurable thresholds . fig3 shows the mounting moment , where it can be appreciated that gravity acceleration 200 ( hereinafter g ) has a component in the direction parallel to the bull &# 39 ; s back 201 ( hereinafter g h ). however , in fig1 , where the bull is in normal position , it can be appreciated that the component of g 200 in the direction parallel to the bull &# 39 ; s back g h 201 is null or substantially null . therefore , by comparing g h 201 to a certain threshold , the presence of a mounting can be inferred . once the mounting is detected , the sample rate is increased and the data stream is saved for further analysis . the ejaculation detection algorithm is applied to the saved data stream . this algorithm is based on the detection of sudden movements made by the animal during the ejaculation , referred to as “ ejaculatory thrust ”. mounting and ejaculation detection algorithms are based on well - known pattern recognition techniques : comparison with a predefined threshold , comparison with a signal power threshold , comparison against a well - known waveform ( template matching ), principal component analysis ( pca ), among others . in cases where there is a need of high savings of battery and / or data traffic , the device 3 will report to cs 6 for each mounting : date , hour , bull identification number , cow identification number , and an ejaculation presence indicator . eventually , it could also inform about characteristic data of the acceleration curves : peak - to - peak amplitude , width , maximum , minimum , among others . in the cases where battery duration or the data traffic are not limiting , the device could report : date , hour , bull identification number , cow identification number , and all data stream , in order to perform the analysis in a centralized manner in cs 6 . communication between reader 11 and tag 4 can be made in two different manners . on the one hand , tag 4 can transmit the identification number on demand , each time it is requested by the reader 11 . on the other hand , it can transmit the identification number each time the cow is mounted , with no need for the reader 11 to request it . in this latter case , transmission can be made a predetermined number of times or during a predetermined period of time . since animals within the herd can be located relatively close , it is possible that , during a mounting , another cow ( and , therefore , its tag 4 ) is close to the cow - bull couple that performed the mounting . in order to avoid incorrect or multiple readings by reader 11 , the present invention is characterized by all cow tags 4 being disabled for reading by default , being enabled solely by the action of the bull during mounting . for example , in fig3 it can be seen how the mounting of bull 1 involves direct physical contact with tag 4 , which enables the reading . the above mentioned enabling lasts for a short period of time ( a few seconds ). in this way , it assures that the only read tag corresponds to the mounted cow . tag 4 comprises a microcontroller , a data reception and transmission system having an antenna , a power supply system ( which , for example , can be based on the same antenna , thus obtaining energy from the electromagnetic field from the reader , based on a battery and / or harvest energy from the environment ). these elements configure what is normally known as radio - frequency identification tag ( hereinafter rfidtag , identified with number 24 in fig5 and 6 ). moreover , tag 4 is characterized by having a system 25 ( hereinafter inhibsys ) that avoids incorrect or multiple tag readings , based on detecting the mounting moment in order to enable the rfidtag 24 reading of cow 2 mounted during a determined period of time after completion of the said mounting . including inhibsys system 25 is crucial in the present invention since this is what allows the identification of the cow that was mounted , with a negligible error margin . implementation of the said system can be mechanical and / or electronic . fig5 shows an example of implementation 4 . 1 of tag 4 , wherein rfidtag 24 . 1 is active , i . e ., it is powered from system 26 . in this example , inhibsys system 25 . 1 is characterized by having a switch 27 that enables the power supply from system 26 to rfidtag 24 . 1 , in order for it to be read as of the start of the mounting and during a certain period of time after its completion . system 26 can be , for example , a battery or a system that harvest energy from the environment . fig6 shows another example of implementation 4 . 2 of tag 4 , wherein rfidtag 24 . 2 can be active , passive or semi - passive ( the system that powers the rfidtag 24 . 2 is not shown in the figure ) and it has the characteristic of having an input signal 28 that enables or disables its operation . inhibsys system 25 . 2 is an electronic or electromechanical circuit that detects the mounting via a switch , accelerometer or vibration detector , and generates signal 28 , thus enabling the operation of rfidtag 24 . 2 as of the start of the mounting and during a certain period of time after its completion . another way of implementation of disabling and enabling tag 4 reading can be made through the modification of the distance where rfidtag 24 can be read . in this scheme , disabling is achieved by forcing that the reading can be made if the reader is less than a few centimeters away , and enabling implies that the reading can be made a few meters away . even though , in this case , rfidtag 24 is not disabled by default for reading from a literal point of view ( it is always possible to read it from a short distance ), for practical purposes it will be disabled , since device 3 is usually located at a considerable greater distance than the maximum allowed for reading . then , as of the start of the mounting and for a certain period of time , the maximum distance from which rfidtag 24 can be read shall be several meters , therefore the corresponding device 3 will be able to perform the reading . this could be electrically implemented by modifying , for example , some parameter of the rfidtag 24 antenna . it could also be mechanically implemented , for example : disabling could be obtained by placing a metallic plate in front of rfidtag 24 in such a manner that the electromagnetic waves are strongly absorbed by it ; and the enabling would consist of removing this plate with the purpose of allowing a rfidtag 24 reading from a significantly greater distance . tag 4 is placed ( even though not exclusively ) in the tail of cow 2 ( see fig4 ), or near it , so that bull 1 always is in direct physical contact with tag 4 during the mounting . as tag 4 is not inside the animal &# 39 ; s body , it is possible to harvest energy from the bull &# 39 ; s movements , and reading is facilitated since there are no animal tissues between the said device and reader 11 . on the other hand , device 3 attachment could be made , even though not exclusively , by placing device 3 within a housing or wrapping attached by glue to the back of the animal , near its kidneys . it is an area that has a direct view to the tail of the cow when the bull comes down after mounting and where the greatest acceleration with the “ ejaculatory thrust ”, caused by ejaculation , is registered . should long - range communication fail to work ( for example , for lack of suitable mobile phone coverage ), the system proposes to use a hand - held that can read information stored on device 3 through link 102 ( which can be wired or wireless ) and functions as a hub of the said information for all bulls in the ranch . accordingly , hand - held 5 sends the collected information to the cs 6 via network 105 through links 103 and 104 . by hand - held 5 and link 102 , it is possible to write and configure device 3 . hand - held 5 can be a mobile phone , a tablet , or an electronic device based on a microcontroller 17 having an interface 18 to communicate with device 3 via link 102 , a user interface 19 that can include , for example , a keyboard and a display , and a plurality of interfaces to communicate with cs 6 ( for example , directly via a mobile phone modem , or indirectly via a usb cable plugged to a pc connected to network 105 ), all these options are summarized in block 20 . as it is a mobile device , it shall have a battery 22 . additionally , it may have an additional memory 23 . finally , hand - held 5 has suitable means for reading , writing and configuring tags 4 via interface 21 using link 107 . cs 6 comprises a set of computers , an energy system , communication elements ( routers , firewall , etc .) and human resources for managing and control . cs 6 has a server application capable of managing and processing information received by device 3 and hand - held 5 . the collected information is stored on a database . an interface for users to have access to information , via a web browser or an application , is implemented through a web server . this interface has a user access privileges management system in order to select information each user can visualize ( for example , ranchers have access only to information of their ranch , but veterinarians can have access to information of all ranches they work for ). moreover , via commands sent by cs 6 , it is possible to configure device 3 . system deployment in a ranch involves installing a tag 4 in each cow , and a device 3 in each bull . moreover , each device must be configured based on operation parameters ( animal identification , veterinarian identification , ranch identification , starting date and time , etc .) these parameters are programmed with hand - held 5 . unlike other inventions in the state of the art , our invention is capable of providing information necessary for monitoring the breeding season ; i . e ., if the bull has performed mountings , and which cows have been mounted , date and time and the effectiveness ( i . e ., if there was or not ejaculation ). this is achieved thanks to the possibility of identifying , with no error margin ( or with a negligible error margin ), the mounted cow , through a system that avoids incorrect or multiple tag readings ; as well as through determining the presence of ejaculation based on a detection algorithm of the “ ejaculatory thrust ”. in addition to monitoring the breeding season , the system can be used for other applications . on the basis of having no better estrus detector than the bull itself , the system can be applied for estrus detection in the case of artificial insemination . indeed , using the above mentioned system in androgenized and neutered bulls , which are capable of mounting but not impregnating , information regarding which cows are in heat is directly obtained . this cannot be guaranteed by other systems that cannot identify the cow without error margin . another application of the present invention would be using the system to determine the animals “ pedigree ”. nowadays , in general , parents are not known and / or registered . having this information would serve for enhancing a traceability system , easily allowing the addition of the father and mother identification to the available information . as a result , genetic enhancement , avoidance of genetic diseases , etc ., could be explored . this function cannot be provided by other systems that cannot determine the presence of ejaculation . another example would be using the system as substitution for the “ blockey test ”. blockey test is a test that allows the assessment of the number of cows that a bull is capable of mounting in a determined period of time ( referred as “ service capacity ”). the above mentioned test is performed in such an invasive manner that does not respect animal welfare : the cow is restrained , and the number of times the bull can mount it are counted . by the present system , the actual service capacity of a bull can be determined in a natural way , respecting animals and their welfare . this cannot be provided by other systems that cannot determine the presence of ejaculation . although in the foregoing description reference is made to cows and bulls , all the points claimed in the present patent can apply to any animal species whose reproductive process involves characteristic movements that can be related to a mounting and an ejaculation .	0
the liquid - crystalline alignment layers preferably comprise liquid - crystalline main - chain polymers , liquid - crystalline side - chain polymers , a combination of the two , liquid - crystalline networks , guest - host systems or mixtures of the above with one another and / or with low - molecular - weight liquid crystals . it is possible to use thermotropic , lyotropic and amphotropic ( i . e . thermotropic + lyotropic ) liquid - crystalline materials . examples of suitable materials are described in ep - a 348 873 , ep - a 322 703 , ep - a 310 081 , ep - a 300 752 and ep - a 297 554 . preference is given to the use of lcps having a glass transition temperature of & gt ; 150 ° c ., for which purpose liquid - crystalline thermotropic main - chain polymers , in particular , are suitable . these are preferably on the one hand soluble in n - methylpyrrolidone or similar solvents , but on the other hand insoluble in the low - molecular - weight or polymeric liquid - crystalline compounds used as the switchable medium . particularly suitable are polyester - based main - chain polymers , in particular polyesters comprising aromatic diols and aromatic diesters , optionally with a hydroxycarboxylic acid as a further component . particular preference is given to a thermotropic polymer based on p - hydroxybenzoic acid , isophthalic acid and hydroquinone . liquid - crystalline polymers of this type are preferably used as a material for alignment layers which contain a nematic phase . it is also possible to use polymers having , for example , smectic phases . the liquid - crystalline polymer employed as the alignment layer is aligned by a process which completely or substantially avoids the generation of electrostatic charges and which avoids contamination of the alignment layer by abraded and dust particles . said polyester - based polymeric liquid - crystalline compounds may , in addition , also be aligned by known processes ( such as , for example , by rubbing , brushing or application of electrical or magnetic fields ). the polyester - based alignment layers produced in this way can , due to their favorable properties ( high homogeneity , strongly aligning effect , etc ), advantageously be employed as components in lc displays , in particular for flc displays . in particular , however , they can be aligned by the process described below . the process according to the invention is based on the use of gas or liquid flow over the layer comprising the liquid - crystalline polymer . the temperature of the gas flow is preferably in the range from 100 ° to 400 ° c ., in particular from 150 ° to 350 ° c . the temperature is particularly preferably higher than the glass transition temperature of the material to be aligned . in a preferred embodiment , the gas is purified beforehand via a filter in order to avoid dust particles . in the case of liquid flow for aligning the lcps , a wide range of liquids can be used , preferably those in which the material of the aligned layer is neither readily soluble nor completely insoluble . examples which may be mentioned of liquids which can be employed even at room temperature are the organic solvents γ - butyrolactone , n - methylpyrrolidone , methyl ethyl ketone , cyclohexanone and diglyme . at temperatures above the glass transition temperature of the polymer , preferred heat transfer media are water , glycerol or appropriate polar liquids . in order to align the polymer layer by means of a gas stream , the gas should be passed over the polymer layer for a period of , preferably , at least 2 minutes . a process duration of from 5 to 60 minutes , in particular from 10 to 40 minutes , generally results in particularly good alignment of the liquid - crystalline , polymeric material . an excessively long alignment process by means of gas flow is less advantageous , if only for economic reasons . in a preferred embodiment , the alignment is achieved by a gas stream in which the gas has a temperature in the range of the liquid - crystalline phase , in particular the nematic phase , of the polymeric material . in a further embodiment , a stream of air is passed onto the polymeric material at an angle of incidence ( α ) of from 0 . 5 ° to 10 °, in particular from 1 ° to 5 °, which allows particularly good alignment to be achieved . after treatment of the liquid - crystalline , polymeric material with a gas or liquid flow , the changes in structure and properties caused by this process are frozen by removing the liquid and / or reducing the temperature to below the glass transition temperature of the polymer . the polymeric alignment layers described can advantageously be employed in liquid - crystal displays , inter alia since they do not have the disadvantages described at the outset of rubbed alignment layers . the liquid - crystalline polymer used was a thermotropic main - chain polymer based on p - hydroxybenzoic acid , isophthalic acid and hydroquinone which has a glass transition temperature of 155 ° c . and a nematic phase in the range from 312 ° to 336 ° c . ( modification of the commercially available polymer ® vectra , registered trademark of hoechst celanese corporation , see also &# 34 ; vectra - polymere werkstoffe , hoechst high chem &# 34 ; [ vectra - polymeric materials , hoechst high chem ] magazine , september 1989 , frankfurt am main ). a solution of this polymer in n - methylpyrrolidone ( 3 % by weight ) was spin - coated onto the surface of a ( previously cleaned ) glass substrate . the film was cured for one hour at a temperature of 200 ° c ., so that the solvent had completely evaporated . the substrate treated in this way has a dry , hard polymer film with a thickness of 50 μm . ( the thickness can be adjusted via the rotation speed during the spin - coating process ). substrates produced in this way were then mounted on a holder in or in front of a long nozzle of various shape and variable cross - section . fig1 shows a diagrammatic view of this arrangement ( dimensions : 200 × 25 × 10 mm ). the rectangular parallelepiped ( 1 ) represents a nozzle having a rectangular cross - section into which the sample holder ( 2 ) has been introduced . on the sample holder ( 2 ) is the glass substrate ( 3 ), which is covered by a layer of the liquid - crystalline polymer ( 4 ). on the left - hand side of the nozzle , two arrows indicate the flow direction of the gas stream . the sample holder ( 2 ) holds the glass substrate ( 3 ) at the angle of incidence ( α ) with respect to the direction of flow of the gas . the nozzle ( 1 ) was coupled to a heat flux unit whose gas throughput rate and gas temperature were adjustable . in the case of the present measurements , the gas throughput was in each case 400 l / min . the liquid - crystalline , polymeric layer was treated with a unidirectional gas stream at various temperatures and at various tilt angles to the air stream with varying process durations . after the alignment process , the substrates ( glass substrate + alignment layer ) were bonded plane - parallel with an antiparallel alignment at a separation of 4 μm using spacers . the measurement cells produced in this way were filled with a liquid - crystalline broad - range mixture having a nematic phase ( for example with &# 34 ; zli 1565 &# 34 ; from e . merck , darmstadt ). the contrast of the test cell was measured as follows : the measurement cell was adjusted under crossed polarizers under a polarizing microscope , and the maximum light transmission and minimum light transmission were determined by means of a photodiode . in order to limit the effect of the spectral sensitivity of the diode on the initial voltage ( u ), a green filter is employed for the measurement . the measurement cells are characterized by the contrast ratio ( cr ), which is defined by the following equation : ## equ1 ## the values determined in this way were compared with values obtained using commercially available measurement cells of the same thickness , but using rubbed polyimide as the alignment layer ( measurement cells from ehc , tokyo ). to ease comparison , the contrast ratio of the ehc cells is defined as 100 . the dependence of the alignment of the liquid - crystalline , polymeric layer on the cross - section and the shape of the nozzle and on the angle of incidence of the stream of air was investigated . the results are shown in fig4 where various nozzle shapes are listed under z , and α describes the angle of incidence of the sample . in the case of nozzle shape ( 1 ), the sample holder was outside the nozzle . it is apparent that simply directing the air flow at the liquid - crystalline polymer layer only results in a small degree of alignment . in the case of nozzle shapes ( 2 ) and ( 3 ), the substrate was positioned inside the nozzle , as indicated in fig1 . it is apparent that significantly greater alignment can be achieved in this way . the numerical values given in table 1 relate to the maximum contrast ratio ( cr ). in the experiments , the temperature of the gas stream was 200 °- 360 ° c ., and in the specifically mentioned samples ( fig4 ) the gas had a temperature of 320 °- 330 ° c ., and the gas used was air . as can be clearly seen from fig4 the use of a nozzle having a rectangular cross - section ( 3 ) results in significantly better alignment , presumably attributable to a more favorable ( laminar ) air flow . comparison of the measurements at various angles of incidence ( α ) with the sample shows that an angle of incidence of 3 ° results in significantly improved results . the dependence of the alignment of the liquid - crystalline , polymeric layer on the temperature of the gas stream and on the duration was investigated . substrates were produced as described in example 1 and mounted in a nozzle having a rectangular cross - section of dimensions 200 × 25 × 10 mm at an angle of incidence ( α ) of 3 °. as can be seen from fig2 the alignment effect of the air stream on the liquid - crystalline , polymeric layer is the greatest when the air stream has a temperature in the range of the nematic phase of the thermotropic polymer . in fig2 the contrast ratio ( cr ) of the test cell is plotted against the temperature ( in ° c .). the process lasted 20 minutes ( i . e . the polymer layer was exposed to said air stream in the nozzle for 20 minutes ). in the present example , an optimum contrast ratio was achieved at a temperature of 326 ° c . the test cells aligned at this temperature had a contrast of up to 80 %, compared with the contrast of the commercially available ehc cells . fig3 shows the effect of the process duration ( t pr ) on the contrast ratio ( cr ). the measurements were carried out at a gas stream temperature of 326 ° c . it was apparent that the alignment effect of the air stream on the liquid - crystalline , polymeric material does not become visible until a treatment duration of some minutes . optimum alignment is achieved after a treatment time of from 15 to 25 minutes . the polyester layer applied to a glass substrate as in example 1 may likewise be aligned by rubbing ( for example with velour ), and the alignment layer produced in this way can advantageously be employed as a component in a measurement cell or in an lc display .	8
referring to fig1 a processor power delivery system 10 enables a dc - to - dc converter 12 to be assembled to a processor carrier 18 in the z - axis . the z - axis ( indicated by an arrow in fig1 ) is the direction that is transverse to the surface of a motherboard 28 and transverse to the lengths of the converter 12 and the processor carrier 18 . the processor carrier 18 may be plugged into a socket 50 that in turn plugs into a motherboard 28 , all in the z - axis direction . a processor 52 may be attached on the carrier 18 , for example using surface mount solder balls 20 , to a connection layer 21 . thereafter , the converter 12 , including components 54 , may plugged atop the processor carrier 18 also in the z - axis direction . this greatly facilitates the connection of the two units . the converter 12 includes contacts 16 on its lower surface 14 to make direct surface to surface contact with the processor carrier 18 . the contacts 16 communicate with the converter 12 components 54 through vias ( not shown ). the processor carrier 18 includes contacts 22 on its upper surface that mate with the contacts 16 when the carrier 18 and converter 12 are edge combined . the contacts 22 eventually electrically connect to power supply pins ( not shown ) on the processor 52 through connection layer 21 . in one embodiment , the contacts 16 and 22 may each be formed of a copper land pattern . a pair of upstanding alignment pins 24 a and 24 b on the processor carrier 18 pass through holes ( not shown in fig1 ) in the converter 12 . this pin / hole connection aligns the contacts 16 and 22 and facilitates the clamping engagement between the converter 12 and the processor carrier 18 . thus , referring to fig2 the pins 24 a and 24 b pass completely through the converter 12 in one embodiment of the present invention . this engagement aligns the contacts 16 and 22 with respect to one another as the converter 12 is pressed down into firm engagement with the processor carrier 18 in the z - axis direction . referring to fig4 the converter 12 laps over an edge and electrically engages , in direct surface to surface contact , the processor carrier 18 . the converter 12 and processor carrier 18 may be clamped together using clamping devices 38 and clamping housing 58 . in one embodiment of the present invention , the pins 24 may be threaded and may be secured using threaded fasteners . however , other clamping devices may be utilized to maintain an even clamping force along the length of the contacts 16 and 22 . referring to fig3 the contacts 16 of the converter 12 include a first set of planar interdigitated contacts 16 a that may provide a power supply ( vcc ) connection . a second set of planar interdigitated contacts 16 b may provide the ground ( vss ) or return power connection . the interdigitation may be achieved through fingers 40 , in one embodiment of the present invention . the interdigitation of the fingers 40 reduces the inductance of the power contacts 16 a and the ground contacts 16 b since mutual inductance is cancelled out by the interdigitated arrangement . power control signals ( such as a pwrgood signal ) may also pass through the contacts 16 from the contacts 22 . for example , a plurality of isolated power signal vias 34 may extend through the contacts 16 . similarly , vias 36 may pass through the process planar power contacts 22 . the arrangement of the signal vias 34 and 36 is subject to considerable variation . alignment holes 26 are provided on the converter 12 for engagement with the alignment pins 24 on the processor carrier 18 . the arrangement of the contacts 22 may be identical to that shown in fig3 with the exception that the contacts 22 may include vias 36 to an internal copper land pattern ( not shown ) and may further include the vias 34 which extend through the contacts 16 for conduction of other signals . the processor power delivery system 10 may include a plurality of components that may be resiliently clamped together between the housing 58 and the motherboard 28 as shown in fig5 . the housing 58 may include an upper surface with a plurality of reinforcing ribs 62 and a body 60 . formed in the body 60 is a corrugated spring 64 . the ends 66 of the spring 64 may be held within the body 60 for example by molding the spring 64 into the body 60 . when the body 60 is pressed against the converter 12 , the spring 64 vees are compressed , applying a uniform force through the body 60 to the converter 12 . in one embodiment , the spring 64 may be formed of beryllium copper . it may be shaped in a corrugated shape with a plurality of vees extending into the spring 64 from above and below . each of the vees may form a v - shaped compression spring pressed against either the body 60 or the converter 12 . the arrangement of the corrugated spring 64 serves to make more uniform the forces applied through the body 60 . ideally , the housing 58 supplies a substantially constant pressure over the life of the system 10 . the spring 64 may be defined with the cold flow properties of the related substrates over time in mind . the housing 58 may be formed of extruded aluminum or plastic as two examples . in one embodiment , the housing 58 may be hinged and latched to clear the contact region and to allow for z - axis assembly or replacement of components while providing a registration feature to align the underlying substrates . sandwiched between the converter 12 and the processor carrier 18 is a relatively low profile conductive polymer interconnect 68 including a polymer film 70 having captured therein conductive polymer contacts 72 . in one embodiment of the present invention , the film 70 may be formed of kapton and the polymer contacts 72 may be formed of a polymer that has been made conductive for example by doping it with conductive particles such as silver particles or oriented metallic wires . in each case , the polymer contacts 72 may be formed of a plastic material that is relatively resilient so that the material may be compressed between the converter 12 and the carrier 18 . the polymer contacts 72 produce a conductive contact between the converter 12 and the carrier 18 . moreover , because of the resilient nature of the interconnect 68 , surface irregularities may be accounted for and more reliable interconnection may be achieved in some cases . in some embodiments , the conductive polymer contacts 72 may be substantially thicker than the film 70 . for example , in one embodiment , the contacts 72 may have a thickness four times that of the film 70 . as shown in fig6 the interconnect 68 includes a pair of openings 74 to receive and pass the alignment pins 24 a and 24 b . the alignment pins 24 a and 24 b also act to precisely position the contacts 72 with respect to the converter 12 and the carrier 18 . the pins 24 a and 24 b may extend upwardly through the interconnect 68 and the converter 12 and in one embodiment through the housing 58 for securement by securement devices 38 shown in fig4 . in other cases , as mentioned previously , a hinged clamping device may be positioned for selectively applying a clamping force to the converter 12 and carrier 18 through the body 60 and the spring 64 . the contacts 16 and 22 may be brought into direct , planar surface to surface contact with one another . the contacts 16 and 22 may be brought into direct engagement in the z - axis direction , with the converter 12 atop the processor carrier 18 . with the application of a compression force across the converter 12 and the processor carrier 18 , good electrical contact may be obtained . the pins 56 on the socket 50 provide electrical communication with the motherboard 28 . because the converter 12 and the processor carrier 18 may both be assembled in the z - axis direction , the assembly of the processor power delivery system 10 is facilitated . of course , it is not necessary that either the converter 12 or the processor carrier 18 be rigorously moved through the z - axis direction . instead , either or both of the converter 12 and the processor carrier 18 may be moved so as to have a component of displacement in the z - axis direction relative to the plane of the motherboard 28 . since the contacts 16 and 22 meet along a common plane , the converter 12 may be moved onto the processor carrier 18 at any angle between the z - axis and the plane of the motherboard 28 . the electrical performance may be optimized in some embodiments by modifying the patterning of the contacts 16 and 22 without re - tooling converter 12 or carrier 18 assemblies . some embodiments may achieve a mechanical benefit from having a single axis of assembly . while an embodiment is illustrated in fig1 through 6 using planar contacts , embodiments of the present invention may be applied to other designs as well . the combination of the spring 64 and the interconnect 68 may be particularly desirable because the pressure applied by the spring 64 may result in more even pressure applied to the conductive contacts 72 in some embodiments . in an embodiment using conductive polymer contacts captured in a kapton film , the film may be formed by molding the conductive contacts into a previously formed film , as one example . another way of forming the interconnect 68 includes shaking conductive contacts into holes in the film and then bonding the contacts in place . generally , pressure may be applied to the contacts to increase their conductivity . while the present invention has been described with respect to a limited number of embodiments , those skilled in the art will appreciate numerous modifications and variations therefrom . it is intended that the appended claims cover all such modifications and variations as fall within the true spirit and scope of this present invention .	7
although the following description of the present invention teaches a hand tool powered by a removable battery it is to be understood that the hand tool may also be powered by a corded ac electric motor in place of the battery powered dc motor described herein . fig1 illustrates a hand held nailing machine 10 generally comprising a main body 12 including and a gripping handle 14 . attached to the end of handle 14 is removable , rechargeable battery 19 for providing the necessary electrical energy to operate the nailing machine power drive mechanism . also included in handle 14 is trigger 16 for operating nailing machine 10 . a fastener supplying magazine assembly 18 is typically attached to main body 12 and handle 14 , as illustrated , for supplying a strip of fasteners to nose assembly 20 . fig2 , 4 , and 5 illustrate top , left side , bottom and rear views of fastener drive assembly 40 as positioned within housing 12 of nailing machine 10 illustrated in fig1 . fig2 , and 5 have electrical control module 25 removed for clarity . the structural details and operation of control module 25 is completely described within the two copending patent applications identified in the “ related patent applications ” section above and are incorporated herein by reference . as illustrated in fig6 the primary operational elements of fastener drive assembly 40 comprise a flywheel 45 for providing kinetic energy , for driving a fastener into a work piece , energized by an electric motor 42 . flywheel 45 is free wheeling upon fixed shaft 32 . upon achieving the required revolutions per minute ( rpm ), drive clutch assembly 30 ( see fig7 and 9 ) causes engagement of clutch 35 and flywheel 45 thereby transferring a portion of the kinetic energy of flywheel 45 to a linearly moving driver 106 for driving a fastener into a work piece . referring now to fig2 through 9 , the elements and operation of the flywheel drive assembly 40 will be discussed . the flywheel drive assembly comprises clutch drive assembly 30 and flywheel 45 gear driven by electric motor 42 . although a gear drive between motor 42 and flywheel 45 is primarily illustrated herein , it is understood that a belt drive may also be used between motor 42 and flywheel 45 or any other suitable drive mechanism . as an alternative to having the motor axis of rotation parallel to the axis of rotation of flywheel 45 , as illustrated herein , it may be preferable to position motor 42 such that its axis of rotation is perpendicular to the axis of rotation of flywheel 45 and shaft 32 , thereby employing a bevel gear drive between the motor output shaft and the flywheel periphery . referring particularly to fig9 and additionally to fig6 through 8 the mechanical structure of flywheel 45 and clutch drive assembly 30 will be operationally described . clutch drive assembly 30 and flywheel 45 are axially aligned upon central shaft 32 as best illustrated in fig9 . central shaft 32 is threadingly affixed to end plate 52 which in turn is rigidly attached to frame 48 by an integral boss 51 extending axially from endplate 52 and received within slotted groove 47 such that end plate 52 and central shaft 32 are non - rotatable . the opposite end of central shaft 32 is received within supporting groove 49 in frame 48 . flywheel 45 is rotatingly positioned at the end of central shaft 32 , as best illustrated in fig9 upon deep groove ball bearing 46 , whereby flywheel 45 freely rotates about central shaft 32 when energized by motor 42 . flywheel 45 includes a conical cavity 44 for receiving therein conical friction surface 36 of conical clutch plate 35 . clutch plate 35 and activation plate 58 , although they are separable members , are geared to drum 34 by interlocking projections 28 and 26 respectively , whereby clutch plate 35 , activation plate 58 and drum 34 rotate freely about shaft 32 as a single unitary assembly . roller bearings 38 a and 38 b , positioned on the inside diameter of drum 34 , are provided to assure the free rotational characteristic of activation plate 58 , drum 34 and clutch plate 35 as a unitary assembly . adjacent activation plate 58 is fixed plate 56 . fixed plate 56 and activation plate 58 are connected to one another by three equally spaced axially expandable ball ramps 66 a , 66 b , 66 c , 66 a ′, 66 b ′ and 66 c ′ as illustrated in fig1 . the operation of the ball ramps 66 between fixed plate 56 and activation plate 58 is described in greater detail below . fixed plate 56 is fixed to housing 48 such that fixed plate 56 is free to move axially upon central shaft 32 , but not free to rotate about shaft 32 by anti - rotation tang 53 slidably received within axially aligned slot 43 within frame 48 . see fig1 . fixed plate 56 includes circular projection 61 receiving thereon freely rotatable thrust bearing 62 positioned between fixed plate 56 and retarder plate 64 . a pair of nested , parallel acting , bellville springs 72 are positioned , as illustrated in fig9 between retarder plate 64 and solenoid plate 54 the function of which is described in greater detail below . axially expandable ball ramps 68 a , 68 b , 68 c , 68 a ′, 68 b ′ and 68 c ′, see fig1 , connect end plate 52 and solenoid plate 54 the function of which is also described in greater detail below . positioned upon central shaft 32 , between clutch 35 and flywheel 45 is compression spring assembly 37 comprising washers 73 and 74 having coil spring 75 therebetween the function of which is described in further detail below . upon start of the fastener work , or driving , cycle , control microprocessor 25 causes motor 42 to “ spin up ” flywheel 45 , in the counter clockwise direction as indicated by arrow a in fig7 to a predetermined rpm . upon flywheel 45 achieving its desired rpm , or kinetic energy state , the control microprocessor 25 activates solenoid 80 which , through a flexible wire cable 84 extending from the solenoid plunger 82 and affixed to the periphery of solenoid plate 54 causes solenoid plate 54 to rotate clockwise , as indicated by arrow b in fig7 . as solenoid plate 54 rotates clockwise , solenoid plate 54 is caused to move axially away from end plate 52 by action of the corresponding ball ramps 68 in end plate 52 and solenoid plate 54 . see fig1 . as end plate 52 and solenoid plate 54 axially separate , the remaining elements of clutch drive assembly 30 are thereby caused to move axially toward flywheel 45 compressing coil spring 75 whereby clutch surface 36 preliminarily engages flywheel cavity 44 . engagement of clutch 35 with flywheel 45 causes counter clockwise rotation of clutch 35 , drum 34 and activation plate 58 , as an assembly . by action of corresponding ball ramps 66 , between fixed plate 56 and activation plate 58 , see fig1 , rotation of activation plate 58 causes axial separation of plates 53 and 58 . bellville springs 72 are thus compressed against solenoid plate 54 thereby providing an opposite axial force , forcing clutch 35 into tighter engagement with flywheel 45 . upon sensing an rpm drop of flywheel 45 , the control microprocessor 25 shuts off solenoid 80 , whereby solenoid plate 54 begins to return to its reset position by action of the axial force applied by the compressed belleville springs 72 . as solenoid plate 54 is urged to its start position the combined inertia of solenoid plate 54 , belleville springs 72 , compressed between solenoid plate 54 and retarder plate 64 , and retarder plate 64 prevent solenoid plate 54 from bouncing as it returns to its start position and engages the end of ball tracks 68 a , 68 b , and 68 c . by the presence and action of retarder plate 64 the system is prevented from oscillating and possibly re - engaging the clutch accidentally . as drum 34 rotates counter clockwise , cables 102 a and 102 b wrap about peripheral grooves 57 and 60 in drum 34 and clutch 35 respectively , thereby drawing piston assembly 111 downward , within cylinder 110 , in a power , or working , stroke whereby the attached fastener driver 106 is likewise driven downward , through guide block 108 , opening 41 within housing 48 , and into nose piece 20 thereby driving a selected fastener into a targeted workpiece . as piston assembly 111 is drawn downward through cylinder 110 a vacuum is created above piston assembly 111 which serves to draw piston assembly back to its start position upon completion of the work cycle thereby resetting the tool drive mechanism to its start position . assembly back to its start position upon completion of the work cycle thereby resetting the tool drive mechanism to its start position . fig1 a through 13c sequentially illustrate the action between fixed plate 56 and activation plate 58 as plate 58 rotates during the power stroke of clutch drive assembly 30 . although ball ramps 66 of fixed plate 56 and activation plate 58 are helical as illustrated in fig1 , ramps 66 are illustrated as being linear in fig1 a through 13c for simplicity of explanation . fig1 a illustrates fixed plate 56 and activation plate 58 at the beginning of the tool &# 39 ; s work cycle . as flywheel 45 drives activation plate 58 counter clockwise ( to the left in fig1 a ) balls 63 , following ramp profile 66 , cause a fast and sudden separation x , between activation plate 58 and fixed plate 56 as illustrated in fig1 b . separation x is maintained throughout the power stroke of driver 106 , as illustrated in fig1 b , thereby affecting the impartion of the kinetic energy , stored within flywheel 45 , to driver 106 as described above . at the end of the power stroke , as illustrated in fig1 c , plates 56 and 58 suddenly close together thereby causing the rapid disengagement of clutch 35 from flywheel 45 . with the solenoid plate 54 returned to its starting position and clutch 35 disengaged from flywheel 45 , activation plate 58 , drum 34 and clutch 35 , as an assembly , may be returned to their start position as described below . fig1 presents a representative graphical plot of the separation x between activation plate 58 and fixed plate 56 as a function of the angle of rotation of activation plate 58 . a combination driver guide and resilient stop block 108 is preferably positioned at the bottom of cylinder 110 to stop piston assembly 111 , within cylinder 110 , at the end of the power stroke . upon disengagement of clutch 35 from flywheel 45 , coil spring 75 urges all elements of clutch drive assembly 30 back toward end plate 52 whereby the vacuum formed above piston assembly 111 draws piston assembly back to its start position and thereby rotating activation plate 58 , drum 35 and clutch 34 by constructing the clutch drive assembly 30 , as taught hereinabove , clutch 35 disengages from flywheel 45 thereby allowing flywheel 45 to continue spinning after drive assembly 30 has reached the end of its power stroke . thus in the event it is desired to successively drive additional fasteners , the remaining kinetic energy is available for the subsequent operation thereby economizing battery power and saving the drive assembly elements and / or the frame 48 from having to absorb the impact that would otherwise occur by bringing flywheel 45 to a full stop immediately after the power stroke . this feature also permits “ dry firing ” of the tool . the clutch drive system as taught herein also provides for automatic compensation for clutch wear in that the expansion between end plate 52 and solenoid plate 54 will continue until clutch 35 engages flywheel 45 thereby allowing solenoid plate 54 to take up the difference at the start of every power drive . referring now to fig1 . vacuum return piston assembly 111 comprises piston 112 slidably received within cylinder 110 . spaced from the top of piston 112 is circumscribing groove 113 having positioned therein sealing o - ring 114 . positioned toward the bottom of piston 112 are two axial stabilizing bands 115 and 116 . the inside diameter d , of cylinder 110 , is flared outward to diameter d ′ at the top of cylinder 110 as illustrated in fig1 . diameter d ′ is slightly greater than the outside diameter of o - ring 114 thus creating an annular gap 117 between o - ring 114 and inside diameter d ′. as piston assembly 111 is drawn axially into cylinder 110 , during the power stroke of driver 106 , o - ring 114 slidingly engages the inside wall diameter d of cylinder 110 thereby forming a pneumatic seal between inside wall 118 of cylinder 110 and piston assembly 111 . as piston assembly 111 progresses into cylinder 110 , a vacuum is created , within the top portion of cylinder 110 , between advancing piston assembly 111 and the sealed end cap 119 . upon disengagement of friction clutch 35 from flywheel 45 , the vacuum created within the top portion of cylinder 110 draws piston assembly 111 back toward end cap 119 thereby resetting activation plate 58 , drum 34 , and clutch 35 , as an assembly , to their restart position . as o - ring 114 passes from inside diameter d to diameter d ′, on its return stroke , any air that may have by passed o - ring 114 , during the power stroke , is compressed and permitted to flow past o - ring 114 through annular gap 117 and to the atmosphere through cylinder 110 , thereby preventing an accumulation of entrapped air above piston assembly 111 . a resilient end stop 120 is preferably positioned within end cap to absorb any impact that may occur as piston assembly 111 returns to its start position at the top of cylinder 110 . as drum 34 returns to its start position tang 33 radially extending from drum 34 engages abutment block 31 affixed to housing 48 , see fig1 , thereby preventing over travel of drum 34 as it returns to its start position . fig1 a illustrates an alternate embodiment for preventing an accumulation of trapped air above piston assembly 111 . as illustrated in fig1 a piston 112 includes circumferential groove 132 receiving therein a generally rectangular shaped seal 134 having a v shaped groove 136 in one laterally positioned side thereof . one leg 133 of v groove 136 extends laterally outward beyond the outside diameter of piston 112 as illustrated in fig1 a . thus seal 134 acts as a check valve such that as piston 112 moves downward , during a power stroke , leg 133 sealing engages the inside wall 118 of cylinder 110 preventing the passage of air past piston 112 thereby creating the desired vacuum above piston 112 . in the event a small accumulation of air does accumulate above piston 112 , compression of that air accumulation upon return of piston 112 to its start position at the top of cylinder 110 will cause the air accumulation to flow past seal 134 thereby preventing a compressive air lock above piston 112 . although the two embodiments described immediately above are preferred embodiments to prevent the accumulation of entrapped air above piston assembly 111 , any other known suitable check valve mechanism may be used whereby entrapped air is permitted to escape to the atmosphere upon return of piston assembly 111 to its start position and wherein a vacuum is created during the power stroke of piston assembly 111 . for example see fig1 b wherein the check valve type of annular seal 134 , of fig1 a , has been replaced by a typical sealing o - ring 138 and a simple flap type check valve 130 which will permit entrapped air to be exhausted from orifice 131 during return of piston 112 to its start position . since the power stroke is relatively fast acting with a rapid return of piston assembly 111 to its start position , it is possible to eliminate check valve flap 130 and size orifice 131 such that the small amount of air that enters the cylinder during the power stroke does not sufficiently affect the resulting vacuum whereby sufficient vacuum remains to return piston assembly 111 to its start position and the air that has accumulated between piston assembly 111 and end cap 119 is exhausted through orifice 131 as piston assembly 111 returns to its start position . having shown and described the preferred embodiments of the present invention , further adaptation of the method and structure taught herein may be accomplished by appropriate modifications by one of ordinary skill in the art without departing from the scope of the present invention . accordingly , the scope of the present invention should be considered in terms of the following claims and is understood not to be limited to the specific structures and methods described in the specification and / or shown in the attached drawings .	1
the invention described herein is directed , in certain embodiments , to methods of treating a category of lip deformity characterized by excessive bulk to the upper and / or lower lip with excessive exposure of mucous membrane . this condition is referred to as hypervolemic lip deformity or lip ectropion . hypervolemic lip deformity can be perceived by the patient in the same vein as excessive prominence of the nose , jaw , forehead , eyebrows , or neck musculature . this condition can occur sporadically but occasionally is associated with specific populations . for example , african - americans and other dark - skinned populations frequently have excessive lip bulk which can be reduced by the methods described herein . sporadically , excessive lip bulk may be associated with jaw malocclusion or craniofacial abnormalities . surgery to debulk or reduce lip volume can be painful and disfiguring . consequently , few patients are interested in undergoing this ordeal . the present inventor has demonstrated using an animal model that shrinkage of large paraspinal muscles may be obtained upon administration of pharmaceutical preparations of botulinum toxin . this was observed using gross dissection and microscopic anatomy . this feature , combined with ease of injection of a botulinum toxin , provides a facile method to treat hypervolemic lip deformity without surgery by multiple injections within the orbicularis ori muscle creating muscle fiber atrophy and hence decreased lip bulk . additionally , decreased muscle tone associated with adjacent lip retractors functions to intort the lip ( i . e . rotate the lip inward ) further giving the impression of smaller lips . such retractors include mentalis , zygomaticu , risorius , nasal labialis , quadratus labii inferioris , and incisivus labii inferioris . in one embodiment of the methods of the present invention , a patient is identified with hypervolemic lips who is desirous of lip size reduction at rest and during dynamic facial movements . contraindications to the use of botulinum toxin ( wherein use of botulinum toxin would be ruled out ) include , for example , facial myopathy , myasthenia gravis and concurrent use of aminoglycoside antibiotics . in one embodiment , botulinum toxin in freeze - dried or liquid formulation is drawn into a syringe at a fixed dosage per 0 . 1 cc . other dose dilutions are possible . injections are made in multiple locations through the lip mucous membrane in at east 4 locations per lip . lip retractors are not directly injected but may be injected if lip size is not adequately reduced by injecting the lip structure directly . topical anesthetics such as 4 % lidocaine cream or cetacaine spray may be used to reduce the discomfort of the procedure . the effect does not occur immediately , but slowly over about 3 to about 5 weeks . repeated injections are necessary over about 3 to about 4 month intervals . asymmetry of mouth position during rest or dynamic movements may be addressed by “ touch - up ” injections after about 3 to about 5 weeks . the botulinum toxin , when injected in multiple locations provides a method of muscle shrinkage which reverses over a 3 - 4 month period . decreased resting muscle tone and contractility represent the muscular effect of botulinum toxin due to the partially denervated state . shrinkage of muscle fiber after point injection is seen in fiber after 4 weeks in table 1 . the invention described herein is also directed to methods for reducing facial muscle bulk and altering facial contour as well as methods of reducing facial volume . a . pharmaceutical compositions comprising botulinum toxin and a sequestration agent pharmaceutical compositions comprising botulinum neurotoxin and a sequestration agent are described in co - pending u . s . application ser . no . 10 / 740 , 755 filed dec . 22 , 2003 which is hereby incorporated by reference into the present application in its entirety . use of such pharmaceutical compositions comprising botulinum toxin and a sequestration agent is contemplated in the methods of the present invention , but is not required . as set forth in the co - pending &# 39 ; 755 application , in one embodiment , the sequestration agent is present in an amount between 550 and 550 , 000 μg sequestration agent per 100 ld 50 units botulinum toxin . in another embodiment , the sequestration agent is present in an amount between 550 and 5 , 500 μg sequestration agent per 100 ld 50 units botulinum toxin . in a further embodiment , the sequestration agent is present in an amount between 5 , 500 and 13 , 000 μg sequestration agent per 100 ld 50 units botulinum toxin . in a preferred embodiment , the sequestration agent is present in an amount between 13 , 000 and 50 , 500 μg sequestration agent per 100 ld 50 units botulinum toxin . in a more preferred embodiment , the sequestration agent is present in an amount between 50 , 500 and 505 , 000 μg sequestration agent per 100 ld 50 units botulinum toxin . in the most preferred embodiment , the sequestration agent is formulated as encapsulated microspheres in an amount between 50 , 500 and 90 , 500 μg sequestration agent per 100 ld 50 units botulinum toxin . in another embodiment , the methods may be practiced with a composition comprising botulinum toxin and a sequestration agent , wherein the sequestration agent is present in an amount between 550 and 900 , 500 μg sequestration agent per 100 ld 50 units botulinum toxin , wherein the albumin may be formulated as a solid albumin particle . the botulinum toxin of the present compositions may be selected from a variety of strains of clostridium botulinum . in a preferred embodiment , the compositions of the present invention comprises a botulinum toxin selected from the group consisting of botulinum toxin types a , b , c , d , e , f and g . in a preferred embodiment , the botulinum toxin is botulinum toxin type a . in a more preferred embodiment , the botulinum toxin is botulinum toxin type a from the hall strain of clostridium botulinum . in another embodiment , the compositions of the present invention comprise a botulinum toxin that consists essentially of fractionated - light - chain botulinum toxin . in yet another embodiment , the botulinum toxin consists essentially of a mixture of hybrid and chain - translocated forms of botulinum toxin . in a further embodiment , the botulinum toxin consists essentially of chimeric forms of botulinum toxin . although the present invention may utilize any botulinum toxin , botulinum toxin fragment that retains neurotoxic activity , botulinum toxin chimeras and hybrids , chemically - modified botulinum toxin , and specific activities well known to those of ordinary skill in the art , in one embodiment the botulinum toxin is purified to a specific activity greater than or equal to about 20 ld 50 units per nanogram botulinum toxin . in certain embodiments , the compositions of botulinum toxin and a sequestration agent are such that the ratio of ld 50 units of botulinum toxin to μg sequestration agent is less than or equal to about 0 . 2 for botulinum toxin type a and is less than or equal to about 10 for botulinum toxin type b . the compositions used in the methods of the present invention , in addition to comprising a botulinum toxin and optionally a sequestration agent , may further comprise a pharmaceutically acceptable carrier and / or zinc and / or a zinc salt . in one embodiment , the botulinum toxin is noncovalently bound to the a sequestration agent . in another embodiment , the botulinum toxin is covalently bound to the sequestration agent . the methods of the present invention may be practiced using compositions of a botulinum toxin and optionally , a sequestration agent , wherein the sequestration agent is selected from the group consisting of : proteins , lipids and carbohydrates . in a preferred embodiment , the sequestration agent is albumin , collagen , epinephrine or hyaluronate . in a more preferred embodiment , the sequestration agent is hyaluronate . in the most preferred embodiment , the sequestration agent is albumin . the methods of the present invention may also be practiced using compositions comprising a botulinum toxin and , optionally a sequestration agent , wherein the sequestration agent is an albumin , preferably human serum albumin . furthermore , in one embodiment , the albumin of the present compositions is recombinantly produced . in one embodiment , the albumin is present in an amount between 550 and 5 , 500 μg albumin per 100 ld 50 units botulinum toxin . in a further embodiment , albumin is present in an amount between 5 , 500 and 13 , 000 μg albumin per 100 ld 50 units botulinum toxin . in a preferred embodiment , albumin is present in an amount between 13 , 000 and 50 , 500 μg albumin per 100 ld 50 units botulinum toxin . in a more preferred embodiment , albumin is present in an amount between 50 , 500 and 505 , 000 μg albumin per 100 ld 50 units botulinum toxin . in a most preferred embodiment , albumin is formulated as encapsulated microspheres in an amount between 50 , 500 and 90 , 500 μg albumin per 100 ld 50 units botulinum toxin . in one embodiment of the present invention , the methods of the present invention may be practiced using compositions comprising a botulinum toxin and , optionally , at least one sequestration agent . in a preferred embodiment , the methods of the present invention may be practiced using compositions comprising a botulinum toxin and albumin and further comprising one or more additional sequestration agents . as used herein , “ effective amount ” is an amount sufficient to produce a therapeutic response . an effective amount may be determined with dose escalation studies in open - labeled clinical trials or bin studies with blinded trials . as used herein , a “ subject in need thereof ” is any patient suffering from a deformity arising from excessive tissue bulk or muscle bulk or tissue volume or muscle volume . as used herein , a “ deformity ” is any physical blemish , imperfection or distortion caused by or associated with excessive tissue bulk or muscle bulk or tissue volume or muscle volume , as perceived by the subject having the deformity . as used herein , one ld 50 unit of botulinum toxin is the dose necessary to kill 50 % of a population of about 20 gram to about 30 gram swiss - webster mice . as used herein , “ sequestration agent ” means an agent that enhances localization and / or retention of the botulinum toxin to the site of administration . the following examples are meant to illustrate the methods of the invention and are in no way intended to limit the scope of the invention . case description of reduction of hypervolemic lip size and volume using botulinum toxin ac is a 49 year old woman with a life - long history of excessive lip size . ac stated that she found this condition disfiguring and desired lip volume reduction . ac had worked as a psychologist and felt that this feature ( excessive lip size ) distorted her ability to communicate with patients and detracted from her personal appearance . the option of using botulinum toxin as a method to shrink the muscle fiber comprising a major component of her excessive lip volume was offered and she expressed the desire to proceed with this intervention . after explaining possible side effects including mouth movement asymmetry and possible temporary drooling , she wished to proceed . about 20 units of botulinum toxin type a were injected at four locations within the upper lip and about 20 units of botulinum toxin type a were injected into multiple locations in the lower lip . after about 3 weeks , the patient noted considerable reduction in lip size and less exposure of lip mucous membrane . the effect was noted to last for about 3 - 4 months . by shrinking muscle volume in ac &# 39 ; s lips by creating neurogenic atrophy induced by botulinum toxin , lip volume and contour were altered and disfigurement mitigated . influence of injection doses on muscle fiber size using botulinum toxin type a using doses of botulinum toxin type a varying from about 1 . 25 units per injection point to about 15 units per injection point , the influence of injection doses on muscle fiber size was examined and the results are shown in table 1 . the listed doses represent use of botulinum toxin type a . for botulinum toxin type b , 100 - 500 units are anticipated per injection point . other formulations can be selected for dose using regional denervation bioassays comparing the potency of the preparation with that of botulinum toxin type a formulated as botox ™ or purtox ( see table 1 ). in table 1 , average muscle fiber cross - sectional diameter is shown in microns ( with standard deviation ) at increasing distances from the point of injection for purtox dose escalations . comparable denervation results were obtained with botox ™ ( n = 100 , per biopsy location , bioquant ii fiber counter ). a patient is identified with increased muscle bulk below the eyelids . the patient is selected for treatment with botulinum toxin based on her desire to reduce the facial muscle bulk displayed below her eyelids . multifocal injections of about 20 units of botulinum type a in a pharmaceutical composition comprising a sequestration agent are administered to the patient . after about three weeks , the patient notes a decrease in facial muscle bulk below her eyelids which is accompanied by an altered facial contour manifested by a smoother , less prominent , appearance of the skin below the eyelids .	0
various apparatuses or methods will be described below to provide an example of an embodiment of each claimed invention . no embodiment described below limits any claimed invention and any claimed invention may cover apparatuses and methods that differ from those described below . the claimed inventions are not limited to apparatuses and methods having all of the features of any one apparatus or method described below , or to features common to multiple or all of the apparatuses or methods described below . it is possible that an apparatus or method described below is not an embodiment of any claimed invention . any invention disclosed in an apparatus or method described below that is not claimed in this document may be the subject matter of another protective instrument , for example , a continuing patent application , and the applicant ( s ), inventor ( s ) and / or owner ( s ) do not intend to abandon , disclaim or dedicate to the public any such invention by its disclosure in this document . the present disclosure relates to optimizing the material specification of alloy 800 to give reliable scc resistance in initiation and propagation during long term exposures , for example , to at least 80 years in canada deuterium uranium ( candu ) reactor and pwr primary systems . materials considered herein are modifications of alloy 800 with different concentrations of cr and ni . the measured scc growth rates were compared with rates obtained previously for alloys 690 ( 61 % ni ) and 316 ( 10 % ni ) in pwr primary water . furthermore , measured scc growth rates were compared with other test results of alloys with variations of nickel and chromium . firstly , the effects of nickel and chromium concentrations on intergranular stress corrosion cracking ( igscc ) was investigated . the following alloys with higher cr concentrations and cold - worked to 20 % ( 20 % cw ) were examined : 32 % ni - 27 % cr — fe ; 35 % ni - 25 % cr — fe ; and 25 % ni - 25 % cr — fe . secondly , the temperature dependence of scc growth of steam generator ( sg ) tubing in a range of operating temperatures was examined . the above - noted ni — cr — fe alloys with higher cr concentration were examined at 290 ° c ., 320 ° c ., 340 ° c . and 360 ° c . thirdly , the role of cavity formation on scc initiation of carbon steel for long terms at high temperatures was considered , and the rate of cavity formation was measured . then , the results were compared with results for alloy 690 to compare the scc initiation resistance of the ni — cr — fe alloys described herein , considering life beyond 60 years . an alloy of 20 % cw solution annealed 32 % ni - 25 % cr — fe ( 1075 ° c .× 1 h w . c .) was examined in the range of temperatures between 425 ° c . and 460 ° c . the results were compared with the results obtained previously to examine the effect of cr concentration and the effect of heat treatment on the rate of cavity formation in air . furthermore , a ni — cr — fe alloy specimen with fine grains was tested at 445 ° c . to confirm its reproducibility of the result obtained at 460 ° c ., and to examine the grain size effect considering steam generator tubing with fine grain size . for applications where increased resistance to corrosion ( scc in particular ) is required , such as in nuclear power plants or similar applications where material integrity is important , any increase in materials performance whilst remaining within specification limits , that are similar to the materials currently in use , is important , and hence useful . alloys of the present disclosure may provide significantly improved resistance to scc compared to alloy 800 alloys currently available . thus , the alloys of the present disclosure may be useful for applications where alloy 800 is currently used , and potentially other applications where ni — cr and austenitic stainless steels are used . alloys of the present disclosure may provide improved corrosion resistance , which becomes an economic benefit if the improved material reduces instances of component failure and results also in longer life of materials and components in service . thus , alloys of the present disclosure may have commercial benefits for manufacturers of ni — cr — fe alloys , and in particular for suppliers of materials to the nuclear industry , and potentially also to the suppliers of materials for all other applications that use alloy 800 or related materials . chemical compositions of test materials are summarized in table 1 . mechanical properties of test materials were measured at room temperature and 320 ° c . ; the results from annealed and ˜ 20 % cold rolled materials are summarized in tables 2 and 3 . specimens were machined as 0 . 5 t compact tension type ( 0 . 5 t ct ) with 12 . 5 mm thicknesses . specimens were prepared using ˜ 20 % cold rolled materials in the t - l orientation , i . e ., crack growth direction parallel to the rolling direction as shown in fig1 . a fatigue pre - crack of about 2 mm was produced using a load ratio ( r = k min / k max = 0 . 1 ) with 8 hz and at a k min below the stress intensity for testing . an example of the ct specimen with fatigue pre - crack before testing is shown in fig2 . rates of scc growth were measured in the range of temperatures between 290 ° c . and 360 ° c . in pwr primary water using 20 % cold rolled ct specimens . the specimens were broken after testing by fatigue in air . the fracture surfaces were analyzed using sem to determine the crack morphology and the depth of igscc . maximum igscc depths were determined using scc depth data that are measured from at least four points . scc crack growth rate was calculated by equation ( 1 ): tests were performed under constant load conditions without dynamic loading in the test environment at 360 ° c ., 340 ° c ., 320 ° c . and 290 ° c . the initial k value was 30 mpam 1 / 2 in all cases . rates of scc growth were measured in test facilities at 360 ° c ., 340 ° c ., 320 ° c . and 290 ° c . in typical pwr primary water , which contains boric acid ( h 3 bo 3 , 500 ppm as b ), lithium hydroxide ( lioh , 2 ppm as li ), and dissolved hydrogen ( dh , ˜ 30 cc / kg h 2 o ). the concentration of hydrogen was adjusted by bubbling an appropriate gas pressure through the solution in the storage tank at room temperature before the solution is pumped into the autoclaves ; hydrogen and oxygen were measured at ambient temperatures using a hydrogen and oxygen gas monitor . dissolved oxygen was controlled to less than 5 ppb through the testing . the depth of intergranular corrosion was measured by sem observation in cross sectional view using focussed ion beam ( fib ) of the bottom of ct specimens to characterize the cr concentration and temperature with peak . film analyses by aes were performed on specimens after testing in pwr primary water at 290 ° c ., 320 ° c ., 340 ° c . and 360 ° c . these measurements provided information on the cause of the measured temperature dependence . good correlations have been reported previously between rates of cavity formation and creep crack growth in gas with carbon steel as shown in fig3 a . similar correlations have also been performed on alloy 690 and alloy 600 as shown in fig3 b . then , the rate of cavity formation was assumed from the results of measured rates of creep crack growth in air considering the correlation between rates of creep crack growth and cavity formation shown in fig3 a and 3b . scc initiation caused by cavity formation was correlated with the rate of cavity formation . rates of creep crack growth were measured at 425 ° c ., 440 ° c . and 460 ° c . in air using ˜ 20 % cold rolled ct specimens of solution annealed 32 % ni - 25 % cr — fe alloy ( 1075 ° c .× 1 h w . c .). furthermore , 19 % cw 34 % ni - 22 % cr ( 1065 ° c .× 10 m a . c .) with fine grains was tested at 445 ° c . to confirm the reproducibility of the results at 460 ° c . to examine effects of grain size . tests were performed under constant load conditions without dynamic loading in the test environment . the initial k value was 40 mpam 1 / 2 in all cases . specimens were broken by fatigue in air after testing . the fracture surfaces were analyzed using sem to determine the crack morphology and the depth of creep crack . maximum creep crack depth was determined using creep crack depth data that are measured from at least four points . creep crack growth rate was calculated by equation ( 2 ): these results were compared with other data to assess effects of cr concentration and carbide precipitation on the rate of cavity formation . results were compared with those of alloy 690 to compare the scc initiation resistance caused by cavity formations between the ni — cr — fe alloys described herein and alloy 690 . test conditions of test 1 at 360 ° c . are summarized in fig4 a , 4b and 4c . test duration in test 1 was 5 , 233 h . water chemistries of the test environments were well controlled during testing . after testing , the specimens were broken by fatigue in air to determine the depth of scc and fracture morphologies . the observed results of the fracture surfaces of test specimens are shown in fig5 a , 5b , 6a , 6b , 7a and 7b . no trace of scc was observed in the test specimens of 35 % ni - 25 % cr — fe alloy and 32 % ni - 27 % cr — fe alloy after 5 , 233 h exposures in pwr primary water at 360 ° c ., as shown in fig5 a , 5b , 6a and 6b . these results show excellent scc growth resistance of these alloys at 360 ° c . in pwr primary water , for example , as compared with alloy 690 in the range of specification of ni concentration of alloy 800 currently available ( 32 to 35 % ni ). one very local and shallow igscc was observed in the 20 % cw 25 % ni - 25 % cr — fe alloy . the maximum rate of scc growth was ˜ 1 . 6 × 10 − 9 mm / s based on the destructive observations shown in fig7 b . test conditions of test 2 at 340 ° c . are summarized in fig8 a , 8b and 8c . test duration in test 2 was 5 , 233 h . water chemistries of the test environments were well controlled during the testing . after testing , the specimens were broken by fatigue in air to determine the depth of scc and the fracture morphologies . the observed results of the fracture surfaces of the specimens are shown in fig9 a , 9b , 10a , 10b , 11a and 11b . no trace of scc was observed in the test specimens after 5 , 233 h exposures in pwr primary water at 340 ° c ., as shown in fig9 a , 9b , 10a , 10b , 11a and 11b . these results show excellent scc growth resistance of the alloys . test conditions of test 3 at 320 ° c . are summarized in fig1 a , 12b and 12c . test duration in test 3 was 6 , 609 h . water chemistries of the test environments were well controlled during the testing . after testing , the specimens were broken by fatigue in air to determine the depth of scc and the fracture morphologies . the observed results of the fracture surfaces of test specimens are shown in fig1 a , 13b , 14a , 14b , 15a and 15b . no trace of scc was observed in the test specimens after 6 , 609 h exposures in pwr primary water at 320 ° c ., as shown in fig1 a , 13b , 14a , 14b , 15a and 15b . these results show excellent scc growth resistance of the alloys , for example , as compared with 20 % cw alloy 690 tt ( t - l ), also at 320 ° c . in pwr primary water . test conditions of test 4 at 290 ° c . are summarized in fig1 a , 16b and 16c . test duration in test 4 was 6 , 155 h . water chemistries of the test environments were well controlled during the testing . after testing , the specimens were broken by fatigue in air to determine the depth of scc and the fracture morphologies . the observed results of the fracture surfaces of test specimens are shown in fig1 a , 17b , 18a , 18b , 19a and 19b . no trace of scc was observed in all of the test specimens after 6 , 155 h in pwr primary water at 290 ° c ., as shown in fig1 a , 17b , 18a , 18b , 19a and 19b . these results show excellent scc growth resistance of the alloys also at 290 ° c . in pwr primary water . to consider mechanisms of scc growth in pwr primary water , film analyses were performed using alloy specimens after testing in pwr primary water at 290 ° c ., 320 ° c ., 340 ° c . and 360 ° c . surface oxidation behaviors after testing are shown in fig2 a , 20b and 20c . lntergranular corrosion was observed after testing at 290 ° c . and 320 ° c . in alloys with low cr concentrations less than 22 % cr , as shown in fig2 a , 20b and 20c . however , there was no trace of intergranular corrosion in alloys with cr concentrations more than 23 %. accordingly , sem observations and aes analyses of cross sectional views were performed to examine the temperature dependence with peak of igscc growth after sampling by fib , as shown in fig2 a , 21b , 21c , 21d , 21e , 21f , 21g , 21h , 21i and 21j . sem observations of cross sectional views were performed to assess the mechanisms of cr concentration dependence on scc growth resistance ; samples of alloys were used with different cr concentrations after tests at 290 ° c ., as shown in fig2 a , 22b and 22c . lntergranular corrosion was observed in alloys with low cr concentration less than 23 % tested at 320 ° c . and 290 ° c . no clear evidence of intergranular corrosion was observed in alloys tested at higher temperatures more than 340 ° c . no clear evidence of intergranular corrosion was observed in alloys with high cr concentration of more than 25 % after testing at 290 ° c ., 320 ° c ., 340 ° c ., and 360 ° c . to examine the effect of material characteristics on scc initiation caused by cavity formation , considering long term reliability more than 60 years in high temperature water , rates of cavity formation were measured from the results of creep crack growth using 20 % cw ct specimens of solution annealed 32 % ni - 25 % cr — fe alloy ( 1075 ° c .× 1 h w . c .) at 425 ° c ., 440 ° c . and 460 ° c . in air . then , the results were compared with results of 20 % cw alloy 690 tt to compare the crack initiation resistance caused by cavity formation . the reproducibility of 19 % cw 34 % ni - 22 % cr — fe alloy ( 1065 ° c .× 10 m a . c .) with fine grains was tested at 445 ° c . to examine the effects of grain size , for example , in steam generator tubing . test durations were between 4 , 030 h and 9 , 590 h . after testing , the specimens were broken by fatigue in air to determine the depth of creep cracking and the fracture morphologies . the results of observations on fracture surfaces are shown in fig2 a , 23b , 24a , 24b , 25a , 25b , 26a and 26b . lntergranular crack growth was observed in almost all specimens tested at 460 ° c ., 445 ° c ., and 440 ° c ., as shown in fig2 a , 23b , 24a , 24b , 26a and 26b . however , no crack growth was observed in solution annealed 32 % ni - 25 % cr — fe alloy tested at 425 ° c . after 9 , 590 h in air , as shown in fig2 a and 25b . measured maximum rates of creep crack growth of solution annealed 32 % ni - 25 % cr — fe alloy tested at 440 ° c . (˜ 1 . 6 × 10 − 8 mm / s ) was about 50 times slower than that of alloy 690 tt with the same grain size (˜ 100 μm ). about 10 times more rapid rate of creep crack growth was observed in 34 % ni - 22 % cr — fe alloy with fine grains (˜ 20 μm ) compared with solution annealed 32 % ni - 25 % cr — fe alloy with large grains (˜ 100 μm ). furthermore , more than 50 times rapid rate of creep crack growth was observed in carbide precipitated 32 % ni - 25 % cr — fe alloy than solution annealed 32 % ni - 25 % cr — fe alloy . the scc growth resistance of ni — cr — fe alloys described herein with cr concentrations more than 25 % in pwr primary water was measured . the results are summarized as a function of cr concentration in fig2 a , 27 b , 27 c , 27 d and 27 e , together with existing results for ni - 16 % cr — fe alloys and alloy 690 tt . the dependencies on temperature of scc growth are summarized in fig2 a and 28b , together with existing results for ni - 16 % cr — fe alloys and alloy 690 tt . there was no trace of scc observed in 32 % ni - 25 % cr — fe alloy , 32 % ni - 27 % cr — fe alloy , and 35 % ni - 25 % cr — fe alloy in the range of temperatures between 290 ° c . and 360 ° c . the results showed that temperature dependencies of scc growth with peak was not observed for cr concentrations more than 25 %. excellent scc growth resistance in ni — cr — fe alloys with more than 25 % cr concentrations were observed relative to alloy 690 tt in the range of temperatures between 290 ° c . and 360 ° c . in pwr primary water . the peak of the scc growth rate of the ni — cr — fe alloys seems to be in the range of temperatures between 320 ° c . and 290 ° c ., judging from results obtained for 32 % ni - 16 % cr — fe alloy , as shown in fig2 a . samples were examined with the sem after testing at 290 ° c . lntergranular corrosion was observed in 32 % ni — cr — fe alloys with 16 %, 20 %, 22 %, and 23 % cr after testing at 290 ° c . in pwr water without the application of stress , as shown in fig2 a and 29b . no trace of intergranular corrosion was observed in the 32 % ni - 25 % cr — fe and 32 % ni - 27 % cr — fe alloys . the thickness of the inner layer may be influenced by the cr concentrations in alloys . these results suggest that intergranular corrosion may produce some influence on igscc growth for ni — cr — fe alloys , judging from the similar trend of dependence of cr concentration both on scc growth and intergranular corrosion , as shown in fig2 a and 29b . samples were examined with the sem after testing at 290 ° c ., 320 ° c ., 340 ° c ., and 360 ° c . furthermore , aes analyses were performed to determine the dependence of temperature on film compositions . the results of these observations are shown in fig2 a , 21b , 21c , 21d , 21e , 21f , 21g , 21h , 21i , 21j , 22a , 22b and 22c . as shown , the thicknesses of inner oxide layers appear to be thicker after testing at high temperature than low temperatures . moreover , the thicknesses of specimens with high cr concentrations appear to be greater than specimens having lower cr concentrations , even at 290 ° c . the parabolic law constant was calculated according to equation ( 3 ) to confirm this trend more clearly . the results are summarized in fig3 a . thickness of inner layer ( mm )=( k p · time ) 1 / 2 ( 3 ) lntergranular corrosion appears to occur at low temperatures less than 320 ° c . in 32 % ni — cr — fe alloys with cr concentrations less than 23 %. furthermore , the susceptibility of the alloys to intergranular corrosion appears to decrease at temperatures higher than 340 ° c . moreover , significant dependencies of film compositions on temperature were not observed . the inner layer consisted mainly of cr - rich oxide . on the other hand , the outer layer mainly consisted of ni — and fe - rich oxides . dependencies on temperature with peak of the parabolic law constant were observed in alloys with low cr concentration in the range between 16 % and 23 %. this trend is similar to the temperature dependence of scc growth with peak of alloy 800 . furthermore , higher parabolic law constants were observed in alloys with higher cr concentrations , including 25 % at 290 ° c . this trend is also similar to the dependence of cr concentration on scc growth of alloy 800 at 290 ° c . these results suggest that intergranular corrosion may play a role in igscc growth , judging from the similar trend of dependence of temperature both on scc growth and intergranular corrosion . furthermore , measured temperature dependencies of intergranular corrosion susceptibilities with peak may be related to the kinetics of the inner oxide layer considering the similar dependence of temperature . scc initiation behavior caused by cavity formation of 20 % cw tt690 , ma600 and carbon steel was examined , as shown in fig3 b . the dependencies of several influences on rates of cavity formation of the alloys were examined to compare with alloy 690 tt . for this , the effects of the following characteristics were examined : comparison of rates of cavity formation with alloy 690 tt ; effect of carbide precipitation on rates of cavity formation ; effect of grain size on rate of cavity formation ; and effect of cr concentration on rates of cavity formation . as shown in fig3 a and 3b , a good correlation was observed between rate of creep crack growth and cavity formation because the rate limiting processes of creep cracking are assumed to be proportional to the rate of cavity formation . therefore , firstly , the measured rate of creep crack growth in solution treated ni — cr — fe alloy with 25 % cr was compared with the results for other alloy specimens with different cr concentrations . then , the effect of cr concentration on the rate of cavity formation could be determined . secondly , the measured rates of solution treated ni — cr — fe alloy were compared with the results of carbide precipitated alloy to determine the effect of carbide precipitation on the rate of cavity formation . thirdly , the measured rates in solution treated ni — cr — fe alloy with large grains (˜ 100 μm ) were compared with the results of solution treated 34ni - 22cr — fe alloys with fine grains (˜ 20 μm ) to determine the effect of grain size on the rate of cavity formation . finally , the measured rates of cavity formation were compared with the results for alloy 690 tt to understand the scc initiation resistance caused by cavity formation . all results are summarized in fig3 c . firstly , it should be appreciated that carbide precipitation may accelerate cavity formation , by providing nucleation sites for cavities , thereby enhancing the rate of cavity formation near the carbides . evidence for this correlation includes the rapid crack growth in carbide precipitated alloy in a double heat treatment at 1075 ° c .× 1 h + 900 ° c .× 1 h . in general , solution annealed alloy in a single high temperature heat treatment is better for the ni — cr — fe alloys described herein so as to not precipitate carbides . secondly , rapid cavity formation may occur in material with small grains , for example , sg tubing relative to thick components such as control rod drive mechanism ( crdm ) housings . an estimated crack initiation time for alloy 690 tt with large grains may be about 100 years at operating temperature ( 320 ° c . ), based on an extrapolated value in fig3 b . however , if the effect of grain size from the data is used to assess the scc initiation time of sg tubing with fine grains , the estimated time may decrease by a factor of ten . consequently , the estimated scc initiation time may be about 10 years . however , the degree of cold work may alter these influences . accordingly , the rate of intergranular crack growth may be about 100 times slower for solution annealed 32 % ni - 25 % cr — fe than for alloy 690 tt . furthermore , carbide precipitated 32 % ni - 25 % cr — fe alloy may be about 100 times faster than for solution annealed 32 % ni - 25 % cr — fe alloy . these results suggest that carbide precipitation strongly decreases the resistance of scc initiation caused by cavity formation in the ni — cr — fe alloys described herein . precipitated carbides may provide initiation sites for cavity formations . therefore , high temperature final heat treatments , such as 1075 ° c . followed by rapid cooling , to reduce carbide precipitation are desirable for scc initiation resistance caused by cavity formation . a ten times more rapid rate of intergranular crack growth ( rate of cavity formation ) was observed in solution annealed alloy with fine grain (˜ 20 μm ) than solution annealed alloy with large size of grain (˜ 100 μm ), as shown in fig3 c . the main cause of the effect of grain size may be the difference of the magnitude of discharged vacancies from small grains , judging from the calculated results shown in fig3 d . this suggests that about ten times shorter scc initiation time is produced by cavity formation with the smaller grains . the estimated scc initiation time caused by cavity formation of 20 % cw alloy 690 tt with large size of grains (˜ 100 μm ) is estimated to be about 100 years , based on the extrapolated value at 320 ° c ., as shown in fig3 b . taking into account the grain size effect described above , the estimated scc initiation time with fine grains may be assumed to be about ten years , although other effects , such as degree of cold work may be considered . no significant effect of cr concentration on the rate of cavity formation was observed in the range of cr concentration between 20 % and 25 %. in conclusion , measured scc growth rates of ni — cr — fe alloys with between 25 and 27 wt % cr were very slow at temperatures between 320 ° c . and 360 ° c ., compared with scc growth rates of alloy 690 . given that the results for alloys having 27 wt % cr were so clearly good , it is believed that alloys having up to 28 wt % cr , and possibly more , may also exhibit an improved resistance to stress corrosion cracking in nuclear environments . regarding the mechanism of dependence of cr concentration in igscc growth , intergranular corrosion may play a role on the susceptibility of igscc growth in pwr primary water . regarding the mechanism of dependence of temperature with peak on igscc growth for ni — cr — fe alloys , intergranular corrosion may play a role on the susceptibility of igscc growth for ni — cr — fe alloys in pwr primary water . furthermore , ni — cr — fe alloys described herein produced excellent crack initiation resistance relative to alloy 690 from the point of view of resistance of cavity formation . lower cavity formation rates may yield an initiation rate for ni — cr — fe alloys described herein that is about 100 times less than an initiation rate for alloy 690 . however , a significant increase in rates of cavity formation may occur with carbide precipitation and small grain sizes . therefore , a high temperature final heat treatment followed by rapid cooling may produce a low rate of cavity formation for the ni — cr — fe alloys described herein . the heat treatment of the ni — cr — fe alloys described herein may be carried out at a temperature of at least 1000 ° c ., for a minimum of 3 minutes , and followed by rapid water cooling . more particularly , the heat treatment may be carried out in the range of 1050 - 1100 ° c . the intent for the ni — cr — fe alloys is to avoid carbide precipitation , which may occur below 1050 ° c . there may be no specified maximum time because the total time may be determined by the thickness of the material , and thus how long it takes the material to get to temperature . once at temperature , a time of 3 minutes or possibly more may be required . for example , for sg tubing , a thin wall ( e . g ., 1 mm ) means that 3 minutes ( the time it takes to go through an annealing furnace ) may be appropriate . maximum times may depend on material thicknesses , initial conditions , etc ., and may be optimized according to product specifications , including grain size , surface cleanliness , hardness , etc . while the above description provides examples of one or more methods or apparatuses , it will be appreciated that other methods or apparatuses may be within the scope of the accompanying claims .	2
referring now to the drawings in greater detail wherein the figures are for the purpose of illustrating preferred embodiments of the present invention only and not for the purpose of limiting the same , a cross - sectional view of a typical piston / cylinder arrangement in an adiabatic diesel engine is illustrated in fig1 . piston 10 having piston rings or sliding seals 12 is housed in cylinder 14 of engine 16 . typically , piston rings 12 are compression loaded against inner cylinder wall 18 whereby the outer ring surface 20 slides along inner wall 18 during operation . ideally , there is no direct contact between the ring surface 20 and the wall 18 but rather a thin lubricant film separates the surface 20 and the wall 18 . during operation of engine 16 extremely high temperatures are generated within cylinder 14 often causing conventional lubricants to simply break down or vaporize . upon lubricant breakdown or vaporization ring surface 20 contacts wall 18 and detrimental wear is experienced on both the seal 12 and the wall 18 . it is to be understood that wall 18 could be a cylinder liner . fig2 a is a detailed illustration of seal 12 and wall 18 in a representative diesel exhaust environment of 7 . 8 % co 2 , 8 . 9 % o 2 , balance n 2 , at approximately 40 psi pressure , 800 ° c . temperature . in fig2 a , seal 12 is a nickelmolybdenum bonded titanium carbide cermet ( ni - mo - tic ) while wall or cylinder liner 18 is partially - stabilized zirconia . as ring 12 slides along wall 18 , molybdenum , mo , ions are released from rings 12 while oxygen , o , reacts with the ring materials to form titanium and nickel oxides , ti ( o ) and ni ( o ). these oxides transfer to wall 18 during operation of the engine , and it is believed function to form discontinuous , but relatively lubricious , films 50 . molybdenum ions do not transfer since at 800 ° c . mo rapidly volatilizes as moo 3 . likewise , fig2 b illustrates the formation of the discontinuous , lubricious film where the ring material is hot - pressed titanium carbide , tic , and the liner 18 is silicon nitride , si 3 n 4 . fig2 b shows the transfer of the titanium oxides to wall 18 to form lubricious film 52 . test results involving standard pin ( simulated ring 12 ) - on - disk ( simulated liner 18 ) experiments performed at 800 ° c ., 5 pounds normal force , and pin - ring relative velocities of 1 m / s , have shown that ceramic friction and wear couples , such as discussed above , which have not been ion - implanted , as hereinafter discussed , exhibit friction coefficients greater than 0 . 35 . the couples degrade by a variety of wear mechanisms , leaving a disk wear track of measurable ( using surface profilometry ) depth . however , when liner ceramics 18 have been ion - mixed with metal ions and oxidized at high oxidizing temperatures as described below , friction coefficients and wear resistance improve significantly . for example , in fig3 liner wall 18 of partially stabilized zirconia ( psz ) has been implanted with titanium , ti , and nickel , ni , mixed , and oxidized at high oxidizing temperatures to form a near surface gradient layer of oxides and the underlying psz . liner wall 18 could also be silicon nitride , si 3 n 4 , or other comparable ceramic composition . implantation is achieved by first depositing a thin film ( approximately 400 angstroms thick ) of a metal ion such as nickel , ni , upon the surface of the wall of ceramic composition of partially - stabilized zirconia . metal ions such as nickel , titanium , niobium , silver , zinc , copper , zirconium and yttrium are also suitable selections for deposition . tests have shown that molybdenum and chromium are not suitable . deposition may be accomplished by chemical vapor deposition ( cvd ), vacuum deposition ( vd ) or otherwise as is known in the art . next , the metal ion deposition is ion mixed or implanted using argon , ar , ions at an accelerating potential of approximately 140 kev . ion fluence is 1 × 10 17 ions / cm 2 , and the ion flux is 1 × 10 12 ions / cm 2 seconds . ion mixing is commonly known in the art . the ion mixing of the metal ion with the ceramic composition occurs within the outer 0 . 4 - 0 . 5 micrometer thick surface region of the ceramic composition . a second deposition is then conducted either with the same metal ion or a second metal ion such as a thin film of titanium being deposited by cvd , vd , or otherwise on the surface of the ceramic compositon which has already been implanted with the first metal ion , this second metal ion also being of the group discussed above . again , there is ion mixing and implantation of the second deposition with the first metal ion and the ceramic composition at the near surface region of the ceramic composition using argon ions at an accelerating potential of approximately 140 kev . the metal ions are mixed together well , but contain relatively little of the underlying ceramic composition . this composite is next oxidized to form a gradient coating . after mixing and implantation , wall 18 is subjected to approximately a thirty minute soak at approximately 600 °- 800 ° c . in moist air or in a representative diesel exhaust environment discussed above , thereby oxidizing the composite and forming the lubricious coating 60 . the thickness of the implanted oxide coating is approximately 0 . 4 - 0 . 5 micrometers . the mixed ions form a gradient of oxides throughout the near surface region ( 0 . 4 - 0 . 5 micrometers ) which allows for the gradual release of the oxide during operation of the wall liner at high operating temperatures . thus a tenacious film is formed on the underlying ceramic composition which is capable of being released and still providing a reservoir of oxide within the wall near surface region . as can be seen in fig3 the composite gradient coating 60 yields metal oxides , such as titanium oxide 70 and nickel oxide 72 , which transfer from wall 18 to seal 12 during operation of the engine ( greatly exaggerated in fig3 ). it is believed that the oxidizing of the implanted coating produces the stable lubricant 54 . with the ionimplanted ceramic composition obtained from the above process , low friction coefficients and high wear resistance at high operating temperatures are obtained . in particular , standard pin ( simulated ring ) - on - disk ( simulated liner ) test results on the implanted materials at 80 ° c ., 5 pounds normal force , and pin - ring relative velocities of 1 m / s , have shown that friction coefficients between 0 . 09 and 0 . 14 are obtained . for these coefficients of friction , pin and disk wear is unmeasurable using profilometry techniques . it has been found that the deposition , implantation , and oxidization of a single layer of cobalt ions using the above discussed procedures yields significantly reduced friction coefficients at operating temperatures from 800 ° c .- 1200 ° c . and above . while it has been shown , described and pointed out the fundamental novel features of the invention as applied to a preferred embodiment thereof , it will be understood that various omissions , substitutions and changes in the form and details of the device illustrated and in its operation may be made by those skilled in the art without departing from the spirit of the invention . it is the intention , therefore , to be limited only as indicated by the scope of the claims appended hereto .	2
the invention is based on the appropriate definition of regions of interest ( rois ), as will be explained briefly with reference to fig2 . in a 2 - d x - ray or angiography image 11 containing blood vessels 12 for example , what is understood quite generally by an roi is a user - defined section of the angiography image 11 . as a result of the preceding subtraction of the mask image in the case of dsa sequences the sum of the grayscale values of all pixels lying within the roi in each individual image of the sequence is directly proportional to the mass of the contrast agent that is contained in the 3 - d volume segment v roi defined by the roi . since no depth information at all is in fact contained in a 2 - d x - ray image 11 , present approaches consequently always acquire the 3 - d volume segment v roi which is “ excised ” by the roi defined in 2 - d and which extends over the entire object depth . it is important for the application of the approaches proposed here that an angulation of the angiography system is chosen which has the fewest possible overlays of the tissue region that is to be examined by blood vessels 12 lying spatially in front of or behind said tissue region . the greater the number of such overlays occurring , the more inaccurate will be the estimation of the relative perfusion parameters . defining suitable rois — either for the purpose of before / after comparisons ( e . g . in the case of tumor embolizations ) or for the purpose of left / right comparisons either in the brain or in paired organs such as the kidneys for example — enables results to be computed in relation to the mass ratio of the contrast agent associated with the respective time instant ( in left / right comparisons ) or with the respective two time instants ( in before / after comparisons ) ( and hence of the blood , provided an ideal mixture of blood and contrast agent is assumed ) within the volume segments v roi defined by the rois . meaningful determinations of the relative blood volume naturally demand here that in the case of before / after comparisons the acquisition parameters , such as in particular the angulation of the c - arm and the zoom factor used for example , and the injection protocol remain constant . any changes to the exposure parameters resulting from the automatic dose regulation by the angiography system must be calculated out of the image sequences accordingly in order to allow a meaningful comparison . in the case of left / right comparisons it is of course likewise necessary to choose a suitable injection protocol which prefers no half of the body per se . typically a stationary state is required for determining the blood volume in a tissue region . according to the theory ( see equation ( 5 ) in konstas et al .) the blood volume v in a volume segment can in fact also be calculated from dynamic data as follows : c tissue ( t ) denotes the average contrast agent concentration in the tissue region under examination , while c artery ( t ) denotes the sum of the average contrast agent concentrations in the supplying arteries . in this case the upper integration limit t should be suitably chosen to enable the transported contrast agent bolus to be recorded completely . however , the integration should only include the time in which the contrast agent bolus undertakes a first pass through the tissue so that distortions of the values caused by recirculation of the bolus are avoided . in before / after comparisons with constant injection protocol and constant acquisition parameters as well as in left / right comparisons with appropriately chosen injection protocol it may be assumed for simplicity that the arterial input left and right or , as the case may be , before and after is consistent , such that in the case of before / after comparisons the relation is obtained and in the case of left / right comparisons the analog relation is obtained . it should be noted that a change in the blood flow ( specified in ml / 100 g / min ) in the case of before / after comparisons or a different blood flow left / right in the case of left / right comparisons has no relevance , since the flow has already been eliminated in the course of the derivation of equation ( 1 ). equation ( 1 ) henceforth includes only the time - dependent contrast agent concentrations . taking into account that the concentration of the contrast agent is proportional to the mass of the contrast agent ( concentration = mass / volume ), and assuming that the volume segments being examined are present with at least approximately the same size ( both in before / after and in left / right comparisons ), the proportionality constants ( 1 / volume ) are omitted in the above formulae and the corresponding relative blood volumes can be expressed by means of the contrast agent masses . as already mentioned further above , the contrast agent masses are in turn proportional to the sums of the grayscale values of all pixels lying within the rois ( in each individual image of the sequence ). in the two previous formulae , therefore , the time integrals are placed over the roi - specific time / contrast curves in the numerator and in the denominator in each case . the general case of the calculation of the change in relative blood volume is explained in more detail with reference to fig3 to 6 . for the purpose of determining relative perfusion data according to the invention a perfusion measurement device 10 is provided in the system control unit 7 , as shown in fig1 . as output of the calculated perfusion data this also effects an insertion for example as a numeric value characteristic of the roi into the image on a display of the traffic - light monitor array 9 . fig3 shows a first time / contrast curve 13 i / t before the treatment and fig4 shows a second time / contrast curve 14 i / t after the treatment . the area auc ( area under the curve ) under the overall curves 13 and 14 is formed by the time integrals . their ratio expresses a change in relative blood volume . in order to calculate the change in relative blood volume the areas under the overall curves 13 and 14 can now be put into the ratio auc after / auc before . for simplicity the calculation of the integrals according to the examples explained with reference to fig3 and 4 can be dispensed with here and in each case the maximum of the associated time / contrast curve can be used instead , as is shown with reference to fig5 and 6 ( in this regard see also fig2 in konstas et al . “ theoretic basis and technical implementations of ct perfusion in acute ischemic stroke , part 1 : theoretic basis ”, ajnr am . j . neuroradiol . 30 , 2009 , pages 662 to 668 ). this simplification is based on the assumption that there are plateau - like maxima of the time / contrast curves at which a saturated state of the contrast agent concentration can be assumed . the advantage of this simplification consists in the fact that it is not necessary to integrate over a relatively long time period and therefore overlay effects caused by the contrast agent flow in draining veins , which could of course also be visible in the projection image , are avoided . however , this simplifying estimation of the relative blood volume requires a greater amount of contrast agent to be administered in order to achieve the stationary state , which is not always desirable or feasible . according to the invention the calculation can now be simplified in that , as shown in fig5 and 6 , the slopes 15 and the maxima 16 of the first simplified time / contrast curve before the treatment and the second simplified time / contrast curve after the treatment are assumed to be straight lines . the maximum intensity 17 i max , v before the treatment and the maximum intensity 18 i max , n after the treatment can then be ascertained in a simple manner . in order to calculate the simplified change in relative blood volume the two maximum intensities are now put into the ratio i max , after / i max , before . in the case of a tumor embolization the tumor can be characterized in the two dsa sequences ( pre - and post - treatment ( before / after )) by means of an roi in each case and then the ratio of the time integrals over the two time / contrast curves determined . according to the above consideration their quotient represents the ratio of the blood volumes before and after the intervention . ideally , no more contrast agent at all accumulates in the tumor after the embolization , thus yielding the ratio v after / v before ˜ 0 as result . as already mentioned , a suitable angulation must be chosen for an examination of said type to ensure that no large blood vessels run through the volume segment defined by means of the roi , since these would distort the result . the relative blood flow can be determined in a comparable way to the determining of the relative blood volume . in this case the so - called “ maximum slope method ” can be used , see equation ( 10 ) in konstas et al . in spite of simplifying assumptions this method is also employed in ct for the purpose of measuring the blood flow . this method provides a simple computing rule for determining the flow f which is assumed as constant over time : here , m ( t ) denotes the mass of contrast agent contained in the tissue volume under examination at the time instant t , and c artery ( t ) denotes the contrast agent concentration in the supplying artery at the time instant t . for the sake of simplicity it is assumed that no venous outflow takes place during the examination time period and that precisely one artery supplies the examined tissue volume . according to this relation the flow f can therefore be determined by dividing the maximum rise of the mass of contrast agent in the tissue by the maximum contrast agent concentration in the supplying artery . the general case of the calculation of the change in relative blood flow is explained in more detail with reference to fig7 and 8 . in this case fig7 shows a first time / contrast curve 19 before the treatment . a first maximum slope 20 is applied to the ascending branch of said first time / contrast curve 19 . fig8 shows a second time / contrast curve 21 after the treatment , to the ascending branch of which a second maximum slope 22 is applied . as also in the case of the determining of the relative blood volume from 2 - d angiography data , suitable rois should be defined in 2 - d at a suitable angulation of the c - arm , which rois then again characterize 3 - d volume segments that extend over the entire object depth . on the assumption that the arterial inflow left / right or before / after is the same , the relative blood flow can be approximated as follows in the case of left / right comparisons according to the formula this means that — owing to the direct proportionality of contrast agent mass and the attenuation along the x - ray beams — the quotients from the maximum slopes 20 and 22 of the time / contrast curves 19 and 21 must be formed in order to obtain the corresponding estimations of the relative blood flow . thus , as was already the case in the determining of the relative blood volumes , the “ trick ” consists in determining the relative flows ( left / right and / or after / before ), since then the proportionality constants , which are not known due to the absence of depth information , are omitted from the formation of the quotients . the simplified case of the calculation of the change in relative blood flow is explained in more detail below with reference to fig9 and 10 . instead of the maximum slopes 20 and 22 that were explained with reference to fig7 and 8 , alternative parameters for determining blood flow can also be chosen if a specific model of the time / contrast curves i / t is assumed for simplicity . in this simplified model it is assumed that a first time / contrast curve 23 rises linearly until saturation is reached , as revealed in fig9 and 10 . it is easy to show that the slope 24 of the first simplified time / contrast curve 23 in this rise phase is proportional to two other parameters . the first parameter is the intensity value i ′ v at a time instant t ′, which must chosen such that it lies before the maximum contrast is reached . the second parameter is the first integral 25 ( area under the curve ( auc )) of the first time / contrast curve 23 up to the time instant t ′. the same also applies to the after case shown in fig1 , in which a linear rise of a second simplified time / contrast curve 26 until saturation is reached is likewise assumed . here too it holds that the slope 27 of the second simplified time / contrast curve 26 in this rise phase is proportional to the intensity value i ′ n at the time instant t ′. the second integral 28 of the second simplified time / contrast curve 26 up to the time instant t ′ can also be drawn upon again here as the second parameter . since these two parameters are proportional to the maximum slope , they can likewise be used for calculating the relative flow by formation of the quotients of the values before and after a treatment ( or , of course , also referred to a left / right comparison ). the change in relative blood flow can therefore be calculated in a simplified manner as follows : where m is the maximum slope and auc is the area under the time / contrast curve i / t . it is important to bear in mind that this simplifying assumption of a linear rise together with the associated simplified estimation of the relative blood flow has nothing to do with the above - explained assumption of a stationary state which leads to a simplified estimation of the relative blood volume . the invention relates to an imaging method for calculating and deriving relative perfusion data , such as blood volume or blood flow for example , from 2 - d angiography data , for example 2 - d dsa sequences . to clarify : per se this perfusion data represents absolute values ( e . g . where ct perfusion is concerned ). in the case of a 2 - d image series this restriction to relative perfusion data must be applied , since no depth information at all is available . by waiving the requirement for absolute data and considering relative data by quotient formation it is possible to dispense with the depth information , which , of course , is not contained in the 2 - d image sequences . put more precisely , this dispenses with knowledge of the proportionality constant which relates the mass of the contrast agent along an x - ray beam to the concentration of the contrast agent along said x - ray beam .	0
all patents , patent applications , government publications , government regulations , and literature references cited in this specification are hereby incorporated herein by reference in their entirety . in case of conflict , the present description , including definitions , will control . thermotoga neapolitana xylose isomerase is described in u . s . pat . no . 7 , 198 , 933 to zeikus et al . hereby incorporated herein by reference in its entirety . thermotoga neapolitana xylose isomerase containing mutations v186t , l283p , and f187s is described in the &# 39 ; 933 patent . the strains thermotoga maritima dsm 3109 , the strains thermotoga elfii dsm 9442 and atcc 51869 , and the strains thermotoga neapolitana dsm 4359 and atcc 49049 are described in u . s . patent no . 5 , 935 , 837 to rasmussen hereby incorporated herein by reference in its entirety . rasmussen teaches thermotoga maritima xylose isomerase , useful for the electrochemical bioreactor system of the present invention . xylose isomerase also known as glucose isomerase is well known to those skilled in the art . the present invention provides a gene encoding thermostable mannitol dehydrogenase from thermotoga maritima and use of the enzyme in a bioreactor system to produce mannitol from glucose . the present invention replaces the current synthetic mannitol production process by the use of an enzyme catalyzed process . for this purpose , a thermostable mannitol dehydrogenase has been cloned and characterized which is used to produce mannitol from fructose or , from glucose in a bioelectrochemical reactor . used alone , this enzyme is able to produce mannitol from a fructose syrup . used in combination with a thermostable xylose isomerase ( glucose isomerase ), this enzyme would be able to produce mannitol directly from a glucose syrup . the t . maritima mannitol dehydrogenase gene was obtained by dna amplification using t . maritima ( msb8 ) genomic dna as the template and oligonucleotides 5 ′- cg catatg aaagtacttttgatag - 3 ′ ( where catatg creates an ndei site ) ( seq id no . 3 ) and 5 ′- ct ctcgag agaaaaaattcccttcatc - 3 ′ ( where ctcgag creates a xhol site ) ( seq id no . 4 ) as the primers . the pcr product has cloned into the ndel and xhol sites of pet24 ( a )+( novagen ) and transformed into escherichia coli bl21 ( de3 ) for protein expression . in this construct , the recombinant t . maritima mannitol dehydrogenase was expressed as a fusion protein with a c - terminal ( his ) 6 tag . the recombinant t . maritima mannitol dehydrogenase was routinely over expressed in e . coli by growing cultures in sb medium and inducing with iptg ( 0 . 6 mm ) when od 600 reaches 1 . 4 . expression was induced for sixteen ( 16 ) hours . after resuspension in 50 mm tris - hcl ph 8 . 5 containing 10 mm β - mercaptoethanol ( buffer a ), the bacteria were lysed using a french pressure cell , the crude extract was centrifuged for 40 min . at 25 , 000 × g , the supernatant was heat treated at 85 ° c . for 20 min . to denature most e . coli proteins , the heat - treated extract was centrifuged for 20 min . at 20 , 000 × g , and the supernatant was finally purified on a ni - nta affinity column . the recombinant t . maritima mannitol dehydrogenase expression and purification systems are currently acceptable for routine bench - top scale preparations , biochemical characterization , and testing in prototype bioelectrochemical reactors . activity levels on fructose as the substrate and with nadh as the cofactor can be increased by mutagenesis to make this enzyme even more performing for industrial mannitol production . in particular , the affinity for fructose relative to mannitol can be increased . since the three - dimensional structure of mannitol dehydrogenase is unknown , random mutagenesis can be used followed by screening for activity at room temperature to select for t . maritima mannitol dehydrogenase derivatives with increased activity levels . it is possible to convert 100 % fructose into 100 % mannitol using an immobilized enzyme system , as it is done today for fructose syrup ( 42 %) production in an immobilized glucose isomerase reactor . fructose is more expensive than glucose , though , and it is produced directly from glucose . since a large selection of thermostable glucose isomerases is available , one can also produce the mannitol dehydrogenase bioreactor . such a system with the robust thermostable mannitol dehydrogenase can be used with the pyrimidine nucleotide cofactor which can be easily recycled . by using electrochemical recycling , glucose can be converted stoichiometrically into mannitol in a single electrochemical reactor system at 60 ° c . containing both immobilized thermostable mannitol dehydrogenase ( mtdh ) and glucose isomerase . an nad - dependent thermostable mannitol dehydrogenase was cloned . t . maritima mannitol dehydrogenase is increasingly active up to 90 ° c . the enzyme shows four times higher affinity for nadh than for nadph . the optimum ph for fructose reduction is 6 . 0 and the optimum ph for mannitol oxidation is 8 . 3 . when co - immobilized on an electrochemical reactor &# 39 ; s electrode , this enzyme and a thermostable xylose isomerase are able to produce mannitol directly from glucose when the cofactor is recycled using electrons provided by an electrical current . while the present invention is described herein with reference to illustrated embodiments , it should be understood that the invention is not limited hereto . those having ordinary skill in the art and access to the teachings herein will recognize additional modifications and embodiments within the scope thereof . therefore , the present invention is limited only by the claims attached herein .	2
with reference to fig1 , a flat card , for example a tc 03 ( trademark ) flat card made by trützschler gmbh & amp ; co . kg of mönchengladbach , germany , has a feed roller 1 , feed table 2 , lickers - in 3 a , 3 b , 3 c , cylinder 4 , doffer 5 , stripper roller 6 , nip rollers 7 , 8 , web - guiding element 9 , web funnel 10 , draw - off rollers 11 , 12 , revolving card top 13 having card - top - deflecting rollers 13 a , 13 b and card top bars 14 , can 15 and can coiler 16 . curved arrows denote the directions of rotation of the rollers . reference letter m denotes the centre ( axis ) of the cylinder 4 . reference numeral 4 a denotes the clothing and reference numeral 4 b denotes the direction of rotation of the cylinder 4 . reference letter b denotes the direction of rotation of the revolving card top 13 at the carding location and reference letter c denotes the direction in which the card top bars 14 are moved on the reverse side . reference numerals 23 ′, 23 ″ denote stationary carding elements and reference numeral 39 denotes a cover underneath the cylinder 4 . arrow a denotes the work direction . referring to fig2 , on each side of the flat card , a flexible bend 17 having several adjustment screws is fixed laterally to the side screen 19 a , 19 b ( see fig4 ). the flexible bend 17 has a convex outer surface 17 a and an underside 17 b . on top of the flexible bend 17 there is a slideway 20 , for example made of low - friction plastics material , which has a convex outer surface 20 a and a concave inner surface 20 b . the concave inner surface 20 b rests on top of the convex outer surface 17 a and is able to slide thereon in the direction of arrows d , e . each card top bar 14 consists of a rear part 14 a and a carrying member 14 b . each card top bar 14 has , at each of its two ends , a card top head , each of which comprises two steel pins 14 1 , 14 2 . those portions of the steel pins 14 1 , 14 2 that extend out beyond the end faces of the carrying member 14 b slide on the convex outer surface 20 a of the slideway 20 in the direction of the arrow b . a clothing 18 is attached to the underside of the carrying member 14 b . reference numeral 21 denotes the circle of tips of the card top clothings 18 . the cylinder 4 has on its circumference a cylinder clothing 4 a , for example a sawtooth clothing . reference numeral 22 denotes the circle of the tips of the cylinder clothing 4 a . the spacing ( carding nip ) between the circle of tips 21 and the circle of tips 22 is denoted by reference letter a and is , for example , 3 / 1000 ″. the spacing between the convex outer surface 20 a and the circle of tips 22 is denoted by reference letter b . the spacing between the convex outer surface 20 a and the circle of tips 21 is denoted by reference letter c . the radius of the convex outer surface 20 a is denoted by reference letter r 1 and the radius of the circle of tips 22 is denoted by reference letter r 2 . the radii r 1 and r 2 intersect at the centre point m of the cylinder 4 . reference numeral 19 denotes the side screen . the high - speed roller shown in fig3 a , 3 b for a fibre - processing machine , for example a cylinder 4 of a flat card , consists of a hollow cylindrical roller body 30 and two roller ends 31 a , 31 b at the end faces . the roller ends 31 a , 31 b advantageously are made of metal , for example steel or aluminium . reference numeral 32 denotes a spoke , reference numeral 33 a hub and reference numeral 34 an end flange . the roller body 30 consists of an internal steel cylinder 35 and an external hardened cfrp sheath 36 . the cfrp sheath 36 has the shape of a thin - walled hollow cylinder . at operating temperature , in the biased state , compressive stresses are present in the circumferential direction in the wall region of the steel cylinder 35 and tensile stresses in the cylindrical cfrp sheath 36 . in use , because of the centrifugal force to which the steel cylinder 35 is subjected , the compressive stresses are reduced . the thermal expansion coefficient of the cylinder material is much greater than the thermal expansion coefficient of the carbon fibre reinforced plastics material in the direction of the reinforcement fibres ; for example , the thermal expansion coefficient α of steel is between 11 × 10 − 6 k − 1 and 17 × 10 − 6 k − 1 and that of cfrp in the fibre direction is about zero , especially between − 2 × 10 − 6 k − 1 and + 2 × 10 − 6 k − 1 . when subjected to heat in use , the internal diameter of the cfrp sheath 36 changes only very slightly , whereas the thermal expansion of the steel cylinder 35 is considerable . the thermal expansion of the cfrp - sheathed steel cylinder 35 is consequently less than the thermal expansion of a cylinder having an all - steel wall . the roller according to the invention , comprising a metal cylinder and a composite fibre sheath , especially a substantially circular cylindrical sheath , is lighter in comparison to an all - steel or all - aluminium roller , has a reduced mass inertia and exhibits linear thermal expansion which is adjustable ( down to negative values ) as a result of constructively arranged fibre orientation . the advantages of the roller according to the invention in use , which result from the properties of the material , are , for example , substantially improved braking values , savings in terms of drive units , energy savings , higher production rates , wider working widths and vibration - free running . the table that follows lists the density , modulus of elasticity and strength of the materials in comparison with one another : in the direction of the fibres , cfrp has considerable advantages compared to steel . the individual fibres made up into a tube in the course of a winding process determine the anisotropic ( directionally dependent ) behaviour of such a tube . fig4 shows part of the cylinder 4 together with the cylindrical surface 4 f of its wall 4 e and the cylinder ends 4 c , 4 d ( radial supporting elements ). the surface 4 f is provided with a clothing 4 a , which in this example is provided in the form of wire with sawteeth . the sawtooth wire is drawn onto the cylinder 4 , that is to say is wound around the cylinder 4 in tightly adjacent turns between side flanges ( not shown ), in order to form a cylindrical work surface provided with tips . fibres should be processed as evenly as possible on the work surface ( clothing ). the carding work is performed between the clothings 18 and 4 a located opposite one another and is substantially influenced by the position of one clothing with respect to the other and by the clothing spacing a between the tips of the teeth of the two clothings 18 and 4 a . the working width of the cylinder 4 is a determining factor for all other work elements of the flat card , especially for the revolving card tops 14 or stationary card tops 23 ′, 23 ″ ( fig1 ), which together with the cylinder 4 card the fibres evenly over the entire working width . in order to be able to perform even carding work over the entire working width , the settings of the work elements ( including those of additional elements ) must be maintained over that working width . the cylinder 4 itself can , however , be deformed as a result of the drawing - on of the clothing wire , as a result of centrifugal force or as a result of heat produced by the carding process . the shaft 25 of the cylinder 4 is mounted in positions ( not shown ) located on the stationary machine frame 24 a , 24 b . the diameter , for example 1250 mm , of the cylindrical surface 4 f , that is to say twice the radius r 3 , is an important dimension of the machine and becomes larger in use as a result of the heat of work . the side screens 19 a , 19 b are fastened to the two machine frames 24 a and 24 b , respectively . the flexible bends 17 a and 17 b are fastened to the side screens 19 a and 19 b , respectively . when heat is produced in use in the carding nip a between the clothings 18 ( or in the carding nip d between the clothings 23 ′) and the cylinder clothing 4 a as a result of carding work , especially in the case of a high production rate and / or the processing of synthetic fibres or of cotton / synthetic fibre blends , the cylinder wall 4 e undergoes expansion , that is to say the radius r 3 increases and the carding nip a decreases . the heat is directed via the cylinder wall 4 e into the radial carrying elements , the cylinder ends 4 c and 4 d . the cylinder ends 4 c , 4 d likewise undergo expansion as a result thereof , that is to say the radius increases . the cylinder 4 is almost entirely encased ( enclosed ) on all sides - in a radial direction by the elements 14 , 23 ′, 37 ( see fig1 and fig5 a ) and to the two sides of the flat card by the elements 17 a , 17 b , 19 a , 19 b , 24 a , 24 b . as a result , scarcely any heat is radiated from the cylinder 4 to the outside ( to the atmosphere ). nevertheless , the heat of the cylinder ends 4 c , 4 d of large surface area is especially conveyed by means of radiation to the side screens 19 a , 19 b of large surface area to a considerable extent , from where the heat is radiated out to the colder atmosphere . as a result of that radiation , the expansion of the side screens 19 a , 19 b is less than that of the cylinder ends 4 c , 4 d , which results in a reduction in the carding nip a ( fig2 a ) that ranges from undesirable ( in terms of the result of carding ) to hazardous . the carding elements ( card top bars 14 ) are mounted on the flexible bends 17 a , 17 b and the fixed carding - elements 23 ′, 23 ″ are mounted on the extension bends , which are in turn fixed to the side screens 19 a , 19 b . in the event of heating , for example in the case of a cylinder 4 of steel and aluminium card top bases 14 , the lifting of the flexible bends 17 a , 17 b - and , as a result , of the clothings 18 of the card top bars 14 - increases less , compared to the expansion of the radius r 3 of the cylinder wall 4 e - and , as a result , of the clothing 4 a of the cylinder 4 -, which results in narrowing of the carding nip a . the cylinder wall 4 e and the cylinder ends 4 c , 4 d are made of steel , for example st 37 , having a linear thermal expansion coefficient of 11 . 5 × 10 − 6 [ 1 /° k .]. in order then to compensate for the relative differences in the expansion of the cylinder ends 4 c , 4 d and the cylinder wall 4 e , on the one hand , and the side screens 19 a , 19 b , on the other hand ( as a result of impeded radiation into the atmosphere because of encasing of the cylinder 4 and free radiation into the atmosphere from the side screens ), the sheath 36 is made of carbon fibre reinforced plastics material ( cfrp ) whose thermal expansion coefficient has been negatively adjusted . by that means , the expansion of the cylinder 4 due to a lack of removal of heat as a result of encasing is reduced or avoided . as a result , undesirable reduction in the carding nip a due to thermal influences is avoided . the biasing method is shown in diagrammatic form in fig5 a , 5 b . the steel cylinder body 35 and the hardened cfrp sheath 36 are shown in these figures in simplified form as hollow cylinders . at room temperature , in accordance with fig5 a , the external diameter of the steel cylinder body 35 is larger than the internal diameter of the hardened cfrp sheath 36 . the excess dimension 37 is calculated on the basis of the desired biasing force in the steel cylinder body 35 and the joining gap 38 required for joining in accordance with fig5 b . from those two variables and the thermal expansion coefficients of the steel cylinder body 35 and the cfrp sheath 36 there is derived the temperature difference necessary for biasing . fig5 b shows the geometric relationships in the cooled state , which corresponds to the joining state . the joining gap 38 must be so dimensioned that the two parts 35 and 36 can be readily inserted one inside the other . the joining temperature is lower than room temperature . after joining , the two parts 35 and 36 are slowly reheated , whereupon the desired biasing takes place . fig3 a shows a roller at room temperature or operating temperature , which can be biased , for example , in accordance with fig5 a , 5 b . in accordance with fig6 , the pitches of the helical windings of the fibres ( 36 1 , see fig7 ) in the inner sheath 36 a and in the outer sheath 36 b are different . the pitch is shown in diagrammatic form by a winding angle of α 1 and α 2 ( see fig7 ). the winding angle of the inner sheath 36 a is small and is , for example , 85 °. the resistance of the cylinder 4 to radial widening under the action of heat and centrifugal force is dependent upon the arrangement of the fibres : the smaller the angle , the higher the resistance . the winding angle of the outer sheath 36 is large and is , for example , 10 °. the resistance of the cylinder 4 to sagging is likewise dependent on the arrangement of the fibres : the larger the angle , the lower the amount of sagging . the rollers of roller cards 51 and of roller card feeders 50 ( fig9 ) can have a length of 5 to 6 m , which requires a low degree of sagging . the combination of winding angles according to fig6 brings about a high degree of resistance both to widening and also to sagging . the affangement according to fig7 is advantageous when different properties are required for the roller in the edge regions , on the one hand , and in the middle region , on the other hand . the winding angle is accordingly steeper in the edge regions 36 ′ and 36 ′″ than in the middle region 36 ″. a single layer sheath having three regions arranged next to one another is shown . in accordance with fig8 , the fibre material ( arrow ) to be cleaned , which is especially cotton , is supplied in flock form to the cleaning apparatus arranged in an enclosed housing , for example a cl - c4 cleaning apparatus made by trützschler gmbh & amp ; co . kg . this is accomplished , for example , by a charging shaft ( not shown ), conveyor belt or the like . the material in wad form is supplied by two feed rollers 41 a , 41 b , with nipping therebetween , to a pin roller 42 , which is rotatably mounted in the housing and which revolves in an anti - clockwise direction ( arrow i ). downstream of the pin roller 42 is a clothed roller 43 , which is provided with a sawtooth clothing . the roller 42 has a circumferential speed of about 10 to 21 m / sec . the roller 43 has a circumferential speed of about 15 to 25 m / sec . the roller 44 has a circumferential speed greater than that of the roller 43 , and the roller 45 has a circumferential speed greater than that of the roller 44 . downstream of the roller 42 there is a succession of further sawtooth rollers 43 , 44 and 45 , the directions of rotation of which are indicated by reference numerals ii , iii and iv . the rollers 42 and 45 have a diameter of about from 150 to 300 mm . the rollers 42 to 45 are enclosed by the housing . associated with the sawtooth roller 45 are a stationary carding element , an adjustment guiding element , an air flow aperture , a separating blade and a pressure - measuring element . associated with the separating blade is a suction hood . reference letter a denotes the working direction of the cleaner . the rollers according to the invention comprising a metal cylinder 35 and a circular cylindrical sheath 36 surrounding the cylinder are used for at least one of rollers 42 to 45 . the cleaner can be constructed , for example , in accordance with de - a - 101 22 459 . in accordance with fig9 , a vertical reserve shaft 52 is provided upstream of a roller card 51 , which shaft is fed from the top with finely dispersed fibre material i . feeding can be accomplished , for example , by means of supply and distribution line 53 by way of a condenser . provided in the upper region of the reserve shaft 52 are air outlet apertures 54 , through which the transporting air ii passes into a venting device 55 after separation from the fibre flocks iii . the lower end of the reserve shaft 52 is closed by a feed roller 56 ( intake roller ), which co - operates with a feed trough 57 . the slow - speed feed roller 56 supplies the fibre material iii from the reserve shaft 52 to a high - speed opener roller 58 located below , which is provided with pins 58 b or sawtooth wire and is in communication at part of its circumference with a lower feed shaft 59 . the opener roller 58 , which revolves in the direction of arrow 58 a , conveys the fibre material iii that it picks up into the feed shaft 59 . the feed shaft 59 has , at its lower end , a take - off roller 60 , which revolves according to the arrow shown and which makes the fibre material available to the roller card 51 . this roller card feeder 50 can be , for example , a scanfeed tf 5000 roller card feeder from the company trützschler , mönchengladbach . the feed roller 56 rotates slowly in clockwise direction ( arrow 56 a ) and the opener roller 58 rotates at high speed in anti - clockwise direction ( arrow 58 b ) so that a contrary direction of rotation is brought about . by means of the revolving feed roller 56 and the revolving opener roller 58 , a specific amount of fibre material iii is continously conveyed per unit time into the feed shaft 59 and an equal amount of fibre material iv is conveyed out from the feed shaft 59 by the take - off roller 60 together with a feed trough 61 and is made available to the roller card 51 . the feed device of the roller card 51 , comprising the feed roller 60 and feed trough 61 , is the same as the take - off device 60 , 61 at the lower end of the feed shaft 59 . the feed roller 60 and the feed troughs 61 are followed in the work direction a of the roller card 51 by a first preliminary roller 62 , a second preliminary roller 63 , a preliminary cylinder 64 ( licker - in ), a transfer roller 65 , a main cylinder 66 , a doffer 67 and , as roller offtake , a stripper roller 68 . associated with the preliminary cylinder 64 ( licker - in ) and the main cylinder 66 are two and six , respectively , pairs of rollers , each pair consisting of a worker 71 and clearer 72 . downstream of the stripper roller 68 , immediately adjacent thereto and cooperating therewith , are two calendar rollers 73 , 74 . the directions of rotation of the rollers are indicated by curved arrows . the roller card 51 can , like the roller card feeder 50 arranged upstream thereof , have a width of , for example , 5 m or more . the rollers according to the invention comprising a metal cylinder 35 and a circular cylindrical sheath 36 surrounding the cylinder are used for at least one of rollers 56 and 58 of the roller card feeder 50 and rollers 60 to 74 of the roller card 51 . the flat card feeder 47 shown in fig1 substantially corresponds , in terms of construction and function , to the roller card feeder 50 according to fig9 . the flat card feeder 47 , like the flat card ( fig1 ), often has a width of 1 m to 1 . 5 m . the rollers according to the invention are used as rollers for at least one of the intake roller 48 and the high - speed opener roller 49 . the metal cylinder of the opener rollers 49 ( fig1 ) and 59 ( fig9 ) can be made of aluminium . although the foregoing invention has been described in detail by way of illustration and example for purposes of understanding , it will be obvious that changes and modifications may be practiced within the scope of the appended claims .	5
in the following description of various illustrative embodiments , reference is made to the accompanying drawings , which form a part hereof , and in which is shown , by way of illustration , various embodiments in which the invention may be practiced . it is to be understood that other embodiments may be utilized and structural and functional modifications may be made without departing from the scope of the present invention . fig1 illustrates a wind turbine 2 on a foundation 4 with a tower 6 supporting a nacelle 8 . one or more blades 10 are attached to a hub 12 via a bolt flange 14 . the hub 12 is connected to a drive train ( not shown ) within the nacelle 8 . the blades 10 may be variable length blades having a root portion 16 and a tip portion 18 . variable length blades may be configured to extend and retract given certain conditions . various modes for controlling a variable length blade may be used to optimize or otherwise increase the effectiveness of such blades and / or a turbine such as wind turbine 2 to which the blades are attached . fig2 illustrates a control mode for a wind turbine 200 having extendable rotor blades 205 that allow a turbine rotor to rotate without engaging drive train motors ( not shown ) and / or without any wind . to achieve such an effect , blades 205 a and 205 b on a first side of the rotor are extended while blade 205 c on a second side is retracted , thereby causing a slow rotation of the rotor . the first and second sides may be defined by an axis intersecting a center of the rotor . for example , in the configuration illustrated in fig2 , a vertical axis 210 is used to define a first side ( including blades 205 a and 205 b ) and a second side ( including blade 205 c ). other axes may be defined and used in controlling the extension and retraction of the rotor blades . although turbine 200 is illustrated as having a counter clockwise rotation , as indicated by arrow x , turbine 200 may also be configured to rotate clockwise . such a control mode may be useful in giving the appearance of an operating wind turbine when there is no wind . even more useful is using this rotation to clean the blades or to remove ice with minimal expenditure of energy and without requiring wind . rotation without wind can also lubricate and keep drive train components warm without using heaters or pumps . fig3 a and 3 b illustrate the clockwise rotation of extendable rotor blades 205 , between a first position and a second position . in the first position as illustrated in fig3 a , blade 205 a is oriented to the right side of the vertical axis 210 . in this position , the blade 205 a is extended and blades 205 b and 205 c are retracted . this causes a moment about the rotor axis 220 , due to the larger overhung weight of the extended blade 205 a , which imparts clockwise rotation to the rotor . in the second position , as illustrated in fig3 b , blade 205 a has rotated 180 degrees clockwise from the beginning position of fig3 a , and is now shown in a shortened length . the following blade 205 c is extended , continuing to impart a clockwise turning moment about the turbine axis 220 . in general , as blades 205 pass the vertical axis 210 , they are lengthened on the right side , and shortened on the left side of fig3 a and 3 b to create a clockwise rotation about the turbine axis 220 due to the differences in overhung weights of the blades 205 . fig3 c represents a position intermediate between the positions shown in fig3 a and 3 b . in this position it can be seen that blade 205 a has begun to be shortened , while the following blade 205 c , having passed the vertical axis 210 , is beginning to lengthen . this illustrates the concept that blades are moved between a shortest length , as depicted by blade 205 c in fig3 a , to a longest length , depicted by blade 205 c in fig3 b , passing through an intermediate length as depicted by blade 205 c in fig3 c . the maximum and minimum lengths are not necessarily defined as the maximum extendable length and the minimum retractable length , respectively . the maximum and minimum lengths may be defined as any length depending on various factors such as a speed of rotation desired , mass of a rotor blade 205 , the speed of extension and retraction of a rotor blade 205 , and the like . similar controls may be used for counterclockwise rotation of the rotor blades 205 . fig4 a and 4 b illustrate a cleaning method using an extension and retraction control mode as described above . fig4 a and 4 b illustrate an extendable portion 410 of blade 405 retracting into a root portion 415 of blade 405 . for example , during auto - rotation as described above , extendable portion 410 may be retracted as blade 405 is rotated . as extendable portion 410 is retracted , a cleaning element 425 of root portion 415 may scrape or dislodge debris 430 from the surface of extendable portion 410 , as shown in fig4 b . thus , if blade 405 has had ice accumulate while the blade 405 was extended , for example , this control mode may be employed to remove the undesired particles . cleaning element 425 may be inwardly biased ( i . e ., toward the extendable portion ) so that contact between cleaning element 425 and extendable portion 410 is maintained throughout retraction and extension . because blade 405 may be oriented downward ( i . e ., towards the ground ) during retraction , scraped or dislodged ice , bits of dirt or cleaning solution will fall away from the turbine ( i . e ., instead of falling on or toward the rotor , another blade or other portion of the turbine ). in this manner , water ice or debris does not sully or damage the exterior or interior surfaces of the turbine blades ( e . g ., blade 405 ). in one or more arrangements , the control mode may also be used with ice scrapers , ice melters , or cleaning brushes and solution mounted at the outward end of the root blade section to further enhance cleaning efficacy and efficiency . in addition to cleaning and providing self - rotation , various control modes may also be used to improve the performance of and reduce potential damage to turbines . for example , instead of or in addition to measuring power output and evaluating loads , other blade and turbine factors may be analyzed including turbulence , harmonic resonance , vibration , electrical current , market prices , wind speed , wind turbulence , mechanical attributes at the transition area between the inner and outer blades , and the like . the use of these additional or alternative control factors may increase turbine performance and reduce risks of damage . in one example , monitoring market prices and controlling extendable rotor blades based thereon may boost profits or minimize costs ( as described in detail below ). as discussed , measurements of turbulence can be used to control the length of a rotor blade . turbulence is generally defined by the formula i = a / u avg , where “ i ” corresponds to turbulence intensity , “ a ” corresponds to the standard deviation of wind speed variations about the mean wind speed and “ u avg ” corresponds to the mean wind speed , ( e . g ., taken over a 10 minute or one hour interval ). thus , analysis of wind data can produce a turbulence intensity value for various types of wind , which gives an indication of how variable the wind is , and how much gusts vary from the average wind speed . during highly turbulent conditions , it may be preferable to have a shorter blade than would otherwise be used to reduce risk of damage to the turbine . while power output ( or other control factors ) may be appropriate for controlling blade length under some conditions , peak loads on a wind turbine during high turbulence may significantly increase the likelihood of damage to the turbine regardless of the average power output . accordingly , a level of turbulence may be factored into the controls analysis to avoid such risks . conversely , if the wind is sufficiently steady ( e . g ., amount or magnitude of turbulence below a predefined level ) it may be possible to keep the blades a little longer to produce more power than would be prudent in less steady conditions . additionally or alternatively , control based on turbulence may also be applied to varying pitch in a variable pitch turbine or speed in a variable speed turbine , irrespective of whether the blades are of variable length . fig5 illustrates a wind turbine 501 having variable length rotor blades 505 , a turbine control system 510 and various sensors 515 such as wind speed sensor 515 a , torque sensor 515 b , rotor speed sensor 515 c , strain sensors 515 d , accelerometers 515 e and 515 f , sound meter 515 g , rotor position sensor 515 i and the like . in some instances , sensors may be located in a transition area 530 of a rotor blade 505 . alternatively or additionally , one or more sensors may be located in an extendable tip portion of rotor blades 505 . for example , in one configuration , all sensors may be placed in the extendable tip portions of rotor blades 505 . data from sensors 515 is sent to control system 510 so that control system 510 may determine appropriate operating characteristics for wind turbine 501 and adjust corresponding components in accordance therewith . for example , wind speed data from wind speed sensors 515 a may be used by control system 510 to determine an amount of turbulence turbine 510 is experiencing . based on the determined turbulence , the control system may adjust the turbine in various manners such as reducing blade length , pitching blades 505 , rotating the turbine 501 and / or combinations thereof to reduce the effects of turbulence or maximize power output . sensors may be connected to control system 510 and / or a power source ( not shown ) via wired , fiber optic , or wireless connections . another control factor of turbine and blade design is avoiding operation at frequencies that cause harmonic resonance with turbine components such as the rotor blades . variable speed turbines have an additional challenge in that varying rotor speeds represent another variable that can cause harmonic vibration . with a variable length blade the resonant frequency of that blade changes with length . this increases the challenge of designing the turbine such that the turbine or a component thereof does not experience harmonic resonance . accordingly , the length of rotor blades may be controlled to avoid harmonic resonance . this can be accomplished using accelerometers to measure vibration or with lookup tables based on a tested machine such that at specific rotational speeds , specific blade lengths are avoided . thus , in one example , the blade length may be extended or retracted upon detecting the turbine speed approaching or meeting a harmonic resonance frequency of a rotor blade at a current length . harmonic resonance occurs when an exciting force coincides in frequency with the natural vibrational frequency of an object . an example of harmonic resonance would be a rotor speed of 20 rpm ( 0 . 33 cycles / sec ) combined with a blade exhibiting an edgewise vibrational frequency of 1 . 33 vibrations / sec . since wind turbine blades exhibit little damping in edgewise vibrations , the blade will tend to have four vibrations for every rotation of the turbine rotor ( e . g ., 1 . 33 is four times 0 . 33 ). at this particular rotor speed , the blade vibration is excited once per revolution , which is once for every four cycles of the blade vibration . the excitation is simply the weight of the blade , which pushes on alternating sides of the blade as it rotates around the hub . since the excitation coincides with the natural frequency of the blade , blade vibrations can rapidly increase to dangerous levels . either changing the rotor speed or the length of the blades will change the frequency ratio to something different than 4 : 1 . if the ratio is not a whole number , the excitation forces will sometimes work in opposition to the natural frequency of the blade , and harmonic vibrations do not occur . since the vibrational modes of a blade can be calculated and verified by testing , it is possible to determine which combinations of speed and length are conducive to producing harmonic resonance . field tests can determine how much the system has to be changed from these harmonic conditions in order to prevent harmonic resonance . those factors can be used in look up tables that allow the controller to avoid dangerous combinations of length and rotor speed . referring again to fig5 , control system 510 may use accelerometer 515 e to measure vibrations in blades 505 or other components of turbine 501 . based on the measured vibrations , control system 510 may detect when harmonic resonance frequencies are being approached and make appropriate adjustments to avoid those frequencies . in one or more arrangements , turbine 501 or control system 510 may include memory that stores lookup tables or other data indicating operating characteristics that would produce harmonic resonance frequencies . the data may include rotational speeds , blade lengths or blade pitches . in one example , a lookup table may indicate that harmonic resonance frequencies would be reached / produced at rotor rotational speeds of 20 rpm and blade lengths of 75 ft . thus , control system 510 may use the lookup table instead of or in addition to using sensor data such as vibration measurements to provide control commands that would prevent the turbine from running at 20 rpm with a blade length of 75 feet to reduce potentially damaging harmonic vibrations . in some instances , as illustrated in fig5 , blades 505 of wind turbine 501 may need to be balanced with one another in order to avoid vibration due to poor balance . since the length of a variable length blade such as blades 505 may be modified at any time and in an individual manner , balancing may be conducted on - site using , for example , an accelerometer 515 f in the nacelle 503 or tower 500 to detect vibration . an accelerometer shows , by the sway of the tower 500 , which blade is heaviest : the heavier blade will ‘ pull ’ the tower 500 towards it during rotation . a shaft encoder , flags and inductive sensors , or other devices such as those used in robotics to create balance , can indicate which blade is in the position to have caused the sway . this blade would then be shortened , or the other blades lengthened until tower sway falls to an acceptable level . in one example , each of blades 505 would be lengthened or shortened slightly until balance was achieved . the process may be repeated for different degrees of extension such as fully retracted , half extended and full extension . once the relative positions of the tips for a balanced rotor are known , the lengths of rotor blades 505 at which balance is achieved may be stored in association with one another and / or with a predefined mode ( e . g ., full extension , half extension , etc .). subsequently , during normal operation of the turbine 501 control system 510 may adjust the length of each blade 505 based on the stored data . in this way , blades 505 do not need to be pre - matched and shipped in sets . instead , blades 505 can be interchanged among turbines without requiring replacement of the entire blade set , thereby making blade replacement simpler and less costly . other sensors that may be used for correcting imbalances may include strain gauges and vibration switches . another control technique for turbines such as turbine 501 is controlling for noise . in particular , turbine 501 may include a sound meter 515 g to detect a level of noise . noise controls may be used to avoid noise violations or complaints in more densely populated or residential areas . for example , during the daytime ( e . g ., between the hours of 9 am - 6 pm ), residents within the area might not be concerned with noise since many may be at work or performing other activities where noise is not an issue . at night , however , when residents may be sleeping or resting ( e . g ., watching television or listening to the radio ), noise may become a significant source of disruption . thus , at night , control system 510 may be used to reduce noise to tolerable levels while during the day , the noise level may be set higher . referring again to fig5 , based on the detected level of noise , control system 510 of turbine 501 may modify various components or characteristics of turbine 501 to adjust the level of noise to within acceptable levels . typical wind turbines have a tip speed of about 150 miles per hour . depending on blade 505 pitch , this speed can produce significant noise . either decreasing tip speed , or changing pitch can reduce noise levels . tip speed is reduced by slowing the rotor 525 or reducing the length of blades 505 . for example , a rotor 525 of turbine 501 can be controlled to adjust speed or blades 505 may be adjusted for pitch , both of which impact noise . additionally , control system 510 may adjust blade length to control the noise level since tip speed is directly related to noise and blade length is directly related to tip speed . for instance , on a constant speed turbine , tip speed increases linearly with blade length . accordingly , noise production may be used as an alternative or additional limiting factor for controlling blade length . instead of or in addition to detecting the level of noise using a sensor , control system 510 may include a database storing predefined noise data . for example , the database may identify certain conditions ( e . g ., blade lengths , vibrations , blade pitches , rotational speed , wind speeds , etc .) that correspond to particular levels of noise . thus , control system 510 may look up the conditions in the database to determine a corresponding level of noise , compare that level to a setpoint , and adjust turbine operations to reduce noise if the setpoint is exceeded . some wind projects have noise level limits as part of their operating permits . these noise level limits may vary over time , such as a requirement to run more quietly at night . controlling pitch , speed or blade 505 length , or any combination thereof , can allow turbines to operate over a wide range of wind speeds while complying with noise requirements . additionally or alternatively , while some current turbine control systems use power output as a control factor , it is also viable to use current as a control factor ( e . g ., for controlling the length of a variable length rotor blade , the pitch of a variable pitch turbine , the speed of a variable speed turbine , or any combination of length , pitch or speed .). because grid voltage does not tend to vary much in most locations , error associated with using current may be tolerable . further , it is current , not power , that determines heat loading of devices . accordingly , heat loading may be monitored and limited using current - based turbine controls . for example , in fig5 , control system 510 of turbine 501 may extend or retract rotor blades 505 , adjust rotor 525 speed , modify blade 505 pitch and the like based on current readings . using controls based on current instead of power output may eliminate the need for voltage transducers and signal processors to calculate power from voltage and current signals . such configurations may thus remove two sources of potential component failure . current may be measured using a variety of devices including current sense integrated circuits , multimeters , power supplies , current transformers , and the like . fig6 is a flowchart illustrating a method for adjusting blade or turbine characteristics based on various control factors . in step 600 , one or more attributes of a wind turbine ( e . g ., turbine 501 of fig5 ) may be determined by a turbine control system such as control system 510 ( fig5 ). the control system may determine attributes such as a level of turbulence , an electrical current , a noise level , vibrations , wind speed , wind turbulence , the presence of external commands from a central control system , and the like . in step 605 , the control system may compare each attribute to a corresponding attribute threshold to determine whether the attribute exceeds the threshold . for example , a level of turbulence may be compared with a turbulence threshold based on potential risk of damage to the turbine . in another example , a level of noise may be compared with predefined noise level thresholds ( e . g ., time - dependent noise levels ) to determine whether the noise is too high at that time . different thresholds may be defined for different operating characteristics such as different blade lengths , different pitches , different rotor rotational speeds , different central control system commands , and / or combinations thereof . continuing with fig6 , if the attribute exceeds the threshold , turbine and / or blade characteristics may be modified or otherwise adjusted to a predefined level or to a degree where the level of the attribute does not exceed the associated threshold in step 610 . the adjustments may include shortening or lengthening an extendable blade , pitching the blades , slowing rotation and the like . if , however , the attribute ( s ) do not exceed the threshold , turbine and / or blade characteristics may be maintained at a current setting in step 615 . alternatively or additionally , if the attributes are a predetermined level below the threshold , turbine and / or blade characteristics may be modified or otherwise adjusted to a degree where the level of the attributes approaches the threshold level , thereby increasing turbine productivity . from an economic perspective , energy sales prices may also be taken into consideration as an additional or alternative control factor . most wind turbine control points are set to ensure a long turbine life . however , it may be desirable at certain energy sales price points to sacrifice some of the turbine &# 39 ; s life for additional profit or income . a turbine controller could use energy sales price data as one of its inputs to either increase the turbine &# 39 ; s maximum power output , or more aggressively approach the ‘ knee ’ of its power curve or otherwise risk greater wear and tear in order to take advantage of high energy sales prices . in a turbine equipped with a variable length blade this would mean a control strategy where the blades are kept longer than they would be otherwise in order to produce additional energy with the option of increasing the maximum power output as well . in addition to blade length , pricing control strategies may also affect how blade pitch and turbine speed are controlled . one method of determining how much more load to apply to turbine components during periods of high energy prices would be to compare lifetime cost of operation to income . operating costs generally increase with increased loads , because increased loads directly affect component life . component life can be calculated using fatigue analysis , comparison with operational records , or other methods . as the result of a cost analysis such as this , a look up table can be created , which would allow a controller , such as control system 510 ( fig5 ), to use varying setpoints in response to varying sales prices of energy . this will generally result in operational setpoints that will vary at different times of the day , on different days of the week , and / or seasonally , based on utility rates . an example would be to reduce loads when energy sales prices are low since the small potential increase in income will not pay for additional maintenance due to increased loads . on the other hand , there may be energy sales prices that are so high that increased revenues will greatly exceed the projected cost of increased maintenance caused by pushing the turbine harder . this might occur for a few hours a day , when utilities pay dearly for power , such as at 6 pm on a summer weekday in a hot climate , when the workforce comes home , turns on the air conditioner and cooks dinner . this places a large demand on the power generation and transmission system , and the utility must find sources to meet that demand . during these periods of high energy sales prices , more aggressive setpoints may be instituted by the controller . according to another aspect , batteries are often an important part of wind turbine safety systems . for example , batteries may be used in some turbines to pitch the blades out of the wind if the power goes out . in a turbine using variable length blades , batteries may be used to pull the blades all the way into a retracted position in case of a power outage . in either case , it is important to have batteries with sufficient charge . thus , to insure that a battery has sufficient charge , a special battery test control mode may be used . in the battery test mode , a charger for the batteries is switched off and the pitching motors , blade retraction motors and / or other load is employed and the battery voltage is observed . if the battery fails to meet a set of requirements for voltage under a load of certain duration then a flag is set to notify wind farm operators that a new battery is needed . if the battery fails to meet a second set of criteria indicating that the turbine would be unsafe in the event of a power outage , ( i . e . : the batteries would be incapable of performing their function ), the turbine can be shut down . alternatively , battery voltage can be continuously monitored under normal operating loads , and these voltages can be compared to setpoints which indicate when a battery is becoming weak or non - functional , triggering associated alarms or turbine shutdowns . for example , a turbine or a portion thereof may be shutdown if the battery does not have sufficient charge . referring again to fig5 , an example of batteries that may be used in accordance with the above is illustrated . in particular , batteries 520 are located in the hub and may provide power to blade retraction / extension mechanisms , sensors , pitching mechanisms and the like . batteries 520 may be charged through another power source . as a fail safe or alternate mode , manual controls may be provided . manual controls may be used to adjust pitch or length of blades , rotor speed , or turbine direction among other characteristics in the event controllers or sensors fail or special circumstances call for different operating attributes . the inventions disclosed herein entail improvements to wind turbine controls and blade design , which may be applicable to a variable length blade turbine such as described in u . s . pat . no . 6 , 902 , 370 as well as to conventional wind turbine blades and other aerodynamic structures such as aircraft wings or helicopter blades . additionally , the methods and features recited herein may further be implemented through any number of computer readable mediums that are able to store computer readable instructions . examples of computer readable mediums that may be used include ram , rom , eeprom , flash memory or other memory technology , cd - rom , dvd or other optical disk storage , magnetic cassettes , magnetic tape , magnetic storage and the like . while illustrative systems and methods as described herein embodying various aspects of the present invention are shown , it will be understood by those skilled in the art , that the invention is not limited to these embodiments . modifications may be made by those skilled in the art , particularly in light of the foregoing teachings . for example , each of the elements of the aforementioned embodiments may be utilized alone or in combination or subcombination with elements of the other embodiments . it will also be appreciated and understood that modifications may be made without departing from the true spirit and scope of the present invention . the description is thus to be regarded as illustrative instead of restrictive on the present invention .	5
referring to the drawings in particular , the present invention pertains to a mounting technique for the side - by - side mounting of side doors ( 6 , 7 , 8 , 9 ) on a vehicle body ( 5 ). this pertains specifically to the mounting unit ( 1 ) provided herefor and , further , also to the 15 mounting process as well as the correct design of the vehicle parts , especially the vehicle body ( 5 ), the side doors ( 6 , 7 , 8 , 9 ) and the door hinges ( 34 ) for the mounting . in a schematic top view , fig1 shows a mounting unit ( 1 ) for vehicle bodies ( 5 ), which are fed on a conveyor ( 11 ) along a transfer line and are transported through a plurality of stations ( 2 , 3 , 4 ). the vehicle body ( 1 ) is a body shell of vehicles , which comprises at least side walls with cross connections via a roof part and / or an underbody . other body parts , such as crossrail for the rear shelf , the front wall and the rear wall of the body , etc ., may likewise be present . fig2 and 3 show schematic view of such a vehicle body ( 5 ). the vehicle body ( 5 ) is intended for an at least four - door vehicle , the side walls having on each side of the vehicle at least two door cutouts ( 30 , 31 ) for front and rear side doors ( 6 , 7 , 8 , 9 ). the embodiment being shown is that of usual limousine forms with two pairs of side doors on left and right . as an alternative , more than two side doors ( 6 , 7 , 8 , 9 ) may also be present on each side of the vehicle , which may be the case of , e . g ., stretch limos or other special vehicles . the subsequent description pertains to four - door vehicles and can correspondingly also be extrapolated to these special vehicles . the left and right side doors are mounted side by side and in pairs in the front and rear door cutouts ( 30 , 31 ) of the vehicle body ( 5 ), which cutouts are present on both sides , in two consecutive mounting stations ( 2 , 3 ). this is preferably the initial mounting , during which the side doors ( 6 , 7 , 8 , 9 ) are in the raw form and not yet fitted with all built - in parts . this initial mounting preferably takes place before the painting . after the general painting of the vehicle body ( 5 ) and the side doors ( 6 , 7 , 8 , 9 ), the side doors are again removed , and the door hinges ( 34 ), which will be described in more detail below , are separated , e . g ., by pulling out the hinge bolts from the joint ( 37 ). the side doors are subsequently fitted with added - on parts and finally mounted again , while the hinge halves are connected again via the inserted hinge bolts . the change in the weight of the finished side doors ( 6 , 7 , 8 , 9 ), which is due to the added - on parts mounted later , is taken into account at the time of the initial mounting , and it is also possible to take into account other changes of the doors at the time of the initial mounting as a precaution . in the variant of the mounting unit shown in fig1 , the two front and rear side doors ( 6 , 7 ) are mounted together on the left side of the vehicle , e . g ., in the first mounting station ( 2 ). the front and rear side doors ( 7 , 8 ) are mounted together on the right side of the vehicle in the next mounting station ( 3 ). the mounting stations ( 2 , 3 ) preferably join each other directly in the transfer line . the left / right sequence of mounting may be alternatively transposed . additional mounting operations , e . g ., the attachment of fenders , etc ., may take place in additional next stations ( 4 ). in a variant of the embodiment being shown , the two mounting stations ( 2 , 3 ) can be combined into a single mounting station , in which the front and rear side doors are mounted , one after another and again side by side , at first on one side and then on the other side of the vehicle . furthermore , it is possible to also mount other body parts , e . g ., the above - mentioned fenders , etc ., on the vehicle body ( 5 ) in the mounting station or mounting stations ( 2 , 3 ). according to fig1 , the making available and feeding of the front and rear side doors ( 6 , 7 , 8 , 9 ) and optionally also the preparation and especially the premounting of these side doors ( 6 , 7 , 8 , 9 ) can be performed on both sides of the transfer line . the prepared front and rear side doors ( 6 , 7 , 8 ) are brought together on the necessary side of the vehicle or the mounting side by means of a component feed ( 24 ) bridging over the transfer line . the side doors ( 6 , 7 , 8 , 9 ) are preferably fitted with door hinges ( 34 ) before the mounting on the vehicle body ( 5 ). this may be carried out in a premounting means ( 25 ), which may be arranged externally or within the mounting stations ( 2 , 3 ). the mounting of the hinges will be discussed in more detail later . a mounting means ( 12 ) is present in each mounting station ( 2 , 3 ) for the mounting of the side doors . this comprises a positioning means ( 13 ) each for guiding the side doors ( 6 , 7 , 8 , 9 ) and holding same in a correct position for mounting and a fixing means ( 19 ) for fixing the side doors ( 6 , 7 , 8 , 9 ) and especially the door hinges ( 34 ) on the vehicle body ( 5 ). the door hinges ( 34 ) are mounted now , e . g ., on the door pillars ( 27 , 28 , 29 ) and fixed . the vehicle body ( 5 ) has , on both sides , an a pillar ( 27 ), a middle b pillar ( 28 ) and a rear - side c pillar ( 29 ). the positioning means ( 13 ) and the fixing means ( 19 ) are arranged opposite each other at the transfer line and the vehicle body ( 5 ) in the embodiment being shown . the positioning means ( 13 ) holds the side door pairs ( 6 , 7 ) and ( 8 , 9 ) with a gripping tool ( 15 ) in a correctly fitting manner and in a correct position for mounting at the facing side of the vehicle body ( 5 ) and position them preferably in a centered and aligned position in the front and rear door cutouts ( 30 , 31 ). fixation is carried out preferably on the inner side of the vehicle and from the interior space ( 26 ) of the body . the fixing means ( 19 ) may be designed for this purpose with its one or more fixing tools ( 21 ) such that it can extend into the interior space ( 26 ) of the body and reach the door hinges ( 34 ) with its fixing tools . in the arrangement being shown , the fixing means ( 19 ) passes in the first mounting station ( 2 ) through the still open door cutouts ( 30 , 31 ) on its side and through the interior space ( 26 ) of the body . in the second mounting station ( 3 ), the fixing means ( 19 ), which is present there and is arranged on the other side of the vehicle , passes through the window cutouts of the side doors ( 6 , 7 ) already mounted on that side . the positioning means ( 13 ) comprises , e . g ., two positioning robots ( 14 ), which are preferably designed as multiaxial , especially six - axis articulated arm robots and have a multiaxial robot hand ( 23 ). the two positioning robots ( 14 ) arranged next to each other carry a gripping tool ( 15 ) each , which comprises a frame with controllable grippers arranged thereon corresponding to the geometry of the door . the positioning robots ( 14 ) can grip with their gripping tools ( 15 ) into the side doors ( 6 , 7 , 8 , 9 ) made ready in a predetermined position and move in a mutually coordinated manner . in a variant , not shown , it is possible to use an individual positioning robot ( 14 ) and a combination gripping tool , which can grip , with correspondingly designed gripping tools and with integrated additional axes , two front and rear side doors ( 6 , 7 ) and ( 8 , 9 ), respectively , together and move them relative to one another preferably multiaxially in a mutually coordinated manner . the positioning means ( 13 ) is equipped with a measuring and aligning device ( 17 ) for the correctly fitting positioning of the side doors ( 6 , 7 , 8 , 9 ). this comprises , e . g ., a plurality of sensors ( 18 ), which may be arranged in a flatly arranged pattern at the gripping tool ( 15 ). these may be , e . g ., sensors scanning edges and / or distance - measuring sensors , which operate in a contacting or contactless manner . for example , optical sensors , but also all other suitable sensor types described , e . g ., even imaging cameras , are possible . the sensors ( 18 ) are connected to a control , not shown , for analyzing the measurement results . the measuring and analysis device ( 17 ) is connected to the positioning robots ( 14 ) and the control thereof and makes possible the coordinated motion thereof for the correctly fitting mounting of the doors . optimized course of a gap and mutual optimized alignment of the front and rear side doors ( 6 , 7 ) and ( 7 , 8 ) can be achieved by means of this coordinated motion . in addition , the pairs of side doors can be aligned in an optimal manner in relation to the vehicle body ( 5 ) and especially the door cutouts ( 30 , 31 ). alignment in relation to design lines , e . g ., bent edges , at the side wall , is also possible now . in particular , efforts are made to optimize the gaps extending in the visible area on the top side as well as on the front side and the rear side of the side doors ( 6 , 7 , 8 , 9 ) in relation to the edges of the door cutouts ( 30 , 31 ) by the gaps being made of equal size and being kept as small as possible . the necessary tolerance compensation can take place on the underside of the door , where larger visible gaps are less conspicuous . flush positioning of the upper edges of the doors and the lower edges of the window cutouts ( 10 ) can also be taken into account during the mounting of the door . in particular , the side doors ( 6 , 7 , 8 , 9 ) can be centered in their door cutouts ( 30 , 31 ) and correspondingly displaced and aligned . transverse tilting of the side doors ( 6 , 7 , 8 , 9 ) by the correspondingly mobile positioning robot ( 14 ) may also take place to apply a possibly desired prestress to the door . in addition , an allowance may be taken into account at the time of the positioning of the door in order to preventively compensate the heavier weight of the door after the finishing of the door . possible changes in the shape of the side doors ( 6 , 7 , 8 , 9 ) as a consequence of the later outfitting with components can also be taken into account at the time of the initial mounting . on the one hand , the side doors ( 6 , 7 , 8 , 9 ) with their relevant parts and especially their contours can be measured in the outer outline and in the window cutout ( 10 ) with the sensors ( 18 ). for example , representative edges or other parts of the door are detected now and their actual position is measured . furthermore , the door cutouts ( 30 , 31 ) can be measured with the sensors ( 18 ) correspondingly in terms of their actual dimensions and their actual position in space . based on these measured values , the correctly fitting alignment of the door and centering can take place on the basis of these measured values . the positioning robots ( 14 ) hold with their gripping tools ( 15 ) the side door pairs ( 6 , 7 ) and ( 8 , 9 ), respectively , for fixation in a closed position that is correct for mounting in the door cutouts ( 30 , 31 ), and possible prestresses , allowances or the like can be taken into account in the above - mentioned manner . the gripping tools ( 15 ) may be supported for the subsequent fixation by mobile torque supports ( 16 ), e . g ., bottom - side support props extensible in a controlled manner , for relieving the robots and for absorbing the forces of reaction developing during the fixation . the actuation and positioning of the torque supports ( 16 ) takes place via the measuring and aligning device ( 17 ). as an alternative , the positioning robots ( 14 ) can perform controlled compensating motions to absorb the forces of reaction . the fixing means ( 19 ) comprises in the embodiment being shown two fixing robots ( 20 ), which are arranged next to each other on the other side of the vehicle opposite the positioning robots ( 14 ). the fixing robots ( 20 ) are likewise designed as multiaxial articulated arm robots with a robot hand ( 23 ) for the multiaxial guiding of the fixing tools ( 21 ) attached here . the fixing tools may be , e . g ., screwing tools or welding tools or the like . in a variant of the embodiment being shown , the fixing robots ( 24 ) may be arranged above the transfer line and designed , e . g ., as portal robots . the fixing robots ( 20 ) may also reach with their robot arms and the robot hand ( 23 ) into the interior space ( 26 ) of the body through the front - side and rear - side window cutout . in addition , it is also possible to arrange the fixing robots ( 20 ) provided with a corresponding range on the same side and next to the positioning robots ( 14 ), the access to the inner side of the vehicle being again granted via the front window and the rear window . the side doors ( 6 , 7 , 8 , 9 ) are positioned with premounted door hinges ( 34 ) aligned in a correct position for mounting and fixed during the mounting . the hinges are mounted here , e . g ., on the outer side ( 31 ) of the door pillars ( 27 , 28 , 29 ), the site of fixation in the interior space of the pillar being able to be reached via one or more passage openings ( 39 ) on the inner side ( 32 ) of the pillar . suitable fixing elements ( 38 ), e . g ., screws , can be introduced through these passage openings ( 39 ) with the fixing tools ( 21 ) or in another manner and activated . when fixing the hinges on the door pillar ( 27 , 28 , 29 ), any tolerances in the x and y directions can be compensated , as this is indicated , e . g ., in fig5 . for example , cage nuts , which are held biaxially movably in a sheet metal bracket at the door hinge ( 34 ) and are pulled and screwed into the correct screwing position with a centering pin , may be used as fixing elements for this . the fixing tool ( 21 ) may be designed for this purpose as a floating screwdriver . as an alternative , tolerance compensation can be brought about by means of the weld seam in case the door hinge ( 34 ) is welded . as is illustrated in fig5 and 6 , the door hinge ( 34 ) has a central joint ( 37 ) with the aforementioned hinge bolt and two hinge flanges ( 35 , 36 ), which are connected movably here . the hinge flanges ( 35 , 36 ) have a bent shape , and , e . g ., the door - side hinge flange ( 35 ) has a t - shaped cross section and has a flat flange plate with a connection web jutting out herefrom to the joint ( 37 ). the pillar - side hinge flange ( 36 ) is designed , e . g ., as a hinge plate bent in an l - shaped pattern in the cross section . for fixation to the door pillar ( 27 , 28 , 29 ) or another part of the door cutout ( 30 , 31 ), the pillar - side hinge flange ( 36 ) can be brought during premounting on the side door ( 6 , 7 , 8 , 9 ) into an angular position that is correct for mounting and temporarily fixed in a suitable manner . as is illustrated in fig5 and 6 , the hinge flanges ( 35 , 36 ) are essentially at right angles to one another in the closed position of the side doors ( 6 , 7 , 8 , 9 ). the side door ( 6 , 7 , 8 , 9 ) has a correspondingly shaped and sufficiently large door rabbet ( 40 ) for this . tolerances along the translatory x , y and z axes as well as optionally also along the rotatory axes are to be taken into account at the time of the mounting of the door . for example , the door - side hinge flange ( 35 ) has a flat design for the translatory tolerance compensation . the tolerance is compensated by elongated holes or the like in the y direction . these tolerances in the y direction can be determined during the premounting of the door hinge ( 14 ) and compensated at the time of the fastening of the hinge . the tolerances in the x and z directions are compensated in the above - mentioned manner by the fastening or fixation of the body - side hinge flange ( 36 ). for example , oversized holes can be used for this , e . g ., for a screw connection . by measuring the door during and after mounting , which is carried out , e . g ., with the measuring and aligning device ( 17 ) or in another manner , it can be determined whether the tolerances were compensated correctly and sufficiently during the mounting of the hinge . should there be , e . g ., any changes on the door pillar ( 27 , 28 , 29 ), which lead to a change in the mounting of the hinge in the y direction , this can be determined by calculation , evaluated , and compensated in the next doors in a preventive manner by a corresponding feedback and control of the premounting on the side door . statistical survey and analysis of the measurement results can be carried out for this in order to make it possible to detect possible trends in the changes in the shape of the vehicle body ( 5 ) in time and in a purposeful manner and compensate them correspondingly . various variants of the embodiments shown and described are possible . the door may be fixed , in case of a suitable design of the door , from the outside and without reaching into the interior space ( 26 ) of the body , and the cooperating positioning and fixing means ( 13 , 19 ) are arranged on the same side of the vehicle . all side doors ( 6 , 7 , 8 , 9 ) may also be mounted and fixed simultaneously . the inner fixation of the side doors ( 6 , 7 , 8 , 9 ) being claimed can also be carried out , on the other hand , with conventional mounting techniques and in case of individual mounting of the doors . thus , it has an independent inventive significance . furthermore , the design embodiment of the mounting means ( 12 ) and the components thereof , and , on the other hand , also the shape of the vehicle body ( 5 ) and parts thereof as well as of the door hinges ( 34 ) may be modified as well . the mounting unit ( 1 ) may otherwise have any desired and suitable design . while specific embodiments of the invention have been shown and described in detail to illustrate the application of the principles of the invention , it will be understood that the invention may be embodied otherwise without departing from such principles .	1
the following definitions and explanations provide background information pertaining to the technical field of the present invention , and are intended to facilitate the understanding of the present invention without limiting its scope : api : ( application program interface ) a language and message format used by an application program to communicate with the operating system or some other system or control program such as a database management system ( dbms ) or communications protocol . crawler : a program that automatically explores the world wide web by retrieving a document and recursively retrieving some or all the documents that are linked to it . gui ( graphical user interface ): a graphics - based user interface that incorporates icons , pull - down menus and a mouse . html ( hypertext markup language ): a standard language for attaching presentation and linking attributes to informational content within documents . during a document authoring stage , html “ tags ” are embedded within the informational content of the document . when the web document ( or “ html document ”) is subsequently transmitted by a web server to a web browser , the tags are interpreted by the browser and used to parse and display the document . in addition to specifying how the web browser is to display the document , html tags can be used to create hyperlinks to other web documents . http ( hypertext transport protocol ): the communications protocol used to connect to servers on the world wide web . its primary function is to establish a connection with a web server and transmit html pages to the client browser . internet : a collection of interconnected public and private computer networks that are linked together with routers by a set of standards protocols to form a global , distributed network . soap ( simple object access protocol ): a message - based protocol based on xml for accessing services on the web employing xml syntax to send text comma url ( uniform resource locator ): a unique address that fully specifies the location of a content object on the internet . the general format of a url is protocol :// server - address / path / filename . web browser : a software program that allows users to request and read hypertext documents . the browser gives some means of viewing the contents of web documents and of navigating from one document to another . web document or page : a collection of data available on the world wide web and identified by a url . in the simplest , most common case , a web page is a file written in html and stored on a web server . it is possible for the server to generate pages dynamically in response to a request from the user . a web page can be in any format that the browser or a helper application can display . the format is transmitted as part of the headers of the response as a mime type , e . g . “ text / html ”, “ image / gif ”. an html web page will typically refer to other web pages and internet resources by including hypertext links . web site : a database or other collection of inter - linked hypertext documents (“ web documents ” or “ web pages ”) and associated data entities , which is accessible via a computer network , and which forms part of a larger , distributed informational system such as the www . in general , a web site corresponds to a particular internet domain name , and includes the content of a particular organization . other types of web sites may include , for example , a hypertext database of a corporate “ intranet ” ( i . e ., an internal network which uses standard internet protocols ), or a site of a hypertext system that uses document retrieval protocols other than those of the www . world wide web ( www , also web ): an internet client — server hypertext distributed information retrieval system . xml : extensible markup language . a standard format used to describe semi - structured documents and data . during a document authoring stage , xml “ tags ” are embedded within the informational content of the document . when the xml document is subsequently transmitted between computer systems , the tags are used to parse and interpret the document by the receiving system . [ 0050 ] fig1 portrays an exemplary overall environment in which an automatic service interface creation system 10 and associated method for discovering and creating service descriptions according to the present invention may be used . system 10 includes a software programming code or computer program product that is typically embedded within , or installed on a host server 15 . alternatively , system 10 can be saved on a suitable storage medium such as a diskette , a cd , a hard drive , or like devices . while the system 10 will be described in connection with the www , the system 10 can be used with a stand - alone database of terms that may have been derived from the www and / or other sources . the cloud - like communication network 20 is comprised of communication lines and switches connecting computers such as servers 25 , 27 , to gateways such as gateway 30 . the servers 25 , 27 and the gateway 30 provide the communication access to the www or internet . users , such as remote internet users , are represented by a variety of computers such as computers 35 , 37 , 39 , and clients applications that can be incorporated on the network servers , such as server 27 , can query the host server 15 for desired information through the communication network 20 . computers 35 , 37 , 39 each include software that will allow the user to browse the internet and interface securely with the host server 15 . the host server 15 is connected to the network 20 via a communications link 42 such as a telephone , cable , or satellite link . the servers 25 , 27 can be connected via high - speed internet network lines 44 , 46 to other computers and gateways . the servers 25 , 27 provide access to stored information such as hypertext or web documents indicated generally at 50 , 55 , and 60 . the hypertext documents 50 , 55 , 60 most likely include embedded hypertext link to other locally stored pages , and hypertext links 70 , 72 , 74 , 76 to other webs sites or documents 55 , 60 that are stored by various web servers such as the server 27 the operation or use of system 10 comprises the following four phases that will be described later in more detail : the analysis phase , the publishing phase , the discovery and development phase , and the runtime phase . the web site analysis phase analyzes the web page of interest and generates a service description ( sd ) file for each form . the sd file contains all the information necessary for producing the ultimate output of the system : api description in the form of web services description language ( wsdl ) files , well - defined service ( wds ) files , and interface service deployment ( isd ) files . the analysis phase is illustrated in fig2 and by method 300 of fig3 . the analyzer 200 of system 10 is connected through a network 205 , such as the internet , to a crawler or toolkit 210 . the crawler 210 is one source of web pages 215 for the system 10 , and it can be any one of the many currently available crawlers . data extracted from the web pages 215 by the analyzer 200 are stored in the service database 220 . web pages 215 can also be accessed by a user toolkit 210 . the user toolkit 210 incorporates a graphical user interface ( gui ) through which the user instructs system 10 which pages or forms to analyze . one method for implementing the gui is to embed the toolkit 210 in a web browser . while the user is browsing the web sites , a panel next to the main viewing area provides buttons or links that allow the user to mark the current page or form for further analysis . pages or forms selected by the user are then transferred to the analyzer 200 . the user toolkit 210 also includes a data extraction feature that instructs a data extractor component how to extract data from pages returned to system 10 when the forms are submitted for analysis . with further reference to fig3 the crawler 210 sends a request in step 302 to the web site 215 , fetching via the internet or other network 205 one or more “ seed pages ” which are web sites 215 . these seed pages 215 contain hyperlinks , or urls . the urls are extracted and inserted into a url pool . the crawler 210 then iteratively fetches a url from the pool and fetches the corresponding document from the web site 215 in step 305 . for example , if the web page 215 is an html page , urls of the web site 215 are again extracted and inserted in the url pool . the crawler 210 is configured to crawl only to a certain “ depth ”; i . e ., it may only move a certain number of links away from the web pages 215 . the distance is measured in terms of the number of links followed , so if the depth is three , the crawler will not go farther than three links away from the web pages 215 . other parameters may control the speed and frequency with which web documents are accessed , and whether every link is followed or a filtering mechanism allows for only a subset of all possible links to be pursued . the crawler 210 passes each page 215 retrieved from the web to the page analyzer 200 in step 310 . the functions of the page analyzer 200 are shown in more detail in fig4 . the analyzer 200 is generally comprised of a page analyzer 405 , a service extractor 410 , an executable code generator 415 , and a standard service format producer 420 . the page analyzer 405 scans the code of a web page such as html page 425 and finds sections of that page that constitute a web form . one page may contain several forms . for example , a form is identified in html by a “& lt ; form & gt ;” tag and contains one or more data entry tags such as “& lt ; input & gt ;” and “& lt ; select & gt ;”. the service extractor 410 then translates these forms into service descriptions . the service extractor 410 analyzes a set of forms that originally resided on a single web page and prepares the data for subsequent output as a service description by the standard service format producer 420 . the service extractor 410 performs the following tasks : assigns a name to the service based on the title of the web page , the url , or an encoded value of either one . extracts the description ( metadata ) of the service from the & lt ; meta & gt ; tags of the web page . assigns a synthetic name to each form residing on the web page based on position number of the form . for example , form number 1 would be assigned the name “ method 1 ”. extracts the http access method used in each form ( get or post ). translates the name of each form variable ( variables listed in & lt ; input & gt ; and & lt ; select & gt ; tags ) into a variable name compatible with the executable code language . defines the data type of each form variable using the xml schema language . the service extractor packages the information it extracted into a service description ( sd ) file , and passes it on to the standard service format producer 420 and to the executable code generator 415 . the service description ( sd ) file is a composite file that contains all the information needed to invoke the web service . the service extractor 410 converts forms such as html page 425 into web services that can operate on a gateway ( or on the client or server computer ). the sd file comprises instructions for construction of the gateway . the sd file is typically written in xml . the executable code generator translates the sd file into an executable code 430 such as java that implements a soap interface wrapper . the executable code 430 is stored in the service database 220 . the standard service format producer 420 translates the sd file into standard web service format such as wsdl ( web services description language ), wds ( well defined service ) and isd ( invocation service description ). the wsdl , wds , and isd files are all stored in the service database 220 . the second phase of system 10 is the publishing phase , as illustrated by the high - level architecture of fig5 . the service publisher 505 gathers wsdl , wds , isd , and executable code files from the service database 220 and prepares them for deployment . the service publisher 505 first invokes an executable code compiler on each executable code file and gets executable code class files as a result . the service publisher 505 then deploys each service to a gateway at block 510 by uploading the executable code to the gateway , using the executable code class file and isd file . this process ( block 510 ) makes the web service available to the client . one method for adding web service files to the gateway at block 510 is by invoking the appropriate method in a soap service manager . the soap service manager “ hosts ” soap services on a gateway . it receives requests from a client application and invokes the appropriate executable code class file that implements the service . any existing soap service manager can be used . next , the service publisher 505 registers each service at a uddi ( universal description , discovery , and integration ) registry 515 by invoking the appropriate method in the uddi registry 515 and providing the wsdl and wds files as input . the uddi registry 515 is a registration service for web servers to advertise web services ; for system 10 , the uddi will list all services available in the soap service manager . a client application or programmer 520 can query the registry to find the soap addresses and other parameters of interesting services . any existing uddi registry can be used . the third phase of the operation of system 10 is the discovery and development phase . in phase 3 , the programmer 520 accesses the uddi registry 515 and develops client programs and applications that invoke the web server at the gateway in block 510 . in an alternative embodiment of system 10 , the latter can include the web service gateway code in the client &# 39 ; s software , thus obviating the need for the uddi registry 515 and the gateway at block 510 . the fourth phase of the operation of system 10 is the runtime phase , illustrated by the high - level architecture of fig6 . the client 605 accesses the web sites 610 through the gateway 615 via the network 620 . the client is comprised of an application code 625 developed by a programmer and a soap wrapper 630 created automatically from the wsdl file by standard software development tools . the client sends a request to the gateway , as shown by network link 635 . the gateway 615 then sends a request to web site 610 via network link 640 . the web site 610 returns to the gateway 615 a response to the request , as shown by network link 645 . the gateway 615 then transfers the response of web site 610 to the client 615 via link 650 . web sites such as web site 610 are designed for viewing by humans . the gateway 615 makes web sites such as web site 610 appear as a web service designed for program access . the client 605 never sees the original web site 610 form that is most likely written in html using the http protocol . the gateway 615 translates the human readable web site interface and presents to the client a machine readable interface most likely written in xml using the soap protocol . the runtime phase operation or method 700 is illustrated by the flowchart of fig7 a and 7b . the client 605 wishes to make a programmatic request of the web site 610 . this process is initiated when the application code 625 calls the wrapper function in step 705 . the soap wrapper 630 translates the host language structure , such as java , to soap . the request of the client 605 is transferred in step 710 to the gateway via network link 635 , using soap protocol . in step 715 , the gateway 615 translates the soap request to the format required by the web site 610 ; i . e ., http post . the gateway 615 submits the web form to the web site 610 in step 720 via network link 640 using , for example , http protocol . in step 725 , the web site 610 performs the action requested by the user in step 705 , i . e ., execute a database query . the web site 610 returns the response to the gateway 615 via the network link 645 in step 730 ; the data format for the response shown by network link 645 is typically html , using http protocol . in the preferred method of system 10 , the http response ( step 735 ) is translated by the gateway 615 to extract data in step 740 . the result of the data extraction is shown in step 745 as xml data . the xml data 745 is wrapped in a soap envelope by the gateway 615 in step 750 . the wrapped response is transmitted via network link 650 to the client 605 in step 755 . the protocol for network link 650 is soap with data format of xml . then , in step 760 the wrapped response to the original web site 550 request is received and translated to the host data structure ( e . g . java ) by the soap wrapper 630 . alternatively , the http response may not be translated to xml , but instead wrapped directly in a soap envelope as shown by optional path 765 . an alternative embodiment of the run - time phase of system 10 is shown in fig8 . in this embodiment , the functions of the gateway are included in the client 805 , allowing the client to directly communicate through the network 810 to the web site 815 . the client is comprised of an application code 820 developed by a programmer and an http wrapper 825 . the client sends a request to the web site 815 via network link 830 . the request is coded in html using http protocol . the web site 815 responds to the request in html using http protocol and transmits it back to the client via network link 835 . this format is recognized by the client 805 and translated as needed for the application code 820 . the runtime phase operation of the alternative embodiment is illustrated by the flowchart of fig9 . the client 805 wishes to make a programmatic request of the web site 815 . this process is initiated when the application code 820 calls the http wrapper function in step 905 . the wrapper function is generated by the executable code generator . the http wrapper 825 translates the host language structure , such as java , to http using the executable code that is stored in the service database . the request of the client 805 is submitted in step 910 to the web site 815 via network link 830 , using the http protocol . in step 915 , the web site 815 performs the action requested by the user in step 905 , i . e ., execute a database query . the web site 815 returns the response to the client 805 in step 920 ; the data format for the response shown by network link 835 is typically html , using http protocol . in a preferred method of system 10 , the http response ( step 925 ) is processed by the client 805 to extract data in step 930 . the result of the data extraction is shown in step 935 as xml data . in step 940 , the client application code 820 translates the xml data to the host language data structure such as java . alternatively , the http response is not translated to xml first , but is instead translated directly from http to the host language data structure in step 940 , as shown by optional link 945 . it is to be understood that the specific embodiments of the invention that have been described are merely illustrative of certain application of the principle of the present invention . numerous modifications may be made to the automatic service interface creation for web sites invention described herein without departing from the spirit and scope of the present invention . moreover , while the present invention is described for illustration purpose only in relation to the www , it should be clear that the invention is applicable as well to databases and other tables with indexed entries .	6
described below are various methods for synthesizing some of the polyorganofullerene derivatives via polynitrofullerenes or polycyclosulfated fullerenes described herein . polynitrofullerene derivatives , f --( no 2 ) n , which act as a reactive intermediate in this invention , can be prepared by one of the following methods : a ) a method for producing f --( no 2 ) n involve reacting fullerene , f , with nitrogen dioxide radicals , no 2 ., which are generated from sodium nitrite , nano 2 , and concentrated hno 3 . see chiang et al ., tetrahedron 1996 , 52 ( 14 ), 4963 . the structure of f --( no 2 ) n has been characterized to contain at least 4 nitro groups . b ) f --( no 2 ) n , wherein n is 4 , can also be prepared from reacting fullerene with dinitrogen tetraoxide , n 2 o 4 in carbon disulfide solution . see cataldo et al ., fullerene sci . & amp ; techno . 1997 , 5 ( 1 ), 257 . c ) yet another method for the preparation of f --( no 2 ) n can be done by reacting fullerene with nitrogen dioxide gas , which is generated from a mixture of nano 2 and feso 4 in aqueous h 2 so 4 . see sarkar et al ., j . chem . soc ., chem . commum . 1994 , 275 . d ) still another method for the preparation of f --( no 2 ) n can be done by reacting fullerene with fuming nitric acid . see hamwi et al ., fullerene sci . & amp ; techno . 1996 , 4 ( 5 ), 835 . polycyclosulfated fullerene derivatives , f --( so 4 ) n , which can also be employed as an effective intermediate in this invention , can be prepared by reacting fullerene and neat fuming sulfuric acid in the presence of an oxidant ( e . g ., p 2 o 5 , v 2 o 5 , or seo 2 ). the structure of the product has been characterized to consist at least 4 cyclosulfated units . polyorganofullerene derivatives , f --( e ) n , can be synthesized in general by reacting f --( no 2 ) n or f --( so 4 ) n with a nucleophilic agent , e -- h , ( e . g ., primary and secondary organoamino compound , alkoxide , organothiolate , organophenol compound , carbanion , organoamide anion , thiocarbamate ion , and the like ) in a non - reactive solvent , such as tetrahydrofuran . a base may be needed in some reactions ( see examples below ) to produce a nucleophilic anion of e -- h that is of enough strength to undergo the substitution reaction . some examples of such a base include 1 , 8 - diazabicyclo [ 5 . 4 . 0 ]- undec - 7 - ene ( dbu ), 1 , 5 - diazabiacyc [ 4 . 3 . 0 ] non - 5 - ene ( dbu ), and lithium diisopropyl - amine ( lda ). alternatively , f --( e ) n can be prepared by reacting f --( no 2 ) n or f --( so 4 ) n with a lithium salt of e -- h , which is generated by reacting e -- h with lithium triethylborohydride ( super - hydride ®) in tetrahydrofuran or other non - reactive solvents . examples of lithium salts of e -- h include , but are not limited to , lithium organoamino compounds , lithium organothiolate , lithium organophenol . a polyorganofullerene derivative from the reactions set forth above , f --( e ) n , can further react with a hydrolyzing agent to generate a polyhydroxyorganofullerene derivative , f --( e ) n ( oh ) m . for instance , sodium hydroxide is an effective hydrolyzing agent in this disclosure and tetrabutylammonium hydroxide can be used herein as a phase - transfer agent . note that the symbol , n , used in each term does not necessary have the same number as the same symbol used in another term in this disclosure . without further elaboration , it is believed that one skilled in the art can , based on the description herein , utilize the present invention to its fullest extent . the following specific examples are , therefore , to be construed as merely illustrative , and not limitative of the remainder of the disclosure in any way whatsoever . all publications recited herein , including patents , are hereby incorporated by reference in their entirety . a two - necked reaction flask a ( 50 ml ) was equipped with a vertical dropping funnel with a stopcock on one neck and a connecting gas bubbling tube on the other neck . the gas - bubbling tube was attached with a drying tube ( cacl 2 ) and inserted into the second two - necked reaction flask b . the other neck of flask b was attached with a bubbling tube which was extended into a trapping flask containing aqueous sodium hydroxide solution ( 2 n ). to minimize the back - flow of moisture from alkaline solution , a drying tube ( cacl 2 ) was installed in between the flask b and the trapping flask . a steady inert gas ( n 2 ) flow was allowed starting from the top of dropping funnel , through the reaction flasks a and b in sequence , into the alkaline solution in the trapping flask . the dropping funnel and the reaction flask a were charged with conc . hno 3 ( 10 ml ) and copper powder ( 10 g ), respectively . in the reaction flask b was placed a solution of [ 60 ] fullerene ( 500 mg ) in benzene ( 50 ml , dried over na ). the inert gas bubbling through the c 60 solution in the flask b was adjusted to a flow rate of 5 ml per min . the fullerene solution was deoxygenated for at least 5 min prior to the reaction . conc . hno 3 solution was then allowed to add dropwise into sodium nitrite solids in the flask a . brown fume was produced immediately upon the contact of conc . hno 3 with nano 2 . it was carried by the steady flow of n 2 and bubbled through the c 60 solution in the flask b . within 15 min of reaction , the purple solution of c 60 was changed to orange - red progressively . the mixture was stirred at ambient temperature for an additional 2 h to give a dark brown - red solution with suspended solids . at the end of reaction , excessive nitrogen dioxide ( no 2 ) was removed by n 2 bubbling and destroyed in the trapping solution . benzene was then evaporated from the product solution at a reduced pressure to give dark brown solids . the solids were suspended in anhydrous n - hexane , separated from n - hexane solution by the centrifuge technique and dried in vacuum at 40 ° c . to afford brown solids of polynitrofullerene derivatives , c 60 ( no 2 ) n ( n = 4 - 6 on average ) ( 650 mg ). irν max ( kbr ) 1572 [ s , ν as ( n -- o )], 1328 [ s , ν s ( n -- o )], 1085 , 1038 , 973 , 815 ( δ ) , 760 , 733 , 696 , 545 , and 466 cm - 1 . the product exhibits appreciable solubility in common organic solvents such as thf , dmf , ch 2 cl 2 , ch 3 oh and dmso . synthesis of polycyclosulfated fullerenes , c 60 ( so 4 ) n a reaction flask ( 50 ml ) charged with a fullerene mixture of c 60 ( 80 %) and c 70 ( 20 %) ( 1 . 0 g ), an oxidant , and fuming sulfuric acid ( 15 ml ) was stirred at 55 - 60 ° c . under n 2 for 5 min to 3 h to give a light brown solution with orange suspensions . the oxidant can be selected from either p 2 o 5 ( 6 . 0 g ), v 2 o 5 ( 150 mg ), or seo 2 ( 700 mg ). the resulting mixture was added dropwise into cold ice - water ( 200 ml ) to cause the precipitation of products . precipitates were separated from the aqueous solution by the centrifuge technique . they were then washed and centrifuged twice with cold ice - water and dried in vacuum at 40 ° c . to afford brown - orange solids of polycyclosulfated fullerenes , c 60 ( so 4 ) n , ( 1 . 4 g ) . the physical data of c 60 ( so 4 ) n are as follow : irν max ( kbr ) 2920 ( br ), 2400 ( br ), 1706 ( w ), 1654 ( w ), 1598 ( w ), 1427 ( s ), 1229 ( s ), 1168 , 1046 , 1002 ( s ), 981 , 953 ( s ), 855 , 826 ( s ), 783 , 641 , 530 , 485 ( w ), and 411 ( w ) cm - 1 ; 13 c nmr ( dmf - d 7 , peak center ) δ 148 . 0 , 77 . 0 , 71 . 0 ; 1 h nmr ( dmf - d 7 , peak center ) δ 14 . 6 ( w , oso 2 -- oh of a partially hydrolyzed product ). synthesis of polyaminofullerenes , c 60 ( nh 2 ) m -- method 1 a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 500 mg ) and tetrahydrofuran ( 40 ml ). the solution was slowly bubbled with a stream of nh 3 gas ( 5 ml per min ) at ambient temperature for 2 h with dry - ice / acetone filling in the cool - trap . at the end of reaction , the resulting solution was added methanol ( 60 ml ) to effect precipitation of brown solids . the solid precipitate was isolated by a centrifuge technique . it was then washed twice with methanol ( 20 ml each time ) and dried in vacuum at 40 ° c . to afford brown solid of the corresponding polyaminofullerene derivative c 60 ( nh 2 ) m ( m ≧ n ). increase of number of substituents is due to further nucleophilic additions of nh 3 on polyaminated fullerenes . the physical data of polyamino fullerenes are as follows : irν max ( kbr ) 3400 ( s , nh 2 ), 3246 ( s ), 1625 , 1556 , 1387 , 1347 , 1271 , 1058 , 742 , and 545 cm - 1 . synthesis of polyaminofullerenes , c 60 ( nh 2 ) m -- method 2 a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 500 mg ) and tetrahydrofuran ( 30 ml ). the solution was added nanh 2 ( 400 mg ) and stirred at ambient temperature for 3 h . at the end of reaction , the resulting solution was added methanol ( 60 ml ) to effect precipitation of brown solids . the solid precipitate was isolated by a centrifuge technique . it was then washed twice with methanol ( 20 ml each time ) and dried in vacuum at 40 ° c . to afford brown solid of the corresponding polyamino - fullerene derivatives , c 60 ( nh 2 ) m , ( m ≧ n ). increase of number of substituents is due to further nucleophilic additions of nh 3 on polyaminated fullerenes . the physical data of polyamino fullerenes are as follows : irν max ( kbr ) 3388 ( s , nh 2 ), 3269 ( s ), 1637 , 1557 , 1381 , 1346 , 1271 , 1060 , 669 , and 538 cm - 1 . a round - bottom reaction flask a ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and purged with n 2 . it was charged with c 60 ( no 2 ) n ( 500 mg ) and tetrahydrofuran ( 30 ml ). in a separated reaction flask b , benzamide ( 1 . 1 equiv . of halogen group in halogenated fullerene ) was allowed to react with sodium hydride ( 1 . 1 . equiv . of benzamide ) in tetrahydrofuran ( 20 ml , distilled over na ) at ambient temperatures to afford immediately the corresponding solution of sodium benzamide ( c 6 h 5 conhna ). the solution was added portionwise into the reaction flask a at 0 ° c . and the mixture was stirred further at that temperature for an additional 3 h . at the end of reaction , all solvents were removed from the resulting solution in vacuum to give brown solids . these solids were transferred into an aqueous solution of naoh ( 15 ml , 3 n ) and the mixture was stirred and heated at 90 ° c . for 16 h . it was cooled to ambient temperature and added methanol ( 60 ml ) to cause precipitation of dark brown solids . the solid precipitate was isolated by a centrifuge technique . it was then washed twice with methanol ( 20 ml each time ) and dried in vacuum at 40 ° c . to afford brown solids of the corresponding polyaminofullerene derivative , c 60 ( nh 2 ) n . synthesis of polyaminofullerenes , c 60 ( nh 2 ) m -- method 4 a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( so 4 ) n ( 500 mg ) and tetrahydrofuran ( 40 ml ). the solution was slowly bubbled with a stream of nh 3 gas ( 5 ml per min ) at ambient temperature for 2 h with dry - ice / acetone filling in the cool - trap . at the end of reaction , the resulting solution was added methanol ( 60 ml ) to effect precipitation of brown solids . the solid precipitate was isolated by the centrifuge technique . it was then washed twice with methanol ( 20 ml each time ) and dried in vacuum at 40 ° c . to afford brown solid of the corresponding polyamino fullerene derivative c 60 ( nh 2 ) m ( m ≧ n ). the physical data of polyamino fullerenes are as follows : irν max ( kbr ) 3400 ( s , nh 2 ), 3246 ( s ), 1625 , 1556 , 1387 , 1347 , 1271 , 1058 , 742 , and 545 cm - 1 . synthesis of poly ( diethanolamino ) fullerenes , c 60 [-- n ( ch 2 ch 2 oh ) 2 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 500 mg ) and acetone ( 30 ml ). the solution was added diethanolamine ( distilled , 900 mg ) in acetone ( 30 ml ) and stirred at ambient temperatures for 12 h . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with acetone and tetrahydrofuran . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( diethanolamino ) fullerenes ( 535 mg ). the physical data of poly ( diethanolamino ) fullerenes are as follows : irν max ( kbr ) 3374 ( s , oh ), 2933 ( c -- h ), 1650 , 1565 , 1453 , 1387 , 1268 , 1070 , 669 , and 538 cm - 1 . 1 h nmr ( 300 mhz , dmso - d 6 ) δ 3 . 0 ( triplet , ch 2 ), 3 . 32 ( oh ), 3 . 63 ( triplet , ch 2 ), and 4 . 56 . synthesis of poly ( diethanolamino ) fullerenes , c 60 [-- n ( ch 2 ch 2 oh ) 2 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( so 4 ) n ( 500 mg ) and tetrahydrofuran ( 30 ml ). the solution was added diethanolamine ( distilled , 900 mg ) in tetrahydrofuran ( 30 ml ) and stirred at ambient temperatures for 5 h . at the end of reaction , suspended solids in the solution were separated by the centrifuge technique and repeatedly washed with acetone . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( diethanolamino ) fullerenes ( 520 mg ). the physical data of poly ( diethanolamino ) fullerenes are as follows : irν max ( kbr ) 3374 ( s , oh ), 2933 ( c -- h ), 1650 , 1565 , 1453 , 1387 , 1268 , 1070 , 669 , and 538 cm - 1 . 1 h nmr ( 300 mhz , dmso - d 6 ) δ 3 . 0 ( triplet , ch 2 ), 3 . 32 ( oh ), 3 . 63 ( triplet , ch 2 ), and 4 . 56 . synthesis of poly ( hydroxyethoxyethylamino ) fullerenes , c 60 (-- nhch 2 ch 2 och 2 ch 2 oh ) n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 500 mg ) and tetrahydrofuran ( 30 ml ). the solution was added tris ( hydroxymethyl )- methylamine ( 900 mg ) in tetrahydrofuran ( 30 ml ) and stirred at ambient temperatures for 16 h . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with tetra - hydrofuran and acetone . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( hydroxy - ethoxyethylamino ) fullerenes ( 490 mg ). the physical data of poly ( hydroxyethoxyethylamino ) fullerenes are as follows : irν max ( kbr ) 3381 ( s , oh ), 2933 ( c -- h ), 2868 ( c -- h ), 1644 , 1565 , 1453 , 1354 , 1242 , 1117 ( s ), 1065 ( s ), and 531 cm 1 . 1 h nmr ( 300 mhz , dmso - d 6 ) δ 2 . 9 ( m , ch 2 ), 3 . 32 ( oh ), and 3 . 62 ( m , ch 2 ) synthesis of poly [ tris ( hydroxymethyl ) methylamino ] fullerenes , c 60 [-- nhc --( ch 2 oh ) 3 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 500 mg ) and tetrahydrofuran ( 30 ml ). the solution was added tris ( hydroxymethyl ) methylamine ( 900 mg ) in tetrahydrofuran ( 30 ml ) and stirred at ambient temperatures for 24 h . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with tetrahydrofuran and acetone . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly [ tris ( hydroxymethyl ) methylamino ] fullerenes ( 570 mg ), which is soluble in dimethylformamide . the physical data of poly [ tris ( hydroxymethyl ) methylamino ] fullerenes are as follows : irν max ( kbr ) 3400 ( s , oh ), 2935 ( c -- h ), 2870 ( c -- h ), 1640 , 1565 , 1454 , 1354 , 1067 ( s ), and 582 cm - 1 . 1 h nmr ( 200 mhz , dmso - d 6 ) δ 2 . 91 ( ch 2 o ) and 3 . 75 ( oh ). synthesis of poly ( disuccinyloxyethylamino ) fullerenes , c 60 [-- n ( ch 2 ch 2 ococh 2 ch 2 co 2 h ) 2 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with succinic anhydride ( 250 mg ), p - toluenesulfonic acid ( 5 mg ), and benzene ( 25 ml ). the mixture was added poly ( diethanolamino ) fullerenes , c 60 [-- n ( ch 2 ch 2 oh ) 2 ] n , ( 200 mg ) and stirred at 75 ° c . for 2 h . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with hot benzene . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( disuccinyloxyethyl - amino ) fullerenes , c 60 [-- n ( ch 2 ch 2 ococh 2 ch 2 co 2 h ) 2 ] n ( 210 mg ). the physical data of poly ( disuccinyloxyethylamino ) fullerenes are as follows : irν max ( kbr ) 3420 ( s ), 2933 ( c -- h ), 2644 , 2545 ( co 2 h ), 1729 ( s , c ═ o ), 1637 , 1413 , 1308 ,, 1209 , 1170 , 1078 , 1012 , 913 , 801 , 689 , 637 , and 564 cm - 1 . synthesis of poly ( p - methylphenylamino ) fullerenes , c 60 [-- nhc 6 h 5 ch 3 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 400 mg ) and tetrahydrofuran ( 30 ml ). the solution was added 4 - methylaniline ( 500 mg ) in tetrahydrofuran ( 10 ml ) and treated under sonication conditions for 25 min at ambient temperatures . at the end of reaction , all solvents in the solution were removed via vaccuo . the resulting semi - solids were redissolved in benzene , precipitated from hexane , and washed with hexane . these brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( p - methylphenylamino ) fullerenes , c 60 [-- nhc 6 h 5 ch 3 ] n , ( 450 mg ), which is soluble in benzene . the physical data of poly ( p - methylphenylamino ) fullerenes are as follows : irν max ( kbr ) 3347 , 3381 ( s ), 3039 ( c -- h ), 1604 ( s ), 1565 , 1499 ( s ), 1380 , 1341 , 1308 , 1249 , 1117 , 1058 , 1031 , 755 ( s ), 696 ( s ), and 505 cm - 1 . synthesis of poly ( n - phenyl - 1 , 4 - phenylenediamino ) fullerenes , c 60 [-- nhc 6 h 4 nhc 6 h 5 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 400 mg ) and tetrahydrofuran ( 30 ml ). the solution was added n - phenyl - 1 , 4 - phenylenediamine ( 500 mg , nh 2 c 6 h 4 nhc 6 h 5 ) in tetrahydrofuran ( 10 ml ) and treated under sonication conditions for 25 min at ambient temperatures . at the end of reaction , the resulting precipitates were separated by filtration and washed repeatedly with methylene chloride . the solids were redissolved in dimethylformamide , precipitated from a mixture of acetone and hexane , and washed with acetone . the light green solids were then dried in vacuum at 40 ° c . to afford the corresponding poly ( n - phenyl - 1 , 4 - phenylenediamino ) fullerenes , c 60 [-- nhc 6 h 4 nhc 6 h 5 ] n , ( 380 mg ). the physical data of poly ( n - phenyl - 1 , 4 - phenylenediamino ) fullerenes are as follows : irν max ( kbr ) 3394 ( n -- h ), 3045 , 2914 , 1598 , 1571 ( s ), 1512 ( s ), 1495 ( s ), 1453 ( w ), 1328 ( s ), 1249 ( w ), 1170 , 1117 , 1071 , 808 , 748 , 689 , and 498 cm - 1 . synthesis of poly ( phenylamino ) fullerenes , c 60 [-- nhc 6 h 5 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n or c 60 ( so 4 ) n ( 400 mg ) and tetrahydrofuran ( 30 ml ). the solution was added aniline or lithium aluminum anilinide ( lial ( hn -- c 6 h 5 ) 4 ) ( 500 mg ) in tetrahydrofuran ( 10 ml ) and treated under sonication conditions for 25 min at ambient temperatures . at the end of reaction , all solvents in the solution were removed via vaccuo . the resulting semi - solids were redissolved in benzene , precipitated from hexane , and washed with hexane . these brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( phenylamino ) fullerenes , c 60 [-- nhc 6 h 5 ] n , ( 445 mg ), which is soluble in benzene . the physical data of poly ( phenylamino ) fullerenes are as follows : irν max ( kbr ) 3447 , 3381 , 3039 , 1604 ( s ), 1565 , 1499 ( s ), 1380 , 1341 , 1308 , 1249 , 1117 , 1058 , 1032 , 894 , 755 ( s ), 696 ( s ), 545 , and 505 cm - 1 . synthesis of poly [ n , n &# 39 ;- bis ( 4 &# 39 ;- aminophenyl )- 1 , 4 - quinonenediimino ] fullerenes , c 60 [-- nh -- c 6 h 4 -- n ═ c 6 h 4 ═ n -- c 6 h 4 -- nh 2 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 400 mg ) and tetrahydrofuran ( 30 ml ). the solution was added n , n &# 39 ;- bis ( 4 &# 39 ;- aminophenyl )- 1 , 4 - quinonenediimine ( 500 mg , nh 2 -- c 6 h 4 -- n ═ c 6 h 4 ═ n -- c 6 h 4 -- nh 2 ) in tetrahydrofuran ( 10 ml ) with or without 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 500 mg ) and treated under sonication conditions for 25 min at ambient temperatures . at the end of reaction , the resulting precipitates were separated by filtration and washed repeatedly with methylene chloride . the solids were redissolved in dimethylformamide , precipitated from a mixture of acetone and hexane , and washed with acetone . the dark green solids were then dried in vacuum at 40 ° c . to afford the corresponding poly [ n , n &# 39 ;- bis ( 4 &# 39 ;- aminophenyl )- 1 , 4 - quinonene - diimino ] fullerenes , c 60 [-- nh -- c 6 h 4 -- n ═ c 6 h 4 ═ n -- c 6 h 4 -- nh 2 ] n , ( 380 mg ). the physical data of poly [ n , n &# 39 ;- bis ( 4 &# 39 ;- aminophenyl )- 1 , 4 - quinonenediimino ] fullerenes are as follows : irν max ( kbr ) 3434 , 2927 ( c -- h ), 2872 , 1604 ( s ) 1591 ( s ), 1501 ( s ), 1341 ( s ), 1150 ( s ), 1047 , 834 , 732 , 552 , and 464 cm - 1 . synthesis of 4 - aminobenzylphosphonic acid derivatives of c 60 , c 60 [-- nhc 6 h 4 ch 2 p (═ o ) ( oh ) 3 ] n a round - bottom reaction flask ( 25 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) ( 100 mg ) and tetrahydrofuran ( 15 ml ). the solution was added 4 - aminobenzylphosphonic acid ( 150 mg ) in tetrahydrofuran ( 5 ml ) and treated under sonication conditions for 30 min at ambient temperatures . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with tetrahydrofuran and acetone . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding 4 - aminobenzylphosphonic acid derivatives of c 60 , c 60 [-- nhc 6 h 4 ch 2 p (═ o ) ( oh ) 3 ] n , ( 95 mg ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 400 mg ). synthesis of amino acid derivatives of c 60 , poly ( l - tyrosinated ) fullerenes , c 60 [-- oc 6 h 4 ch 2 ch ( nh 2 ) co 2 h ] n to a solution of c 60 ( no 2 ) n ( 300 mg ) in tetrahydrofuran ( 50 ml ) in a round - bottom reaction flask was added l - tyrosine ( 500 mg , finely divided ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 600 mg ). the mixture was stirred at 45 ° c . for a period of 16 h to give a dark reddish brown solid suspended solution . the suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with tetrahydrofuran , dimethylformamide , and acetone in sequence . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( l - tyrosinated ) fullerenes , c 60 [-- oc 6 h 4 ch 2 ch ( nh 2 ) co 2 h ] n , ( 410 mg ). the physical data of poly ( l - tyrosinated ) fullerenes are as follows : irν max ( kbr ) 3415 ( s ), 3200 , 2900 ( c -- h ), 2580 ( br , co 2 h ), 1592 ( s ), 1580 , 1557 , 1473 , 1400 , 1384 , 1326 , 1300 , 1202 , 1070 ( br , s ), 814 , 785 , 703 , 635 , 587 , and 514 cm - 1 . synthesis of 2 - hydroxymethylphenol derivatives of c 60 , c 60 [-- oc 6 h 4 ch 2 oh ] n to a solution of c 60 ( so 4 ) n ( 300 mg ) in tetrahydrofuran ( 50 ml ) in a round - bottom reaction flask was added 2 - hydroxymethylphenol ( 1 . 0 g ) with or without 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 400 mg ). the mixture was stirred at 50 ° c . for a period of 1 . 5 h to give a dark reddish brown solid suspended solution . the suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with water . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding 2 - hydroxymethylphenol derivatives of fullerene , c 60 [-- oc 6 h 4 ch 2 oh ] n , ( 410 mg ). the products are soluble in tetrahydrofuran . the physical data of 2 - hydroxymethylphenol derivatives of fullerene are as follows : irν max ( kbr ) 3375 ( s , broad ), 2928 ( c -- h ), 1649 , 1611 , 1593 , 1500 , 1455 , 1382 , 1228 , 1057 ( s ), 843 , 753 , and 526 cm - 1 . synthesis of poly ( 2 , 3 - dihydroxypropylmercapto ) fullerenes , c 60 (-- sch 2 ch ( oh ) ch 2 oh ) n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 350 mg ) and tetrahydrofuran ( 20 ml ). the solution was added 2 , 3 - dihydroxypropylthiol ( 500 mg ), 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 500 mg ), and triethylamine ( 1 g ) in methylene chloride ( 20 ml ) and stirred at 60 ° c . for 10 h . at the end of reaction , all solvents in the solution were removed via vaccuo to obtain gummy products . the resulting semi - solids were suspended in ethylacetate to yield brown solids , which were washed with ethylacetate . these brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( 2 , 3 - dihydroxypropylmercapto ) fullerenes , c 60 (-- sch 2 ch ( oh ) ch 2 oh ) n , ( 315 mg ). the physical data of poly ( 2 , 3 - dihydroxy - propylmercapto ) fullerenes are as follows : irν max ( kbr ) 3400 ( s , oh ), 2920 ( c -- h ), 2868 ( c -- h ), 1621 , 1400 , 1157 , 1046 , 1025 , 652 , 574 , and 511 cm - 1 . synthesis of mercaptosuccinic acid derivatives of fullerenes , c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( no 2 ) n ( 400 mg ), triethylamine ( 1 g ), and tetrahydrofuran ( 25 ml ). the solution was added 2 - mercaptosuccinic acid ( 550 mg ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 600 mg ) in tetrahydrofuran ( 25 ml ) and stirred at 60 ° for 10 h . at the end of reaction , suspended solids in the solution were separated by a centrifuge technique and repeatedly washed with tetrahydrofuran . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding mercaptosuccinic acid derivatives of fullerenes , c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n , ( 405 mg ). the physical data of these compounds are as follows : irν max ( kbr ) 3425 ( s , oh ), 2910 ( c -- h ), 2608 - 2534 ( co 2 h ), 1700 ( s ), 1623 , 1544 , 1392 , 1388 , 1307 , 1263 , 1202 , 1173 , 1056 , and 525 cm - 1 . synthesis of mercaptosuccinic acid derivatives of fullerenes , c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with c 60 ( so 4 ) n ( 400 mg ) and tetrahydrofuran ( 25 ml ). the solution was added 2 - mercaptosuccinic acid ( 550 mg ) in tetrahydrofuran ( 25 ml ) and 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( dbu , 600 mg ) and stirred at 50 ° c . for 1 . 0 h . at the end of reaction , diethylether ( 30 ml ) was added to effect precipitation of solids which were separated by a centrifuge technique and repeatedly washed with a mixture of tetrahydrofuran and diethylether . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding mercaptosuccinic acid derivatives of fullerenes , c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n , ( 415 mg ) . the physical data of these compounds are as follows : irν max ( kbr ) 3425 ( s , oh ), 2910 ( c -- h ), 2608 - 2534 ( co 2 h ), 1700 ( s ) 1623 , 1544 , 1392 , 1388 , 1307 , 1263 , 1202 , 1173 , 1056 , and 525 cm - 1 . synthesis of poly ( hexylmercapto ) fullerenes , c 60 [-- sch 2 ch 2 ch 2 ch 2 ch 2 ch 3 ] n a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with sodium ( 100 mg ) and tetrahydrofuran ( 25 ml ). the mixture was added hexanethiol ( 420 mg ) and stirred for 1 h to afford a sodium hexylthiolate solution . the solution was then added c 60 ( no 2 ) n ( 400 mg ) in tetrahydrofuran ( 25 ml ) and stirred at ambient temperatures for an additional 2 h . at the end of reaction , all solvents in the solution were removed via vaccuo to obtain brown solid products , which were washed twice with water and acetone . the resulting brown solids were dried in vacuum at 40 ° c . to afford the corresponding poly ( hexylmercapto ) fullerenes , c 60 [-- sch 2 ch 2 ch 2 ch 2 ch 2 ch 3 ] n , ( 465 mg ). the physical data of these compounds are as follows : irν max ( kbr ) 2953 ( c -- h ), 2921 ( c -- h ), 2848 ( c -- h ), 1644 , 1459 , 1428 , 1384 , 1183 , 1045 , 793 , 729 , 577 , and 526 cm - 1 . synthesis of poly ( acetylacetonato ) fullerenes , c 60 [-- ch ( coch 3 ) 2 ] m a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with 2 , 4 - pentanedione ( 350 mg ) and tetrahydrofuran ( 20 ml ). the mixture was added lithium diisopropylamine in tetrahydrofuran ( 1 . 1 equiv of 2 , 4 - pentanedione ) and stirred for 1 h to afford the corresponding lithium acetylacetonate . the solution was then added c 60 ( no 2 ) n ( 400 mg ) in tetrahydrofuran ( 25 ml ) and stirred at ambient temperatures for an additional 2 h . at the end of reaction , the mixture was quenched with h 2 o to give precipitation of products , which were separated from the mother liquor by centrifuge . the solids were washed with diethylether ( 30 ml ), twice with benzene ( 20 ml each time ), twice with acetone ( 20 ml each time ), and dried in vacuum at 40 ° c . to afford brown solids of the corresponding poly ( acetyl - acetonato ) fullerenes ( 380 mg ), c 60 [-- ch ( coch 3 ) 2 ] m , where m ≧ n . the physical data of poly ( acetylacetonato ) fullerenes are as follows : irν max ( kbr ) 3401 ( s , oh ), 2979 ( c -- h ), 2927 ( c -- h ), 2881 ( c -- h ), 1702 , 1620 , 1426 , 1380 , 1361 , 1260 , 1183 , 1057 , 953 , and 532 cm - 1 . synthesis of poly [ bis ( 1 , 1 &# 39 ;- hydroxyaminoethyl ) methyl ] fullerenes , c 60 {-- ch [ c ( oh )( nh 2 ) ch 3 ] 2 } m a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with 2 , 4 - pentanedione ( 350 mg ) and tetrahydrofuran ( 20 ml ). the mixture was added lithium diisopropylamine in tetrahydrofuran ( 1 . 1 equiv of 2 , 4 - pentane - dione ) and stirred for 1 h to afford the corresponding lithium acetylacetonate . the solution was then added c 60 ( no 2 ) n ( 400 mg ) in tetrahydrofuran ( 25 ml ) and stirred at ambient temperatures for an additional 2 h . at the end of reaction , the mixture was quenched with ammonium iodide , nh 4 + i - , and stirred for 1 h . tetrahydrofuran was then removed from the solution to give semi - solid of products , which were washed repeatedly with water and acetone , and dried in vacuum at 40 ° c . to afford brown solids of the corresponding poly [ bis ( 1 , 1 &# 39 ;- hydroxyaminoethyl ) methyl ] fullerenes , c 60 {-- ch [ c ( oh )( nh 2 ) ch 3 ] 2 } m , where m ≧ n . the physical data of these compounds are as follows : irν max ( kbr ) 3400 ( s ), 3151 ( s ), 3043 , 2929 ( c -- h ), 2880 ( c -- h ), 1635 , 1401 , 1220 , 1035 , 773 , 630 , and 545 cm - 1 . synthesis of poly [ methoxyoligo ( ethyleneglycolated )] fullerenes , c 60 [-- o ( ch 2 -- ch 2 o ) 3 or 12 - 13 ch 3 ] m a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with polyethylene glycol monomethylether , ho ( ch 2 ch 2 o ) 3 ch 3 or ho ( ch 2 ch 2 o ) 12 - 13 ch 3 , ( 1 . 3 equiv of nitro groups in polynitro fullerene ) and tetrahydrofuran ( 20 ml ). the mixture was added sodium ( 1 . 2 equiv of -- oh ) and stirred for 1 h to afford the corresponding nao ( ch 2 ch 2 o ) p ch 3 . the solution was then added c 60 ( no 2 ) n ( 400 mg ) in tetra - hydrofuran ( 25 ml ) and stirred at ambient temperatures for an additional 2 h . at the end of reaction , water ( 0 . 2 ml ) was added and tetrahydrofuran was evaporated from the resulting solution to afford pale brown to brown solids . the solid was added into hexane ( 100 ml ) with stirring to give fine suspension of products . the solid precipitate was isolated by a centrifuge technique . it was then dissolved in tetrahydro - furan , filtered , and purified by chromatography ( sio 2 ) using ethylacetate as an eluent , where all unreacted polyethylene glycol monomethylether was removed ( r f = 0 . 85 ). solids in a brown band on the thin - layer chromatographic plate ( r f = 0 . 2 ) were recovered and dried in vacuum at 40 ° c . to afford pale brown to brown solids of the corresponding poly [ methoxy - oligo ( ethylene glycolated )] fullerenes , c 60 [-- o ( ch 2 ch 2 o ) 3 ch 3 ] m or c 60 [-- o ( ch 2 ch 2 o ) 12 - 13 ch 3 ] m , where m ≧ n . the physical data of c 60 [-- o ( ch 2 ch 2 o ) 12 - 13 ch 3 ] m are as follows : irν max ( kbr ) 3435 ( s ), 2920 ( c -- h ), 2874 ( c -- h ), 2835 , 1593 ( s ), 1453 , 1410 , 1367 , 1270 , 1105 ( s ), 949 , 776 , 623 , and 455 cm - 1 . 1 h nmr ( 300 mhz , dmso - d 6 ) δ 3 . 22 ( ch 3 ) and 3 . 40 ( ch 2 ). a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with either ho -- y 1 , h 2 n -- y 1 , hs -- y 1 , ho -- c 6 h 4 -- y 1 , hs -- cs -- y 1 , or h 2 n -- co -- y 1 ( 1 . 3 equiv of nitro groups in polynitro fullerene ) and tetrahydrofuran ( 20 ml ). the mixture was added superhydride ( 1 . 1 equiv of -- oh , -- nh 2 , or -- sh groups , 1 . 0 m in tetrahydrofuran ) and stirred for 1 h to afford the corresponding lithium salts of lio -- y 1 , linh -- y 1 , lis -- y 1 , lio -- c 6 h 4 -- y 1 , lis -- cs -- y 1 , or lihn -- co -- y 1 . the solution was then added c 60 ( no 2 ) n ( 400 mg ) in tetrahydrofuran ( 25 ml ) and stirred at ambient temperatures for an additional 2 h . at the end of reaction , tetra - hydrofuran was evaporated from the resulting solution to afford pale brown to brown solids . the solid was added into diethylether ( 100 ml ) with stirring to give fine suspension of products . the solid precipitate was isolated by a centrifuge technique . it was then washed twice with diethyl ether ( 20 ml each time ), twice with acetone ( 20 ml each time ), and dried in vacuum at 40 ° c . to afford pale brown to brown solids of the corresponding functionalized polyorgano fullerene derivatives , c 60 (-- a -- b -- z ) m , where m ≧ n , a , independently , is -- o --, -- nh --, -- s --, -- o -- c 6 h 4 --, -- hn -- co --; b , independently , is -- r -- o --[ si ( ch 3 ) 2 -- o --] 1 - 100 , c 1 - 200 alkyl , c 6 - 50 aryl , c 7 - 100 alkylaryl , c 7 - 100 arylalkyl , ( c 2 - 30 alkyl ether ) 1 - 100 , ( c 6 - 40 aryl ether ) 1 - 100 , ( c 7 - 60 alkylaryl ether ) 1 - 100 , ( c 7 - 60 arylalkyl ether ) 1 - 100 , ( c 2 - 30 alkyl thioether ) 1 - 100 , ( c 6 - 40 aryl thioether ) 1 - 100 , ( c 7 - 60 alkylaryl thioether ) 1 - 100 , ( c 7 - 60 arylalkyl thioether ) 1 - 100 , ( c 2 - 50 alkyl ester ) 1 - 100 , ( c 7 - 60 aryl ester ) 1 - 100 , ( c 8 - 70 alkylaryl ester ) 1 - 100 , ( c 8 - 70 arylalkyl ester ) 1 - 100 ; each z , independently , is -- c -- d --, wherein each c , independently , is -- r --, -- r -- ar --, -- ar -- r --, or -- ar --; and each d , independently , is -- h , -- o -- si ( ch 3 ) 3 , -- s -- ch 2 -- ar , -- so 3 - , -- co 2 - , -- o -- po 3 - 2 , -- o -- po ( o )-- o -- po 3 - 2 , or -- nr 1 r 2 , wherein each of r , r 1 , r 2 , r 3 is independently c 1 - 20 alkyl and each ar , independently , is aryl . synthesis of polyhydroxymercaptosuccinic acid derivatives of fullerenes ( fssa -- oh ), c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n ( oh ) m a round - bottom reaction flask ( 100 ml ) equipped with a magnetic stirrer was fitted with a septum and a cool - trap condenser . it was charged with mercaptosuccinic acid derivatives of fullerenes ( fssa , 200 mg ), c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n prepared by a method shown in example 13 , sodium hydroxide ( 2 . 5 g ), tetrabutylammonium hydroxide ( 1 . 0 ml , 2 . 0 m in h 2 o ), and h 2 o ( 20 ml ). the mixture was stirred at 40 ° c . for 4 h . at the end of reaction , the resulting solution was added methanol ( 200 ml ) to effect precipitation of brown solids . the precipitated solid was isolated by a centrifuge technique . it was then washed twice with methanol ( 20 ml each ) and dried in vacuum at 40 ° c . to afford the corresponding sodium salts of polyhydroxymercaptosuccinic acid derivatives of fullerene ( 215 mg ), c 60 [-- sch 2 ( co 2 na ) ch 2 co 2 na ] n --( oh ) m . the treatment of these sodium salts with an aqueous solution of hcl ( 1 . 0 n ) at ambient temperature for 0 . 5 h gave c 60 [-- sch 2 ( co 2 h ) ch 2 co 2 h ] n ( oh ) m ( fssa -- oh ) in a quantitative yield . the physical data of c 60 [-- sch 2 ( co 2 na ) ch 2 co 2 na ] n --( oh ) m are as follows : irν max ( kbr ) 3450 ( broad , s ), 2925 ( w , c -- h ), 2870 ( w , c -- h ), 1623 ( s ), 1589 ( s ), 1392 , 1055 , and 690 ( broad ) cm - 1 . 1 h nmr ( 200 mhz , d 2 o ) δ 3 . 59 ( t , ch ), 2 . 82 ( broad , oh ), and 2 . 62 ( d , ch 2 ). from the above description , one skilled in the art can easily ascertain the essential characteristics of the present invention , and without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions . thus , other embodiments are also within the claims .	2
referring now to fig1 - 6 , there is shown a coil form 10 in accordance with one form of the invention . the coil form 10 includes a generally cylindrical 12 having axially spaced circular side member or flanges 14 , 16 . a reference surface 12a is provided to cooperate with coil winding machinery and insure that the coil form 10 is positioned properly during winding . carried along the circular side flanges 14 , 16 are respectively rectangular plate shape members 18 , 20 . the members 18 , 20 are disposed in generally aligned relationship and is best seen in fig1 . ordinarily the coil form 10 will be manufactured of a synthetic material such as nylon . the material used may in some forms of the invention be a glass filled nylon material which is particularly suitable for high temperature applications . the plate shaped members 18 , 20 ordinarily will be molded in a manner which need not have the elasticity inherent in known plastic hinges . the molding process ordinarily will not require any special treatment to improve the hinge characteristics of the material and the coil form 10 ordinarily will be merely injection molded . instead , it is sufficient to have merely enough elasticity to enable folding of the plate shaped members 18 , 20 to the engaged position shown in fig6 . once folded to this position no further bending is required . the plate shaped member 18 includes upstanding side flanges 22 , 24 , and 26 . a gap 18 is disposed intermediate the flange 22 and the flange 24 . similarly , a gap 30 is disposed intermediate the flange 26 and the flange 24 . a reinforcing rib 32 is disposed on the inner face of the upstanding flange 26 as seen in fig1 . although not visible in fig1 a reinforcing rib is similarly positioned on the interface of the upstanding flange 22 . the plate shaped member 20 includes locking members 34 , 34 which have a generally wedge shaped cross section and which engage the slots 28 and 30 . ordinarily the slots 28 , 30 will have steps disposed adjacent to the open end thereof and the wedge shaped members 34 will also have steps as shown in fig1 . the cooperating steps are dimensioned and configured for locking engagement when the two plate shaped members 18 , 20 are moved to the positioned illustrated in fig6 . the shape of the steps in the slots 28 , 30 is visible in fig6 . the ribs 32 further insure locking cooperation of the slots 28 , 30 with the wedge shaped members 34 by insuring that little twisting occurs which might inadvertently disengage the cooperating surfaces . also disposed on the plate shaped member 20 are a plurality of generally wedge shaped bosses 36 which are disposed in a matrix of rows and columns . ordinarily the bosses 36 will be oriented so that the wedge shaped cross section has the elongated &# 34 ; peak &# 34 ; thereof disposed in generally aligned relationship with the axis of the cylindrical member 12 as well as with the elongated &# 34 ; peak &# 34 ; of the wedge shaped member 34 . the plate shaped members 18 , 20 will be respectively joined to the generally circular members 14 , 16 by tabs 19 , 21 . these tabs 19 , 20 are intended to bend at the generally tangential intersection with the generally circular members 14 , 16 . holes 19a are proved to insure that the generally l - shaped assemblies of the plate 19 and the tab 19a bend also at the generally tangential intersection with the generally circular member 14 . in a similar manner the tab 21a is also provided with similar holes to insure that the generally l - shaped sub - assembly of the plate member 20 and table 21 will bend along the line of intersection with the generally circular plate or end member 16 . as shown in fig2 automatic coil winding machinery is ordinarily used to position a bifilar coil of copper wire 40 intermediate the circular flanges 14 , 16 . the axial extremities of the copper windings are indentified by the numerals 42 , 44 , 46 , and 48 . ordinarily a portion of the coil is covered with tape 15 as shown in fig2 . ordinarily the upstanding bosses 36 will be disposed in four discrete area rows extending in a direction generally aligned with the axis of the cylindrical member 12 . the space is intermediate these rows are occupied by 3 terminations 54 , 56 and 58 as best shown in fig3 . it will be understood that it is normal practice to provide only three terminations 54 , 56 and 58 even though there are four axial extremities 42 , 44 , 46 and 48 of the windings 40 . this is possible , of course , since two of the axial extremities are connected to a single termination . as also seen in fig3 the axial extremity 42 - 48 are connected to the terminations 54 - 58 by twisting . thereafter , as shown in fig4 diagonal cutters 60 are utilized to cut the upstanding axial extremities 42 - 48 in the stripped ends of the terminations 54 - 58 to a suitable length . the utilization of discrete wedge shaped bosses 36 is ordinarily preferable to a single continuous channel for each termination wire 54 , 56 , and 58 because the discrete bosses 26 insure better gripping of the terminations 54 , 56 , and 58 and also make insertion of the terminations 54 , 56 , and 58 into the spaces intermediate the bosses 36 easier . thereafter as shown in fig5 the axial extremities 42 - 48 and the terminations and stripped ends of the terminations 54 - 58 are dipped into a reservoir 62 of molten solder . after this has been accomplished the generally plate shaped members are closed together in locking engagement as shown in fig6 . when so positioned the terminations 54 - 58 extend intermediate the free end of the plate shaped member 20 and the flange 24 of the member 18 . we see that the locking engagement of the wedge shaped members 34 , 34 with the spaces 28 , 30 insures a positive and permanent relationship between the plate shaped members 18 , 20 . it will be further seen that the apparatus in accordance with the invention results in a positive locking arrangement which has a pleasing appearance but which is highly durable , in addition the recited steps can be performed very rapidly with a minimum of material and labor costs .	7
porous pellets are prepared by compacting powder to form porous anode bodies ( fig5 ). the pellets may be made from any suitable conductive material . preferred materials include metals , conductive metal oxides or conductive metal nitrides . more preferably the anode comprises a valve metal , conductive valve metal oxide or a conductive metal nitride with preferred valve metals being tantalum , aluminum , niobium , hafnium , zirconium , titanium , tungsten and alloys of these elements . tantalum and niobium oxide are the preferred materials . tantalum is the most preferred material . many types of binders or lubricants , such as stearic acid , polypropylene carbonate , polyethylene carbonate , and n , n ′- ethylene distearylamide , polyalkylene carbonates and polyethyleneglycol , can be incorporated into the anodes and later removed either by soaking or thermal decomposition . a particularly preferred polyethylene carbonate is qpac 25 and a particularly preferred polypropylene carbonate is qpac 40 . a particularly preferred n , n ′- ethylene distearylamide is acrowax c . the compacted pellets may then be processed using an abrasive process , in which contact among the compacted pellets , or among pellets and grinding media ( sand , milling media such as metal / ceramic beads , sintered tantalum pellets , al 2 o 3 , sic , zr , synthetic plastic fragments , nut shells , ground hardwood , pressurized liquid , etc .) serves to break down the corners , edges , and surfaces of the pellets ( fig6 ). grinding media is a material , also referred to as milling media , which acts to abrade an item placed therein and moved . in general , the abrasive process employs the mechanical means , preferably but not limited to , tumbling a large volume of pellets in a cylindrical barrel shaped device made from lined or unlined metal , rigid plastic or ceramic rotating about its primary axis situated substantially horizontal . vibrating , blasting , and grinding with milling media may be employed to equivalently achieve abrasive results indicative of those processes . anode tumbling without added media , as described here , is the preferred method because the nature of the process dictates that material is removed from the anode bodies &# 39 ; corners , edges , and surfaces — in descending degree by nature of their geometric exposure . additionally , tumbling as described here is preferred because it achieves the desired results without the need to use any foreign material that could degrade the purity of the anode bodies such as by inclusion in the pores , nor needs additional processing to be removed or separated from the anode bodies . the pellets are then sintered to bond the compacted powder particles together into solid anode bodies that still possess their porous construction . the sintered pellet is then anodized using standard procedures , including but not limited to , those described in u . s . pat . no . 7 , 248 , 462 to form the oxide film which serves as the dielectric of the capacitor . the internal surfaces of the anodic oxide film are next coated with a primary cathode layer . manganese dioxide may be applied as a primary cathode layer by applying manganous nitrate solution and converting the nitrate to manganese dioxide via heating in a pyrolysis oven . typically the conversion step is carried out between 250 ° and 300 ° c . alternatively , an intrinsically conductive polymer can be employed as the primary cathode layer . the conductive polymer material is typically applied as a monomer using either a chemical oxidative process such as is described in u . s . pat . no . 6 , 001 , 281 or by applying a pre - formed polymer slurry preferably of polythiophene , polypyrrole or polyaniline such as is described in u . s . pat . no . 6 , 391 , 379 . in the case of a chemical oxidative process , byproducts of the reaction are removed by washing and typically multiple applications and washings are required prior to a reanodization process used to isolate the defect sites in the dielectric . the pellets are then placed in suitable electrolyte bath , for instance a dilute aqueous phosphoric acid solution with conductivity in the range 50 to 4000 micos / cm . voltage is applied to drive the process which causes isolation and healing of the dielectric flaw sites this process may not be required in the case of applying a preformed ( prepolymerized ) polymer slurry to the anodes . the process is repeated to insure complete coverage of the internal and external dielectric surfaces . the components are subsequently dipped in a carbon suspension to coat the external surfaces of the primary cathode material . a silver layer applied to the device with a commercial silver paint to form an external coating . fig1 depicts the manner in which a liquid or slurry pulls away from an edge or corner due to surface tension effects . especially in the case of capacitors coated with polymer slurry , the cathode failure site occurs predominantly on the corners of the anode which are poorly coated by the polymer slurry due to surface tension of the more viscous slurry . polymer slurries of intrinsically conductive polymers are an alternative coating methodology to the formation of polymer from a monomer and catalyst on the surface of the oxidized pellet . slurries may be applied using a cross - linking agent as disclosed in u . s . pat . no . 6 , 451 , 074 . the use of slurries reduces the number of coating steps when making the capacitor and reduces the loss of monomer due to contamination . u . s . published application no . 2006 / 0236531 discloses polythiophene particles with filler as a coating material of conductive polymer . any intrinsically conductive polymer may be used . polyaniline may be preferred due to ease of handling . coating thickness should be at least 0 . 25 micrometers , preferably at least 1 micrometer and optimally at least 3 micrometers to obtain complete coverage of all appropriate surfaces . the use of anode pellets exhibiting curvature where the primary surfaces meet , particularly at the end and / or sides away from the anode lead wire , allows reliable mechanical dipping into the slurry with minimal deposition of polymer on the anode lead . the capacitor precursor then may be coated with graphite and ag , a cathode lead attached and final assembly performed . it is preferred that the pellet be abraded until the edge sharpness is removed . the edge sharpness is considered removed herein when the pellet has a minimum radius of curvature of at least 0 . 0076 cm ( 0 . 003 inches ). more preferably the pellet has a minimum radius of curvature of at least 0 . 0127 cm ( 0 . 005 inches ) and most preferably at least 0 . 025 cm ( 0 . 010 inches ). a fluted anode is one which has surfaces which are not substantially flat . the variations in the surface may be , but are not necessarily , symmetrical or repeated in a pattern . examples of fluted anodes may be found in u . s . pat . nos . 7 , 154 , 742 ; 7 , 116 , 548 ; 6 , 191 , 936 ; and , 5 , 949 , 639 . the capacitors disclosed in these references are pressed to have substantially flat ends where anode lead projects and at the opposite end . most have flat sides except for the penetrations into the body of the anode . multiple sharp edges are present and present challenges when coatings are applied . modifications of the external surfaces to remove sharp corners and edges results in improved coating . internal surfaces , meaning those wholly within the interstices of the flutes ( i . e . at acute not obtuse angles ), need not be modified . in preferred embodiments , multiple flat wires are used as anode leads . fig1 depicts prior art in which the top edges of a surface mount capacitor were chamfered to reduce stress on those edges . fig1 is a depiction of an anode with chamfered top edges as described in u . s . pat . no . 5 , 959 , 831 ( maeda , et al .). fig1 depicts chamfering of bottom edges as depicted in us 2005 / 0231895 a1 . fig1 is a picture of capacitors following a breakdown test indicating the failures occurred on the corners of the anode . in a breakdown voltage test , a power supply , resistor , fuse , and capacitor are placed in series . the voltage applied to the capacitor is increased until the capacitor breaks down as indicated by the blown fuse . especially in the case of capacitors with polymer slurry cathode the failure site occurs predominantly on the corners of the anode which are poorly coated by the polymer slurry . fig2 shows a rectangular prism or a parallelopiped . the x , y , and z axes are defined with respect to origin “ o .” the exposed surfaces are labeled xy , xz , and yz . an edge is defined as the intersection of two surfaces . a corner ( or point ) is defined as the intersection of three surfaces or three edges . modification of an edge can be defined by reference to fig2 . fig2 represents an anode in perspective view . a surface xz with a length x ′ and width z ′ represents a first external surface of an anode . a surface yz with a length y ′ and width z ′ represents a second external surface of an anode . for conventional anodes xz and yz meet to form a right angle at an edge . in an edge modified design the first surface xz will deviate at point a and distance x ″ from the edge , e , which is the projected intersection of xz and yz . the second surface of the anode will deviate from yz at point b and distance y ″ from e . this deviation creates at least one additional surface , herein defined as a transition surface , ts . in one embodiment the deviation is a straight diagonal line between points a and b wherein the transition surface creates a chamfer . in another embodiment the transition surface is a non - linear , curved , or radiused edge . edge modified designs as defined here refers to any deviation of the external surface from xz and yz such that : the concept can be extended to a third dimension of a conventional rectangular prism . a corner , c , is defined by the projected intersection of three surfaces yz , xz and xy . the surface xz with a length x ′ and width z ′ representing an external surface of an anode . in a corner modified design the surface xz will also deviate at point d and distance z ″ from c . a corner modified design as defined herein refers to any deviation of the external surfaces such that : in a conventional smt the anode shape is a regular rectangular prism as illustrated in fig2 . the surfaces all intersect at right angles ( or approximations thereof ), providing six surfaces and twelve edges . according to this invention , most or all of the edges are modified to form transition surfaces . the transitions may be flat as in a traditional chamfer or bevel . alternately , the transition may form multiple chamfers including , in the limit , a curved surface such as would be obtained using a corner round router bit . when rounded edges intersect , a quarter of a hemisphere is formed which maybe regular , as when all radii of generation are equal or compound when the radii of the generating curves differ . referring again to fig2 , it is apparent that the size of a straight bevel or chamfer can be defined in terms of x ″, y ″, and / or z ″. since there are twelve edges and eight corners formed by six surfaces , a great variety of shapes can be formed when the lengths x , y and z differ from each other or when different edges are chamfered or when only corners are chamfered . depending upon the size of the anode - case size - different transition surface shapes and sizes are found to be preferred . as an example of a body having a transition surface , reference is made to fig1 . anode body 71 , having six planar sides 73 , 74 , 75 , 76 , 77 , and 78 and an anode lead 79 has been chamfered at each corner to provide transitional planar surfaces 81 , 82 , 83 , 84 , 85 , 86 , 87 , and 88 . this shape directly addresses the problem with corner coating as illustrated in fig1 a and fig1 b . this is a corner chamfer anode . when edges and corners are all curved , the result is an edgeless shape as shown in fig1 . three transitional surfaces are present , a short side curved transitioned surface 91 , a long side curved transitional surface 93 and a corner quarter hemisphere 95 . in the preferred embodiment , all radii of generation are equal but such is not necessary . for small case sizes a greater radius in the z direction may be preferred . when the curvature at the edges in the yz surface is expanded to become a continuous curve , the resultant figure is an obround prism as shown in fig1 . the yz surface has been replaced with a curved surface , such as semicircular in cross - section . in the preferred embodiment , the transition surfaces form the xy surface and from the semicircular side are radiused into the xz surface ( cf . 103 ) and the transition surface from the xy surface ( cf . 105 ) are radiused into the xz surface . such an anode has no sharp edges save for some flashing at the points of juncture of the dice employed . the xy surface of an oblong prism may be flat or curved . extrapolation of the edgeless obround shape of fig1 is the edgeless cylinder of fig1 . a cylindrical anode has traditional round sides 107 , but the transition surface 111 to the flat top 109 ( and bottom , not shown ) is chamfered or , in the drawing , rounded or curved to make a smooth transition from side to top . when the basic prism shape is obround , the edges and corners may have consistent or changing radii , but the chord for the curve is defined using the same criteria as for a chamfered surface . when the figure is a cylinder , the radius of the circle of origin becomes one length , and the height of the cylinder becomes the other length , i . e ., the intersection of planar surface and circumferential surface is characterized as 0 . 03 mm & lt ; r & lt ; r and 0 . 03 mm & lt ; h & lt ; h / 2 where r and h are the radius of the circle of origination and h the height of the cylinder . the edgeless cylinder has particular application in hermetically sealed leaded devices . failure site analysis reveals that the vast majority of failures , up to 95 %, will appear on the edges of the cylindrical anode . these edges are most susceptible to any outside forces applied to the case wall ( fig1 ). in between these edges , the pellet structure offers a strong resistive structure that will spread the force and absorb it . in between the edge and the sealed , top of the case , the case can compress to absorb the force . at the edges , the forces can create a fracturing force on the pellet . the relative stresses are in the order s 1 , & lt ; s 2 , & lt ; s 3 . the top edge ( nearest the anode seal ) is more susceptible than the bottom edge ( nearest the cathode lead ) as the closed end of the barrel adds stiffness here . in order to mitigate this failure mechanism the edges of the pellet can be rounded . by eliminating the sharp edge ( fig2 ), the amount of force required to fracture or chip the pellet increases tremendously . once the pellet is soldered in the case , the sharp edges would have been eliminated and replaced with a tapering solder thickness . the radiused or rounded elements nearest the outer diameter have capabilities of spreading blunt forces through the case . the radiused elements furthest from the outer diameter have thicker solder which creates additional buffering . it has been found that a second approach to enhancing coverage is surprisingly effective . an anode having cut - away portions at the corners — hereinafter a corner cut anode — is effective in collecting conductive polymer at the corners during the coating process . fig2 shows a preferred corner cut anode sintered body . at the juncture of three surfaces 73 , 75 and 78 , two cuts are made to create two additional transitional surfaces , 121 and 123 . this pattern is repeated at the other seven corners to form “ pockets .” the improvement may be seen in fig2 when contrasted with fig2 and fig2 . while not being bound by any theory , it is seemed that monomer , and subsequently polymer , accumulates on the surfaces of the transition surface 121 , 123 and compensates for the thin or incomplete layers found in standard rectangular parallelepiped shape for anodes . the corner cut anode seems particularly suitable for dipping in polymer slurries . polymer slurries of intrinsically conductive polymers are an alternative coating methodology to the formation of polymer from a monomer and catalyst on the surface of the oxidized pellet . slurries may be applied using a cross - linking agent as disclosed in u . s . pat . no . 6 , 451 , 074 . the use of slurries reduces the number of coating steps when making the capacitor and reduces the loss of monomer due to contamination . u . s . published application no . 2006 / 02336531 discloses polythiophene particles with filler as a coating material of conductive polymer . any intrinsically conductive polymer may be used . polyaniline is preferred due to ease of handling . coating thickness should be at least 0 . 25 micrometers , preferably at least 1 micrometer and optimally at least 3 micrometers to obtain complete coverage of all edges . the use of anode pellets with transition surfaces at the end and / or sides away from the anode lead allows reliable mechanical dipping into the slurry with minimal deposition of polymer on the anode lead . the capacitor precursor then may be coated with graphite and ag , a cathode lead attached and final assembly performed . a fluted anode is one which has surfaces which are not substantially flat . the variations in the surface may be , but are not necessarily symmetrical or repeated in a pattern . examples of fluted anodes may be found in u . s . pat . nos . 7 , 154 , 742 ; 7 , 116 , 548 ; 6 , 191 , 936 ; and , 5 , 949 , 639 . the capacitors disclosed in these references are pressed to have substantially flat ends where anode lead projects and at the opposite end . most have flat sides except for the penetrations into the body of the anode . multiple sharp edges are present and present challenges when coatings are applied . modifications of the external surfaces to remove sharp angles results in improved coating . the edges and / or corners may be chamfered or curved in the manner of fig1 and 16 to achieve a more uniform coating of the polymer . triangular corners as shown in fig1 and notched corners such as shown in fig2 are also preferred . internal surfaces , meaning those wholly within the interstices of the flutes need not be modified . in preferred embodiments , multiple flat wires are used as anode leads . commercial electronic grade 22 , 000 cv / g tantalum powder was pressed to form anodes to a density of 5 . 5 g / cc with dimensions 4 . 70 × 3 . 25 × 1 . 68 mm using a radial action press . the punches of the press were modified to create a notch or v - cut in each corner of the anode as depicted in fig2 . this modification to the corners is referred to as corner cut anode designs . the sintered anodes were anodized at 100 volts in an aqueous phosphoric acid electrolyte maintained at 80 ° c . the parts were subsequently dipped in liquid suspensions containing pre - polymerized polyethelyenedioxthiophene ( pedt ). photomicrographs were taken to determine the degree of polymer coverage on the corners of the anodes ( fig2 ). after application of a conductive polymer slurry the parts were dipped in a carbon suspension used for commercial tantalum conductive polymer capacitors . the anodes were dipped in an electronics grade silver paint prior to assembly and encapsulation to form surface mount tantalum capacitors . after encapsulation 25 volts was applied to the capacitors and leakage was read through a 1 k ohm resistor after allowing 60 seconds for the capacitors to charge . the results were plotted in fig2 . commercial electronic grade 13 , 000 cv / g tantalum powder was pressed to a density of 5 . 5 g / cc with dimensions 4 . 70 × 3 . 25 × 1 . 70 mm using a radial action press . conventional punches were used which created well defined corners typical of anodes used in the industry . the sintered anodes were anodized to 130 volts in an aqueous phosphoric acid electrolyte maintained at 80 ° c . the parts were subsequently dipped in liquid suspensions containing pre - polymerized polyethelyenedioxthiophene ( pedt ). photomicrographs were taken to determine the degree of polymer coverage on the corners of the anodes ( fig2 ). after application of the conductive polymer slurry the parts were dipped in a carbon suspension used for commercial tantalum conductive polymer capacitors . the anodes were dipped in an electronics grade silver paint prior to assembly and encapsulation to form surface mount tantalum capacitors . after encapsulation 25 volts was applied to the capacitors and leakage was read through a 1 k ohm resistor after allowing 60 seconds for the capacitors to charge . the results and comparison were plotted in fig2 wherein dcl is direct current leakage and pe is post - encapsulation . a comparison of the polymer coverage and leakage distributions after encapsulation demonstrates the improvements obtained with the corner cut anode design relative to prior art . commercial electronic grade 13 , 000 cv / g tantalum powder was pressed to a density of 5 . 5 g / cc with dimensions 4 . 57 × 3 . 10 × 1 . 63 mm using a pill style press . the lead wire is attached after pressing with this type of press . the action of this style press generates anodes with rounded corners on one side of the anode . the corners on the opposite side of the anode are sharp , well defined corners . the sintered anodes were anodized to 130 volts in an aqueous phosphoric acid electrolyte maintained at 80 ° c . the parts were subsequently dipped in liquid suspensions containing pre - polymerized polyethelyenedioxthiophene ( pedt ). photomicrographs were taken to determine the degree of polymer coverage on the rounded corners of the anodes ( fig2 ). photomicrographs taken of the opposite side of the anode demonstrates the poor polymer coverage on the sharp well defined corners of the anode ( fig2 ). these pictures clearly indicate the need to modify the corners of the anodes in order to obtain sufficient coverage using slurries or suspensions to apply cathode layers . in order to eliminate the corners completely an axial press was used to press obround anodes . commercial electronic grade 22 , 000 cv / g tantalum powder was pressed to an average density of 5 . 5 g / cc with dimensions 4 . 70 × 3 . 25 × 0 . 81 mm . an obround shaped die was used to press an anode without corners . the sintered anodes were anodized to 100 volts in an aqueous phosphoric acid electrolyte maintained at 80 ° c . the parts were subsequently dipped in liquid suspensions containing pre - polymerized polyethelyenedioxthiophene ( pedt ). photomicrographs were taken to determine the degree of polymer coverage on the anodes . polymer coverage at the top of the anode , where the density was less than 5 . 5 was acceptable ( fig2 ). however , at the bottom of the anode where the press density was greater than 5 . 5 the edges of the anode were not covered with polymer ( fig3 ). the density gradient observed in these anodes is characteristic of anodes produced on an axial press . in the process of preparing anodes 50 kcv / gram ta powder from h . c . starck was mixed with n , n ′ ethylene diamine distearamide and pressed to form a rectangular parallelepipeds such as shown in fig5 . the pressed anode bodies were put into a tantalum lined grinding jar and rolled for 60 minutes at 20 rpm . the anode bodies were removed from the grinding jar and cleaned with compressed air , followed by sintering for 15 minutes at 1520 ° c . in a vacuum oven . fig9 shows an anode body before tumbling . fig1 shows an anode body after tumbling . table 1 summarized the electrical results of ta capacitors after surface mounting . the polymer slurry coated anodes processed using the tumbling process show the noticeable reduction in electrical short failures . the invention has been disclosed in regard to preferred examples and embodiments which do not limit the scope of the invention disclosed . modifications apparent to those with skill in the art are subsumed within the scope and spirit of the invention . the disclosed invention provides a method of processing anode bodies that ultimately improves quality , reliability , and durability of capacitors in electronic devices .	8
fig1 is a diagram showing an overall structure of the fuel vapor processing system embodying the present invention , in which the parts corresponding to those of the prior art shown in fig6 are denoted with like numerals without repeating the description of such parts . referring to fig1 , a fuel tank 1 and a canister 2 are connected to each other via a fuel vapor passage 3 , which is branched into a pair of branch passages 3 a and 3 b at the end communicating with the fuel tank 1 . the first branch passage 3 a is selectively closed by a float valve 4 provided at the fuel tank end of the first branch passage 3 a , and the second branch passage 3 b is selectively closed by a cut valve 5 provided at the fuel tank end of the second branch passage 3 b . an intermediate part of the second branch passage 3 b is provided with a two - stage check valve 6 which comprises a high set - pressure valve 7 and a low set - pressure valve 8 incorporated in the high set - pressure valve 7 as shown in fig2 . the high set - pressure valve 7 comprises a valve chamber 7 a communicating with the canister end of the second branch passage 3 b , a port 7 b communicating with the fuel tank end of the second branch passage 3 b , a cup - shaped valve member 7 c axially slidably received in the valve chamber 7 a so as to selectively close the port 7 b , and a compression coil spring 7 d resiliently urging the valve member 7 c in the direction to close the port 7 b . the low set - pressure valve 8 comprises a cylindrical valve housing 8 a formed inside the valve member 7 c and integrally attached thereto , a port 8 b formed in the bottom wall of the valve member 7 c so as to communicate the valve housing 8 a with the fuel tank end of the second branch passage 3 b , a ball - shaped valve member 8 c received in the valve housing 8 a so as to selectively close the port 8 b , and a compression coil spring 8 d resiliently urging the valve member 8 c in the direction to close the port 8 b . the interior of the valve housing 8 a communicates with the valve chamber 7 a of the high set - pressure valve 7 . the first prescribed pressure p 1 at which the valve member 8 c is pushed open against the spring force of the compression coil spring 8 d is smaller than the second prescribed pressure p 2 at which the valve member 7 c is pushed open against the spring force of the compression coil spring 7 d ( p 1 & lt ; p 2 ). under normal condition or when the internal pressure of the fuel tank 1 is not higher than that of the canister 2 , the ports 7 b and 8 b of the check valve 6 are closed by the valve members 7 c and 8 c , respectively , as illustrated in fig2 . when the fuel tank 1 is filled full , the first branch passage 3 a is closed by the float valve 4 , and any additional filling of fuel causes the internal pressure of the fuel tank 1 to rise . the resilient biasing force of the compression coil spring 8 d is selected in such a manner that the pressure rise due to the filling of the fuel tank beyond the tank full state is enough to push open the valve member 8 c against the spring force of the compression coil spring 8 d . therefore , when the fuel tank is filled beyond the tank full state , the low set - pressure valve 8 opens ( see fig3 a ). thus , the fuel vapor which is displaced from the fuel tank 1 by the filling of fuel into the fuel tank 1 beyond the tank full state is allowed to be conducted to the canister 2 as indicated by the arrows in fig3 a , instead of the fuel fill pipe 9 so that the fuel vapor is successfully absorbed by the canister 2 and prevented from being released to the atmosphere from the fill pipe 9 . by reducing the opening area of the port 8 b , the flow rate of the fuel vapor directed to the canister 2 is controlled . therefore , a certain level of pressure rise can be preserved in the fuel tank 1 so that the froth of fuel is allowed to rise in the fill pipe 9 during the time of filling the tank beyond the tank full state , and the sensor equipped to the fuel fill nozzle g is enabled to detect the rise of the froth and shut off the supply of fuel without any problem . the internal pressure of the fuel tank 1 may rise to a significant level even when fuel is not being filled into the fuel tank 1 if the surrounding temperature is high . such an excessive pressure is desired to be removed as soon as possible , but it is not desirable to release fuel vapor to the atmosphere to remove the high pressure . such a pressure rise opens the low set - pressure valve 8 , but the flow rate is so limited that the pressure rise may continue . this problem is resolved by the high set - pressure valve 7 provided in the check valve 6 . when the internal pressure of the fuel tank 1 reaches a prescribed pressure p 2 higher than the set pressure p 1 of the low set - pressure valve 8 , this high set - pressure valve 7 opens . when the high set - pressure valve 7 opens , the vapor can flow across a relatively large sectional area surrounding the valve member 7 c and the check valve 6 can thereby accommodate a relatively large flow rate in addition to that effected by the open state of the low set - pressure valve 8 . as a result , even when the internal pressure of the fuel tank 1 rises for other reasons than filling fuel into the fuel tank beyond the tank full state , the high pressure can be released to the canister 2 via the fuel vapor passage 3 . the fuel vapor is absorbed by the canister 2 , and would not be released to the atmosphere . the check valve 6 that opens in two stages as described above was made particularly compact by incorporating the low set - pressure valve 8 into the high set - pressure valve 7 . therefore , the check valve 6 can be mounted without requiring no more space than the conventional counterpart , and can also be used in place of a conventional counterpart without requiring any substantial change to the existing design . in the check valve 6 of the illustrated embodiment , the low set - pressure valve 8 was incorporated into the high set - pressure valve 7 , but the check valve of the present invention is not limited to this example but may be designed in any other way possible as long as it combines a first valve that opens at a relatively low pressure and a second valve that opens at a relatively high pressure . fig4 shows another embodiment of the check valve 6 . in fig4 , the parts corresponding to those of the previous embodiment are denoted with like numerals without repeating the description of such parts . in this case , a low set - pressure valve 8 and high set - pressure valve 7 are arranged in parallel with each other . the bottom wall of the valve member 7 c of the high set - pressure valve 7 is closed . the ports 7 b and 8 b of these valves on the side of the fuel tank 1 are commonly connected to the fuel tank end of the second branch passage 3 b , and the valve chamber 7 a and valve housing 8 a of these valves on the side of the canister 2 are commonly connected to the canister end of the second branch passage 3 b . this also provides an action similar to that of the previous embodiment by opening the low set - pressure valve 8 upon the occurrence of a slight pressure rise resulting from the filling of the fuel tank to full and opening the high set - pressure valve 7 upon the occurrence of a substantial pressure rise resulting from a high temperature or a cause other than filling the tank full . according to this embodiment , because the two valves 7 and 8 can open independently from each other , the threshold pressures p 1 and p 2 can be set at a high precision , and the manufacturing process can be simplified . the low set - pressure valve 8 started opening at pressure p 1 and the high set - pressure valve 7 started opening at pressure p 2 in a step - wise fashion in the foregoing embodiment , but they may be adapted to open gradually so as to progressively increase the flow rate as the pressure rises as indicated by the graph of fig5 . in the graph , the abscissa corresponds to the pressure ( gauge pressure ) inside the fuel tank 1 , and the ordinate corresponds to the rate of flow that passes through the check valve 6 . as indicated by the graph , the high set - pressure valve 7 and low set - pressure valve 8 remain closed when the pressure is lower than the first threshold pressure p 1 . even in this state , there is a slight leak flow at the rate of q 1 . when the pressure has reached the first threshold pressure p 1 , only the low set - pressure valve 8 opens , and the fuel vapor passes through the check valve 6 at a flow rate which progressively increases with the rise in the pressure . the increase flow rate eventually diminishes as the pressure approaches the second threshold pressure p 2 . when the pressure has reached the second threshold pressure p 2 , the high set - pressure valve 7 also opens , and the fuel vapor passes through the check valve 6 at the flow rate q 2 . as the pressure rises further , the opening of the high set - pressure valve 7 progressive increases , and so does the flow rate . the second threshold pressure p 2 should be selected to be equal to that encountered when the tank is filled full or slightly higher . by thus progressively increasing the flow rate with the rise in pressure , the canister can be absorb the fuel vapor from an early stage of filling up the fuel tank 1 . also , because the high set - pressure valve 7 is adapted to accommodate a relatively large flow rate for a given rise in pressure , the pressure rise owing to a high temperature condition can be controlled in a relatively promptly . although the present invention has been described in terms of preferred embodiments thereof , it is obvious to a person skilled in the art that various alterations and modifications are possible without departing from the scope of the present invention which is set forth in the appended claims .	8
one version of a roller - belt conveyor embodying features of the invention is shown in fig1 . the conveyor 24 transports articles on a roller belt 12 , which forms an endless belt loop defining a belt path . the belt path can be considered to be divided into four segments : ( a ) an upper carryway segment 26 along which articles are conveyed in a conveying direction 16 ; ( b ) a lower returnway segment 28 ( shown in part ) below the carryway segment ; ( c ) a first reversing segment 30 at an upstream , or infeed , end 31 of the conveyor along which the roller belt transitions upward from the returnway to the carryway ; and ( d ) a second reversing segment 32 at a downstream , or exit , end 33 of the conveyor along which the roller belt transitions downward from the carryway to the returnway . a reversing wheel 36 , which may be a drive drum or a drive sprocket mounted on a shaft 38 and driven by a motor ( not shown ) to rotate in the direction of the arrow 38 , engages the underside of the belt loop in the second reversing segment to drive the belt and transition it to the returnway . alternatively , the roller belt may be driven in the returnway segment by a drum or sprocket . in that case , the reversing wheel at the exit end of the conveyor is an idle wheel with its shaft not coupled directly to a drive motor . the roller belt 12 includes a plurality of rollers 10 having salient portions that protrude past inner 40 and outer 41 sides of the belt . articles 42 are supported atop the salient portions of the rollers extending above the outer side of the belt along the carryway . the salient portions of the rollers extending past the inner side of the belt on the carryway ride along a planar carryway bearing surface 44 . as the belt advances , the rollers roll on the bearing surface and rotate in the direction of the arrows 18 . the rotation of the rollers propels articles in the direction of belt travel at twice the speed of the belt if the rollers don &# 39 ; t slip as they roll along the bearing surface . in this way , the conveyor increases the spacing between consecutive conveyed articles . at the downstream , or exit , end 33 of the conveyor , the planar bearing surface 44 terminates upstream of the reversing wheel to avoid interference . there is no reversing wheel at the upstream end 31 of the conveyor in this version . instead , the roller belt reverses around a stationary convex bearing surface 46 in the first reversing segment . in this version , the convex bearing surface is continuous with the planar bearing surface 44 . tension in the advancing roller belt conforms the belt to the convex bearing surface as the belt is pulled through the first reversing segment at the upstream end of the conveyor . by providing a bearing surface for the rollers in the first reversing segment , the convex bearing surface allows the rollers to rotate before they reach the carryway . because all the rollers at the upstream end of the conveyor are rotating at full speed before they enter the carryway , articles fed onto the conveyor at the upstream end are immediately pulled away by the rotating rollers . there is no delay due to non - rotating rollers at the infeed to the conveyor . one version of the bearing surfaces of fig1 is shown in fig2 . the bearing surfaces are formed on a sheet 48 that includes a planar portion 50 and a convex portion 51 . the sheet is continuous across the width of the conveyor in the carryway segment and in the first reversing segment . when viewed from the side edge 52 of the sheet , the convex portion is c - shaped with a slightly upturned lip 54 at its lower end to prevent the belt from snagging as it first encounters the convex bearing surface . the sheet may be made of metal , which may be coated with a synthetic material to enhance the rolling engagement of the rollers on the bearing surface , or of a synthetic material with desirable rolling properties . the sheet may be a single bent sheet forming one continuous bearing surface or may be made of two sections ( the planar portion and the convex portion ) separated by a small gap at the interface 56 between the two portions . fig3 shows an alternative embodiment of the bearing surface . in this version , the bearing surfaces are segmented across the width of the conveyor . parallel linear wearstrips 58 provide planar bearing surfaces along the carryway . c - shaped wearstrips 60 provide convex outer bearing surfaces 61 in the first reversing segment . the linear and convex wearstrips are shown separated by a small gap 62 at the interface between the first reversing segment and the carryway segment . of course , a continuous wearstrip bent to form the convex portion at one end could be used instead . further details of a roller belt and the planar portion of the wearstrips of fig3 along the carryway are shown in fig4 and 5 . the portion of the roller belt shown is a modular plastic belt 64 constructed of rows 66 , 67 of one or more belt modules , such as edge modules 68 and interior modules 69 , arranged side by side to form a row . hinge eyes 70 at the leading and trailing ends of each belt row are interleaved with corresponding hinge eyes of a consecutive row and connected together by a hinge rod 72 received in the lateral passageway formed by the aligned , interleaved hinge eyes . rollers 10 are mounted in cavities 74 formed in the interior of the modules . the rollers are arranged in parallel lanes . the linear wearstrips 58 are also arranged in parallel on spacings equal to the spacings of the lanes of belt rollers to provide planar bearing surfaces underlying each longitudinal lane of rollers . each roller has a diameter greater than the thickness of the belt so that salient portions of the rollers protrude past the inner 40 and outer 41 sides of the belt . the rollers in this version rotate on axles 76 spanning the cavities and supported at their ends in the interior of the belt modules . bores in the cylindrical rollers receive the axles . in this example , the axles are arranged perpendicular to the direction of belt travel so that the rollers rotate in the direction of belt travel as the belt advances . recesses 78 formed in the belt modules on the inner side of the belt loop include drive surfaces that are engaged by driving surfaces , such as teeth , on the reversing wheel . in another version of the conveyor shown in fig6 , reversing wheels 80 , or sprockets , mounted on a shaft 81 supported for rotation in bearing blocks 83 , are used in the first reversing segment . planar bearing surfaces 82 extend from the carryway segment 26 upstream into the first reversing segment 30 past the centerline 84 of the shaft . the extension of the linear bearing surface into the first reversing portion provides a bearing surface for the roller belt rollers to roll on at the upstream , infeed end of the conveyor . consequently , articles fed onto the roller - belt conveyor immediately encounter rotating rollers . thus , the various versions of roller - belt conveyors described provide immediate pull - away of articles transferred to the infeed end of a separation conveyor . although the invention has been described in detail with respect to a few preferred versions , other versions are possible . for example , the roller axles in the conveyor belt need not be oriented perpendicular to the direction of belt travel . they could instead be oriented oblique to the direction of belt travel to provide an additional lateral component of motion to conveyed articles . as another example , spherical roller balls without axles , rather than the generally cylindrical rollers described , could be used as belt rollers . as still another example , the convex bearing surface could alternatively be realized as the outer surface of a stationary drum or shoe . so , as these few examples suggest , the scope of the claims is not meant to be limited to the versions described in detail .	1
the method for preparing cyclic oligosiloxane according to the invention is by reacting an organopolysiloxane having the general formula ( 1 ) and / or an organopolysiloxane having the general formula ( 2 ) in the presence of a catalyst . herein r 1 is each independently hydrogen , hydroxyl or a substituted or unsubstituted monovalent hydrocarbon group , r 2 is each independently a substituted or unsubstituted monovalent hydrocarbon group , r 3 is hydrogen or a substituted or unsubstituted monovalent hydrocarbon group , and n is an integer of 2 to 10 , 000 . herein r 2 is each independently a substituted or unsubstituted monovalent hydrocarbon group , r 3 is hydrogen or a substituted or unsubstituted monovalent hydrocarbon group , and m is an integer of 4 to 15 . more particularly , r 1 which may be the same or different is a hydrogen atom , a hydroxyl group or a substituted or unsubstituted monovalent hydrocarbon group . suitable monovalent hydrocarbon groups include those of 1 to 12 carbon atoms , preferably 1 to 10 carbon atoms , for example , alkyl groups such as methyl , ethyl , n - propyl , isopropyl , n - butyl , isobutyl and t - butyl , cycloalkyl groups such as cyclohexyl , alkenyl groups such as vinyl , allyl and propenyl , aryl groups such as phenyl and tolyl , aralkyl groups such as benzyl and phenylethyl , and substituted forms of the foregoing groups in which one or more hydrogen atoms are substituted by halogen atoms or the like , such as 3 , 3 , 3 - trifluoropropyl . of these , hydrogen , methyl and phenyl are preferred , with the methyl and hydrogen being most preferred . methyl and hydrogen are preferred particularly when r 3 is hydrogen , and methyl is preferred particularly when r 3 is a monovalent hydrocarbon group . r 2 which may be the same or different is a substituted or unsubstituted monovalent hydrocarbon group , examples of which are the same as described for r 1 . inter alia , methyl and phenyl are preferred , with the methyl being most preferred . r 3 is a hydrogen atom or a substituted or unsubstituted monovalent hydrocarbon group , examples of which are the same as described for r 1 . inter alia , hydrogen , methyl and phenyl are preferred , with the hydrogen and methyl being most preferred . in formula ( 1 ), n is an integer of 2 to 10 , 000 , preferably 10 to 2 , 000 , more preferably 20 to 1 , 500 . in formula ( 2 ), m is an integer of 4 to 15 , preferably 4 to 10 . the method for preparing cyclic oligosiloxane according to the invention favors use of an organopolysiloxane having formula ( 1 ) as the starting reactant . in preparing the organopolysiloxane having formula ( 1 ), an organopolysiloxane having formula ( 2 ) can also be formed . the resulting organopolysiloxane mixture may be used without separation . in this mixture , the organopolysiloxane having formula ( 1 ) and the organopolysiloxane having formula ( 2 ) are present preferably in a ratio from 100 : 0 to 20 : 80 , and more preferably from 100 : 0 to 30 : 70 by weight . for reaction of the reactants , organopolysiloxanes having formula ( 1 ) and / or ( 2 ), a catalyst having the general formula ( 4 ) is used . herein m is a metal selected from among aluminum , titanium , zirconium , tin and zinc , p is the valence of the metal m , and r 4 is each independently a substituted or unsubstituted monovalent hydrocarbon group or a group of the formula ( 5 ). herein r 5 is each independently a substituted or unsubstituted monovalent hydrocarbon group . examples of monovalent hydrocarbon groups represented by r 5 are as will be described for r 4 , and are typically methyl , ethyl , propyl and phenyl , with methyl being most preferred . the subscript h is an integer of 0 to 100 , preferably 0 to 50 , and more preferably 0 to 20 . in formula ( 4 ), r 4 which may be the same or different is a substituted or unsubstituted monovalent hydrocarbon group , preferably of 1 to 12 carbon atoms , more preferably 1 to 10 carbon atoms . examples include alkyl groups such as methyl , ethyl , n - propyl , isopropyl , n - butyl , isobutyl and t - butyl , cycloalkyl groups such as cyclohexyl , alkenyl groups such as vinyl , allyl and propenyl , aryl groups such as phenyl and tolyl , aralkyl groups such as benzyl and phenylethyl , and substituted forms of the foregoing groups in which one or more hydrogen atoms are substituted by halogen atoms or the like , such as 3 , 3 , 3 - trifluoropropyl . of these , alkyl groups of 1 to 4 carbon atoms and phenyl are preferred , with methyl being most preferred . illustrative examples of the catalyst having formula ( 4 ) are given below . no particular limit is imposed on the technique of preparing the catalyst having formula ( 4 ). it may be prepared by the technique described in a . a . zhdanov , j . polymer sci ., 30 , 513 ( 1958 ), for example . an appropriate amount of the catalyst having formula ( 4 ) is 0 . 001 to 10 parts by weight , more preferably 0 . 01 to 5 parts by weight per 100 parts by weight of the reactants , organopolysiloxanes having formula ( 1 ) and / or ( 2 ). in the method of the invention , the reaction is preferably carried out at a temperature of room temperature to 250 ° c ., more preferably 130 ° c . to 200 ° c ., when r 3 is hydrogen , and at a temperature of 200 ° c . to 350 ° c ., more preferably 240 ° c . to 300 ° c ., when r 3 is a monovalent hydrocarbon group . also , the reaction may be carried out either under atmospheric pressure or under reduced pressure , preferably under a reduced pressure of up to 500 mmhg , more preferably 10 to 300 mmhg . if necessary , the reaction is followed by distillation . the disproportionation reaction according to the invention produces a cyclic oligosiloxane having the general formula ( 3 ): herein r 2 is each independently a substituted or unsubstituted monovalent hydrocarbon group , r 3 is hydrogen or a substituted or unsubstituted monovalent hydrocarbon group , k is an integer of 3 to 8 , preferably 4 to 6 , with the proviso that k & lt ; m when the organopolysiloxane of formula ( 2 ) is used . understandably , the cyclic oligosiloxane is generally produced as a mixture of cyclic oligosiloxanes having different degrees of polymerization . examples and comparative examples are given below for further illustrating the invention , but are not intended to limit the invention . a catalyst having formula ( i ) was synthesized according to the teaching of a . a . zhdanov , j . polymer sci ., 30 , 513 ( 1958 ). a 0 . 5 - l three - necked flask equipped with a stirrer and condenser was charged with 40 g of sodium trimethylsilanolate , after which 160 ml of benzene was added for dissolving the silanolate . at room temperature , a suspension of 12 . 4 g of aluminum chloride in 70 ml of benzene was added over one hour whereby the temperature increased from 20 ° c . to 40 ° c . at the end of the exothermic reaction , the reaction solution was filtered through a paper filter . the filtrate was added to a 1 - l flask which was heated in an oil bath , distilling off the benzene at atmospheric pressure . the solidified flask contents were purified by sublimation under vacuum , obtaining the target substance . its structure was identified by proton - nmr . a 1 - l four - necked flask equipped with a thermometer , stirrer , column packed with cylindrical glass of about 1 × 1 mm to a height of 500 mm , water - cooled condenser , outlet tube , and distillate receiver was connected to a vacuum pump . to the flask were fed 500 g of trimethylsilyl end - capped polymethylhydrogensiloxane having the formula : and 0 . 5 g of the catalyst ( i ) synthesized above , after which agitation was commenced . while the flask interior was kept under a reduced pressure of 50 mmhg , the flask was heated at 170 - 180 ° c . in an oil bath . a fraction that distilled out for 2 hours was collected ( 398 g ). the majority of this fraction was 1 , 3 , 5 , 7 - tetramethylcyclotetrasiloxane . the residue ( 40 g ) was a clear liquid . a 1 - l four - necked flask equipped with a thermometer , stirrer , column packed with cylindrical glass of about 1 × 1 mm to a height of 500 mm , water - cooled condenser , outlet tube , and distillate receiver was connected to a vacuum pump . to the flask were fed 500 g of trimethylsilyl end - capped polymethylhydrogensiloxane having the formula : and 0 . 1 g of the catalyst ( i ) synthesized above , after which agitation was commenced . while the flask interior was kept under a reduced pressure of 100 mmhg , the flask was heated at 160 - 170 ° c . in an oil bath . a fraction that distilled out for 2 hours was collected ( 356 g ). the majority of this fraction was 1 , 3 , 5 , 7 - tetramethylcyclotetrasiloxane . the residue ( 129 g ) was a clear liquid . a 1 - l four - necked flask equipped with a thermometer , stirrer , column packed with cylindrical glass of about 1 × 1 mm to a height of 500 mm , water - cooled condenser , outlet tube , and distillate receiver was connected to a vacuum pump . to the flask were fed 100 g of trimethylsiloxy end - capped dimethylpolysiloxane having a viscosity of 10 , 000 centistokes at 25 ° c . and 1 . 0 g of the catalyst ( i ) synthesized above , after which agitation was commenced . while the flask interior was kept under a reduced pressure of 50 mmhg , the flask was heated at 250 - 260 ° c . using a mantle heater . a fraction that distilled out for 14 hours was collected ( 45 g ). the residue ( 31 g ) was a clear liquid . a 1 - l four - necked flask equipped with a thermometer , stirrer , column packed with cylindrical glass of about 1 × 1 mm to a height of 500 mm , water - cooled condenser , outlet tube , and distillate receiver was connected to a vacuum pump . to the flask were fed 500 g of trimethylsilyl end - capped polymethylhydrogensiloxane having the formula : and 0 . 1 g of a catalyst al ( or ) 3 wherein r is isopropyl , after which agitation was commenced . while the flask interior was kept under a reduced pressure of 100 mmhg , the flask was heated at 160 - 170 ° c . in an oil bath . a fraction that distilled out for 2 hours was collected ( 460 g ). the majority of this fraction was 1 , 3 , 5 , 7 - tetramethylcyclotetrasiloxane . an analysis by gas chromatography revealed that by - products having added thereto an isopropoxide group originating from the catalyst , represented by the following formulae ( a ) and ( b ), formed in amounts of about 1 . 5 % and about 0 . 5 %, respectively . the residue ( 32 g ) was a clear liquid . in none of examples 1 to 3 , an alkoxy group bonded to si was detected on analysis of the fractions by gas chromatography . although some preferred embodiments have been described , many modifications and variations may be made thereto in light of the above teachings . it is therefore to be understood that the invention may be practiced otherwise than as specifically described without departing from the scope of the appended claims .	2
while this invention is susceptible of embodiment in many different forms , there are shown in the drawings , and will be described herein in detail , specific embodiments thereof with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the invention to the specific embodiments illustrated . u . s . provisional application 62 / 029 , 189 , filed jul . 25 , 2014 is herein incorporated by reference . a first embodiment is disclosed in fig1 - 8 . a second embodiment is disclosed in fig9 - 15c . fig9 - 15c illustrate a ball washing apparatus 10 according to a second embodiment of the invention . the ball washing apparatus 10 includes a ball washing body 12 connectable to a canopy support post of a golf cart utilizing a mounting apparatus 32 . the ball washing body 12 includes a cap - shaped cover 16 which is removably sealed to a cap - shaped reservoir 26 . the body 12 includes an actuator 36 for opening and closing the reservoir 26 with respect to the cover 16 . the actuator 36 includes a push rod 40 and a push knob 46 . the push rod 40 comprises a square cross - section . the push rod is guided through a square hole 40 a in a cover mount 12 a ( see fig1 a ) and is fixed by adhesive , set screw , press fitting , or the like , into a square hole 40 b in a reservoir mount 26 a ( see fig1 c ). the push knob 46 can be an actual golf ball fixed to the push rod . the golf ball can have indicia on it identifying the golf ball manufacturer or any other business . this is for novelty and advertising purposes . a power push button 48 exposed through a top of the cover 16 can be pushed down to commence the ball washing operation . the mounting apparatus 32 includes a stationary bracket 32 a mounted to the cover mount 16 a and an angle adjustable bracket 32 b that is mounted to the stationary bracket via a pivot bolt 32 c and a locking bolt 32 d . the angle adjustable bracket includes a curved slot 32 e . when the pivot bolt 32 c and the locking bolt 32 d are loosened , the angle adjustable bracket 32 b can be pivoted about the pivot bolt 32 c and the locking bolt relatively moves , although remaining stationary , through the curved slot as the curved slot moves with the pivoting of the angle adjustable bracket 32 b . once the angle is correctly adjusted the bolts 32 c , 32 d are tightened to lock the relative positions of the two brackets 32 a , 32 b . the bracket 32 b is fastened to a clamping bracket 32 f which tightly captures a canopy support post or the like on a golf cart or other structure . the ball washer can thus be adjusted in angle to be substantially vertical given an angled mounting post . fig1 illustrates in schematic form the push button 48 connected to a momentary switch which receives electric power from the golf cart battery or other power source or power generator . the switch is connected to a timer which delivers power for a pre - determined amount of time to an electric gearmotor 50 . the gearmotor 50 is mounted on a motor mount plate 54 by screws . a disc shaped brush 56 having downwardly directed bristles is mounted to an underside of the plate 54 . fig1 also illustrates the reservoir 26 is sealed along a top edge of the reservoir to the plate 54 by an o - ring or other flexible element 27 of the plate 54 . an annular shaped brush 66 having upper , radially inward directed bristles 68 extending from an outer base ring 69 and facing golf balls 67 a , 67 b to be washed ; and lower , radially inward directed bristles 70 extending from the outer base ring 69 is fit snugly within the reservoir 26 . the brush 66 is reversible for a prolonged useful life by removing and inverting the brush and making the bristles 70 now face the golf balls 67 a , 67 b . although only the left and right profiles of the bristles are shown it is to be understood that the bristles 68 , 70 can extend around the inside surface the base ring 69 for 360 degrees . the reservoir 26 is designed to sealingly hold a ball washing fluid , e . g ., water and soap . a ball cradle 80 is shown in fig1 a - 15c . the cradle 80 has the capacity to hold one or two golf balls 67 a , 67 b and is mounted to a downwardly extended rotary output motor shaft 84 of the motor 50 via a sleeve 85 . a set screw 84 a fixes the motor shaft 84 within the sleeve 85 and a pair of screws 96 a , 96 b fixes the sleeve 85 to a mount portion 96 of the ball cradle 80 via holes in the portion 96 and corresponding holes in the sleeve 85 . the ball cradle 80 includes a circular ball supporting plate 86 and semi - circular ball side guides 88 , 90 . in order to guide the downward movement of the reservoir with respect to the cap , two guide rods 102 , 104 are provided as shown in fig1 a , 11 and 12 . the guide rods are fixed to a top of the cover mounting assembly by adhesive or press fitting or other fixing means at points 102 a , 104 a respectively . the guide rods extend downward in parallel and are guided by guide holes 102 b , 104 b respectively in the reservoir mount . in order for the reservoir to return to its closed operational position , two coil springs 106 , 108 are provided as shown in fig1 , 10a and 11 . the springs 106 , 108 are fixed at bottom ends 106 a , 106 b respectively to a spring hook 110 mounted to the reservoir mount . top ends 106 b , 108 b respectively of the springs 106 , 108 are fixed to a spring support 114 that is fixed to a top of the cover mount . thus , when the reservoir is separated from the cap to load or unload golf balls as shown in fig1 a , the springs 106 , 108 are stretched and the reservoir is urged back up toward the cap . the plate 54 includes bosses 54 a for screw mounting the motor 50 on one side and bosses 54 b for screw mounting the brush 56 on the opposite side ( see fig1 a - 14d ). a threaded drain opening 26 c for receiving a plug 26 d is provided on the bottom of the reservoir ( see fig1 and 13c ). the cover 16 , the reservoir 26 , the motor mount plate 54 and ball carriage 80 can all be composed of black uv abs . hardware can be aluminum , stainless steel or the like . fig1 - 20 are views of an alternate embodiment ball washer 200 . some components are not shown to see underlying components . for example the cover 16 is not shown and the reservoir 326 is shown in fig2 . all the components of assembly of the ball washer 10 are included in the ball washer 200 and are identical and serve identical functions as in the ball washer 10 , except as noted . according to this embodiment , an alternate ball cradle 280 is used that is fixed to a shaft 290 via two roller pins 291 , 292 ( shown also in fig1 ). the shaft 290 is also coupled to a coupling 300 using a roller pin 301 ( shown also in fig1 ). the coupling includes a semi - circumferential slot 306 . the roller pin 301 is fixed into the shaft 290 and captured in the slot 306 . the slot allows a rotational lost motion between the shaft 290 and the shaft 330 of the motor 50 . thus after the wash cycle is complete , and the ball washer opened , the user can manually rotate the ball cradle in the opposite direction of the motor turning direction , within the angular limit of the slot , to facilitate removal of the golf balls . this is convenient in the case that the motor stops with one of the balls in the back of the washer . the coupling 300 is attached to a motor shaft 330 of the gearmotor 50 ( shown in fig1 ) by a set screw 331 in a tapped hole 332 ( shown also in fig1 ). the ball cradle 280 includes a top plate 281 , a central portion 282 for receiving the shaft 290 through a hole 283 , curved sidewalls 284 , 285 for guiding golf balls and bottom walls 286 , 287 for supporting golf balls . fig2 shows the reservoir 326 includes a brass bushing 327 fixed to the bottom of the reservoir that receives a bottom end of the shaft 290 when the reservoir is raised to the closed position for golf ball washing . the shaft extends 290 down into the bushing 327 to stabilize the rotation of the ball cradle from wobbling during the wash cycle . fig2 - 26 illustrate a ball washing apparatus 500 . the ball washing apparatus 500 includes a ball washing body 502 connectable to a canopy support post of a golf cart utilizing a mounting apparatus 507 . the ball washing body 502 includes a lid 506 which is hinged to a cap - shaped housing 512 . the body 502 includes a knob 526 for opening and closing the lid 506 with respect to the housing 512 . the knob 526 is fastened to the lid with a fastener . the knob 526 can be in the form of a golf ball , or an actual golf ball . the golf ball can have indicia on it identifying the golf ball manufacturer or any other business . this is for novelty and advertising purposes . the mounting apparatus 507 includes a stationary bracket 540 mounted to the housing 512 , by screws or other means , and an angle adjustable bracket 542 . the angle adjustable bracket 542 is comprised of two mirror image configured members 542 a , 542 b . the bracket 542 is mounted to the stationary bracket 540 via a pivot bolt 543 and nut passed through aligned pivot holes 544 through both brackets 540 , 542 , and a locking bolt 545 and nut that can be inserted through selectable holes 546 through both brackets 540 , 542 to set an angular orientation between the two brackets 540 , 542 . to adjust the angle between the brackets 540 , 542 , the bolt 543 is loose while the bolt 545 is not installed into the holes 546 . the bracket 542 can be pivoted with respect to the bracket 540 until a selectable hole grouping 546 is aligned to receive the bolt 545 which is passed through the selected holes 546 . once the angle is correctly adjusted , the bolts 543 , 545 and corresponding nuts are tightened to lock the relative positions of the two brackets 540 , 542 . unlike the previous embodiment , a curved slot is not used to adjust the angle , rather a plurality of holes 546 are used between the brackets 540 , 542 which align or register corresponding to incremental angular orientations of the bracket 542 with respect to the bracket 540 . the bracket 542 is clamped to a canopy support post or the like on a golf cart or other structure . the bracket 542 is clamped by two bolts and corresponding nuts ( not shown ) that span through upper holes 560 and lower holes 562 respectively and when tightened , clamps the canopy support post between the members 542 a , 542 b . the members 542 a , 542 b include inward facing ridges 566 that define , with inward facing walls 568 , a rectangular space for capturing the canopy support post in a confined clamped area that prevents angular tilting of the bracket 542 on the canopy support post . the ball washing apparatus can thus be attached at an angle to be substantially vertical given an angled mounting post . fig2 illustrates in schematic form the push button 580 connected to a momentary switch 582 which receives electric power from the golf cart battery or other power source or power generator . the switch is connected to a timer 586 which delivers power for a pre - determined amount of time to an electric gearmotor 590 . as an alternative to the push button 580 , the closing of the lid 506 can trigger the timer 586 . opening of the lid can automatically stop the motor . the gearmotor 590 is mounted to a bottom of the housing 512 by screws or other means . a cup shaped basin 604 has a cup shaped scrubbing pad 606 within . the basin is configured to hold cleaning fluid for washing the golf balls . the basin 604 includes a central pipe 610 . the pad 606 includes a central hole for allowing the pipe to extend therethrough so that the pad can be fit snugly down onto the bottom of the basin and rising up along the walls of the basin . a rubber gasket 613 seals the lid 506 to an upper rim of the basin 604 when the lid is closed . a ball paddle body 620 ( fig2 ) is mounted to a drive shaft 624 via a fastener 622 . the ball paddle body 620 includes four curved paddles 620 a curved toward each other in pairs to hold two golf balls , one golf ball between each pair of paddles that are curved toward each other . the drive shaft 624 is connected to the gearmotor 590 . the ball paddle body 620 fits snuggly between the pipe and the pad and is configured to receive two golf balls . the paddles 620 a have slots 620 b to allow cleaning fluid to pass through the paddles . the basin and pad are stationary with respect to the housing 512 while the gearmotor 590 and the drive shaft spin the paddles . during operation the golf balls spin revolve with the spinning paddle in the cleaning fluid and are cleaned by contact with the pad . the golf balls will also tend to spin during revolution of the golf balls about the spinning axis of the ball paddle body 620 . a cup shaped cover 650 is fastened to a bottom of the housing 512 and encloses the gearmotor 590 and electronics . the paddles 620 are removable through the top by opening the lid 506 and unfastening the fastener 622 . the pad 606 is then removable through the top , as is the basin 604 . the basin pipe 610 slides upward over the shaft 624 . the parts can be cleaned easily or replaced and reinstalled . the lid 506 , housing 512 and cover 650 are preferably impact and uv resistant plastic . in operation , the basin 604 is filled with cleaning fluid , the lid 506 is opened , two golf balls are inserted into the wash basin 604 onto the scrubbing pad 606 , each golf ball fit within two paddles 620 a . the lid 506 is closed and the start button 580 is activated to begin a 15 second wash cycle . the wash cycle shuts off after 15 seconds . from the foregoing , it will be observed that numerous variations and modifications may be effected without departing from the spirit and scope of the invention . it is to be understood that no limitation with respect to the specific apparatus illustrated herein is intended or should be inferred .	0
this description pertains in some specific embodiments to televisions with the capability to run java ( or similar ) applets and display output from the java applets to the television display . however , the invention is not limited to use with java applets or televisions . other embodiments of the invention may be used with any type of graphics plane or any type of display device . java is an object - oriented programming language originally developed by sun microsystems . one attractive feature of java is that it can be used to produce platform - independent “ applets ,” which are class files that are written in a higher level than machine code . accordingly , the applets can be downloaded to computers running different operating systems , i . e ., microsoft windows , unix , linux , apple os , etc ., and run from a java platform that is machine - specific . among other things , such applets can be embedded in html pages to provide interactive content on a user &# 39 ; s web browser . standard java does not support multi - plane graphics , which can be highly desirable in a television where multiple concurrently executing applets may be necessary and / or the system itself may need to create java output . the principles explained herein can also be applied to other java - enabled electronic devices such as pdas ( personal data assistants ), cellular phones , and gaming devices . as used herein , a television primarily functions to display video from one or more external video sources . the television embodiments described herein still retain this primary function , but have added capabilities to run applets that can create graphical output that overlays ( or supercedes ) a video source . as televisions generally do not possess the voluminous processing and storage resources of a computer , are expected to fit in a clean form factor similar in size to the display itself , and preferably are operable by persons with less technical expertise than computer users , using simpler interface devices , running applets on a television presents particular challenges that are addressed herein . in particular , newer lcd and plasma televisions tout their thinness and lightness as selling points , and thus have little room for the bulky heat - generating components of a fast computer . conventional televisions offer a fixed set of pre - loaded graphical applications , typically limited to configuration menus for the television . the embodiments below can include a richer set of pre - loaded applets / applications , for instance voice messaging , timers , media players / recorders / time shifters and media locator / selectors , etc . the embodiments also offer a viewer the capability to select other applets — not preloaded on the television — and run the applets on the television . in addition to new or upgraded applets developed specifically for the television platform (“ platform - aware ” applets ), the embodiments preferably also allow a viewer to run applets that are platform independent , such as games or other applets that are typically available to computer users . because platform - independent applets are currently developed without use by a television viewer as a primary consideration , the television embodiments herein preferably allow such applets to run as expected , while still allowing the television to function as expected . to allow a viewer to provide new applets to the television , the television in some embodiments contains a removable device port , which supports media , as well as other removable devices . in some embodiments , the removable device port comprises one or two pcmcia ( personal computer memory card international association ) pc card ports . the pc card and its ports are described in a series of standards dating back to the 1980s , for instance , pc card standard 8 . 0 release — april 2001 . the pc card interface was developed for laptop computers and other computers that do not provide the large internal card bays ( e . g ., for peripheral component interconnect cards ) of desktop and tower servers . pc cards manufactured today provide ethernet network interfaces , modems , wireless network interfaces ( e . g ., ieee 802 . 11x ), mass storage with micro disk drives or flash memory ( compactflash ), and compactflash adapters for other flash formats such as memory stick , multimedia card , secure digital , smartmedia , and xd . in some embodiments , applets can be provided to the television by loading the applets to a mass storage device , e . g ., from a computer , or purchasing a mass storage device with the applets preloaded , and then connecting the mass storage device to the pc card port . alternately , with a wireless network interface card inserted in the pcmcia port , applets stored on a personal computer on the same wireless network can be accessed at the television . additionally , the television may accept and support other pcmcia - compatible devices . fig1 contains a block diagram for a liquid crystal display ( lcd ) television capable of operating according to some embodiments of the present invention . television 100 contains an lcd panel 102 to display visual output to a viewer based on a display signal generated by an lcd panel driver 104 . lcd panel driver 104 accepts a primary digital video signal in ccir656 format ( eight bits per pixel yc b c r , in a “ 4 : 2 : 2 ” data ratio wherein two c b and two c r pixels are supplied for every four luminance pixels ) from a digital video / graphics processor 120 . a television processor 106 provides basic control functions and viewer input interfaces for television 100 . television processor 106 receives viewer commands , both from buttons located on the television itself ( tv controls ) and from a handheld remote control unit ( not shown ) through the ir port . based on the viewer commands , television processor 106 controls an analog tuner / input select section 108 , and also supplies user inputs to the digital video / graphics processor 120 over a universal asynchronous receiver / transmitter ( uart ) command channel . television processor 106 is also capable of generating basic on - screen display ( osd ) graphics , e . g ., indicating which input is selected , the current audio volume setting , etc . television processor 106 supplies these osd graphics , when activated , as a tv osd signal to lcd panel driver 104 for overlay on the display signal . analog tuner / input select section 108 allows television 100 to switch between various analog ( or possibly digital ) inputs for both video and audio . video inputs can include a radio frequency ( rf ) signal carrying standard broadcast television , digital television , and / or high - definition television signals , ntsc video , s - video , and / or rgb component video inputs , although various embodiments may not accept each of these signal types or may accept signals in other formats ( such as pal ). the selected video input is converted to a digital data stream , dv in , in ccir656 format and supplied to a media processor 110 . analog tuner / input select section 108 also selects an audio source , digitizes that source if necessary , and supplies that digitized source as digital audio in to an audio processor 114 and a multiplexer 130 . the audio source can be selected — independent of the current video source — as the audio channel ( s ) of a currently tuned rf television signal , stereophonic or monophonic audio connected to television 100 by audio jacks corresponding to a video input , or an internal microphone . media processor 110 and digital video / graphics processor 120 provide various digital feature capabilities for television 100 , as will be explained further in the specific embodiments below . in some embodiments , processors 110 and 120 can be tms320dm270 signal processors , available from texas instruments , inc ., dallas , tex . digital video / graphics processor 120 functions as a master processor , and media processor 110 functions as a slave processor . media processor 110 supplies digital video , either corresponding to dv in or to a decoded media stream from another source , to digital video / graphics processor 120 over a dv transfer bus . media processor 110 performs mpeg ( motion picture expert group ) coding and decoding of digital media streams for television 100 , as instructed by digital video / graphics processor 120 . a 32 - bit - wide data bus connects memory 112 , e . g ., two 16 - bit - wide × 1m synchronous dram devices connected in parallel , to processor 110 . an audio processor 114 also connects to this data bus to provide audio coding and decoding for media streams handled by media processor 110 . dotted line 116 divides the media processor subsystem from the host processor subsystem . media processor 110 cannot directly access the devices on the right ( host ) side of dotted line 116 . digital video / graphics processor 120 can access media processor 110 and memory 112 directly , however , and thus indirectly provides connectivity between media processor 110 and flash memory 126 or pcmcia cards 128 . digital video / graphics processor 120 coordinates ( and / or implements ) many of the digital features of television 100 . a 32 - bit - wide data bus connects memory 122 , e . g ., two 16 - bit - wide × 1m synchronous dram devices connected in parallel , to processor 120 . a 16 - bit - wide system bus connects processor 120 to media processor 110 , an audio processor 124 , flash memory 126 , and ports for removable pcmcia cards 128 . flash memory 126 stores boot code , configuration data , system executable code , and java code / class files for graphics applications and applets , etc . pcmcia cards 128 can provide extended media and / or application capability , such as the java applets explained herein . digital video / graphics processor 120 can pass data from the dv transfer bus to lcd panel driver 104 as is , but processor 120 can also supercede , modify , or superimpose the dv transfer signal with other content . for instance , processor 120 can generate java application / applet graphics that overlay or supercede the dv transfer signal , system graphics that display messages over all underlying content , or decode media from pcmcia cards 128 , e . g ., in a “ time - shifting ” mode where media processor 110 is coding a program to the pcmcia card and processor 120 decodes and displays a time - shifted version of the same program , allowing the viewer to pause , rewind , or skip through the program . multiplexer 130 provides audio output to the television amplifier and line outputs ( not shown ) from one of three sources . the first source is the current digital audio in stream from analog tuner / input select section 108 . the second and third sources are the digital audio outputs of audio processors 114 and 124 . these two outputs are tied to the same input of multiplexer 130 , since each audio processor is capable of tri - stating its output when it is not selected . in some embodiments , processors 114 and 124 can be tms320vc5416 signal processors , available from texas instruments , inc ., dallas , tex . at system powerup , digital video / graphics processor 120 creates an executable image for itself in memory 122 and for media processor 110 in memory 112 . flash memory 126 stores the elements of this image as default system code for processors 110 , 114 , 120 , and 124 . this code includes : a system manager , a java engine , which may contain any combination of a just - in - time java compiler , a java interpreter , or precompiled java code , and an application manager such as a java manager that manages java applets for processor 120 ; audio codecs for processors 114 and 124 ; and video codecs for processors 110 and 120 . the system manager provides low - level functions for communication with the other devices attached to processor 120 , and communicates system events to the java manager and other processes . the java engine interprets and executes java code for the java manager , and java applets when applets are loaded . referring to fig2 , processor 120 works at various times with up to three display planes : a system display plane 30 , an applet display plane 40 , and a video and still image plane 50 . the rearmost plane 50 can contain digital video received at the dv transfer port from processor 110 or decoded mpeg video or jpeg images , as well as images originally stored in other formats . the middle plane 40 is active when a java applet 95 has focus , or when the java manager displays graphics on the middle plane . the front plane 30 is used , typically infrequently , to display alert and status messages from the java manager . these messages can include message requests from a platform - aware java applet 90 that does not have focus . to create the digital video stream for the display , software mixer 200 and hardware mixer 70 combine information from display planes 30 , 40 , and 50 . software mixer 200 combines information from display planes 30 and 40 , as will be explained in further detail below . a look - up table ( lut ) is used in block 60 to convert the output of software mixer 200 to the yc b c r color space of video plane 50 . the output of lut color conversion block 60 is combined with video plane 50 in hardware mixer 70 . fig3 shows internal detail of software mixer 200 . applet plane graphics are rendered to applet display buffer 210 . system plane graphics are rendered to system display buffer 220 . although it is possible to merge graphics from these two planes in a fairly mindless fashion for each video frame , display artifacts would be visible to a viewer from time to time , and a significant percentage of available processing resources would be consumed merely to perform the merge . mixer 200 , however , takes advantage of the observations that system graphics are displayed a small percentage of the time and usually occupy a small region of the viewable area to provide visually acceptable mixing while consuming far less resources . the output of software mixer 200 is taken at a multiplexer 280 . multiplexer 280 can take input from one of three buffers : applet display buffer 210 , system display buffer 220 , or an anti - flicker display buffer 270 . the multiplexer select signal is generated by region manager 290 , and the select criteria will be explained below . to summarize , however , if only one of the applet and system display planes is active , mixing is bypassed to save resources , and two switches 240 and 245 remain open . only when both display planes are active are switches 240 and 245 closed to cause mixing to occur . further , even when both display planes 210 and 220 are active , mixing is only performed regionally as needed . region manager 290 tracks which regions of buffers 210 and 220 are being updated , and controls a mux control block 230 , a multiplexer 250 , and the addressing of a composite display buffer 260 and the anti - flicker display buffer 270 to mix only the updated regions . in order to intelligently control mixing , region manager 290 receives two types of notifications : system graphics section registration ( and unregistration ) notifications from the java manager ; and paint region notifications for both display buffers from the java engine . in other embodiments , the registration notifications and paint region notifications are received from other sources , such as an application manager . the region manager 290 can be implemented , wholly or partly , within the java engine . referring to fig4 , when the java manager 300 desires to paint system graphics to a region of the display , it calls a java engine api ( application programming interface ) to register a rectangular section of the display bounding the desired region ( the system graphics need not be rectangular , but the registered section is preferably rectangular for simplicity ). for instance , fig4 shows two registered section of the system display plane . section 1 is described by the parameters ( x 1 , y 1 , w 1 , h 1 ), which respectively specify the section &# 39 ; s left boundary with respect to the left edge of the display , the section &# 39 ; s upper boundary with respect to the top edge of the display , the section &# 39 ; s width , and the section &# 39 ; s height . section 2 is described by similar parameters ( x 2 , y 2 , w 2 , h 2 ). a second api allows the java manager to unregister a previously registered section . in some embodiments , region manager 290 maintains a linked list of registered system graphics areas , with the head of the list maintained by a pointer systemgraphics section head that is initially a null pointer . when the java manager requests registration of section 1 , a node is added to the linked list containing the parameters ( x 1 , y 1 , w 1 , h 1 ) and a next pointer that is initially null . when the java manager subsequently requests registration of section 2 , a second node is added to the linked list containing the parameters ( x 2 , y 2 , w 2 , h 2 ) and a next pointer that is initially null . the next pointer of the first node is modified to point to the second node to create the linked list shown in fig4 . when the java manager unregisters a region , the corresponding node is removed from the linked list . whenever systemgraphics section head is not null , region manager 290 assumes that system graphics are active . note that region manager 290 can in some embodiments choose to merge two linked list nodes to a single bounding rectangle node , particularly if the regions overlap . the second type of notification received by region manager 290 is a paint region notification . whenever an applet with focus or a component of the java manager calls a routine to draw to applet display buffer 210 , the draw or paint routine notifies region manager 290 that a rectangular bounding region for the routine has been modified . whenever the java manager draws to system display buffer 220 , the draw or paint routine sends a similar notification to region manager 290 . region manager 290 uses paint region notifications to create a second linked list similar to the system graphics section linked list . as shown in the flowcharts of fig5 - 7 , region manager 290 uses the paint region linked list to control mixing when both buffers 210 and 220 are active . returning briefly to fig3 , mux control 230 controls the mixing operation of multiplexer 250 . mux control 230 causes multiplexer 250 to operate on the portions of buffers 210 and 220 that are newly added to the paint region linked list . if a newly - painted section does not overlap a current system graphics section , switch 245 is kept open and the paint region is copied to the composite display buffer . when a system graphics section is overlapped , mixing is required . in that case , mux control 230 looks for a hard key in the pixel data coming out of system display buffer 220 : when the hard key is not set for a particular pixel , the current pixel in buffer 220 is copied to composite display buffer 260 ; when the hard key is set for a particular pixel , the current pixel in buffer 210 is copied to composite display buffer 260 . in some implementations , the hard key is a pixel value of zero , which indicates a transparent pixel . fig5 shows the high - level mixing control operation of region manager 290 . the output of mixer 280 depends on whether system graphics are enabled and whether an applet ( or the java manager ) has focus . when both of these conditions are false , region manager 290 disables hardware mixing and multiplexer 280 need not produce any output . when system graphics are disabled but an applet has focus , the applet display buffer 210 output is selected for hardware mixing with video . when system graphics are enabled and an applet does not have focus , the system display buffer 220 output is selected for hardware mixing with video . and when system graphics are enabled and an applet has focus , software mixing is required . when software mixing is required , region manager 290 determines whether the status of the system display or applet display has changed since the last time region manager 290 performed this analysis . in particular , if mixing was not performed on the immediately preceding frames , the anti - flicker display buffer 270 likely is not current and should be initialized before multiplexer 280 switches to accept output from buffer 270 . in this instance , region manager 290 sets the whole display area as an update region before initiating mixing . during software mixing , the output of buffers 210 and 220 is mixed to composite display buffer as shown in fig6 , and the anti - flicker display buffer is updated as shown in fig7 from the composite display buffer on a frame interrupt to prevent frame tearing . once the anti - flicker display buffer is stable , region manager 290 selects the anti - flicker display buffer for hardware mixing . fig6 shows the software mixing process . when no newly painted regions have been added to the paint region linked list since the last mixing operation , no software mixing is required and the routine returns . otherwise , the first region in the paint region linked list is selected . region manager 290 determines whether the paint region overlaps a system region in the system graphics section linked list : when the regions overlap , the output of buffers 210 and 220 are merged into composite display buffer 260 , as previously described , for the paint region ; when the paint region does not overlap any registered system region , the corresponding region of applet display buffer 210 is copied to composite display buffer 260 . once the composite display buffer has been updated for a paint region , the corresponding node in the paint region linked list is modified to indicate a status of “ mixed .” region manager 290 then traverses to the next node in the paint region linked list . when the next region is null , the end of the list has been reached and the software mixing routine exits . when the next paint region is not null and has not been mixed already , the software mixer loops back up and processes the new region as described for the first region . fig7 shows the anti - flicker display buffer update process . preferably , an anti - flicker display buffer update routine is called on frame interrupt so that updates are synchronized with the display sequencing . region manager 290 determines whether any paint regions in the paint region linked list have been marked as “ mixed .” when no newly mixed regions have been added to the paint region linked list since the last mixing operation , no anti - flicker display buffer updates are required and the routine returns . otherwise , the first region in the paint region linked list is selected . region manager 290 determines whether the first paint region has been mixed yet to the composite display buffer ; when it has , the region is copied from the composite display buffer to the anti - flicker display buffer and the region is removed from the paint region linked list . when the first paint region has not yet been mixed , processing is bypassed for that region . region manager 290 then traverses to the next node in the paint region linked list . when the next region is null , the end of the list has been reached and the anti - flicker display buffer routine exits . when the next paint region is not null , the routine loops back up and processes the new region as described for the first region . the java engine allows multiple java applets to run concurrently with each other and with the java manager . as just described , however , only one applet at a time can have the “ focus ” of the viewer &# 39 ; s remote control or other input device and perform updates to the applet display buffer . platform - aware applets can be written to understand what it means to receive and lose focus , but no such assumption can be made when the viewer is allowed to load platform - independent java applets from the pcmcia port . thus the television embodiments are designed to cope with two types of java applets : platform - aware applets , which are coded specifically to interoperate with the java manager and platform - specific apis , and platform - independent applets , which are not . generally , the applets that are factory - loaded into flash memory 126 are platform - aware applets , while applets accessible through pcmcia cards can be either platform - aware applets or platform - independent applets . platform - aware applets have access to platform - specific apis to perform such functions as channel and volume changes , picture - in - picture functions , jpeg and mpeg4 display , etc . the java manager includes a class ( the application manager ) that functions as a java applet browser / launcher . the application manager can be assigned to a specific key on the viewer &# 39 ; s remote control and / or can be activated from a menu . the application manager maintains a list of currently - available java applets that are available to the viewer . this list will typically include some of the java applets stored in flash memory 126 ( some may only be available to other java applets and not to the viewer ) and any applets found using pcmcia cards 128 . preferably , the application manager locates descriptor files and icons for each available applet and can then present the applets to a viewer in an easily - comprehended graphical format . note that if a pcmcia card 128 provides wireless connectivity to multiple “ shares ,” where a share is a shared resource located on a computer or other wireless device , applets available on each share can be arranged in the graphical format by share . assume for the following example that the application manager 310 is the described application manager and a platform - aware applet b 320 is an mp3 player . in addition , assume that the application manager has located two platform - independent applets , an applet c 330 and an applet d 340 , which could be for instance a solitaire game and a checkers game , respectively . fig8 a - 8h illustrate applet / manager function as a viewer navigates between the application manager , these various applets , and the video function of the television . an applet that is currently not loaded to memory 122 is depicted with a dashed border ; an applet that is loaded to memory 122 is depicted with a solid border ; and an applet that has focus is depicted with a bold solid border . in fig8 a , the viewer selects application manager 310 from a remote control . the java manager 300 is notified of the viewer selection and directs focus to the application manager class . the java engine is notified that the application manager class will now receive focus and receives a request to begin executing the class files for the application manager if they were not executing already . the application manager locates the applets available to the viewer in flash memory and through a pcmcia card and creates a browse / launch display in applet display buffer 210 . the viewer may then use remote control buttons to navigate and select one of the displayed applets , with the application manager modifying its display according to the navigation commands in order to interact with the viewer . when a user selects one of the displayed applets , the application manager notifies java manager 300 that the viewer has requested the launch of an applet . for instance , in fig8 b , the viewer selects applet b , the mp3 player . the java manager 300 calls the java engine to launch applet b . application manager 310 loses focus and can no longer paint to the applet display buffer . the java engine is notified that applet b will now receive focus and receives a request to begin executing the class files for the mp3 player . applet b may provide to the viewer , for instance , playlists or individual mp3 file lists for mp3 files accessible through the pcmcia cards 128 . the viewer may then use remote control buttons to navigate and select an mp3 file , files , or playlist and hit “ play ” to begin playing the selected mp3 media through audio processor 124 . although the application manager has now lost focus , it still runs in a background mode . when a new pcmcia card is inserted or removed from the television , or new shares appear or disappear from the wireless lan , the application manager can be programmed to notify the viewer that the list of available applets has changed . for instance , on pcmcia card removal , all running processes receive a broadcast message that the card has been removed . upon receiving this message , since the application manager does not have focus , it can signal another section of the java manager to request a transient system message , e . g ., “ some applets no longer available — press applets key to view current list ”. java manager 300 requests a system graphics section for the message and displays it to system display buffer 220 . referring now to fig8 c , the viewer now selects a video mode , causing applet b to lose focus . java manager 300 asks applet b whether it can be killed . in this example , applet b responds “ no ,” at which time applet b is notified that it has lost focus and can no longer paint to the applet display buffer . the java engine is notified that applet b has lost focus , but applet b can continue to play mp3 files in a background mode . like the application manager , applet b can use the java manager to display status messages , such as a song name when a new song starts , on the system display buffer . in fig8 d , the viewer presses a button to return focus to the application manager . the java engine is notified that the application manager now has focus , the application manager is notified that it has focus , and the application manager once again draws its applet browser display to applet display buffer 210 . in fig8 e , the viewer selects a platform - independent applet c ( the solitaire game ) and launches it , causing a series of events similar to those described for fig8 b . the solitaire game class files are loaded from the pcmcia card to memory 122 and applet c is launched . whereas applet b registered as a platform - aware applet when launched , applet c has no such registration function , and thus the java manager 300 and java engine know that applet c has no platform specific provisions for receiving and losing focus . applet c output is directed to the applet display buffer and the viewer can operate the applet using remote control buttons . since the applet display buffer requires no special api controls , platform - independent applets can write to it without problem . the java engine and software mixer allow the platform - independent applets to function in a manner that is compatible with the television platform . in fig8 f , the viewer once again selects the application manager to regain focus . applet c cannot continue to run because it does not have the ability to direct its output anywhere but the applet display buffer , and thus would interfere with the output of the application manager . applet c can either be killed or “ paused ,” i . e . remain in memory but not receive any calls , as a design choice . if paused , applet c can potentially be resumed by reselecting it from the application manager . the kill or pause decision can also be based on other criteria , such as memory usage . thus if memory usage is high , the oldest “ paused ” applets can be deleted from memory . fig8 g illustrates a case where the viewer selects a different platform - independent applet d to run . before applet d class files are loaded , applet c can be killed to free memory , and then applet d can be launched and run in similar fashion to applet c . finally , in fig8 h the viewer once again selects a video mode , causing the java manager to pause ( or optionally kill ) applet d . although optional , the application manager could allow other applet - related activities . for instance , applets could be copied from a network share to pcmcia mass memory . or , a “ favorite applet ” could be designated and saved to flash memory 126 . one of ordinary skill in the art will recognize that the concepts taught herein can be tailored to a particular application in many other advantageous ways . in particular , those skilled in the art will recognize that the illustrated embodiments are selected from many alternative implementations that will become apparent upon reading this disclosure . the particular functional block groupings used herein present one possible functional grouping , but functions can be subdivided and / or combined in many other combinations that fall within the scope of the appended claims . although java applets have been described , the described embodiments can be used with other object - oriented coding schemes . the removable device port can be a port other than a pcmcia port . for instance , a firewire ( ieee 1394 ) or usb ( universal serial bus ) 2 . 0 port can be used to connect a removable device . ports that directly accept memory stick , multimedia card , secure digital , smartmedia , and / or xd flash devices can also be used . two java buffers have been described , but more can exist and be integrated into the described mixing schemes . mixing with a single hard key has been described , but more complicated mixing schemes are possible . such minor modifications are encompassed within the embodiments of the invention , and are intended to fall within the scope of the claims . the preceding embodiments are exemplary . although the specification may refer to “ an ”, “ one ”, “ another ”, or “ some ” embodiment ( s ) in several locations , this does not necessarily mean that each such reference is to the same embodiment ( s ), or that the feature only applies to a single embodiment .	6
the present invention relates to a hydraulic load lifting system and , in particular , to a system including a hydraulic cylinder and means for preventing a load carried by said cylinders from moving should a leak occur in the hydraulic line to the cylinder . hydraulic systems , such as those found in excavators and the like , employ a hydraulic cylinder to raise and lower relatively heavy loads and at times to support such loads in an elevated position . when the cylinder is required to support the load in such an elevated position , it is normally desirable to isolate the relatively high load generated pressure in the load supporting end of the cylinder from the remainder of the system . this is to prevent the downward drifting of the load due to leakage past a valve spool of a conventional control valve normally used in such systems . the load pressure is also normally isolated to prevent the sudden dropping of the load in the event of a hydraulic line failure or the like . this isolation can be accomplished by the positioning of a load check valve in the hydraulic line leading from the control valve to the hydraulic cylinder . such a load check valve permits the free flow of fluid to the cylinder , but normally prevents the escape of fluid from the cylinder . the load check valve can be of the type which is vented behind the check valve spool , such that the check valve closes the hydraulic line when the venting line is blocked . when the venting line is opened , hydraulic fluid can flow from the cylinder to the control valve and from the control valve to the cylinder . the load check valve can be mounted directly to the hydraulic cylinder eliminating the need for a conduit to connect the cylinder to the check valve and thus eliminating the possibility of a break therein . however , there is always a possibility that a rupture might occur in the hydraulic line which connects the load check valve to the control valve . if such a rupture occurs and if the venting line from the load check valve is not closed , the load can fall until the operator of the hydraulic system realizes that the load is falling and acts to block the vent line , preventing the load from dropping still further . the present invention is directed to overcoming one or more of the problems as set forth above . in a hydrauluc system comprising a check valve having a main line and a vent line , the improvement includes a blocker means for closing said vent line when the pressure in said main line falls below a predetermined level . accordingly , should a break in the main line between the load check valve and the control valve occur , back pressure in said line would fall . the blocker means can sense this reduction in pressure and can automatically close the vent line preventing the check valve from allowing hydraulic fluid to flow from the cylinder . thus , the system automatically prevents the load from falling without the operator being required to sense the falling load and then act to close the vent line . in another aspect of the invention , the blocker means includes a blocker valve positioned in the vent line , the blocker valve actuated by a resolver means which selects the lowest pressure in the main line between two sensed positions in said main line . thus , if a break occured in one portion of the main line , the resolver means will immediately select the lower main line pressure occuring adjacent the break and communicate said pressure to the blocker valve of the main line to shut the vent line , preventing the load from falling . the figure shows an overall schematic circuit diagram of a hydraulic load lifting system which includes a blocker valve and a sectioned resolver valve embodiment of the present invention . the hydraulic load lifting system of the figure , except for the aforementioned blocker valve and the resolver valve , is described in u . s . pat . no . 4 , 000 , 683 issued on jan . 4 , 1977 to lawrence f . schexnayder . for purposes of brevity , only the main features of the hydraulic system are discussed hereinbelow . following the numbering of the above referenced patent , the hydraulic load lifting system 10 generally includes load supporting hydraulic motor means , such as a pair of hydraulic jacks 12 and a control circuit 13 operatively connected to control the extension of such jacks 12 for raising a load 14 and the retraction thereof for lowering the load 14 . the jacks each include a load supported or head end 16 and an opposite rod end 17 . the control circuit 13 includes a fluid reservoir 19 , a main pump 20 connected for drawing fluid from the reservoir 19 and a pilot - operated main control valve 21 . a pump line 23 connects pump 20 to the control valve 21 . the control valve 21 is selectively positioned between the depicted neutral or a hold position and either of two other operative positions . the control valve 21 communicates with the reservoir 19 by way of a tank line 24 and a cooler 26 . a relief valve 25 selectively controls communication between the pump line 23 and the tank line 24 to limit the maximum pressure in the control circuit between the pump 20 and the control valve 21 . the control valve 21 is further connected to the head end 16 and the opposite rod end 17 of the jacks 12 by main control lines 27 and 28 , respectively . a pair of main line relief valves 30 and 31 are connected to main control lines 27 and 28 , respectively , to limit the maximum pressure in the control circuit on the hydraulic jack side of the control valve . make up valves 32 and 35 are also connected to main control lines 27 and 28 , respectively , and to tank line 24 to provide fluid to the lines 27 and 28 whenever pressure in either of the lines fall below a predetermined level . this is accomplished as pump line 23 is connected to tank line 24 with main control valve 21 in the neutral position and as cooler 26 provides back pressure in the tank line 24 by restricting the flow therefrom to tank 19 . a pair of identical , vented load check valves 33 and 34 are disposed within the main motor line 27 to each of the head ends 16 of the hydraulic jacks 12 . the purpose of such load check valves , as will be apparent to those skilled in the art , is to avoid downward drifting of the load due to leakage through the main control valve 21 and to prevent the sudden dropping of the load in the event of a line failure or the like . for this reason , the load check valves are preferably disposed on their respective jacks . while the schematic drawing in figure shows such valves as being somewhat spaced from jacks 12 , they are preferably mounted directly on their respective jacks or integral therewith to alleviate the possibility of a line failure between the jacks and the load check valve . the control circuit 13 is provided with venting apparatus generally indicated at 47 for selectively venting the load check valves 33 , 34 . the apparatus 47 includes a pilot operated venting valve 48 . a pilot controlled system , indicated generally at 50 , is provided for selectively simultaneously controlling the operation of the main control valve 21 and the venting valve 48 . the pilot system includes a pilot pump 51 , connected for drawing fluid from the reservoir 19 , for supplying fluid to the pilot control valve 52 by a line 53 . the pilot control valve 52 communicates with the reservoir through a second line 54 . a relief valve 55 is disposed between lines 53 and 54 to limit the maximum pressure in the pilot system to a predetermined level . the pilot control valve is further communicated with the opposite ends of the main control valve 21 by way of pilot lines 56 and 57 . the pilot line 56 is also connected to the venting valve 48 to communicate pilot fluid thereto when pilot pressure is directed to the control valve 21 to shift the control valve to the jack lowering position . as is evident from the figure , pilot lines of the pilot pressure system are represented by dash lines . the pilot operated venting valve 48 is connected to the load check valves 33 amd 34 by way of a vent line 69 . the valve 48 is also connected to the main control line 27 by a connector line 71 . further , a tank line 68 communicates the valve 48 with the tank 19 . the preferred construction of the venting apparatus 47 includes a valve body 60 having a valve bore 61 therein for reciprocally mounting a valve spool 63 . the bore is provided with three axially spaced annuli 64 , 65 and 66 . the first annulus 64 is connected to the reservoir 19 by way of the tank line 68 . the second annulus 65 is connected to the load check valves 33 and 34 by way of vent line 69 . the third annulus 66 is connected by way of passage 70 in the valve body and connector line 71 to the main control line 27 connected to the head end 16 of the jack 12 . a check valve 73 is disposed within the passage 70 for freely admitting fluid to the connector line 71 but preventing flow in the opposite direction . the valve spool is normally biased to a first or vertical position , depicted in the figure , by a spring 74 . the valve body 60 has a pilot inlet port 75 which is connected to the pilot line 56 for communicating pilot pressure against one end of the valve spool to shift the spool toward the right . the valve spool 63 is provided with passage means including an angular passage 77 and a metering slot 78 for interconnecting the second annulus 65 with the first annulus 64 to permit the venting of the load check valves 33 and 34 to allow their opening . however , the valve spool is also provided with an intermediate position between the neutral and fully actuated position . the valve spool is provided with passage means including a pair of staggered angularly disposed passages 80 and 81 for interconnecting the second and third annuli when the spool is in its intermediate position . thus the fluid pressure in the vent line 69 is communicated to the main control line 27 through the connector line 71 and the passage 70 . the venting valve 48 is also provided with a passage 83 interconnecting the first and second annuli which passage is provided with a relief valve 84 and is designed to open at a pressure somewhat lower than the opening pressure of the main line relief valve 30 . the venting line 69 is provided with a pair of branch lines 86 and 87 for individually connecting the vent line with the load check valves 33 and 34 , respectively . each branch line is provided with a choke and check device 88 . each device 88 allows fluid to flow from the respective load check valve , but includes means for partially restricting the flow in the opposite direction . the present invention includes the incorporation of a blocker valve 100 in the vent line 69 . the blocker valve 100 has a closed position ( depicted in the figure ) and an open position and is normally biased by a lightweight spring 102 to the closed position , preventing fluid from flowing in vent line 69 . in a preferred embodiment blocker valve 100 is in fluid communication with and actuated by the fluid from a low pressure resolver valve 104 through conduit 106 . resolver valve 104 communicates with main control line 27 through conduit 108 at a point adjacent to the pilot operated main control valve 21 and through conduit 110 at points adjacent the vented load check valves 33 and 34 . lines 27 and 28 would always have same fluid pressure in them during normal operation due to the aforementioned back pressure in line 24 as a result of fluid flowing through cooler 26 . this back pressure will be transferred to line 27 and 28 through make up valves 32 and 35 . further it is to be appreciated that absent cooler 26 and make up valves 32 and 35 , there would still be back pressure in lines 27 and 28 . the low pressure resolver valve 104 includes a valve housing 112 which defines a central bore 114 having a first enlarged chamber 116 and a second enlarged chamber 118 . as can be seen in the figure , conduit 108 is provided in communication with central bore 114 adjacent to first enlarged chamber 116 and conduit 110 is provided in fluid communication with central bore 114 adjacent to second enlarged chamber 118 . an internal bore 120 provides fluid communication between a portion of central bore 114 intermediate first and second enlarged chambers 116 and 118 and conduit 106 which is provided in fluid communication with blocker valve 100 . disposed in central bore 114 is a slidable spool 122 . slidable spool 122 defines first spherical end 124 and second spherical end 126 . first spherical end 124 is restrainingly contained in first enlarge chamber 116 and second spherical end 126 is restrainingly contained in second enlarge chamber 118 . if the pressure in the conduit 108 is higher than the pressure in conduit 110 , first spherical end 124 is urged against the internal wall 128 of first enlarged chamber 116 , preventing any fluid from conduit 108 from flowing through central bore 114 to conduit 106 . concurrently , due to the length of slidable spool 122 , the second spherical end 126 is positioned substantially in the middle of second enlarged chamber 118 such that the lower pressure fluid in conduit 110 can flow through central bore 114 to conduit 106 . the above described position is depicted in the figure . should the pressure in line 110 be below the predetermined level , owing to a break in conduit 27 adjacent the check valves 33 and 34 , blocker valve 100 would automatically close due to reduced pressure in conduit 106 preventing the relief of pressure from said check valves 33 and 34 and thus preventing the load 14 from falling . conversely , if the pressure in conduit 108 is less than the pressure in conduit 110 , the second spherical end 126 will be urged against the internal wall 130 of the second enlarged chamber 118 blocking fluid communication from conduit 110 through central bore 114 end to conduit 106 . again the slidable spool 122 is of such a length that with the second spherical end 126 positioned against the internal wall 130 of the second enlarged chamber 118 , the first spherical end 124 is positioned in the middle of the first enlarged chamber 116 such that fluid communication is provided from conduit 108 through the central bore 114 to conduit 106 . again , if the hydraulic pressure in main control line 27 drops below a predetermined level , owing to a break in main control line 27 adjacent control valve 21 , the fluid pressure in line 108 would be insufficient to keep the spring 102 from closing the blocker valve 100 , and thereby closing the vent line , preventing the load from falling . it is to be understood that alternatively the low pressure resolver valve 104 can be eliminated from the hydraulic system and the blocker 110 can be connected directly to the main control line 27 by conduit 106 . in such case the blocker valve 100 would be actuated to an open position by the pressure at one point on main control line 27 instead of being actuated by the lowest of two pressures at two different points on main control line 27 . the overall operation of the hydraulic load lifting system is discussed in u . s . pat . no . 4 , 000 , 683 , discussed above and incorporated herein by reference . the operation of the improvement is as follows : with , for example , the pilot control valve 52 in the appropriate position for allowing the jack 12 to lower the load 14 , venting valve 48 opens venting line 69 so that fluid can be vented behind load check valves 33 and 34 thereby allowing the fluid from the head ends 16 of the jacks 12 to flow through the main control line 27 . as long as the return flow pressure in main control line 27 is at or above the normal operating level at the points where the conduit 108 and 110 communicate with said main control line , the resolver valve 104 will select the lowest of the pressures at the points and communicate that pressure to blocker valve 100 . valve 100 will be urged to an open position , keeping vent line 69 open so that the lowering of load 14 can continue as fluid is vented behind check valves 33 and 34 . if a break should occur in the main control line 27 so that the pressure at the intersection of either conduit 108 and main control line 27 or conduit 110 and main control line 27 is below the normal operating level , the lower pressure will be selected by low pressure resolver valve 104 and communicated through conduit 106 to blocker valve 100 . the lower pressure will be unable to overcome the spring 102 , and thus spring 102 will urge the blocker valve to the closed mode , preventing fluid from flowing through venting line 69 from the load check valves 33 and 34 . this will quickly cause load check valves 33 and 34 to close , thus preventing fluid from flowing from the jacks 12 through said load check valves 33 and 34 to the main control line 27 . as is obvious from the above description , the blocker valve and resolver valve 104 function automatically should a rupture occur in the main control line 27 . accordingly , for example , without the operator having to realize that the load 14 is descending at a higher rate than that selected , and in fact , before the rate of descent is noticably different from that selected , the resolver 104 and blocker valve 100 have prevented fluid from flowing in vent line 69 and thus the load from falling . in a prior device , upon seeing the load falling , the operator would have to immediately shift a pilot control , such as pilot control valve 52 , to a blocking position to prevent fluid from venting behind the load check valve 33 and 34 . further as the blocker valve 100 overrides the pilot control system 50 , the operator cannot inadvertently restart the jacks 12 in motion until the break in the main control line 27 is repaired and normal operating pressure is restored . it is to be understood that if desired a blocker valve ( not shown ) and a resolver valve ( not shown ) similar to valves 100 and 104 and with appropriate load check valves ( not shown ) could be incorporated into main control line 28 to prevent a load from falling should the jacks 12 be inverted . other aspects , objects , and advantages of this invention can be obtained from a study of the drawing , the disclosure , and the appended claims .	5
fig1 illustrates a shredder apparatus 10 having a full bin indicator 24 in accordance with an embodiment of the present invention . the apparatus 10 generally includes a shredder housing 20 , a bin 22 , and an indicator 24 . in the embodiment shown , the indicator 24 is a flap attached to the bin side ( underside ) of the shredder housing 20 and has an extended portion 25 . fig1 shows a view of the shredder housing 20 from the top . as shown , the shredder housing 20 is situated upon the bin 22 so that materials inserted into a shredder opening 32 will be shredded and deposited directly into the bin 22 . the shredder housing 20 may have a lip 46 or other structural arrangement that corresponds in size and shape with a top edge 48 of the bin 22 . in the embodiment shown , the shredder housing 20 and bin 22 are sized such that all but a portion 34 of the entire bin opening is covered by the shredder housing 20 . this opening 34 is a bin access opening that may be utilized to deposit articles ( e . g ., trash ) that are not desired to be shredded . the shredder housing 20 may optionally be provided with a cutout 42 that increases the size of the bin access opening 34 in order to accommodate larger articles . the bin 22 may optionally be provided with an extension portion 36 to likewise increase the size of the bin access opening 34 . naturally , at least one of a cutout 42 in the shredder housing 20 or an extension portion 36 in the bin 22 is preferred , so as to form the bin access opening 34 . alternatively , the bin 22 and the shredder housing 20 be may an integral component . in such a case , shredded materials within the bin portion of the apparatus may be removed via a door located on the bin portion and / or the shredder housing portion . all other features of an integral bin / housing configuration relevant to the present invention may be as described herein . the configuration of the bin access opening 34 and its location relative to the shredder input opening 32 ( also commonly referred to as the throat ) is not particularly critical , and the invention is not limited to the configuration disclosed . for example , the bin access opening need not be provided in part by the bin , and instead may be an opening through the shredder housing 20 itself . likewise , it may be entirely provided by an opening formed through the structure of the bin . furthermore , in some embodiments of the present invention there may be no bin access opening present . instead , the bin 22 and / or shredder housing 20 may be provided with a window through which the indicator 24 may be viewed . in other embodiments , the indicator 24 may be operably connected to or have a secondary element that is otherwise viewable from the exterior of the shredder apparatus 10 without requiring a bin access opening 34 or a window ( e . g ., a mechanical element that moves or otherwise changes its appearance that is connected to the indicator 24 through the shredder housing , or a mechanical gauge that is operably connected to the indicator 24 ). although the shredder housing 20 and bin 22 are shown as nesting in a complementary fashion , one of skill in the art will appreciate that such a complementary fit is not a requirement of the present invention . the present invention may be applied in apparatuses in which the shape of the shredder housing 20 greatly varies from that of the bin 22 ( e . g ., in cases where a shredder housing in accordance with the present invention is used with a pre - existing or generic receptacle ). the top of the shredder housing 20 may include a switch or plurality of switches to control operation of the shredder apparatus 10 . as shown in fig1 , a rocker switch is provided on the shredder housing that includes a power button portion 26 and a reverse button portion 28 . indicator lights 30 are also provided . the power button portion 26 turns the shredder apparatus 10 on and off . the reverse button portion 28 may be used to clear a jam when materials get stuck in the shredder machinery by reversing the feed direction . it is appreciated that any switches known in the art may be used for these purposes within the scope of the invention . the indicator lights 30 may indicate various operations and / or statuses associated with the shredder apparatus 10 . the shredder housing 20 may further be provided with a handle 50 to facilitate removal from and placement onto the bin 22 . the bin side ( underside ) of the shredder housing 20 is shown in fig2 . as is known in the art , the shredder machinery 42 , including blades configured to shred inserted materials , is configured to receive inserted materials and to feed them through the device and to eject or deposit the shredded pieces of the materials into the bin 22 . the shredding machinery 42 therefore has an input opening at 32 and an output opening 43 at the bottom of the housing , as shown in fig2 . the top of the shredder housing 20 having an opening for the shredding machinery input 32 may be considered an “ input side .” the bin side , or underside , of the shredder housing 20 may be considered an “ output side .” the shredder housing 20 and bin 22 may be designed for use together , or the shredder housing 20 may be designed to mount to pre - existing bins owned by a user , such as wastebaskets , trash cans , and the like . the particular construction is not intended to be limiting . in accordance with an embodiment of the present invention , a flap 24 is provided and is pivotally attached to the bin side ( underside ) of the shredder housing 20 between the output opening 43 of the shredder housing 20 and the bin access opening 34 . pivotal attachment may include a simple pivotal attachment about a pivot axis , or an attachment for compound movement that may include multiple axes or other types of movement ( such as linear movement ). such attachment may be implemented by means of hinges 38 and / or hook 40 . the flap 24 is configured to rotate freely about the hinges 38 and / or hook 40 when not impinged by any other forces . as such , when the shredder housing 20 is placed upon the bin 22 and the bin 22 is empty , the flap 24 is in a first position in which it hangs freely under gravity from the shredder housing 20 in a downward direction , as shown in fig4 . as the bin 22 becomes full of paper and / or other materials , the contents will begin to push against the flap 24 from the shredder side of the flap 24 and towards the bin access opening 34 ( or other viewable location ; e . g ., a window , as discussed above ). the accumulation of shredded materials will eventually be enough to push and rotate the flap 24 to a second position , shown in fig1 and 2 , which may be approximately ninety degrees from the first position ( fig4 ). in this position , at least a portion of the flap 24 becomes visible from the input side ( i . e ., exterior ) of the shredder housing 20 through the bin access opening 34 . the flap 24 may be provided with an extension 25 so as to increase visibility through the bin access opening 34 . the extension 25 or another part of the flap 24 visible through the bin access opening 34 may have indicia 27 thereon , such as the words “ bin full ” ( see fig4 – 5 ) or an easily noticeable color ( e . g ., red , yellow , or orange ), in order to alert a user that the bin 22 is full . the extension 25 may alternatively be sized to completely cover the bin access opening 34 in order to prevent the insertion of further articles when the bin 22 is full . in embodiments where no bin access opening 34 or viewing window is present , the extension 25 may be a flag or other element that is mechanically connected to the flap 24 and passes through a slot in the shredder housing 20 to become visible ( or alter its appearance ) to a user . as shown in fig2 – 3 , the output side of the shredder housing 20 may be provided with a recess 44 that is sized and shaped to correspond to the flap 24 and any extension 25 . the recess 44 is suitable for allowing the flap 24 to be flush with the shredder housing surface during storage and / or transport . if the flap 24 is positioned in proximity of the output opening 43 of the shredder machinery 42 and the recess 44 is positioned around the output 43 , the flap 24 may be pivoted into position in the recess 44 to provide suitable protection from and for the sharp components of the shredder machinery 42 , as shown in fig3 . accordingly , a completely mechanical ( with no electronic components aside from the shredding mechanism ) indicator is provided to notify a user when the contents of a shredder bin 22 should be emptied . failure by a user to recognize that a bin 22 is full may result in overfilling , jamming , a paper mess , or other hazardous condition . while specific embodiments have been described above , it will be appreciated that the subject of the present disclosure may be practiced otherwise than as described . the descriptions above are intended to be illustrative , not limiting . thus , it will be apparent to one skilled in the art that modifications may be made without departing from the scope of the claims set out below .	1
in fig1 an insulating perforated plate or perforation matrix 1 is made of quartz , glass , ceramic or a synthetic material having low vapor pressure , the matrix containing a plurality of regularly disposed holes 2 . about and between these holes on an upper side thereof there are , extending in rows in one direction , drive electrodes in the form of applied conductor paths 3 . these serve as anodes for the auxiliary gas discharge space . the conductor strips or paths 3 may be applied to the substrate 1 by printing , vapor deposition , or a photographic process . the conductor path 3 passes around each opening 2 , continuing from the opposite side thereof in a narrow conductor as shown . at the underside of the perforation matrix 1 , conductor paths 4 form individual image points or control electrodes , extending perpendicularly to the row electrodes 3 and being applied in the same fashion to the matrix 1 . a solid cathode 5 is spaced from the anodes 3 to serve as one of the two electrodes of gas discharge space between anode 3 and cathode 6 . a screen electrode 6 is spaced a shorter distance from the control electrodes 4 . when an individual row 3 is driven by raising its potential , a gas discharge occurs near the row and is initially maintained because the other row electrodes have a floating potential or are at cathode potential . from this narrow gas discharge strip the control electrodes 4 for the individual image points located at the side of the perforation matrix 1 , can extract electrons through the individual holes 2 . such extraction may occur either successively among the control electrodes 4 or simultaneously , depending upon whether the control signal itself is applied sequentially or simultaneously . an intermediate store in the fashion of a shift register sr may be employed to trigger simultaneously a whole control row 4 for the individual image point conductor paths , if the relevant control signals have a corresponding positive value . despite the high positive field strength , no gas discharge occurs in the space between electrodes 4 and 6 because the discharge space length is adequately small to avoid a paschen discharge . upon switching to a next row , the gas discharge again strikes , its new ignition being facilitated by the residual ionization near the preceding row . the gas discharge thus skips from row to row with the row driving frequency and remains confined to the gas discharge space . the image point grid arranged at the other side of the perforation matrix and likewise subdivided into parallel elements , thus functions as a control grid 4 , acting through the holes to control the intensity of the electrons extracted from the gas discharge by the high voltage on the screen electrode 6 . if the screen electrode 6 is negatively biased vis - a - vis the anode 3 , which itself is substantially at earth potential , the electron stream will be blocked . as those skilled in the art will realize , in accordance with the paschen law set out in fig2 where the discharge voltage is plotted on the ordinate gas pressure × electrode interval = p × d on the abscissa , it is possible at a given gas pressure and electrode spacing to read off the voltage below which ignition cannot occur and no gas discharge is possible . below a minimum value of this product for a particular gas the discharge voltage or minimum ignition voltage rises very steeply ; in the case for example of argon ( not shown ), this value is 0 . 9 mm hg × mm at 137v . at a low pressure , about 1 mm hg , and a distance between cathode 5 and anode 3 of about 1 cm , it is possible to strike or ignite and maintain a discharge in any of several gases at as little as a few hundred volts . in the electron acceleration space between electrodes 4 and 6 , because of the much smaller electrode distance , a much higher voltage , some few thousand , can be applied without causing a discharge to occur . thus , the ignition of a gas discharge is determined for given values of gas pressure and voltage by the distances between the electrodes in the gas . the electrons produced from the gas discharge , as from a large - area cathode , can , because of the high field strength prevailing in the acceleration space between a hole 2 and the electrode screen 6 and also because of the gas , strike a specific image point on the screen 6 in a concentrated beam without interfering with neighboring image points . with individual control of the individual electron beams through the holes 2 by control of anode row and control electrode column potentials , substantially the same conditions may be achieved as in a conventional cathode ray tube . the value of the mean acceleration potential , corresponding to a direct bias voltage on the control grid 4 , can also be employed to optimize beam focussing ; focussing in any event is not difficult because of the short distance between the bottom surface of the matrix 1 and the screen electrode 6 . the arrangement described corresponds somewhat to a large - area hot cathode . gases such as neon and argon are suitable since their striking voltages are very much lower than for example that of air . also , argon has little unwanted luminosity . to drive the image points of an anode of row 3 , individual signals such as video signals are applied in timed sequence to successive conductor paths of the control electrodes . thus electron streams from the discharge zone passing through the holes 2 impinge successively , point by point , on the screen electrode 6 , each for a very short time , i . e ., only for as long as the signal persists on an electrode 4 under the discharge conditions for an anode row 3 . because this time is very short , screen images produced in this manner are more or less dark as a whole . it is possible to brighten the image produced by preprocessing signals corresponding to the content of a complete anode row in a buffer or intermediate store in accordance with the operation of the series shift register sr to apply all control electrode signals for all points on an anode row 3 simultaneously to all the conductor paths 4 . the processing and reorganization of the relevant video signal to form a signal which is matched to the requirements of the matrix may take place in a series shift register sr with a corresponding number of parallel outputs , for example about 800 , after the manner of a 625 line television picture . in the series shift register sr , the video signal is shifted point by point until individual registers , consisting of semi - conductor stores , are filled . to achieve maximum brilliance in the discharge display device for a black and white picture , the discharge duration of an anode row 3 , of 64 microseconds , must be fully exploited for storage . the register sr , however , also requires this amount of time to become full so that accordingly two such stores can be arranged to operate alternately to process the signals , e . g ., one each for the even and odd rows . thus , based upon the normal line periodicity of 64 microseconds encountered in television pictures for example , a substantial brilliance can be achieved . if , however , the individual electron streams are to persist for a longer period of time , then the video signal must be stored individually with respect to each point in the matrix . to do this a matrix drive system is suitable , signal input being carried out using a three - terminal device , e . g . in the form of a transistor . an integrated system of 500 , 000 transistors is required over an area corresponding to that of a television screen . this problem can be met by a thin - film technique , employing field - effect transistors . an arrangement of the transistors in the discharge device has been shown schematically in fig3 . a control grid 14 for controlling the passing electrons is formed by a metal rim around each square hole 12 in an insulated perforation matrix 11 . the matrix wiring is arranged at the top side of the perforation matrix and consists of row electrodes 17 , marked s i for source or base , and of image point electrodes 18 , marked g i for gate or collector . each control electrode 14 , also marked d ik for drain or emitter , is divided into individual rings and is not connected to the other wiring . a metallic underside 13 of the perforation matrix serves as a perforated anode , and a capacitor with each of the control electrodes 14 . transistors 21 are each located near points of intersection 20 between the s and g lines , the g lines having extensions 19 from line 18 and parallel to line 17 . the intersection area is coated after assembly with an insulating layer to prevent chemical and mechanical changes in the transistors . when using sequential drive techniques , operating point by point , and individual storage for each image point , the video signal v or a signal processed in a series shift register sr is applied to the individual conductor paths 18 ( g i ). to drive a single row , a potential positive in relation to the cathode is applied to one of the row electrodes 17 ( s i ). because the control electrodes 14 ( d ik ) are initially at earth potential or at a negative potential , then depending upon the potential of the particular g i electrodes a current of varying intensity flows toward the row electrode 17 ; this flow charges the individual control electrodes 14 ( d ik ) to a positive potential peak . this potential peak then controls the actual electron flow from the gas discharge space ( below 13 , not shown ) to the screen electrode ( above 11 , not shown ), thus switching on an individual electron beam with a desired intensity . this electron stream continues to flow as long as the control electrode 14 ( d ik ) is sufficiently positively charged . during this control operation , the capacitor between the control electrode 14 ( d ik ) and the anode 13 is charged . accordingly , the capacitance serves as an individual store vis - a - vis each electron beam . the charge and therefore the control voltage of each capacitor can be reached by allowing for selected leakage currents ; however , should such currents be too weak the capacitors can also be shunted by a vaporised - on resistive layer connecting the electrodes 14 and 13 , so that a determinate time constant is produced . should leakage currents be too great , they can be reduced as by increasing the size of the holes 12 in the perforation matrix ll , i . e ., enlarging the control grid openings 14 in relation to the openings in the earthed auxiliary anode 13 at the back of the perforation matrix . by advancing the constant bias voltage on the conductor paths 17 ( s i ), one row after another may be driven in the same way . by advancing also the signals on the g i image point electrodes , the video signal is driven in a point by point sequence . however , it is better to use the procedure described above , in which the video signal is stored in a buffer store or intermediate store sr , i . e ., is prepared by a series shift register , and the signal for a complete row is simultaneously applied to all image point electrode lines 18 ( g i ) in that row . the prime advantage , among others , of this method is that the picture or image exhibits less flicker , in particular , however , time is gained for the charging up of all the capacitors , intersection points 20 , and conductors 17 ( s i ), to the full video signal . if the entire time interval , for example 64 microseconds in the case of television pictures , available for an individual row is used , a very bright image is achieved . the system is also suitable for purely static displays in lieu of moving images . the storage capacity of a device for a static display must be comparatively large and the leakage current from the control electrode 14 small in comparison to a device for a moving image display . the arrangement described is also suitable for color displays . three times the number of s i or g i conductor paths is needed ; to achieve the smallest possible switching capacitance , it is better to increase the number of row conductor paths s i . the individual color components signals must also be applied simultaneously to each color row . thus , for each of three color rows , only a third of the former time , about 21 microseconds , is available for electron flow . a weak video signal on the transistors can in some cases be compensated for by the use of a higher beam intensity or by an increased signal storage time . the principle of creation of a gas discharge current and electron stream in a space and the partial separation thereof from a second space having a shorter path length and higher field strength is in no way limited to the television - screen display device described here but is of quite general application . this principle is applicable to other display devices and tubes operating with gas discharge mechanisms , to achieve greater brilliance as well as the attainment of clear color production with bistable storage operation .	7
digital communication systems typically employ packet - switching systems that transmit blocks of data called packets . typically , data to be sent in a message is longer than the size of a packet and must be broken into a series of packets . each packet consists of a portion of the data being transmitted and control information in a header used to route the packet through the network to its destination . a typical packet switching system 100 a is shown in fig1 a . in the system 10 a , a transmitting server 110 a is connected through a communication pathway 115 a to a packet switching network 120 a . packet switching network 120 a is connected through a communication pathway 125 a to a destination server 130 a . the transmitting server 110 a sends a message as a series of packets to the destination server 130 a through the packet switching network 120 a . in the packet switching network 120 a , packets typically pass through a series of servers . as each packet arrives at a server , the server stores the packet briefly before transmitting the packet to the next server . the packets proceed through the network until they arrive at the destination server 130 a . the destination server 130 a contains memory partitions on one or more processing chips 135 and on one or more memory chips 140 a . the memory chips 140 a may use various memory technologies , including sdram . for illustrative purposes , a particular implementation of a packet switching system is described . for ease of description , a particular implementation in which a message may be any length , a packet may vary from 1 to 64k bytes , and the memory partition size is 64 bytes is used . many implementations may employ variable length packets having maximum packet sizes and memory partition sizes larger than 64 bytes . for example , maximum packet sizes of two kilobytes or four kilobytes may be used . packet switching systems may manage data traffic by maintaining a linked list of the packets . a linked list may include a series of packets stored in partitions in external memory , such that the data stored in one partition points to the partition that stores the next data in the linked list . as the data are stored in external memory , memory space may be wasted by using only a portion of a memory partition . the present design is directed toward efficient memory operation within such a packet switching system , either internal or external , and may also apply to computer , networking , or other hardware memories including , but not limited to , sdram memories . one typical hardware application employing sdram is a network switch that temporarily stores packet data . network switches are frequently used on ethernet networks to connect multiple sub - networks . a switch receives packet data from one sub - network and passes that packet data onto another sub - network . upon receiving a packet , a network switch may divide the packet data into multiple sub - packets or cells . each of the cells includes additional header data . as is well known in the art , ethernet packet data has a maximum size of approximately 1 . 5 kbytes . with the additional header data associated with the cells , a packet of data has a maximum size in the range of under 2 kbytes . after dividing the packet data into cells , the network switch may temporarily allocate a memory buffer in the sdram to store the packet before retransmission . the address and packet data are translated to the sdram , which may operate at a different clock rate than other hardware within the switch . the packet data is then stored in the memory buffer . for retransmission , the switch again accesses the sdram to retrieve the packet data . both the storage and retrieval of data from the sdram introduce access delays . in the present design , the memory employed may be partitioned into a variety of memory partitions for ease of storage and retrieval of the packet data . [ 0028 ] fig1 b is a block diagram illustrating an example of physical memory partitioning . typically , memory 100 is divided into equal fixed - size partitions with each of the partitions used as a fifo buffer and assigned to a flow . each flow may be associated with a device , such as an asynchronous transfer mode ( atm ) device . the size of the memory 100 may be 1 gbyte , for example , and the memory 100 may be divided into 256k partitions . each of the 256k partitions may be statically assigned to a flow ( e . g ., the partition 1 is assigned to the flow 1 , etc .) such that every flow is associated with at most one partition . no free partition exists . in this example , each partition is 4 kbytes long . this partitioning technique is referred to as complete partitioning . [ 0029 ] fig2 is a block diagram illustrating another example of a memory and its partitions , where memory 200 may be partitioned into multiple partitions . the number of partitions may be at least equal to the number of supported flows , and the partitions may be of the same size . for example , the size of the memory 200 may be 1 gb , and the memory 200 may be partitioned into 16m ( 16 × 1024 × 1024 ) equally sized partitions , even though there may only be 256k flows . in this design , partitions may be grouped into two virtual or logical groups , a dedicated group and a shared group . for example , referring to the example illustrated in fig2 a , there may be 4m partitions in the dedicated group 201 and 12m partitions in the shared group 202 . the grouping of partitions described here relates to the number of partitions in each group . the partitions 1 - 16m in the current example may not all be at contiguous addresses . each flow may be associated with a fifo buffer . each fifo buffer may span multiple partitions assigned to that flow . the multiple partitions may or may not be contiguous . the size of the fifo buffer may be dynamic . for example , the size of a fifo buffer may increase when more partitions are assigned to the flow . similarly , the size of the fifo buffer may decrease when the flow no longer needs the assigned partitions . the function of the fifo buffer is to transfer data to the partitioned memory in a first in , first out manner . [ 0032 ] fig2 b is a block diagram illustrating another example of a memory and its partitions . in this example , there are three flows 1 , 3 and 8 , each assigned at least one partition from the dedicated group 201 . these may be considered active ports because each has assigned partitions , and unread data may exist in these partitions . one or more inactive ports may exist , and no partitions are typically assigned to inactive ports . [ 0033 ] fig2 c is a block diagram illustrating an example of a partition . a partition may include a data section to store user data and a control section to store control information . for example , partition 290 may include a data section 225 that includes user data . unit zero ( 0 ) of the partition 290 may also include a control section 220 . the control information about the data may include , for example , start of packet , end of packet , error condition , etc . each partition may include a pointer that points to a next partition ( referred to as a next partition pointer ) in the fifo buffer . for example , the first data unit 225 of the partition 290 may include a next partition pointer . the next partition pointer may be used to link one partition to another partition when the fifo buffer includes more than one partition . when a partition is a last or only partition in the fifo buffer , the next partition pointer of that partition may have a null value . for one embodiment , the next partition pointer may be stored in a separate memory leaving more memory space in the partition 290 for storing data . unit 0 is the only unit in the foregoing example configuration containing control information or a pointer . as illustrated in fig2 c , units 1 through 7 are dedicated to 8 bytes of data each . [ 0036 ] fig2 d is a block diagram illustrating an example of a fifo buffer that includes more than one partition . fifo buffer 260 in this example includes three partitions , partition 290 , partition 290 + n , and partition 290 + m . these partitions may or may not be contiguous and may be in any physical order . the partition 290 is linked to the partition 290 + n using the next partition pointer 225 . the partition 290 + n is linked to the partition 290 + m using the next partition pointer 245 . the next partition pointer of the partition 290 + m may have a null value to indicate that there is no other partition in the fifo buffer 260 . the fifo buffer 260 may be associated with a head pointer 250 and a tail pointer 255 . the head pointer 250 may point to the beginning of the data , which in this example may be in the first partition 290 of the fifo buffer 260 . the tail pointer 255 may point to the end of the data , which in this example may be in the last partition 290 + m of the fifo buffer 260 . as the data is read from the fifo buffer 260 , the head pointer 250 may be updated accordingly . when the data is completely read from the partition 290 , the head pointer 250 may then be updated to point to the beginning of the data in the partition 290 + n . this may be done using the next partition pointer 225 to locate the partition 290 + n . the partition 290 may then be returned . from fig2 b , partitions in the dedicated group 201 and / or in the shared group 202 may not have been assigned to any flow . these partitions are considered free or available partitions and may logically be grouped together in a free pool . for example , when a flow returns a partition to either the shared group 202 or the dedicated group 201 , it may be logically be viewed as being returned to the free pool . one example of a previous memory management system used to manage memory , either partitioned or not partitioned , is illustrated in fig3 . for the system shown in fig3 memory management entails obtaining a pointer to a free partition every time a new cell or fragment of a packet is enqueued to a data buffer . the memory manager also returns a pointer to memory every time a partition is dequeued . as shown in fig3 chip 301 includes enqueuer 302 , dequeuer 303 , ddr sdram interface 304 , and ddr sdram 305 . external memory 306 resides off chip and holds free pointers , as the size of the ddr sdram 305 dictates that pointers cannot be held within ddr sdram 305 . the memory manager 307 , which has typically been on chip but may be off chip , receives an indication that a new cell has been received , obtains a pointer from external memory 306 , and provides the pointer to the enqueuer 302 which enqueues the pointer and new cell and places them in ddr sdram 305 in one partition . when dequeued , the dequeuer 303 obtains the pointer and the cell in the partition , provides the pointer to the external memory for recycling , and passes the cell for processing , which may include assembly into a packet . thus external memory is accessed every time that a cell is dequeued or enqueued , and the required reading and writing of pointers significantly decreases memory access efficiency because of the requisite access time to the external memory 305 . [ 0041 ] fig4 illustrates an on - chip implementation enabling improved access times to free pointers . fig4 presents a chip 401 having an enqueuer 402 , a dequeuer 403 , a ddr sdram interface 404 , and a ddr sdram 405 . the chip 401 further includes a free pointer pool fifo 406 located between the dequeuer 403 and the enqueuer 404 . the memory manager 407 receives an indication that a new cell has been received , obtains a pointer from the free pointer pool fifo 406 , and provides the pointer to the enqueuer 402 which enqueues the pointer and new cell and places them in ddr sdram 405 in one partition . when dequeued , the dequeuer 403 obtains the pointer and the cell in the partition within the ddr sdram , provides the pointer to the free pointer pool fifo 406 , and passes the cell for processing , which may include assembly into a packet . thus the free pointer pool fifo 406 acts as a balancing mechanism that operates to continuously recycle unused pointers located on the ddr sdram 405 . a certain quantity of unused pointers is located in the ddr sdram 405 , and those pointers may be freely transferred to and from free pointer pool fifo 406 . [ 0043 ] fig5 illustrates the composition of a sample ddr sdram 405 having n partitions , of any size but for purposes of this example having a size of 64 bytes . the free pointer pool 501 within the ddr sdram 405 occupies a certain subsection of the ddr sdram 405 , and various sizes may be employed depending on circumstances , such as the pointer size and ddr sdram or other memory size , such as 5 per cent of the entire memory . in this example , the free pointer pool 501 occupies n / 20 partitions and may store as many as n pointers . pointer size in this example is 25 bits . thus as shown in fig3 the ddr sdram 405 is divided into multiple partitions of 64 bytes each in this example . a subsection of the ddr sdram 405 includes the free pointer pool 501 , such as 5 per cent of the ddr sdram 405 , and the other 95 per cent is used to store data partitions used to build data buffers . the ddr sdram 405 memory segment including the free pointer pool 501 is also divided into partitions , such as 64 byte partitions , and in this example can store twenty 25 bit pointers to free data partitions . the 64 byte partitions can be accessed as a circular buffer . as may be appreciated by one skilled in the art , virtually all variables or elements described in connection with this example may be altered , namely increased in size or quantity or decreased in size or quantity , including but not limited to pointer size , partition number and size , free pointer pool size , and percentage of memory taken up by the free pointer pool . the example is meant by way of illustration and not limitation on the concepts disclosed herein . in one particular implementation in accordance with the foregoing example , 20 free partition pointers may be stored in the 64 byte partitions occupying 5 per cent of the ddr sdram 405 , as shown in fig6 a . if 128 bits memory data bus width is employed , the pointers may be stored as shown in fig6 b . the memory manager may communicate with the ddr sdram using a 128 bit bus interface as ddr sdram interface 404 . the 64 byte data partitions , such as each of the individual partitions illustrated in fig6 a and 6b , may be organized as eight words having eight bytes each . as shown in fig7 the first word of the data partition includes control information , including a 25 bit pointer to the next partition , and certain control bits , including but not limited to start of packet , end of packet , and so forth . the remaining seven words or 56 bytes include data . data cells or packets can be stored in different ways , typically depending on the type of data flow or the manner in which data is received . for a packet - to - packet flow , each partition may store the 56 bytes , a small segment of the data packet . the last partition may contain less than 56 bytes , and thus the number of bytes stored in the last partition of a packet is provided in the information stored in the control word . this control word makes up the first portion of the packet . in the event the memory operates with atm ( asynchronous transfer mode ) cells , either in cell - to - cell , packet - to - cell , or cell - to - packet transfers from the input flows , each partition stores one complete atm cell , typically having a 52 byte data width . in the event the packet is received as cells and converted to packets , one atm cell received makes up the partition , and the cells can be assembled into packets . thus in this example , the on chip free pointer the on chip free pointer pool fifo 406 is a 125 bit by 32 word memory . each 125 - bit entry in the free pointer pool fifo 406 is a free pointer : the memory address of an available ( or free ) 64 - byte partition located in the external sdram . the free pointer pool fifo 406 may take various forms , but typically it must offer functionality of providing for reading and writing , thus including two ports , and must be able to store an adequate quantity of pointer partitions . one implementation of the free pointer pool fifo 406 that can accommodate the foregoing example is a two port ram having the ability to store four pointer partitions , or 80 pointers . operation of the on - chip free pointer pool fifo 406 is as follows . when a cell or packet segment is enqueued , or stored in the ddr sdram 405 , the enqueuer 402 may obtain a pointer , the pointer indicating an unused data partition within ddr sdram 405 . the pointer is read from the on chip free pointer pool fifo 406 . when a cell or packet segment is dequeued , or read from the ddr sdram 405 , the dequeuer 403 returns or stores the pointer associated with the dequeued partition for future reuse . the pointer is written to the on chip free pointer pool fifo 406 . when the contents of the on chip free pointer pool fifo 406 is above a specified threshold , such as above 75 per cent of capacity , or above 60 pointers , the enqueuer 402 returns a block of 20 pointers , one 64 byte partition , to the free pointer pool in the ddr sdram 405 . when the contents of the on chip free pointer pool fifo 406 is below a specified threshold , such as below 25 per cent of capacity , or below 20 pointers , the dequeuer 403 reads a block of 20 pointers , one 64 byte partition , from the free pointer pool in the ddr sdram 405 . at initiation , a certain quantity of pointer may be loaded from ddr sdram 405 into the free pointer pool fifo 406 . for the aforementioned example , 40 pointers may be loaded into the free pointer pool . data received is enqueued using the enqueuer 402 , while data transmitted is dequeued from ddr sdram using the dequeuer 403 . in a balanced environment , a similar number of pointers will be needed and returned over a given period of time , and thus the free pointer pool fifo 406 may not require refilling or offloading to the ddr sdram 405 . the free pointer pool fifo 406 contents may exceed a threshold when certain write cell cycles are not used to enqueue data partitions . one write cell cycle is then used by the free pointer pool fifo 406 to write a certain number of pointers to the ddr sdram 405 external free pointer pool . the free pointer pool fifo 406 contents may fall below a threshold when certain read cell cycles are not used to dequeue data partitions . one read cell cycle is then used by the free pointer pool fifo 406 to read a certain number of pointers from the ddr sdram 405 external free pointer pool . in this manner , access to ddr sdram for the purpose of reading or writing pointers operates at a very low rate , such as only once every 20 cycles or more . the present design can be used by memory controllers supporting bank interleaving . for example , a memory controller implementing four bank interleaving may employ four on chip free pointer pool fifos 406 . this design may be employed on memories other than ddr sdram , including but not limited to sdr sdram , and rdram , or generally any memory having the ability to change partition size and fifo size . the present system may be implemented using alternate hardware , software , and / or firmware having the capability to function as described herein . one implementation is a processor having available queueing , parsing , and assembly capability , data memory , and possibly on chip storage , but other hardware , software , and / or firmware may be employed . it will be appreciated to those of skill in the art that the present design may be applied to other memory management systems that perform enqueueing and / or dequeueing , and is not restricted to the memory or memory management structures and processes described herein . further , while specific hardware elements , memory types , partitioning , control fields , flows , and related elements have been discussed herein , it is to be understood that more or less of each may be employed while still within the scope of the present invention . accordingly , any and all modifications , variations , or equivalent arrangements which may occur to those skilled in the art , should be considered to be within the scope of the present invention as defined in the appended claims .	6
there is schematically illustrated in fig1 a chamber 10 provided with a first conveying system 12 consisting of a conduit 14 having one end 16 near the bottom of the chamber 10 and a second end 18 directly exposed to the atmosphere . as will be apparent hereinafter , in its broader aspects the present invention is designed to create a partial vacuum or increase the pressure of the chamber in order to withdraw materials and objects 20 into the end 18 of the pipe 14 and downwardly through the pipe 14 for discharge into the chamber 10 through end 16 or to retain the collected materials and objects 20 within the chamber 10 and , when desired , to expel the materials and objects 20 up the pipe 14 through the opening 18 to the atmosphere . the reference numeral 22 designates generally a valve assembly which , as depicted , is arranged for rotational movement . the valve assembly 22 is provided with air passageways 24 , 26 and 28 , described hereinafter . the reference numeral 26 designates generally a second air passageway in the form of conduit structure for transporting air . the reference numeral 32 designates an oscillating air source for moving air along the second air passageway 26 . the reference numerals 34 and 36 designate one - way valves within the valve assembly 22 operatively connecting the second air passageway 26 and the oscillating air source 32 . when it is desired to collect materials or objects 20 and deposit same within the chamber 10 , the valve assembly 22 is moved to the position illustrated in fig3 a . as oscillating air source 32 increases the pressure in second passageway 26 air is expelled outwardly therefrom through the one - way valve 36 into the third air passageway 28 , through which the air is discharged to the atmosphere . the secondary action of the oscillating air source 32 then creates a partial vacuum in the second air passageway causing air to move through the one - way valve 34 creating a partial vacuum in the first air passageway 24 and the chamber 10 , causing the materials and objects 20 to be drawn into the conduit 14 for deposit within the chamber 10 . when it is desired to propel the materials and objects 20 from the chamber 10 to the atmosphere , the position of the valve assembly 22 is reversed to the position shown in fig3 b , by rotation of handle 50 and stem 52 . in this position , activation of the oscillating air source 32 causes air to be propelled through the one - way valve 36 into the first air passageway 24 and thereafter into the chamber 10 . the air pressure then moves the materials and objects upwardly into and through the conduit 14 , thus causing the materials and objects 20 to move out of the chamber 10 to the atmosphere . the secondary action of the oscillating air source 32 then creates a partial vacuum in the second air passageway 26 which is released by air entering through conduit 28 and valve 34 . application of the principles of the present invention to a kitchen implement will now be described with reference to fig2 . the kitchen implement performs as a baster , skimmer , separator , cooler / stock container , a portable , hot - liquid dispenser and a transporter . all of these functions may be performed with a single , simple - to - use implement adapted particularly for use in extracting fat from food preparations , including basting fluids , skimming fat from soups or other hot mixtures , making fat - reduced gravy , when browning or parboiling meats , and the like . the kitchen implement featuring the present invention provides for splatter and dribble free collection , transportation , storage , or dispensation of hot and cold liquids in measured quantities and , also , can be used to collect , mix and dispense or serve liquids in the manner of gravy boats , salad dressing crucibles , creamers and the like . as can be seen in fig2 the chamber 10 is defined by a jar 38 suitably provided with a rotatably mounted cover 40 . the conduit 16 is supported within a frame 46 , which may also attached to the cover 40 , such that one end 48 of the conduit is positioned near the bottom of the jar 38 while the other end 55 thereof is positioned to receive a distal extension piece ( not shown ). the oscillating air source , generally designed by the reference numeral 32 in fig2 includes an oscillating piston , a flexible bellows or the bulb - like member 51 ( shown ), which may be conveniently squeezed by the user . the oscillating air source may be driven manually , as shown , or by a mechanical , electrical or similar force . bulb 51 is operatively connected to the second air passageway 26 within the frame 46 . valve assembly 22 , handle 50 and stem 52 are sealed within the frame 46 by , for example , an end cap 56 which includes an air seal 54 . in this way , the second air passageway 26 is connected to the first and third passageways 24 , 28 through the valve assembly 22 . the structure of the valve assembly will now be discussed with reference to fig3 a , 3b , 4a , 4b , 5a , 5b , 5c , 5d , 6a , 6b , 6c and 6d . fig3 a is a schematic diagram of the valve assembly showing the positions of the one - way valves 36 and 34 for collecting materials or objects 20 and depositing same within the chamber 10 . when the oscillating air supply mechanism , for example a bulb , contracts air is forced out of the second air passageway 26 through valve 36 to the atmosphere through third air passageway 28 . when the bulb expands , valve 36 closes and valve 34 opens to allow air from the jar into the second air passageway 26 through the first air passageway . when it is desired to expel materials and objects 20 from the chamber 10 through conduit 16 to the atmosphere , the valve assembly is turned to the position shown in fig3 b . when the oscillating air supply , for example a bulb , contracts , air from the second air passageway 26 is forced through valve 36 through the first air passageway 24 and into the chamber 10 . when the bulb expands , valve 36 closes and valve 34 opens to allow air to pass from the atmosphere to the second air passageway 26 via third air passageway 28 . the one - way bladder valves are formed such that when the pressure on the rear side of the valve 35 exceeds the pressure on the front side of the valve 37 , the valve opens to allow the air pressure to equalize . however , when the air pressure on the front side of the valve 37 exceeds the air pressure on the back side of the valve 35 , the valve remains closed . the valve is closed when the pressures on the front side 37 and the rear side 35 are equal . fig4 a is a perspective view of the one - way bladder valve in the closed position . fig4 b is a perspective view of the one - way bladder valve in the open position . fig4 c is a perspective view of the rear side of the bladder valve . fig5 a - 5d show the valve assembly 22 which is received within frame 46 . fig5 a and 5b correspond to the valve positions shown in fig3 a . in fig5 a and 5b , a bladder valve 36 is operatively connected with third air passageway 28 to allow air forced through valve 36 to the atmosphere . valve 34 is operatively connected with the first air passageway 24 to allow air from the chamber 10 into the first air passageway 30 . the valves 34 , 36 are received within a rotational body 23 which is formed in the shape of a cylinder or a truncated cone to allow rotation within the frame 46 . fig5 c and 5d show the valve positions represented in fig3 b . in this position , one - way bladder valve 34 is operatively connected to third air passageway 28 to allow air in from the atmosphere and one - way bladder valve 36 is operatively connected to first air passageway 24 such that air is forced from the oscillating air source into the chamber 10 , thus forcing materials or objects 20 from the chamber 10 to the atmosphere . fig6 a - 6d are analogous to fig5 a - 5d ; however , the one - way valves used are ball bearing valves rather than the bladder valves of fig5 a - 5d . when it is desired to expel ( possibly ) fat - reduced material 20 from the jar 38 onto the food being cooked during the basting operation , the valve assembly 22 is moved to the position illustrated in fig3 b , from which it will be apparent that the oscillating air source 32 , such as a piston , bulb or bellows expels air therefrom into second air passageway 26 , after which the air is propelled into first air passageway 26 to pass into the reservoir of the jar 38 . the air exerts pressure on the liquid 20 contained therein propelling same upwardly along the conduit 16 eventually leaving the end 50 of the conduit 16 . during this operation , the oscillating air source 32 is connected to the atmosphere through the second and third air passageways 26 and 28 . when it is desired to move fatty material into the jar , the valve mechanism 22 is rotated to the opposite position ( see fig2 ), at which time the action of the oscillating air source 32 , for example , depression of the bulb 51 causes air to enter and move along the second air passageway 26 entering the third air passageway 28 and outwardly to atmosphere . subsequently , the expansion of the flexible bulb 51 draws a vacuum causing air within the second air passageway 26 to move into the bellows 51 , in turn pulling a vacuum on the inside of the jar 38 through valve 34 and first air passageway 24 . this action of creating a partial vacuum draws fatty substance 20 into the open end 50 of the tube 44 from which it moves downwardly and is deposited within the jar 38 . the second embodiment of the present invention is illustrated in fig7 . in the course of dispersing material and objects 20 from the jar 38 , there sometimes arises the need to expel material or objects that float to the top of the fluid in that they are the target or purpose for using the implement . to facilitate that end the first conveying means is provided with junction 87 midway in the conduit 16 inside the jar 38 mounted with a swing tube 89 jointed at both ends 88 to swivel up and down as the fluid level changes . the floating head 85 supports both the inlet tube 86 at the surface of the material and objects 20 and the swing tube 89 at the swing joint 88 thereby removing floating objects or lighter material from the top of fluid 20 from open end of inlet 86 through tube 89 to conduit 16 and out the open end 50 to atmosphere . although application of the present invention to a kitchen implement has been disclosed , it will be readily apparent that the principles of the present invention are equally applicable in collecting , retaining , mixing and dispensing a wide variety of materials in homes , garages , garden centers , shops , schools , laboratories , production facilities , and the like . wherever fluids are used the present invention simplifies the ability to move , mix , collect and dispense a range of problematic , unstable or dangerous fluids . while we have described a preferred embodiment of the present invention , it should be understood that various changes , adaptations and modifications will be made therein without departing from the spirit of the invention and the scope of the following claims .	0
reference will now be made in detail to embodiments of the invention , examples of which are illustrated in the figures . each embodiment is provided by way of explanation of the invention and not meant as a limitation of the invention . it is intended that the invention include modifications and variations to the embodiments described herein . as shown in fig1 , each spinning unit of an open - end spinning machine possesses a disintegrator with a disintegrator roll ( 1 ) enclosed in a housing ( not shown ), which is assembled from several disintegrator roll components , namely a roll body 10 and a fittings carrier 11 which bears the fittings 110 . the roll body 10 , by force fit , is placed on a drive shaft 2 . the drive shaft 2 receives its own rotational drive in the customary way by means of a circumferential shaft sheave 21 ( see fig8 ) which is disposed on the end of the drive shaft , remote from the roll body 10 . this sheave 21 accommodates a tangential or single drive belt ( not shown ). the drive shaft 2 is carried in conventional fashion on ball bearings 22 in a journal 20 . the roll body 10 of the disintegrator roll 1 possesses , where these ball bearings 22 are concerned , a clearance 23 , so that its rotation is not impaired by the non - rotating journal 20 . the set of fittings 110 is in accord with the embodiment shown in fig1 , which also demonstrates the interpositioning of a ring 111 , which encircles the outer circumferential surface of the fittings carrier 11 . however , as may be seen in fig1 , it is entirely possible to place the fitting 110 directly on the outer circumferential surface of the fittings carrier 11 . to assure the centering of the fittings carrier 11 , the roll body 10 possesses a ring groove 100 facing the fittings carrier 11 , into which the fittings carrier 11 with the fittings 110 carrying ring 111 partially penetrates . the connection of the fittings carrier 11 to the roll body 10 is subjected to no great axial forces , since , during the spinning operation , essentially only radial forces act upon the individual components of the disintegrator roll 1 . consequently , a clip type connector 3 suffices , which , in accord with the embodiment shown in fig1 , is comprised of a stud 30 as well as a stud receptor 31 . in this arrangement , the stud 30 ( or a similar boltlike element ) extends longitudinally in a radial direction toward the inside , that is , in the direction of the drive shaft 2 and is made as an integral part of a ring 300 , which is placed in a corresponding recess 112 of the fittings carrier , which recess extends circumferentially within the entire circumference of the fittings carrier 11 . the roll body 10 , also carries a ring 310 with the already mentioned stud receptor 31 . this receptor 31 is essentially in the shape of a open slot 311 , which , itself , is oriented essentially parallel to the disintegrator roll axis of drive shaft 2 . the slot 311 possesses on its open end , which is facing the length of the stud 30 , ( which is to enter therein ) a tapered entry 312 , which terminates in a narrow passage 313 ( see fig2 as well ). at this narrow passage 313 , the sidewalls of the said slot 311 exhibit a side to side distance a which is smaller than the diameter d 1 of the stud 30 . at this narrow passage 313 , is an adjacent enlargement 314 , which , in regard to shape and dimensioning , essentially fits the shape and the dimensioning of the stud 30 . fig2 shows the slot 311 continues on from this enlargement 314 , in a longitudinal stretch 315 of width b 1 which is less than the diameter of the said enlargement 314 . as can be seen in fig2 , running essentially parallel to the slot 311 is provided an additional slot 317 , which is so closely placed by the first slot 311 , that the relatively thin side wall 316 can yield when the stud 30 , passes through the said narrow passage 313 in its penetration movement . the wall 316 , conversely , returns to its original , narrow position when the stud has continued on and rests in its place within the complementary , slot enlargement 314 . to this end , the ring 310 , in the embodiment according to fig1 , is made of a resilient material , for instance , from an appropriate plastic . various fibers are feed materials for open - end spinning machines , especially natural fibers such as cotton , but also artificial substances such as polyacryl , polyester , viscose and mixtures of any of these . these varied fiber materials are not uniformly disentangled in optimum manner with fittings 110 of universal application , even if the speed of rotation of the disintegrator is adjusted to the individual fiber material . what is looked for as necessary is the achievement of optimal spinning results . to bring about such results , it is desirable to apply the best suited fittings 110 with appropriate distribution of teeth or tooth - shape or to employ fittings of optimum needle type . an exchange of the fittings 110 is introduced by bringing the disintegrator roll 1 to a standstill . then , in a conventional way , the disintegrator roll 1 is made accessible , so that the fittings carrier 11 can then be seized , and in the direction of the arrow f 1 pulled away from the roll body 10 . when the stud 30 leaves the stud receptor 31 , the sidewall 316 yields from the pressure exerted by the stud 30 , until the stud 30 has passed through the narrow passage 313 . during the withdrawal of the stud 30 out of the stud receptor 31 , the fittings carrier 11 along with the ring 111 and the fittings 110 simultaneously leave the ring groove 100 of the roll body 10 . the fittings carrier 11 , freed in this way from the roll body 10 , can now be completely taken out of the housing of the disintegrator . in a similar manner , subsequently an already prepared fittings carrier 11 with a different fitting 110 can be installed . after this has been properly positioned in respect to the roll body 10 , then the fittings carrier 11 , by means of an axially directed force can be connectingly pushed in the direction of the roll body 10 . as this is done , the ring shaped area of the fittings carrier 11 carrying the fittings 110 is centered in the annular groove 100 of the roll body 10 , while the stud 30 now enters the area of the tapered entry 312 , whereby the stud receptor 31 sets up an increasing resistance until the stud 30 has passed the narrowed passage 313 and snaps into the slot enlargement 314 . when the connection apparatus 3 once again takes up its holding position , then the position of the stud 30 is exactly defined in the stud receptor 31 , since the stud 30 cannot leave the slot enlargement 314 either in the direction of the entry tapering 312 nor in the opposite direction of the longitudinal extension 315 which is too narrow for its passage . if in such a case , as shown in the embodiment of fig1 , the connection device 3 is not installed coaxial to the drive shaft 2 , the recommendation would be to provide two or more connection apparatuses 3 of that kind . these would be arrayed in a circle concentric to the drive shaft 2 at equal circumferential distances from one another ( not shown ). with such an apportionment , unbalance would be avoided . the release of the connection apparatus 3 can be supported with the help of an ejection device 4 , which , in accord with the embodiment shown in fig1 , possesses an ejection plate 40 which can be inserted to be against a provided , internal ejector contact surface 41 on an end wall 113 of the fittings carrier 11 . this end wall 113 covers that side of the fittings carrier 11 adjacent to the end of the drive shaft 2 . the ejector contact surface 41 is to be found on that side of the end wall 113 proximal to the roll body 10 . for the sake of safety , in order to avoid a tilt of the fittings carrier 11 in relation to the roll body 10 during the withdrawal by the ejection plate 40 , in accord with the embodiment of fig1 , the contact surface 41 is placed concentric to the fittings carrier 11 . the ejection contact surface 41 surrounds a ejection plate access opening 42 ( fig1 , 3 ) which penetrates the said end wall 113 of the fittings carrier 11 . both this ejection plate access opening 42 and also the ejection plate 40 possess , respectively , a contour which deviates from the circular , so that the ejection plate 40 can be brought into a first turning position through this ejection plate access opening 42 on the side of the end wall 113 remote from the roll body 10 . in this way , the shape of the non - circular ejection plate access opening 42 and the ejection plate 40 , may assume , for example , the shape of a triangle , or a rectangle , an oval , or the like . in accord with the embodiment shown in fig3 , the ejection plate access opening 42 is comprised of a circular , open mid - area 420 as well as two diametrically opposite slots 421 and 422 , the widths b 2 of which are smaller than the diameter d 2 of the central section 420 . a similar contour is shown by the ejection plate 40 , wherein the diameter d 3 of its center section 400 is smaller than the diameter d 2 of the center section 420 of the ejection plate access opening 42 and the length l 2 and the width b 3 of its radial projections 401 and 402 are less than the corresponding dimensions of the center area length l 1 and width b 2 of the slots 421 and 422 . if the ejection plate 40 has passed through the ejection plate access opening 42 , then , the ejection device 4 would be brought by turning about its longitudinal axis into a second rotated position , in which , by withdrawing the ejection device 4 in the direction of the arrow f 1 , the radial projections 401 and 402 on the ejection plate contact surface 41 lie between the slots 421 and 422 and upon a further pulling action in said direction , the stud 30 moves out of the stud receptor 31 . in the same action , the ring 111 and the fittings 110 are released from the ring groove 100 , so that the now loosened fittings carrier 11 can be withdrawn from the roll body 10 . the object of the invention , within the framework of the invention , can be altered in many ways , especially by means of the exchange of individual or several features with equivalents , or by other combinations of the invented features or their equivalents . instead of the described arrangement , also a reversed placement of the stud 30 and the stud receptor 31 is possible , so that the stud 30 is carried by the roll body 10 and the stud receptor 31 is a component of the fittings carrier 11 . it is further possible , that the stud 30 be aligned parallel to the axis of rotation of the drive shaft , whereby the stud 30 would be provided with a thickened head ( not shown ). also , in such a design and orientation of the stud 30 ( also not shown ), the stud 30 can be introduced , again with its thickened head , into the tapered entry 312 and through the narrow passage 313 to come to rest in the widened opening 314 . in this case the bolt also carries out its function for the establishment of the connection between the roll body 10 and the fittings carrier 11 . the release of this lockup is done in an analogous manner as this has been explained in connection with a bolt 30 which has been installed in the radial direction . the stud receptor 31 , instead of being in the form of a slot 311 , can also be a boring , which possesses laterally situated elastic elements for the snap in of the stud 30 as it assumes its operational position . it is obvious that the stud 30 need not be carried by a ring 300 which is part of the fittings carrier 11 , but can be placed directly in a corresponding boring ( not shown ) of the fittings carrier 11 or the roll body 10 ( in an reverse design of the connection apparatus 3 ). instead of an elastic design of the sidewall 316 , an alternative provision could be , that the side wall 316 be made of a rigid material and parts of this sidewall 316 ( for example , at the area of the narrow passage 313 ) be subjected to the loading of an elastic element , for example a compression spring or the like , in order to make possible the required yielding motion . alternatively , provision can be made that the stud receptor 31 be made wholly rigid , and accordingly , the stud 30 would then possess the elastic characteristics . in this case , the stud , for example , on its free end or head area , would carry an elastic ring or the like ( not shown ). this elastic ring , during its introduction into the tapered entry 312 , would be pressed into a circumferential groove in the stud 30 , until this elastic element , upon reaching the expansion 314 could once again expand and hold the stud 30 in its desired position . instead of a clip type connection device 3 , a latch type connection apparatus 5 could be employed ( fig4 ). this possesses , essentially , a latching member hook 50 as well as a latch shoulder 51 and a release apparatus 52 . principally , no difference is made , in this case , as to whether the latch s 0 is mounted on the fittings carrier 11 and the recess 510 with the latch shoulder 51 is carried by the roll body 10 or whether the arrangement of these components is reversed . however , from the design standpoint , it is to be recommended as advantageous to place the release apparatus 52 in that same place where the latch shoulder 51 is located . in accord with fig4 , the latch hook 50 is firmly bound to the fittings carrier 11 and extends itself parallel to the axis of the drive shaft 2 in the direction of the roll body 10 . this roll body 10 possesses a recess 510 , which extends in the longitudinal direction of the latch hook 50 on a guide surface 54 , which recess 510 is bordered on its end proximal to the fittings carrier 11 by a latch shoulder 51 . the end of the said recess 510 , remote from the said latch shoulder 51 , is terminated by a detent 511 . the release apparatus 52 possesses , as an essential component , a sliding element 520 , which can move back and forth between the detent formed by the said latch shoulder 51 and the detent 511 . in this action , the sliding element 520 , by an appropriate , guide ( which is only schematically indicated ) is secured in the recess 510 . in the connection position shown in fig4 , the latch hook 50 is locked behind the latch shoulder 51 and is thus held in this position . in this case , an elastic construction of the latch hook 50 will suffice for this function . in order to increase the assurance of the retention power of said latch hook 50 , the fittings carrier 11 is loaded by a an elastic element , for example , two leaf springs 53 , in a direction toward the latch shoulder 51 so that the latch hook 50 is pressed against the latch shoulder 51 . this elastic element in the form of leaf springs 53 is placed independently of the connection apparatus 5 , whereby for this function , the said annular groove 100 of the roll body 10 suffices . in order to activate the release mechanism 52 for the lifting of the connection between the roll body 10 and the fittings carrier 11 , so that this is freed , the latch hook 50 is moved counter to the force of the leaf springs 53 in the longitudinal direction of the recess 510 . to this end , a pressure in the direction of the arrow f 2 is exerted against the fittings carrier 11 . when this is done , the latch hook 50 pushes the release element 520 before it until the release element reaches the detent 511 on the other end of the recess 510 . at this moment , the latch hook 50 slides over a lifting edge 521 , which is part of the release element 520 , reaching a guide surface 524 which is also part of the release element 520 , that element now being motionless , due to its abutting the detent 511 . because of the ending of the exertion of pressure on the fittings carrier 11 , the said leaf springs 53 force the fittings carrier 11 in the direction of the arrow f 1 and thereby away from the roll body 10 . the latch hook 50 is carried along , without leaving the guide surface 524 of the release element 520 , which element also follows this movement . now the release element 520 finally abuts the latch shoulder 51 and is thereby prevented from following the progressing return movement of the fittings carrier 11 . because of the abutment of the release element 520 against the said latch shoulder 51 , the latch hook 50 can not engage anew on the latch shoulder 51 , but slides off the guide surface 524 of the release element 520 and onto the unobstructed surface 54 . the fittings carrier 11 can now be removed from the roll body 10 . as may be seen from the above description , due to being lifted out of the recess 510 , the latch hook 50 comes into a movement track which circles the recess 510 , in which the latch hook 50 is conducted around the recess 510 . when this occurs , this movement path is formed essentially by means of the guide surface 524 of the release element 520 as well as the guide surface 54 . another fittings carrier 11 , equipped with such fittings as is desired , now can be installed in place of the removed fittings carrier 11 by being pushed onto the roll body 10 in the direction of the arrow f 2 . in this way , the latch hook 50 reaches the release element 520 and pushes this before it , until the latch hook 50 engages itself behind the latch shoulder 51 and thus secures the fittings carrier 11 in its position against the roll body 10 . in order to assure the security of the sliding , i . e ., the come - along of the release element 520 in the desired manner , provision can be made , that the release element 520 slightly exceeds the height the recess 510 . in order to ease the pushing of the latch hook 50 on to the release element 520 , the latch hook 50 can have a run - on ramp on its end proximal to the release element 520 , which enables the elastically designed or elastically held latch hook 50 to yield in such a manner , that it can slide onto the release element 520 . for this purpose , the lifting edge 521 proximal to the latch hook 50 can be provided , outside of the recess 510 , with a chamfer or a small ramp 522 . in an embodiment , not presented in a figure , in the case of the just described embodiment the release element 520 can be furnished without , or only with a short run - on ramp , and , on this account , the lifting edge 521 , upon contact of the release element 520 against the latch hook 51 , stands slightly above the latching shoulder 51 . thereby , the latch hook 50 springs over the latch shoulder 51 upon the withdrawal of the latch hook 50 . in accord with the variant shown in fig5 , 6 , the release apparatus 52 possesses a displacement means designed as an angled diversion 523 , which deflects the latch hook 50 to the side . upon pushing the fittings carrier 11 onto the roll body 10 , the elastically constructed , or the elastically secured latch hook 50 is diverted hereby from the straight movement path a into a deflected curved path b , in which the recess 510 is to be found , and where the latch hook 50 engages itself behind the latch shoulder . for the lifting of this latch connection , the latch hook 50 with its ramp 500 is caused to run on to a lift edge 513 on the other end of the recess 510 , and thereby , is completely lifted out of the recess 510 and out of the operational area of the diversion means 523 so that the sideways bending of the prestressed latch hook 50 reassumes its straight position once more and thus returns directly into the straight movement track a , which runs next to the curved track b . if now , the fittings carrier 11 is withdrawn from the roll body 10 , then , the latch hook 50 does not create any resistance to said withdrawal , because the latch hook 50 is no longer in the diverted path b of movement with the latch shoulder 51 . in accord with fig5 , the latch hook 50 is connected to a supporting surface 60 , which is movably placed in the fittings carrier 11 . the support surface 60 is held relatively large and serves as an operative element for the connection apparatus 6 . if several connection apparatuses 6 are placed equally apportioned about a circular line in the front wall 113 of the fittings carrier 11 , then the support surface 60 can also be ring shaped and be designed as a common operative element for a plurality of connection apparatuses 6 . the radial support surface 60 is loaded toward the latch shoulder 51 by a compression spring 115 , the other end of which abuts against a radial support wall 114 of the fittings carrier 11 . for the lifting of the latch connection between the fittings carrier 11 and the roll body 10 , the fittings carrier 11 must not be in motion , but a movement of the latch hook 50 suffices , which is attained by pressure on the support surface 60 . for the securement of the connection apparatus 6 in the fittings carrier 11 , a restraint 7 is provided , as a part of which , the latch hook 50 ( see fig5 ) possesses a second hook , which coacts with one of the independent safety detents 70 of the connection apparatus 6 . if the latch hook 50 , as a result of its release , leaves the area of the connection apparatus 6 , then it proceeds with its second hook 501 to contact this security detent 70 and would be held back in this position . the securement detent 70 is a part of the slider 71 which is movable transversely to the direction of motion of the latch hook 50 ( see double arrow f 3 ) and is operated by means of an activation device 72 , which in turn is loaded by a compression spring 73 and by means of a ( not shown ) detent — or the like — is prevented from being pushed outward over the surface of the end wall 113 . the activation apparatus 72 possesses a guide plate 74 , with which a bolt 75 carried by a slider 71 engages . the slider 71 is conducted in a radial direction with the aid of a guide ( not shown ), so that it can principally carry out radial movements . in the position shown in fig5 by dotted lines the slider 71 is found in its operational position , in which the latch hook 50 , after its release by the connection apparatus 6 comes into contact with the latch shoulder 70 . if now the activation apparatus 72 is activated , then the slider 71 , with the aid of the plate guide 74 is drawn out of the space of the latch hook 50 , which is hereby released . accordingly , provision may be made , that the connection apparatus 6 , in the connection on the guide surface 54 which is proximal to the fittings carrier 11 , can exhibit an incline 76 , so that the space between the support wall 114 and the roll body 10 is increased . if the hook 501 , after the withdrawal of the slider 71 , comes to lie adjacent with the support wall 114 , then , by an appropriate energizing of the activation element 72 the slider is pushed against the hook 501 , in order to slide this downward from the support wall 114 , so that the latch hook 50 , while making use of the space created by the incline 76 , releases the fittings carrier 11 . at the operational speed of rotation of the disintegrator roll 1 of 8000 or more rpm , severe centrifugal forces are present . in order to secure the latch hook 50 in its idle position against these centrifugal forces , the latch shoulder 51 can be designed with a back - cut 514 and the latch hook 50 which engages with latch shoulder 51 , can be provided with a recess 502 which is complementary to the back - cut 514 ( see fig7 ). if the latch hook 50 is directly , or indirectly loaded with the force of the leaf springs 53 or the like ( see fig4 ) or of a compression spring 115 ( see fig5 ), then the latch hook 50 is pressed even more securely into the backcut 514 , so that the latch hook 50 cannot undesirably leave the back - cut 514 . according to the arrangement of the latch shoulder , the back - cut 514 can be in an acute angle , relative to the guide surface 54 , or made to fit a stepped form of the latch shoulder 51 . instead of a lifting edge 521 or 513 , a lifting means can be activated by the motion of the latch hook 50 and can be provided ( not shown ). this would be , for instance , a kind of an angular lever , which is pivoted by means of the advance of the latch hook 50 and thereby , the latch hook 50 is lifted out of the recess 510 . fig8 shows an activator element 9 serving now as an ejection device 43 which is located in the drive shaft 2 , which is designed as a hollow shaft . the activator element 9 is pushed inside the drive shaft 2 in the longitudinal direction and abuts the contact surface 41 , so that the withdrawal of the fittings carrier 11 from the roll body 10 is supported . in case it is desired , and if space conditions allow , it is entirely possible that this ejector 43 can be inserted each time upon need , in the drive shaft 2 from its end distal from the disintegrator roll 1 or , in the reverse action , be once again withdrawn from the drive shaft 2 . it would be more simple to manipulate and , in consideration of the generally very close space conditions , also more advantageous , if this ejector 43 were to remain permanently in the drive shaft 2 of the disintegrator roll 1 . in this way , the connection apparatus 3 , 5 or 6 without the aid of tools , can be brought not only into its connection position but also into its release position . in order to prevent the ejector 43 from undesirably leaving the drive shaft 2 , that end of the ejector 43 which is proximal to the end wall 113 of the fittings carrier 11 is equipped with a striking plate 430 , which extends itself in a radial direction beyond the boring 24 which accepts push - out device 43 in the drive shaft 2 . in an analogous manner , also that end of the ejector 43 which is remote from the fittings carrier 11 is equipped with a manual push - plate 431 . in this way , the maximum thrust path of the ejector 43 , relative to the drive shaft , is a specified distance . so that the contact plate 430 does not undesirably come to rest on the face of the end wall 113 of the fittings carrier 11 , in accord with the depicted embodiment , between the plate 431 and the end 125 , which is proximal to this plate 431 , a compression spring 432 is installed , or another analogous elastic element is provided , which , for instance , holds the ejector 43 always in that end position , in which its contact plate 430 maintains a specified distance from the provided ejector contacting surface 41 which is on the front wall 113 of the fittings carrier 11 , or from a releasing position of the connection apparatuses 3 , 5 or 6 . to initiate the removal of the fittings carrier 11 from the roll body 10 , the assigned operator presses the ejector 43 counter to the force of the compression spring 432 against ejection surface 41 . after its release , the ejector 43 returns into its operative base position again because of the force of the compression spring 432 . for example , arrangements can be made to clean the covered , inner face surface of the housing ( not shown ) of the disintegrator roll 1 and to remove the disintegrator roll 1 in its entirety from the drive shaft 2 . so that the drive shaft 2 can remain in the machine , between the roll body 10 and the drive shaft 2 is provided a clearance 26 and for the connection of the roll body 10 with the drive shaft 2 a clip type 3 or a latch arrangement 8 is available . this is principally to fulfill the purpose of assuring that the roll body 10 remains in axial alignment on the drive shaft 2 . however , the components can also take on responsibility for the transmission of the rotation from the drive shaft 2 to the roll body 10 . the clip or latch type connection apparatus can be constructed in various manners . the following description limits itself to an embodiment example of the type shown in fig8 , in accord with which , for the transmission of the rotation from the drive shaft 2 to the roll body 10 , a latch type connection is provided . this has at least one sphere 80 , which is retained for one part , in a complementary recess 81 in the circumferential surface of the drive shaft 2 and for the other part , fits into a corresponding recess 82 in the inner circumferential surface of the roll body 10 . the sphere 80 is , in this installation , subjected to the force of a compression spring 83 by means of which the sphere 80 is pressed into the said recess 81 . in order to be able to withdraw the roll body 10 from the drive shaft 2 , principally , no additional measures or auxiliary means are required . however , the removal of the roll body 10 from the drive shaft 2 is eased , and also a later reverse action of replacing the roll body 10 on the drive shaft 11 are additionally eased by the already cited activation element 9 . in accord with the embodiment shown in fig8 , the ejector 43 is an integral component of this activation element 9 , however , the activation element 9 can be provided for the activation of the connection apparatus 8 independent as to whether an ejector 43 is provided or not . the activation element 9 is integral with a lifting device 90 acting in a radial direction , which , in the embodiment shown in fig8 , is constructed in the form of one or more cams 900 , which extend themselves in a radial direction and reach , essentially , to an imaginary extended outside surface line 29 of the drive shaft 2 . the depicted , at - least - one cam 900 , is guided into a slot shaped radial opening 27 of the drive shaft 2 . this slot 27 ends in the recess 81 . the slot 27 has such a length , in the direction of the activation element 9 in the axial boring 24 of the drive shaft 2 , that the cam 900 ( or a plurality thereof , in which case a sphere 80 for each must be provided )— if the sphere 80 is to enter its recess 81 — is withdrawn from that area of said recess 81 . the cam 900 is now available for the lifting of the connection between the drive shaft 2 and the roll body 10 of the connection apparatus 8 . accordingly , the cam 900 moves into the connection apparatus 8 in such a manner , that the sphere 80 is lifted up the cam ramp onto a surface 901 of the cam 900 . this surface is at the level of the circumferential surface of the drive shaft 2 . in this position of the sphere 80 , the axial movement of the roll body 10 is free of obstruction . instead of the sphere 80 and the recess 81 , it is also possible , for a corresponding result , to provide ( not shown ) a centering and locking rod moving in a radial direction with a centering boring . in an additional embodiment , the sphere 80 or the said centering rod can be provided on the drive shaft 2 and the recess 81 or the centering hole on the roll body . because of centrifugal force , the pressure of the sphere or the centering rod on the , recess or centering opening is greatly increased , which leads , during rotation , to a much stronger connection and centering effect . a corresponding connection can also be established between the roll body 10 and the fittings carrier 11 . the described sphere ( s ) 80 of the connection apparatus , as already mentioned , suffices for the rotational inclusion effect of the roll body 10 by the drive shaft 2 . in order that the rotational inclusion effect can be achieved independently of the connection apparatus 8 , in accord with fig8 , for example , both in the circumferential surface of the drive shaft , as well as that of the roll body 10 , a longitudinal groove 28 , or a groove 101 is provided , in which a spring 102 is inserted . the force fit connection between the drive shaft 2 and the roll body 10 in the direction of rotation can also be effected by a kind of toothed engagement , or yet in another manner .	3
turning now to the detailed description of the preferred arrangement or arrangements of the present invention , it should be understood that the inventive features and concepts may be manifested in other arrangements and that the scope of the invention is not limited to the embodiments described or illustrated . the scope of the invention is intended only to be limited by the scope of the claims that follow . fig1 shows the basic schematics of the two different grid geometries used in reservoir simulation and geomechanical finite element simulation over a same section . the data in reservoir grid are represented by block - centered values of 9 blocks in dashed lines labeled p 1 through p 9 . the blocks p 1 through p 9 in the model are determined to have a value that is , for simplicity , interpreted as uniform across each block . overlying the 9 blocks are 12 nodal values labeled l 1 through l 12 with subscript denoting the node number . the nodes present finite element geomechanical simulation data . in order to couple the reservoir flow simulation to the geomechanical simulation to investigate the mechanical deformation of reservoir and its impact on flow behavior of the hydrocarbons , mapping { p 1 , p 2 , . . . p 9 } to { l 1 , l 2 , . . . l 12 } is a prerequisite and is crucial . however , this mapping is also technically challenging since the node distribution in the geomechanical model is considerably random and irregular with respective to the geometry of block centers of the reservoir model . the present invention comprises a least squares finite element method along with a procedure to achieve accuracy and efficiency of this complex data mapping with ease . the data mapping procedure of the present invention consists of two major steps : the first is point - block geometry mapping and the second is the application of least squares finite element analysis method . the procedure described below gives an example of a 2d problem with a triangle element in geomechanical model . without loss of generality , the procedure can also be applied to quadrilateral elements in 2d and tetrahedral elements or hexahedral elements in 3d problem . the first step is to identify and locate the numerical integration points of each finite element . as shown in fig2 a , the integration points a , b and c of a triangular element are shown . in fig2 b , the integration points a , b , c and d of a tetrahedral element are shown . the next step is to identify which block each of these numerical integration points is located . in fig3 , the grid blocks are shown in dashed lines and the numerical integration points a , b and c are found in blocks p 1 , p 4 and p 2 , respectively . the next step is to equalize data value at numerical integration points to the block - center data value of their associated reservoir grid blocks found at previous step . reservoir data is grid - centered based , which means that all the points inside a grid block will have the same value of data , which is equal to value at the center . therefore , if a numerical integration point of finite elements is inside one reservoir grid block , it has the exactly same value of data as that reservoir grid block . for example , in fig4 , the grid blocks number p 1 , p 2 , p 4 have pressure value of 500 psi , 1000 psi and 2000 psi , respectively . known from fig3 , numerical integration points a , b , c are inside reservoir block numbers of p 1 , p 4 , p 2 respectively . as a result , pressure values at these points are equal to 500 psi , 2000 psi and 1000 psi , respectively . the next step is to perform a least squares finite element computation . setting up the computation , let us define p 0 ( x , y ) as the pressure function inferring from known value of each numerical integration point within each finite element , and also define p ( x , y ) as the other pressure function inferring from data value at each finite element node which we are seeking for . thus , there are two pressure distribution functions , p 0 ( x , y ) and p ( x , y ), defined over the same finite element model domain ( x , y ). the goal is to find the integral minimal differences between p ( x , y ) and p 0 ( x , y ) over any location within ( x , y ). this problem can be solved using least squares finite element method as described below . firstly , we define a least squares functional f ( p ) over the model domain v = v ( x , y ), i . e . by virtue of variational principle , finding the minimal of functional f ( p ) can be achieved by performing δf ( p )= 0 . so we can have where δp refers to the virtual increment of the data function p ( x , y ). then , equation ( 2 ) can be discretized using a galerkin finite element technique to easily solve for nodal solutions of finite elements in the following matrix forms , where p ={ p 1 p 2 . . . p n } referring to the nodal solution of finite elements , n is the total number of nodes in each element , and where ξ i is the triangular coordinate of a triangle element at point i shown in fig2 , which is also called the area coordinate , w i are gauss quadrature weight for each numerical integration point i , n gp is the number of gauss quadrature points , \| j \| e is the determinant of the jacobian matrix which relates the area in local coordinates to that in global coordinates for element e and n k is the shape function at node k , which will be explained later . as such , p 0 ( ξ i ) is the estimated solution of p 0 ( x , y ) at numerical integration point i of a triangle element . as shown in fig4 at step 2 , where p 1 is the block center value of block 1 in the reservoir model , in which integration point ξ i is inside . once we obtain p ={ p 1 p 2 . . . p n } after solving equation ( 3 ), we will finish mapping the reservoir block center - based solutions of { p 1 p 2 . . . p m } to finite element nodal solutions of { p 1 p 2 . . . p n } as shown in fig1 . the above method can be compared to other methods described as follows : equation 3 can be interpreted as solving for p 1 in the reservoir model ( the right hand side term in equation 3 ) by means of averaging nodal values p ={ p 1 p 2 . . . p n } in a geomechanical model with k k1 being the averaging coefficients . as known from equation ( 5 ), averaging coefficients k k1 are functions of a shape function for a triangle element . hence , this averaging can be called shape function based weighted averaging . shape function n k in equations 4 and 5 in a 2d triangle element is defined as equal to its area coordinate ( triangular coordinate ) or volume coordinate in 3d tetrahedral element . for example , where ( x i , y i ) denoting the global ( x , y ) coordinates of node i shown in fig2 a and 2b and x ij = x i − x j , y ij = y i − y j . continuing with the explanation , it is known from equations ( 8 ) and ( 9 ), this shape function weighted averaging can account for the geometrical relationship between data points of two different grid models and is very similar to distance weighted averaging method widely used by previous researchers in data mapping . however , the shape function weighted averaging method according the present invention is different and offers many advantages over other distance weighted averaging methods . a first advantage is that a distance weighted averaging method requires searching for all neighboring reservoir blocks for each node . the number of neighboring reservoir blocks for each node is likely to be at least 8 in 2d considerations as shown in fig1 , and will be as high as 25 or more in 3d considerations . a huge number of nodes and grid blocks in field scale reservoir simulation , along with irregular geometry and a random distribution of those nodes and block - centers will definitely make those approaches considerably tedious and prone to poor accuracy . in contrast , the proposed method in this invention only needs to locate only one reservoir block for each node as shown in step 1 of the procedure . so , by comparison , the inventive method is simple and efficient . a second advantage is that distance weighted averaging requires calculation of all the distances between each node and block center of all of its neighboring blocks as weight coefficients . this is time consuming and not efficient . in contrast , the averaging weight coefficient in proposed method is based on a shape function which is a basic concept in finite element simulation , which automatically accounts for geometric relationship between different data points . thus , there is no need to calculate the distances . and the averaging can be linear or quadratic , depending on which type of elements used in geomechanical model . as a result , this is believed to be more accurate . in addition , the proposed method will also employ the classical least squares curve fitting method to fit reservoir model data to geomechanical model data . this should improve the accuracy of data mapping . in summary , the proposed method in this invention has advantages of simplicity , efficiency and accuracy over other methods , such as distance weighted averaging method widely used by previous researchers . fig5 shows the grid geometry of a reservoir model in reservoir flow simulation with a close - up of the grid geometry at left bottom corner shown in fig6 . a hexahedral type of grid was used in this reservoir model of fig6 which is a quite regular geometry . in comparison , fig7 shows that a different grid ( tetrahedral type ) that was employed in a geomechanical model , where random and irregular distribution of nodes can be clearly observed in the close - up view as shown in fig8 . as mentioned before , the objective is to map block - centered pressure data in fig5 and 6 to nodal pressure data in fig7 and 8 and map them accurately . the distinction in two geometries will make data mapping between two models extremely complicated . fig9 shows the pressure distribution at a specific depth in the example reservoir in the reservoir model where high pressure areas are in the darker gray area 91 , lower pressure is in the lower gray area 92 . the mapped pressure distribution in the geomechanical model using the inventive method is presented in fig1 also shows higher pressure 101 and lower pressure area 102 . it is evident that the contour shape and values of pressure depicted in fig1 are in substantial agreement with those in original reservoir model shown in fig9 . this is especially notable along the left side of the figures where pressure is higher . this illustrates the accuracy of data mapping in two dimensions by the proposed inventive method for this horizontal plane . in order to validate the accuracy of data mapping in three dimensions , pressure comparisons at two more different depths are also examined from fig1 to 14 . fig1 and 12 compare the pressure distribution at a depth 100 above the plane shown in fig9 and 10 where fig1 shows original pressure data in the reservoir model with higher pressure area 111 and lower pressure area 112 and fig1 demonstrates the mapped pressure data from reservoir model to the geomechanical finite element model with higher pressure area 121 and lower pressure 122 . obviously , pressure solutions between two models at this depth are also in excellent agreement . the shape of pressure contour , especially at head ( on the left ) and tail ( on the right ) of the higher pressure area can be captured remarkably in fig1 . similarly , fig1 and 14 depict the contour and values of pressure at a depth of about 80 feet above the fig1 and 12 depth for the same reservoir where fig1 shows original pressure data in the reservoir model where higher pressure is in area 131 and lower pressure is in the area 132 and fig1 demonstrates the mapped pressure data from reservoir model to the geomechanical finite element model with higher pressure in area 141 and lower pressure in area 142 . it is readily observed that the pressure mapping from reservoir model shown in fig1 to geomechanical model shown in fig1 is also performed effectively . as described above , fig9 to 14 show pressure values over the three representative depths with the intervals of 100 feet and 80 feet , which encompass the most of reservoir production zone in this reservoir model . therefore , achievement of excellent pressure mapping results in three dimensions over these depth intervals will allow us to move forward to solve this engineering problem accurately and efficiently using simulation coupling study . it should also be recognized that these drawings are for explanation and that in practice , more granularity is available by using color coded diagrams where multiple levels of pressure or other parameters are used and easily shown . thus it can be seen that utilizing the proposed least squares finite element technique and procedure , efficient pressure mapping in three dimensions from corner - point grid in the reservoir simulation model to a finite element tetrahedral grid in a geomechanical simulation model has been successfully created . it allows the coupling of reservoir simulation with geomechanical simulation to estimate the mechanical deformation of reservoirs over production / injection period and its impact on production as a consequence . in closing , it should be noted that the discussion of any reference is not an admission that it is prior art to the present invention , especially any reference that may have a publication date after the priority date of this application . at the same time , each and every claim below is hereby incorporated into this detailed description or specification as an additional embodiment of the present invention . although the systems and processes described herein have been described in detail , it should be understood that various changes , substitutions , and alterations can be made without departing from the spirit and scope of the invention as defined by the following claims . those skilled in the art may be able to study the preferred embodiments and identify other ways to practice the invention that are not exactly as described herein . it is the intent of the inventors that variations and equivalents of the invention are within the scope of the claims while the description , abstract and drawings are not to be used to limit the scope of the invention . the invention is specifically intended to be as broad as the claims below and their equivalents .	6
fig1 to 7 show an oven chamber having first filling openings 1 , 3 and 5 and second filling openings 2 and 4 . further , a riser 6 is connected to the oven chamber . in the first step of the first portion of the process , which is represented in fig1 coal is filled through filling opening 5 positioned adjacent riser 6 . this filling operation produces a cone - shaped charge 7 . this first step is ended when the outer edge of the cone - shaped charge 7 is situated approximately perpendicularly or vertically below filling opening 4 . the coarser coal is gathered in the areas of the outer surface or jacket of cone - shaped charge 7 , especially in the lower portion thereof . the filling gases produced during the charging operation are removed directly through riser 6 . in the next step of the first portion of the process , which is represented in fig2 the oven chamber is charged simultaneously through filling openings 1 and 3 . this produces cone - shaped charges 8 and 9 . this filling operation is stopped when the bases of the cone - shaped charges almost contact each other . here also the coarser coal is again deposited on the outer surfaces of the cone - shaped charges . approximately 30 % of the coal to be introduced through each filling opening 1 , 3 and 5 is introduced through each of such filling openings during the above operations . the filling gases formed in the second step are passed through filling opening 2 and filling opening 4 into a manifold 10 , and then pass through filling opening 5 , which is adjacent to riser 6 , back into the oven chamber . from there , the filling gases are directly removed through riser 6 . the above described first portion of the process is followed by a second portion of the process ( see fig3 ). here , the coal is charged simultaneously through filling openings 2 and 4 . this produces cone - shaped charges 11 and 12 , that are respectively positioned between cone - shaped charges 7 and 8 and 8 and 9 . here also the coarser coal is gathered on the outer surfaces of the charges . the filling performed through openings 2 and 4 is stopped before the coal flows over the tops of cone - shaped charges 7 , 8 and 9 , so that additional coarse - grained coal from charges 11 and 12 is not gathered on the outer surface of cone - shaped charges 7 , 8 and 9 . there is introduced in this step of the process approximately 80 % of the total amount of coal to be introduced through openings 2 and 4 . the filling gases are led through openings 1 and 3 into manifold 10 . the gases return into the oven chamber through filling opening 5 and then pass from the chamber into riser 6 . the trajectory of the filling gases is indicated in fig1 to 7 in each case by means of dashed lines . keeping in mind the extension of the oven chamber in the direction perpendicular to the plane of the drawings in fig1 to 7 , the filling operation produces true cones each having a circular cross section or flattened cones at the walls of the oven chamber . the step of the process represented in fig4 is a repetition of the step described with reference to fig1 . the charge introduced in this operation is designated by numeral 13 . the step of the process represented in fig5 is likewise a repetition of the step described with reference to fig2 . the charges introduced in this operation are designated by numerals 14 and 15 . the total charge to be introduced into the oven chamber through filling openings 5 , 3 and 1 is brought into the oven chamber with charges 13 , 14 and 15 . fig6 shows an intermediate step of the process , wherein the filling gas is removed through openings 1 - 4 . a levelling or grading opening 40 in the side of the chamber is opened . through opening 40 can be introduced a levelling tool 15 which levels the tips of the fills ( see fig7 ). at the same time , and as a repetition of the step of fig3 the residual charge to be introduced through openings 2 and 4 is poured into the oven chamber through such openings . from the drawings it can be seen that the surfaces of the charges , whereat the coarser coal is necessarily gathered , extend diagonally in the oven chamber . this guarantees a uniform carbonization of the coal . further , from the drawings it can be seen that the filling openings which are not used for feeding coal are available for conducting the filling gases . during each of the steps described the charging truck communicates with selected of the filling openings 1 to 5 through corresponding charging connections . the total filling time amounts to about two minutes . fig8 illustrates a charging truck 16 which can be transported on rails 17 that are placed on a cover 18 of the oven . charging truck 16 has five filling units 19 - 23 , that are each associated with one of the filling openings 1 - 5 . fig9 shows one of the filling units more in detail . each filling unit includes a feeder hopper 24 which is open on its lower side . a conveying device is arranged at such position and may be , e . g . a dish wheel , a vibrating trough , or a screw conveyor 25 , which conveys the coal stored in hopper 24 as required to a charging connection 26 . connection 26 has at the lower end thereof a discharge pipe 27 that can be telescoped by means of hydraulic lifting cylinders 28 and piston rods 29 . the discharge pipe 27 can be also pivoted within certain limits , so that it can be adapted to the specific position of the filling opening . a branch pipe 30 opens into charging connection 26 above conveying device 25 . the branch pipe 30 can be closed with respect to charging connection 26 by means of a shutoff valve 31 . at the end thereof situated opposite charging connection 26 , the branch pipes 30 of each of filling unit 19 - 23 end in a common manifold 10 . the operation of shutoff valves 31 , conveying devices 25 and lifting cylinders 28 may be controlled through known hydraulic or electric means . when coal is to be supplied into the oven chamber from a feeder hopper 24 through the filling opening associated therewith , conveying device 25 is started , and the coal conveyed thereby drops through charging connection 26 and discharge pipe 27 into the oven chamber . shutoff valve 31 is closed during this operation . when the desired amount of coal is supplied into the oven chamber , which amount may be measured , e . g . by means of a level detector , or predetermined by setting the operation time of conveying device 25 , then conveying device 25 is switched off and shutoff valve 31 is opened . the level may be checked visually through sight holes . for example , if at a time when coal has been conveyed into the oven chamber from the feeder hoppers of filling devices 19 and 21 , and the conveying devices associated with such filling units are switched off and the shutoff valves associated therewith are opened , the filling gas formed during the subsequent filling of the oven chamber from filling units 20 and 22 , may flow through charging connections 26 of filling units 19 and 21 and corresponding branch pipes 30 into manifold 10 . from there the filling gas is led past the branch pipes 30 of filling units 20 and 22 , that are closed by the respective shutoff valves 31 thereof , to the branch pipe 30 of filling unit 23 and passes through corresponding charging connection 26 thereof back into the chamber and from there into riser 6 . it will be apparent that many modifications may be made to that described above without departing from the scope of the present invention .	2
the present inventors have unexpectedly discovered that due to the small molecular size of the fluoride , and its affinity for multiple cross - linking sites , the fluoride can produce cross - linkage in hair and cause temporary or permanent restructuring of the hair ; i . e . causes straightening , smoothing , defrizzing and / or curling of the hair fiber . more particularly , the use of sodium fluoride can be used in hair products for straightening , smoothing , defrizzing and / or curling . sodium fluoride has excellent water solubility . unexpectedly , the present inventors have discovered that the fluoride can be used to crosslink other molecules to the hair to provide long lasting conditioning or volume to the hair . it can also be used to bind hair dye molecules in the hair for longer lasting coloring of the hair . sodium fluoride is an alternative to conventional hair products using formaldehyde . our data show that compositions for hair treatment having about 0 . 1 to about 15 %, preferably about 0 . 1 to about 3 . 0 %, and more preferably about 0 . 60 to about 1 . 25 % sodium fluoride at ph 4 . 8 , along with a polysaccharide thickener ( such as amigel ®) has a perceptible effect on curl reduction , and that smoothening or better alignment of hair fibers is observed for all normal and porous hair types . fig1 to 7 show the effects of a sodium fluoride composition on several hair types , normal and porous hair including 20 volume color treated and bleached hair . the results from examples 1 to 7 below are shown in fig1 to 7 , respectively . in each of the following examples , the hair was treated as follows : the hair was shampooed and blotted dry . the hair was combed and the treatment composition was applied on the hair for 35 minutes at room temperature with a brush and then it was treated as in the directions below for each of examples 1 to 7 . for all hair samples marked “ a ”, the treatment composition was applied for 35 minutes and then the hair was rinsed with tap water . the hair was air - dried naturally . for all hair samples marked “ b ”, the treatment composition was applied for 35 minutes and then the hair was rinsed with tap water . the hair was blow dried to about 90 % and then flat ironed at 430 ° f . the hair was then rinsed with tap water . for all hair samples marked “ c ”, the treatment composition was applied for 35 minutes and then the hair blow dried at a medium setting to about 90 %, and then flat ironed at 430 ° f . the hair was then rinsed with tap water , and the hair was air - dried naturally . for example 1 , shown in fig1 , a composition of the present disclosure containing 1 % sodium fluoride at ph 4 . 8 was applied to very curly normal hair . for example 2 , shown in fig2 , a composition of the present disclosure containing 1 % sodium fluoride at ph 4 . 8 was applied to very curly 20 volume hair . for example 3 , shown in fig3 , a composition of the present disclosure containing 1 % sodium fluoride at ˜ ph 4 . 8 was applied to very curly 40 volume bleached hair . for example 4 , shown in fig4 , a composition of the present disclosure containing 1 % sodium fluoride at ˜ ph 4 . 8 was applied to wavy 20 volume hair . for example 5 , shown in fig5 , a composition of the present disclosure containing 2 % sodium fluoride at a ph of approximately 4 . 8 was applied to very curly normal hair . for example 6 , show in fig6 , a composition of the present disclosure containing 1 . 5 % sodium fluoride at a ph of approximately 4 . 8 was applied to 40 volume bleached hair . for example 7 , samples a , b , and c were treated as follows : the treatment composition was applied to the hair for 35 minutes . the hair was blow dried at medium heat setting to about 90 % dry , and then flat - ironed at 430 ° f . the hair was then rinsed with tap water , and the hair was air dried naturally . samples o and z were treated as follows : the treatment composition was applied to the hair for 35 minutes , and then the hair was blow dried at a medium heat setting to about 90 % dry . the hair was then flat - ironed at 430 ° f ., and then was rinsed with tap water . the hair was then air dried naturally . as used in this application , the word “ about ” for dimensions , weights , and other measures , means a range that is ± 10 % of the stated value , more preferably ± 5 % of the stated value , and most preferably ± 2 % of the stated value , including all sub ranges there between . in practice of the present disclosure one or more other extended cosmetic compositions can be included for their generally acceptable recognized purposes . these can include soothing agents , such as aloe or allantoin gelatin ; auxiliary emollients , such as squalene , mineral oil , argan oil , coconut oil , jojoba oil , walnut oil or liquid silicones ; fatty alcohol based thickeners , such as cetyl alcohol , cetearyl alcohol , or stearic acid ; low to no foaming cationic , nonionic or amphoteric emulsifiers ; or preservatives , such as phenoxyethanol , sorbitol , potassium sorbate , sodium sorbate , methyl paraben , propyl paraben , imidazolidynyl urea , or dmdm hydantoin . the composition may also contain a fragrance to neutralize any malodors of the composition . the hair swatches are shampooed with a clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . the performance % curl reduction , shine and smoothness the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and hair was blow dried straight at high heat setting using a brush . the hair was rinsed after 48 hrs . the performance % curl reduction , the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a brush and processed for 35 minutes . the excess product was towel blotted and air dried from the hair . the hair was rinsed after 48 hrs . the performance % curl reduction , shine and smoothness was evaluated . the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i was applied liberally to the hair with a brush and processed for 35 minutes . the hair was rinsed with luke warm water . the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . the tabulated data of table i above shows that the overall performance of curl reduction , shine and smoothness on hair depends on the ph of composition i and method of application . the performance appears to be dependent on the ph and independent of the type of ph adjustor . the optimum performance of composition i ph range on normal , color treated and bleached hair , appears to be between 4 - 5 . also , the performance effects are dependent on the method of application of composition i . application methods a and d are preferable over methods b and c . both methods a and d have high heat flat ironing greater than 400 f .° with composition i or rinsed off the hair . curl reduction , increase in smoothness and shine of 40 - 80 % have been observed on normal , color treated and bleached hair . the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and hair was blow dried and straightened at high heat setting using a brush . the hair was rinsed after 48 hrs . the performance % curl reduction , the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition i product was applied liberally to the hair with a brush and processed for 35 minutes . the excess product was towel blotted and air dried from the hair . the hair was rinsed after 48 hrs . the performance % curl reduction , shine and smoothness was evaluated . the tabulated data on table ia shows that the optimum ph of composition i for maximum performance is about 4 . 50 . this is in agreement with the previous data of table i . exceptional curl reduction , smoothing and shine is observed on all hair types including normal , color treated and multi bleached hair . performance effects of 1 treatment , 1 wash , 5 wash , 10 wash and 2nd treatment with 0 . 75 % naf composition ii - b on very curly / frizzy hair ( normal , color treated and 2x bleached hair type ) process a : the hair swatches were shampooed with an alkaline shampoo ( ph = 8 . 10 ), towel blot and dried at medium heat with blow dryer . the composition ii - b product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . one of the swatch was rinsed and evaluated , the second swatch was washed 1 times and evaluated , the third swatch washed 5 times and evaluated , the fourth swatch was washed 10 times and evaluated and the fifth swatch was washed 10 times and 2nd treatment was repeated and after 48 hours the tabulated data on table ii shows that the performance longevity of a single treatment with composition ii - b can last multiple shampoos . in addition , the performance of repeat or double treatments increases significantly the performance in curl reduction , shine and smoothness . curl reduction study at higher ph range with 0 . 50 % naf composition ii - b on very curly / frizzy hair process a : the measurement of the initial length ( l0 ) and ( l100 ) of each swatch was taken . the hair swatches were shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition ii “ b ” with different ph range was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and the hair is dried to about 95 % with a blow dryer at high heat followed by flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours and air dried . % curl reduction was calculated with the final length ( lt ) the data of table iii shows the performance of composition iib , 0 . 50 % naf above ph 8 . 05 shows no advantages . this is probably due to unfavorable crosslinking between unprotonated amino r ′— n — r ″ ( r ′═ h , c ═ o or r ″═ h , c ═ o ) peptide side terminals and the fluoride ion that occurs at high ph . whereas the ph decreases the protonation of the amino group and specifically the peptide side terminals of lysine , arginine r — nh3 + and will favor crosslinking with the fluoride ion . these side terminal crosslinks r — nh3f , — n — h2f , — n — hf or possible amide crosslinks f — n — c ═ o are more favorable at low ph . alternatively , favorable crosslinking may occur with the side oh side terminals of threonine and serine or indirect crosslinking followed by dehydration for threonine side terminal . the hair swatches are shampooed with clarifying shampoo , towel blot and dried at medium heat with blow dryer . the composition ii product was applied liberally to the hair with a tint brush and processed for 35 minutes . the excess product was towel blotted and the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing @ 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . the hair swatches are shampooed with shampoo , towel blot and dried at medium heat with blow dryer . the composition ii product was applied liberally to the hair with a brush and processed for 35 minutes . the hair was rinsed with luke warm water . the hair is dried to about 95 % with a blow dryer at low heat followed with flat ironing at 430 ° f . using 7 - 8 passes . the hair was rinsed after 48 hours . the performance % curl reduction , shine and smoothness was evaluated . the tabulate data of table iv shows that the performance on normal hair is not affected greatly with the concentration increase of naf from 0 . 5 - 2 . 50 %. however , on porous hair 20 volume and twice 40 volume bleached hair , naf concentration effects are observed . the data shows equivalent performance to 0 . 5 % formaldehyde is obtained with 0 . 23 % f ( 0 . 50 % naf ). this observation can be explained due to the presence of larger number of ionic sites in hair which result in greater crosslinking and overall performance of curl reduction and smoothing effects . it also suggests that the crosslinking reactions of the fluoride and formaldehyde with hair may not entirely be the same . the specificity of crosslinking with the fluoride is greater than formaldehyde , thus more predictable results can be obtained . table v performance evaluation using treatment processes e , f and g ( normal , color treated and 2x bleached hair type ) composition ii - b naf 0 . 75 % amigel thickener 0 . 60 % glycerol 0 . 50 % phenoxyethanol 0 . 20 % 50 % phosphoric acid ph adjustment only qs di water qs . performance ph lo ( cm ) ls ( cm ) lt ( cm ) % curl reduction shine smoothness normal curly process e 4 . 49 13 . 0 20 . 0 14 . 5 21 . 43 % ++ ++ hair process f 4 . 49 13 . 0 20 . 0 15 . 0 28 . 57 % +++ +++ process g 4 . 49 13 . 0 20 . 0 15 . 0 28 . 57 % +++ +++ 20 vol / 6r process e 4 . 49 10 . 0 13 . 5 11 . 0 28 . 57 % ++ ++ color treated process f 4 . 49 10 . 0 13 . 5 11 . 0 28 . 57 % ++++ ++++ hair process g 4 . 49 13 . 0 20 . 0 15 . 0 28 . 57 % ++++ ++++ 2x bleached hair process e 4 . 49 14 . 0 18 . 0 16 . 0 50 . 00 % ++ ++ 40 vol process f 4 . 49 14 . 0 18 . 0 16 . 0 50 . 00 % ++++ ++++ process g 4 . 49 14 . 0 18 . 0 16 . 0 50 . 00 % ++++ ++++ different processes tested process e : wash hair with clarifying shampoo . towel blot excess water and blow dry in medium heat up to 95 % dry . apply the fluoride product thoroughly and comb hair through to ensure that all hair fibers are saturated with the product . process for 35 min . keep the hair straight during process time . rinse with luke warm water and towel blot excess water . apply a moisturizing leave - on conditioner and detangle the hair with the comb . blow dry hair in high heat . take thin sections and flat iron at approximately 430 ° f . with 7 - 8 passes , make sure that all the fibers are passed through the heat evenly . after 48 hours wash hair with sulfate free shampoo and conditioner . process f wash hair with clarifying shampoo . towel blot excess and blow dry in medium heat up to 95 % dry . apply the fluoride product thoroughly and comb hair through to ensure that all hair fibers are saturated with the product . process for 35 min . keep the hair straight during process time . towel blot excess product and apply a deep conditioning masque . comb through so that all the fibers are covered with masque . process for 10 min and rinse with luke warm water . towel blot excess water and blow dry in high heat . take thin sections and flat iron at approximately 430 ° f . with 7 - 8 passes , make sure that all the fibers are passed through the heat evenly . after 48 hours wash hair with sulfate free shampoo and conditioner . process g wash hair with clarifying shampoo . towel blot excess and blow dry in medium heat up to 95 % dry . apply the fluoride product thoroughly with a tint brush . comb hair through to ensure that all hair fibers are saturated with the product . process for 35 min . keep the hair straight during process time . towel blot excess product and apply a leave - on conditioner . comb through so that all the fibers are saturated . towel blot excess and blow dry up to 95 % dry . take very thin sections and flat iron at approximately 430 ° f . with 7 - 8 passes , make sure that all the fibers are passed through the heat evenly . section hair and apply the deep conditioning masque and process for 10 minutes . rinse with luke warm water and style as desired . % curl reduction evaluation : lo = initial length of curly hair ls = length of hair @ 100 % curl reduction lt = length of treated curly hair % ⁢ ⁢ curl ⁢ ⁢ reduction = lt - lo ls - lo ⨯ 100 shine and smoothness evaluation : grading 0 % ± 0 - 20 % + 20 - 40 % ++ 40 - 60 % +++ 60 - 80 % ++++ 80 - 100 % +++++ the data in table v shows the different methods of treatment application to enhance the conditioning effects with the fluoride treatment . all treatment methods e , f and g increase the conditioning and smoothing effects of hair . based on the results it appears that method g is the best where the fluoride is crosslinked first to the hair and the conditioning agents are further crosslinked by the fluoride . this multi - crosslinking effect of fluoride between the hair and the conditioning agent creates longer lasting effects between washes . comparative results with just hair conditioning treatments of masking or rinse off conditioners shows a temporary effect that does not last more than one or two shampoos . the fluoride crosslinked hair will have a strong affinity to bind different molecules , such as conditioning , antistatic , volumizing ingredients , keratin proteins and non - keratinous proteins . the crosslinking of fluoridated keratin reacts with functional groups of strong cationic character , such amino , mono or divalent cations forming strong ligand structures within the air . the formation of these additional structures will restructure hair and produce effects of increased softness , manageability and tensile strength . methods of sodium fluoride application on hair for maximum conditioning / smoothing effects wash the hair with clarifying shampoo . towel blot excess and blow dry in medium heat up to 95 % dry . apply the fluoride composition product on hair thoroughly . and comb through to ensure that all the fibers are saturated with the product . process for 35 min . keep the hair straight during process time . rinse with luke warm water and towel blot excess water . apply a leave - on conditioner and detangle the hair with the comb . blow dry with medium heat . take thin sections and iron hair with a preheated flat iron with a minimum of 7 - 8 passes , making sure that all the fibers are passed through evenly . after 48 hours wash hair with sulfate free shampoo and conditioner . wash the hair with clarifying shampoo . towel blot excess and blow dry in medium heat up to 95 % dry . apply the fluoride composition product on hair thoroughly and comb through to ensure that all the fibers are saturated with the product . process for 35 min . keep the hair straight during process time . towel blot excess product and apply a deep conditioner , reconstructor or conditioning masque with a tint brush . comb through so that all the fibers are covered with deep conditioner , reconstructor or conditioning masque . process for 10 min and rinse with luke warm water . towel blot excess water and blow dry with high heat . take thin sections and iron hair with a pre - heated flat iron with a minimum of 7 - 8 passes , making sure that all the fibers are passed through evenly . after 48 hours wash hair with sulfate free shampoo and conditioner . wash hair with clarifying shampoo . towel blot excess and blow dry hair in medium heat up to 95 % dy . apply the fluoride composition product on hair thoroughly and comb through to ensure that all the fibers are saturated with the product . process for 35 min . keep the hair straight during process time . towel blot excess product and apply a leave - on conditioner . comb through so that all the fibers are saturated . towel blot excess and blow dry up to 95 % dry . take very thin sections and iron hair with a pre heated flat iron with a minimum of 7 - 8 passes , making sure that all the fibers are passed through evenly . section hair and apply a deep conditioner , reconstructor or conditioning masque and process for 10 minutes . rinse with luke warm water and style as desired . detection of fluoride ion in normal , colored and bleached single treated hair fibers with composition ii , 0 . 75 % na f @ ph 4 . 51 analysis of fluoride ion in single treated hair initially and after hair type : normal , 20 vol / 6r color treated and 2x bleached hair . variations : 1 treatment ; 3 wash ; 5 wash ; 10 wash and 15 washes buffer solution : 25 ml . tisab ii + 25 ml . di h 2 o for immersing the hair sample for 48 hours . standards for calibration : 2 , 4 , 6 , 10 , 20 ( μg / ml ) fluoride ion all the hair swatches were washed with an alkaline shampoo at ph 8 . 09 . the controls and the samples to be treated were dried to 95 % with blow dryer , at medium heat setting . the hair swatches ( approximately 5 inch in width ) were treated with composition ii ( 0 . 75 % naf ) ph = 4 . 51 . processed for 35 min . towel blot excess . dried up to 95 % dry with blow dryer at medium heat followed with flat ironing small sections of hair at approximately 430 ° f . with 7 - 8 passes . after 48 hours the hair was rinsed with copious amounts of water and hair was dried at ambient conditions and cut into small 1 / 16 ″ sections . the hair was further equilibrated under ambient conditions for 8 hours and hair samples weighed about 0 . 5 grams and were immersed into 50 ml of buffer solutions 1 : 1 total ionic strength adjustment buffer ( tisab ii ): deionized water for 48 hours . direct analysis of the fluoride ion was carried out in the leached solutions using the fluoride ion selective electrode potentiometric method ( astm d 1179 - 72 ) approved by the american society of testing and materials . the hair swatches were washed 3x , 5x , 10x and 15 x , and the hair was dried with blow dryer between the washes . the multi washed hair samples were analyzed as above . the data in table vi shows that fluoride is detected in normal , colored and bleached hair treated hair . based on the assay results about 3 , 400 μmoles f / g hair is detected in water / buffer leaches of normal and color treated hair . this is compared to 1 , 800 μmoles f / g hair for bleached hair . this detection of fluoride in treated hair even after fifteen washes suggest that stable crosslinking has occurred and it is resistant to conventional shampooing and conditioning . the detection of fluoride in the buffer / water leaches is about 42 - 46 % after fifteen shampoos showing slow rate of depletion or leaching of fluoride from hair . based on these observations long lasting results of up to fifteen or more shampoos should be expected from a single treatment . procedure : hair for tensile testing was prepared with five bundles of twelve hair fibers ( total of 60 fibers ) of similar texture with normal , 20 volume , 2 × bleached hair . the bundles were immersed in water for 1 - 2 hours and the initial wet tensile strength of all the bundles was evaluated at 20 % extension using an instron model 1122c5054 at 0 . 5 inch / minute . the bundles after 24 hours were washed , blow dried with a paddle brush to about 95 % and the naf composition i at ph 4 . 50 was applied with the tint brush and processed for 35 minutes . after the excess product was towel blotted and blow dried to about 95 % with medium heat using a paddle brush , each bundle were flat ironed at approximately 430 ° c . with 7 - 8 passes . after 24 hours , the fibers were soaked in di water and after 45 minutes the tensile strength of bundles was determined under the identical conditions . the tensile strength of bundles was determined versus untreated fibers with composition i . the wet tensile strength of each bundle was calculated as 20 % index given below : the tensile strength studies showed that statistically a single treatment of normal , colored and bleached hair with the fluoride composition i statistically and significantly improved the tensile strength . the wet strength is attributed by adding support to the alpha helical crosslinks of cystine . this is not an expected effect for wet strength since all secondary bonds should be minimized in water . it is interesting that formaldehyde has significantly decreased the tensile strength of hair which suggests the weakening of these crosslinks . this supports our understanding that the crosslinking reactions and mechanism between the fluoride and formaldehyde is different . differential scanning calorimetry ( dsc ) techniques published earlier by cao ( j . cao , melting study of the α crystallites in human hair by dsc , thermody . acta , 335 ( 1999 ) and f . j . wortmann , ( f . j wortmann , c . springob , and g . sendlebach , investigations of cosmetically treated human hair by dsc in water , iffcc . ref 12 ( 2000 ) are used to study the structural changes of hair by measuring the thermal decomposition pattern or behavior . the thermal stability of hair is evaluated by measuring the amount of thermal energy required for denaturation or phase transition . the technique measures the amount of heat transferred into and out of a sample in a comparison to a reference . the heat transfer in ( endothermic ) and out ( exothermic ) is detected and recorded as a thermogram of heat flow versus temperature . the technique gives valuable information on the morphological components of hair of feughelman &# 39 ; s accepted two phase filament matrix model for hair ( m . feugelman , a two phase structure for keratin fibers , text . res . 1 , 29 , 223 - 228 , 1959 ). this two phase model includes the crystalline filaments ( alpha helical proteins ) or traditionally referred to as microfibrils which are embedded in an amorphous matrix . the dsc data technique yields thermogram data on the denaturation temperature t m and the denaturation enthalpy ( delta h ) of hair . it is concluded that the thermogram data of the denaturation temperature t m of hair is dependent on the crosslink density of the matrix in which surrounds the microfibrils or crystalline filaments . also , the denaturation enthalpy ( delta h ) depends on the strength of the crystalline filaments or microfibrils . it has been shown that cosmetic treatments , such as bleaching or perming , effect these morphological components selectively and differently at different rates causing changes in denaturation temperatures and in heat flow . dsc was use to analyze the effects of naf treatment on normal , 20 volume color treated and four times bleached hair . the treatment included process a using composition i at 1 % naf at ph 4 . 50 . the hair after 48 hours was rinsed and dried at ambient temperature conditions and relative humidity ( 20 c .°, 65 % rh ). the hair samples were cut into small pieces of about 2 mm in length and about 4 - 7 mg weighed into aluminum pans followed with capping . the hair samples were analyzed using perkin elmer diamond dsc instrument and a method of 50 c .° to 280 c .° at 20 c .°/ minute using an empty capped aluminum pan as reference . the obtained dsc thermograms for treated and untreated hair samples showed single endothermic ( absorbed thermal energy ) denaturation temperatures t m ranging from 178 to 189 c .° and delta h from 154 to 340 ( j / g ). the comparative tabulated data below for normal untreated and treated hair shows differences in the denaturation temperatures of 178 . 88 and 184 . 33 c .°, respectively , with no differences in the delta h . this is due to changes in the crosslink density of the matrix attributed by an increase in the crosslink density of the matrix proteins with naf . based on the delta h it is assumed that the intermediate filaments or alpha helical protein regions or microfilaments are not affected . the results for 20 volume color treated and untreated hair show significant statistically changes in the delta h ( p = 0 . 00019 ) of 226 . 53 and 270 . 01 ( j / g ) and no changes in the denaturation temperature . this observation suggests that the effects of naf on 20 volume color treated hair are primarily on the alpha helical protein regions with no effect on the matrix proteins . the multi bleached hair fibers show statistically differences in the denaturation temperatures 187 . 76 and 181 . 49 c .° and delta h 260 . 28 and 318 . 16 ( j / g ) between untreated and treated samples . this observation suggests that both the matrix proteins and the alpha - helical proteins are affected by the naf treatment . this data is in good agreement with previously reported data by humphries et al . jscc , 1972 on oxidized and colored dried hair showing higher denaturation temperatures and delta h . the explanation may be explained by an increase in crosslinked bridges between the polypeptide chains giving more structural support . this appears to be the same observation with the naf increasing the overall support for hair through crosslinking on the matrix proteins and alpha helical regions of the hair . it should be understood that the foregoing description is only illustrative of the present disclosure . various alternatives and modifications can be devised by those skilled in the art without departing from the disclosure . accordingly , the present disclosure is intended to embrace all such alternatives , modifications , and variances that fall within the scope of the disclosure .	0
a preferred embodiment of the present invention will now be described by way of example and with reference to the accompanying drawings . the pbx system 10 is connected to pstn 2 , pstn meaning public switched telephone network — this is the outside external telephone system . the pbx is connected to pstn by regular phone lines 12 . the onhold means 1 is responsible for answering the call , routing the call to a call center agent 3 , deciding and controlling the mode for each conversation , such as short or long queue status and queue waiting or free waiting possibilities . the onhold monitors conversations and also accepts commands from call center . the onhold may be within the pbx 10 which will be a new pbx system , or external , as illustrated , connected through channel 11 which can be implemented by any kind of data and / or control lines . thus , the new pbx system may be implemented by connecting onhold to a conventional pbx system . the call center 3 is consisted of human call center agents , which can answer calls and also control the mode of conversation and other parameters . connection lines 13 , are responsible for transferring : control parameters and controlling commands from call center to onhold , status of the pbx system to call center , status of the onhold system to call center , switching the call lines to the agents . fig2 illustrates possible implementation of the onhold 1 by two systems : the onhold manager 14 and the conversation manager 15 . the onhold manager is responsible for answering the call , routing the call to a call center agent 3 , deciding , controlling and asking caller for the mode of the conversation : short or long queue and queue waiting or free waiting . the onhold manager controls when and whether to put onhold or route to call center . the onhold manager manages fifos and queues , which keep the data regarding the callers . “ fifo ” or “ fifo ” here refers to a “ first in first out ” memory means as known in the art . the conversation manager connects calls to call center agents , notifies the onhold manager when a call ends , limits the call time when needed and record a call when needed . the conversation manager connects calls to call center agents through connections 13 . the conversation manager notifies the onhold manager when a call ends and transfers commands coming from call center through lines 16 . the conversation manager accepts commands and calls through lines 16 . the onhold manager and conversation manager may be within the pbx 10 which will be a new pbx system , or external , as in the figure , connected through 11 which can be implemented by any kind of data and / or control lines . fig3 describes internal parts of the conversation manager and the onhold manager . when a call is received on one of lines 11 , to the pbx , it is connected to a channel 142 , which is within the onhold manager 14 . there may be many channels at the pbx , each one can control the session in several ways : accept a conversation , answer the call and play a message or music , inform the system and the call center that a conversation has arrived , disconnect the conversation and any other operation . a decision engine 140 is managing the channels , through lines 141 , according to the information coming from the channels , through line 141 , and the status of the system such as parameters set by operators , and the status of fifos : 143 , 144 , 145 and 146 . a conversation engine 150 is monitoring the conversations , which are being answered , through call lines 161 , and can disconnect the conversation if it reaches a time limit set by the decision engine . the conversation engine may record the conversation if it is required , this can be set by defining criteria for recording , or by sending a command through lines 163 from the decision engine . the conversation engine informs the decision engine through 162 , when the call has ended , so that other conversation can be accessed . when a call is received and connected to a channel , the channel informs the decision engine through lines 141 , about the conversation . the decision engine then checks if there is a free line to the call center . in case there is a free line to call center , the line is switched through the conversation manager , on line 161 , to connect a human agent 31 at call center . in case there is not a free line to call center , the decision engine informs the channel , through line 141 , that there is no free line . the channel asks the user for the modes of conversation , such as short or long queue , queue waiting or free waiting possibilities . the channel informs the decision engine about the chosen mode of operation . the decision engine can then update the status of the user in the relevant fifo : if the user chooses long queue and queue waiting , data will be written to fifo 143 . if the user chooses short queue and queue waiting , data will be written to fifo 144 . if the user chooses long queue and free waiting , data will be written to fifo 145 . if the user chooses short queue and free waiting , data will be written to fifo 146 . the data will include details about the caller and the location in the relevant queue . in the free - waiting fifos , the details about each caller will include the phone number that the caller was requested to type as the phone number he / she can be reached at , when he / she had chosen the free waiting option . data will be written and read through lines 148 which connect between the fifos and the decision engine . the decision engine can also control future user &# 39 ; s requests and control music played by the channel . all of these operations are done through lines 141 . the onhold monitors conversations and also accepts commands from call center . a serviced queue fifo 147 keeps an updated list of users to serve . users are added by the decision engine , through line 148 . the type of service is also kept in this fifo , in order to let the conversation engine know how to monitor each channel ( recording , for example ). users are removed by the conversation engine , which also write for each channel the reason for which the conversation ended , for example : caller exceeded time limit or call hanged up the phone . these details are sent from conversation engine to the serviced queue fifo , through line 164 . the decision engine constantly calculates when is the turn of a new caller . when it is estimated that according to data in one of the free waiting fifos ( 145 , 146 ) there are 40 seconds ( or any other time , as configured by the user ) left before next user should be answered , the decision engine commands a channel to initiate a call to that user . if a call in a channel which is registered at one of the queue - waiting fifos ( 143 , 144 ) was hanged up , then the decision engine commands the channel to disconnect that conversation . the conversation engine is updated by the decision engine as well , so that a new caller may be connected instead . if a caller that was waiting in one of the queue - waiting fifos has disconnected the call before his turn to be serviced had arrived , then the decision engine will delete this caller from the fifo . fig4 describes a method for handling incoming telephone calls an incoming call 200 is arriving through a regular telephone line or through a pbx , a channel answers that call 210 , the function of the channel is as previously described . if there is a free human agent who can answer that phone call then it will be answered 225 . if there is no free human agent who can answer that phone call , then the caller will be told that waiting is required , and then caller will be put onhold . in this case , the caller will be asked to choose between two options 230 : waiting in the short queue , or waiting in the long queue . in both cases , the caller will be asked to choose between queue waiting and free waiting 240 , 250 . if the caller selected “ no ” in 240 or 250 , that is short or long queue waiting respectively , then the caller can choose while waiting , from interactive options 241 , 251 for short and long queue waiting , respectively . these options may include : changing and controlling music playing if at all , receiving information about estimated time to get the service , having quizzes and other games , choosing a radio station to listen to , etc . if the caller selected free waiting , short or long , that is “ yes ” in 240 or 250 respectively , then the caller will be asked to type the phone number where he / she can be reached , and then the caller may hang up the phone and be free to doing other things , picking up the phone only when his / her turn for accepting service has arrived or when it is soon to arrive . the specific decision , 245 for short line or 255 for long line , when to call the client can be based on algorithmic decision , time estimation and operator &# 39 ; s commands . in all of these possible choices the caller is advancing along in the queue , however each possibility has different queue . if the caller chooses a short / long queue waiting , then when the caller is first in the line he / she will access the agent at the call center . this is implemented by 242 , 252 for short or long queue waiting , respectively . a caller &# 39 ; s status and position may be monitored by the system at 241 , 242 , 244 , 245 and at 251 , 252 , 254 , 255 . in all such cases , time to service estimation is available . if the caller is in short queue , a more precise time to service estimation is available , since each caller has a limited time service . if the caller chooses a short / long free waiting , then when the caller is at a predefined position in the queue , and based on other parameters such as number of agents handling this queue , the system will initiate a phone call to that caller , so that only a reduced waiting time will remain . eventually , a conversation with human agent is made 243 , 246 , 253 , 256 . the conversation is monitored and can be recorded or disconnected by decision . the system and any of its functions and / or components may be implemented by software and / or by hardware means , as known in the art .	7
fig1 is a block diagram illustrating a configuration example of a call system 10 according to a first exemplary embodiment of the present invention . the call system 10 includes a calling - side device 100 , a called - side device 200 , a related contact destination device 300 , and a caller identification server 400 ( caller identification apparatus ). the calling - side device 100 , the called - side device 200 , and the related contact destination device 300 are connected to each other via a telephone network 20 . further , the telephone network 20 , the caller identification server 400 , the called - side device 200 , and the related contact destination device 300 are connected to each other via a predetermined data communication network 30 ( such as the internet ). the calling - side device 100 includes at least a telephone set ( not illustrated in fig1 ) operated by a caller . the called - side device 200 includes a telephone set 210 and an information terminal 220 . the telephone set 210 is a telephone set operated by a call recipient . the information terminal 220 is a terminal ( such as a personal computer ) for communicating with a device ( such as the caller identification server 400 ) connected to the data communication network 30 . the information terminal 220 has at least a function of communicating with the device connected to the data communication network 30 , and an expression function of visually displaying or phonetically displaying predetermined information . for example , the information terminal 220 receives a “ call type ” described below from the caller identification server 400 , and displays this call type on a screen . the related contact destination device 300 is capable of communicating with at least the caller identification server 400 via the data communication network 30 . herein , the related contact destination is for example , a family member of the call recipient , a service center operated by a business operator providing a telephone service , the police , or the like . fig2 is a block diagram illustrating a configuration example of the caller identification server 400 . the caller identification server 400 includes a storage unit 410 ( a storage means ) and a voice characteristic analysis unit 420 ( a voice characteristic analysis means ). in the present exemplary embodiment , description is made by exemplifying a case in which the voice characteristics are “ voiceprint ”. of course , the voice characteristics are not limited to the voiceprint only . the storage unit 410 stores a white list 430 and a black list 440 . in the white list 430 , voice characteristic information ( such as voiceprint information ) of a close relative ( such as a family member or a friend ) of a call recipient is recorded in advance . in the black list 440 , voiceprint information of a criminal such as a swindler , or of a person suspected of a crime is recorded in advance . the voice characteristic analysis unit 420 acquires voice data of a caller , from the telephone network 20 via the data communication network 30 . the voice characteristic analysis unit 420 extracts voiceprint information from the acquired voice data . the voice characteristic analysis unit 420 analyzes the extracted voiceprint information ( concretely , determines whether or not it coincides with the voiceprint recorded in each list , and determines whether or not one piece of the voice data includes voiceprints of a plurality of persons ). additionally , there is no particular limitation on a timing that the voice characteristic analysis unit 420 analyzes the extracted voiceprint information . for example , it may perform matching at predetermined intervals ( such as 5 - second intervals ) to determine whether or not a talking person can be distinguished , and when this determination cannot be made , the voice characteristic analysis unit 420 may perform the matching again . as another option , at the end of the call , it may collectively analyze the voiceprint information extracted during the call . the voice characteristic analysis unit 420 performs an appropriate process based on the analysis result ( call type ), as described below . fig3 is a flowchart illustrating an operation example of the caller identification server 400 . the voice characteristic analysis unit 420 acquires the voice data of the caller , from the telephone network 20 via the data communication network 30 ( step s 1 ). the voice characteristic analysis unit 420 extracts voiceprint information from the acquired voice data ( step s 2 ). the voice characteristic analysis unit 420 determines whether or not the extracted voiceprint information coincides with the voiceprint information recorded in the white list 430 ( step s 3 ). when the information coincides with the voiceprint information recorded in the white list 430 ( yes at the step s 3 ), the voice characteristic analysis unit 420 classifies a type of the call into “ a call type a ( a second determination result )” ( undoubtedly , the call from the close relative ) ( step s 4 ). when the information does not coincide with the voiceprint information recorded in the white list 430 ( no at the step s 3 ), the voice characteristic analysis unit 420 determines whether or not the extracted voiceprint information coincides with the voiceprint information recorded in the black list 440 ( step s 5 ). when the information coincides with the voiceprint information recorded in the black list 440 ( yes at the step s 5 ), the voice characteristic analysis unit 420 classifies a type of the call into “ a call type b ( a third determination result )” ( undoubtedly , the call from the swindler ) ( step s 6 ). when the information does not coincide with the voiceprint information recorded in the black list 440 ( no at the step s 5 ), the voice characteristic analysis unit 420 determines whether or not the extracted voiceprint information includes voiceprints of a plurality of persons ( step s 7 ). when the information includes voiceprints of a plurality of persons ( yes at the step s 7 ), the voice characteristic analysis unit 420 classifies a type of the call into “ a call type c ( a first determination result )” ( a call having a high possibility of being a call from a swindler ) ( step s 8 ). when the information does not include voiceprints of a plurality of persons ( no at the step s 7 ), the voice characteristic analysis unit 420 classifies a type of the call into “ a call type d ( a fourth determination result )” ( a call having a low possibility of being a call from a swindler ) ( step s 9 ). among frauds , there is sometimes a fraud in which a scenario is created in advance to carefully make determination about “ who says what at which timing .” in other words , when a plurality of persons appear in one call , the call has a high possibility of being a call from a fraud group . however , when all of those persons are not recorded in the black list , such a call is not determined as a call from a swindler by a method of making determination for a call simply on the basis of coincidence or non - coincidence with those in the black list . in view of it , according to the first exemplary embodiment , for a call that is classified into none of a close relative and a swindler , it is determined whether or not a plurality of pieces of voiceprint information exist ( i . e ., whether or not a plurality of persons appear ) so that a call type is classified in more detail . concretely , call types are classified into each one of four types of the above - described call types a to d . the voice characteristic analysis unit 420 transmits the call type ( one of the call types a to d ) of the call to the information terminal 220 via the data communication network 30 ( step s 10 ). the information terminal 220 displays the received call type on the screen . the voice characteristic analysis unit 420 determines whether or not a call type of the call is the call type b ( undoubtedly , a call from the swindler ) or the call type c ( a call having a high possibility of being a call from a swindler ) ( step s 11 ). when a call type is neither the call type b nor the call type c ( no at the step s 11 ), the present flow is ended . when a call type is the call type b or the call type c ( yes at the step s 11 ), the voice characteristic analysis unit 420 transmits a “ warning ” to the related contact destination device 300 ( step s 12 ). examples of a method of transmitting the warning may include an email , a telephone call , push notification to an application in a smart phone , and the like . further , the warning may be simultaneously transmitted to all of the transmission destinations ( the family member of the call recipient , the service center operated by the business operator providing a telephone service , the police , and the like ), or may be transmitted only to one or more specified transmission destinations . for example , the warning can be first of all transmitted only to the service center . in this case , in accordance with necessity , the service center mutually makes contact with the call recipient , the family member of the call recipient , the police , and the like to take appropriate measures for preventing a fraud . in the above - described first exemplary embodiment , for a call that is classified into none of the close relative and the swindler , it is determined whether or not a plurality of pieces of voiceprint information exist ( i . e ., whether or not a plurality of persons appear ) to classify a call type in more detail . concretely , classification into four types of the above - described call types a to d is performed . in other words , compared with a simple alternative determination method of making comparison only with a black list or only with a white list , the case of the present exemplary embodiment makes it difficult to cause a problem that a call from a swindler supposed to be detected is overlooked , or a person who is not a swindler is determined as a swindler , briefly , according to the present exemplary embodiment , a call from a swindler and a call from a non - swindler can be sharply distinguished from each other with higher accuracy . in addition , when a call type is the call type b or the call type c , the voice characteristic analysis unit 420 may transmit , to the information terminal 220 , action to be taken ( such as asking advice from a family member , asking advice from a person other than a family member , asking advice from the police , making a report to a call center , or the like ). further , for asking advice from or making a report to each of the above - described contact parties , a mechanism of click - to - dial can be used so that a call for asking advice can be easily made from the information terminal 220 . furthermore , instead of click - to - dial , various methods such as email , push notification to an application in a smart phone , or making connection to a web server of the call center to ask advice can be adopted . additionally , click - to - dial is a service in which an icon or a link displayed in a web page or the like is clicked to automatically make a call to a party . fig4 is a block diagram illustrating a configuration example of a call system 500 according to a second exemplary embodiment of the present invention . the call system 500 differs from the call system 10 ( fig1 ) in that the telephone set 210 and the information terminal 220 are connected to each other . the telephone set 210 transmits voice data of a caller to the caller identification server 400 via the information terminal 220 . thereby , it becomes unnecessary to forward the voice data from the telephone network 20 to the caller identification server 400 . when setting of the telephone network 20 is changed , significantly troublesome work , such as a request of cooperation of a telecommunication carrier who provides a telephone service , is necessary . in contrast , making a configuration as in the present exemplary embodiment enables the call type identification service to be provided more simply and easily . additionally , without description , it is apparent that the second exemplary embodiment attains the same advantageous effects as those in the first exemplary embodiment . further , a program for implementing functions of all or a part of each of the above - described exemplary embodiments may be recorded in a computer - readable recording medium , and a computer system may read and execute the program recorded in this recording medium to thereby perform the processes of the respective units . examples of the computer system may include a central processing unit ( cpu ). the “ computer - readable recording medium ” is a non - transitory storage device , for example . examples of the non - transitory storage device may include a portable medium such as a magneto - optical disk , a read only memory ( rom ), or a nonvolatile semiconductor memory , and a hard disk incorporated in the computer system . the “ computer - readable recording medium ” may be also a transitory storage device . examples of the transitory storage device may include a communication line in the case of transmitting the program via a network such as the internet or via a communication circuit such as a telephone circuit , or a volatile memory inside the computer system . besides , the above - described program may be one for implementing a part of the above - described functions , or further , may be one that can implement the above - described functions in combination with a program already recorded in the computer system . while the invention has been particularly shown and described with reference to exemplary embodiments thereof , the invention is not limited to these embodiments . it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the claims . this application is based upon and claims the benefit of priority from japanese patent application no . 2014 - 124446 , filed on jun . 17 , 2014 , the disclosure of which is incorporated herein in its entirety by reference .	7
referring jointly to fig1 and 2 , there is shown a 5 . 25 &# 34 ; magnetic data disk 10 which comprises a circular disk of thin high polymer material on which a coating of magnetic recording material is formed on both surfaces to which a recording / reproducing magnetic head ( not shown ) is to be brought in close proximity for write / read of data recorded in the media on concentric tracks 11 . a circular aperture or hub 12 formed in the center of the disk is adapted for reception of the drive spindle ( not shown ) of a disk drive system . in a conventional disk of this type , a circular reinforcing ring 13 is conventionally secured to the central hub 12 of disk 10 by suitable adhesive means to lengthen the reusable life of the disk by protecting the hub from prematurely wearing out in normal use . in accordance with a feature of the invention , hub ring 13 comprises the magnetic marker for surveillance control and for this purpose is preferably formed of an amorphous ferromagnetic material having a relatively low coercivity and a high magnetic permeability . in a preferred form of the invention , the coercivity , as measured in an external magnetic field changing its field strength and direction periodically with a frequency of 60 hz , should not exceed about 5 oersteds and most preferably should be less than 0 . 5 oersteds . correspondingly , the material should have relatively high magnetic permeability with a value preferably not lower than 20 , 000 and , most preferably , greater than 100 , 000 . suitable material for use as the hub ring marker 13 would be an amorphous ferromagnetic material such as is described in u . s . pat . no . 4 , 553 , 136 . a material of this type is sold under trademark &# 34 ; metglas &# 34 ; by allied corporation of morristown , n . j .. alternatively , a ferromagnetic material having a high barkhausen effect , such as described in u . s . pat . no . 4 , 660 , 025 , may also be used . hub ring marker 13 as shown in fig1 is an unbroken ring extending continuously about the aperture 12 of disk 10 . in order to enhance the field modifying effect of the ring , it may be desirable to provide one or more radially extending gaps in ring 13 such that ring 13 extends discontinuously about central aperture 12 . additionally , there is normally a significant band of unrecorded surface area on disk 10 extending radially outward from aperture 12 . this allows a degree of latitude in determining the radial dimension of hub ring marker 13 for a desired field modifying effect within the overall dimensional constraints of the disk format . further in accordance with an important aspect of the invention , hub ring marker 13 is formed integrally onto the polymer material of the disk by means of suitable adhesive material , preferably a high strength pressure sensitive adhesive , or by means of an ultrasonic bonding process , such that any attempt to remove the hub ring marker 13 would physically damage the disk by removing the means by which concentricity of the disk is determined thus making it virtually impossible to read the data on the disk in a disk drive . as a consequence , an attempt to remove the hub ring marker 13 to enable surreptitious removal of the disk from a secure area would result in protection of the data on the disk by making it no longer accessible even though the physical article itself , namely the disk , would be destroyed for all practical purposes . to enhance the concentricity determining aspect of the hub ring marker 13 , aperture 12 can be made slightly larger in diameter than the drive spindle of the disk drive and ring 13 made the correct diameter , as shown in fig2 . additionally , the centers of aperture 12 and ring 13 can be slightly offset so that even extremely careful removal of ring 13 would still eliminate the concentricity of the disk 10 vis - a - vis recorded tracks 11 . referring to fig3 and 4 , there is shown a standard 3 . 5 &# 34 ; format microfloppy disk 20 having a central drive hub 21 secured in conventional manner by an adhesive ring 22 to the center aperture 23 of the disk 20 . in accordance with the invention , adhesive ring 22 comprises the marker for disk 20 and , to this end , is formed of the amorphous ferromagnetic material described above in connection with fig1 and 2 . in a conventional 3 . 5 &# 34 ; microfloppy disk , central drive hub 21 is typically made from a ferromagnetic material , such as iron , to cooperate with a magnetic clamping arrangement on the drive spindle of the disk drive system . in order that the hub ring marker 22 of disk 20 be fully effective to modify the field pattern of an interrogation zone as described above or to insure that the field modifying effect of ring marker 22 is not easily overridden by magnetizing central drive hub 21 , it may be preferable that central drive hub 21 be formed of a non - ferromagnetic material , such as plastic . in this event , a modified form of disk drive apparatus may be required to maintain the disk on the drive spindle , for example by employing a compression spring clamping arrangement of suitable design . referring now to fig5 there is shown an article surveillance control system according to the invention which comprises a disk drive and write control means effective to ensure that sensitive data is written only onto protected disks of the type described in connection with fig1 - 4 . to this end , the system of fig5 includes a disk drive 30 adapted to receive and rotationally drive a 5 . 25 &# 34 ; or 3 . 5 &# 34 ; disk 31 while data is written onto or read from disk 31 by means of magnetic heads 32 in conventional manner . in all respects , the rotating drive mechanism of disk drive 30 , including drive motor 35 , drive spindle 33 and disk clamp 34 is of conventional construction except that drive spindle 33 and hub clamp 34 are preferably comprised of a non - ferromagnetic material , such as a suitable plastic . magnetic write / read heads 32 are coupled through a write control circuit 36 to a host computer 37 . write control circuit 36 comprises a gating circuit operative in response to a signal level on input line 38 to enable or inhibit the passage of data signals on line 39 from computer 37 through to output line 40 for application to write / read heads 32 . a magnetic field generating circuit 44 is included in the disk drive system of the invention to generate a low level periodically changing magnetic field via radiating antenna 43 positioned adjacent the spindle drive 33 and disk clamp 34 . an antenna 42 , similarly mounted adjacent the drive components 33 , 34 , is coupled to harmonic field detecting receiver circuit 41 to sense the presence of field patterns occurring at harmonics of the magnetic field applied by generating circuit 44 via radiating antenna 43 . the output of receiver circuit 41 is coupled by line 38 to write control circuit 36 to serve as the control signal which causes control circuit 36 to inhibit or enable the writing of data onto a disk inserted in the drive . in operation , with the computer in the &# 34 ; on &# 34 ; condition , a low level periodically changing magnetic field is generated by circuit 44 and radiating antenna 43 in the vicinity of the drive spindle of the disk drive system 30 . if a protected disk 31 of the type described above in relation to fig1 - 4 having a desired ferromagnetic marker 45 integrally formed about the hub of the disk 31 is in place in the drive , the applied magnetic field is disturbed by the marker and harmonic fields are generated . these harmonic fields are picked up by sensor antenna 42 and detected in receiver circuit 41 wherein an appropriate &# 34 ; enable &# 34 ; control signal level is produced and applied via line 38 to control circuit 36 to enable the writing of data onto disk 31 . if an unprotected disk is placed in the drive , the absence of a marker 45 results in no harmonic fields being generated . this , in turn , causes receiver circuit 41 to send an &# 34 ; inhibit &# 34 ; control signal level to control circuit 36 to inhibit the writing of data onto the unprotected disk . in this way , sensitive data created on the computer is assured of being &# 34 ; saved &# 34 ; or recorded only onto protected disks , the unauthorized removal of which from the secure area can be detected by conventional interrogation zone systems . moreover , data on a protected disk is prevented from being copied onto an unprotected disk by this system , since all such data must be enabled through the write control circuit 36 in order to be recorded on a disk . since all components of this surveillance control system are incorporated in the disk drive housing , conventional computers can be easily retrofitted to include this data protection capability thus avoiding the need to replace or retrofit entire computer systems . while the invention has been described in connection with use on recording disks in which write / read of data is performed entirely by magnetic means , it will be appreciated that a marker of the type described can also be integrally formed onto optical and thermo - magneto - optical disks in which an optical beam is employed in the write / read process . additionally , the effect of the marker on generating harmonic magnetic fields in the sensing zone can be enhanced by using an adhesive in which amorphous ferromagnetic powders have been dispersed during the formulation thereof . moreover , an adhesive formulated in this manner makes it possible to employ printing techniques to form the marker on the data disks , either in conjunction with use of the amorphous ferromagnetic ring or when used alone as a marker surface on the face of the disk . the invention has been described in detail with particular reference to a presently preferred embodiment , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention .	6
fig1 a illustrates a signal generator 100 with pre - corrected digital inputs 181 and 183 according to an embodiment of the present invention . in a quadrature modulation block 101 , digital - to - analog converters ( dac ) 103 and 107 , respectively , receive digital inputs 181 and 183 and send analog signals corresponding thereto to anti - aliasing low - pass filters ( lpf ) 105 and 109 , respectively . digital input 181 is a pre - corrected in - phase input i c , whereas digital input 183 is a pre - corrected quadrature input q c . anti - aliasing low - pass filters 105 and 109 in turn output signals to multiplicative mixers (“ mixers ”) 111 and 113 , respectively . a 90 ° splitter 115 receives a synthesized frequency from a synthesizer 121 and outputs two signals which are 90 ° out of phase , with the signal to mixer 113 lagging 90 ° behind the signal to mixer 111 . the mixed outputs from mixer 111 and mixer 113 are input to a summing unit 117 . the output from quadrature modulation block 101 is input to a switch 133 a , which can be selectably switched to pass the direct output of quadrature modulation block 101 or the output of quadrature modulation block 101 mixed by a mixer 131 with a synthesized frequency from a synthesizer 123 . various embodiments of the invention feature switches configured in a manner similar to that of switch 133 a . certain embodiments of the invention provide that these switches be independently selectably switchable . independent switchability according to these embodiments of the invention not only provides versatility in configuring apparatus , but also provides benefits in calibration of the apparatus , as detailed below . quadrature modulation typically suffers from spurious image - frequency signal and from local oscillator feed - through . these imperfections can be significantly reduced by signal pre - compensation in the digital domain . the setting of the pre - compensation or pre - correction coefficients requires a feedback mechanism allowing the measurement of the above spurious signals . therefore , an embodiment of the present invention provides for pre - correction as follows . a numerically - controlled oscillator ( nco ) 141 receives a frequency signal 143 to set the frequency f of the oscillator , and an initial phase signal 143 to set the initial phase φ 0 . numerically - controlled oscillator 141 outputs two signals , a sine wave 147 sin ( f , φ 0 ) and a cosine wave 149 cos ( f , φ 0 ), which are input to a complex multiplier 151 , whose other inputs are an in - phase data stream 153 i data ( k ) and a quadrature data stream 155 q data ( k ). the complex product outputs of complex multiplier 151 are a desired in - phase data wave 157 i and a desired quadrature data wave 159 q . however , in order to compensate for effects such as amplitude imbalance of quadrature modulation to be performed by quadrature modulation block 101 , a pre - correction is needed , which is furnished by a matrix multiplier 161 , containing filters 163 , 165 , 167 and 169 for single sideband ( ssb ) rejection . in addition , matrix multiplier 161 also corrects for local oscillator leakage with direct current offsets i dc and q dc into summing mixers 177 and 175 , respectively . furthermore , in accordance with an embodiment of the present invention , digital filters 163 , 165 , 167 , and 169 feeding into summing mixers 171 and 173 , respectively , are incorporated into matrix multiplier 161 to compensate for the frequency - dependencies of anti - aliasing low pass filters 105 and 109 . the result , as previously noted , are pre - corrected in - phase input 181 i c and pre - corrected quadrature input 183 q c . fig1 b illustrates a sideband selector configuration switch 133 b according to a related embodiment of the present invention . sideband selector configuration switch 133 b selectively switches between the direct output of quadrature modulation block 101 and either the upper sideband of the output of quadrature modulation block 101 mixed via mixer 131 with the output of synthesizer 123 , or the lower sideband thereof , as passed by an upper sideband filter 135 or a lower sideband filter 137 , respectively . in the above descriptions , transmission signal generation is a hybrid configurable one / two conversion process as illustrated in fig1 a . the different states reached under the topology depend on the setting of switch 133 a and are as follows : direct conversion based on a frequency synthesizer 121 , which is directly modulated by wide - band quadrature modulator block 101 ; double conversion operation based on mixing between the output of quadrature modulator block 101 with synthesizer 123 . this architecture inherently features an extremely wide frequency coverage ( dc to 10s ghz ) while maintaining low spurious signal content . in certain cases the synthesizer frequency range is increased by digital dividers . in these cases , for noise minimization and stability , it may be of interest to have the synthesizers operate at different frequencies . digitally divided signals , however , typically have high spurious harmonic content . operation over a multi - octave frequency range normally requires complicated re - configurable filters and filter banks to suppress these spurious signals . by heterodyne down - conversion of the direct modulated signal , wide frequency coverage can be achieved with the spurious signals lying out - of - band . as the frequency coverage requirement widens , so does the coverage requirement from the synthesizers and direct modulators . employing both direct and double conversions may relax the above requirement . for example , a quadrature modulator covering the range 4 - 8 ghz may be mixed with an additional 8 - 12 ghz synthesizer in order to cover the dc - 4 ghz range , and with a 12 - 16 ghz synthesizer in order to cover the 8 - 12 ghz frequency range . higher frequencies may be covered by using up - conversion rather than down - conversion . another benefit provided by embodiments of the present invention is the capability of arbitrarily modulating a wide - band waveform ( as wide as the baseband ) at any frequency within the frequency coverage . this permits the use of modulation schemes such as chirp / pseudo - random bit sequence ( prbs ) for pulse compression in radar applications , communication constellations , and so forth . further use of the arbitrary digital modulation provided by embodiments of the present invention allows a fine - frequency offset in the digital domain . this permits coarser frequency steps in the synthesizers , improving their phase noise performance for the same frequency resolution requirement . another benefit provided by embodiments of the present invention is the ability to reach a certain output frequency via several different configurations . in a non - limiting example , by stepping the synthesizer to a higher frequency and correspondingly stepping the baseband frequency to a lower frequency the output frequency is unchanged . this is instrumental in producing a coherent frequency coverage across all synthesizer frequencies , even though it does not retain a specific phase over frequency change . fig2 illustrates a signal generator according to another embodiment of the present invention , where a second quadrature modulation block 203 is utilized to directly modulate synthesizer 123 to create the local oscillator for the second conversion . this enables a tradeoff of quadrature modulation imbalance versus phase noise to attain arbitrary frequency in generating the local oscillator for the conversion node . fig3 illustrates a multiple signal generator according to an embodiment of the present invention . frequency synthesizer 301 feeds quadrature modulation blocks 303 and 305 , and frequency synthesizer 351 feeds quadrature modulation blocks 353 and 355 . selector switches 311 , 331 , 361 , and 381 operate as previously described for selector switch 133 a ( fig1 a ), and selectably switch between the direct output of quadrature modulation blocks 303 , 305 , 353 , and 355 respectively , and outputs of mixers 313 , 333 , 363 , and 383 , respectively , all of which receive input from frequency synthesizer 391 . as previously noted , various embodiments of the present invention provide selector switches 311 , 331 , 361 , and 381 to be independently switchable . the arrangement illustrated in fig3 is useful in radar communication systems where there is a need for multiple microwave signals in parallel . non - limiting examples of such needs include : simultaneous generation of transmit signal and of a receive local oscillator signal ; generation of multiple transmit signals in multiple input - multiple output ( mimo ) and phased / true delay array systems ; and generation of sine and cosine local oscillator signals of quadrature down conversion . for example , by digitally modulating the transmit signal and the receive local oscillator signal in a short range frequency - modulated continuous wave ( fm - cw ) radar system one can introduce an intentional frequency offset so as to avoid handling near - dc signals ( see fig4 ). an inherent trait of this architecture is that several direct conversion blocks and heterodyne converters may be fed from the same synthesizers , thereby naturally meeting the aforementioned need . this allows phase tracking between different microwave signals , as well as tracking of the phase noise . another advantage of this architecture is the distribution of a generated signal among many nodes , such as transmission antennas / receivers etc . this enables applications such as “ multistatic radar ” ( see below ). further embodiments of the present invention provide multiple synthesizers ( as in fig3 ), some of which are modulated and some are not , so as to simultaneously generate multiple signals at arbitrarily spaced frequencies . fig4 illustrates a transceiver according to an embodiment of the present invention . a frequency synthesizer 401 feeds quadrature modulator blocks 403 and 405 having selector switches 411 and 431 respectively , which select between direct output from the quadrature modulator blocks and the outputs of mixers 413 and 433 , respectively , both of which receive input from a frequency synthesizer 407 . the output of selector switch 411 feeds into an amplifier 451 , which in turn feeds an antenna switch / circulator 453 to an antenna 455 for transmission . signals received from antenna 455 ( such as by reflections of the transmitted signal ) are fed to a mixer 457 , which receives input from switch 431 . output of mixer 457 feeds to an anti - aliasing low - pass filter 459 and thence to an analog - to - digital converter 461 ( adc ). by modulating quadrature modulation blocks 403 and 405 , fed by the same synthesizer 407 with a frequency shift , both the transmit signal and local oscillator drive for an arbitrary intermediate frequency ( if ) receiver are produced . the received signal is down - converted to an intermediate frequency corresponding to the offset of the modulation frequency between quadrature modulation blocks 403 and 405 . another example of arbitrary waveform modulation - based receiver local oscillator generation is a modulation with a pseudo - random binary sequence ( prbs ) modulation , for a spread - spectrum radar . a further example of an arbitrarily - configurable demodulation is multi - tone demodulating . such a configuration is useful in the simultaneous measurement of several spectral components , e . g . by down - converting them to distinct intermediate frequencies . both the amplitudes and phases of the spectral components may be measured . the above capability of the signal generator for attaining an output frequency in several configurations , enables relating measurements across the entire frequency range , i . e . including local oscillator and measured path phase . according to a related embodiment , this is achieved by overlapping measurements between different local oscillator frequencies , where the baseband frequencies are adjusted to account for the local oscillator frequency offset between the measurements . this phase - related measurement differs from the common practice in the art , where , as the local oscillator is tuned over the coverage range , unaccounted - for phase changes occur . retaining the relative phase according to this embodiment is instrumental in characterizing non - linear parameters in a vector network analyzer ( vna ) embodiment of the present invention . fig5 illustrates a quadrature receiver according to an embodiment of the present invention . a switch 511 and a switch 531 are ganged together by a common selector 533 , to generate a 0 ° local oscillator 541 and a 90 ° local oscillator 543 , which feed mixers 561 and 563 , respectively , to convert a signal received by an antenna 555 , which is amplified by an amplifier 551 . the two intermediate frequency signals are fed into anti - aliasing low - pass filters 571 and 575 , respectively , to be demodulated by analog - to - digital converters 573 and 577 , respectively . the configuration illustrated in fig5 allows the generation of a 90 ° split over a wide frequency range , as opposed to conventional analog techniques , and without introducing substantial spurious harmonic content , which occurs when using digital dividers . according to related embodiments of the invention , calibration techniques can be used to adjust the relative phase and amplitude between the quadrature channels . in non - limiting examples : measuring the phase and amplitude between the in - phase ( i ) and quadrature ( q ) components of the down - converted continuous wave signal ; simultaneously measuring the phase and amplitude on several signals ; and cross - correlation measurements between the i and q arms . fig6 illustrates a multistatic radar apparatus according to an embodiment of the present invention . in many cases it is desirable for a generated signal to be distributed among many nodes , such as transmission antennas / receivers , and so forth . fig7 illustrates a 3 - channel multiple input - multiple output ( mimo ) transceiver according to an embodiment of the present invention . in this embodiment , the above - described coherent arbitrary modulation topology is used in conjunction with parallelism ( i . e . all quadrature modulation blocks are fed by the same synthesizer and are coherent to each other ). this configuration enables active beamforming such as in the context of phased - array antennas . current implementations are usable principally in narrow - band arrays , where carrier frequencies reach the microwave regime and analog delay - induced phase shifts are used . this embodiment of the present invention provides true beam - forming by digital relative delay means . beam - forming is achieved by baseband modulation of coherent channels relative to each other , and does not hinder the broad band nature of the transceiver array . in addition , this embodiment provides ease of implementation with digital accuracy . steering resolution and phase coherence are very precise since the relative phase attainable at any baseband frequency is practically arbitrary , as it is limited principally by digital - to - analog converter resolution . calibration plays a significant role , where quadrature modulation imbalance , local oscillator leakage and the response of the receiver and transmitter paths comprise fundamental factors in attaining the required performance of a transceiver . quadrature modulation imbalance and local oscillator leakage calibrations are typically performed by a minimization of mixing products after passage through a broadband envelope detector . the quadrature modulator is subjected to modulation by complex sine wave at frequency f bb . at the output of the envelope detector , the detected power fluctuates at frequencies associated with the frequency offset between the desired signal and the spurious signals ( either 2 f bb for the quadrature modulation image or f bb for the local oscillator leakage ). the power fluctuations are typically measured by an analog - to - digital converter ( adc ). it is important to note that if a high f bb is used then a high speed adc is needed in order to capture and quantify the power fluctuations ( the adc bandwidth needs to be at least twice the baseband bandwidth in order to capture both spectral components ). current techniques suffer from inherent difficulties associated with spurious signals and mixing products which fall on the to - be - measured quantities . as an example , mixing products from 2f signal − 2f lo fall on the to - be - measured frequency associated with the quadrature - modulated image : f signal − f image . thus , the measurements are not independent . embodiments of the invention facilitate the calibration for quadrature modulation imbalance and local oscillator leakage , without increase in architectural complexity . the corrective action for compensation of quadrature modulation imbalance and local oscillator leakage are well known in the art . the quadrature modulation imbalance compensation involves pre - multiplying the i and q components by a matrix of correction coefficients . the compensation of local oscillator leakage typically involves adding dc coefficients to the i and q components . the difficult part of this procedure is determining which coefficients &# 39 ; values to use . this involves a feedback measurement of the strength of the image and spectral components of the local oscillator leakage . fig8 illustrates a spectral component measurement arrangement at the output of the signal generation block according to an embodiment of the present invention . here , two quadrature modulation blocks are fed by a single , common , synthesizer . a method of measuring the image or local oscillator leakage is by placing the second synthesizer — used to convert the signal to the baseband — at a frequency offset relative to the spectral component of interest . to measure the image , situated at f image = f sa − f iqa1 , placing the second synthesizer at f sb = f image − f if which will be , after f if conversion , linear in the original image magnitude . in order to reach the desired frequency at the output of the second synthesizer — driving the conversion of the output of the quadrature modulation block — fine frequency selection may be facilitated by either / or both the utilization of a fractional n synthesizer and an quadrature modulation of the synthesizer output . only a single channel ( one quadrature modulator , two synthesizers ) is needed for the above scheme . fig9 illustrates a receiver - assisted spectral component measurement arrangement according to an embodiment of the present invention . fig1 a illustrates a symmetrized receiver - assisted spectral component measurement arrangement for characterization of a first quadrature modulation block according to the present invention . fig1 b illustrates a symmetrized receiver - assisted spectral component measurement arrangement for characterization of a second quadrature modulation block according to the present invention . baseband filter characteristics may vary at production . in the case of integrated circuit implementation , the filter bandwidth and shape may depend on process , temperature and voltage . the characteristics of baseband filters in the transmit and receive chains may affect system performance regarding signal - to - noise ratio , inter - symbol interference , power flatness , mask conformity , and so forth . it is thus desirable to characterize the filters and compensate for their deviation from desired characteristics . examples of compensation include directly adjusting the filter and performing digital compensation . the hardware architecture of embodiments of the present invention facilitates measurement of filter characteristics without further increasing complexity . to characterize the transmit filter , the f bb is scanned throughout the range of interest . for each f bb the synthesizer &# 39 ; s frequencies ( f sa , f sb ) are adjusted such that the resulting intermediate frequency is constant ; thus avoiding the receive filter response variation ( when measuring at different intermediate frequencies per f bb ). the receiver can be tuned to a frequency corresponding to an aliased frequency ± f bb + n · f sample ( where f sample is the digital - to - analog converter sampling frequency ). by doing so , the low pass filter in the transmit path can be characterized beyond the nyquist frequency of the digital - to - analog converter . embodiments of the invention as described above and depicted in fig8 and fig1 a and 10b illustrate two similar schemes for scanning the baseband frequency as described above , by digitizing the output of the signal generation block . measuring the receiver filter is conceptually similar to the above schemes , but benefits from prior knowledge of the transmitter filter response : by knowing the response of the transmission filter , the quadrature modulation frequency can be tuned to scan the frequencies of the receiver filter . alternatively , it is possible to measure the receiver filter separately without first characterizing the transmission filter . to do so , the quadrature modulation is held at a constant frequency ( so as to not incur response variation ) and the receiver frequencies are scanned by tuning the synthesizer &# 39 ; s frequencies . the intermediate frequency can be tuned beyond the nyquist frequency of the analog - to - digital converter so that the receive anti - alias low - pass filter reacts to the input intermediate frequency , while the digitized output is at an aliased frequency ± f bb + n · f sample ( where f sample is the analog - to - digital converter sampling frequency . by doing so , the low pass filter in the receive path can be characterized beyond the nyquist frequency of the analog - to - digital converter . digitization of the first synthesizer , down converted by the second synthesizer , allows characterizing the relative phase noise between the two synthesizers . this measurement can be used for either self - test purposes or for performance optimizations , such as setting the phase - locked loop parameters so as to optimize the phase noise . an example of such parameter is the setting of the charge pump current in the phase detector . fig1 illustrates a multi - module referenced based scaling arrangement according to an embodiment of the present invention . fig1 is a flowchart 1200 of a method of calibrating a two - synthesizer signal generator according to an embodiment of the present invention . in a step 1201 the first frequency synthesizer is set to the desired test frequency . in a step 1203 an outer loop begins , in which the first numerically - controlled oscillator is set to the desired test frequency offset . in a step 1205 , the second frequency synthesizer and the second numerically - controlled oscillator are set to obtain the desired receiving intermediate frequency . in a step 1207 an inner loop begins for configuring a set of quadrature modulation imbalance correction coefficient values , and in a step 1209 an imbalance - related magnitude is measured . at a decision point 1211 , if the coefficient set is not exhausted , the method returns to step 1207 . otherwise , if the set is exhausted , the loop beginning in step 1207 exits and the method proceeds to a step 1213 , in which optimal correction coefficients are calculated . at a decision point 1215 , if the first numerically controlled oscillator frequencies are not exhausted , the method returns to step 1203 . otherwise , if the frequencies are exhausted , the loop beginning in step 1203 exits , and the method concludes with a step 1217 , in which the optimal frequency - dependent correction coefficients are calculated .	7
fig1 illustrates an airbag cover 1 , which , in this drawing , is opened and connected by a hinge 2 to a surrounding area 3 of the airbag cover . the surrounding area 3 is part of , for example , a dashboard , a headrest , an armrest of a motor vehicle seat , a column , vehicle interior trim paneling , etc . an undeployed airbag is stored behind the airbag cover 1 . the airbag itself is not shown in the drawings . when the airbag cover 1 opens , it swings about the hinge 2 into the interior space of the vehicle and opens up a path that allows the inflating airbag to expand into the interior of the vehicle . the hinge 2 absorbs a portion of the forces exerted on the airbag cover 1 , which prevents the cover from opening in an uncontrolled manner . this minimizes the risk that the airbag cover 1 will detach from the surrounding area 3 and put persons sitting in the vehicle at risk of injury from the cover 1 . fig2 is a cross - sectional view of the hinge portion of the airbag cover 1 . the airbag cover 1 in the area of the hinge 2 is constructed from a carrier 4 that may be made of a plastic material , particularly a thermoplastic material such as polypropylene . a coating of foam 5 is applied to the carrier 4 on the side facing the interior of the vehicle and a decorative covering 6 then applied to the surface of the foam , so as to fashion a visually attractive interior of the vehicle . in this embodiment , the illustration of the carrier 4 is interrupted , because the depth or thickness of the carrier 4 , preferably 2 - 3 mm , depends upon the respective size of the airbag cover 1 . in this embodiment , a layer 7 is provided on the side of the carrier 4 facing away from the decorative covering 6 . the layer can be constructed , for example , as a coating side . a two - dimensional textile element 8 is arranged on the side of the layer 7 facing away from the carrier 4 . in this embodiment , the two - dimensional textile element 8 is constructed as a knitted fabric . the layer 7 is provided as a flow - or penetration - inhibiting layer that limits the flow or penetration into the layer 7 of the molten thermoplastic material that forms the carrier 4 , i . e ., the layer 7 has a higher level of flow resistance than the two - dimensional textile element 8 , so that the penetration depth “ a ” of the two - dimensional textile element 8 to the thermoplastic material forming the carrier 4 can be precisely adjusted . in this embodiment , layer 7 is made of a fleece . after the thermoplastic material used in this embodiment is hardened , the two - dimensional textile element 8 is thus embedded across the area of the penetration depth a , that is , the penetration depth a characterizes the matrix 9 in which the two - dimensional textile element 8 is embedded . on the side of the matrix 9 facing away from the carrier 4 , there is a “ free area ” 10 of the two - dimensional textile element 8 . this free area 10 is not part of the embedded two - dimensional textile element 8 . instead of the fleece used in the embodiment according to fig2 ( which , for example , can be polyester ), a perforated film or other similar flow - resistant materials can be used as the coating materials , which achieve a uniform penetration depth when a curable mass penetrates the two - dimensional textile element . fig3 illustrates a carrier 4 , which is , on the other hand , covered with foam 5 , as well as a finishing decorative skin 6 , on the side facing the interior of a motor vehicle . in this embodiment , an additional layer 7 or coating side is not used . instead , the two - dimensional textile element 8 has an area 11 facing the carrier 4 that creates a higher flow resistance than a “ looser ” area 12 facing away from the carrier 4 , which has a lower flow resistance than area 11 . as shown in the embodiment according to fig2 , a non - embedded , free area 10 of the two - dimensional textile element 8 is also provided here . the area of the coated two - dimensional textile element 8 that is embedded into the matrix of the carrier 4 is designated by 9 . in an advantageous embodiment , due to the barrier effect of the coated two - dimensional textile element , for example , more than 50 % ( as shown in the vertical direction in the illustration ) of the thickness of the two - dimensional textile element 8 is included in the embedded area , and less than 50 % of the two - dimensional textile element 8 belongs to the “ free ”, non - embedded area 10 of the same . in an advantageous embodiment , approximately 70 to 80 % of the two - dimensional textile element is embedded . naturally , a corresponding variation of the ratio of embedded area to free area can be provided , depending upon the application , that is , upon the force that an expanding airbag exerts on the airbag cover , and , depending upon the weight and size of the airbag cover , as well as upon the length of the outward swing of the airbag cover . if a large portion of the two - dimensional textile element is embedded in the matrix of the carrier 4 , then a greater portion of the occurring forces can be absorbed by this hinge . in addition to the illustrated knitted fabrics , the two - dimensional textile element can also be constructed as woven fabric , whereby an advantageous adjustment of the free area that is not embedded can then be achieved , if the woven fabric has sufficient thickness , such as is customary , for example , for knitted fabrics . naturally , as described above , the woven fabric can also be coated . likewise , a two - dimensional textile element , such as , for example , a woven fabric that has a pleated construction can be used , so that , for example , the pleat areas adjacent the carrier 4 are embedded and the “ pleat crests ” facing away from the carrier are exposed , i . e ., not embedded . with reference to fig4 , the hinge area of an airbag cover is illustrated in an oversize illustration , that is , the airbag cover is swung in the direction of the arrow toward the motor vehicle interior . the number 14 designates a predetermined breaking point that represents a weakening and which is used to define the site of the swinging motion of the airbag cover 1 . the swinging open of the airbag cover 1 causes the carrier material 4 to break . the cover 1 swinging open even farther causes the two - dimensional textile element to detach , loosen , or stretch in a pre - defined manner , up into the inside of the carrier matrix 4 . a great portion of the occurring forces is thereby absorbed over the entire surface by the structural expansion and by the component strength of the carrier matrix . the area of the two - dimensional textile element in which the material for the carrier does not flow delaminates up into the inside of the adjacent carrier matrix . thus , the structural expansion over the entire surface of the two - dimensional textile element and its embedding into the carrier serve to absorb the occurring forces into the carrier matrix , and this results in an outward swinging motion of the airbag cover 1 . residual forces cause an additional swinging open of the airbag cover 1 , and these residual forces are initially received and absorbed over the entire surface by the textile expandability of the two - dimensional textile element , i . e ., particularly of a knitted fabric , so that , for one , the airbag cover opens in a controlled manner and is in no danger of being torn from its surrounding environment . one advantage of the proposed hinge is that a particularly lightweight two - dimensional textile element 8 can be used , so that the weight of the hinge 2 can be kept very low . because of this , it is not necessary that the hinge be a heavy metal hinge , for example , which is cost - intensive to produce . because the weight of the hinge 2 can be kept low , the forces that occur are also lower than would be the case with a heavier cover for the airbag . furthermore , the proposed hinge 2 for the airbag cover also enables a cost - effective manufacturing process , because the hinge 2 can be manufactured together with the airbag cover 1 . in other words , the two - dimensional textile element 8 of the hinge 2 can be embedded into the carrier matrix ( partially ), at the time the carrier is manufactured .	1
referring to fig3 a four - way reversing valve according to the present invention includes a cylindrical valve casing 30 . the valve casing 30 has a supply port p formed at one side of the upper surface thereof , two load ports a and b formed with a slight gap between them and placed at the same height on the outer circumferential surface thereof , and a drain port r formed at the center of the lower surface thereof . coolant connection pipes 31 , 32 , 33 , and 34 , connected to the respective portions of an air conditioning system , for example , the outlet and inlet of the compressor and respective coolant pipes of the heat exchangers , are welded at the respective ports and bent properly . reference numeral 70 denotes a solenoid installed at the upper surface of the valve casing 30 . the solenoid is operated to convert the valve by being excited by an electric signal . the electric signal is applied only when the heating operation of an air conditioning system is selected , but not applied when cooling operation is selected . referring to fig4 the valve casing 30 is formed into a cup shape by processing metal such as brass . a cap 36 having a disc shape is capped on a hooking step 35 formed at the upper portion of the valve casing 30 and the edge of the cap 36 is welded to seal the cap 36 . it is possible to screw together the valve casing 30 and the cap 36 with a separate sealing member so that they can be easily assembled and disassembled . a valve main body 40 fixedly installed in the valve casing 30 is a mold formed by injecting resin , for example . the valve main body 40 includes a cylindrical body portion 41 , a flange portion 42 at the upper portion of the body portion 41 , and a block support portion 43 at the upper portion of the flange portion 42 . the body portion 41 has a diameter slightly less than the inner circumferential surface of the valve casing 30 , so that it can be easily inserted during assembly . the flange portion 42 has such a diameter as to tightly fit to the inner circumferential surface of the valve casing 30 , so that it can be placed on a hooking step 37 formed on the inner circumferential surface of the valve casing 30 and fixed thereon . a cut - away portion 44 is formed at one side of the flange portion 42 and the block support portion 43 and accommodates an end portion 31 a of a coolant connection pipe 31 penetrating the supply port p formed at the cap 36 . the valve main body 40 has a valve chamber 50 a formed in the body portion 41 and a pilot hydraulic chamber 50 b formed by extending the side of the valve chamber 50 a . the valve chamber 50 a is connected to the coolant connection pipe 31 at the support port p through a main port connection hole 51 at the supply &# 39 ; s side penetrating the cut - away portion 44 of the flange portion 42 above the valve chamber 50 a . also , the valve chamber 50 a can be connected to each of the coolant connection pipes 32 and 33 at the side of load ports a and b through main port connection holes 52 and 53 at the load &# 39 ; s side penetrating a wall surface of the body portion 41 . the pilot hydraulic chamber 50 b is formed by cutting the wall surface and bottom surface of the body portion 41 to secure a sufficient space and thus encompassed by the wall surface and bottom surface of the inner circumference of the valve casing 30 exposed thereto and fixed vanes 57 and 58 at both ends of the cut portion . two pilot input ports 54 and 55 respectively formed along the wall surface at the side of the fixed vanes 57 and 58 and above the flange portion 42 penetrate the pilot hydraulic chamber 50 b . a pilot drain port 56 of the pilot hydraulic chamber 50 b penetrates the center of the flange portion 42 to be always connected to a second flow path of the main spool 60 which is described later . the body portion 41 of the valve main body 40 is cut in a diametric direction between the valve chamber 50 a and the pilot hydraulic chamber 50 b and seal blocks 45 and 46 are inserted in the cut portion . the seal blocks 45 and 46 maintain sealing with respect to a boss portion 61 of the main spool 60 which is described later by the inner end portions thereof and the inner circumferential surface of the valve casing 30 by the outer end portions thereof , so that the valve chamber 50 a and the pilot hydraulic chamber 50 b are separated into sealed spaces . seal rings 47 and 48 installed around the main port connection holes 52 and 53 at the load &# 39 ; s side on the outer circumferential surface of the body portion 41 in a half - embedded state closely contact the load ports a and b penetrating the inner circumferential surface of the valve casing 30 to maintain a sealing state . the seal blocks 45 and 46 and the seal rings 47 and 48 are formed of a material exhibiting a high mechanical and sealing feature , for example , teflon based resin . the main spool 60 is formed of a cylindrical boss portion 61 , a spool portion 62 extending from one side of the boss portion 61 and accommodated in the valve chamber 50 a , a vane portion 63 extending from the other side of the boss portion 61 and accommodated in the pilot hydraulic chamber 50 b , and a groove 64 formed from the end of the spool portion 62 to the lower end portion of the boss portion 61 . the groove 64 at the end of the spool portion 62 is connected to the load port a or b through one of the main port connection holes 52 and 53 at the load &# 39 ; s side of the valve main body 40 and always connected to the drain port r of the bottom of the valve casing 30 at the lower end portion of the boss portion 61 , thus forming the second main flow path . also , a drain connection hole 65 for connecting the pilot drain port 56 of the valve main body 40 to the groove 64 is formed by penetrating the upper end portion of the boss portion 61 of the main spool 60 . sealing rings 66 and 67 formed of teflon - based resin are coupled to the upper and lower end portions of the boss portion 61 of the main spool 60 to seal around the drain connection hole 65 penetrating the flange portion 42 of the valve main body 40 and around the drain portion r at the bottom of the valve casing 30 . seal members 68 and 69 formed of teflon - based resin are coupled to the end portion of the spool portion 62 to maintain sealing with the inner circumferential wall surface at the side of the valve chamber 50 a and to the edge of the vane portion 63 to maintain sealing with the ceiling of the pilot hydraulic chamber 50 b and the inner circumferential wall surface and the bottom surface of the valve casing 30 . next , the solenoid 70 , a stem 71 , a plunger 72 , a pilot spool 75 , and a spool seat block 80 are provided as a pilot hydraulic converting means . the solenoid 70 is inserted around the stem 71 and fixed by a screw 77 . an end portion of the stem 71 penetrates the cap 36 so that the stem 71 is fixedly welded on the cap 36 to erect thereon . the plunger 72 is inserted in the stem 71 together with a spring 74 and always protrudes toward a normal position ( refer to fig6 a ) in a spring offset manner . when the solenoid 70 is excited , the plunger 72 is pulled to a converting position ( refer to fig6 b ) by an electrical thrust . the pilot spool 75 has a concave cavity 76 and is inserted into a groove 73 formed in an end portion of the plunger 72 . the pilot spool 75 closely contacts a seat surface 81 of the spool seat block 80 and slides thereon and moves together with the plunger 72 . the spool seat block 80 accommodated on the block support portion 43 of the valve main body 40 is manufactured by processing metal such as brass and has three pilot port connection holes 82 , 83 , and 84 formed in the seat surface 81 which are open with an interval in a vertical direction , that is , in a direction in which the plunger 72 moves . the interval between two neighboring ones of the three pilot port connection holes 82 , 83 , and 84 is less than the diameter of the cavity 76 of the pilot spool 75 and the length between the uppermost pilot port connection hole 82 and the lowermost pilot port connection hole 83 is greater than the diameter of the cavity 76 . that is , when the pilot spool 75 is in a normal position , the lower two neighboring pilot port connection holes 83 and 84 are connected by the cavity 76 of the pilot spool 75 and the uppermost pilot port connection hole 82 is exposed outside the cavity 76 ( referring to fig6 a ). at the converting position , the upper two neighboring pilot port connection holes 82 and 84 are connected by the cavity 77 of the pilot spool 75 and the lowermost pilot port connection hole 83 is exposed . the two uppermost and lowermost pilot port connection holes 82 and 83 of the pilot port connection holes 82 , 83 , and 84 of the spool seat block 80 are connected to the two pilot input ports 54 and 55 formed in the valve main body 40 and the other pilot port connection hole 84 is connected to the pilot drain port 56 . in fig5 reference numerals 38 and 49 denote a concave groove and a protrusion correspondingly formed to guide an assembly position when the valve main body 40 is assembled to the valve casing 30 . in the operation of the four - way reversing valve according to the present invention , referring to fig5 most of fluid ( coolant ) supplied through the coolant connection pipe 31 at the side of supply port p flows into the valve chamber 50 a through the port connection hole 51 at the supply &# 39 ; s side . part of the fluid flows into a space at the upper side of the flange portion 42 of the valve main body 40 along a gap provided at the inner circumferential surface of the valve casing 30 and further enters in the one side of the pilot hydraulic chamber 50 b through one of the two pilot port connection holes 82 and 83 of the spool seat block 80 exposed to the space . when the solenoid 70 is not in an excited state , the plunger 72 protrudes downward by the spring 74 , that is , at the normal position on the seat surface 81 of the spool seat block 80 . when the pilot spool 75 is positioned at the normal position , as shown in fig6 a , the lower two pilot port connection holes 83 and 84 of the three pilot port connection holes 82 , 83 , and 84 formed in the spool seat block 80 are connected by the cavity 76 of the pilot spool 75 and the uppermost pilot port connection hole 82 is exposed . thus , part of the fluid supplied from the supply port p flows in the exposed uppermost pilot port connection hole 82 and moves toward the pilot hydraulic chamber 50 b through the pilot input port 54 at one side connected thereto . the fluid input to the pilot hydraulic chamber 50 b through the pilot input port 54 at one side applies pressure to the vane portion 63 of the main spool 60 from the fixed vane 57 at one side toward the fixed vane 58 at the other side , so that the entire main spool 60 rotates clockwise . when the main spool 60 is rotated clockwise , as shown fig7 a , the load port a at one side of the two load ports a and b is connected to the valve chamber 50 a , forming a first main flow path . also , the load port b at the other side is connected to the drain port r through the groove 64 of the main spool 60 , forming a second main flow path . thus , the air conditioning system is set to perform a cooling operation . in the meantime , during the clockwise rotation of the main spool 60 , the fluid remaining in the clockwise direction of the vane portion 63 in the pilot hydraulic chamber 50 b is exhausted through the pilot input port 55 at the other side formed in the main spool 60 . as shown in fig6 a , the remaining fluid proceeds via the pilot port connection hole 83 connected to the pilot input port 55 , the cavity 76 of the pilot spool 75 , and the pilot port connection hole 84 . then , as shown in fig5 the fluid sequentially passes the pilot drain port 56 of the valve main body 40 and the drain connection hole 65 of the main spool 60 , and is guided toward the groove 64 of the main spool 60 forming the second main flow path . the fluid joins the main stream of the fluid flowing along the second main flow path of the groove 64 and then is drained . next , when the solenoid 70 is excited , the plunger 72 is pulled upward by an electrical thrust according to the excitation of the solenoid 70 . here , as shown in fig6 b , the pilot spool 75 is located at the converting position on the seat surface 81 of the spool seat block 80 . when the pilot spool 75 is positioned at the converting position , the upper two pilot port connection holes 82 and 84 of the three pilot port connection holes 82 , 83 , and 84 formed in the spool seat block 80 are connected by the cavity 76 of the pilot spool 75 and the lowermost pilot port connection hole 83 is exposed . thus , part of the fluid supplied from the supply port p flows in the exposed lowermost pilot port connection hole 83 and moves toward the other side of the pilot hydraulic chamber 50 b through the pilot input port 55 connected thereto . the fluid input to the pilot hydraulic chamber 50 b through the pilot input port 55 at the other side applies pressure to the vane portion 63 of the main spool 60 from the fixed vane 57 at the other side toward the fixed vane 58 at one side , so that the entire main spool 60 rotates counterclockwise . when the main spool 60 is rotated counterclockwise , as shown fig7 b , the load port b at the other side of the two load ports a and b is connected to the valve chamber 50 a , forming a first main flow path . also , the load port a at one side is connected to the drain port r through the groove 64 of the main spool 60 , forming a second main flow path . thus , the air conditioning system is set to perform a heating operation . in the meantime , during the counterclockwise rotation of the main spool 60 , the fluid remaining in the counterclockwise direction of the vane portion 63 in the pilot hydraulic chamber 50 b is exhausted through the pilot input port 54 at one side formed therein . as shown in fig6 a , the remaining fluid proceeds via the pilot port connection hole 82 connected to the pilot input port 54 , the cavity 76 of the pilot spool 75 , and the pilot port connection hole 84 . then , as shown in fig5 the fluid sequentially passes the pilot drain port 56 of the valve main body 40 and the drain connection hole 65 of the main spool 60 , and is guided toward the groove 64 of the main spool 60 forming the second main flow path . the fluid joins the main stream of the fluid flowing along the second main flow path of the groove 64 and then is drained . as described above , the four - way reversing valve according to the present invention includes a vane type main spool as a solenoid - hydraulic - rotation operating type . since a solenoid operated type pilot valve of an inner pilot type to operate the vane type main spool is incorporated into the valve main body in a casing , only the connection pipes corresponding to the main port need to be welded at the valve casing . therefore , the number of welding points can be minimized and manufacturing thereof is made easy . further , during the manufacturing and use thereof , the rate of breakdown due to defective welding can be remarkably reduced . although the present invention is described as being used for a heat pump air conditioning system for a double use of cooling and heating in the above preferred description , it is not limited to the use thereof and the accompanying drawings . that is , the number of ports can be changed according to products to which the present invention is applied . also , the solenoid operated type pilot valve for the operation of the vane type main spool or the structure of the vane can be realized in various ways .	5
referring now to fig1 there is shown a plan view of a thermal ink jet printer 10 . the printer 10 is shown broken away , and in the interior thereof there may be seen a roll or platen 11 for carrying and indexing the print media , which may be paper , overhead transparency film , or the like . a carriage 12 is mounted for movement back and forth adjacent the print zone p of the platen 11 along a guide rail 13 . mounted within the carriage 12 are five disposable print cartrides or pens 14 , 15 , 16 , 17 and 18 . there is no fixed order for the pens 14 - 18 , but for purposes of description , it will be assumed that by way of example , pen 14 prints the color cyan , pen 15 magenta , pen 16 yellow , and pens 17 and 18 print black , although only one black pen 17 may be used , if desired . all five pens 14 - 18 are thermal ink jet pens employing heating of a thin - film resistor to fire a drop of ink . this technology works on the principle of drop on demand . each pen 14 - 18 has a plurality of nozzles 21 ( fig2 ), and each nozzle 21 can supply a drop of ink on demand as the pen carriage 12 scans across the print media carried by the platen 11 . fig2 shows an elevation view of adjacent orifice plates 20 , greatly magnified , which form a part of the pens 14 - 18 . the orifice plates 20 are shown with thirty nozzles 21 for convenience of description , although the actual number of nozzles 21 may be more or less than 30 , if desired . furthermore , the orifice plates 20 may have a different configuration than that shown , for example , long and narrow with the nozzles 21 in two rows instead of three . this multi - pen printer 10 of the present invention has the advantage of providing faster printing speeds and more pages between replacement of disposable print cartrides or pens 14 - 18 . the printer 10 of the present invention which employs a separate pen for each of the primary colors ( pens 14 , 15 , 16 ), plus separate black pens ( pens 17 and 18 ), has a print quality which is equal to or better than prior art printers which provide the three primary colors on a single pen . it has been found that there exists a strong correlation between the alignment of the primary color dots and the quality of the resulting image . in the multi - pen printer of the present invention , the ability to accurately overlay the primary color dots is dependent on manufacturing tolerances in both the pens and the printer . rather than reduce these tolerances by refining the manufacturing processes , the printer of the present invention is provided with the capability to measure tolerance - related dot placement errors . this capability allows application of a correction algorithm to the drop fire timing and image data such that the highest possible quality image is produced . to calibrate the pens 14 - 18 , there is provided a linear encoder 22 , shown in fig3 and 4 . the linear encoder 22 is a high resolution carriage position sensor with quadrature outputs , the resolution being increased by interpolating between quadrature states . the linear encoder 22 is integral to the pen carriage 12 and provides a constant output of position of the carriage 12 as the pens 14 - 18 are scanned back and forth along the guide rail 13 . referring to fig3 the linear encoder 22 which is integral to the carriage 12 employs as a reference a code strip 23 . the code strip 23 is a long strip of dupont brand mylar material , for example , provided with a marking of opaque lines , which may be photographically produced . typically , the code strip 23 may have on the order of 150 lines per inch . the linear encoder 22 may be a linear optical incremental encoder module , such as model heds - 9200 manufactured by the optoelectronics division of hewlett - packard company . a quadrature output of typically 600 to 800 counts per inch is used to operate the motion control system . the reference signal for positioning of ink drops on the print media is generated from a single channel of the encoder 22 . this eliminates any possible problem with phase errors in the encoder 22 . in prior art devices the position of the orifice plate is detected to determine distance between pens in the pen scan direction ( y ). in the present invention the position of a drop of ink in the nominal plane of the print media is detected . in fig4 there is shown a plan view of the arrangement for determining distance between pens in the pen scan direction ( y ). to one side of the print zone ( p ), a drop detector 24 is placed in the nominal plane of the print media . the drop detector 24 comprises a strip of piezoelectric film 25 which is freely suspended or mounted as a diaphragm to the base of the printer 10 . the film 25 is located to be coplanar with the print zone p . the piezoelectric film 25 may be film sold under the trade name kynar , or the like . the piezoelectric film 25 is provided with an opening 26 . behind the opening 26 there is disposed an absorbent ink collector 27 . an electrical connection 28 conducts any electric charge developed by the piezoelectric film 25 to an amplifier and microprocessor electronics ( not shown ). while the carriage 12 is moving at a constant velocity from righ to left , one of the pens 14 - 18 is fired continuously at the rate of 2000 or more drops per second . firing of ink drops begins at a position such that the drops initially pass through the opening 26 and are collected in the absorbent ink collector 27 . when the drop stream hits the edge 30 of the opening 26 , it impacts a portion of the piezoelectric film 25 , causing an electric charge to be developed . at the instant of first drop detect , the encoder 22 integral with the carriage 12 is read . similarly , a reading is obtained for each of the remaining pens 14 - 18 . since the carriage 12 travels at a constant velocity and the pens 14 - 18 are fired , in turn , at a constant frequency , the distance between the pens 14 - 18 in the pen scan direction ( y ) is easily determined . comparison of the carriage positions for all pens 14 - 18 provides the inter - pen spacings . the resolution of the linear encoder 22 is increased by interpolating between pulses . the measurement of the inter - pen distance or spacing ( s ) involves two problems . the carriage 12 is moved at a constant velocity controlled by a servo via the linear encoder 22 and the code strip 23 . the first problem in the measurement of inter - pen spacing ( s ) is that the very slow speed at which the drop detection must be performed ( typically on the order of 0 . 625 to 0 . 833 inches per second ) necessitates a special servo system configuration . the resolution of the linear encoder 22 is such that one encoder count will be traversed in two milliseconds . the high quality velocity feedback needed for stabilizing the servo loop can be obtained despite the quantization of the encoder feedback by timing between encoder counts . the second problem is that the resolution of the measurement that is needed is greater than the 0 . 00125 inch quantization level of the linear encoder 22 . this problem is solved by interpolating between encoder counts by means of time measurements . the time elapsed between encoder counts is available from the timing based servo previously described . an additional timer provides the time elapsed from the last encoder count until drop detection is indicated by the drop detector 24 . the ratio of these times can be used to interpolate the position of the carriage12 at the time of the drop detection . comparison of the positions of the carriage 12 for all pens 14 - 18 provides the inter - pen spacing ( s ). actual test results have shown that position measurements of 0 . 0004 inch or better are obtained . this measurement of the inter - pen spacings s is performed automatically to one side of the print zone p , and the result of the measurement is converted to a correction algorithm to electronically compensate the drop fire timing and image data . this enables the multi - pen thermal ink jet printer 10 of the present invention to accurately overlay the primary color dots , thus resulting in a high quality image being produced . as is well known , the cartridges or pens 14 - 18 are replaceable and are held in place by a latch mechanism and by mechanical registration surfaces . the repeatability of registration of the pens 14 - 18 to the carriage 12 directly affects the print quality . the body of the print cartridges or pens 14 - 18 has some uncertainty in dimension . discrepancies in alignment of the pens 14 - 18 may result in offsets ( o ) or displacements of nozzle arrays relative to each other in the print media index axis ( x ) as shown in fig5 . x - axis measurements are made by successively positioning each one of the pens 14 - 18 adjacent a special pattern 31 of openings provided in the piezoelectric film 25 and firing ink drops through the nozzle array to locate the nozzle pattern . multiple tests per pen may be taken in one carriage pass . this operation is repeated for each of the pens 14 - 18 in the carriage 12 . the special pattern 31 of punched openings is shown in fig6 where it may be seen that the openings are rectangular and of varying lengths and arranged side - by - side in a stair - step pattern . some of the drops impact the piezoelectric film 25 and are detected . others pass through the special pattern 31 of openings and are not detected . this information is mapped into the known position of each nozzle 21 to create a detect / no detect pattern for each of the pens 14 - 18 . the patterns are then compared to determine relative offsets from pen - to - pen . if two of the pens 14 - 18 are determined to be out of alignment by more than one - half a dot row , the image data is shifted up or down in the nozzle arrays to produce the optimum alignment . note that by doing so , nozzles 21 at the ends of the arrays may have to be sacrificed . that is , they will not be usable . the algorithm is a detect / no detect pattern generated from each of the pens 14 - 18 to determine relative pen - to - pen offsets o . this algorithm for the pen alignment in the print media index axis ( x ) is employed as a correction algorithm to electrronically compensate the drop fire timing and image data . this enables the multi - pen thermal ink jet printer 10 of the present invention to accurately overlay the primary color dots , thus resulting in a high quality image being produced . thus , there has been described inter - pen offset determination and compensation in multi - pen thermal ink jet pen printing systems . it will be seen that the printer of the present invention measures drop location data in the nominal plane of the print media rather than at the orifice plate . it will be seen that the printer of the present invention detects drop position both in x and y axes , not in just one axis . also , it will be seen that the printer of the present invention compensates for directionality errors because it measures drop position in the nominal plane of the print media . it is to be understood that the above - described embodiment of the invention is merely illustrative of the many possible specific embodiments which represent applications of the principles of the present invention . numerous and varied other arrangements can be readily devised in accordance with these principles by those skilled in the art without departing from the scope of the invention .	8
in a typical melt - spinning system as depicted in fig1 an extruder 10 extrudes a polymer melt through a spin pack 12 having a plurality of spin pots 14 therein . the spin pots 14 include a plurality of spinneret orifices that , in turn , form a plurality of filament threadlines 16 . it will be understood that , depending on the intended end use , each of the threadlines may include a single filament or may include any number of filaments . preferably , however , each threadline 16 is formed of a plurality of individual filaments . the filament threadlines 16 are cooled in a quench cabinet 18 ( e . g ., by a flow of quench air or other quench fluid ) and are converged at take - up roll 20 to form a yarn . the filaments of the yarn may thereafter be drawn by godet rolls 22 , 24 and taken up by a winder 26 . prior to being taken up by the winder 26 , the filament threadlines may be brought into contact with a finish applicator 28 so that finish oil may be applied thereto . the principal structures employed in an exemplary spin pot 14 according to the present invention is depicted in accompanying fig2 . in this regard , the spin pot 14 includes a generally cylindrical housing 30 which houses an apertured polymer distribution plate 32 , a mott filter unit 34 and a spinneret plate 36 in that order . the housing 30 is sealed at its upper end via an end cap 38 and a membrane gasket 40 interposed between the cap 38 and the distribution plate 32 . at its lower end , the housing 30 is sealed against polymer leakage by a gasket 42 interposed between the spinneret 36 and the housing 30 . important to the present invention , a rigid apertured support plate 50 is provided so as to support a relatively thin , flexible perforated electroformed screen 44 . specifically , the support plate 50 is provided as a mechanical support for the screen 44 and includes a high density of apertures sufficient in size and number so as to maintain the support plate &# 39 ; s rigidity . the screen 44 unitarily includes a peripheral annular nonperforated region 44 - 1 which bounds a central perforated region 44 - 2 . the support plate 50 and screen are sealed between the upstream mott filter unit 34 and the downstream spinneret 36 by means of annular gaskets 46 , 48 , respectively . the perforation pattern of the central region 44 - 2 is shown in a greatly enlarged ( approximately 200x ) manner in accompanying fig3 . as shown therein , the individual perforations 44 - 3 are generally rectangularly shaped and are oriented in a row and column matrix such that perforations 44 - 3 in adjacent rows are offset from one another . the width - wise ( narrower ) dimension of each perforation establishes the smallest nominally sized particle that is prevented from passing therethrough . in this regard , when thermoplastic polymers ( e . g ., nylons such as nylon 6 , nylon 6 , 6 and the like ) are spun , the widthwise dimension of the perforations 44 - 3 should be between about 25μ to about 44μ , and most preferably between about 32μ to about 40μ . particularly favorable results have been obtained when utilized for spinning nylon 6 thermoplastic polymer by perforations 44 - 3 having a widthwise dimension of about 38μ . the lengthwise dimension and the spacings between the perforations 44 - 3 are chosen so as to minimize the pressure drop of the polymer flow through the screen 44 while maintaining its mechanical integrity at the operating pressures involved . thus , as a general rule , the lengthwise dimension of the perforations 44 - 3 should be as long as possible , and the spacing between adjacent perforations should be as small as possible within the design considerations noted previously . again , using nylon 6 polymer as an example , the lengthwise dimension of the perforations can be up to between about 150 to about 155μ or less with the spacings between the perforations ( both end - to - end and laterally ) being within the range of about 110μ to about 150μ , and more typically between about 120μ and about 135μ . the thickness of the screen 44 may range from between about 0 . 001 inch to about 0 . 005 inch . the perforated screen 44 is most preferably formed of an electroformed metal such as nickel , copper , silver or gold . most preferably , however , the screen 44 is formed of electroformed nickel . as shown in fig4 the electroforming process creates a gently sloped shoulder region 44 - 4 which terminates in the well defined rectangular shape of the perforation 44 - 3 . the shoulder region 44 - 4 is thus most preferably positioned in an downstream direction -- i . e ., adjacent the apertured support plate 50 -- with the well defined rectangularly shaped perforation 44 - 3 being positioned in an upstream direction -- i . e ., adjacent the mott filter unit 34 . the electroplated perforated screen may be obtained commercially , for example , from stork veco international of bedford , mass . in this regard , in the electroforming process , a photographic film is used to produce the precise perforation pattern on a metal matrix . the matrix , which is used as the cathode , is submerged in an electroplating bath . with the application of an electrical current , the metal in the electroplating solution ( e . g ., nickel ) is attracted to the pattern on the matrix , for the part . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiment , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims .	3
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . fig5 is the control sequence of defect area management for an optical disc in accordance with the present invention , and shows the operation of an optical disc r / p device with a host . to improve real time processing of data , maintaining compatibility with the conventional command system would be preferable . accordingly , the present invention further adds a data flag for real - time processing to the conventional command system . as a result , if a defective block is found during a write command for real - time processing , the defective block is skipped rather than replaced . fig6 shows a preferred embodiment of the present invention . generally a conventional write command of 12 bytes for writing data into an optical disc by skipping defective blocks during writing or playback is altered in the present invention . more specifically , a reserved area of the write command ( the 10th byte ) includes a flag indicating the type of data to be written ( wtype ). the reserved area may also include information indicating the speed of the data to be written ( wspeed ). such information would be used by discs which have capability to support the flags . for example , when normal data which does not need real - time writing is input , wtype flag is set to 0 . however , when data requiring real - time processing is input , wtype flag is set to 1 , thereby informing the optical disc r / p device that the data requires real - time processing . accordingly , if the wtype flag within the transferred write command is set to 1 , the optical disc r / p device skips a defective block during writing or playback rather than replacing the defective block . thus , the input data is written into a normal block following the defective block . when the input data does not require real - time processing , the wtype flag is reset to 0 and the optical disc r / p device allows linear replacement whereby data is written into the spare area . also , the wspeed flag may be set according to the required write speed of the input data and transferred within the write command . the optical disc r / p device determines whether to execute linear replacement by utilizing the wspeed . particularly , the speed of data transferred from the host to the optical disc r / p device is recorded into the wspeed area . the optical disc r / p device then compares the recorded speed of the data transfer with the speed by which the data is being written into the optical disc to determine whether to allow linear replalcement . if the transfer speed of data from the host is close to the writing speed of the data into the optical disc , execution of linear replacement slows down the writing of data , thereby reducing the speed of data transfer and increasing the data transfer time . on the other hand , if the transfer speed is significantly slower than the writing speed , slowing down the writing of data would not affect the data transfer time . accordingly , when the transfer speed is lower than the writing speed by a predetermined amount , linear replacement is executed , except when real - time processing is required . the host may determine and control whether to execute linear replacement utilizing the wtype flag , and / or the optical disc r / p device may determine whether to execute linear replacement utilizing both the wtype flag and wspeed . referring to fig5 , if data to be written in real time , such as digital tv stream data or camcorder data , is input ( step 501 ), the host generates a real - time write command and sets the wtype flag to 1 . the host then transfers both the data to be written and the write command to the optical disc r / p device ( step 502 ) through the interface . upon receiving the real - time write command , the optical disc r / p device processes the transferred data together with the write command , and writes the data into a designated position ( step 503 ). the position of the optical disc into which the data is written may be designated using the lba or may be specified in advance using another command . the optical disc r / p device determines whether defective areas exist utilizing the pdl and sdl which indicate the defective areas in the optical disc . if a defective block recorded in the sdl is found during the writing of data ( step 504 ), the optical disc r / p device checks the wtype flag within the write command . since the write command is for real - time processing , the wtype flag would be set to 1 . when the wtype flag is set to 1 , the optical disc r / p device skips the defective block and writes the data into a normal block following the defective block ( step 505 ). upon completion of writing the data ( step 506 ), the optical disc r / p device sends a report back to the host . in the preferred embodiment , if the host requires a current progress during the writing of data , the optical disc r / p device transfers the required information to the host . if there is no request from the host during writing of data , the optical disc r / p device sends a report to the host after data writing is completed . accordingly , if the optical disc r / p device determines that the writing of data is completed , it monitors whether there are any r / p defective blocks . a difference exists between the transfer length used by the host to write the real - time data and the actual size of data to be written due to the number of sdl entries skipped during the writing of the data . thus , if there is at least one skipped defective block , the optical disc r / p device indicates an error and transfers the information of skipped defective blocks to the host ( step 507 ). the host monitors whether the optical disc r / p device has appropriately executed the write command and detects the volume of data which had not been written by the real - time write command of step 502 , based upon the received report . namely , the report includes information such as the number of defective blocks , i . e . the number of sdl entries , skipped during the writing . the host takes into consideration the number of sdl entries in the next write command . particularly , the host varies the volume of data to be written in the next write command , in response to the number of sdl entries skipped during the writing . because the skipped defective blocks cannot be used , the effective size of the disc must be rearranged based upon the skipped defective blocks ( step 508 ). if there is either data which could not be written into the designated position of the optical disc due to the skipped defective blocks ( step 509 ) or continuing data successively connected by the real - time write command ( step 510 ), the host returns to step 502 and repeats transferring the real - time write command . if there is no further data to be written or continuing data in steps 509 and 510 , the writing process ends . however , in the preferred embodiment , if there is no further data to be written or continuing data , the optical disc r / p device moves to the dma area and indicates in the sdl entries where the skipped defective blocks were registered during the recording , that the data corresponding to the defective blocks has been recorded by skipping the defective blocks . thus , during playback of the data , the optical pickup need not move to the spare area , but to the normal block following a defective block when a defective block is found through the sdl . furthermore , if wspeed has been set in the write command when a defective block is found in step 504 , a determination whether to allow and execute a linear replacement for data can be made utilizing wspeed . particularly , the optical disc r / p device compares the speed of wspeed to the actual speed at which the data is being written into the optical disc . if a linear replacement would not affect the writing of data , i . e . writing speed faster than the transfer speed , the linear replacement is executed and data corresponding to defective blocks are written into a replacement block in the spare area . if a linear replacement would detrimentally slow down the real - time writing , i . e . writing speed is slightly higher than the transfer speed , a skip defective area technique is executed and data corresponding to defective blocks are written into normal blocks following the defective blocks . as described above , in the present invention , when data requiring a real - time processing is generated , a real - time write command is sent by which a defective block is skipped and the data corresponding to the defective block is written in a normal block following the defective block . as a result , the optical pickup does not need to move to the spare area whenever a defective block is found , thereby reducing the time it takes the optical pickup to move to and from the spare area . thus , the present invention improves a real - time processing of data in the optical disc r / p device . the foregoing embodiments are merely exemplary and are not to be construed as limiting the present invention . the present teachings can be readily applied to other types of apparatuses . the description of the present invention is intended to be illustrative , and not to limit the scope of the claims . many alternatives , modifications , and variations will be apparent to those skilled in the art .	6
throughout this document , all temperatures are given in degrees celsius and all percentages are weight percentages , unless otherwise stated . the term “ halogen ” or “ halo ” refers to f , cl , i , or br . the term “ alkyl ”, “ alkenyl ”, or “ alkynyl ” refers to a straight chain or branched chain carbon radical containing the designated number of carbon atoms . the term “ alkoxy ” refers to a straight or branched chain alkoxy group . the term “ halo alkyl ” refers to a straight or branched alkyl group substituted with one or more halo atoms . the term “ halo alkoxy ” refers to an alkoxy group substituted with one or more halo atoms . the term “ aryl ” or “ ph ” refers to a phenyl group . the term “ substituted aryl ” refers to a phenyl group substituted with c 12 - c 6 alkyl , c 1 - c 6 alkoxy , halo - c 1 - c 6 alkyl , halo - c 1 - c 6 alkoxy , halo , nitro , carbo - c 1 - c 6 alkoxy , or cyano . the term “ heteroaryl ” refers to pyridyl , pyridinyl , pyrazinyl or pyridazinyl . the term “ me ” refers to a methyl group . the term “ et ” refers to an ethyl group . the term “ pr ” refers to a propyl group . the term “ bu ” refers to a butyl group . the term “ ppm ” refers to parts per million . the term , “ psi ” refers to pounds per square inch . while all the compounds of this invention have fungicidal activity , certain classes of compounds may be preferred for reasons such as , for example , greater efficacy or ease of synthesis . a more preferred class includes those compounds of formula ( 3 ), below a next more preferred class includes those compounds of formula ( 4 ), below a next more preferred class includes those compounds of formula ( 5 ), below a next more preferred class includes those compounds of formula ( 6 ), below wherein x is methyl , halo , or haloalkyl and the additional substituents are as defined in formula ( 1 ), above . currently , it is sometimes preferred when r 1 is hydrogen , c 1 - 4 alkyl , formyl , alkanoyl , alkoxycarbonyl , dialkylaminocarbonyl , or dialkylphosphonyl and r 5 is h , c 1 - 4 alkyl . compounds of the present invention may be prepared by routes commonly known in the art using commercially available or readily synthesized starting materials . such general procedures are described in scheme 1 and scheme 2 , below , wherein the substituents are as described in formula ( 1 ), above , and v is a leaving group , such as , for example , f , cl , or so 2 ch 3 . an compound of formula ( 8 ) is reacted with an appropriately substituted pyridine derivative of formula ( 7 ) in the presence of a base in an aprotic solvent . examples of an appropriate solvent for this reaction would include , but are not restricted to , tetrahydrofuran , dimethyl sulphoxide , acetone , acetonitrile , dimethyl formamide , or n - methylpyrrolidinone . examples of an appropriate base for this reaction would include , but are not restricted to , sodium hydride , potassium hydride , potassium carbonate , potassium t - butoxide , or a tertiary amine derivative such as triethylamine . a ketone derivative of formula ( 9 ) is reacted with an organometallic reagent of the form r 3 — m in a compatible solvent to give an alcohol of the formula ( 10 ). examples of a group r 3 — m would include , but are not restricted to a grignard reagent such as methyl magnesium bromide , an organolithium reagent such as phenyl lithium or a hydride transfer reagent such as sodium borohydride . examples of a suitable solvent would be tetrahydrofuran , diethyl ether , or an appropriate alcohol , selected by compatibility with the reagent and the transformation being carried out . the compound of formula ( 10 ) may be further derivatised by reaction with an appropriate alkylating or acylating reagent r 1 — q , optionally in the presence of an appropriate base . compounds of the formula r 1 — q would include , but are not restricted to acetic anhydride , benzyl bromide , dimethyl carbamoyl chloride , ethyl chloroformate , diethyl phosphoryl chloride , 5 - chloro - 3 - methyl - 2 - methylsulphonylpyridine . examples of a suitable base would include , but are not restricted to a tertiary amine such as triethylamine or pyridine , sodium carbonate , sodium hydride , potassium hydride , or potassium t - butoxide . a compound of formula ( 10 ) may also be reacted with a sulphonyl chloride of the formula rso 2 cl ) in the presence of a suitable base in a compatible solvent to give the corresponding chloride of formula ( 11 ). examples of a suitable sulphonyl chloride would be methanesulphonyl chloride , p - toluenesulphonyl chloride , and examples of a suitable base would be pyridine , triethylamine , or hünig &# 39 ; s base . the compound of formula ( 11 ) may be reacted further with a metal alkoxide salt in a compatible solvent to give a compound of formula ( 1 ). examples of a suitable metal alkoxide would include sodium methoxide , potassium ethoxide , or magnesium methoxide produced in situ by the addition of magnesium metal to methanol . the following examples further illustrate this invention . the examples should not be construed as limiting the invention in any manner . 5 - acetyl - 2 , 3 - dichloropyridine ( 24 . 5 g , 0 . 129 mol ) was slurried in t - butanol ( 200 ml ) and sodium methanethiolate ( 10 g , 0 . 143 mol ) was added . the mixture was heated under reflux conditions for two hours , cooled to room temperature , and diluted with water ( 200 ml ) and ether ( 150 ml ). this was separated and the aqueous phase extracted with ether ( 50 ml ). the combined organic extracts were washed with water ( 100 ml ) and saturated sodium chloride solution ( 100 ml ), dried over anhydrous sodium sulphate , and evaporated to dryness to give the desired product ( 24 . 1 g , 94 %) as a pale , low melting solid . 5 - acetyl - 3 - chloro - 2 - methylthiopyridine ( 24 . 1 g , 0 . 12 mol ) was slurried in absolute ethanol ( 200 ml ) and sodium borohydride ( 4 . 5 g , 0 . 118 mol ) added in portions . the reaction mixture was stirred at room temperature for 48 hours and acidified to ph 2 with 2n hydrochloric acid . this was then diluted with water ( 200 ml ) and the bulk of the ethanol evaporated under reduced pressure , the temperature of the mixture being maintained below 50 ° c . the reaction mixture was diluted with water ( 200 ml ) and extracted twice with dichloromethane ( 15 ml ). the combined organic extracts were washed with water ( 200 ml ) and saturated sodium chloride solution ( 100 ml ), dried over anhydrous sodium sulphate , and evaporated to dryness to give the desired product ( 21 . 9 g , 90 %) as an orange oil . 3 - chloro - 5 -( 1 - hydroxyethyl )- 2 - methylthiopyridine ( 21 . 9 g , 0 . 108 mol ) was dissolved with stirring in anhydrous dmf ( 250 ml ) and 60 % sodium hydride ( 5 g , 0 . 125 mol ) added in portions . the mixture was stirred at room temperature for 30 minutes and benzyl bromide ( 17 . 6 g , 0 . 103 mol ) added dropwise . the mixture was then stirred at room temperature for four hours , diluted with water ( 400 ml ) and extracted three times with ethyl acetate ( 100 ml ). the combined organic extracts were washed twice with water ( 200 ml ) and saturated sodium chloride solution ( 100 ml ), dried over anhydrous sodium sulphate , and evaporated to dryness . purification of the residue by chromatography over silica ( 0 - 5 % ethyl acetate : hexane ) gave the desired product ( 25 . 0 g , 79 %) as a pale yellow oil . 5 -( 1 - benzyloxyethyl )- 3 - chloro - 2 - methylthiopyridine ( 25 g , 0 . 085 mol ) was dissolved with stirring in dichloromethane ( 600 ml ) and 60 % m - chloroperoxybenzoic acid ( 53 . 8 g , 0 . 19 mol ) added in portions . the reaction mixture was stirred at room temperature overnight and 10 % sodium carbonate solution ( 300 ml ) added . the reaction mixture was stirred at room temperature for one hour , separated , and the organic phase washed four times with 2n sodium hydroxide solution ( 150 ml ). it was then washed with saturated sodium chloride solution ( 150 ml ), dried over anhydrous sodium sulphate , and evaporated under reduced pressure to give the product ( 26 . 5 g , 96 %) as a clear viscous oil . 60 % sodium hydride ( 0 . 8 g , 0 . 2 mol ) was washed twice with 50 ml portions of hexane and slurried in anhydrous thf ( 40 ml ). 2 -( hydroxymethyl )- α -( methoxyimino )- n - methyl - benzeneacetamide ( 2 . 0 g , 0 . 009 mol ) was then added in one portion and the mixture stirred at room temperature for 30 minutes . a solution of 5 -( 1 - benzyloxyethyl )- 3 - chloro - 2 - methylsulphonylpyridine ( 3 . 0 g , 0 . 009 mol ) in anhydrous thf ( 5 ml ) was added and the mixture stirred at room temperature overnight . water ( 100 ml ) was added and the mixture extracted three times with ethyl acetate ( 50 ml ). the combined organic extracts were washed twice with water ( 100 ml ) and then with saturated sodium chloride solution ( 50 ml ). the solvent was evaporated under reduced pressure and the residue purified by chromatography over silica ( 30 % ethyl acetate : hexane ) to give the desired product ( 2 . 8 g , 66 %) as a clear viscous gum . sodium borohydride ( 129 mg ; 3 . 4 mmol ) was added in one portion to a solution of 2 -[[[ 5 - benzoyl - 3 - chloro - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 1 . 0 g ; 2 . 3 mmol ) in ethanol ( 23 ml ) and dichloromethane ( 3 ml ). the reaction was stirred for 10 minutes and quenched with 1n hydrochloric acid ( 2 ml ). the reaction mixture was extracted twice with dichloromethane ( 20 ml ), and the combined organic layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated to give the desired product ( 993 mg ; 99 %) as a white foam . acetic anhydride ( 0 . 17 ml ; 1 . 8 mmol ; 2 eq ) was added dropwise at 0 ° c . to a solution of 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 400 mg ; 0 . 91 mmol ) and 4 - dimethylaminopyridine ( 167 mg ; 1 . 4 mmol ; 1 . 5 eq ) in dichloromethane ( 5 ml ). the reaction mixture was warmed slowly to room temperature , and stirring continued for 10 minutes . the reaction mixture was quenched with water , partitioned , and the aqueous phase was extracted twice with dichloromethane . the combined organic layers were washed with 1n hydrochloric acid followed by saturated sodium chloride solution , then dried over anhydrous sodium sulphate , filtered and concentrated . purification of the crude residue by flash chromatography using 50 % etoac in hexanes provided the acetate as a sticky white foam ( 395 mg ; 0 . 84 mmol ; 93 %). a solution of 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 515 mg ; 1 . 2 mmol ) and pyridine ( 0 . 38 ml ; 4 . 7 mmol ; 4 eq ) in dichloromethane ( 5 ml ) was cooled to 0 ° c . for the dropwise addition of trifluoroacetic anhydride ( 0 . 33 ml ; 2 . 3 mmol ; 2 eq ). the reaction was warmed slowly to room temperature and was quenched with water . upon partitioning , the aqueous layer was extracted twice with dichloromethane ( 5 ml ), and the combined aqueous layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . the crude product was placed under vacuum to remove the last traces of pyridine . the desired product ( 68 mg ; 0 . 13 mmol ; 11 %) was isolated by chromatography over neutral alumina ( 50 % ethyl acetate : hexane ). 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 500 mg ; 1 . 1 mmol ) and 4 - dimethylaminopyridine ( 836 mg ; 6 . 8 mmol ; 6 eq ) were dissolved in dichloromethane ( 5 ml ), and dimethylcarbamoyl chloride ( 0 . 31 ml ; 3 . 4 mmol ; 3 eq ) was added at room temperature . the reaction mixture was heated to reflux for three hours , cooled back down to room temperature and quenched with water . the aqueous layer was extracted twice with dichloromethane ( 5 ml ), and the combined organic layers were washed with 1n hydrochloric acid and saturated sodium chloride solution . they were then dried over anhydrous sodium sulphate , filtered and concentrated . the crude residue was purified by chromatography using 20 % ch 3 cn and dichloromethane to yield the desired product ( 192 mg 34 %). 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 200 mg ; 0 . 45 mmol ), triethylamine ( 0 . 31 ml ; 2 . 3 mmol ; 5 eq ) and 4 - dimethylaminopyridine ( 44 mg ; 0 . 36 mmol ; 0 . 8 eq ) were dissolved in dichloromethane ( 3 . 6 ml ), and the resulting solution was cooled to − 40 ° c . acetyl formyl anhydride ( 0 . 19 ml ; 1 . 2 mmol ; 2 . 5 eq ) was added dropwise to the reaction mixture , and stirring was continued at low temperature until the reaction was complete after 10 minutes . the cooling bath was removed , and saturated sodium bicarbonate was added to quench any excess reagent still present . the aqueous phase was extracted with dichloromethane ( 2 × 3 ml ), and the combined organic layers were washed with 1n hydrochloric acid followed by saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . the crude product was purified by chromatography using 50 % etoac in hexanes to give the product ( 541 mg , 100 %) as a white foam . a solution of triethylphosphite ( 94 μl ; 0 . 55 mmol ; 1 . 2 eq ) in dichloromethane ( 0 . 5 ml ) was cooled to 0 ° c . for the addition of iodine ( 126 mg ; 0 . 50 mmol ; 1 . 1 eq ). stirring continued until the purple color dissipated , indicating complete formation of the phosphoryl iodide . this cold solution was transferred dropwise via cannula to a solution of 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 200 mg ; 0 . 45 mmol ) in pyridine ( 0 . 15 ml ; 1 . 8 eq ; 4 eq ) and dichloromethane ( 4 ml ). the alcohol solution turned yellow as the phosphoryl iodide reagent was added , but the color quickly dissipated as stirring continued . upon completion of the addition , the reaction stirred at room temperature for another 30 minutes , turning brown in the process . it was quenched with saturated sodium bicarbonate solution and shaken with a crystal of sodium hydrogen sulphate . the aqueous phase was extracted with dichloromethane ( 2 × 3 ml ), and the combined organic layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . the crude product was purified by chromatography using 70 - 80 % etoac in hexanes to yield the desired product ( 130 mg , 50 %) as a yellow - tinged foam . dihydropyran ( 0 . 16 ml ; 1 . 7 mmol ; 1 . 5 eq ) and a catalytic amount of pyridinium p - toluenesulphonate ( 28 mg ; 0 . 11 mmol ; 0 . 1 eq ) were added to a solution of 2 [[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 500 mg ; 1 . 1 mmol ) in dichloromethane ( 8 ml ). the reaction was stirred at room temperature overnight and was quenched with half - saturated sodium chloride solution ( 5 ml ). the aqueous layer was extracted twice with diethyl ether ( 5 ml ), and the combined organic layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . purification of the crude product by chromatography using 50 % etoac in hexanes gave the desired product ( 521 mg , 87 %) as a white foam . 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 500 mg ; 1 . 1 mmol ) and pyridine ( 0 . 18 ml ; 2 . 3 mmol ; 2 eq ) were dissolved in dichloromethane ( 5 . 7 ml ) at room temperature . the resulting solution was cooled to − 20 ° c . for the dropwise addition of triethylsilyl triflate ( 0 . 39 ml ; 1 . 7 mmol ; 1 . 5 eq ). the bath was removed , and the reaction mixture was warmed slowly to room temperature where it stirred for 30 minutes . it was quenched with water ( 10 ml ) and diluted with diethyl ether ( 10 ml ). the aqueous phase was extracted with diethyl ether ( 5 ml ), and the combined organic layers were washed with 1n hydrochloric acid followed by saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . the crude product was filtered through a plug of silica gel using diethyl ether to afford the desired product ( 511 mg , 81 %) as a sticky , colorless oil . to a solution of 2 -[[[ 5 - benzoyl - 3 - chloro - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 1 . 0 g ; 2 . 3 mmol ) in thf ( 30 ml ) was added a 3 . 0 m solution of methylmagnesium bromide in diethyl ether ( 4 . 6 ml ; 13 . 7 mmol ; 6 eq ) at 0 ° c . the solution yellowed , and a precipitate appeared after a few minutes . the solution was warmed to room temperature where it was stirred for two hours . it was then cooled back down to 0 ° c . and quenched with aqueous ammonium chloride ( 20 ml ). the aqueous layer was extracted twice with diethyl ether ( 10 ml ), and the combined organic layers were washed with brine , dried over sodium sulfate and concentrated . the crude residue was passed through a plug of silica gel with the aid of diethyl ether to give the desired product ( 933 mg , 90 %). 2 -[[[ 3 - chloro - 5 -( 1 - hydroxy - 1 - phenylethyl )- 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 933 mg ; 2 . 1 mmol ) was dissolved in ch 2 cl 2 ( 10 ml ), and triethylamine ( 0 . 87 ml ; 6 . 2 mmol ; 3 eq ) was added at room temperature followed by methanesulfonyl chloride ( 0 . 40 ml ; 5 . 2 mmol ; 2 . 5 eq ). the reaction mixture stirred for 30 minutes and was quenched with water . the aqueous layer was extracted twice with diethyl ether ( 20 ml ), and the combined organic layers were washed with 1n hcl followed by brine and then dried over sodium sulfate and concentrated . the crude product was purified by flash column chromatography using 80 % diethyl ether in hexanes to give the desired product ( 778 mg , 87 %). a 60 % solution of n - methylmorpholine n - oxide in water ( 1 . 9 ml ; 11 . 0 mmol ; 1 . 5 eq ) was added to a solution of 2 -[[[ 3 - chloro - 5 -( 1 - phenylethenyl )- 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 3 . 2 g ; 7 . 3 mmol ) in aqueous acetone ( 30 ml acetone ; 6 ml water ) at room temperature . this was followed by the dropwise addition of a 4 % solution of osmium tetroxide in water ( 1 . 43 ml ; 0 . 18 mmol ; 0 . 025 eq ). the resulting reaction mixture stirred overnight , at which point sodium sulfite ( 250 mg ) was added to quench any remaining oxidants . stirring was continued until a black precipitate appeared , and the solution was diluted with water ( 15 ml ) and extracted twice with etoac ( 30 ml ). the combined organic layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . purification by chromatography using a step gradient of 50 - 80 % etoac in hexanes yielded the desired product as a brownish foam ( 3 . 5 g , 100 %). 2 -[[[ 3 - chloro - 5 -( 1 , 2 - dihydroxy - 1 - phenylethyl )- 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 1 . 22 g ; 2 . 6 mmol ) was dissolved in pyridine ( 6 ml ) and the solution was cooled to 0 ° c . for the addition of p - toluenesulphonyl chloride ( 743 mg ; 3 . 9 mmol ; 1 . 5 eq ). the bath was removed , and the reaction mixture stirred at room temperature overnight . it was then quenched with water ( 6 ml ) and diluted with etoac ( 10 ml ). the aqueous layer was extracted with etoac ( 6 ml ), and the combined organic layers were washed with 1n hydrochloric acid followed by saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . the crude tosylate was purified by chromatography using 50 % etoac in hexanes to afford 1 . 3 g ( 2 . 0 mmol ; 80 %) of the pure product as a white solid ( m . p . 55 - 60 ° c .). 2 -[[[ 3 - chloro - 5 -( 2 - hydroxy - 1 -[[( 4 - methylphenyl ) sulfonyl ] oxy ]- 2 - phenylethyl )- 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 570 mg ; 0 . 91 mmol ) was dissolved in methanol ( 9 ml ), and potassium carbonate ( 250 mg ; 1 . 8 mmol 2 eq ) was added in one portion . stirring continued at room temperature for about an hour , at which point the reaction mixture was diluted with water and the extracted with diethyl ether ( 10 ml ). the combined organic layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated to give the desired product ( 336 mg , 82 %) as a white solid ( m . p . 48 - 53 ° c .). the following table identifies several compounds of formula ( 1 ) of the formula below prepared analogous to the various procedures illustrated in the preceding examples : the compounds of formula ( 1 ) thus produced are usually obtained as a mixture of the e and z forms , which can then be separated , via standard means known in the art , into each of those forms , if desired . the compounds of formula ( 1 ) show strong fungicidal activity against a wide variety of fungi . the following tests illustrate the fungicidal efficacy of the compounds of this invention . the compounds of the present invention have been found to control fungi , particularly plant pathogens . when employed in the treatment of plant fungal diseases , the compounds are applied to the plants in a disease inhibiting and phytologically acceptable amount . application may be performed before and / or after the infection with fungi on plants . application may also be made through treatment of seeds of plants , soil where plants grow , paddy fields for seedlings , or water for perfusion . the compounds may also be employed effectively for the control of fungi on wood , leather , carpet backings , or in paint . as used herein , the term “ disease inhibiting and phytologically acceptable amount ” refers to an amount of a compound of the present invention which kills or inhibits the plant disease for which control is desired but is not significantly toxic to the plant . this amount will generally be from about 1 to 1000 ppm , with 10 to 500 ppm being preferred . the exact concentration of compound required varies with the fungal disease to be controlled , the type of formulation employed , the method of application , the particular plant species , climate conditions , and the like . a suitable application rate is typically in the range from about 0 . 10 to about 4 lb / a . the compounds of the invention may also be used to protect stored grain and other non - plant loci from fungal infestation . the following experiments were performed in the laboratory to determine the fungicidal efficacy of the compounds of the invention . compound formulation : compound formulation was accomplished by dissolving technical materials in acetone , with serial dilutions then made in acetone to obtain desired rates . final treatment volumes were obtained by adding nine volumes 0 . 05 % aqueous tween - 20 or triton x - 100 , depending upon the pathogen . late blight of tomatoes ( phytophthora infestans — phytin ): tomatoes ( cultivar rutgers ) were grown from seed in a soilless peat - based potting mixture ( metromix ) until the seedlings were 1 - 2 leaf ( bbch 12 ). these plants were then sprayed to run off with the test compound at a rate of 100 ppm . after 24 hours the test plants were inoculated with an aqueous spore suspension of phytophthora infestans . the plants were then transferred to the greenhouse until disease developed on the untreated control plants . powdery mildew of wheat ( erysiphe araminis — erysgt ): wheat ( cultivar monon ) was grown in a soilless peat - based potting mixture ( metromix ) until the seedlings were 1 - 2 leaf ( bbch 12 ). these plants were then sprayed to run off with the test compound at a rate of 100 ppm . after 24 hours the test plants were inoculated with erysiphe graminis by dusting spores from stock plants onto the test plants . the plants were then transferred to the greenhouse until disease developed on the untreated control plants . glume blotch of wheat ( leptosphaeria nodorum — leptno ): wheat ( cultivar monon ) was grown from seed in a soilless peat - based potting mixture ( metromix ) until the seedlings were 1 - 2 leaf ( bbch 12 ). these plants were then sprayed to run off with the test compound at a rate of 100 ppm . after 24 hours the test plants were inoculated with an aqueous spore suspension of leptosphaeria nodorum . the plants were then transferred to the greenhouse until disease developed on the untreated control plants . brown rust ( puccinia recondita — puccrt ): wheat ( cultivar monon ) was grown from seed in a soilless peat - based potting mixture ( metromix ) until the seedlings were 1 - 2 leaf ( bbch 12 ). these plants were then sprayed to run off with the test compound at a rate of 100 ppm . after 24 hours the test plants were inoculated with an aqueous spore suspension of puccinia recondita . the plants were then transferred to the greenhouse until disease developed on the untreated control plants . septoria leaf spot ( septoria tritici — septtr ): wheat ( cultivar monon ) was grown from seed in a soilless peat - based potting mixture ( metromix ) until the seedlings were 1 - 2 leaf ( bbch 12 ). these plants were then sprayed to run off with the test compound at a rate of 100 ppm . after 24 hours the test plants were inoculated with an aqueous spore suspension of septoria tritici . the plants were then transferred to the greenhouse until disease developed on the untreated control plants . the following table presents the activity of typical compounds of the present invention when evaluated in these experiments . the effectiveness of the test compounds in controlling disease was rated using the following scale : the compounds of this invention are preferably applied in the form of a composition comprising one or more of the compounds of formula ( 1 ) with a phytologically - acceptable carrier . the compositions are either concentrated formulations which are dispersed in water or another liquid for application , or are dust or granular formulations which are applied without further treatment . the compositions are prepared according to procedures which are conventional in the agricultural chemical art , but which are novel and important because of the presence therein of the compounds of this invention . some description of the formulation of the compositions is given to assure that agricultural chemists can readily prepare desired compositions . the dispersions in which the compounds are applied are most often aqueous suspensions or emulsions prepared from concentrated formulations of the compounds . such water - soluble , water suspendable , or emulsifiable formulations are either solids , usually known as wettable powders , or liquids , usually known as emulsifiable concentrates or aqueous suspensions . the present invention contemplates all vehicles by which the compounds of this invention can be formulated for delivery for use as a fungicide . as will be readily tappreciated , any material to which these compounds can be added may be used , provided they yield the desired utility without significant interference with activity of the compounds of this invention as antifungal agents . wettable powders , which may be compacted to form water dispersible granules , comprise an intimate mixture of the active compound , an inert carrier and surfactants . the concentration of the active compound is usually from about 10 % to about 90 % w / w , more preferably about 25 % to about 75 % w / w . in the preparation of wettable powder compositions , the toxicant products can be compounded with any of the finely divided solids , such as prophyllite , talc , chalk , gypsum , fuller &# 39 ; s earth , bentonite , attapulgite , starch , casein , gluten , montmorillonite clays , diatomaceous earths , purified silicates or the like . in such operations , the finely divided carrier is ground or mixed with the toxicant in a volatile organic solvent . effective surfactants , comprising from about 0 . 5 % to about 10 % of the wettable powder , include sulfonated lignins , naphthalenesulfonates , alkylbenzenesulfonates , alkyl sulfates , and non - ionic surfactants , such as ethylene oxide adducts of alkyl phenols . emulsifiable concentrates of the compounds of this invention comprise a convenient concentration , such as from about 10 % to about 50 % w / w , in a suitable liquid . the compounds are dissolved in an inert carrier , which is either a water miscible solvent or a mixture of water - immiscible organic solvents , and emulsifiers . the concentrates may be diluted with water and oil to form spray mixtures in the form of oil - in - water emulsions . useful organic solvents include aromatics , especially the high - boiling naphthalenic and olefinic portions of petroleum such as heavy aromatic naphtha . other organic solvents may also be used , such as , for example , terpenic solvents , including rosin derivatives , aliphatic ketones , such as cyclohexanone , and complex alcohols , such as 2 - ethoxyethanol . emulsifiers which can be advantageously employed herein can be readily determined by those skilled in the art and include various nonionic , anionic , cationic and amphoteric emulsifiers , or a blend of two or more emulsifiers . examples of nonionic emulsifiers useful in preparing the emulsifiable concentrates include the polyalkylene glycol ethers and condensation products of alkyl and aryl phenols , aliphatic alcohols , aliphatic amines or fatty acids with ethylene oxide , propylene oxides such as the ethoxylated alkyl phenols and carboxylic esters solubilised with the polyol or polyoxyalkylene . cationic emulsifiers include quaternary ammonium compounds and fatty amine salts . anionic emulsifiers include the oil - soluble salts ( e . g ., calcium ) of alkylaryl sulphonic acids , oil soluble salts or sulphated polyglycol ethers and appropriate salts of phosphated polyglycol ether . representative organic liquids which can be employed in preparing the emulsifiable concentrates of the present invention are the aromatic liquids such as xylene , propyl benzene fractions ; or mixed naphthalene fractions , mineral oils , substituted aromatic organic liquids such as dioctyl phthalate ; kerosene ; dialkyl amides of various fatty acids , particularly the dimethyl amides of fatty glycols and glycol derivatives such as the n - butyl ether , ethyl ether or methyl ether of diethylene glycol , and the methyl ether of triethylene glycol . mixtures of two or more organic liquids are also often suitably employed in the preparation of the emulsifiable concentrate . the preferred organic liquids are xylene , and propyl benzene fractions , with xylene being most preferred . the surface active dispersing agents are usually employed in liquid compositions and in the amount of from 0 . 1 to 20 percent by weight of the combined weight of the dispersing agent and active compound . the active compositions can also contain other compatible additives , for example , plant growth regulators and other biologically active compounds used in agriculture . aqueous suspensions comprise suspensions of water - insoluble compounds of this invention , dispersed in an aqueous vehicle at a concentration in the range from about 5 % to about 50 % w / w . suspensions are prepared by finely grinding the compound , and vigorously mixing it into a vehicle comprised of water and surfactants chosen from the same types above discussed . inert ingredients , such as inorganic salts and synthetic or natural gums , may also be added to increase the density and viscosity of the aqueous vehicle . it is often most effective to grind and mix the compound at the same time by preparing the aqueous mixture and homogenizing it in an implement such as a sand mill , ball mill , or piston - type homogenizer . the compounds may also be applied as granular compositions , which are particularly useful for applications to the soil . granular compositions usually contain from about 0 . 5 % to about 10 % w / w of the compound , dispersed in an inert carrier which consists entirely or in large part of coarsely divided attapulgite , bentonite , diatomite , clay or a similar inexpensive substance . such compositions are usually prepared by dissolving the compound in a suitable solvent and applying it to a granular carrier which has been preformed to the appropriate particle size , in the range of from about 0 . 5 to about 3 mm . such compositions may also be formulated by making a dough or paste of the carrier and compound , and crushing and drying to obtain the desired granular particle . dusts containing the compounds are prepared simply by intimately mixing the compound in powdered form with a suitable dusty agricultural carrier , such as , for example , kaolin clay , ground volcanic rock , and the like . dusts can suitably contain from about 1 % to about 10 % w / w of the compound . the active compositions may contain adjuvant surfactants to enhance deposition , wetting and penetration of the compositions onto the target crop and organism . these adjuvant surfactants may optionally be employed as a component of the formulation or as a tank mix . the amount of adjuvant surfactant will vary from 0 . 01 percent to 1 . 0 percent v / v based on a spray - volume of water , preferably 0 . 05 to 0 . 5 percent . suitable adjuvant surfactants include ethoxylated nonyl phenols , ethoxyated synthetic or natural alcohols , salts of the esters or sulphosuccinic acids , ethoxylated organosilicones , ethoxylated fatty amines and blends of surfactants with mineral or vegetable oils . the composition may optionally include fungicidal combinations which comprise at least 1 % of one or more of the compounds of this invention with another pesticidal compound . such additional pesticidal compounds may be fungicides , insecticides , nematocides , miticides , arthropodicides , bactericides or combinations thereof that are compatible with the compounds of the present invention in the medium selected for application , and not antagonistic to the activity of the present compounds . accordingly , in such embodiments the other pesticidal compound is employed as a supplemental toxicant for the same or for a different pesticidal use . the compounds in combination can generally be present in a ratio of from 1 : 100 to 100 : 1 . the present invention includes within its scope methods for the control or prevention of fungal attack . these methods comprise applying to the locus of the fungus , or to a locus in which the infestation is to be prevented ( for example applying to cereal or grape plants ), a fungicidal amount of one or more of the compounds of this invention or compositions . the compounds are suitable for treatment of various plants at fungicidal levels , while exhibiting low phytotoxicity . the compounds are useful in a protectant or eradicant fashion . the compounds of this invention are applied by any of a variety of known techniques , either as the compounds or as compositions including the compounds . for example , the compounds may be applied to the roots , seeds or foliage of plants for the control of various fungi , without damaging the commercial value of the plants . the materials are applied in the form of any of the generally used formulation types , for example , as solutions , dusts , wettable powders , flowable concentrates , or emulsifiable concentrates . these materials are conveniently applied in various known fashions . the compounds of this invention have been found to have significant fungicidal effect particularly for agricultural use . many of the compounds are particularly effective for use with agricultural crops and horticultural plants , or with wood , paint , leather or carpet backing . in particular , the compounds effectively control a variety of undesirable fungi which infect useful plant crops . activity has been demonstrated for a variety of fungi . it will be understood by those in the art that the efficacy of the compounds of this invention for the foregoing fungi establishes the general utility of the compounds as fungicides . the compounds of this invention have broad ranges of efficacy as fungicides . the exact amount of the active material to be applied is dependent not only on the specific active material being applied , but also on the particular action desired , the fungal species to be controlled , and the stage of growth thereof , as well as the part of the plant or other product to be contacted with the toxic active ingredient . thus , all the active ingredients of the compounds of this invention , and compositions containing the same , may not be equally effective at similar concentrations or against the same fungal species . the compounds of this invention and compositions are effective in use with plants in a disease inhibiting and phytologically acceptable amount . the term “ disease inhibiting and phytologically acceptable amount ” refers to an amount of a compound which kills or inhibits the plant disease for which control is desired , but is not significantly toxic to the plant . this amount will generally be from about 1 to about 1000 ppm , with 10 to 500 ppm being preferred . the exact concentration of compound required varies with the fungal disease to be controlled , the type of formulation employed , the method of application , the particular plant species , climate conditions , and the like . a suitable application rate is typically in the range from about 0 . 10 to about 4 pounds / acre .	0
synthesis of an amine terminated cholesterol group was based on literature . to a stirred solution of 1 . 0 molar equivalent i ( n - boc - 2 , 2 ′-[ ethylenedioxy ] diethylamine , sigma - aldrich ) and 1 . 1 molar equivalents ii ( cholesteryl chloroformate , sigma - aldrich ) in anhydrous toluene , 1 . 5 molar equivalents of dipea ( diisopropylethylamine , sigma - aldrich ) and a catalytic amount of dmap ( 4 - dimethylaminopyridine , sigma - aldrich ) were added . the reaction mixture was refluxed under argon atmosphere for 17 hours . subsequently , the solvent was removed under reduced pressure to obtain an oily residue . flash column chromatography was performed using 40 % ethyl acetate + 60 % hexane as eluent ( rf = 0 . 22 ). the solvent was removed under reduced pressure and the product iii was found to be an off white sticky residue . esi - tof : [ m ] + calcd 661 , [ m ] + found 661 . 1 h nmr ( 300 mhz , cdcl 3 ): 5 . 37 ( t , 1h , olefinic h ), 5 . 25 ( t , 1h , nh ), 5 . 1 ( t , 1h nh ), 4 . 5 ( m , 1h , o — ch cholesterol ), 3 . 61 ( s , 4h , o — ch 2 — ch 2 — o ), 3 . 55 ( m , 4h , 2 × o — ch 2 ), 3 . 37 ( m , 4h , 2 × ch 2 in ch 2 nh ), 2 . 5 - 0 . 87 ( 34h , cholesterol ), 1 . 5 ( s , 9h tert boc ), 0 . 86 ( d , 6h 2 × ch 3 cholesterol ), 0 . 68 ( s , 3h , 1 × ch 3 cholesterol ). product iii was dissolved in dichloromethane and was added in a drop - wise manner to a stirred solution of 4 molar equivalents of tfa ( trifluoroacetic acid ) in dichloromethane . deprotection was obtained after 23 hours at room temperature under continuous stirring . using tlc the deprotection was monitored . solvent was removed under reduced pressure and the residue was dissolved in dichloromethane and neutralized with tea ( triethylamine ). flash column chromatography was performed using 1 % nh 3 ( aq ) solution ( 25 % nh 3 in water ), 9 % meoh and 90 % chloroform ( rf frac13 - 16 = 0 . 38 , rf frac17 - 35 = 0 . 24 ). after solvent removal a yellowish sticky residue was obtained ( 76 . 3 % yield ). the purified product was stored at − 20 ° c . until further use . 1 h nmr ( 300 mhz , cdcl 3 ): 5 . 37 ( t , 1h , olefinic h ), 5 . 25 ( t , 1h nh ), 4 . 5 ( m , 1h , o — ch cholesterol ), 3 . 61 ( s , 4h , o — ch 2 — ch 2 — o ), 3 . 56 ( m , 4h , 2 × och 2 ), 3 . 52 ( t , 2h , nh 2 ), 3 . 37 ( m , 2h , ch 2 in ch 2 nh ), 2 . 89 ( t , 2h , ch 2 nh 2 ), 2 . 5 - 0 . 87 ( 34h , cholesterol ), 0 . 86 ( d , 6h , 2 × ch 3 cholesterol ), 0 . 68 ( d , 3h , 1 × ch 3 cholesterol ) polycaprolactone ( pcl ) was treated for ten seconds ( 10 s ) with oxygen plasma treatment ( opt ) using a plasma prep ii ( spi supplies ). this is a rf plasma treatment . the pcl used was a pcl sheet solvent casted from chloroform , mn 45 , 000 da ( sigma ). prior to sample treatment the chamber was cleaned during a 20 minutes cleaning run . the plasma treatment was performed using electromagnetic radiation having an energy of 400 j , at 200 mtorr of vacuum pressure . this was sufficient to generate aldehyde groups as shown by the purple discoloration of aldehyde - specific purpald dye in thin layer chromatography ( tlc ). the generation of aldehyde groups was further confirmed with x - ray photoelectron spectroscopy ( xps ) and ir - spectroscopy . quantera sxm ( scanning xps microprobe from physical electronics ) showed an increase in oxygen bearing groups , in particular o — c ≡ o and — c ═ o . moreover , bulk polymer modification was excluded by comparing fourier transform infrared spectroscopy with attenuated total reflectance ( ftir - atr ; diamond ) with polarization modulation infrared reflection absorption spectroscopy ( pm - irras ). only in pm - irras on spin - coated gold samples a shoulder appeared in the carbonyl region that was not observed in the atr spectra . due to the differences in sampling depth , atr diamond 5 μm and pm - irras nm regime , surface confinement of the oxygen plasma treatment was concluded . the plasma treatment was repeated with electromagnetic radiation having a different energy . the results of these experiments are given in fig1 . fig1 clearly shows that there is an optimum in the energy of the electromagnetic radiation at 400 j for the treatment of pcl , under the present experimental conditions . the opt modified polycaprolactone sheet according to example ii was contacted with 1 mm of amine terminated cholesterol group in ethanol . contacting lasted for 1 hour at room temperature while shaking the solution . the modified caprolactone sheet was reduced directly in a freshly made nabh 4 solution ( sigma ) i . e . 100 mg in 10 ml ethanol and 40 ml 1 × phosphate buffered saline ( pbs , sigma ). in this example and in example iva the pbs was prepared by the solution of a pbs tablet ( sigma ) in 200 ml of deionized water to yield a 0 . 01 m phosphate buffered saline , with 0 . 0027 m potassium chloride and 0 . 137 m sodium chloride ; ph 7 . 4 at 25 ° c . subsequently the samples were rinsed with milliq to remove salt and briefly sonicated in ethanol to remove adsorbed linker and dried under a stream of nitrogen . to evaluate whether the aldehyde groups , formed after oxygen plasma treatment , are reactive towards the cholesterol group time of flight secondary ion mass spectroscopy ( tof - sims ) ( waters - micromass lct ) and contact angle measurements were used . the surface modification of three different biopolymers treated with oxygen plasma treatment ( opt ) using electromagnetic radiation having an energy of 400 j was compared . the biopolymers tested were polycaprolactone ( pcl , mn = 45 kda ), a segmented block copolymer of poly ( ethylene oxide terephthalate ) and polybutylene terephthalate ( pa , polyactive ® 1000 / 70 / 30 ) and a block copolymer of polylactic acid and polycaprolactone ( pg , pla65 / pcl35 ). after the treatment with opt the samples were incubated with the amine terminated cholesterol group for 1 hour as described above . after both the opt treatment and the incubation with the amine terminated cholesterol group the sensile contact angle was determined . the sensile water contact angle was measured using a krüss contact angle measuring system g10 . the sample for contact angle measurement was placed horizontally with the side to be measured facing up . using the automated syringe a water droplet ( 30 μl droplet distilled or ultrapure milliq water ) was placed on the surface . the droplet was imaged within a period of 5 seconds . by the use of software fitting the sensile water contact angle with the sample surface was deduced . the samples were measured on multiple locations , & gt ; n = 3 , to ensure that a reliable value for the water contact angle was found . fig2 shows the contact angle for the native polymers ( pcl , pa and pg ), the contact angle after treatment with opt and the contact angle after incubation with the amine terminated cholesterol group . the contact angle becomes lower after the treatment with opt which means that the surface becomes more hydrophilic . after incubation with the amine terminated cholesterol group the surface of the polymers becomes more hydrophobic again . further the contact angle after treatment with opt was determined for the pg polymer . the contact angle was determined after various amounts of time as shown in table 1 . also the mobility properties of the bslb were determined . the incubation with the amine terminated cholesterol group was performed as described above . the method for the formation of the lipid bilayer was performed as described in example iv , a below . the amount of mobility of the lipid bilayer was determined by frap analysis as described in example iv , b below . the results of these experiments were used to determine for which amount of time the reactive groups a , were present on the surface of the pg polymer . table 1 shows that for a time of about 92 hour after storage in water ( at room temperature ) the opt treatment the contact angle remained low . after storage under air ( room temperature ) the contact angle remained low for about 2 hours . thus within this time frame sterol groups could be attached to the reactive groups a to form an air - stable lipid bilayer ( rbslb ). a similar stability experiment with pa ( polyactive ® 1000 / 70 / 30 ) showed a much lower stability of the reactive groups a ( aldehyde groups ) and reaction of the aldehyde groups with sterol groups preferably takes place within 5 minutes after the activation of the surface of the pa - object ( see table 1 ). large unilamellar vesicles ( luvs ) were prepared by extrusion ( 11 times ) of a solution of multi laminar vesicles ( mlv ) through 100nm polycarbonate membranes on an avanti polar lipids extruder . the mlv solution was a solution of 1 , 2 - dioleoyl - sn - glycero - 3 - phosphocholine ( dopc ) obtained from avanti polar lipids . mlvs of dopc were generated by vortexing a rehydrated lipid cake in fresh milliq ( 18mω ) at 1 mg / ml . the lipid cake was prepared by drying 99 . 8 mol % dopc and 0 . 2 mol % oregon green or texas red - 1 , 2 - dihexadecanoyl - sn - glycero - 3 - phosphoethanolamine ( dhpe , invitrogen ) from organic solvent . the cake was dried under a stream of nitrogen and left to dry under vacuum for 1 hour . opt modified polycaprolactone sheet according to example ii and opt modified and cholesterol modified polycaprolactone sheets according to example iii were treated with a diluted luv solution of 0 . 5 mg / ml in pbs . the sheets were incubated with the luv solution for 45 minutes above t m of the lipids used (− 20 ° for dopc ) to allow for vesicle adsorption and rupture to occur . optional , to further ensure high yield of ruptured vesicles a freezing step at − 80 ° c . was employed after the initial incubation . after extensive washing in 1 × phosphate buffered saline ( pbs , sigma ), the fluorescently labelled bilayer on pcl was achieved as shown by a fluorescence image of the pcl sheet . the thickness of the dopc layer formed on the object was 4 . 1 nm +/− 0 . 7 nm as determined by force spectroscopy . the dopc lipid bilayer formed according to example iva proved fluidic on the pcl support . the mobility was deduced by observing the diffusion occurring after a population of fluorescent lipids has been bleached , so - called recovery . in fig3 the bilayer consisted of dopc doped with 0 . 2 mol % of oregon green dhpe and was prepared using 100 nm luvs . a , fitted cslm frap recovery curve using a one - component fit , r 2 0 . 999207 . a diffusion coefficient of 1 . 016 μm 2 / s ± 0 . 012 with a mobile fraction of & gt ; 95 % was found . the roi , tot and bg regions had a ω of 24 μm during bleaching and acquisition . the inset shows the complete recovery profile during a single frap measurement using 600 iterations at 900 ms interval . epi - fluorescence images of b , pre bleach c , post bleach and d , after 15 minutes show recovery of fluorescence , scale bar 200 μm . here , the field diaphragm was closed to bleach a 130 μm spot on a single fiber to qualitatively assess later diffusion of the fluorescent layer . according to the method described above lipid bilayers were formed on pcl sheets that were treated with opt and thereafter incubated with an amine terminated cholesterol group for 1 hour , 2 hours or 3 hours respectively . it is shown by the results in table 2 below that by the opt treatment in combination with the incubation with the amine terminated cholesterol group an air - stable lipid bilayer ( rbslb ) can be formed with a mobile fraction of & gt ; 90 % as determined by frap analysis . when the incubation with the amine terminated cholesterol group lasts 3 hours it is shown that the mobile fraction of the air - stable lipid bilayer was reduced to about 50 %. on the untreated pcl sheet and on the pcl sheet that was only treated with opt an air - stable lipid bilayer was not formed . pcl films of 0 . 5 × 0 . 5 cm 2 ( sigma ) were modified on one side , while the other side remained unaltered , with a dopc lipid bilayer formed according to the process described in examples ii , ill and iva . these films were incubated with bovine serum albumin ( bsa , sigma ) modified with dylight 488 ( thermo scientific ) for 20 min . at room temperature in the dark . after the set incubation and protein desorption in sds solution for 1 hour the bsa - dylight488 content was quantified for determination of the non - fouling nature of the modified pcl films . the total protein adsorption decreased by about 50 % after application of the bilayer . it is expected that the reduction is due to the non - fouling nature of the zwitterionic lipid bilayer . since only half of the total surface area was treated , a high degree of protein resistance ( of about 100 %) can be deduced even after dehydration and rehydration of the sample i . e . 1 ×, 2 × or 3 times sequentially . one dehydration cycle was performed by removal of all the liquids above the object and let it dry for 30 min . afterwards pbs was added to rehydrate the lipid bilayer , all conducted at room temperature . bsa conjugated with dylight 488 was incubated with the substrates in pbs . the adsorbed protein was quantified with a plate reader after being desorbed in sds solution . the inset shows adsorption data of bsa in dmem , lacking fbs . relative protein adsorption is presented as mean ± sd ( n = 3 ) and compared using 1 - way anova with post - hoc tukey test , * p =& lt ; 0 . 05 . the bsa adsorption figures show that the attachment of the lipid bilayer to the pcl object is stable . even after rehydration and dehydration of the sample 3 times no amendment of the bsa adsorption occurred . further no fouling with the proteins out of the bsa occurs on the lipid bilayer . this means that the lipid bilayers will also protect the object against other forms of bio - fouling . to gain insight in the non - fouling behaviour of the bslbs , a protein adsorption assay was performed . here , fluorescently labelled bsa was prepared and used to quantify the amount of protein adsorbed to the samples surface . briefly , n - hydrocysuccinimide ( nhs ) activated dylight - 488 was incubated with bsa and purified using spin columns following the protocol provided by the manufacturer ( thermo scientific ). bslb modified pcl films of 0 . 5 × 0 . 5 cm 2 ( sigma ) were incubated with 50 μg / ml bsa conjugates in pbs for 20 min . subsequent washings using pbs ensured loosely bound protein to be removed . adsorbed protein was desorbed in sds solution for 1 h at room temperature and quantified using a plate reader ( victor , perkin - elmer ) and a standard curve . in the case of the dehydrated bslb the buffer was removed and the surface was exposed to air . subsequently , pbs buffer was added to rehydrate the bslb samples . data are presented in table 4 and show that upon formation of the bslb the amount of adsorbed protein is significantly reduced . kgg - peptides were synthesized using a microwave solid - phase peptide synthesizer ( oem ). the fluorenylmethyloxycarbonylchloride ( fmoc )- protected amino acids and the coupling reagents hydroxybenzotriazole ( hobt ) and o - benzotriazole - n , n , n ′, n ′- tetramethyl - uronium - hexafluoro - phosphate ( hbtu ) were obtained from multisyntech . rink - amide resin and hobt / hbtu coupling were used . standard manufacturers amino acid coupling methods were adopted . with exception that the first amino acid was coupled using an initial double coupling procedure . 3 . microwave step ; 35 watt , max t ˜ 40 ° c ., ˜ 40 sec 6 . microwave step , 35 watt , max t ˜ 79 ° c ., ˜ 3 min 11 . microwave step ; ser , asp , gly : 25 watt , max t ˜ 79 ° c ., ˜ 5 min 3 . microwave step ; , 35 watt , max t ˜ 40 ° c ., ˜ 40 sec . 6 . microwave step ; 35 watt , max t ˜ 79 ° c ., ˜ 3 min arg ; 0 watt , max t ˜ 79 ° c ., ˜ 30 min lys ; 25 watt , max t ˜ 79 ° c ., ˜ 5 min arg ; 25 watt , max t ˜ 79 ° c ., ˜ 5 min lys : 25 watt , max t ˜ 79 ° c ., ˜ 5 min the n - terminal kgg - r n was used to couple n - hydroxysuccinimide ( nhs ) activated palmitic acid . nhs - palmitate was prepared according to a literature procedure . 1 : 1 : 1 molar equivalents of palmitic acid ( sigma ), nhs ( sigma ) and n , n ′- dicyclohexylcarbondiimide ( dcc , sigma ) were stirred at 0 ° c . for 1 hr and left overnight at room temperature in thf . the reaction solution was filtered and the product was purified by means of recrystallization in hot methanol . the ir analysis showed for palmitic acid the c - h stretching at 2 , 912 & amp ; 2 , 848 cm − 1 of the alkane , the o — h and — c ═ o stretching at 2 , 500 - 3 , 300 cm − 1 and 1 , 700 cm − 1 of the acid . the nhs - palmitate showed peaks at : alkane , — c — h : 2 , 912 & amp ; 2 , 848 cm − 1 ; ester , — c ═ o : 1 , 821 cm − 1 and — c — o — n : 1 , 071 cm − 1 ; succinimide , sym . c ═ o : 1 , 784 cm − 1 , asym . c ═ o : 1 , 731 cm − 1 and asym . c — n — c : 1 , 212 cm — 1 . after completion of the peptide synthesis a final deprotection step was performed to yield a ‘ free ’ n - terminal amine , leaving the lysine side - group protected . on resin the peptide was reacted with 10 molar equivalents nhs - palmitate in dmf and a small amount of n , n - diisopropylethylamine ( dipea ). the nhs - palmitate was allowed to react for 5 hours . the resin was washed multiple times with dmf and dcm after that microwave cleavage using the microwave solid - phase peptide synthesizer ( cem ) in a tfa / tis / water 95 / 2 . 5 / 2 . 5 was performed according to manufactures instruction as described under example va . after diethyl ether precipitation the peptide conjugate was purified with hplc and lyophilized . hplc purification was performed using water and acetonitrile gradient supplemented with 0 . 1 % tfa . using es + the [ m + h ] + and [ m + h ] 2 + peaks could be found for the fibronectin derivatives using the lyophilized , purified ‘ monopal ’ peptides the coupling of a second nhs - palmitate to the ‘ free ’ amine of the lysine residue was performed . the reaction was conducted in dsmo / dipea in a 10 times molar excess of nhs - palmitate . the reaction was monitored using es + and stopped upon disappearance of the monopal peak , after 4 hours . the crude was washed several times with diethyl ether to remove unreacted nhs - palmitate . the dmso fraction was diluted with milliq and lyophilized . pcl membranes functionalized with two different lipid bilayers were used . the functionalized pcl membranes were obtained according to the process as described in example iva . to test the performance of the lipid bilayers palmitoylated rgd peptides were chosen as a model system for cell adhesion . here , the bilayer was contacted with a high concentration of peptide ( 10 mol %) and the effect of lipids lateral mobility on cell behavior was compared . in the figure the resulting cell size as well as cell area was deduced after two hours of incubation . the cell count decreased upon application of a bare dopc or dspc bilayer . however , upon doping with rgd peptides the cell count increased . when rge control peptides were chosen , cell adhesion was suppressed . moreover , for the gel state lipids ( dspc ) the cell area was significantly higher . immortalized mesenchymal stem cells ( imscs ) were seeded in basal media for two hours at a density of 5 , 000 cells per cm 2 and washed after 30 minutes to remove loosely adherent cells . to study the effect of lateral mobility more in detail imscs were cultured for a period of 1 week in adipogenic media ( to promote the formation of fat cells ) and in osteogenic media ( to promote the formation of bone cells , both fully supplemented . it has been described that fat cell differentiation is promoted on soft surfaces while bone differentiation on stiff supports . it is postulated that mobile ligands ( liquid bslb ) would approximate soft materials while immobile ligands ( gel bslb ) stiff ones . to assess osteogenesis alp was measured and corrected for dna content . moreover , prior to that a proliferation assay allowed us to get insight into the cell densities of the oil o red samples that were used to determine adipogenisis . it can be noted that the liquid state bslb promoted adipogenisis while the gel state bslb promoted osteogenesis .	0
the present invention now is described more fully hereinafter with reference to the accompanying drawings , in which embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . referring now to the drawings , fig1 - 4 illustrate exemplary embodiments of a vehicle energy harvester . the exemplary embodiments can make productive use of the energy that is normally wasted ( in the form of heat ) in reducing the speed of motor vehicles on exit ramps , toll plazas etc ., etc . the vehicle energy harvester can absorb mechanical energy from passing ( or breaking ) vehicles and convert the mechanical energy to electrical energy using , for example , shaft driven generators . other means for converting the mechanical energy to electrical energy also are contemplated . in an exemplary embodiment , the electric power from the generators can be converted , metered , and fed into the commercial power grid . in another exemplary embodiment , each site can be equipped with wireless communications to monitor the status and / or output of the system . the disclosed embodiments can include individual assemblies with integral generators . other generator configurations also are possible , such as separate generators . as shown in fig1 , the vehicle energy harvester unit 10 can be a low - profile surface mounted assembly . the vehicle energy harvester unit 10 can include an entry ramp 12 and an exit ramp 14 . the vehicle energy harvester unit 10 can include a plurality of subunits 16 having a top surface or driving surface 17 . each subunit can include one or more vehicle activated treadles 18 . in an embodiment , each subunit 16 can include a generator unit 20 . in other embodiments , the vehicle energy harvester unit 10 can be set into the road surface . the surface mounted assembly may require minimal installation effort . additionally , the unit count can be scaled to road / breaking needs . in an embodiment , each generator unit 20 can feed a common power summing / conversion unit 22 . a simple cable interconnect conversion 24 can be provided to connect each generator unit 20 to the common power summing / unit 22 . a fail safe configuration can protect the system against individual unit failures . in a disclosed embodiment , the individual absorber units 16 can be connected via cable assemblies 24 . the input power can be summed and applied to a low - loss inverter unit . the power can be converted immediately to a form that is transmittable to the power grid . the output can be metered and applied to the power grid for transmission . with reference to fig2 , an exemplary embodiment of a subunit 16 of a vehicle energy harvester unit 10 can include spring - loaded treadles 18 having a treadles gear 30 engaging a drive gear 32 . the drive gear 32 is coupled to a shaft 34 . in operation , one or more vehicle tires force the spring - loaded treadles 18 down as they roll over the treadles 18 . the treadle gears 30 drive the plurality of drive gears 32 , which rotate the shaft 34 . the shaft 34 winds a torsion spring 36 , thereby absorbing the treadle drive transient . a pawl can lock the shaft 34 as rotation ends . the torsion spring 36 rotates a flywheel 38 , thereby spreading the impulse of the treadle drive over time to extend output to a generator 40 . the flywheel 38 can turn a generator 40 , such as a hydro pump . the generator 40 , in turn , can generate electric power for sale / use / storage . in order to reduce the wear and tear on the treadle assembly , an exemplary embodiment includes a transient absorption means in the form of a torsion spring 36 , as illustrated in fig2 and 4 . in conventional systems , the treadle drive mechanism commonly is attached directly to an electrical generation means . as a result , high speed vehicle impacts with the treadle assembly 18 will cause undue stress on the mechanical components due to the inertia of the electrical generation means ( e . g ., 40 ) connected to it . the exemplary embodiments of the present invention , for example as shown in fig2 and 4 , reduce the mechanical stress ( impulse ) on the mechanical components substantially by storing the treadle drive output in a torsion spring 36 which will release its stored energy to the alternator / generator ( e . g ., 40 ) after the vehicle passes over the treadle 18 . more particularly , the torsion spring 36 can provide advantages of absorbing the impulse imparted by fast - moving vehicles striking the treadles 18 . the torsion spring 36 also can isolate the treadle assembly from mass / inertia of the connected flywheel 38 and alternator / generator ( e . g ., 40 ). the torsion spring 36 further can release stored energy to the electrical charging means ( e . g ., 40 ) with very little loss . as illustrated in fig3 , in another embodiment , a flexible link 42 can provide a low - cost alternative . in this embodiment , the vehicle striking the treadle 18 forces the treadle 18 to rotate about its hinged end point . the inertia of the charging system ( e . g ., 40 ) resists turning of the drive gear 32 . the flexible link 42 can bow ( e . g ., bend or flex ) to absorb impulse then release the energy to the charging system ( e . g ., 40 ). the exemplary embodiments of the invention recognize that a delicate balance must be maintained between the amount of energy absorbed from a vehicle and the resultant disruption to the vehicle and its occupants . thus , the practicality and safety of the system configuration can be improved by absorbing the vehicle &# 39 ; s kinetic energy gradually . in an exemplary embodiment , the system can include a vehicle energy harvester unit 10 with a plurality of treadle subunits 16 having small ( i . e ., less intrusive or disruptive ) portions or components ( e . g ., treadles 18 ) that absorb the vehicles kinetic energy as gently and quietly as possible . as a result of the less disruptive nature of the exemplary system , the actual amount of energy derived from each treadle 18 may be relatively small or reduced compared with more disruptive designs . therefore , the exemplary embodiments of the invention provide further advantages of improving the efficiency with which the system converts the vehicles kinetic energy . exemplary embodiments that can improve the conversion efficiency of the system are discussed below . with reference to fig4 , exemplary embodiments for improving the conversion efficiency of the system will now be described . as exemplarily illustrated in fig4 , an exemplary embodiment of the vehicle energy harvester unit 10 can be equipped with a means for moving or returning the treadle 18 back to the active position , such as a reciprocal spring arrangement 44 or assembly . the embodiments recognize that at least a portion of the energy stored in the means ( e . g ., 44 ) for moving the treadle 18 back to the active position can be used to continue the generate power , thereby improving the conversion efficiency of the system . one of ordinary skill in the art will recognize that the reciprocating spring assembly 44 or arrangement is not limited to the embodiment illustrated in fig4 , and that other arrangements can be provided for performing the desired function of moving the treadle 18 back to the active position can be provided . for example , the reciprocating spring 44 can include one or more springs , such as a compression spring , an extension spring , or a torsion spring , among others , as well as other devices that are capable of storing a portion of the energy imparted by the movement of the treadle or moving the treadle 18 back to the active position , such as a lever arm , a cantilever , a pulley system , etc . in operation of the exemplary embodiment of fig4 , the weight of an oncoming vehicle ( s ) forces the treadle 18 downward . in response to the downward movement of the treadles 18 , one or more drive gears 32 rotate the shaft 34 in a first direction , as indicted by the arrows in fig4 . the ratchet gear 42 a can rotate freely during the downward motion of the treadle 18 . as shown in fig4 , one or more springs ( e . g ., reciprocating springs 44 a ) can be mounted in opposition to the movement of the treadle 18 . when the treadle 18 is actuated by the weight of a passing vehicle , one or more of the springs 44 a are compressed . after the vehicle passes over the treadle 18 , the treadle 18 is released from under the weight of the vehicle and the compressed reciprocal springs 44 a operate to push the treadle 18 back to the ready position . as explained above , the compression of one or more of the springs 44 a results in a portion of the energy absorbed from the vehicle being stored in the springs 44 a . thus , the conversion efficiency of the system can be improved by using at least a portion of this stored energy in the reciprocating springs 44 a to continue to apply rotational force to the shaft 34 . various systems can be implemented to convert a portion of the energy stored in the reciprocating springs 44 a into continued or additional rotational movement of the shaft 34 . for example , as illustrated in fig4 , during the movement of the treadle 18 back to the ready or active position , one or more ratchet gears 42 a can engage in the upward direction and continue to apply rotational force to the shaft 34 . by using the attached ratcheting gear 42 a assembly , some of the energy stored in the springs 44 a can be used to continue the motion of the permanent magnet alternator ( pma ) 40 and thereby provide a backstroke to improve the overall conversion efficiency . thus , the conversion efficiency of the system can be improved by using at least a portion of the stored energy in one or more of the reciprocating springs 44 a to continue to apply rotational force to the shaft 34 . the present invention has been described herein in terms of several preferred embodiments . however , modifications and additions to these embodiments will become apparent to those of ordinary skill in the art upon a reading of the foregoing description . it is intended that all such modifications and additions comprise a part of the present invention to the extent that they fall within the scope of the several claims appended hereto . like numbers refer to like elements throughout . in the figures , the thickness of certain lines , layers , components , elements or features may be exaggerated for clarity . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . unless otherwise defined , all terms ( including technical and scientific terms ) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . it will be further understood that terms , such as those defined in commonly used dictionaries , should be interpreted as having a meaning that is consistent with their meaning in the context of the specification and relevant art and should not be interpreted in an idealized or overly formal sense unless expressly so defined herein . well - known functions or constructions may not be described in detail for brevity and / or clarity . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . as used herein , the term “ and / or ” includes any and all combinations of one or more of the associated listed items . as used herein , phrases such as “ between x and y ” and “ between about x and y ” should be interpreted to include x and y . as used herein , phrases such as “ between about x and y ” mean “ between about x and about y .” as used herein , phrases such as “ from about x to y ” mean “ from about x to about y .” it will be understood that when an element is referred to as being “ on ”, “ attached ” to , “ connected ” to , “ coupled ” with , “ contacting ”, etc ., another element , it can be directly on , attached to , connected to , coupled with or contacting the other element or intervening elements may also be present . in contrast , when an element is referred to as being , for example , “ directly on ”, “ directly attached ” to , “ directly connected ” to , “ directly coupled ” with or “ directly contacting ” another element , there are no intervening elements present . it will also be appreciated by those of skill in the art that references to a structure or feature that is disposed “ adjacent ” another feature may have portions that overlap or underlie the adjacent feature . spatially relative terms , such as “ under ”, “ below ”, “ lower ”, “ over ”, “ upper ”, “ lateral ”, “ left ”, “ right ” and the like , may be used herein for ease of description to describe one element or feature &# 39 ; s relationship to another element ( s ) or feature ( s ) as illustrated in the figures . it will be understood that the spatially relative terms are intended to encompass different orientations of the device in use or operation in addition to the orientation depicted in the figures . for example , if the device in the figures is inverted , elements described as “ under ” or “ beneath ” other elements or features would then be oriented “ over ” the other elements or features . the device may be otherwise oriented ( rotated 90 degrees or at other orientations ) and the descriptors of relative spatial relationships used herein interpreted accordingly .	7
fig1 a and 1b depict exemplary systems 100 for deriving and analyzing periodic information in a vibration signal . in the embodiment of fig1 a , a sensor 104 , such as an accelerometer , is attached to a machine 102 to monitor its vibration . although an accelerometer is depicted in the exemplary embodiment of fig1 a , it should be appreciated that other types of sensors could be used , such as a velocity sensor , a displacement probe , an ultrasonic sensor , or a pressure sensor . the sensor 104 generates a vibration signal ( or other type of signal for a sensor other than an accelerometer ) that contains periodic information . for repeatable and best results , it is preferable to place each sensor 104 such that there is a solid path of transition from the signal source ( e . g . a bearing ) to the mounting location of the sensor . the mounting of the sensor 104 should also be performed to ensure that the signal is sensed with as minimal distortion as possible . preferred embodiments include one or more tachometers 116 for measuring the rotational speed of one or more rotating components of the machine 102 . the vibration and tachometer signals are provided to a data collector 106 preferably comprising an analog - to - digital converter ( adc ) 108 for sampling the vibration and tachometer signals , an optional low - pass anti - aliasing filter 110 ( or other combination of low - pass and high - pass filters ), and buffer memory 112 . for example , the data collector 106 may be a digital data recorder , a handheld vibration data collector , or a permanently or temporarily mounted monitoring device . the vibration signal data is communicated to a periodic information processor 114 that performs the information processing tasks described herein . in the embodiment of fig1 a , the periodic information processor 114 is a component of the data collector 106 . in this embodiment , the periodic information processor 114 communicates processed data via a machine data network 122 , which may be a hart ™ or wirelesshart ™ network , an ethernet network , or the internet . an analyst computer 120 receives the processed data via the network 122 for display on a display device 118 . in an alternative embodiment depicted in fig1 b , the periodic information processor 114 is a component of the analyst computer 120 . this embodiment may be preferable for situations in which data transmission and storage are not a major concern , so that the entire data set can be transferred via the network 122 to the analyst computer 120 or other remote processing device for post - processing using the same algorithms and techniques . with regard to sensor placement for bearing and gear diagnosis , the sensor 104 is typically mounted orthogonal to the shaft . it is preferably mounted on a rigid and massive piece of metal that is near the source of the signal ( i . e . bearing or gear ). the large mass of metal on which the sensor is mounted helps prevent resonances entering the signal due to the surface of the machine as opposed to what is happening internal to the machine . the sensor 104 should be mounted so as to minimize loss of signal integrity during transmission . this requires a rigid connection — typically by stud mounting the sensor 104 . in some circumstances , such as where the mounting surface of the machine is rough or covered with many layers of paint , the surface will need to be sanded . fig2 depicts a flowchart of a method for calculating a periodic signal parameter ( psp ) according to a preferred embodiment of the invention . a time - domain vibration waveform is measured , such as using the accelerometer 104 or other sensor attached to the machine 102 being monitored ( step 12 ). an autocorrelation function is performed on the vibration waveform to determine how much of the energy in the waveform is periodic ( step 14 ). in a preferred embodiment , the autocorrelation function cross - correlates the vibration signal with itself to find repeating patterns within the waveform . the autocorrelation function outputs an autocorrelation waveform 16 , examples of which are depicted in fig3 - 7 . several statistical characteristics of the autocorrelation waveform are calculated , including the standard deviation ( σ ), the maximum absolute peak amplitude in the waveform ( maxpeak ), the maximum absolute peak after the first 3 % of the waveform ( maxpeak ( after first 3 %)), and the crest factor ( cf 1 ) ( step 18 ). the positive waveform peaks are sorted out ( step 32 ), any of those peaks that are statistically too large are discarded ( step 34 ), and the mean amplitude ( sorted μ ) and the crest factor ( cf 2 ) of the remaining peaks are calculated ( step 35 ). methods for sorting and discarding peaks that are statistically too large are described hereinafter . if maxpeak is greater than or equal to 0 . 3 ( step 20 ) and if maxpeak is greater than or equal to 0 . 3 ( step 20 ) and if maxpeak is less than 0 . 3 ( step 20 ) and cf 1 less than 4 and σ is less than or equal to 0 . 1 ( step 26 ), then z = 0 . 025 ( step 28 ). if maxpeak is less than 0 . 3 ( step 20 ) and cf 1 is not less than 4 or σ is greater than 0 . 1 ( step 26 ), then z = 0 ( step 30 ). if cf 2 is greater than or equal to 4 and the number of discarded peaks is greater than 2 ( step 36 ), then w = 0 . 025 ( step 38 ). if cf 2 is less than 4 or the number of discarded peaks is not greater than 2 ( step 36 ), then w = 0 ( step 40 ). ( step 42 ) and σ is between 0 . 1 and 0 . 9 ( step 44 ), then x = 0 . 1 ( step 46 ). if ( step 42 ) or σ is not between 0 . 1 and 0 . 9 ( step 44 ), then x = σ ( step 48 ). the psp is the sum of the values of x , w , y and z ( step 50 ). in general , smaller psp values are indicative of more non - periodic signals and less distinctive frequencies , while larger psp values are symptomatic of more periodic signals relating to large single frequencies . as shown in fig3 , psp values of less than a first threshold , such as 0 . 1 , indicate that the vibration waveform is mostly non - periodic . as shown in fig4 , the algorithm for the psp assigns a value of 0 . 1 to signals having low amplitude , higher frequency data . this data may also prove to be bad data . as shown in fig5 , psp values between first and second thresholds , such as between about 0 . 10 and 0 . 14 , indicate that distinct frequencies are present but there is still a significant amount of non - periodic content . as shown in fig6 , psp values greater than the second threshold , such as greater than about 0 . 14 , indicate very distinctive frequencies that are important to analysis , such as vane pass or ball pass frequencies , along with small amplitude signals indicative of lower frequencies , such as rpm or cage along with their harmonics . as shown in fig7 , psp values greater than a third threshold , such as greater than 0 . 5 and above , indicate large dominant single frequencies in the spectrum taken from the vibration waveform . the closer the psp value is to 1 . 0 , the waveform has more periodic signal components and less non - periodic content . the psp provides a single number indicative of the periodic content in a waveform . statistical values are calculated from the autocorrelated waveform and one or more of these values are combined to produce the psp . indication of bad data or non - periodic signals is provided . information about periodicity can be extracted from a large data set and broadcast via a small bandwidth protocol such as hart ®, wirelesshart ®, and other similar protocols . the psp value may be applied specifically to peakvue ™ data in order to distinguish between periodic and non - periodic faults , such as lubrication , cavitation , bearing , gear and rotor faults . the psp value can be used in conjunction with other information to generate an indication of machine condition ( i . e . nature of mechanical fault , severity of the fault ). the other information may include : the original waveform ; processed versions of the waveform ; information obtained from the original vibration waveform ( i . e . peak value , crest factor , kurtosis , skewness ); information obtained from a processed version of the original waveform ( i . e . peakvue ™ processed , rectified , or demodulated waveform ); and / or one or more rule sets . an example is illustrated in table 2 below , where derived values representing psp output and stress wave analysis output ( for example , maximum peak in the peakvue ™ waveform or another derivative of peakvue ™ type analysis or another form of stress wave analysis ) are used to distinguish between different types of faults . in the majority of cases , the severity of the defect increases as the level of peakvue ™ impacting increases . although the example below refers to a stress wave value , other embodiments may use other vibration waveform information indicative of an impacting or other fault condition . a further embodiment of the present invention employs a programmable central processing unit , such as the processor 114 , programmed with program logic to assist a user with an interpretation of waveform information . the program logic compares the periodic signal parameter and stress wave analysis information with expected or historical or empirically - derived experiential values to discern a relative ranking from low to high . then discrete or graduated outputs , such as those portrayed in table 2 above , are employed to select logically arrayed observations , findings , and recommendations . in addition to evaluating psp and stress wave analysis information , program logic sometimes prompts a user to supply additional information or obtains additional information from another source such as from a knowledge base , to enable the logic to distinguish between two or more possible logical results . for example , program logic that returns a high psp and a high stress wave analysis finding may select a rolling element defect finding rather than other possible findings within that category because a similarity is calculated when program logic compares a periodic frequency finding and a bearing fault frequency for a machine component identified in a knowledge base . another technique to differentiate between lubrication and pump cavitation is to look at the trend of the impacting as indicated by stress wave analysis . if it increases slowly , then insufficient lubrication should be suspected . if it increases suddenly on a pump , then it is likely pump cavitation . if combined with logic or inputs on a control system , then the logic could look for process configuration changes that occurred at the same time as the increase in impacting — along with a low psp — to confirm pump cavitation . in some embodiments , the system suggests to the operator what action caused the cavitation , so that the operator can remove the cause and stop the machine from wearing excessively and failing prematurely . a preferred embodiment of the invention creates a new type of vibration spectrum , referred to herein as a periodic information plot ( pip ). the pip provides the user an easily viewed summary of the predominate periodic peaks from the originating spectrum , which would be a peakvue spectrum in a preferred embodiment . in a first embodiment , a signal is collected from plant equipment ( e . g . rotating or reciprocating equipment ) and is processed using two different sets of analysis techniques as depicted in fig8 . first , a waveform is acquired ( step 60 of fig8 ), such as a vibration waveform acquired using the system depicted in fig1 a . if employing a high - pass filter and peak - hold decimation to an oversampled waveform to capture impacting information ( such as using the peakvue ™ process ), this may be a calculated waveform . an fft of the waveform is taken ( step 62 ), resulting in a vibration spectrum ( vs ) 64 with frequency on the x - axis and amplitude on the y - axis , an example of which is shown in fig9 . the waveform from step 60 is also autocorrelated ( step 66 ) to generate a waveform referred to herein as the autocorrelation waveform 68 , having time on the x - axis and the correlation factor on the y - axis . the autocorrelation process accentuates periodic components of the original waveform , while diminishing the presence of random events in the original signal . as a result of the autocorrelation calculations , the autocorrelation waveform 68 has half the x - axis ( time ) values as that of the original vibration waveform 60 . therefore , the timespan of the autocorrelation waveform 68 will be half of that of the original vibration waveform 60 . an optional step ( 70 ) takes the square root of the autocorrelation waveform ( y - axis values ) to provide better differentiation between lower amplitude values . an fft of the autocorrelation waveform 68 is taken ( step 72 ), resulting in an autocorrelation spectrum ( as ) 74 . since random events have largely been removed from the autocorrelation waveform 68 , the remaining signal in the autocorrelation spectrum 74 is strongly related to periodic events . as shown in fig1 , the autocorrelation spectrum 74 has frequency on the x - axis and amplitude related to the correlation factor on the y - axis . because the autocorrelation waveform &# 39 ; s duration is half that of the vibration waveform 60 , the associated autocorrelation spectrum 74 has half the lines of resolution compared to the vibration spectrum 64 . in the first embodiment , the vibration spectrum 64 and the autocorrelation spectrum 74 are processed to derive a graph referred to herein as the periodic information plot ( pip ) ( step 76 ). several methods for processing the vibration spectrum 64 and the autocorrelation spectrum 74 may be used according to the first embodiment , three of which are described below . because the vibration spectrum is twice the resolution of the autocorrelation spectrum , a point - to - point comparison for values on the x - axis ( frequency ) between the two spectra is not possible . however , a point - to - point comparison can be made by mathematically combining the amplitude values of two x - axis values in the vibration spectrum ( step 65 ) for each associated x - axis value in the autocorrelation spectrum . each x as ( n ) value of the autocorrelation spectrum ( where n = 1 . . . n , and n is the number of lines of resolution for the autocorrelation spectrum ) is mapped to the x vs ( 2n ) value on the vibration spectrum . the mathematically combined x - axis value is defined such that x mcvs ( n )= x vs ( 2n ). the mathematically combined amplitude values y vs ( 2n ) and y vs ( 2n − 1 ) ( herein termed y mcvs ( n )) associated with the x mcvs ( n ) value from the vibration spectrum are calculated from the amplitudes of both the x vs ( 2n ) and x vs ( 2n − 1 ) frequencies from the x - axis . the calculation for deriving the mathematically combined amplitude value associated with the x mcvs ( n ) value from the vibration spectrum is : y mcvs ( n )=√{ square root over (( y vs ( 2n − 1 )) 2 +( y vs ( 2n )) 2 )}, 0 where n = 1 . . . n and n is the number of lines of resolution found in the autocorrelation spectrum . in a first method ( step 76 a ), for each x - value in the pip ( x pip1 ), the y - value in the pip ( y pip1 ) is determined by multiplying the mathematically combined y - value in the vibration spectrum ( y mcvs ) by the corresponding y - value in the autocorrelation spectrum ( y as ), according to : for n = 1 to n , where n is the number of x - values ( frequency values ) in the autocorrelation spectrum . since amplitudes of periodic signals in the autocorrelation spectrum are higher than the amplitudes of random signals , the multiplication process will accentuate the periodic peaks while decreasing non - periodic peaks . an example of a pip formed by the first method is depicted in fig1 . in all of the examples depicted herein , n = 1600 . in a second method ( step 76 b ), for each x - value in the pip ( x pip2 ), the y - value in the pip ( y pip2 ) is determined by comparing the corresponding y - value in the autocorrelation spectrum ( y as ) to a predetermined threshold value ( y thr ). for each autocorrelation spectrum amplitude greater than this threshold value , the associated amplitude for pip ( y pip2 ( n )) will be set to the corresponding mathematically combined value from the vibration spectrum ( y mcvs ( n )). y as values above the predetermined threshold indicate data that is largely periodic . thus , the y pip2 values are determined according to : if y as ( n )& gt ; y thr , y pip2 ( n )= y mcvs ( n ) 2 a if y as ( n )≦ y thr , y pip2 ( n )= 0 ( or some other default level ) 2 b in one preferred embodiment of the second method , y thr is set to only include a percentage of the largest peaks from the autocorrelation spectrum . the percentage may be calculated based on the percent periodic signal in the autocorrelation waveform . the percent periodic signal is calculated based on the autocorrelation coefficient , which is the square root of the y - value of the largest peak in the autocorrelation waveform . for this method , only the percent periodic signal of the total number of autocorrelation spectrum peaks will be evaluated . an example of a pip formed by this method , with y thr set to 59 %, is depicted in fig1 . in another preferred embodiment of the second method , y thr is set to include only peaks with values that are within the “ percent periodic signal ” of the largest peak value in the autocorrelation spectrum . these peaks , along with their harmonics that appear in the autocorrelation spectrum , will be utilized as the group of peaks to be intersected with those in the vibration spectrum to form the pip . an example of a pip formed by this method , with y thr set to 59 %, is depicted in fig1 . in a third method ( step 76 c ), the pip is determined according to the first method described above , and then the threshold of the second method is applied to the pip according to : if y pip1 ( n )& gt ; y thr , y pip3 ( n )= y pip1 ( n ) 3 a if y pip1 ( n )≦ y thr , y pip3 ( n )= 0 ( or some other default level ) 3 b for n = 1 to n . an example of a pip formed by this method is depicted in fig1 . some embodiments also derive a non - periodic information plot ( npip ) that consists of only the y - values of the autocorrelation spectrum that are less than a predetermined threshold ( step 78 ). thus , the npip includes only non - periodic components . an example of an npip formed by this method is depicted in fig1 . some embodiments also derive a periodicity map from the vibration spectrum and the autocorrelation spectrum ( step 82 ). the periodicity map is created by pairing the mathematically combined y - values from the vibration spectrum and the autocorrelation spectrum corresponding to any given x - value of the autocorrelation spectrum . these pairs are plotted with the mathematically combined y - value from the vibration spectrum y mcvs ( n ) as the x - value of the point on the map x pm ( n ), and the y - value from the autocorrelation spectrum y vs ( n ) as the corresponding y - value on the map y pm ( n ), according to : for n = 1 to n . as shown in fig1 , the resulting graph resembles a probability mapping . a specific software implementation would allow the user to run a cursor over each point to view the values creating that point . some embodiments also derive a circular information plot from any of the periodic information plots described above ( step 80 ). once a linear pip is calculated , an inverse fft can be applied to generate an “ information waveform .” a circular information plot can then be generated from this information waveform . an example of a circular information plot formed by this method is depicted in fig1 . although preferred embodiments of the invention operate on vibration signals , the invention is not limited to only vibration signals . periodic signal parameters and periodic information plots may be derived from any signal containing periodic components . in a second embodiment , a signal is collected from plant equipment ( i . e . rotating or reciprocating equipment ) and is processed using the method 300 depicted in fig2 . first , a waveform is generated ( step 302 of fig2 ), such as a vibration waveform acquired using the system depicted in fig1 a . if employing a high - pass filter and peak - hold decimation to an oversampled waveform to capture impacting information ( such as using the peakvue ™ process ), this may be a calculated waveform . an fft of the vibration waveform is taken ( step 304 ), resulting in a vibration spectrum 306 with frequency on the x - axis and amplitude on the y - axis , an example of which is shown in fig9 . the vibration spectrum 306 is also referred to herein as the original spectrum to differentiate from the autocorrelation spectrum discussed hereinafter . the waveform from step 302 is autocorrelated ( step 314 ) to generate an autocorrelation waveform 316 , having time on the x - axis and the correlation factor on the y - axis . an fft of the autocorrelation waveform 316 is calculated using the same fmax as was used in the calculation of the fff of the original waveform ( step 318 ), resulting in an autocorrelation spectrum 320 . using the same fmax forces the lines of resolution ( lor ) of the autocorrelation spectrum 320 to be half of the lor used in calculating the original spectrum 306 . since random events have largely been removed from the autocorrelation waveform 316 , the remaining signal in the autocorrelation spectrum 320 is strongly related to periodic events . as shown in fig1 , the autocorrelation spectrum has frequency on the x - axis and amplitude related to the correlation factor on the y - axis . because the autocorrelation waveform &# 39 ; s duration is half that of the original waveform , the associated autocorrelation spectrum has half the lines of resolution compared to the original spectrum . percent periodic energy (% periodic energy ) is the percentage of energy in the original spectrum 306 that is related to periodic signals . it is calculated at step 322 based on the autocorrelation waveform 316 according to : % periodic energy =√{ square root over ( maxpeak ( after 3 % of autocorrelation waveform ))} in a preferred embodiment , the total energy of the original spectrum 306 is calculated as the square root of the sum of the squares of each bin value in the original spectrum 306 ranging from zero to fmax . for purposes of finding bearing and / or gear teeth faults , the original spectrum 306 is the peakvue spectrum . the percent energy of the original spectrum 306 is calculated at step 308 according to : a list of peaks from the original spectrum 306 is generated , wherein each listed peak is a located peak having a located frequency and an associated located amplitude ( step 310 ). a list of peaks from the autocorrelation spectrum 320 is also generated , wherein each listed peak is a located peak having a located frequency and an associated located amplitude ( step 324 ). in both lists , the peaks are arranged in order of descending amplitude , such that the peak having the largest amplitude is first in the list and the peak having the smallest amplitude is last ( steps 312 and 326 ). for the frequency value of each peak in the peak list generated for the autocorrelation spectrum , an associated matching peak is found in the peak list generated for the original spectrum ( step 328 ). for a peak to “ match ,” the frequency value of the peak from the original spectrum 306 must be within n × δfrequency of the frequency value of the peak from the autocorrelation spectrum 320 , where in a preferred embodiment n = 4 and δfrequency is expressed as : for each matching peak from the original spectrum 306 found in step 328 , the values of the located frequency and located amplitude is added to a pip peak list ( step 330 ). as each matching peak is added to the pip peak list , a running total peak energy value of all peaks in the pip peak list is calculated ( step 332 ). because a hanning window is used in the fft calculation for this embodiment , the energy of a located peak is the result of energy from three bin values used in the creation of the located peak . for each total peak energy ≦% energy of original , discard the associated peak in step 330 from the autocorrelation spectrum peak list before returning to step 328 ( step 335 ). this process of matching peaks and adding matched peaks to the pip peak list continues until the periodic information plot ( pip ) is created by plotting the three points associated with each peak in the pip peak list ( step 336 ). in the preferred embodiment , the three points correspond to three bins associated with each located peak , assuming a hanning window is used for fft calculations . examples of pip &# 39 ; s created using the method 300 of fig2 are depicted in fig2 and 23 - 26 . periodic peaks in a spectrum are classified as either synchronous or non - synchronous peaks . synchronous peaks are peaks that occur at the running speed of a shaft and its harmonic frequencies . for a gearbox having multiple shafts , there are also multiple families of synchronous peaks , wherein each family is associated with the speed of a particular shaft in the gearbox . in addition to running speed peaks , synchronous peaks associated with a gearbox also occur at all hunting tooth fundamental frequencies and their harmonics . non - synchronous peaks are periodic families of harmonic peaks that are not members of a synchronous family . a family of non - synchronous , periodic peaks is most likely related to a bearing defect . because there may be many families of peaks related to either synchronous or non - synchronous peaks , a preferred embodiment provides a display color scheme to separate the different families of peaks . by color coding the different families in a spectrum , it is easy to distinguish between frequencies related to bearings ( non - synchronous ) and those related to running speed . in a gearbox , analysis of these running speed harmonic families ( synchronous ) can lead to the discovery of gear teeth problems . using colors to designate the different families of peaks in a spectrum display or in the periodic information plot simplifies the analysis for both the novice and experienced analyst . fig2 depicts an exemplary display indicating the presence of a broken tooth on a two - stage gearbox . the presence of synchronous and non - synchronous periodic peaks is notable in the periodic information plot ( pip ) 130 . as indicated in the key provided in fig2 , synchronous families of peaks include the running speed fundamental and / or harmonics of “ shaft 1 ” highlighted in white ( represented by large solid lines ), “ shaft 2 ” highlighted in red ( represented by long dash lines ), and “ shaft 3 ” highlighted in green ( represented by dotted lines ). other synchronous families of peaks include hunting tooth fundamental frequencies and their harmonics “ htf 1 ” highlighted in blue ( represented by dash - dot - dash - dot lines ) and “ htf 2 ” highlighted in yellow ( represented by dash - dot - dot lines ). non - synchronous families of peaks are highlighted in purple ( represented by thin solid lines —). it should be noted that the peaks shown in red ( long dash lines ) make up the overwhelming number of synchronous family of peaks , all related to the second shaft in the gearbox . in this example , the bull gear on the second shaft has a missing tooth . methods for sorting and discarding statistically outlying peaks in the autocorrelation waveform ( step 34 in fig2 ) the following routine takes an array of data values , such as values of positive peaks in the autocorrelation waveform , and discards values outside the statistically calculated boundaries . in a preferred embodiment , there are four methods or criteria for setting the boundaries . consider an array of p values ( or elements ) where p 0 represents the number of values in the present array under evaluation . now let p − 1 represent the number of values in the array evaluated a single step before p 0 , let p − 2 represent the number of values in the array evaluated a single step before p − 1 , and let p − 3 represent the number of values in the array evaluated a single step before p − 2 . while evaluating the array of values for either the first time or p 0 ≠ p − 1 , calculate the mean ( μ ) and standard deviation ( σ ) for p 0 if   n   σ μ ≥ x , where   x = 0 , 1   and   n = 1 , 2   or   3   in   the   preferred   embodiment , then calculate the mean ( μ ) and standard deviation ( σ ) for p 0 if   n   σ 2  μ ≥ x , where   x = 0 , 1   and   n = 1 , 2   or   3   in   the   preferred   embodiment , then if p 0 = p − 1 = p − 2 , and p − 2 ≠ p − 3 , then calculate the mean ( μ ) and standard deviation ( σ ) for p include array values such that if p 0 = p − 1 = p − 2 , and p − 2 ≠ p − 3 , then calculate the mean ( μ ) and standard deviation ( σ ) for p 0 method 2 : non - conservative , using maximum statistical boundary only ( no minimum boundary ) use the same procedure as in method 1 except only values exceeding the upper statistical boundaries are discarded . the minimum boundary is set to zero . method 4 : conservative , using maximum statistical boundary only ( no minimum boundary ) discard values based on method 1 , step 1 only and based on values exceeding the upper statistical boundaries . the minimum boundary is set to zero . as an example of the sorting method 1 , consider an original set of values , p 0 , containing the twenty - one values listed below in table 3 below , with n = 1 . next , define the set p − 1 = p 0 and define a new set p 0 , the values of which are all the values of p − 1 that are between the values μ + σ = 0 . 689343 and μ − σ = 0 . 409735 . the set p 0 now contains the values listed below in table 4 , wherein three outlier values have been eliminated . now define the set p − 2 = p − 1 , and p − 1 = p 0 and define a new set p 0 , the values of which are all the values of p − 1 that are between the values μ + σ = 0 . 571797 and μ − σ = 0 . 432887 . the set p 0 now contains the values listed below in table 5 , wherein four more outlier values have been eliminated . if at any point in the calculations p 0 = p − 1 and p − 1 ≠ p − 2 , then step 2 would be executed instead of step 1 . in the example above , since p 0 ≠ p − 1 for every iteration , only step 1 was necessary for the calculations . fig2 depicts steps in a preferred embodiment of a method 400 for generating bearing fault condition information . a time - domain oversampled vibration waveform is measured ( step 402 ), such as using the accelerometer 104 or other sensor attached to the machine 102 being monitored . a peakvue ™ waveform is then generated ( step 404 ), such as by high - pass filtering and peak - hold decimating the oversampled waveform . the maximum peak amplitude ( maxpeak ) of the peakvue ™ waveform is determined ( step 406 ), and its associated autocorrelation waveform is calculated ( step 408 ). based on the autocorrelation waveform , the periodic signal parameter ( psp ) is calculated according to the method depicted in fig2 ( step 410 ). in a preferred embodiment , alert amplitude limit levels ( in g &# 39 ; s ) are determined based on the nominal turning speed according to the relationship depicted in fig2 ( step 412 ). fault amplitude limit levels are preferably two times the alert levels . fig2 provides a graphical representation of one method for determining alert limits for a peakvue signal based on the rpm of the machine shaft . the alert level would be compared to the peak value occurring in the peakvue waveform and applies for a developing inner race fault . it will be appreciated that the alert limit levels depicted in fig2 are suggestions only , and the analyst may decide to use values that have been determined to be optimal for their machine . in some situations , the analyst may start out using the values from fig2 , and then adjust them based on experience . before calculations of severity values can be made , percent periodic energy must be calculated . percent periodic energy ( step 414 ) is calculated from the autocorrelation waveform according to : wherein the maximum peak in the autocorrelation waveform does not include the first 3 % of the waveform . generally , the percent periodic energy calculation is not as accurate for values less than 50 %. accordingly , as indicated in fig1 , the slope of the function for values less than 50 % is greater than 1 . 0 . therefore , the percent periodicity is not determined for values less than 50 %. a general severity value is necessary for all severity estimates , which is calculated according to : in a preferred embodiment , the severity value is normalized by multiplying the result of step 416 by a desired maximum gauge value x according to : for the gauges shown in fig1 , where x = 10 , if the psp is greater than 0 . 1 ( step 419 ), a bearing fault is possibly present . bearing fault severity ( bfs ) may be calculated according to : if the resulting answer is greater than x ( 10 in this example ), then the answer is truncated to be x . in some embodiments , knowledge of the turning speed improves confidence that the periodicity is related to bearing faults and not turning speed incidences . when the turning speed is known , periodic peaks from the periodic information plot ( pip ) can be classified as synchronous and non - synchronous . if only synchronous peaks are present , no bearing fault is indicated . if significant non - synchronous peaks are present , a possible bearing issue is confirmed , as indicated by : if psp ≦ 0 . 1 and maxpeak is & lt ; alert level , no fault is indicated by the measurement , meaning the asset is in good condition . if psp is less than or equal to 0 . 1 and maxpeak is greater than the alert amplitude limit level ( step 420 ), a deficiency in bearing lubrication is indicated . in addition , there may be lubrication issues when a bearing fault is present . ( this is shown in fig2 with an arrow going from between steps 419 and 430 to step 422 .) the severity of the lubrication problem is generally dependent upon the maxpeak value of the originating waveform ( step 406 ) and the percent non - periodic energy (% npe ) indicated from the associated autocorrelation waveform ( step 408 ). as shown in fig1 , percent non - periodic energy (% npe ) is a function of percent periodic energy and can be determined using the plot of fig1 ( step 422 ). percent periodic energy (% periodic energy ) is defined as the percentage of energy in the peakvue ( original ) spectrum that is related to periodic signals . % npe is defined as the percentage of energy in the peakvue ( original ) spectrum that is related to random vibration signals . where x is the normalization value ( step 426 ). for the lubrication severity gauge shown in fig1 , x = 10 . if the resulting value is greater than x ( 10 in this example ), then the value is truncated to be x . in an alternative embodiment , instead of determining whether psp is greater than 0 . 1 in step 114 , it is determined whether % periodic energy is greater than y , where in most cases y is 50 %. while the preferred embodiment of the algorithm described above and depicted in fig2 uses a peakvue waveform , the algorithm could be applied to any waveform generated from any type of signal , such as vibration , current , ultrasonic , etc . following are four examples that demonstrate use of the algorithm of fig2 to determine the status of a bearing under different conditions . fig2 depicts the results for a new , fully - lubricated bearing with no faults . as shown , the gauges for bearing fault severity and lubrication severity both indicate a value of zero because the bearing is new and in good condition . fig2 depicts the results for a bearing with no faults other than it is running “ dry ” because there is insufficient lubrication present in the bearing . as shown , the bearing fault severity is still zero but the lubrication severity is about 6 . 5 . in this example , the % periodic energy is 44 . 3 %. the resulting % npe based on fig1 is 77 . 85 %. it should be noted that the psp is 0 . 0618 . fig2 depicts the results for a bearing with a small inner race fault and no lubrication problems . as shown , the bearing fault severity is slightly elevated to about 1 . 4 , but the lubrication severity is close to zero . in this example , the % periodic energy is 88 . 8 %. based on fig1 , the resulting % npe is 11 . 2 %. it should be noted that the psp is 0 . 213 for this example . fig2 depicts the results for a bearing with a small inner race fault as well as a lubrication problem due to the fact that the bearing is running “ dry .” even though psp is 0 . 074 , % periodic energy is 51 %. therefore , the signal has some periodicity . as shown , the bearing fault severity is almost 3 , while the lubrication severity is around 3 . 25 . those skilled in the art will appreciate that this diagnostic result is an advancement in technology , and could not be determined by other available algorithms . the ability to isolate the lower amplitude non - synchronous signals caused by the mechanical damage to the bearing from the non - periodic energy generated by lack of lubrication , which is significantly higher in amplitude , has not previously been available . fig2 depicts steps in a preferred embodiment of a method 200 for generating gearbox fault condition information . a time - domain oversampled vibration waveform is measured , such as using the accelerometer 104 or other sensor attached to the machine 102 being monitored ( step 202 ). a peakvue ™ waveform is then generated , such as by high - pass filtering and peak - hold decimating the oversampled waveform ( step 204 ). the maximum peak amplitude ( maxpeak ) of the peakvue ™ waveform is determined ( step 206 ), and its associated autocorrelation waveform is calculated ( step 208 ). based on the autocorrelation waveform , the periodic signal parameter ( psp ) is calculated according to the method depicted in fig2 ( step 210 ). the rotational speed of at least one of the shafts in the gearbox is measured , such as using a tachometer ( step 212 ), and the speed of each of the other shafts in the gearbox is calculated based on the speed measured in step 212 and knowledge of the gear ratios for the other shafts ( step 214 ). in addition , based on shaft running speeds , hunting tooth frequencies are calculated based on techniques known to those of ordinary skill in the art . in a preferred embodiment , alert amplitude limit levels ( in g &# 39 ; s ) are determined based on the nominal turning speed according to the relationship depicted in fig2 , or based on the analyst &# 39 ; s experience , or both , as discussed above ( step 216 ). fault amplitude limit levels are preferably two times the alert levels . before calculations of specific severity values can be made , percent periodic energy must be calculated . in a preferred embodiment , percent periodic energy is calculated from the autocorrelation waveform according to : wherein the maxpeak of the autocorrelation waveform does not include the first 3 % of the waveform ( step 218 ). generally , the percent periodic energy calculation is not as accurate for values less than 50 %. accordingly , as indicated in fig1 , the slope of the function for values less than 50 % is greater than 1 . 0 . in order to calculate severity values for different faults , a general severity value is determined . general severity may be calculated according to : the severity value is normalized by multiplying the result of step 220 by a desired maximum gauge value x according to : for the gauge shown in fig1 , where x = 10 , the pip is generated using the procedure described herein with reference to fig2 ( step 224 ). if the psp is greater than 0 . 1 ( step 225 ), periodic frequencies related to the gearbox and / or bearings are present . based on knowledge of the turning speed , periodic peaks from the periodic information plot ( pip ) can be classified as synchronous and non - synchronous . if non - synchronous peaks are present in the pip ( step 226 ), a bearing fault severity ( bfs ) value may be calculated ( step 228 ) and displayed ( step 234 ) according to : if synchronous peaks are present ( step 230 ) and fault limits are exceeded , gear teeth degradation is indicated . a gearbox fault severity ( gfs ) value may be calculated ( step 232 ) and displayed ( step 234 ) according to : if the resulting answer is greater than x ( 10 in this example ), then the answer is truncated to be x . if psp ≦ 0 . 1 and max peak is & lt ; alert level , no fault is indicated by the measurement , meaning the asset is in good condition . if psp is less than or equal to 0 . 1 and maxpeak is greater than the alert amplitude limit level ( step 234 ), a deficiency in bearing and / or gearbox lubrication is indicated . in addition , there may be lubrication issues along with mechanical faults present . ( this is shown in fig2 by an arrow going from between steps 225 and 226 to step 236 ). the severity of the lubrication problem is generally dependent upon the maxpeak value of the originating waveform ( step 206 ) and the percent non - periodic energy (% npe ) indicated from the associated autocorrelation waveform ( step 208 ). as discussed above , percent non - periodic energy (% npe ) is a function of percent periodic energy and can be determined using the plot of fig1 ( step 236 ). percent periodic energy (% periodic energy ) is defined as the percentage of energy in the peakvue ( original ) spectrum that is related to periodic signals . percent non - periodic energy is defined as the percentage of energy in the peakvue ( original ) spectrum that is related to random vibration signals . the bearing or gearbox lubrication severity value is determined and displayed according to : where x is the normalization value ( steps 240 and 242 ). for the lubrication severity gauge shown in fig1 , x = 10 . if the resulting value is greater than x ( 10 in this example ), then the value is truncated to be x . in an alternative embodiment , instead of determining whether psp is greater than 0 . 1 in step 218 , it is determined whether % periodic energy is greater than y , where in most cases y is 50 %. the foregoing description of preferred embodiments for this invention has been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise form disclosed . obvious modifications or variations are possible in light of the above teachings . the embodiments are chosen and described in an effort to provide the best illustrations of the principles of the invention and its practical application , and to thereby enable one of ordinary skill in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . all such modifications and variations are within the scope of the invention as determined by the appended claims when interpreted in accordance with the breadth to which they are fairly , legally , and equitably entitled .	6
in the following examples , nss - tag is proved to be feasible to be applied to monitor recombinant protein expressed by zucchini yellow mosaic virus vector . nss - tag is useful for western blotting or enzyme - linked absorption assay ( elisa ) to detect recombinant protein . when nss - tagged zymv hc - pro and wsmov np are transiently expressed by agroinfiltration in tobacco , they are readily detectable and the tag &# 39 ; s possible efficacy for gene silencing suppression is not noticed . co - immunoprecipitation of nss - tagged and non - tagged proteins expressed confirms the interaction of potyviral hc - pro and coat protein . thus , the present invention provides a novel nss - tag system for tagging recombinant protein in both bacterial and plant expression systems . determination and applicability of the minimal sequence of nsscon in prokaryotic protein expression system in the present example , the nsscon sequence was used for tagging gfp expressed by pet28b vector . the feasibility of nsscon sequence as an epitope tag was tested , and the minimal length of the nsscon sequence recognizable by the nsscon monoclonal antibody ( mab ) ( chen et al ., 2006 , phytopathology 96 , 1296 - 1304 ) was determined in the bacterial expression system . all the primers used in this example were listed in table 1 . the green fluorescent protein ( gfp ) open reading frame ( orf ) containing the nsscon sequence ( gfpnsscon ), bamhi , kpni and xhoi sites at its c - extreme was constructed by three successive pcr ( 35 cycles : 30 s denaturation at 94 ° c . ; 30 s annealing at 55 ° c . ; 2 min synthesis at 72 ° c . ; followed by a 10 min final extension at 72 ° c .) using the forward primer p - cacc - gfp coupled with three reverse primers , m - nsscong1 - bk , m - nsscong2 and mnsscon . the gfpnsscon was introduced into pet28b ( novagen , darmstadt , germany ) via ncoi and xhoi restriction sites to generate pet28 - gfpnsscon - his . table 1 primer for construction of pet28 - gfpnsscon - his restriction primer name sequence / seq id no . enzyme * p - cacc - gfp 5 ′- ca ccatgg tgagcaagggcgaggagct - 3 ′ ncoi ( seq id no . 2 ) m - nsscong1bk 5 ′- gttcttcacacctggtttcctta c ggtac bamhi and cggatcc cttgtacagctcgtccatgccg - 3 ′ kpni ( seq id no . 3 ) m - nsscong2 5 ′- ttgattgtgcattgtgaacttgcagcct gtgttcttcacacctggtttc - 3 ′ ( seq id no . 4 ) m - nsscon 5 ′- ggtg ctcgag atttggattaaagatttg xhoi attgtgcattgtgaa - 3 ′ ( seq id no . 5 ) * restriction site is underlined . the stop codon is in bold . the progressively deleted nsscon , either from its n - or c terminus , were constructed by pcr from pet28 - gfpnsscon - his . the primers with added kpn1 , nco1 or xhoi sites for cloning purpose were listed in table 2 . individual constructs of gfp fused with different n - terminal deletions ( 2 - 12 a . a removed ) of nsscon were separately cloned into pet28 - gfpnsscon - his via kpni and xmai sites ( fig1 a and fig1 b ); similarly , those with different c - terminal deletions of nsscon ( 2 - 6 a . a removed ) were separately cloned into pet28 - gfpnsscon - his via ncoi i and xhoi sites ( fig1 a and fig1 b ). the gfp fused with the deletion form nsscon 11 a . a deleted from its n - terminal and 3 a . a from c - terminal ends ( dn11c3 ) was constructed by pcr from the pet28 - gfp - dn11 using primers p - cacc - gfp and m - nsscon - d3 , and then introduced into pet28 - gfpnsscon - his by ncoi and xhoi digestion ( fig1 a and fig1 b ). all the resulted recombinant plasmids were verified by sequencing . the nsscon sequence ( 23 a . a ; residues 98 - 120 of nss protein ) ( seq id no . 56 ) was used for tagging gfp expressed by the pet28b vector in bacteria ( fig1 a and fig1 b ). the gfp - nsscon containing both the nsscon sequence and his - tag ® was readily detected by western blotting using nsscon mab or gfp antiserum ( fig1 b ). gfp tagged with different n - terminal deletions of nsscon ( fig1 b ) were expressed and monitored by western blotting using nsscon mab . the nsscon mab readily recognized the deletion forms of nsscon with up to 11 a . a removed from the n - terminal end , but failed to recognize the 12 a . a - deleted nsscon ( fig1 b ). our results established that the amino acid residues upstream of k109 of nsscon are dispensable for recognition by the mab , whereas residue k109 is indispensable . the mab also recognized the nsscon sequences having 2 , 3 and 4 residues deleted from the c - terminal end , but failed to recognize the peptide when 5 or 6 residues were removed ( fig1 b ). these results indicated that residue f117 at the c - terminal region of nsscon is important for mab recognition , as the reactivity was greatly diminished upon its deletion . thus , the nine amino acid stretch “ 109kftmhnqif117 ” ( seq id no : 1 ) of the nsscon ( fig1 b ) is the minimal length for its recognition by the nsscon mab ; this minimal peptide was designated as “ nss ” asia tospoviral common epitope . serial constructs were generated on a modified petsa vector to express nsscon -, nss - or his - tagged gfp to compare the detectability of different tags ( fig1 c ). the recombinant gfps carrying the different tags , either at the n or c - terminus , were monitored by western blotting using nsscon mab , his - tag ® mab ( invitrogen , carlsbad , usa ) or gfp antiserum . expression of the recombinant gfps was verified by gfp antiserum and quantified relatively to the untagged gfp . the expression level of gfp tagged with either the whole nsscon or the minimal nss at the n - extreme was higher than that for untagged gfp ( fig1 c ). however , expression levels were lower when either of these tags was individually fused at the c - terminus of gfp ; this was especially noticed for the gfp - nsscon fusion ( fig1 c ). importantly , the expression levels of nsscon - or nss - tagged gfp were comparable to those of his - tagged gfp , indicating that both nsscon and nss can efficiently tag gfp for its expression in the bacterial system . also , the reaction strength appeared to be similar for nsscon and nss , regardless of their fusion at the n - or c - terminus of gfp . application of the nss - tag in the bacterial and plant viral expression system in the present example , construct for recombinant protein with nss - tag was constructed and introduced into a bacterial and plant expression system . a . construction of recombinant proteins tagged with nsscon , nss or poly - histidine for expression in prokaryotic or eukaryotic expression system constructs for recombinant proteins tagged with nsscon , nss or poly - histidine for expression in prokaryotic or eukaryotic expression system were prepared by the step as described as follows . for using sphi and apai restriction sites of primers as cloning sites , pet28b was converted into pet28dsa by abolishing the sphi and apai sites of the former by site - directed mutagenesis using the quikchange ™ xl site - directed mutagenesis kit ( stratagene , ca , usa ). as shown in fig1 c , the petsa - gfp - his carrying gfp orf with stop codon and petsa - gfp carrying gfp orf without stop codon were constructed by pcr amplification of gfp sequence from pet28 - gfpnsscon - his using the primer pairs , p - gfp - nsa / m - gfp - bkx and p - gfp - nsa / m - gfp - tga , respectively , and cloned into the mutated pet28dsa . primers were listed in table 3 . in order to compare the efficiencies of different tags , gfp was individually tagged with nsscon , nss - tag and his - tag ® and the sequences were cloned in bacterial expression vector pet28dsa . the gfp orf fused with nsscon sequence and stop codon at c terminal end was amplified by pcr using the primers p - gfp - nsa and m - nsscontga , and cloned into petsa - gfp - his via ncoi and xhoi sites to form petsa - gfp - nsscon ( fig1 c ). the vector petsa - nsscon - gfp ( fig1 c ) carrying gfp orf with nsscon sequence at its n - extreme was constructed from pet28 - gfpnsscon - his by three successive pcrs using three forward primers , p - nsscon1 , p - nsscon2 and p - nsscon , coupled with the reverse primer m - gfptga - x . the amplified fragment was cloned into petsa - gfp via ncoi and xhoi sites . petsa - gfp - nss ( fig1 c ) carrying gfp orf with nss sequence and a stop codon at its c - extreme was constructed petsa - gfp by a modified site - directed mutagenesis pcr ( stratagene , ca , usa ) using the primers p - cnss and m - cnss . the petsa - nss - gfp or petsa - his - gfp carrying gfp with the nss sequence or his - tag ® at the n - extreme was constructed following the design for petsa - gfp - nss , using primer pairs p - nnss / m - nnss and p - nhis / m - nhis , respectively . for tagging other proteins with nss - tag , the orfs of the nia protease of papaya ringspot virus w type ( wnpro ) ( chen et al ., 2008 , molecular plant - microbe interactions 21 , 1046 - 1057 ), the helper component - protease ( hc - pro ) of zucchini yellow mosaic virus ( zhc ) ( lin et al ., 2007 , phytopathology 97 , 287 - 296 ), a chimeric house dust mite allergen , which combined partial dp2 ( 384 b . p ) and dp5 ( 342 b . p ) orfs ( dp25 ) ( seq id no . 57 ), and the nucleocapsid protein of watermelon silver mottle virus ( wnp ) ( chen et al ., 2005 , journal of virologuical methods 129 , 113 - 124 ) were amplified from respective constructs using specific primer pairs ( table 4 ). these amplified fragments were individually introduced into the petsa vector via suitable restriction sites ( fig1 c ). since the above manipulation , which introduced an inadvertent stretch of nucleotide encoding the hc - pro cleavable amino acid stretch yrvg / g , led to unintended post - translational removal of the tags from hc - pro , petsa - zhc - nss or petsa - zhc - his were modified by site - directed mutagenesis pcr using the primer pair p - nss - d6 / m - zhcd6 or p - his - d6 / m - zhcd6 to generate petsa - zhcd6 - nss or pet - zhcd6 - his . from the zymv vector p35zgfphis , which expresses c terminally his - tagged gfp in cucurbit plants ( hsu et al ., 2004 ), p35zgfpnss was generated by site - directed mutagenesis pcr using the primer pair p - zgn / m - zgn . to express n - terminally his - tagged gfp , p35znssgfp was generated from p35zgfphis by two successive site - directed mutagenesis with the primer pairs p - zng / m - zng that added the nss sequence at the n - extreme of gfp and pzdhis / m - zdhis that deleted the his - tag from p35zgfphis . primers were listed in table 5 ). the gfp orfs in p35znssgfp and pzgfpnss were replaced by the orfs of wsmov np ( chen et al ., 2005 ) via sphi / kpni sites or the chimeric dp25 orf via apai / bamhi sites to generate p35znsswnp , p35zwnpnss , p35znssdp25 and p35zdp25nss , respectively . in order to monitor the transient expression of nss - tagged recombinant proteins by agroinfiltration , the sequences of zymv hc - pro , wsmov np and gfp with the nss - tag ( either at n - or c - extreme ) or without tag were released from petsa vector and cloned into the binary pba vector ( niu et al ., 2006 , nature biotechnology 24 , 1420 - 1428 ) via ncoi / xhoi sites to generate the pba - nss - zhc , pba - zhc - nss , pba - zhc , pbanss - wnp , pba - wnp - nss , pba - wnp or pba - gfp . b . protein expression and detection by western blotting or indirect elisa in the present example , protein expression and detection were conducted by western blotting or indirect elisa by the steps as described as follows . the plasmids for protein expression were transferred into e . coli bl21 cells ( novagen , darmstadt , germany ); protein expression was performed as described in the manual of pet system ( novagen , darmstadt , germany ). the plasmids of zymv vector were introduced into the systemic host zucchini squash ( cucurbita pepo l . var . zucchi ) by particle bombardment ( hsu et al ., 2004 ). bacterial protein and zymv - infected tissue samples prepared following standard method were separated on a 12 % polyacrylamide gel containing sodium dodecyl sulfate . the resolved protein profiles were electro - blotted onto a nitrocellulose membrane using a bio - rad ® trans - blot ® apparatus ( trans - blot transfer medium , bio - rad , hercules , calif .) and the expressed proteins were separately detected using the nsscon monoclonal antibody ( mab ) ( 10 , 000 × dilution ) ( chen et al ., 2006 ), gfp antiserum ( 5000 × dilution ) ( hsu et al ., 2004 ), prsv nia - pro antiserum ( prepared against bacteria - expressed nia - pro in our laboratory , unpublished ) ( 5000 × dilution ), zymv hc - pro antiserum ( wu et al ., 2010 , molecular plant - microbe interactions 23 , 17 - 28 ) ( 5000 × dilution ), dp5 antiserum ( hsu et al ., 2004 ) ( 5000 × dilution ) or wsmov np mab ( lin et al ., 2005 , phytopathology 95 , 1482 - 1488 ) ( 10 , 000 × dilution ), following standard procedure . the zymv - expressed recombinant proteins were also monitored similarly using the same antisera . the signals were quantified relatively to the untagged proteins by kodak ® 1d image analysis software ( eastman kodak , rochester , n . y .). the feasibility of nss - tagged proteins for detection by indirect enzyme - linked immunosorbent assay ( elisa ) was examined . the elisa analysis of nss - tagged gfp and wsmov np expressed in bacterial and zymv viral vector systems were done with the nsscon mab ( chen et al ., 2006 ), gfp antiserum ( hsu et al ., 2004 ) wsmov np mab ( lin et al ., 2005 , phytopathology 95 , 1482 - 1488 ), as described earlier by yeh and gonsalves ( yeh and gonsalves , 1984 , phytopathology 74 , 1273 - 1278 ). in the present example , the results demonstrated that the four test proteins fused were detected by the nsscon mab , except for the hc - pro - nss fusion ( fig2 a ). this isolated failure was understood to be because of an hc - pro cleavage site ( yrvg / g ) inadvertently introduced during the construction , which allowed an autocatalytic cleavage by hc - pro ( carrington et al ., 1989 ) that removed the tag following translation . restoration of detection of nss - tag was accomplished by deletion of the cleavage site from the c - terminal region of hc - pro ( fig2 a , zhcd6nss ); however , the his - tag ® was still not detected ( fig3 b , zhcd6his ). expression levels of all recombinant proteins were similar , as shown by western blot assays using the individual antibodies against each protein ( fig2 a ). wnpro and wnp with his - tag ® at their n - termini and zhc - pro with his - tag ® at its c - terminus were not detected , while his - tagged dp25 at its n - terminus was barely detected . when an equal amount of 5 μg purified igg was used for comparison , the nss - tagged gpfs were detected at 256 × antigen dilution by nsscon mab , comparable to the detection sensitivity of the protein by gfp antiserum but superior to the detectablility of the his - tag ® mab which only detected his - tagged gfp up to 32 × dilution ( data not shown ). these results indicated that the nss - tag has greater detection sensitivity for recombinant proteins than the his - tag ®. the above results demonstrate that all the recombinant viruses were infectious and the nss - tagged recombinant proteins were detected by nsscon mab by western blotting from squash plants ( fig2 b and 3b ). the nss - tagged gfp and wnp expressed by bacterial or zymv vector system were also readily detected by elisa using nsscon mab . overall , the results indicate that the recombinant proteins tagged with the nss sequence can be readily detected by the nsscon mab , regardless of the nss - tagged terminus and that the nss sequence is suitable to be used as an epitope tag in both bacterial and plant viral vector expression systems . since the nss sequence is derived from the common epitope of the tospoviral ptgs suppressor , nss protein ( takeda et al ., 2002 , febs letters 532 , 75 - 79 ), in the present example examined was the possibility for nss - tag &# 39 ; s functional interference with the tagged zymv hc - pro , a gene silencing suppressor , and wsmov np , a non - gene silencing suppressor . the nss - tagged and non - tagged zymv hc - pro and wsmov np were separately constructed in a binary vector and expressed in leaves of n . benthamiana by agroinfiltration . in order to monitor the transient expression of nss - tagged recombinant proteins in plants by agroinfiltration , the sequences of zymv hc - pro , wsmov np and gfp fused with the nss sequence ( either at n - or c - extreme ) or without tag were released from petsa vector and cloned into the binary pba vector ( niu et al ., 2006 , nature biotechnology 24 , 1420 - 1428 ) via ncoi / xhoi sites to generate the pba - nss - zhc , pba - zhc - nss , pbazhc , pba - nss - wnp , pba - wnp - nss , pba - wnp or pba - gfp . these binary vectors were introduced into agrobacterium tumefaciens abi strain by eletroporation and cultured in luria - bertani medium ( lb ) with kanamycin and spectinomycin at 28 . 0 overnight . the cells were pelleted down and resuspended to an od600 of 1 . 0 in 10 mm mgcl 2 containing 0 . 015 mm acentonsyrigone and kept in room temperature for 3 hours . suspensions of a . tumefaciens abi carrying pbagfp ( a gfp expressor , driven constitutively by a 35 s promoter ), pbagfi ( a ⅔ gfp orf construct with inverted repeat and used as a silencing inducer , provided by dr shih - shun lin , national taiwan university , taiwan ) were mixed with individual constructed vectors ( ratio 1 : 1 : 1 ) and then injected into the lower side of leaves nicotiana benthamiana domin plants of 10 cm height stage by a syringe without needle and the plants were kept at 25 ° c . the empty vector pba ( niu et al ., 2006 ) was used as a negative control . the transiently expressed recombinant proteins at 3 dpi were monitored by chemiluminescent western blotting ( amersham , bucks , u . k .) using zymv hc - pro antiserum ( wu et al ., 2010 , molecular plant - microbe interactions 23 , 17 - 28 ), wsmov np mab ( lin et al ., 2005 , phytopathology 95 , 1482 - 1488 ) or nsscon mab ( chen et al ., 2006 ) as the primary antibody and horseradish peroxidase - conjugated goat anti - rabbit immunoglobulin ( amersham , bucks , u . k .) or horseradish peroxidase - conjugated goat anti - mouse immunoglobulin ( amersham , bucks , u . k .) as the secondary antibody . the gfp fluorescence was monitored at 3 dpi by a hand - held uv light b - 100ap ( uvp , ca , usa ) and photographed with a digital camera ( d7000 ™, nikon , japan ) with a cokin ™ p series filter ( cokin , 84 mm , 524 nm , french ). the above results demonstrated that at 3 dpi , recombinant zymv hc - pro tagged with the nss sequence , either at the n - or c - terminus , was readily detected by hc - pro antiserum and nsscon mab ( fig4 a ). the nss - tagged forms of wsmov np were expressed to similar levels , based on their detection by the np mab and nsscon mab ( fig4 a ). at 3 dpi , gfp expression was completely silenced when coinfiltrated with the gfi silencing inducer ( fig4 b ). in contrast , fluorescent signals of gfp were similar if coinfiltrated with the gfi construct with either the nss - tagged or non - tagged hc - pro ( fig4 b ). however , gfp expression was not restored if coinfiltrated with the gfi construct with the nss - tagged or non - tagged np ( fig4 b ). the results indicated that nss - tag renders the tagged transiently expressed recombinant proteins immunodetectable and the tag neither interferes with the suppressor activity of zymv hc - pro , nor confers the function of gene silencing suppression on wsmov np . the interaction of potyviral coat protein ( cp ) and hc - pro is essential for the aphid transmission of potyviruses ( atreya and pirone , 1993 proceedings of the national academy of sciences of the united states of america 90 , 11919 - 11923 ; granier et al ., 1993 , journal of general virology 74 , 2737 - 2742 ). in order to test if the nss sequence can be used for co - immunoprecipition analysis of interacting proteins , in the present example , either the bacteria - expressed nss - tagged zymv cp or nss - tagged hc - pro was treated with the other non - tagged interacting protein and the complex was immunoprecipitated using nsscon mab . zymv cp with or without nss - tag was first cloned into the petsa vector ( fig1 c ) by pcr with primers p - zcp and m - zcp ( table 4 ). e . coli bl21 cells were transformed with the individual plasmids carrying zymv cp ( petsa - nss - zcp , petsa - zcp - nss or petsa - zcp ). zymv hc - pro sequences with or without the nss - tag ( petsa - nss - zhc , petsa - zhcd6 - nss or petsa - zhc ) were also used for this example . following induced expression of recombinant proteins , e . coli cells were pelleted and resuspended in 1 ml extraction buffer ( 50 mm tris - hcl , 150 mm nacl , 0 . 5 % triton x - 100 , 5 % glycerol , 1 mm edta and 0 . 02 % nan 3 ) containing protease inhibitor cocktail ( roche diagnostics , in , usa ), lysed with a sonicator 250 - 450 sonifier analog cell disruptor ( branson , conn ., usa ) and then centrifuged at 13 , 000 rpm for 5 minutes . the presence of recombinant proteins in soluble fractions was confirmed with the antiserum against zymv cp ( hsu et al ., 2004 , journal of allergy and clinical immunololgy 113 , 1079 - 1085 ) or hc - pro ( wu et al ., 2010 , molecular plant - microbe interactions 23 , 17 - 28 ). aliquots of each 300 μl sample containing nss - tagged hc - pro or nss - tagged cp were mixed with each 100 μl sample containing non - tagged cp or non tagged hc - pro ( i . e ., nsszhc + zcp ; zhcnss + zcp or nsszcp + zhc ; zcpnss + zhc ) and incubated at 4 ° c . for 1 hour . purified igg of nsscon mab ( 100 μg , described above ) was added to each reaction mixture and incubated at 4 ° c . for 1 hour . then 25 μl mag protein a sepharose ™ ( ge healthcare life sciences , uppsala , sweden ) was added and the mixture was incubated further for 1 hour . the tubes were kept on a magnetic platform ( magrack6 ) to capture the mag protein a sepharose ™ beads . after washing with 600 μl extraction buffer two times , the beads were resuspended in 100 μl sample buffer and the immunoprecipitated proteins were analyzed by western blotting using the antiserum against zymv hc - pro or cp to detect the non - tagged protein pulled down by nsscon mab through co - immunoprecipitation with the nss - tagged proteins . according to the above results , the non - tagged hcpro was co - immunoprecipitated with the nss - tagged cps ( either nsszcp or zcpnss ) by nsscon mab and was able to be detected by hc - pro antiserum ( fig5 a ). similarly , the non - tagged cp was co - immunoprecipitated with nss - tagged hc - pros ( fig5 b ). taken together , the results demonstrated the co - immunoprecipitation of non - tagged hc - pro / cp with nss - tagged cp / hc - pro , implying that the nss - tag is applicable for co - immunoprecipitation analyses for protein - protein interactions . even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and features of the invention , the disclosure is illustrative only . changes may be made in the details , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .	2
referring now to the drawings , wherein like reference characters represent like elements , there is shown a preferred embodiment of a topical hyperbaric apparatus 2 in accordance with the present invention . as is conventional , hyperbaric apparatus 2 is to be applied to the patient &# 39 ; s body for the treatment of various wounds and lesions . the hyperbaric apparatus 2 according to the present invention administers therapeutic gases to wound sites by creating a sealed internal chamber 4 which encapsulates such wound sites . when thus encapsulated , therapeutic gases are introduced , and the healing of such wounds is aided . fig1 illustrates a cross - sectional perspective view of the instant invention . hyperbaric chamber apparatus 2 is here cut along line 1 -- 1 of fig2 . internal chamber 4 may be seen as residing in the middle of a shell 10 having an opening 5 disposed on one end . gas introduction means 6 is seen passing through shell 10 and terminating at port 7 . pressure relief means 8 also passes through shell 10 and terminates at port 9 . ports 7 and 9 are sealably affixed to gas impermeable liner 12 . adhesive sealing means 30 is disposed about opening 5 . belting means 20 may be provided as well , as best viewed in fig4 . therein , hook affixing means 24 and loop fastening means 26 are also seen . fastening means 26 is superimposed over the entire length of belt 20 . affixing means 24 is disposed only at one end . the internal chamber 4 is sealed on top end 11 by gas impermeable liner 12 . gas impermeable liner 12 lines the inside of chamber 4 and , as stated , seals top end 11 of said chamber . this is best seen in fig1 where gas impermeable liner 12 and shell 10 are cut along line 1 -- 1 . referring now to fig2 shell 10 as configured , is of a doughnut shape , with non - permeable liner 12 creating a cuplike structure or sealed chamber 14 within shell 10 . the only passageways to such sealed chamber 14 are therapeutic gas introduction means 6 , pressure relief means 8 , and opening 5 . shell 10 is comprised of a base 18 and a short protuberance 19 at the bottom end 16 . circumscribing and disposed on the edge of short protuberance 19 is adhesive sealing means 30 . adhesive sealing means 30 , in conjunction with sealed chamber 14 , when applied to the patient &# 39 ; s body 1 , creates an encapsulated area except for the passageways represented by ports 7 and 9 , which are adapted to receive therapeutic gas introduction means 6 , and pressure relief means 8 , respectively . in use , therapeutic gas introduction means 6 is sealed by attachment to therapeutic gas source 40 and pressure relief means 8 is sealed by attachment to pressure release apparatus 50 . in a preferred embodiment of the present invention , shell 10 , in conjunction with gas impermeable liner 12 and adhesive sealing material 30 , is affixed to the patient &# 39 ; s body so as to encapsulate within sealed chamber 14 a treatable lesion . therapeutic gas source 40 is connected to this sealed chamber by therapeutic gas introduction means 6 and port 7 . therapeutic gases are then introduced within sealed chamber 14 by port 7 . such therapeutic gases pressurize sealed chamber 14 and ultimately pass by way of port 9 through pressure relief means 8 to pressure relief apparatus 50 . belt 20 is correspondingly wrapped around the patient &# 39 ; s body 1 so as to reinforce and secure the sealed chamber 14 to the patient &# 39 ; s body . as thus configured , the patient 1 need only ensure that therapeutic gas source 40 is introducing the therapeutic gases within the proper parameters by viewing control means 42 . at that point , pressure relief apparatus 50 will ensure that the optimal conditions are maintained within the chamber itself . in this embodiment , pressure relief apparatus 50 is a static pressure relief valve . the atmosphere within sealed chamber 14 may also be moisturized by humidification means 44 . fig5 and 6 illustrate the preferred method of application of the present invention . hyperbaric chamber apparatus 2 is here affixed to the lower back in the region of the upper buttock , specifically in the region of the division between buttocks . in this figure , the hyperbaric chamber apparatus 2 is secured to the patient 1 by means of belt 20 . belt 20 is depicted as translucent , therefore , internal chamber 4 may be viewed within shell 10 . therapeutic gas introduction means 6 is attached to therapeutic gas source 40 , humidification means 44 , and control means 42 . pressure relief means 8 is here connected to pressure relief apparatus 50 . in fig6 protuberance 19 is seen as conforming with an irregularly shaped portion of the patient &# 39 ; s body 1 . in this embodiment , shell 10 is preferably comprised of a polyurethane foam 32 and is conformable to the shape of the surface to which it is applied . polyurethane foam 32 is characterized by a 1 . 4 - pound density , a 34 - pound indent load defamation , and is also fire retardant . gas impermeable liner 12 may be any flexible and gas impermeable material , such material being well known , such as the occlusive poly film material manufactured by the 3m corporation under the trademark blend derm . adhesive sealing means 30 is most preferably a hydrofluid material capable of repeated use and rejuvenation . such adhesive means 30 , for proper use , must also be hypoallergenic . such characteristics are present in the adhesive material karaya , a naturally occurring polymer resin . as thus embodied , the present invention introduces an improved method of sealing which produces a hermetic seal . this improved method of sealing also produces numerous beneficial end results , such as portability , hermetic sealing in a portable device , the ability to treat previously untreatable wound sights , lower cost , and disposability . the present invention , by creating a less complicated sealing means and hyperbaric apparatus , is extremely portable . the instant invention weighs in a preferred embodiment , less than 2 pounds , is small in size , and is easily transported . also , because of its low pressure and volume requirements , the present invention allows for the use of the smaller and more portable e size oxygen cylinders . the prior hyperbaric chamber devices , such as lo piano , and lasley , required the much larger h and k size cylinders . this is a significant advance . in addition , the present invention obviates the need for trained personnel for its application . this portability will also facilitate uses heretofore unavailable , such as uses in less accessible locations by people who would not usually have such apparatus available and will allow for patients receiving such treatment to have more normal lives and broader range of travel . not only will the present invention provide a portable hyperbaric chamber , as a result of adhesive sealing means 30 and the flexibility of shell 10 , it also provides a portable hyperbaric chamber with the desired hermetic seal . this hermetic seal has many advantages . it allows for absolute control of the chamber &# 39 ; s environment . leaks which previously made control of the various parameters nearly impossible , will be greatly reduced . this hermetic seal will allow for the optimum conditions to be maintained within the chamber . the flow of the oxygen , the pressure of the oxygen , and the various other stimuli that are introduced within the chamber will be easily regulatable . also as a result of adhesive sealing material 30 and shell 10 , the present invention also facilitates the treatment of wound sights previously untreatable in the absence of relatively sophisticated and cumbersome devices . for instance , lesions in the area of the buttock or bony protrusions of the hip are now treatable . this is particularly significant , because quite often treatable lesions occur in such areas . this device , with respect to such awkwardly placed lesions , will rival the effectiveness of more cumbersome and sophisticated machines . another dramatic result of the present invention is its lower manufacturing cost . the introduction of polyurethane foam 32 and adhesive sealing material 30 to the hyperbaric chamber environment facilitates the manufacture of a particularly useful device for a relatively low price . this will decrease end user cost and conversely increase end user use . as previously stated , this will enable many patients , who in the past were unable to afford such treatment , to now receive the proper therapy . the lower manufacturing costs of the present device will produce wide ranging changes in the use of hyperbaric chambers . hyperbaric chambers will become more widely available . for instance , a local drugstore which could not possibly afford to carry the previous embodiments of hyperbaric chambers , will be able to carry the present invention . further , remote locations which may only store items which ( 1 ) are absolutely necessary , or ( 2 ) are affordable enough to keep one on hand just in case , will be able to stock the present invention . the instant invention will also lead to wider use of hyperbaric chambers for the treatment of appropriate wounds . the &# 34 ; reluctant patient &# 34 ; will be much more likely to utilize a device which is low in cost and simple to use . the instant device , because of its low cost and ease of application as a result of adhesive sealing material 30 , is particularly conducive to home treatment . the instant device &# 39 ; s ease of application further reduces cost by not requiring application by a trained technician . such ease of use will also facilitate wider use by allowing those physically incapable of applying the previous embodiments of portable hyperbaric chambers to apply the present invention by themselves . the present invention will also allow for hyperbaric chamber treatments to be applied in area where it was previously inefficient and cost ineffective to do so . for instance , the treatment of minor wounds , such as burns , which would clearly heal over time and not require sophisticated treatment such as hyperbaric chamber treatment , will now be able to be healed faster by exposure to the hyperbaric atmosphere using the instant invention . previously , such a course of treatment would have been cost ineffective and only available to those able to afford the finest of treatment . the present invention will allow many more people to receive hyperbaric healing treatments . another benefit which flows from such lower cost , is the ability to create a disposable hyperbaric chamber . this ability and result is significant and dramatic . there has been a significant need for such a disposable hyperbaric chamber in multi - patient health care facilities . in such facilities , there exists a considerable handicap in the use of hyperbaric chambers , namely , between each use , the device necessarily required sterilization . further , there is always the risk of spreading the contagion of an infectious disease . these factors limited the availability of hyperbaric chamber atmosphere treatment . with the relatively large investment required for institutions to purchase such devices , it was prohibitive to purchase enough devices to treat all patients as would optimally be required . this produces a situation in which patients are placed on waiting lists and required to take treatments as the devices become available . the present invention will allow the device to be purchased on a per - patient basis and , at the end of the patient &# 39 ; s use , be disposed of or be taken home . this will allow more patients to obtain this treatment more frequently . for example , according to one study , thirty - eight percent of the patients in nursing homes have bedsores . as these types of devices are used today , those patients are required to wait until such equipment becomes available for their use . because of the prohibitive costs , such patients may only be treated on a daily basis or less , rather than the twice daily optimum treatment schedule . the present device will allow for each patient to purchase their own hyperbaric chamber , which may be disposed of after use or be taken home when the patient is to be discharged . the present invention , as previously mentioned , also simplifies the application and operation of such devices . because the present invention is sealed by non - permeable liner 12 , adhesive sealing material 30 and is secondarily reinforced by a belt 20 , the patient is much more capable than previously possible to apply the instant device him or herself . such ease of use will produce similar benefits to those created by lower cost and , in fact , make such benefits only more likely . although the invention herein has been described with reference to a specific embodiment , it is to be understood that this embodiment is merely illustrative of the principles and applications of the present invention . more specifically , it is to be understood that the embodiment , as represented in the detailed description of the present invention , is that embodiment which the inventor presently believes to be preferred . it is to be understood that numerous modifications may be made to the illustrative embodiment and that other arrangements may be devised from the spirit and scope of the present invention as defined by the appended claims .	0
the following detailed description is of the best presently contemplated modes of carrying out the invention . this description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating general principles of embodiments of the invention . the scope of the invention is best defined by the appended claims . in certain instances , detailed descriptions of well - known devices and mechanisms are omitted so as to not obscure the description of the present invention with unnecessary detail . fig1 - 9 illustrate one embodiment of a trash can assembly 20 according to the present invention . the assembly 20 has an outer shell 22 and an inner liner 24 that is adapted to be retained inside the outer shell 22 . the outer shell 22 is a four - sided shell that has four side walls , including a front wall 42 . it is also possible to provide the outer shell 22 in a generally cylindrical , oval or egg shape . the inner liner 24 can have the same , or different , shape as the outer shell 22 . the lid is made up of two separate lid portions 26 and 28 that are split at about the center of the outer shell 22 , each of which is hingedly connected to an upper support frame 130 ( see fig7 ) along a top side edge of the outer shell 22 in a manner such that the lid portions 26 , 28 pivot away from each other ( see arrows m in fig4 ) when they are opened . the outer shell 22 and its lid portions 26 and 28 can be made of a solid and stable material , such as a metal . the upper support frame 130 can be secured to the opened top of the outer shell 22 , and can be provided in a separate material ( e . g ., plastic ) from the outer shell 22 . each lid portion 26 , 28 has a side edge 30 that has a sleeve 32 extending along the side edge 30 . a shaft ( not shown ) is retained inside the sleeve 32 and has opposing ends that are secured to one side edge of the upper support frame 130 , so that the lid portion 26 , 28 can pivot about an axis defined by the shaft and its corresponding sleeve 32 . an l - shaped bracket 34 is secured at the rear end of each lid portion 26 , 28 . one leg of the bracket 34 is secured to the underside of the lid portion 26 , 28 , and the other leg of the bracket 34 has an opening 40 that is adapted to receive an upper hooked end 36 of a corresponding lifting rod 38 . in addition , a toe - kick recess 44 can be provided on the outer shell 22 adjacent the base 46 of the outer shell 22 , and is adapted to receive a foot pedal 48 that is pivotably secured to a pedal bar 60 in the base 46 . the toe - kick recess 44 can be formed as part of the base 46 , and the outer shell 22 would define a curved cut - out to receive the recess 44 . the curved cut - out in the shell 22 can be made by first cutting out a properly sized and configured hole in the body of the outer shell 22 , and then inserting a plastic curved panel that defines the actual recess 44 . the recess 44 extends into the interior confines of the outer shell 22 ( as defined by the periphery of the outer shell 22 ). the recess 44 also extends upwardly for a short distance from the base 6 . the pedal bar 60 is made of a material ( e . g ., metal ) that carries some weight , and extends from the foot pedal 48 along the base 46 and is then pivotably coupled to the lifting rods 38 that extend upwardly along the rear of the outer shell 22 to connect the lid portions 26 , 28 . the pedal bar 60 and the lifting rods 38 operate to translate an updown pivot motion of the pedal 48 to an up - down pivot motion for the lid portions 26 , 28 . each of these components will be described in greater detail hereinbelow . referring now to fig3 - 6 , the base 46 of the outer shell 22 has a raised or domed base panel 52 and a skirt or flange portion 50 that extends from the base panel 52 . in one embodiment of the present invention , the base panel 52 , the skirt 50 and the recess 44 can be formed in one plastic piece . the pedal bar 60 is retained under the base panel 52 and inside the skirt 50 . the pedal bar 60 has two short side walls 64 . the front of the pedal bar 60 is attached to the pedal 48 , and the rear of the pedal bar has two opposite holes 62 . one of the holes 62 is provided on each of the two opposing side walls 64 , and each hole 62 receives a lower hooked end 66 of a corresponding lifting rod 38 . a fulcrum rod 68 extends through the two side walls 64 of the pedal bar 60 at a location that is closer to the front of the pedal bar 60 than the rear of the pedal bar 60 . thus , the pedal bar 60 can be pivoted about a pivot axis defined by he fulcrum rod 68 . in particular , the pedal bar 60 can be pivoted between two positions , a first rest position as shown in fig2 where the pedal 48 is at a vertically higher position than the rear of the pedal bar 60 , and a second open position ( where the lid portions 26 , 28 are opened ) as shown in fig5 where the pedal 48 is pressed to a vertically lower position than the rear of the pedal bar 60 . thus , the fulcrum rod 68 is positioned at a location that is closer to the front of the pedal bar 60 than the rear of the pedal bar 60 so that the portion of the pedal bar 60 that is rearward of the fulcrum rod 68 would be greater ( and therefore heavier ) than the portion of the pedal bar 60 that is forward of the pedal bar 60 , thereby causing the rear of the pedal bar 60 to be at a vertically lower position than the pedal 48 when in the rest position of fig2 . as shown in fig5 the base panel 52 defines a recessed region 70 with a soft material 72 ( e . g ., a foam sponge ) secured below the recessed region 70 . the recessed region 70 acts as a stop member in that it prevents the rear of the pedal bar 60 from being raised to a vertical level that exceeds the vertical position of the recessed region 70 , as shown in fig5 . the soft material 72 therefore functions as a noise and contact absorber so that there will be minimal noise and wear on the pedal bar 60 when it contacts the recessed region 70 . in many applications , given the dimensions of the base 46 , it will be difficult to first position the pedal bar 60 inside the base 46 and then attempt to fit a lengthy fulcrum rod inside the base 46 and insert the fulcrum rod through the pedal bar 60 . therefore , the present invention provides a novel method for securing the fulcrum rod 68 in its desired position with respect to the base 46 and the pedal bar 60 . first , referring to fig6 the base panel 52 is provided with a column 74 that extends vertically downwardly from the base panel 52 , and the column 74 has a horizontal bore ( not shown ) that opens towards the center of the base 46 . next , the fulcrum rod 68 is extended through opposing and aligned openings in the two side walls 64 so that the two opposing ends 76 , 78 of the fulcrum rod 68 extend beyond the side walls 64 . in the next step , the pedal bar 60 and the fulcrum rod 68 are positioned inside the base panel 52 , with one end 76 of the fulcrum rod 68 positioned inside the bore of the column 74 . the other end 78 of the fulcrum rod 68 has a flat configuration with a hole ( not shown ), so that a screw 80 can be threaded through the hole in the end 78 to secure the fulcrum rod 68 to the base panel 52 . a pair of springs 84 and 86 are provided to normally bias the lid portions 26 , 28 to the closed position shown in fig2 . referring to fig2 - 4 , each spring 84 , 86 has a first end 90 that is secured to the base panel 52 , and a second end 92 that is secured to a bent portion 94 of one of the lifting rods 38 . thus , when the assembly 20 is not experiencing any external forces ( i . e ., it is in the closed position ), the springs 84 , 86 will normally bias the lifting rods 38 in the downward vertical direction , thereby causing the lid portions 26 , 28 to be closed . the springs 84 , 86 also prevent the lower hooked ends 66 from becoming disengaged from the rear of the pedal bar 60 , and takes out any slack in the linkage involving the lifting rods 38 . the assembly 20 provides a motion damper 96 that functions to dampen the closing motion of the lid portions 26 , 28 so that the lid portions 26 , 28 can close slowly and not experience a hard slamming motion . the motion damper 96 is illustrated in greater detail in fig9 and can be embodied in the form of the “ rotary motion damper ” sold by itw delpro of frankfort , ill ., although other known and conventional motion dampers can be utilized without departing from the scope of the present invention . the motion damper 96 has a toothed bar 98 with a row of teeth 100 positioned along a side thereof . one end of the toothed bar 98 has a pair of aligned openings 102 . a platform 104 has a pair of guides 106 that receive the toothed bar 98 . a toothed damping wheel 108 is carried on the platform 104 and is adapted to engage the teeth 100 on the toothed bar 98 as the platform 104 experiences relative movement in both directions ( see arrows a and b ) along the toothed bar 98 . assuming that the damping wheel 108 remains stationary , when the toothed bar 98 moves in the direction b , the damping wheel 108 does not offer any resistance so the toothed bar 98 can move smoothly and quickly in the direction b . however , when the toothed bar 98 moves in the direction a , the damping wheel 108 does offer resistance so the toothed bar 98 can only move very slowly in the direction a . the motion damper 96 is positioned in the interior of the outer shell 22 , and is secured to both the base panel 52 and the pedal bar 60 . in particular , the platform 104 has a connecting element 110 that is secured to a bracket ( not shown ) in the base panel 52 . the bracket can be secured to the base panel 52 by a screw 116 as shown in fig2 . in addition , the end of the toothed bar 98 with the aligned openings 102 extends through an opening in the base panel 52 , and a damping rod 112 secured to the pedal bar 60 extends through the openings 102 ( see fig5 and 6 ) to couple the toothed bar 98 to the pedal bar 60 . thus , the platform 104 of the motion damper 96 is essentially fixed at a stationary position with respect to the base panel 52 , and the toothed bar 98 can be moved up or down ( i . e ., in the directions b or a ) as the rear end of the pedal bar 60 is pivoted up or down by the pedal 48 . the operation of the trash can assembly 20 will now be described . when the assembly 20 is not in use , the lid portions 26 , 28 are normally closed as shown in fig2 . at this position , the springs 84 and 86 are relaxed and do not exert any bias . to open the lid portions 26 , 28 , the user steps on the pedal 48 , which pivots the pedal bar 60 about the fulcrum rod 68 with the pedal 48 moving vertically downward , and the rear end of the pedal bar 60 being pivoted vertically upwardly . the soft material 72 provides a buffer or absorber to minimize any noise that may be caused by the pedal bar 60 contacting the recessed region 70 . as shown in fig3 - 5 and 7 - 8 , the rear end of the pedal bar 60 pushes the lifting rods 38 upwardly , so that the lifting rods 38 will push the lid portions 26 , 28 open about the pivoting of the shafts in the sleeves 32 . the lid portions 26 , 28 will pivot away from each other to expose the top of the of the outer shell 22 . simultaneously , the damping rod 112 will push the toothed bar 98 upwardly ( i . e ., in the direction b in fig9 ). as described above , the damping wheel 108 will not offer any resistance to the movement of the toothed bar 98 , so the entire lifting motion of the rear of the pedal bar 60 and the lifting rods 38 will be smooth and relatively quick . at this opened position , the springs 84 and 86 are stretched and therefore biased . as long as the user maintains his or her step on the pedal 48 , the bias of the springs 84 , 86 is overcome , the rear of the pedal bar 60 will remain in the position shown in fig5 and the lid portions 26 , 28 will remain opened . when the user releases the pedal 48 , the combined weight of the pedal bar 60 ( i . e ., a pulling force ) and the lid portions 26 , 28 ( i . e ., pushing forces ), as well as gravity and the natural bias of the springs 84 , 86 , will cause the lid portions 26 , 28 will pivot downwardly to their closed positions . in other words , the lifting rods 38 , the toothed bar 98 and the pedal bar 60 will all experience a downward motion . in this regard , the fact that the fulcrum rod 68 is positioned closer to the pedal 48 ( i . e ., the front of the pedal bar 60 ) means that the rear of the pedal bar 60 is actually heavier , and will exert a force to aid in pulling the lifting rods 38 down in a vertical direction . however , the damping wheel 108 will resist the downward vertical movement ( i . e ., in the direction of arrow a in fig9 ) of the toothed bar 98 , so the entire downward motion of the rear of the pedal bar 60 and the lifting rods 38 will be slowed . by slowing this downward motion of the pedal bar 60 and the lifting rods 38 , the lid portions 26 , 28 will close slowly , and the pedal bar 60 will be lowered slowly , all to avoid any annoying loud slamming actions or noises . referring now to fig2 and 7 , the upper support frame 130 has a border shoulder 132 that extends along its inner periphery which is adapted to receive the upper lip 140 of the inner liner 24 so that the inner liner 24 can be suspended on the shoulder 132 inside the outer shell 22 during use . the support frame 130 has opposing ends 134 and 136 , with a scalloped groove 138 formed in each end 134 , 136 . the scalloped grooves 138 allow the user to insert his or her fingers into the grooves 138 under the upper lip of the inner liner 24 to lift the inner liner 24 from the interior of the outer shell 24 when the lid portions 26 , 28 are opened . this provides a convenient way for the user to remove the inner liner 24 from the outer shell 22 , without requiring the user to grab or grip unnecessarily large portions of the inner liner 24 . the hinged connection of the lid portions 26 , 28 to the upper support frame 130 shown in fig7 can be modified as shown in fig1 - 14 . in fig7 each lid portion 26 , 28 has a metal shaft that is retained in a sleeve 32 and has opposing ends that are secured to the upper support frame 130 in a manner such that the corresponding lid portion 26 or 28 can pivot about an axis defined by the shaft and the sleeve 32 . the sleeve 32 can be formed by curling part of the edge of the metal lid portion 26 , 28 in a manner that leaves a longitudinal opening along the length of the sleeve 32 between the outermost edge of the sleeve 32 and the lid portion 26 , 28 . this curling is best illustrated in fig1 in connection with the sleeve 32 a . the metal shaft can be retained inside this sleeve 32 . unfortunately , the metal - on - metal contact between the shaft and the sleeve 32 causes wear and tear , and result in the generation of squeaky noises when the shaft pivots inside the sleeve 32 . in addition , after extended use , food , dust and other waste matter may enter the interior of the sleeve 32 via the longitudinal opening , which may impede the pivoting motion of the shaft inside the sleeve 32 . the present invention provides a modified connection in fig1 - 14 that overcomes these drawbacks . the same numeral designations will be used to designate the same elements in fig7 and 10 - 14 , except that an “ a ” will be added to the designations in fig1 - 14 . in the embodiment shown in fig1 - 14 , the metal shaft 200 is retained inside a non - metal ( e . g ., plastic ) tube 202 , which is in turn retained inside the sleeve 32 a , as best shown in fig1 . the tube 202 has a generally cylindrical configuration with a protruding edge 204 extending along the length of the tube 202 . the protruding edge 204 is configured as a somewhat rectangular block that is adapted to fit snugly into the longitudinal opening of the sleeve 32 a , thereby blocking the longitudinal opening and preventing dust and particles from entering the interior of the sleeve 32 a . as best shown in fig1 , the tube 202 does not completely fill up the interior space of the sleeve 32 a . the tube 202 has an interior bore 206 through which two separate shaft pieces 208 can be inserted . both shaft pieces 208 can be identical in construction , with one provided at each of the opposing ends of the tube 202 . the shaft pieces 208 can be made from metal . as best shown in fig1 , each shaft piece 208 has a smaller - diameter inner section 210 and a larger - diameter outer section 212 . the inner section 210 is inserted into the bore 206 at one end of the tube 202 , and the outer section 212 has a larger diameter to ensure that part of the shaft piece 208 remains outside the bore 206 . to assemble the lid portion 26 , 28 , the user or manufacturer first inserts the tube 202 into the sleeve 32 a in a manner such that the protruding edge 204 is snugly fitted into the longitudinal opening of the sleeve 32 a . the sleeve 32 a and its tube 202 are then placed into the appropriate location on the side edge of the upper support frame 130 as shown in fig1 . then , as shown in fig1 , the inner section 210 of each shaft piece 208 is inserted through bores 218 in the upper support frame 130 that are aligned with the bore 206 of the tube 202 when the sleeve 32 a and its tube 202 are positioned in the upper support frame 130 . the inner section 210 will extend through the bore 218 in the upper support frame 130 and then into the bore 206 of the tube 202 . a portion of the outer sections 212 of the shaft pieces 212 will be exposed to the outside of the bore 218 , but most of the outer sections 212 will be positioned inside the bore 218 . with one shaft piece 208 provided at each opposing end of the tube 202 and sleeve 32 a , the lid portions 26 , 28 can pivot about the axis defined by these shaft pieces 208 . a small opening 220 is provided on the protruding edge 204 adjacent each end of the tube 202 . the free end of the inner section 210 of each shaft piece 208 is positioned adjacent this opening 220 . as a result , a user can remove the lid portions 26 , 28 by inserting a sharp - tip object ( e . g ., screw - driver ) through the openings 220 ( see fig1 ) and pushing the inner section 210 of each shaft piece 208 out of the bores 206 and 218 . thus , the provision of the non - metal tube 202 provides two immediate benefits . first , the protruding edge 204 prevents dust and particles from entering the interior of the sleeve 32 a . second , the non - metal material of the tube 202 eliminates the metalon - metal contact or grinding of a pivoting metal shaft within a metal sleeve . [ 0054 ] fig1 and 15 also illustrate another modification , where a non - metal ( e . g ., plastic ) washer 230 can be provided to prevent the undesirable metal - to - metal grinding between the bracket 34 and the upper hooked end 36 of the lifting rod 38 . specifically , a plastic washer 230 can be positioned in the opening 40 in the bracket 34 . the washer 230 can have a sleeved configuration with a flange 232 so that the upper hooked end 36 can extend through the washer 230 . as a result , the washer 230 acts as a separating layer between the metal upper hooked end 36 and the metal bracket 34 . fig1 - 9 illustrate the use of one inner liner 24 , but it is also possible to provide two or more inner liners . for example , fig1 and 17 illustrate two inner liners 24 a and 24 b that can be configured to fit snugly , and in side - by - side fashion , inside the outer shell 22 . the provision of two inner liners 24 allows the user to sort the trash , for example , to separate recycleable waste matter from other waste matter . the above detailed description is for the best presently contemplated modes of carrying out the invention . this description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating general principles of embodiments of the invention . the scope of the invention is best defined by the appended claims . in certain instances , detailed descriptions of well - known devices , components , mechanisms and methods are omitted so as to not obscure the description of the present invention with unnecessary detail .	1
references in this specification to “ an embodiment ”, “ one embodiment ”, or the like , mean that the particular feature , structure or characteristic being described is included in at least one embodiment of the present invention . occurrences of such phrases in this specification do not necessarily all refer to the same embodiment . the following detailed description is described with reference to a storage system environment ; however , it is appreciated that the systems , methods , and data structures described herein are equally applicable to any data processing system utilizing a key - value map in conjunction with a data buffer . fig1 shows an example of a network storage system 100 , which includes a plurality of client systems 104 a - n ( collectively referred to herein as “ clients 104 ,” or any one client system individually , as “ client 104 ”), a storage server 108 , and a network 106 connecting the client systems 104 and the storage server 108 . as shown in fig1 , the storage server 108 is coupled with a number of mass storage devices ( or storage containers ) 112 a - n ( collectively referred to herein as “ storage containers 112 ,” or any one storage container individually , as “ storage container 112 ”), such as disks , in a mass storage subsystem 105 . alternatively , some or all of the mass storage devices 112 can be other types of storage , such as flash memory , solid - state drives ( ssds ), tape storage , etc . however , for ease of description , the storage devices 112 are assumed to be disks herein . the storage server 108 can be , for example , one of the fas - series of storage server products available from netapp ®, inc . the client systems 104 are connected to the storage server 108 via the network 106 , which can be a packet - switched network , for example , a local area network ( lan ) or wide area network ( wan ). further , the storage server 108 can be connected to the disks 112 via a switching fabric ( not shown ), which can be a fiber distributed data interface ( fddi ) network , for example . it is noted that , within the network data storage environment , any other suitable number of storage servers and / or mass storage devices , and / or any other suitable network technologies , may be employed . the storage server 108 can make some or all of the storage space on the disk ( s ) 112 available to the client systems 104 in a conventional manner . for example , each of the disks 112 can be implemented as an individual disk , multiple disks ( e . g ., a raid group ) or any other suitable mass storage device ( s ). storage of information in the mass storage subsystem 105 can be implemented as one or more storage volumes that comprise a collection of physical storage disks 112 cooperating to define an overall logical arrangement of volume block number ( vbn ) space on the volume ( s ). each logical volume is generally , although not necessarily , associated with its own file system . the disks within a logical volume / file system are typically organized as one or more groups , wherein each group may be operated as a redundant array of independent ( or inexpensive ) disks ( raid ). most raid implementations , such as a raid - 4 level implementation , enhance the reliability / integrity of data storage through the redundant writing of data “ stripes ” across a given number of physical disks in the raid group , and the appropriate storing of parity information with respect to the striped data . an illustrative example of a raid implementation is a raid - 4 level implementation , although it should be understood that other types and levels of raid implementations may be used according to the techniques described herein . one or more raid groups together form an aggregate . an aggregate can contain one or more volumes . the storage server 108 can receive and respond to various read and write requests from the client systems 104 , directed to data stored in or to be stored in the storage subsystem 105 . the storage server 108 also includes an internal buffer cache 110 , which can be implemented as dram , for example , or as non - volatile solid - state memory , such as flash memory . in one embodiment , the buffer cache 110 comprises a host - side flash cache that accelerates i / o . although not shown , in one embodiment , the buffer cache 110 can alternatively or additionally be included within one or more of the client systems 104 . although the storage server 108 is illustrated as a single unit in fig1 , it can have a distributed architecture . for example , the storage server 108 can be designed as a physically separate network module ( e . g ., “ n - blade ”) and disk module ( e . g ., “ d - blade ) ( not shown ), which communicate with each other over a physical interconnect . such an architecture allows convenient scaling , such as by deploying two or more n - blades and d - blades , all capable of communicating with each other through the interconnect . further , a storage server 108 can be configured to implement one or more virtual storage servers . virtual storage servers allow the sharing of the underlying physical storage controller resources , ( e . g ., processors and memory , between virtual storage servers while allowing each virtual storage server to run its own operating system ) thereby providing functional isolation . with this configuration , multiple server operating systems that previously ran on individual machines , ( e . g ., to avoid interference ) are able to run on the same physical machine because of the functional isolation provided by a virtual storage server implementation . this can be a more cost effective way of providing storage server solutions to multiple customers than providing separate physical server resources for each customer . fig2 is a diagram illustrating an example of the hardware architecture of a storage controller 200 that can implement one or more network storage servers , for example , storage server 108 of fig1 . the storage server is a processing system that provides storage services relating to the organization of information on storage devices , such as disks 112 of the mass storage subsystem 105 . in an illustrative embodiment , the storage server 108 includes a processor subsystem 210 that includes one or more processors . the storage server 108 further includes a memory 220 , a network adapter 240 , and a storage adapter 250 , all interconnected by an interconnect 260 . the storage server 108 can be embodied as a single - or multi - processor storage server executing a storage operating system 222 that preferably implements a high - level module , called a storage manager , to logically organize data as a hierarchical structure of named directories , files , and / or data “ blocks ” on the disks 112 . the memory 220 illustratively comprises storage locations that are addressable by the processor ( s ) 210 and adapters 240 and 250 for storing software program code and data associated with the techniques introduced here . for example , some of the storage locations of memory 220 can be used as a data buffer 224 , a key - value map 226 , and a key management engine 228 . the data buffer 224 temporarily stores data that is transferred between the clients 104 and the disks 112 . each non - empty entry in buffer 224 includes a key that is associated with a value of a key - value pair . the key - value map 226 stores the key - value pairs . in particular , each slot of the key - value map 226 is identifiable by a plurality of keys and includes a slot header ( or meta data ) and a slot value ( data ). the slot header indicates the status ( or state ) of each of the plurality of keys associated with the slot . at any given time , at most , a single key can be used as the current key ( i . e ., allocated key or next key to be allocated if all keys are unallocated ) for any given slot of the key - value map 226 . in some embodiments , each key is associated with a value or identifier ( id ) that uniquely identifies a data module . this may be useful if , for example , the size of the identifier is larger than the size of the key . the key management engine 228 includes software code configured to create and maintain the key - value map 226 and the keyspace ( i . e ., the plurality of keys associated with each slot ) using the slot headers . the processor 210 and adapters may , in turn , comprise processing elements and / or logic circuitry configured to execute the software code and manipulate the data structures . although not shown , in one embodiment , the data buffer 224 , the key - value map 226 , and / or the key management engine 228 can be included within one or more clients ( e . g ., client 104 of fig1 ). the storage operating system 222 , portions of which are typically resident in memory and executed by the processing elements , functionally organizes the storage server 108 by ( among other functions ) invoking storage operations in support of the storage service provided by the storage server 108 . it will be apparent to those skilled in the art that other processing and memory implementations , including various computer readable storage media , may be used for storing and executing program instructions pertaining to the techniques introduced here . similar to the storage server 108 , the storage operating system 222 can be distributed , with modules of the storage system running on separate physical resources . the network adapter 240 includes a plurality of ports to couple the storage server 108 with one or more clients 104 , or other storage servers , over point - to - point links , wide area networks , virtual private networks implemented over a public network ( internet ) or a shared local area network . the network adapter 240 thus can include the mechanical components as well as the electrical and signaling circuitry needed to connect the storage server 108 to the network 106 . illustratively , the network 106 can be embodied as an ethernet network or a fibre channel network . each client 104 can communicate with the storage server 108 over the network 106 by exchanging packets or frames of data according to pre - defined protocols , such as transmission control protocol / internet protocol ( tcp / ip ). the storage adapter 250 cooperates with the storage operating system 222 to access information requested by the clients 104 . the information may be stored on any type of attached array of writable storage media , such as magnetic disk or tape , optical disk ( e . g ., cd - rom or dvd ), flash memory , solid - state drive ( ssd ), electronic random access memory ( ram ), micro - electro mechanical and / or any other similar media adapted to store information , including data and parity information . however , as illustratively described herein , the information is stored on disks 112 . the storage adapter 250 includes a plurality of ports having input / output ( i / o ) interface circuitry that couples with the disks over an i / o interconnect arrangement , such as a conventional high - performance , fibre channel link topology . the storage operating system 222 facilitates clients &# 39 ; access to data stored on the disks 112 . in certain embodiments , the storage operating system 222 implements a write - anywhere file system that cooperates with one or more virtualization modules to “ virtualize ” the storage space provided by disks 112 . in certain embodiments , a storage manager 310 ( fig3 ) element of the storage operation system 222 logically organizes the information as a hierarchical structure of named directories and files on the disks 112 . each “ on - disk ” file may be implemented as a set of disk blocks configured to store information . as used herein , the term “ file ” means any logical container of data . the virtualization module ( s ) may allow the storage manager 310 to further logically organize information as a hierarchical structure of blocks on the disks that are exported as named logical units . fig3 schematically illustrates an example of the architecture 300 of a storage operating system 222 for use in a storage server 108 . in one embodiment , the storage operating system 222 can be the netapp ® data ontap ™ operating system available from netapp , inc ., sunnyvale , calif . that implements a write anywhere file layout ( wafl ™) file system . however , another storage operating system may alternatively be designed or enhanced for use in accordance with the techniques described herein . the storage operating system 222 can be implemented as programmable circuitry programmed with software and / or firmware , or as specially designed non - programmable circuitry ( i . e ., hardware ), or in a combination thereof . in the illustrated embodiment , the storage operating system 222 includes several modules , or layers . these layers include a storage manager 310 , which is the core functional element of the storage operating system 222 . the storage manager 310 imposes a structure ( e . g ., one or more file systems ) on the data managed by the storage server 108 and services read and write requests from clients 104 . to allow the storage server to communicate over the network 106 ( e . g ., with clients 104 ), the storage operating system 222 also includes a multi - protocol layer 320 and a network access layer 330 , logically under the storage manager 310 . the multi - protocol layer 320 implements various higher - level network protocols , such as network file system ( nfs ), common internet file system ( cifs ), hypertext transfer protocol ( http ), and / or internet small computer system interface ( iscsi ), to make data stored on the disks 112 available to users and / or application programs . the network access layer 330 includes one or more network drivers that implement one or more lower - level protocols to communicate over the network , such as ethernet , internet protocol ( ip ), tcp / ip , fibre channel protocol and / or user datagram protocol / internet protocol ( udp / ip ). also , to allow the device to communicate with a storage subsystem ( e . g ., storage subsystem 105 ), the storage operating system 222 includes a storage access layer 340 and an associated storage driver layer 350 logically under the storage manager 310 . the storage access layer 340 implements a higher - level storage redundancy algorithm , such as raid - 4 , raid - 5 or raid dp ®. the storage driver layer 350 implements a lower - level storage device access protocol , such as fibre channel protocol or small computer system interface ( scsi ). also shown in fig3 is the path 315 of data flow through the storage operating system 222 , associated with a read or write operation , from the client interface to the storage interface . thus , the storage manager 310 accesses the storage subsystem 105 through the storage access layer 340 and the storage driver layer 350 . clients 104 can interact with the storage server 108 in accordance with a client / server model of information delivery . that is , the client 104 requests the services of the storage server 108 , and the storage server may return the results of the services requested by the client , by exchanging packets over the network 106 . the clients may issue packets including file - based access protocols , such as cifs or nfs , over tcp / ip when accessing information in the form of files and directories . alternatively , the clients may issue packets including block - based access protocols , such as iscsi and scsi , when accessing information in the form of blocks . additionally , in the example of fig3 , a data buffer 312 is inserted in the path 315 of data flow through the storage operating system 222 . in one embodiment , the data buffer 312 comprises a circular buffer or cache system that acts as a first - in first out ( fifo ) queue . the circular buffer is configured to accelerate i / o operations on the main storage 105 . the data buffer 312 includes a plurality of entries ( see , for example , data buffer 450 of fig4 ). each non - empty entry in the data buffer 312 includes a key that corresponds to a specific source ( e . g ., storage container or disk ) in the main storage . a key - value map 314 is used to associate the keys with the identities of the specific sources . that is , to use the circular buffer , an identifier for each source is added to the key - value map so that a key is bound to that identifier . thus , in such an embodiment the number of sources that can use the circular buffer is limited to the number of slots in the key - value map . in some embodiments , the value bound to the current key in the slot of the key value map is a source identifier ( id ) associated with the source . it is appreciated that a key - value map can be used in different manners in other ( e . g ., non - storage ) environments . the storage operating system 222 includes a management layer 360 that provides a path for a network administrator to request network management operations ( e . g ., storage system configuration changes , etc . ), on the storage system . in one embodiment , the management layer includes a key management engine 370 that creates and maintains the key - value map 314 . for example , the key - value map 314 comprises slots that store opaque data blobs or values . accordingly , these values are only accessible via one or more commands issued from the key - management engine 370 . the commands can be a result of one or more system administer initiated operations such as , for example , add , get , and delete operations . additionally , the key management engine 370 must be able to recognize and track the status of invalid keys . for example , the data buffer , key management engine , or other management engine may issue a get operation to obtain the value bound to an invalidated key . the key - management engine 370 must be able to recognize and communicate the invalidity of the key to the caller ( e . g ., the data buffer 312 or other management engine ) so that the data in the buffer associated with the invalid key is not transferred ( e . g ., to / from clients or to / from main storage ). fig4 shows an example of the contents of a memory system 400 that includes at least one data buffer and at least one key - value map stored thereon , for example , memory 220 of fig2 . more specifically , fig4 illustrates how associating a plurality of keys with each slot of a key - value map , as described herein , can result in the ability to reuse slot entries when a key - value pair is deleted . memory system 400 includes a key - value map 410 , a keyspace 420 , a free slot list 430 , and a data buffer 450 . the memory system 400 can comprise one or more persistent memories such as disks , flash memory , solid - state drives ( ssds ), tape storage , etc ., and / or one or more non - persistent memories such as dram . however , it is appreciated that in order to achieve durability , the key - value map 410 must be stored or replicated on one or more persistent memories . although not shown for the sake of simplicity , in some embodiments the key - value map 410 includes both in - memory and persistent data structures . the in - memory data structures can be realized using a memory array . additionally , a persistent copy of the key - value map &# 39 ; s in - memory contents can also be stored on a non - volatile storage device . for example , the key - value map 410 can be implemented using flash storage on solid state drives ( ssds ). however , it is appreciated that any non - volatile storage medium can be used , including magnetic disk and phase - change memory . the persistent copy can be referred to as the map region . the map region is an array of map entries or slots . a slot &# 39 ; s index in the array is its “ key .” the key value map 410 is an array indexed from 0 to n − 1 where n is equal to the total number of map entries or slots in the key - value map . in the example of fig4 , n is equal to 4 . note that n can be any number ( i . e ., greater than , equal to , or less than 4 ); the value of n equal to 4 is chosen in this example for ease of description . continuing with the example of fig4 , the key value map 410 includes slots 411 - 414 . the slots 411 - 414 include slot headers 416 and slot values 418 . the slot headers 416 can include a variety of information including information for managing the plurality of keys associated with each slot . that is , at any given time each key of the plurality of keys associated with a slot is in one of three possible states . the states for the keys are tracked by the slot headers 416 . the slot headers 416 are discussed in greater detail with reference to fig5 . the slot values 418 are the values or identifiers that are stored with the current key . for example , values can be added to the key - value map 410 or bound to a key when an add operation is received . the add operation adds or associates the current key as defined in the slot header with a value . for example , in embodiments discussed herein related to the storage system environment , a value that is associated with a key can comprise , for example , a disk or storage container identifier . once the disk or storage container identifier is added to the key - value map 410 , then the disk or storage container can be cached or buffered . the disks or storage containers that can be cached or buffered can be a subset of the total number of disks or storage containers in use in some embodiments . the keyspace 420 includes all of the possible keys that can be used or associated with the slots of key - value map 410 . in this example , keyspace 420 includes 16 keys illustratively numbered 0 - 15 . it is appreciated that any number of keys can be used with the key - value map 410 as long as each slot is associated with at least a plurality of keys . the key management engine associates the keys in keyspace 420 with the slots . in one embodiment , the key management engine associates the keys in the keyspace 420 with the slots of the key - value map based on the total number of slots n , where a key k is defined to map or associate to a slot s by the function s = k % n . thus , given a keyspace with m possible values ( e . g ., a 32 - bit key value can have 2 32 possible values ), there are at most ceiling ( m / n ) possible keys that map to a particular slot . accordingly , in the example of fig4 , keys 0 , 4 , 8 , and 12 are associated with slot 0 ( slot 411 ); keys 1 , 5 , 9 , and 13 are associated with slot 1 ( slot 412 ); keys 2 , 6 , 10 , and 14 are associated with slot 2 ( slot 413 ); and keys 3 , 7 , 11 , and 15 are associated with slot 3 ( slot 414 ). the range or number of keys that can be associated with or map to a particular slot can thus be expressed as r = ceiling ( m / n ), where each of the slot &# 39 ; s r keys is in one of three states : unallocated , current , or wait . an individual keys state is determined based on information in the associated slot header 416 . in the unallocated state , the key is available to be assigned to a new value ( e . g ., the key is “ free ”). in the current state , the slot is currently storing the value for the key . in the wait state , the key has been deleted from the map and is waiting for indication from the buffer that any references to the key have been removed — at which point the key transitions the unallocated state . the state map that tracks the state of each key is discussed in greater detail with reference to fig6 . the key management engine 370 uses the free slot list 430 to track the free slots of the key - value map 410 . as shown in fig4 , free slot list 430 includes an entry for each slot 432 that indicates a “ free ” status . free slots are those slots that are currently in an unallocated state . that is , free slots are those slots that are neither associated with a value in the key - value map nor in the wait state subsequent to having the value previously associated with that key deleted . in some embodiments , the key management engine 370 can keep a separate free slot list 430 for each key - value map . alternatively or additionally , the key management engine 370 may read the slot headers 416 to determine whether a slot is free . in the example of fig4 , a value of “ 0 ” indicates that a slot is not available and a value of “ 1 ” indicates that a slot is available . accordingly , in the example of fig4 , slot 2 is the only available slot . because slot 2 ( slot 413 ) of key - value map 410 is available , none of the keys associated with the slot ( i . e ., keys 2 , 6 , 10 , or 14 ) are bound to the value ( i . e ., id — 2 ). each entry in the buffer 450 includes a reference key 452 and a buffer value 454 . in the example of fig4 , the buffer values 454 are illustrated as buffer_value — 1 through buffer_value — 11 , where each buffer value 454 is data cached from a system , disk , or storage container identifiable by the reference key ( i . e ., by using the key - value map 410 to obtain the value bound to the key ). although not shown , when the key previously associated or bound to the value “ id — 2 ” is deleted ( e . g ., keys 2 , 6 , 10 , or 14 ), the key management engine 370 either determines the current read location in the buffer 450 and tracks the buffer to identify when there are no more references to the key , or transfers a message to the buffer 450 or a buffer management engine ( not shown ) to request a notification of when no more references to the key are made in the buffer 450 ( i . e ., no more references are made to the deleted key in the reference key 452 ). fig5 shows an example of a persistent key - value slot header 500 that includes various fields . slot header 500 can be a detailed example of one of the slot headers 416 and slot values 418 discussed with reference to fig4 ; although other configurations are also possible . slot header 500 includes a sector field 510 , a map checksum field 512 , a current key position field 514 , a wait window start position field 516 , a flag field 518 , and a reserved field 520 . the map value field 522 is also shown which can be , for example , the key value field 418 of fig4 . it is appreciated that more or fewer field are possible . in one embodiment , the sector field 510 represents the sector containing the key - value map slot . the sector field 510 can be used to identify or detect misdirected i / o operations . the map checksum field 512 contains the computed checksum of the map entry . in some cases the checksum may be computed with all zeros for the checksum field 512 . the checksum may be used to detect corruption of the map entry . in one embodiment , the sector field 510 and the map checksum field 512 are optional . the map current key position field 514 , the wait window start position field 516 , and the flag field 518 are used in concert to determine the current state of the keys associated with a slot . the map current key position field 514 indicates the position of the current key . the current key can be indicated numerically ( shown in greater detail with reference to fig7 a - 7d ). the wait window start position field indicates the position of the first key in a wait state . that is , the keys typically enter the wait state on a first - in first - out ( fifo ) basis . the wait window indicates the first key of the plurality of keys associated with the slot that entered the wait state . the flag field numerically indicates the state of the slot . for example , the current key position field and the wait window start position field can both be set to the same value when initialized or when all keys are in a wait state . accordingly , the flag field can indicate when the slot is empty and none of the keys are assigned , when the slot is empty and all of the keys are in wait state , when the current key contains a bonded value , and when the current key does not contain a bonded value . each key state is discussed in greater detail with reference to fig6 . fig6 shows an example of a state diagram having the various states and state transitions associated with each key of the keyspace , for example , keyspace 420 of fig4 . more specifically , fig6 illustrates management of the keys of the keyspace by the management engine on a per slot basis . each key of the plurality of keys associated with a slot is always in one of three states : the unallocated state 610 , the allocated state 620 , or the wait state 630 . when initialized by the key management engine , a plurality of keys of the keyspace are associated with each slot . as discussed , each slot has a slot header including various fields . using fig4 as an example , keys 1 , 5 , 9 , and 13 of keyspace 420 , when initialized , are associated with slot 1 of key - value map 410 . association of the keys to the slots can be performed by the key management engine in a number of manners . in this example , the keys are associated based on the function s = k % n . in one embodiment , the header fields associated with slot 1 will be set at initialization . the current key position field is set to 0 ; the wait window start position field is set to 0 ; and the flag field is set to ‘ all empty .’ when the flag field is set to ‘ all empty ,’ the current key position and the wait window start position fields are ignored . thus , after initialization , the current key is the key corresponding to position 0 . more importantly , after initialization , all of the keys associated with a slot are in unallocated state 610 . at any given time , of the plurality of keys associated with the slot , more than one of the plurality of keys , or all of the keys , can be in the unallocated state 610 simultaneously . in the unallocated state 610 , there are no references to the key in the data buffer . moreover , when in the unallocated state 610 , a key is free to be assigned , associated or bound to a new value . when the keyspace management engine receives an add operation indicating a request from a user or system administrator to add or bind a key , one of the keys of the plurality of keys in the unallocated state 610 is bound to the new value and that key is put into the allocated state 620 . at any given time , at most , one of the keys of the plurality of keys associated with the slot can be in the allocated state 620 . in the current state , the slot is currently storing the value for the key . further , during the current state , the bound key may be referenced one or more times in the data buffer . these references are valid references or non - dirty references because , in the current state , the key has not yet been deleted . the key management engine receives a remove operation when , for example , a system administrator wants to remove one of the key - value pairs in the key - value map . the remove operation deletes the key - value pair or unbinds the key value pair . the key can be unbound from the value in the key - value map immediately ; however , the key may still be referenced in the data buffer . thus , after a key is deleted , the key is put into a wait state 630 . the wait state 630 is the period after a key has been deleted and before the key has been recycled ( i . e ., where recycling a key is defined as entering the unallocated state ). the key - value map structure can support a wait state of an arbitrary duration . multiple keys ( or all of the keys ) associated with a slot of the key - value map can be in wait state 630 simultaneously . however , keys must exit the wait state in the order in which they entered . during the wait state 630 , the key may be referenced one or more times in the data buffer . however , the references to the key are no longer valid because the key has been deleted . accordingly , these references in the data buffer are referred to as invalid or “ dirty ” keys . in one embodiment , the wait state can only be exited once all of the invalid keys are guaranteed to be removed from the data buffer . that is , the wait state 630 can only be exited once the invalid references no longer exit . in the case where a circular buffer ( or cache ) is used , the key management engine can guarantee that the invalid references no longer exists in the circular data buffer once the circular buffer has completed a full rotation . for example , when a delete operation is received at the key management engine , the key management engine puts the key to be deleted in a wait state and concurrently identifies the current read pointer or read location in the circular buffer . as the circular buffer increments , if an invalid key reference is determined to exist in the circular buffer , then the reference is deleted . thus , when the circular buffer completes a full rotation ( i . e ., after returning to the original read location ), the key management engine can then guarantee that any invalid references to the deleted key have been properly removed . at this point , the state of the key can transition back to the unallocated state . it is appreciated that the data buffer may use other ways to determine when the key is no longer referenced . fig7 a - 7d show examples illustrating a scheme of persistently tracking keys using one or more of the various fields of the persistent key - value slot headers , for example , slot header fields 416 of fig4 . more specifically , fig7 a - 7d illustrate an example of using the slot header fields to track the state ( unallocated , current , or wait ) of each of a plurality of key &# 39 ; s that are associated with a single slot while the slot is in use . the key tracking is illustrated using a key wheel 700 . referring first to fig7 a , which illustrates the key - wheel 700 for a single slot after initialization or when all the keys are empty ( not assigned or bound to a value ). in this example , the key - wheel 700 illustrates slot 1 of key - value map 410 . the key - wheel 700 includes key locations 0 , 1 , 2 , and 3 corresponding to keys 1 , 5 , 9 , and 13 , respectively . as shown in fig7 a , the current key position and the wait key position are both set to 0 corresponding to key 1 . further , the flag field in fig7 a is set to ‘ all empty .’ thus , in the example of fig7 a , each of the keys 1 , 5 , 9 , and 13 are in the unallocated state 610 . fig7 b illustrates key - wheel 700 after a key is bound to a new value . more specifically , key location 0 of slot 1 corresponding to key 1 of keyspace 420 is bound to a new value in the key - value map 410 . in this example , the current key position does not change because the current key position ( as determined by the current key position field ) is already set to 0 . however , the flag field is set to ‘ current full ’ indicating that the value in the value field is currently bound to the key indicated by the current key position field . the wait key position remains unchanged . in this case , key 1 of the keyspace 420 is in the allocated state and the remaining keys associated with slot 1 ( i . e ., keys 5 , 9 , and 13 ) remain in the unallocated state . fig7 c illustrates key - wheel 700 after the key - value pair assigned in fig7 b is deleted , a new key - value pair is assigned and deleted , and another new key value pair is assigned and deleted . more specifically , the value associated or bound to key 1 in fig7 b is first deleted . although not shown , at this point the current key position is incremented from key location 0 corresponding to key 1 to key location 1 corresponding to key 5 and the flag field is set to ‘ current empty ’ indicating that the current key position field is not currently filled . moreover , because key 1 was deleted , the state of the key is changed from the allocated state 620 to a wait state 630 . as previously discussed , when a key is deleted or in the wait state 630 , the key management engine either tracks the data buffer or requests a notification from a data buffer manager ( not shown ) for an indication of when there are no longer references to the deleted key in the data buffer . in this example , the key management engine requests a notification of when data buffer 450 no longer includes references to key 1 . a new value is then bound to or assigned to key 5 ( corresponding to key location 1 in the key - wheel 700 ) of the key - value map and subsequently deleted . although not shown , at this point the current key position in the key - wheel 700 is incremented from key location 1 corresponding to key 5 to key location 2 corresponding to key 9 . the flag is set to ‘ current empty ’ and because key 5 is deleted , it is placed in the wait state 630 . another new key value pair is then bound to or assigned to key 9 ( corresponding to key location 2 in the key - wheel 700 ) of the key - value map and subsequently deleted . the flag is set to ‘ current empty ’ ( after being set to ‘ current full ’ when the value is bound to key 9 ) and because key 9 is deleted , it is placed in the wait state 630 . also shown in this example , subsequent to the value assigned to or bound to key 1 corresponding to key location 0 being deleted , the key management engine receives the indication that key 1 is no longer referenced in the data buffer . accordingly , the key management engine transitions key 1 from the wait state 630 back to the unallocated state 610 . it is appreciated that this indication may arrive anytime after key 1 is placed in the wait state 630 and has no relation to the other keys being bound and / or deleted . thus , as shown in fig7 c , keys 1 and 13 are in the unallocated state 610 , and keys 5 and 9 are in the wait state 630 . fig7 d illustrates key - wheel 700 after a third key - value pair is added and deleted and a fourth key - value pair is added and deleted . as previously discussed , after each key is deleted it is transitioned to the wait state 630 . thus , as shown , in fig7 d all of the keys associated with slot 1 ( i . e ., keys 1 , 5 , 9 , and 13 ) are in the wait state . the keys will be removed from the wait state as indicators are received that the keys are no longer referenced in the data buffer . in this case , the keys will be transitioned from the wait state 630 to the unallocated state 610 in the order in which the keys entered the wait state ( i . e ., in the following order : key 5 , key 9 , key 13 , and , key 1 ). fig8 is a flow diagram illustrating an example process 800 for creating and initializing a key - value map , for example , the key - value map 410 of fig4 . the key management engine , among other functions , creates and maintains the key - value map . in one embodiment , the key management engine creates and initializes the key - value map including associating a plurality of keys with each slot of the key - value map . in the creation stage , at step 810 , the key management engine creates the key - value map by allocating a plurality of slots in a memory . in the association stage , at step 812 , the key management engine associates a plurality of keys of the keyspace with each slot of the key - value map . it is appreciated that the key management engine may associate the plurality of keys of the keyspace with each slot of the key - value map in any number of ways including , in one embodiment , associating the plurality of keys of the keyspace to each slot based on the function s = k % n . in the initialization stage , at step 814 , the key management engine initializes the plurality of keys for each slot by setting the slot header values to default values . in one embodiment , the initialization stage is optional or combined with the association stage . fig9 is a flow diagram illustrating an example of a process 900 for adding a key - value pair to a key - value map , for example , the key - value map 410 of fig4 . the key management engine , among other functions , receives requests to add or bind values to keys of a key - value map and performs the process 900 . in one embodiment , the key management engine receives a value , associates or binds the value with a key of the key - value map ( if a slot is available ) and returns the bound key . in the receiving stage , at step 910 , the key management engine receives a bind or add request including a value to be bound . the request can be received from a system user or administrator . in one embodiment , a system administrator provides the name or identification of a storage container or system that the system administrator would like to cache ( i . e ., use the circular data buffer ). the key management engine , at step 912 , determines whether a free slot is available . in one embodiment , the key management engine uses a free slot list to determine whether a free slot is available . if a free slot is not available , at step 914 , the key management engine either waits for a free key to become available or returns a failure message to the system administrator . a free slot may not be available if a number of keys from one or more slots are in the wait state and / or if all of the slots currently have keys in the allocated state ( i . e ., the slots already have a value bound to one of the plurality of keys associated with the slot ). if a free slot is available , in the identification stage , at step 916 , the key management engine identifies the current key of the slot using the slot header information . in the binding stage , at step 918 , the key management engine binds the identified current key with the value . in one embodiment , the key management engine binds the identified current key by updating the header information for the slot and writing the header information and the value to the slot . lastly , at the return stage , step 920 , the key management engine returns the key to which the provided value is now bound in the key - value map . in one embodiment , the returned key can then be used to identify i / o operations from the identified storage container . the process then returns . fig1 is a flow diagram illustrating an example process 1000 of deleting a key - value pair from a key - value map , for example , the key - value map 410 of fig4 . the key management engine , among other functions , receives requests to delete or remove a bound key - value pair from a key - value map and performs the process 1000 . in one embodiment , the key management engine receives a key , identifies the associated slot , and deletes the key - value pair binding if the key is valid . the key management engine also recycles the deleted key and can reuse the deleted slot immediately . in some examples , the value may be removed from the key - value pair . in other cases , the slot header information may simply be updated to reflect that the given key is no longer valid ( i . e ., put into the wait state ). in the receiving stage , at step 1010 , the key management engine receives a delete or unbind request including the key associated with the key - value pair to be unbound . in one embodiment , a system administrator provides an instruction to remove a storage container from caching and the key management engine first determines the key associated with the storage container . once the key management engine receives and / or identifies the key to be deleted , at step 1012 , the key management engine determines whether the key is valid . if the key is not valid then , at step 1014 , the key management engine returns a failure message ( e . g ., to the system administrator and / or the calling module ). if the key is valid then , in the wait state determination stage , at step 1020 , the current key is placed in a wait state . in the slot determination stage , at step 1022 , the key management engine determines the next key to use with the slot ( e . g ., the next key that will be bound for that slot ). in one embodiment , the keys are used in a specific order . for example , the keys may be used in the order in which the keys become available ( i . e ., the order in which they are recycled or enter the unallocated state ). in one embodiment , the key with the lowest number available is used . in some examples , the next available key will not be currently available . it is appreciated that there many possibilities for determining the next key to use with the slot . in the write stage , at step 1024 , the slot header information is updated by writing the updated slot header information including the updated slot header information . at step 1026 the key management engine determines whether additional keys are available for use for the slot ( e . g ., whether the flag field for the slot is not set to ‘ all wait ’). if keys are remaining , at step 1038 , the key management engine adds the slot to the free slot list . otherwise , the process returns . from the wait stage , at step 1032 , the key management engine transfers a request for notification . the request for notification indicates when the deleted key is no longer referenced in the data buffer . in one alternative embodiment , the key management engine monitors the buffer itself to determine when the deleted key is no longer referenced . at step 1034 , the key management engine determines if the notification has been received . if the notification has been received , at step 1036 , the deleted key can be recycled ( i . e ., transitioned from the wait state to the unallocated state ). at step 1038 , the key management engine adds the slot to the free slot list if all of the keys were in the wait state before this notification was received ( i . e ., flag field set to ‘ all wait ’). the process then returns . fig1 is a flow diagram illustrating an example process 1100 of getting or looking up a value associated with a key of key - value pair from a key - value map , for example , key - value map 410 of fig4 . the key management engine , among other functions , receives requests to get or lookup a value of a bound key - value pair from a key - value map . in one embodiment , the key management engine receives a key , identifies the associated slot , and reads and returns the value bound to the key if the key is valid . in the receiving stage , at step 1110 , the key management engine receives a get or lookup request including a key . the get or lookup operation can be received from the data buffer , for example , data buffer 450 of fig4 , or from a data buffer management engine ( not shown ). the request can also be received from a system administrator . once the key management engine receives or identifies the request , at step 1112 , the key management engine determines whether the key is valid . if the key is not valid then , at step 1114 , the key management engine returns a failure message ( e . g ., to the system administrator and / or the calling module ). if the key is valid then , in the determination stage , at step 1116 , the key management engine determines the value bound to the key and , at step 1118 , the key management engine returns the value . the processes described herein are organized as sequences of operations in the flowcharts . however , it should be understood that at least some of the operations associated with these processes potentially can be reordered , supplemented , or substituted for , while still performing the same overall technique . the techniques introduced above can be implemented by programmable circuitry programmed or configured by software and / or firmware , or they can be implemented entirely by special - purpose “ hardwired ” circuitry , or in a combination of such forms . such special - purpose circuitry ( if any ) can be in the form of , for example , one or more application - specific integrated circuits ( asics ), programmable logic devices ( plds ), field - programmable gate arrays ( fpgas ), etc . software or firmware for implementing the techniques introduced here may be stored on a machine - readable storage medium and may be executed by one or more general - purpose or special - purpose programmable microprocessors . a “ machine - readable medium ”, as the term is used herein , includes any mechanism that can store information in a form accessible by a machine ( a machine may be , for example , a computer , network device , cellular phone , personal digital assistant ( pda ), manufacturing tool , any device with one or more processors , etc .). for example , a machine - accessible medium includes recordable / non - recordable media ( e . g ., read - only memory ( rom ); random access memory ( ram ); magnetic disk storage media ; optical storage media ; flash memory devices ; etc . ), etc . the term “ logic ”, as used herein , can include , for example , special - purpose hardwired circuitry , software and / or firmware in conjunction with programmable circuitry , or a combination thereof . although the present invention has been described with reference to specific exemplary embodiments , it will be recognized that the invention is not limited to the embodiments described , but can be practiced with modification and alteration within the spirit and scope of the appended claims . accordingly , the specification and drawings are to be regarded in an illustrative sense rather than a restrictive sense .	6
it is now contemplated to solvent - deasphalt an asphalt - containing mineral oil with a liquid solvent consisting of at least two components selected from the group consisting of hydrogen sulfide , carbon dioxide , and light hydrocarbon , said light hydrocarbon being selected from the group consisting of propane , butanes , pentanes and blends thereof . thus , both binary and ternary liquid solvents are contemplated . briefly , the process comprises contacting the asphalt - containing mineral oil with the liquid solvent , in the absence of added hydrogen , in a volume ratio of 1 : 1 to about 1 : 20 , i . e . one to about 20 volumes of solvent are used for each volume of mineral oil to be treated . the contacting is conducted for a time and at a temperature and pressure more fully described hereinbelow , whereby are formed a liquid phase containing solvent and deasphalted oil and a separate liquid phase rich in tar . the immiscible phases are separated , followed by recovery of deasphalted oil and asphalt from the respective phases . the advantage provided by the binary or ternary liquid solvent of this invention is an increase in selectivity over that achieved with a single solvent consisting of hydrogen sulfide , carbon dioxide or light hydrocarbon used alone . the binary or ternary solvent of this invention also is characterized by being easily separated from the deasphalted oil and the tar - rich phases , thereby minimizing cost and reducing solvent loss . the process of this invention is particularly well suited for the deasphalting of atmospheric tower or vacuum tower bottoms from the distillation of petroleum oils , commonly known as residual oils or residua . however , petroleum crude oils , and topped crude oils , as well as other petroleum hydrocarbon oils that contain an asphaltic component , may be treated by the method of this invention . additionally , heavy oils derived from tar sands , shale , or other sources , may likewise be treated . any conventional method of contacting the asphaltene - containing mineral oil with the binary or ternary liquid solvent of this invention may be used . for example , batch contacting is effective . countercurrent contacting and separation of the phases , as is commonly practiced in propane deasphalting , may be used . in this latter method of contacting , the asphalt - containing mineral oil , which in some cases may advantageously be mixed with a small amount of the solvent to promote fluidity , is fed continuously at an intermediate point in a packed tower . concurrently , the binary or ternary solvent of this invention is fed at a point below the intermediate point , and flows upwardly through the tower wherein it contacts the fed and forms two liquid phases , one rich in oil and the other rich in tar . the oil phase flows upwardly and is removed from the top of the tower , while the tar phase flows downwardly and is removed from the bottom of the tower . the liquid solvent of this invention consists of two components or three components , as hereinabove described , each of the components being present in an amount equal to at least 10 percent of the total volume of the solvent . the components of the liquid solvent are selected from the group consisting of hydrogen sulfide , carbon dioxide , and light hydrocarbon , said light hydrocarbon consisting essentially of propane , butane , pentane , or blends of these hydrocarbons . for the purpose of this invention , it is particularly preferred that the light hydrocarbon consist essentially of propane . thus , in its preferred form , it is contemplated that this invention utilizes a binary solvent consisting of hydrogen sulfide and carbon dioxide ; or hydrogen sulfide and propane ; or carbon dioxide and propane . the preferred ternary composition consists of hydrogen sulfide , carbon dioxide , and propane . for each of the binary solvents , the composition contains 10 to 90 percent by volume of one component , with the remainder , 90 to 10 % by volume , being the second component . the ternary liquid solvent contains at least 10 volume percent each of hydrogen sulfide , carbon dioxide , and propane . as will be recognized by those skilled in the art , the critical temperatures and pressures of hydrogen sulfide , carbon dioxide , and lighthydrocarbon are different from one another . since the present invention contemplates contacting asphalt - containing mineral oil with liquid solvent , the contacting must be done at a temperature lower than the critical temperature , and at a pressure sufficiently high to maintain the binary or ternary solvent in the liquid phase during the contacting step , and until the phases are separated . after separation of the phases , the liquid solvent is removed from each of the phases by conventional means , whereby recovery of deasphalted oil , and tar comprising asphaltenes , aromatic hydrocarbons , heterocyclic nitrogen and sulfur compounds and metal - containing compounds , are effected . alternatively , the tar phase may be subjected to additional treatment prior to removal of the liquid solvent in order to modify or separate the constituents thereof . when using mixtures of hydrogen sulfide and light hydrocarbon as the binary solvent in the process of this invention , it is preferred to conduct the contacting step and separation of the phases at a temperature of less than about 60 ° c ., and at a pressure of at least about 400 p . s . i . g ., said pressure being effective to maintain the solvent in the liquid phase . in some instances temperatures of 60 ° c . to 80 ° c . may be used , however . the precise temperature to be used will depend on the mineral oil to be deasphalted , the volume ratio of solvent to mineral oil , the equipment chosen , and the extent of deasphalting and / or demetallization desired . the selection of operating conditions based on a few routine experiments is a procedure well known to those of skill in the art . the critical conditions for mixtures of hydrogen sulfide and propane have been reported in the literature by w . b . kay and g . m . rambosek , ind . eng . chem . 45 , 221 - 226 ( 1953 ), the entire contents of which are incorporated herein by reference . table i is derived from that publication and is reproduced here for convenience . table i______________________________________critical conditions for h . sub . 2 s - propane mixtures critical criticalmol . % propane pressure , temperatures , in mixture lb ./ sq . in . ° c . ______________________________________0 1297 . 1 99 . 910 . 16 1159 . 5 92 . 721 . 83 1040 . 2 87 . 532 . 45 956 . 2 84 . 943 . 59 887 . 6 84 . 656 . 58 821 . 7 85 . 770 . 14 759 . 2 88 . 583 . 67 695 . 0 92 . 0100 . 0 616 . 3 96 . 7______________________________________ when using binary or ternary mixtures other than hydrogen sulfide and light hydrocarbon , it is necessary to conduct the contacting at a temperature of less than about 100 ° c ., and preferably at a temperature less than about 35 ° c ., with a pressure of at least about 1000 p . s . i . g . the critical conditions for mixtures of hydrogen sulfide and carbon dioxide have been reported in the literature by j . a . bierlein and w . b . kay , ind . eng . chem . 45 , 618 - 623 ( 1953 ), the entire contents of which are incorporated herein be reference . table ii is derived from that reference and is reproduced here for convenience . table ii______________________________________critical conditions for h . sub . 2 s - co . sub . 2 mixtures critical criticalmol . fraction pressure , temperaturesco . sub . 2 lb ./ in .. sup . 2 ° c . ______________________________________0 1306 100 . 38 . 0630 1305 93 . 50 . 1614 1302 84 . 16 . 2608 1284 74 . 48 . 3759 1245 64 . 74 . 4728 1207 56 . 98 . 6659 1129 43 . 72 . 8292 1085 35 . 96 . 9009 1076 33 . 531 . 1072 31 . 10______________________________________ this invention will now be illustrated by examples , which examples are not to be construed as limiting the invention described by the present specification including the claims . all parts and ratios given in the examples are by weight unless explicitly stated to be otherwise . in general , the contacting of the asphaltene - containing mineral oil with the liquid solvent according to this invention is conducted for a time sufficient to insure intimate contact of the oil and solvent , and in general this occurs within a period of less than about 10 minutes in a single stage batch apparatus . in a column operation which effects multistage contacting , each stage generally will require less than about 10 minutes for effective contacting . thus , the contacting step does not require extensive time except when the mineral oil is extremely viscous , in which case it is preferred to premix the oil with an amount of solvent effective to reduce the viscosity of the mineral oil , said amount being insufficient to induce phase separation . the reducing solvent preferably is chosen from the group consisting of liquid hydrogen sulfide , liquid carbon dioxide , liquid light hydrocarbon , and mixtures thereof . for purposes of the present invention , the deasphalting solvent is preferably substantially anhydrous , and precautions should be taken to avoid entry of moisture into the process during the contacting and separation steps . a residual oil obtained by vacuum distillation of an arabian crude was deasphalted in a continuous unit using propane as a solvent . ______________________________________gravity , ° api 9 . 6specific gravity at 60 / 60 ° f . 1 . 0028carbon residue , % wt ( conradson ) 12 . 5nickel , ppm 16vanadium , ppm 72______________________________________ the deasphalting was conducted with a solvent dosage of 600 volume percent , and at an average deasphalting temperature of 50 ° c . the properties of the recovered deasphalted oil and tar were as follows : ______________________________________deasphalted oil______________________________________yield , % vol . 66 . 8gravity , ° api 16 . 6specific gravity at 60 / 60 ° f . 0 . 9554carbon residue , % wt ( conradson ) 7 . 6nickel , ppm 1 . 5vanadium , ppm 8 . 4______________________________________ ______________________________________tar______________________________________yield ( by difference ) 33 . 2carbon residue , % wt ( conradson ) 20nickel , ppm 30vanadium , ppm 155______________________________________ the same feed is used as in example 1 , under the same process conditions but , instead of propane , the solvent is a mixture of h 2 s / propane in the ratio of 1 / 9 vol . the yields and properties of the recovered deasphalted oil and tar are : ______________________________________deasphalted oil______________________________________yield , % vol . 72gravity , ° api 16 . 6specific gravity at 60 / 60 ° f . 0 . 9554carbon residue , % wt ( conradson ) 7 . 6nickel , ppm 1 . 5vanadium , ppm 8 . 4______________________________________ ______________________________________tar______________________________________yield , % vol . ( by difference ) 28carbon residue , % wt ( conradson ) 24nickel , ppm 50vanadium , ppm 190______________________________________ the same feed is used as in example 1 , under the same process conditions but , instead of propane , the solvet is a mixture of co 2 / propane in the ratio 2 / 8 vol . the yields and properties of the recovered deasphalted oil and tar are : ______________________________________deasphalted oil______________________________________yield , % vol . 69gravity , ° api 16 . 6specific gravity 60 / 60 ° f . 0 . 9554carbon residue , % wt ( conradson ) 7 . 6nickel , ppm 1 . 5vanadium , ppm 8 . 4______________________________________ ______________________________________tar______________________________________yield , % vol . ( by difference ) 31carbon residue , % wt ( conradson ) 22nickel , ppm 40vanadium , ppm 170______________________________________ the same feed is used as in example 1 , under the same process conditions but , instead of propane , the solvent is a mixture of h 2 s / co 2 / propane in the ratio of 2 / 2 / 6 vol . the yields and properties of the recovered deasphalted oil and tar are : ______________________________________deasphalted oil______________________________________yield , % vol . 78gravity , ° api 16 . 6specific gravity , 60 / 60 ° f . 0 . 9554carbon residue , % wt ( conradson ) 7 . 6nickel , ppm 1 . 5vanadium , ppm 8 . 4______________________________________ ______________________________________tar______________________________________yield , % vol . ( by difference ) 22carbon residue , % wt ( conradson ) 27nickel , ppm 60vanadium , ppm 200______________________________________	1
the above and other technical details , features and effects of the present invention will be will be better understood with regard to the detailed description of the embodiments below , with reference to the drawings . the drawings as referred to throughout the description of the present invention are for illustration only , but not drawn according to actual scale . please refer to fig3 a - 3b and 4 - 5 . fig3 a shows an image 30 which is non - uniformly illuminated . fig3 b shows an embodiment as to how the non - uniformly illuminated image 30 of fig3 a is segmented into four non - overlapping regions r 31 - r 34 , in which different regions r 31 - r 34 are exposed by different exposure parameters ( in this embodiment , different exposure durations ed 31 - ed 34 as shown in fig4 ). fig5 shows a flowchart of a region based shutter adaptation method according to an embodiment of the present invention . after obtaining an image 30 ( the step st 1 in fig5 ), the image 30 is segmented into different regions r 31 - r 34 ( the step st 2 in fig5 ). typically , an image includes multiple pixels , so each of the regions r 31 - r 34 include one or more pixels . as shown in fig3 b , in one embodiment , the number of the regions is , for example but not limited to , four . in other embodiments , the number of the regions may be varied as a matter of design choice . besides , in the embodiment of fig3 a - 3b , all the regions r 31 - r 34 are rectangular and all four regions r 31 - r 34 have the same area size . this is only one non - limiting embodiment of the present invention . in other embodiments , the image can be segmented by any other ways wherein the regions can have the same or different shapes , the same or different area sizes , and located by any layout . several non - limiting examples are given in fig6 a - 6d . next , in the step st 3 in fig5 , this embodiment identifies the brightness value of each of the regions r 41 - r 44 . because the image 30 is non - uniformly illuminated , at least some of the regions r 31 - r 34 have different brightness values . the brightness value of a region can be calculated by any suitable ways , and the present invention is not limited to anyone of them . for example , the brightness value of a region can be represented by a brightness value of the brightest pixel in the region ; the brightness value of a region can be represented by an average brightness value of all the pixels in the region ; the brightness value of a region can be represented by a number of the pixels which have a brightness value higher than a brightness threshold ; etc . ( each pixel has a corresponding brightness value .) in the step st 4 in fig5 , this embodiment applies exposure parameters to the regions r 31 - r 34 according to brightness values of the regions r 31 - r 34 . referring to fig3 b and 4 , the region r 32 having the highest brightness value is exposed by a shortest exposure duration ed 32 , while the region r 33 having the lowest brightness value is exposed by a longest exposure duration ed 33 . the regions r 31 and r 34 having middle brightness values are exposed by exposure durations with a time length between the shortest exposure duration ed 32 and longest exposure duration ed 33 . in this embodiment , the regions r 31 and r 34 have similar brightness values , so the exposure durations ed 31 and ed 34 have the same time length . in another embodiment , the exposure durations ed 31 and ed 34 may have different time lengths . the exact time lengths of the exposure durations ed 31 - ed 34 can be determined in correspondence with the brightness values of the regions r 31 and r 34 . in this embodiment , for example , the exposure duration ed 32 is 100 ms , the exposure durations ed 31 and ed 34 are 150 ms each , and the exposure duration ed 33 is 300 ms . certainly , the numbers can change according to practical requirements of exposure . note that , although the embodiment shown by fig3 a - 3b and 4 - 5 discloses three different exposure parameters applied to four regions , the present invention is not limited to this arrangement . the present invention only requires at least two different exposure parameters applied to at least two different regions . the minimum requirement is that the exposure parameter applied to one of the regions is different from the exposure parameter applied to at least another one of the regions . a region other than these two regions can use an exposure parameter which is the same as or different from the exposure parameter of one of the two regions . as compared to the prior art shown in fig2 a - 2b where only one exposure region is assigned to the whole non - uniformly illuminated image 20 , the present invention can obtain better information of the non - uniformly illuminated image 30 because the exposure duration for each respective region can be different . in fig2 a - 2b , because only one exposure duration is applied to everywhere in the image 20 , either the region r 2 is underexposed or the region r 1 is overexposed . however , in the present invention , the information or features in the regions r 31 - r 34 can be respectively obtained by different exposure parameters most suitable to respective regions . note that a “ region ” in an image does not necessarily have to consist of a group of pixels which are directly or indirectly neighboring to one another . for clarity , the term “ directly neighboring ” is defined as two pixels directly in contact with each other ; the term “ indirectly neighboring ” is defined as two pixels which are not directly in contact with each other but can be connected through one or more pixels in the same region . a “ region ” can be a group of pixels by any definition , which can include pixels which are neighboring ( directly or indirectly ) to one another or pixels which are not neighboring to one another . fig7 shows an embodiment wherein a “ region ” includes a group of pixels which are separated from one another . as an illustrative example to explain why the regions are thus defined , it is assumed that the image 50 is a color image wherein each pixel unit includes four pixels 1 - 4 . for example , the number 1 may indicate green pixels ; the number 2 may indicate red pixels ; the number 3 may indicate blue pixels ; and the number 4 may indicate red pixels or a fourth color . please refer to fig7 in conjunction with fig5 . after obtaining an image 50 ( the step st 1 in fig5 ), the image 50 is segmented into four different regions r 51 - r 54 ( the step st 2 in fig5 ), wherein the region 51 includes all the pixels denoted by the number 1 ; the region 52 includes all the pixels denoted by the number 2 ; the region 53 includes all the pixels denoted by the number 3 ; and the region 54 includes all the pixels denoted by the number 4 . ( the shapes circle , square , triangle and rounded - square that encompass the numbers 1 - 4 are used to illustrate the grouping , not about the sizes of the pixels ). in one embodiment , at least one of the regions 51 - 54 consists of pixels of only one color . even if the ambient light is uniform and the image 50 is uniformly illuminated , the brightness of each color may be different in response to such ambient light . for example , there may be stronger light intensity in the green component than the other color components . according to the present invention , for better extracting information or features in the image 50 , the regions r 51 - r 54 can be exposed by different exposure parameters such as by different exposure durations . fig8 a - 8b show two embodiments of the exposure durations of the regions r 51 - r 54 of fig7 . please refer to fig8 a and the steps st 3 - st 4 in fig5 , this embodiment identifies the brightness values of the regions r 51 - r 54 and exposes the regions r 51 - r 54 by corresponding exposure durations ed 51 - 54 ( as shown in fig8 a ). more specifically , for example , the ambient light has strong green component ( strong green light intensity ), weak red component ( weak red light intensity ), and the light intensity of the blue component is in between . therefore , as shown in fig8 a , the exposure duration ed 51 for the region r 51 which includes all the green pixels is the shortest ; the exposure duration ed 53 for the region r 53 which includes all the blue pixels is longer than the exposure duration ed 51 ; and the exposure durations ed 52 and ed 54 for the regions r 52 and r 54 which include the red pixels are the same and the longest . in another embodiment , although the regions r 52 and r 54 are both groups of red pixels , these regions do not have to be exposed by the same exposure duration . as shown in fig8 b , assuming that the regions r 52 and r 54 are both groups of red pixels , these regions r 52 and r 54 are exposed by different exposure durations according to their respective brightness values . that is , pixels of the same color can be divided into different regions and exposed by different exposure parameters such as different exposure durations . in other words , an image can be segmented into different regions by any characteristics of the pixels , such as but not limited to : by locations of the pixels , by colors of the pixels , or by locations and colors of the pixels . the present invention has been described in considerable detail with reference to certain preferred embodiments thereof . it should be understood that the description is for illustrative purpose , not for limiting the scope of the present invention ; for example , the colors of the pixels are not limited to green , red and blue . an embodiment or a claim of the present invention does not need to achieve all the objectives or advantages of the present invention . the title and abstract are provided for assisting searches but not for limiting the scope of the present invention . those skilled in this art can readily conceive variations and modifications within the spirit of the present invention . in view of the foregoing , the spirit of the present invention should cover all such and other modifications and variations , which should be interpreted to fall within the scope of the following claims and their equivalents .	7
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . like numbers refer to like elements throughout . the novel flight subsystem of embodiments of the invention performs the function of an “ electronic hood ” and is worn like glasses or goggles . the pilot eyewear of embodiments of the invention integrates variable opacity optical elements into comfortable glasses , goggles , or any suitable eyewear . this has been accomplished through the use of custom lens structures employing a transmissive - type twisted nematic liquid crystal polymer layer as an electro - active layer . in at least one embodiment , the lens darkening system uses battery powered near infrared light emitting diode ( led ) sources mounted in the cockpit of an aircraft to provide a solid angle cone of invisible light which functions to determine pilot head position . the infrared source and detection system responds to the pilot - in - training head up / down position , allowing the pilot to always see the cockpit - mounted tactical and strategic displays but restricting that pilot &# 39 ; s vision out of the windscreen and / or ( optionally ) side windows . the instructor pilot does not wear the vision restrictive glasses to ensure flight safety . in one embodiment , a controller , linked to the aircraft flight computer or altimeter , commands the lenses to become clear when the test pilot looks through the windscreen when the aircraft is below 200 feet altitude on final approach , enabling the pilot to safely maneuver the aircraft to touchdown . in an alternate embodiment , the infrared source receives the altitude information directly from the altimeter or flight computer and the infrared source stops emitting ( thereby causing the lenses to become clear ) when the aircraft is below 200 feet altitude on final approach . a goal of the invention is to provide a system and method to enable pilots in instrument training to become proficient with instrument metrological conditions or flying solely by cockpit instruments . another goal is to provide a wearable variable vision restriction system which can simulate variable visibility conditions corresponding to various metrological conditions such as clouds , rain , fog , smoke , haze , night time darkness levels , or clear skies . this second goal may be accomplished by selective variation of the lens darkening schemes ( such as by varying duty cycle , excitation frequency , and amplitude of the lens control signal ) combined with selective light scattering mechanisms as additive lens elements , fig1 is block diagram of a system for selectively obscuring a user &# 39 ; s vision , in accordance with one embodiment of the invention . such a system may be used to restrict or obscure a student pilot &# 39 ; s vision during instrument - only flight sessions . the system 10 comprises a head position detection element 12 for detecting a position of the user &# 39 ; s head , eyewear 16 having variably transmittive lenses , and a controller 14 . the controller is configured to receive user head position information from the head position detection element and to control the transmittivity of the lenses based on the user head position information by varying an electrical signal applied to the lenses . the head position detection element 12 may comprise one or more near - infrared light emitting diodes and an associated detector 24 mounted on the user &# 39 ; s head ( e . g ., on a helmet worn by the user ). in one specific embodiment , the head position detection element comprises three near - infrared light emitting diodes , such that one light emitting diode 18 is mounted in front of the user to detect an up and down position of the user &# 39 ; s head and one light emitting diode is mounted on each side of the user to detect a right ( 20 ) and left ( 22 ) position of the user &# 39 ; s head . a collimator 23 is positioned adjacent the detector 24 such that the infrared light from the leds passes through the collimator before being received by the detector ( i . e ., the detector is “ looking through ” the collimator at the leds ). as the leds emit an uncollimated “ cone ” of light , the collimator enables the detector to have a limited field of view that provides angularity in the detection to enable the head position to be determined . for purposes of this application , the combination of the collimator and the detector will be termed a “ collimated detector .” the controller 14 typically controls the transmittivity of the lenses by varying the amplitude or duty cycle of the electrical signal applied to the lenses , such as via signal generator 26 . in one embodiment , the infrared ( ir ) sources ( leds 18 , 20 , 22 ) receive altitude information , such as from altimeter 28 . this altitude information enables the ir sources to cease emitting , thereby lightening the lenses and not obscuring the user &# 39 ; s vision when the aircraft altitude information indicates that the aircraft is below a predetermined altitude ( e . g ., 200 feet ). in an alternate embodiment , the controller 14 may receive the aircraft altitude information , such as from altimeter 28 , and cease applying the signal to the lenses . fig2 - 4 illustrate the operation of the system of fig1 in for pilot training in an aircraft . the user head position information from the head position detection element typically comprises at least information regarding the up / down position of the user &# 39 ; s head relative to a predetermined point in space in front of the user . as such , the controller may be configured to reduce the transmittivity to darken the lenses and thereby obscure the user &# 39 ; s vision when the user &# 39 ; s up and down head position is above the predetermined point in space , and to increase the transmittivity to lighten the lenses and thereby not obscure the user &# 39 ; s vision when the user &# 39 ; s up and down head position is below the predetermined point in space . in one embodiment , the invention allows the pilot to always see the cockpit - mounted tactical and strategic displays ( which may be termed the “ instrument panel ”) but restricting that pilot &# 39 ; s vision out of the windscreen and / or ( optionally ) side windows . in such an embodiment , the predetermined point in space is at the border between the windscreen and the instrument panel ( i . e ., at the “ dashboard ”). this is illustrated in fig2 , 3 a and 3 b . fig2 illustrates a pilot &# 39 ; s view of a windscreen 30 , a dashboard 32 , and an instrument panel 34 of an aircraft . as illustrated in fig2 , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look out the windscreen 30 , the lenses of the variably transmittive eyewear become opaque . conversely , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look at the instrument panel 34 , the lenses of the variably transmittive eyewear become clear . fig3 a and 3b illustrate a side view of a pilot 36 wearing the variably transmittive eyewear 16 . as seen in fig3 a , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look out the windscreen 30 , the lenses of the variably transmittive eyewear become opaque . conversely , as seen in fig3 b , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look at the instrument panel 34 , the lenses of the variably transmittive eyewear become clear . in addition to the up / down position of the pilot &# 39 ; s head , the user head position information may comprise information regarding the left / right position of the user &# 39 ; s head relative to a predetermined point in space in front of the user . as such , the controller may be configured to reduce the transmittivity to darken the lenses and thereby obscure the user &# 39 ; s vision when the user &# 39 ; s left and right head position is more than a predetermined distance from the predetermined point in space . this is illustrated in fig4 . fig4 illustrates a top view of a pilot within an aircraft cockpit . as illustrated in fig4 , when the pilot &# 39 ; s head position indicates that the pilot 36 is attempting to look out either of the side windows 38 , the lenses of the variably transmittive eyewear become opaque . when the pilot &# 39 ; s head position indicates that the pilot is looking forward , the up / down position information determines whether the eyewear is opaque or clear . although not illustrated in the figures , the system may comprise a gaze direction detection element for detecting a direction of the user &# 39 ; s gaze . in such an embodiment , the controller is further configured to receive user gaze direction information from the gaze direction detection element and to control the transmittivity of the lenses based on the user head position information and the gaze direction information . fig5 a and 5b illustrate the location of led receivers in an aircraft 40 , in accordance with one embodiment of the invention . fig5 a is a top view and fig5 b is a side view . as can be seen in fig5 a , three near - infrared light emitting diodes may be used , such that one light emitting diode 18 is mounted in front of the user to detect an up and down position of the user &# 39 ; s head 36 and one light emitting diode is mounted on each side of the user to detect a right ( 20 ) and left ( 22 ) position of the user &# 39 ; s head . as seen in fig5 a , the leds provide a solid angle cone of invisible light which functions to determine pilot head position . as can be seen in fig5 b , the front led 18 is typically mounted on the aircraft dashboard and the side leds are typically mounted above each side window ( the left side led is illustrated in fig5 b ). fig5 b also again illustrates that , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look out the windscreen 30 , the lenses of the variably transmittive eyewear become opaque . conversely , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look at the instrument panel 34 , the lenses of the variably transmittive eyewear become clear . fig6 is a not - to - scale cross section of a lens of variably transmittive eyewear , illustrating the structure of the lens , in accordance with one embodiment of the invention . each variably transmittive lens 50 typically comprises two stacked variable attenuation optical cells 52 sandwiching a half - wave plate 64 . each optical cell 52 may comprise a transparent substrate 60 , an optically transparent electrically conductive layer 58 on the substrate , a transmissive type twisted nematic liquid crystal polymer layer 56 on the electrically conductive layer , a first linear polarization layer 62 on the substrate opposite the electrically conductive layer , and a second linear polarization layer 54 on the liquid crystal polymer layer . the second polarization layer 54 has a transmission axis oriented 90 degrees apart from a transmission axis of the first polarization layer 62 . in at least one embodiment a 4 - 6 micron thickness nematic layer 56 is deposited upon a transparent substrate 60 that is coated with optically transparent indium tin oxide ( ito ). the ito electrically conductive layer 58 acts to provide a uniform electric field in the region between substrates such that the electric field is perpendicular to the substrates and is also coated with a thin variable rotation optical element layer . lens elements ideally comprise optical grade polycarbonate ( but glass also works ) as substrate material . the above described layered lenses serve to accomplish variable light transmission operating as an electro - optical kerr cell over the visible band ( 270 nanometer ( nm ) bandwidth centered on 560 nm ) when a sufficiently large electric field is applied to the ito layers . inside the helically oriented birefringent nematic crystal layer , propagating light is described by two elliptically polarized eigen modes ( which follows the mauguin limit where d times delta n is much greater than phi times lambda divided by pi ( where phi = the twist angle of the liquid crystal layer , d = layer thickness , delta n = birefringence of the liquid crystal , and lambda = center wavelength ( about 560 nm ))). light rays become linearly polarized photons which follow the nematic helix structure resulting in wave - guiding . thus by application of an electric field to the ito layer , the degree of rotation of the nematic crystal can be controlled , which in turn controls the transmission of light through the combined layers . the layers act as electro - optical attenuation cells by effectively rotating the polarization axis of light exiting the first linear polarization layer such that it will also pass through the second linear polarization layer . thus the transmission characteristics may be controlled by an applied electric field of sufficient amplitude to rotate the nematic crystal . the ratio of light transmission through one cell can achieve as much as 500 : 1 extinction ratio with proper excitation . stacking two such variable attenuation cells in sequential optical path with a half - wave plate ( with matching optical transmission characteristics , e . g ., 270 nm bandwidth centered on 560 nm ) positioned in plane parallel fashion results in transmission characteristics dependent upon the orientation of the fast axis of the half - wave plate relative to the transmission axis of the linear polarizers on either side of the half - wave plate . two such layered structures serve as left and right “ unbreakable ” lens elements ( i . e ., considerably more break - resistant than glass of same ( approx . 0 . 7 millimeter ) thickness ) when integrated into a wearable frame with earpieces to be worn like sunglasses . the laminated polarizing films also serve to protect the wearer &# 39 ; s eye ( s ) in the event of accidental lens breakage due to impact . a driver circuit output ( such as from signal generator 26 ) is normally a square wave of 6 to 12 volts amplitude applied directly to the ito layers , but additional rectification and driving the two lens elements in parallel by use of a selective switching matrix greatly increases the extinction ratio . the electrical connection between the driver circuit outputs and the ito lens elements ( both can be located within the glasses frames ) is typically accomplished using interconnecting wires positioned with conductive elastomeric strips in contact with the ito surfaces . overall light transmission / attenuation through each combined lens element is controlled by variation of the amplitude of excitation voltage as well as the duty cycle applied to the ito layers . the overall transmission of light through two “ stacked ” lens cells without excitation is determined by setting the exact angle of the half - wave plates to allow an equivalent amount of light to equal the desired neutral density filter . the equivalent neutral density filter transmission characteristics can be calibrated by comparison with a fixed neutral density filter . the left lens elements dynamic and static light transmission characteristics are typically matched to the right lens elements characteristics to prevent disorientation of the wearer . substrate material : optical grade polycarbonate optical blank dimensions : 4 centimeter ( height )× 6 centimeter ( width ) metallization layer : indium tin oxide transparent , conductive layer deposited over polycarbonate . retarder material ; nematic liquid ( bi - refringent polymer ) crystal polarizing material : dichroic polymer wavelength : wideband 450 to 700 nanometers transmission polychromatic with bandpass centered on 560 nm “ gray ” or “ green ” lens appearance beam divergence : 2 arc minutes distortion : ¼ wavelength transmittance : clear mode = 75 % with unpolarized input lower transmission values obtained by rotation of lens element layers to approximate dark neutral filter ( nd = 4 ) has been determined optimal for full sunlight in cockpit contrast on / off attenuation : currently around 500 : 1 per layer voltage level for transition : 8 to 15 volts 15 volts applied to two lens elements ( positioned serially in optical path ) results in 1000 : 1 attenuation ratio led power supply : coin cell lithium batteries circuitry : flexible detector / driver card in glasses frames standard pc board for infrared led drivers switching ( transparent to dark ) time : 1 millisecond temperature range : 10 to 50 degrees centigrade with minor modifications , such as using an instantly acting ( 10 millisecond to extinction ) optical attenuation cell integrated into eyewear , embodiments of the invention may be capable of protecting a pilot &# 39 ; s eyes by detection and attenuation of hostile laser impingement . many modifications and other embodiments of the invention will come to mind to one skilled in the art to which this invention pertains having the benefit of the teachings presented in the foregoing descriptions and the associated drawings . therefore , it is to be understood that the invention is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims . although specific terms are employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation .	6
the following description is of the best embodiments presently contemplated for carrying out this invention . this description is made for the purpose of illustrating the general principles of this invention and is not meant to limit the inventive concepts claimed herein . referring now to fig1 , there is shown a disk drive 100 which could embody this invention . as shown in fig1 , at least one rotatable magnetic disk 112 is supported on a spindle 114 and rotated by a disk drive motor 118 . the magnetic recording on each disk is in the form of annular patterns of concentric data tracks ( not shown ) on the magnetic disk 112 . at least one slider 113 is positioned near the magnetic disk 112 , each slider 113 supporting one or more magnetic head assemblies 121 . as the magnetic disk rotates , slider 113 moves radially in and out over the disk surface 122 so that the magnetic head assembly 121 may access different tracks of the magnetic disk where desired data are written . each slider 113 is attached to an actuator arm 119 by way of a suspension 115 . the suspension 115 provides a slight spring force which biases slider 113 against the disk surface 122 . each actuator arm 119 is attached to an actuator means 127 . the actuator means 127 as shown in fig1 may be a voice coil motor ( vcm ). the vcm comprises a coil movable within a fixed magnetic field , the direction and speed of the coil movements being controlled by the motor current signals supplied by controller 129 . during operation of the disk storage system , the rotation of the magnetic disk 112 generates an air bearing between the slider 113 and the disk surface 122 which exerts an upward force or lift on the slider . the air bearing thus counter - balances the slight spring force of suspension 115 and supports slider 113 off and slightly above the disk surface by a small , substantially constant spacing during normal operation . the various components of the disk storage system are controlled in operation by control signals generated by control unit 129 , such as access control signals and internal clock signals . typically , the control unit 129 comprises logic control circuits , storage means and a microprocessor . the control unit 129 generates control signals to control various system operations such as drive motor control signals on line 123 and head position and seek control signals on line 128 . the control signals on line 128 provide the desired current profiles to optimally move and position slider 113 to the desired data track on disk 112 . write and read signals are communicated to and from write and read heads 121 by way of recording channel 125 . with reference to fig2 , the orientation of the magnetic head 121 in a slider 113 can be seen in more detail . fig2 is an abs view of the slider 113 , and as can be seen the magnetic head including an inductive write head and a read sensor , is located at a trailing edge of the slider . the above description of a typical magnetic disk storage system , and the accompanying illustration of fig1 are for representation purposes only . it should be apparent that disk storage systems may contain a large number of disks and actuators , and each actuator may support a number of sliders . with reference now to fig3 , 4 and 5 , an example of a lorentz magnetoresistor , ( in this case shown in the form of an extraordinary magnetoresistive sensor ( emr )) 300 for use in a magnetic head 121 ( fig2 ) is shown and described . other lorentz magnetoresistors may be substituted . a lorentz magnetoresistive sensor ( of which an emr sensor is but one example ) is a device that uses the lorentz effect to detect the presence of a magnetic field and register this presence of a magnetic field as a change in electrical properties of the device . the lorentz sensor 300 may be formed in a mesa structure 301 formed on a substrate 304 such as si , gaas , inas , insb or inp . the mesa structure 301 can include a hetero - structure 302 . the heterostructure 302 can include a first layer 306 of semi - conducting material having a first band - gap , a second layer 308 of semi - conducting material formed on the first layer 306 and having a second bandgap that is smaller than that of the first layer 306 , and a third semi - conducting layer 310 of semi - conducting material formed on top of the second layer 308 and having a third band gap that is greater than the second band gap . the materials in the first and third layers 306 , 310 may be similar or identical . an energetic potential well ( quantum well ) is created by the first , second and third semi - conducting material layers due to the different band - gaps of the different materials . thus , carriers can be confined inside layer 308 , which is considered the emr active film , or magnetically active film , in the sensor 300 . this is also referred to as the quantum well or the two - dimensional electron gas ( 2deg ) layer . the first layer 306 is typically formed on top of a buffer layer 312 that may be one or more layers . the buffer layer 312 can comprise several periods of a super - lattice structure that functions to prevent impurities present in the substrate from migrating into the functional layers 306 , 308 , 310 . in addition , the buffer layer 312 is chosen to accommodate the typically different lattice constants of the substrate 304 and the functional layers of the heterostructure 302 to thus act as a strain relief layer between the substrate and the functional layers . one or more doped layers are incorporated into the semiconductor material in the first layer 306 , the third layer 310 , or both layers 306 and 310 , and are spaced apart from the boundary of the second and third semiconductor materials . the doped layers provide electrons ( if n - doped ) or holes ( if p - doped ) to the quantum well . the electrons or holes are concentrated in the quantum well in the form of a two dimensional electron - gas or hole - gas , respectively . n - doping layers are not necessary in the case of alsb / inas / alsb wherein the electrons originate from deep donors in the alsb layers as well as from states in the interface between the alsb and the inas quantum well . higher electron densities can be obtained by the use of te dopant atoms in the alsb liner layers or their vicinity . the layers 306 , 308 , 310 may be for example a al 0 . 09 in 0 . 91 sb / insb / al 0 . 09 in 0 . 91 sb heterostructure grown onto a semi - conducting si substrate 304 with a buffer layer 312 in between . the layers 306 , 308 , 310 may also be alsb / inas / alsb . quantum wells are preferably made of narrow gap materials such as insb , gaas and inas . narrow band - gap semiconductors typically have a high electron mobility , since the effective electron mass is greatly reduced . for example , the room temperature electron mobility of insb and inas are 70 , 000 cm 2 / vs and 35 , 000 cm 2 / vs , respectively . the bottom al 0 . 09 in 0 . 91 sb layer 306 formed on the buffer layer 312 has a thickness in the range of approximately 1 - 3 microns and the top al 0 . 09 in 0 . 91 sb layer 310 can have a thickness in the range of approximately 10 to 1000 nm , typically 50 nm . the doping layers incorporated into layers 306 , 310 have a thickness from one monolayer ( delta - doped layer ) up to 10 nm . the doping layer is spaced from the insb / al 0 . 09 in 0 . 91 sb boundaries of first and second or second and third semi - conducting materials by a distance of 10 - 300 angstrom . an n type doping is preferred , since electrons typically have higher mobility than holes . the typical n - dopant is silicon with a concentration in the range of 1 to 10 19 / cm 3 . in the case of alsb / inas / alsb quantum wells , delta doping is also possible to increment the electron density in the inas quantum well . this is typically done by intercalating a few monolayers of te within the alsb layers . the deposition process for the heterostructure 302 is preferably molecular - beam - epitaxy , but other epitaxial growth methods can be used . a capping layer 314 is formed over the heterostructure 302 to protect the device from corrosion . the capping layer 314 is formed of an insulating material such as oxides or nitrides of aluminum or silicon ( e . g ., si 3 n 4 , al 2 o 3 ) or a non - corrosive semi - insulating semiconductor . the layers 312 , 306 , 308 , 310 , 314 together form the mesa structure 301 . two current leads 316 , 318 and two voltage leads 320 , 322 are patterned over one side of the emr structure 302 so that they make electrical contact with the quantum well 308 . a metallic shunt 324 is patterned on the side opposite the current and voltage leads 318 - 322 of the emr structure 302 so that it also makes electrical contact with the quantum well 308 . an applied magnetic field h ( fig4 ), i . e ., the magnetic field to be sensed , is generally oriented normal to the plane of the layers in the emr structure 302 . the leads 316 , 318 , 320 , 322 typically comprise metallic contacts , for example au , auge , or ge diffused into the device . for the case of an emr device based on si , the leads and shunt material are preferably a metallic alloy of si , such as tisi 2 . fig4 is a top schematic view of the emr sensor 300 through a section of the active film 308 and will illustrate the basic operation of the sensor . in the absence of an applied magnetic field h , sense current through the leads 316 , 322 passes into the semiconductor active film 308 and is shunted through die shunt 324 , as shown by line 402 . when an applied magnetic field h , having a component perpendicular to the plane of the layers in the emr structure 302 , is present , as shown by the arrow tail into the paper in fig2 , current is deflected from the shunt 324 and passes primarily through the semiconductor active film 308 , as shown by line 404 . the change in electrical resistance due to the applied magnetic field is detected across the voltage leads 320 , 318 . although , the emr sensor 300 has been described in terms of a mesa structure 301 having a semiconductor heterostrucure 302 that forms a quantum well , this is by way of example only . various other structures are possible for forming an emr sensor . for example , the mesa structure could be formed as a block of semiconducting material si , without the multi - layer structure 302 . other suitable semiconductor materials are thin films of the iii - v group such as gaas and inas . although such thin films have no quantum well structures , in the case of si , it has been found to provide effective emr sensing capabilities . therefore , the emr sensor described above is for purposes of illustration only , and the integrated amplification of the present invention ( to be described below ) can be used with any form of lorentz magnetoresistive sensor . in addition , although the integrated signal amplification is being described herein in terms of use with an emr sensor , the integrated signal amplification could be used in another type of sensor , such as a giant magnetoresistive sensor ( gmr ) or tunnel junction sensor ( tmr ). fig8 , shows a schematic illustration of an integrated amplification structure that can efficiently amplify a signal from the emr sensor 300 . the proximity of the amplifier to the signal source drastically reduces the added noise concomitant with remote signal amplification . although prior art emr sensors have used the substrate 304 merely as a support structure onto which to build and hold the mesa 301 , the present invention takes advantage of the fact that the substrate is constructed of a semiconductor material and incorporates a signal amplifying transistor within the substrate structure 304 . with particular reference to fig8 , one of the voltage leads 320 is connected with the gate of an integrated amplifier formed in the substrate of 304 . the amplifier circuit 802 can be constructed , for example , as a mosfet transistor amplifier , or some other type of semiconductor based amplifier structure employing other transistor types such as cmos , bi - polar , etc . an insulation layer 804 such as an oxide layer may be formed between the substrate 304 and the emr sensor 300 . although , the integrated amplification can be accomplished with only a single amplifier 802 such as that described above , a second amplifier 810 can be provided , with the gate of the second amplifier 810 being connected with the other voltage lead 322 of the emr or other lorentz magnetorsistor sensor . as can be seen with reference to fig8 , each of the amplifier circuits 802 , 810 can have a source lead 806 , 812 and a drain lead 808 , 814 . these leads can be connected ( such as through a via formed in the oxide layer 804 ) with ancillary electronics ( not shown ) and then to other amplification and processing circuitry such as the data recording channel circuitry 125 discussed above with reference to fig1 . of course , the emr sensor 300 and integrated amplifier 802 and / or 810 could be used in applications other than data recording , in which case the source and drain circuitry 806 , 808 would be connected with other circuitry appropriate to that application . for example , the current leads from the emr device 300 could be connected directly to the built - in amplifier if the emr devices is operated in constant voltage mode , thereby providing an alternative sensing mode to the conventional voltage detection mode . with reference now to fig6 and 7 , a possible structure for constructing an emr sensor 300 with integrated amplification 802 is described . fig6 shows a cross sectional view of the substrate , with the oxide layer 804 formed thereover . fig7 shows a top down view of the structure shown in fig6 . the current leads 316 , 318 and voltage leads 320 , 322 can be formed over the oxide layer 804 . as shown in fig7 , the leads 316 - 322 are connected with the mesa structure of the emr sensor 300 as described with reference to fig3 - 5 or other structure that undergoes a magnetoresistive change in the presence of an external magnetic field . with reference to fig6 , the substrate 304 is constructed of a semiconductor material , such as si , gaas , inas or insb . one or more transistors , such as a mosfet , cmos or some other type of transistor amplifier can be formed in the substrate and appropriately connected with a voltage or a current lead of the emr device 300 . for example , to construct an integrated mosfet transistor amplifier , the substrate can be a p - type material such as si , and portions of the substrate can be implanted with phosphorous through a mask to produce n - doped regions 604 , 606 . in the case shown in fig6 , the voltage lead v 2 322 ( or voltage lead v 1 320 ) provide a gate voltage . the n doped region 604 , can be connected with an electrical lead 602 for example to provide a source current at the n doped region 604 . a lead 608 can be connected with the other n doped region 606 to provide a drain from which a signal can be read . of course , the above description of a specific transistor circuit incorporated into a substrate onto which an emr device is constructed of is for purposes of illustration only . many other types and constructions of transistors can be incorporated into a substrate , and would all fall within the intended scope of the invention . this built - in signal amplification is needed to extend the usefulness of emr devices to detect bit dimensions in the nano - scale regime as it will be required for tb / in 2 recording . the basic upper structure of the emr sensor can be any type of emr sensor device . this invention uses the fact that the substrate material can be used as an active electronic material to provide built - in amplification , rather than merely as a physical support structure providing no electronic functionality as has been the case in the prior art . in such prior art devices , because the signal from the emr device itself is small , the signals have needed to be remotely amplified leading to noise problems and rise - time limitations . the integrated amplification of the present invention avoids these problems by providing signal amplification right at the location of the emr device . in the present invention , amplifiers such as cmos transistors are used to amplify the voltage signal , using the voltage region of the emr device as a gate voltage . this could be used with just one voltage sense , or with compared voltage sense for greater sensitivity . this also gives a low - impedance output , leading to faster device operation . it should also be pointed out that , while the integrated signal amplification has been described above as being useful with an emr sensor , such integrated signal amplification could be used with many other types of magnetic sensor devices . for example , the emr sensor could be replaced with another type of magnetoresistive sensor , such as but not limited to : a current in plane or current perpendicular to plane giant magnetoresistive sensor ( cpp or cip - gmr ); tunnel magnetoresistive sensor ( tmr ) also known as a magnetic tunnel junction sensor ( mtj ); coulomb blockade anisotropic magnetoresistive device ; hall effect sensor ; spin accumulation device ; or spin hall effect sensor . the integrated signal amplification could also be used to amplify a signal of some other sensor devices other than a magnetoresistive sensor . while various embodiments have been described above , it should be understood that they have been presented by way of example only , and not limitation . other embodiments falling within the scope of the invention may also become apparent to those skilled in the art . thus , the breadth and scope of the invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents .	6
in the following description , numerous details are set forth to provide an understanding of the present invention . however , it will be understood by those skilled in the art that the present invention may be practiced without these details and numerous variations or modifications from the described embodiments may be possible . as used herein , the terms “ up ” and “ down ”, “ upper ” and “ lower ”, “ upwardly ” and “ downwardly ” and other like terms indicating relative positions above or below a given point or element are used in this description to more clearly describe some embodiments of the invention . however , when applied to equipment and methods for use in wells that are deviated or horizontal , such terms may refer to a left to right or right to left relationship as appropriate . generally , preferred embodiments of the invention provide a variable flow area valve assembly that includes an axially sliding valve sleeve adapted to regulate the flow of fluid through one or more orifices in the valve housing . the sleeve is axially translated from one flow area position to the next by the pressure of a measured volume of hydraulic fluid bearing on a cross - sectional area of the sleeve . a valve actuator operably attached to the valve housing transmits , from a surface source , the measured volume of hydraulic fluid necessary to shift the valve sleeve position from one flow increment to the next in a sequence of several locations between a fully open position to a fully closed position . the change in fluid flow area as the sleeve is actuated through the incremental positions varies so that predetermined changes in flow condition can be provided . as used herein , flow condition may refer to pressure drop across the valve and / or flow rate through an orifice in the valve . at each position increment of the sleeve translation range between fully open and fully closed , the sleeve is secured from uncontrolled displacement by a resilient snap ring set in a sleeve ring seat . at each designated flow area position , is a detent channel in the valve housing . the snap ring on the sleeve expands into a respective detent channel . each detent channel is defined between parallel channel walls . at least one wall of each channel is formed at an acute angle to the housing axis with each angle being progressively steep . consequently , a relationship may be established between the channel wall angle respective to a particular flow area setting and the hydraulic pressure from the valve actuator necessary to displace the sleeve from the particular flow area to another . with respect to fig1 a , the “ upper ” end of the invention assembly includes an index housing 10 shown in cross - section to be a tubular element having a number of circumferential channels 40 a through 40 g turned about the internal bore perimeter 11 . the side walls of these channels are set at distinctive acute angles . the side walls of the channel 40 a may be cut at 25 °, for example . representatively , the side wall cut for channel 40 b may be cut at 30 °, the sidewall angle of channel 40 c may be 35 °, the sidewall angle for channel 40 d may be 45 °, the sidewall angle for channel 40 c may be 50 ° and the sidewall angle of channel 40 f may be 60 °. as shown by fig1 b , the lower end of the index housing 10 threadably assembles with a tubular actuator housing 12 . the assembly joint between the index housing 10 and the actuator housing 12 compresses a chevron seal 30 that wipes the outer cylindrical surface of an axially shifted flow regulator sleeve 20 . the lower end of the actuator housing 12 threadably assembles with a tubular sub 14 as shown by fig1 d . the bottom end of the sub 14 threadably assembles with a tubular bottom housing 16 . the thread joint between the sub 14 and the bottom housing 16 compresses a chevron seal 34 against the outer cylindrical surface of the axially shifted sleeve 20 . the tubular wall of the actuator housing 12 is perforated by a number of elongated orifices 28 as seen from fig1 c . in open alignment with the actuator housing orifices 28 are the corresponding orifices 26 through a seal compression sleeve 24 . the compression sleeve 24 engages the intermediate chevron seal 36 and is secured by an outer clamp 18 . the chevron seal 36 wipes the regulator sleeve 20 surface . within the housing bore , a tubular sleeve 20 is disposed for a sliding seal fit with the chevron seals 30 , 34 and 36 . through the lower end of the sleeve 20 tube wall , a number of elongated orifices 22 may be provided to cooperate with the housing orifices 26 and 28 . the upper end of the regulator sleeve 20 carries a resilient snap ring 42 in a caging channel 44 shown by fig1 a . the outer corners of the snap ring 42 are chamfered to facilitate radial constriction of the snap ring perimeter by an axial thrust on the sleeve 20 . the sleeve is designed for an operative stroke between the detent channels 40 a and 40 g , inclusive . the snap ring 42 seats into each detent channel 40 for a respective fluid flow relationship through the orifices 22 , 26 and 28 . when the snap ring 42 is seated in detent channel 40 a , the valve is fully closed . when the snap ring 42 is seated in detent channel 40 g , the valve is fully open . at each of the detent channel positions between 40 a and 40 g , a progressively increasing flow area is provided by increased alignment between the sleeve orifices 22 and the housing orifices 26 , 28 . along the outer surface of the sleeve 20 and aligned between the upper housing seal 30 and the intermediate seal 36 is a chevron seal 32 shown by fig1 c . the seal 32 is secured to the sleeve 20 and moves with it as a load piston . the seal 32 wipes the internal bore wall of a housing cylinder 13 and divides it into two variable volume pressure chambers 46 and 48 . the upper pressure chamber 46 is served by a closing hydraulic conduit 50 from a surface source of hydraulic pressure supply as illustrated by fig1 b . the lower pressure chamber 48 is served by a hydraulic conduit 52 from the control actuator 60 as shown by fig1 c . the control actuator 60 is supplied with hydraulic fluid from the well surface through conduit 54 as shown by fig1 b for opening the valve . one embodiment of the control actuator 60 is illustrated in detail by fig2 . an actuation cylinder 61 contains a stepping piston 62 for control of hydraulic fluid flow through the cylinder 61 along a direction of orientation from the supply conduit 54 to the sleeve control conduit 52 . the stepping piston 62 has a sliding seal 65 with the wall of cylinder 61 . a return spring 66 exerts a resilient bias on the stepping piston toward the fluid in - flow end of the cylinder 61 . an orifice closure plug 63 projects axially from the out - flow end of the stepping piston to align with the entrance orifice of the sleeve control conduit 52 . distinctively , the volume 64 of cylinder 61 that is displaced by translation of the stepping piston 62 from the in - flow end of the cylinder 61 as illustrated by fig2 to closure of the conduit 52 by the plug 63 substantially corresponds to the displaced volume of the lower sleeve chamber 48 for advancement of a single opening increment e . g . to move the sleeve snap ring 42 from the detent channel 40 b to the detent channel 40 c . a plurality of stepping piston 62 strokes may be required to move the sleeve 20 from an initial opening of the valve as illustrated by fig1 a and the axial distance between detent channels 40 a and 40 b . the stepping piston 62 further comprises a fluid flow check valve 76 that is oriented to permit a reverse flow of fluid at a limited flow rate from the sleeve control conduit 52 toward the supply conduit 54 by lifting the valve closure off the valve conduit seat against the bias of closure spring 77 . also within the body of the stepping piston 62 is a stepping valve 70 that comprises an orifice closure pintle 74 acting against the valve seat 73 around the flow orifice 71 . a spring 75 exerts resilient bias on the pintle 74 to open the flow orifice 71 . however , a salient end 78 of the pintle 74 projects above the in - flow end - plane of the pintle 74 to close the orifice 71 when the stepping piston 62 is pressed against the in - flow end of the cylinder 61 by the bias of return spring 66 . as illustrated by fig1 d , the regulator sleeve 20 is in the closed valve position . opening of the valve to a minimum flow rate increment requires the sleeve 20 to be advanced upwardly to move the snap ring 42 from the detent position 40 a illustrated to the adjacent detent position 40 b . such linear displacement of the sleeve position relative to the housing requires a finite volumetric increase in the lower pressure chamber 48 . this finite volume of hydraulic fluid is displaced from the displacement chamber portion 64 of the actuation cylinder 61 by the stepping piston 62 as the piston is translated along the cylinder length . opening hydraulic pressure is directed from the surface along the opening hydraulic line 54 into the upper chamber 68 of the cylinder 61 . the initial pressure differential across the opposite faces of the piston 62 closes both piston valves 70 and 76 and overcomes the spring bias 66 to drive the piston 62 toward the control conduit 52 thereby displacing the fluid volume 64 from the cylinder 61 . at the end of the piston 62 stroke , the plug 63 closes the entrance orifice of conduit 52 to terminate the fluid displacement from the actuation cylinder 61 . closure of the conduit 52 is signaled to the surface by an abrupt increase in the pressure of opening line conduit 54 . the fluid displaced from actuation cylinder 61 is channeled into the lower sleeve chamber 48 to drive the sleeve snap ring 42 from detent channel 40 a to 40 b . the resilient bias of the snap ring 42 into the channel 40 b secures the sleeve position at that location . upon receipt of the abrupt pressure increase , pressure in the opening conduit 54 is released at the surface and the return spring 66 is allowed to drive the stepping piston 62 toward the in - flow end of the cylinder 61 . without the high pressure differential across the stepping valve 70 , the spring 75 displaces the pintle 74 from the valve seat 73 to permit a bypass flow of fluid from the conduit 54 through the orifice 71 into the displacement chamber 64 of cylinder 61 until the pintle salient 78 abuts the end wall of the cylinder . the foregoing procedure is repeated for each increment of sleeve opening except that the pressure supplied to the opening conduit 54 that is required to overcome the progressively increased angle of each detent channel wall 40 c through 40 g increases correspondingly . hence , by the pressure value required to advance the sleeve an increment , the identity of the opening increment may be known . from any position of relative opening , the valve may be closed by a surface directed pressure charge along closing conduit 50 into the upper sleeve chamber 46 . see fig1 b and 1c . correspondingly displaced fluid in the lower sleeve chamber 48 follows a reverse flow path along the actuator control conduit 52 into the cylinder 61 and past the stepping piston 62 through the check valve 76 . an alternative embodiment of the invention control actuator 60 is illustrated by fig3 . in this embodiment , the check valve 76 is omitted as separate apparatus . the bias force of stepping valve opening spring 75 is modified to keep the orifice 71 open against the closing bias of return spring 66 to permit a controlled bypass flow of fluid from the lower sleeve chamber when the valve is closed . use of sleeve retainer detent channels 40 having progressive side wall angles is one method of informational feedback for indicating the sleeve position . it should be understood by those of skill in the art that other devices may be used to accomplish the same end such as linear transducers . other applications for the actuator valve 60 described herein may include stepping control for under - reaming tools . it may also be used in a drill - stem testing tool to set an inflatable packer for pressure reversals without unsetting the tool . in another application , the actuator may be used to step set an inflatable packer to different inflation pressures . similar to the present embodiments , the actuator may be used to step set a gas lift valve into different flow rate positions . although the invention has been described in terms of particular embodiments which are set forth in detail , it should be understood that this is by illustration only and that the invention is not necessarily limited thereto . alternative embodiments and operating techniques will become apparent to those of ordinary skill in the art in view of the present disclosure . accordingly , modifications of the invention are contemplated which may be made without departing from the spirit of the claimed invention .	4
fig1 shows a fastener device 100 of the prior art . the prior art fastener 100 has a rounded upper surface 110 , a central hole 120 , an embedded fastener 130 , slots 140 , and a hole 150 . the prior art fastener 100 is made of a molded plastic , and is placed below a slat opening in a slat floor . a common bolt type fastener is inserted into the central hole 120 from above and screwed into the embedded fastener 130 . in this manner , the prior art fastener 100 may be used to fasten equipment to an upper surface of a slat floor . the slots 140 may be used to position or restrain an item being fastened to the slat floor . the hole 150 may be used in conjunction with a tool to hold the prior art fastener 100 in position below a slat opening . fig2 shows one embodiment of a fastener 200 of the present invention . the fastener 200 has a flat upper surface 210 , two sloping upper surfaces 220 , two substantially vertical end surfaces 230 , a bevel 240 , and a central hole 250 . the two sloping upper surfaces 220 are preferrably at an angle from the horizontal of approximately twenty - nine degrees , but may range from , for example , ten to sixty degrees in angle . the width w of the fastener 200 in the preferred embodiment is approximately seven eighths of an inch , which allows the fastener 200 to fit through a standard one inch slat opening . alternatively , the width w of the fastener 200 may vary from , for example , about one - quarter of an inch to about six inches , depending on the size of the slat opening . in the preferred embodiment , the fastener 200 has a length l of approximately one and eleven sixteenths inches , but the length l may vary from about one - quarter of an inch to about twelve inches . in the preferred embodiment , the fastener 200 has a height h of fifteen sixteenths of an inch , but the height h may vary from about one - quarter of an inch to about twelve inches . in the preferred embodiment , the fastener 200 is made of a thermoplastic resin , and more particularly of a thirty percent glass - filled thermoplastic resin . it will be obvious to one skilled in the art that other materials may be used to make the fastener 200 , such as wood , metal , or other plastics having satisfactory qualities . in use , the central hole 250 is capable of receiving an upper fastener component , such as a bolt or a screw ( not shown ). the two sloping upper surfaces 220 function to bring the fastener 200 into a centered position with respect to a slat opening in a slat floor , so that the upper surface 210 and the central hole 250 are centered in the slat opening . the upper fastener component , whether it be a screw or a bolt , may be started into the fastener 200 prior to the fastener 200 being inserted downward through an opening in the slat floor . alternatively , the fastener 200 may be placed underneath an item already in place on the slat floor by means of a tool and then the upper fastener component may be inserted downward into the fastener 200 . when the threads of the upper fastener component meet the thread locking capability of the fastener 200 ( discussed below ) the fastener 200 will turn with the upper fastener component unless a restraining force is applied to the fastener 200 . due to this thread locking capability , the fastener 200 will turn with the upper fastener component unless it is brought upward into contact with the lower surface of the slat floor . the angled surface of the bevel 240 translates a portion of an upward force into rotational force when the fastener 200 is forced upward into contact with the lower surface of a slat floor . in this manner , the fastener 200 is brought into cross - alignment with the slat opening in the slat floor , and held in alignment by the sloping upper surfaces 220 . the fastener 200 can therefore be inserted downward through a slat opening from the upper side of the slat floor , can center itself in the slat opening , and can seek and maintain a position of cross - alignment while being tightened , so that the fastener 200 may function to fasten an item firmly to the slat floor . in one embodiment , an upper fastener component such as a screw ( not shown ) is used in conjunction with the fastener 200 . the screw can be used to fasten an item to the fastener 200 by screwing the screw into the central hole 250 of the fastener 200 . in this embodiment , the central hole 250 must be of a diameter that is less than the diameter of the screw , so that the threads of the screw will be forced into the material of the fastener 200 . the central hole 250 may be of a depth sufficient to accommodate the screw , or alternatively may be deeper , including a central hole 250 that passes all the way through the fastener 250 . in addition , the material of the fastener 200 may be displaced by the screw threads of the screw , creating a friction sufficient to create a thread locking capability between the screw and the fastener 200 . fig3 is a side view of the preferred embodiment of the fastener 200 . the preferred embodiment of the fastener 200 includes an upper central hole 250 , a lower central hole 260 , and a lower fastener component 270 . the lower fastener component 270 is a threaded nut , although alternatively the lower fastener component 270 could be a spring clip or other retainer that attaches to a corresponding upper fastener component inserted into the central hole 250 . the lower fastener component 270 is embedded in substantially the center of the fastener 200 . additionally , the lower fastener component 270 is coaxial with both the upper central hole 250 and the lower central hole 260 , which are also coaxial with each other . due to the embedded nature of the lower fastener component 270 , it is firmly held in place and cannot turn with respect to the fastener 200 when an upper fastener component is inserted and tightened . the upper central hole 250 is sized to accommodate an inserted upper fastener component , and in the preferred embodiment can accommodate a bolt of three - eights of an inch in diameter . the lower central hole 260 is slightly smaller than the upper central hole 250 . the smaller diameter of the lower central hole 260 provides a locking effect to the bolt fastener , as any threaded portion of the bolt that extends beyond the lower fastener component 270 will bite into the sidewall of the lower central hole 260 , with the friction generated between the bolt and the fastener 200 being sufficient to prevent removal of the bolt unless sufficient torque is exerted on the bolt . in the preferred embodiment , the lower central hole 260 is approximately eleven thirty - seconds of an inch to one quarter of an inch in diameter when a three - eighths inch bolt is being used . fig4 is a side view of an alternative embodiment of the fastener 200 , showing the placement of a lower fastener component 270 embedded in the lower surface of the fastener 200 and coaxial with the central hole 250 . the lower fastener component 270 is a threaded lock nut , although alternatively the lower fastener component 270 could be a spring clip or other retainer that attaches to a corresponding fastener component inserted into the central hole 250 . the embedded lower fastener component 270 is held in the fastener 200 by friction , although alternatively it could be loose or held in place by an adhesive or other means . it will be obvious that although the lower fastener component 270 is shown as being recessed into the fastener 200 , it could alternatively rest on the lower surface of the fastener 200 . fig5 illustrates the use of the fastener 200 . the slat floor 500 is generally constructed of concrete of four to five inches in thickness . the slat opening 510 in the slat floor is generally one inch in width . the upper fastener component 520 passes through an item 530 which is to be fastened to the slat floor 540 , and then into the fastener 200 . in use , the fastener 200 is inserted length - wise through the slat opening 510 and then rotated into cross - alignment with the slat opening 510 , as shown . the upper fastener component 520 is screwed into the fastener 200 in order to bring the fastener 200 into firm contact with the slat floor 500 . in this manner , the item 530 can be firmly fastened to the slat floor 500 with the advantage that the fastener 200 can be inserted , cross - aligned , and tightened from the top side of an existing slat floor . although the opening is shown having beveled surfaces corresponding to the sloping upper surfaces 220 , it should be understood that the fastener 200 may be used with any configuration of hole or slot opening , including openings having bevels or sloped sides . while the invention has been described in detail above , the invention is not intended to be limited to the specific embodiments as described . it is evident that those skilled in the art may now make numerous uses and modifications of and departures from the specific embodiments described herein without departing from the inventive concepts .	5
the following description is merely exemplary in nature and is not intended to limit the present disclosure , application , or uses . it should be understood that throughout the drawings , corresponding reference numerals indicate like or corresponding parts and features . as used herein , the terms module , control module , and controller may refer to one or more of the following : an application specific integrated circuit ( asic ), an electronic circuit , a processor ( shared , dedicated , or group ) and memory that execute one or more software or firmware programs , a combinational logic circuit , or other suitable components that provide the described functionality . as used herein , computer readable medium may refer to any medium capable of storing data for a computer or module , including a processor . computer - readable medium includes , but is not limited to , memory , ram , rom , prom , eprom , eeprom , flash memory , cd - rom , floppy disk , magnetic tape , other magnetic medium , optical medium , or any other device or medium capable of storing data for a computer . with reference to fig1 , an exemplary refrigeration system 5 includes a compressor 10 that compresses refrigerant vapor . while a specific refrigeration system is shown in fig1 , the present teachings are applicable to any refrigeration system , including heat pump , hvac , and chiller systems . refrigerant vapor from compressor 10 is delivered to a condenser 12 where the refrigerant vapor is liquefied at high pressure , thereby rejecting heat to the outside air . the liquid refrigerant exiting condenser 12 is delivered to an evaporator 16 through an expansion valve 14 . expansion valve 14 may be a mechanical or electronic valve for controlling super heat of the refrigerant . the refrigerant passes through expansion valve 14 where a pressure drop causes the high pressure liquid refrigerant to achieve a lower pressure combination of liquid and vapor . as hot air moves across evaporator 16 , the low pressure liquid turns into gas , thereby removing heat from evaporator 16 . the low pressure gas is again delivered to compressor 10 where it is compressed to a high pressure gas , and delivered to condenser 12 to start the refrigeration cycle again . with reference to fig1 and 3 , compressor 10 may be driven by an inverter drive 22 , also referred to as a variable frequency drive ( vfd ), housed in an enclosure 20 . enclosure 20 may be near compressor 10 . inverter drive 22 receives electrical power from a power supply 18 and delivers electrical power to compressor 10 . inverter drive 22 includes a control module 25 with a processor and software operable to modulate and control the frequency of electrical power delivered to an electric motor of compressor 10 . control module 25 includes a computer readable medium for storing data including the software executed by the processor to modulate and control the frequency of electrical power delivered to the electric motor of compressor and the software necessary for control module 25 to execute and perform the protection and control algorithms of the present teachings . by modulating the frequency of electrical power delivered to the electric motor of compressor 10 , control module 25 may thereby modulate and control the speed , and consequently the capacity , of compressor 10 . inverter drive 22 includes solid state electronics to modulate the frequency of electrical power . generally , inverter drive 22 converts the inputted electrical power from ac to dc , and then converts the electrical power from dc back to ac at a desired frequency . for example , inverter drive 22 may directly rectify electrical power with a full - wave rectifier bridge . inverter driver 22 may then chop the electrical power using insulated gate bipolar transistors ( igbt &# 39 ; s ) or thyristors to achieve the desired frequency . other suitable electronic components may be used to modulate the frequency of electrical power from power supply 18 . electric motor speed of compressor 10 is controlled by the frequency of electrical power received from inverter driver 22 . for example , when compressor 10 is driven at sixty hertz electric power , compressor 10 may operate at full capacity operation . when compressor 10 is driven at thirty hertz electric power , compressor 10 may operate at half capacity operation . piping from evaporator 16 to compressor 10 may be routed through enclosure 20 to cool the electronic components of inverter drive 22 within enclosure 20 . enclosure 20 may include a cold plate 15 . suction gas refrigerant may cool the cold plate prior to entering compressor 10 and thereby cool the electrical components of inverter drive 22 . in this way , cold plate 15 may function as a heat exchanger between suction gas and inverter drive 22 such that heat from inverter drive 22 is transferred to suction gas prior to the suction gas entering compressor 10 . as shown in fig2 and 3 , electric power from inverter drive 22 housed within enclosure 20 may be delivered to compressor 10 via a terminal box 24 attached to compressor 10 . a compressor floodback or overheat condition is undesirable and may cause damage to compressor 10 or other refrigeration system components . suction super heat ( ssh ) and / or discharge super heat ( dsh ) may be correlated to a flood back or overheating condition of compressor 10 and may be monitored to detect and / or predict a flood back or overheating condition of compressor 10 . dsh is the difference between the temperature of refrigerant vapor leaving the compressor , referred to as discharge line temperature ( dlt ) and the saturated condenser temperature ( tcond ). suction super heat ( ssh ) is the difference between the temperature of refrigerant vapor entering the compressor , referred to as suction line temperature ( slt ) and saturated evaporator temperature ( tevap ). ssh and dsh may be correlated as shown in fig5 . the correlation between dsh and ssh may be particularly accurate for scroll type compressors , with outside ambient temperature being only a secondary effect . as shown in fig5 , correlations between dsh and ssh are shown for outdoor temperatures ( odt ) of one - hundred fifteen degrees fahrenheit , ninety - five degrees fahrenheit , seventy - five degrees fahrenheit , and fifty - five degrees fahrenheit . the correlation shown in fig5 is an example only and specific correlations for specific compressors may vary by compressor type , model , capacity , etc . a flood back condition may occur when ssh is approaching zero degrees or when dsh is approaching twenty to forty degrees fahrenheit . for this reason , dsh may be used to detect the onset of a flood back condition and its severity . when ssh is at zero degrees , ssh may not indicate the severity of the flood back condition . as the floodback condition becomes more severe , ssh remains at around zero degrees . when ssh is at zero degrees , however , dsh may be between twenty and forty degrees fahrenheit and may more accurately indicate the severity of a flood back condition . when dsh is in the range of thirty degrees fahrenheit to eighty degrees fahrenheit , compressor 10 may operate within a normal range . when dsh is below thirty degrees fahrenheit , the onset of a flood back condition may occur . when dsh is below ten degrees fahrenheit , a severe flood back condition may occur . with respect to overheating , when dsh is greater than eighty degrees fahrenheit , the onset of an overheating condition may occur . when dsh is greater than one - hundred degrees fahrenheit , a severe overheating condition may be present . in fig5 , typical ssh temperatures for exemplar refrigerant charge levels are shown . for example , as the percentage of refrigerant charge in refrigeration system 5 decreases , ssh typically increases . to determine dsh , dlt may be subtracted from tcond . dlt may be sensed by a dlt sensor 28 that senses a temperature of refrigerant exiting compressor 10 . as shown in fig1 , dlt sensor 28 may be external to compressor 10 and may be mounted proximate a discharge outlet of compressor 10 . alternatively , an internal dlt sensor 30 may be used as shown in fig4 . in fig4 , a cross - section of compressor 10 is shown . internal dlt sensor 30 may be embedded in an upper fixed scroll of a scroll compressor and may sense a temperature of discharge refrigerant exiting the intermeshing scrolls . in the alternative , a combination temperature / pressure sensor may be used . in such case , tcond may be measured based on the pressure of refrigerant exiting compressor 10 as measured by the combination sensor . moreover , in such case , dsh may be calculated based on dlt , as measured by the temperature portion of the sensor , and on tcond , as measured by the pressure portion of the combination sensor . tcond may be derived from other system parameters . specifically , tcond may be derived from compressor current and voltage ( i . e ., compressor power ), compressor speed , and compressor map data associated with compressor 10 . a method for deriving tcond based on current , voltage and compressor map data for a fixed speed compressor is described in the commonly assigned application for compressor diagnostic and protection system , u . s . application ser . no . 11 / 059 , 646 , publication no . u . s . 2005 / 0235660 . compressor map data for a fixed speed compressor correlating compressor current and voltage to tcond may be compressor specific and based on test data for a specific compressor type , model and capacity . in the case of a variable speed compressor , tcond may also be a function of compressor speed , in addition to compressor power . a graphical correlation between compressor power in watts and compressor speed is shown in fig6 . as shown , tcond is a function of compressor power and compressor speed . in this way , a three - dimensional compressor map with data correlating compressor power , compressor speed , and tcond may be derived for a specific compressor based on test data . compressor current may be used instead of compressor power . compressor power , however , may be preferred over compressor current to reduce the impact of any line voltage variation . the compressor map may be stored in a computer readable medium accessible to control module 25 . in this way , control module 25 may calculate tcond based on compressor power data and compressor speed data . control module 25 may calculate , monitor , or detect compressor power data during the calculations performed to convert electrical power from power supply 18 to electrical power at a desired frequency . in this way , compressor power and current data may be readily available to control module 25 . in addition , control module 25 may calculate , monitor , or detect compressor speed based on the frequency of electrical power delivered to the electric motor of compressor 10 . in this way , compressor speed data may also be readily available to control module 25 . based on compressor power and compressor speed , control module 25 may derive tcond . after measuring or calculating tcond , control module 25 may calculate dsh as the difference between tcond and dlt , with dlt data being receiving from external dlt sensor 28 or internal dlt sensor 30 . control module 25 may monitor dsh to detect a flood back or overheat condition , based on the correlation between dsh and flood back and overheat conditions described above . upon detection of a flood back or overheat condition , control module 25 may adjust compressor speed or adjust expansion valve 14 accordingly . control module 25 may communicate with or control expansion valve 14 . alternatively , control module 25 may communicate with a system controller for refrigeration system 5 and may notify system controller of the flood back or overheat condition . system controller may then adjust expansion valve or compressor speed accordingly . dsh may be monitored to detect or predict a sudden flood back or overheat condition . a sudden reduction in dlt or dsh without significant accompanying change in tcond may be indicative of a sudden flood back or overheat condition . for example , if dlt or dsh decreases by a predetermined temperature amount ( e . g ., fifty degrees fahrenheit ) within a predetermined time period ( e . g ., fifty seconds ), a sudden flood back condition may exist . such a condition may be caused by expansion valve 14 being stuck open . likewise , a sudden increase in dlt or dsh with similar magnitude and without significant accompanying change in tcond may be indicative of a sudden overheat condition due to expansion valve 14 being stuck closed . for example , if dlt or dsh increases by a predetermined temperature amount ( e . g ., fifty degrees fahrenheit ) within a predetermined time period ( e . g ., fifty seconds ), a sudden overheat condition may exist . control module 25 may monitor dsh and dlt to determine whether compressor 10 is operating within a predetermined operating envelope . as shown in fig7 , a compressor operating envelope may provide maximum flood back and maximum and / or minimum dsh / dlt limits . in addition , a maximum scroll temperature limit ( tscroll ) may be provided , in the case of a scroll compressor . in addition , a maximum motor temperature ( tmotor ) may be provided . as shown in fig7 , compressor speed and expansion valve 14 may be adjusted based on dsh and / or dlt to insure compressor operation within the compressor operating envelope . in this way , dsh and / or dlt may move back into an acceptable range as indicated by fig7 . compressor speed adjustment may take priority over expansion valve adjustment . in some cases , such as a defrost state , it may be difficult for expansion valve 14 to respond quickly and compressor speed adjustment may be more appropriate . in the event of a flood back condition , control module 25 may limit a compressor speed range . for example , when dsh is below thirty degrees fahrenheit , compressor operation may be limited to the compressor &# 39 ; s cooling capacity rating speed . for example , the cooling capacity rating speed may be 4500 rpm . when dsh is between thirty degrees fahrenheit and sixty degrees fahrenheit , compressor operating speed range may be expanded linearly to the full operating speed range . for example , compressor operating speed range may be between 1800 and 7000 rpm . the function correlating tcond with compressor speed and power , may assume a predetermined or constant saturated tevap . as shown in fig8 , the correlation between compressor power and tcond may be insensitive to variations of tevap . for additional accuracy , tevap may be derived as a function of tcond and dlt , as described in commonly assigned u . s . application ser . no . 11 / 059 , 646 , u . s . publication no . 2005 / 0235660 . for variable speed compressors , the correlation may also reflect compressor speed . in this way , tevap may be derived as a function of tcond , dlt and compressor speed . as shown in fig9 , tevap is shown correlated with dlt , for various tcond levels . for this reason , compressor map data for different speeds may be used . tcond and tevap may be calculated based on a single derivation . in addition , iterative calculations may be made based on the following equations : multiple iterations of these equations may be performed to achieve convergence . for example , three iterations may provide optimal convergence . as discussed above , more or less iteration , or no iterations , may be used . tevap and tcond may also be determined by using compressor map data , for different speeds , based on dlt and compressor power , based on the following equations : once tevap and tcond are known , additional compressor performance parameters may be derived . for example , compressor capacity and compressor efficiency may be derived based on additional compressor performance map data for a specific compressor model and capacity . such additional compressor map data may be derived from test data . for example , compressor mass flow or capacity , may be derived according to the following equation : where m0 - m19 are compressor model and size specific , as published by compressor manufacturers . compressor map data may be stored within a computer readable medium within control module 25 or accessible to control module 25 . as shown in fig1 , a flow chart for derived parameters is shown . in step 100 , tcond may be derived from compressor power and compressor speed . in step 101 , tevap may be derived from dlt and tcond . in step 102 , capacity / mass flow and a compressor energy efficiency ratio may be derived from tevap and tcond . in addition , by monitoring run time in step 103 , additional parameters may be derived . specifically , in step 104 , load and kwh / day may be derived from run time , capacity / mass flow , eer , and compressor power . by monitoring the above operating parameters , control module 25 may insure that compressor 10 is operating within acceptable operating envelope limits that are preset by a particular compressor designer or manufacturer and may detect and predict certain undesirable operating conditions , such as compressor floodback and overheat conditions . further , control module 25 may derive other useful data related to compressor efficiency , power consumption , etc . where compressor 10 is driven by a suction cooled inverter drive 22 , tevap may be alternatively calculated . because tevap may be calculated from mass flow , tcond , and compressor speed as discussed above , control module 25 may derive mass flow from a difference in temperature between suction gas entering cold plate 15 ( ts ) and a temperature of a heat sink ( ti ) located on or near inverter drive 22 . control module 25 may calculate delta t according to the following equation : ts and ti may be measured by two temperature sensors 33 and 34 shown in fig1 . temperature sensor 33 measures the temperature of the heat sink ( ti ) and may be incorporated as part of inverter drive 22 . alternatively , temperature sensor 33 may measure a temperature of suction gas exiting cold plate 15 and may be located on or near the piping between cold plate 15 and compressor 10 . temperature sensor 34 measures the temperature of suction gas entering cold plate 15 . control module 25 may determine mass flow based on delta t and by determining the applied heat of inverter drive 22 . as shown in fig1 , mass flow may be derived based on lost heat of inverter drive 22 and delta t . as shown in fig1 , the relationship between mass flow , delta t and applied inverter heat may be mapped based on test data . inverter heat may be derived based on inverter speed ( i . e ., compressor speed ) and inverter efficiency as shown in fig1 . with reference again to fig1 , inputs include compressor speed ( rpm ) 120 , compressor current 122 , compressor voltage 124 , compressor power factor 126 , ti 128 and ts 130 . from compressor current 122 , compressor voltage 124 , and power factor 126 , compressor power 132 is derived . from temperatures ti 128 and ts 130 , delta t 134 is derived . from rpm 120 and power , tcond 136 is derived . also from rpm 120 and power 132 , inverter heat loss 138 is derived . from inverter heat loss , and delta t 134 , mass flow 140 is derived . from rpm 120 , tcond 136 , and mass flow 140 , tevap 142 is derived . from tevap 142 and ts 130 , ssh 144 is derived . from ssh 144 and ambient temperature as sensed by ambient temperature sensor 29 , dsh 146 is derived . once dsh 146 is derived , all of the benefits of the algorithms described above may be gained , including protection of compressor 10 from flood back and overheat conditions . as shown by dotted line 141 , tcond and tevap may be iteratively calculated to more accurately derive tcond and tevap . for example , optimal convergence may be achieved with three iterations . more or less iterations may also be used . as shown in fig1 , control module 25 takes as measured inputs compressor speed rpm , inverter drive current , voltage , and power , and heat sink temperatures ti and ts . control module also takes as input ambient temperature as indicated by ambient temperature sensor 29 . as discussed above , control module 25 derives from these measured inputs the outputs of tcond , tevap , mass flow , ssh , dsh , and dlt . as shown in fig1 , control module 25 may monitor slt with slt sensor 35 , which may include a combination pressure and temperature sensor may be used . in such case , tevap may be measured based on the suction pressure as measured by the pressure portion of the combination sensor . further , ssh may be calculated based on slt , as measured by the temperature portion of the combination sensor , and tevap . slt sensor 34 , 35 may be located at an inlet to compressor 10 and may sense a temperature or pressure of refrigerant entering compressor 10 subsequent to inverter 22 , enclosure 20 , or cold plate 15 . alternatively slt sensor may be located at an inlet to enclosure 20 , inverter 22 , or cold plate 15 and may sense a temperature or pressure of refrigerant entering the enclosure 20 , inverter 22 , or cold plate 15 . in addition , similar to the calculation of dsh based on dlt described above , control module 25 may also calculate ssh . for example , compressor power , compressor speed , and compressor map data may be used to derive tcond and tevap may be derived from tcond . once tevap is derived , ssh may be derived from slt and tevap and used as described above for monitoring various compressor operating parameters and protecting against flood back and overheat conditions .	5
the present invention is directed to an improved method for administering a safe and effective dosage of tranilast for the treatment or prevention of restenosis associated with coronary intervention . m . nobuyoshi conducted pathological observations on coronary vessels of 7 patients who died within 3 months after coronary intervention ( ptca ), and reported that excessive proliferation of vascular smooth muscle cells ( hereinafter referred to as vsmcs ) could be observed but excessive production of collagen could not be observed ( ptca , pages 15 - 21 , published by igakushoin , 1988 ). this report suggests that proliferation of vsmcs plays a key role in restenosis associated with coronary interventions . for purposes of the present invention , it was concluded that a drug concentration in human plasma which prevents proliferation of vsmcs is a desirable method for the treatment or prevention of restenosis associated with coronary intervention . this was confirmed by clinical tests . it was found that tranilast significantly prevents proliferation of human vsmcs at 100 micromolar concentration ( 100 μm ) in human plasma ( fukuyama et al , canadian journal of physiology and pharmacology , vol . 74 , no . 1 , pp . 80 - 84 , 1996 ). it was demonstrated that proliferation of vsmcs in humans can be prevented by administering tranilast at a plasma concentration of about 100 μm . data was obtained from clinical studies in which tranilast was administered to three healthy adult humans in a dose of 2 . 5 mg / kg three times per day for a period of five days . it was confirmed that when tranilast was administered in a dose of 2 . 5 mg / kg three times per day , the plasma concentration of tranilast reached a steady state of about 18 . 7 - 27 . 4 μg / ml ( about 57 - 84 μm ) on the 2nd day after the first administration . thus , it was demonstrated that restenosis associated with coronary interventions can be treated or prevented by administering tranilast so as to maintain a plasma concentration of about 100 μm which is effective for preventing the proliferation of human vsmcs . for example , in the case of patients weighing 60 kg , tranilast was administered in a dose of about 500 - 790 mg per day in order to obtain a plasma concentration of about 100 μm which prevents or treats restenosis associated with coronary intervention . since absorption of tranilast varies depending on the weight and sex and age of the patients , the severity of the condition to be treated , and the like , it is preferable to determine a daily dose of tranilast so as to maintain a plasma concentration of about 100 μm in view of the status of patients . a plasma concentration which prevents proliferation of vsmcs varies depending on the nature of patients . therefore , a plasma concentration which prevents proliferation of vsmcs , i . e ., 100 μm , has to be a guide for the treatment or prevention of restenosis associated with coronary intervention . data also was obtained from clinical studies of patients who were administered a dose of 600 mg of tranilast per body per day for a period of 8 weeks to 3 months after coronary interventions ( ptca ), and it was confirmed that the incidence of restenosis after coronary intervention ( ptca ) was less than 20 % with drug treatment . when a placebo was administered to patients , the incidence of restenosis was about 50 %. ueda et al conducted pathologic studies by angiography on cardiovascular vessels after coronary intervention , and reported that a large proliferation of vsmcs occurs at about 12 days after coronary intervention [ kokyu to junkan ( respiration and circulation ), vol . 43 , no . 3 , pp . 257 - 262 , 1995 ]. tamai et al proposed that tranilast has to be administered in a daily dose of 300 - 1000 mg for a period of about 3 - 6 consecutive months after coronary intervention . taking into consideration that proliferation of vsmcs is a critical factor in restenosis associated with coronary intervention , and that proliferation of vsmcs occurs at an early stage after coronary intervention , the method proposed by tamai et al is not the only protocol for the treatment or prevention of restenosis associated with coronary intervention . the data from clinical studies stated above demonstrate that tranilast has to be administered after coronary intervention in a manner which prevents excessive proliferation of vsmcs . it is not necessary to administer tranilast for a period of more than 3 months , since in accordance with the present invention a shorter treatment period is effective for the prevention or treatment of restenosis . tranilast and pharmaceutically acceptable salts thereof of the present invention are known compounds and can be prepared according to standard processes , such as the method described in u . s . pat . no . 4 , 623 , 724 . when tranilast or a pharmaceutically acceptable salt thereof is employed therapeutically , it can be administered in appropriate dosage forms , such as powder , granules , tablets , capsules , dry - syrups , plasters , suppositories , injectable solutions , and the like . a tranilast pharmaceutical composition can be formulated by admixing suitable carriers such as excipients , disintegrators , binders , brighteners , and the like , and prepared in accordance with conventional molding methods and dosage forms . the present invention is further illustrated in more detail by way of the following examples . this example demonstrates the effect of tranilast on proliferation and migration in culture of human vascular smooth muscle cells ( vsmcs ). newborn human aortic smooth muscle cells at the fourth passage culture were provided by kurabo ( osaka , japan ). confluent vsmcs were subcultured at a 1 : 5 split ratio in dmem supplemented with 10 % fbs . vsmcs were used within passages 5 - 10 and were characterized as smooth muscle by morphologic criteria and by expression of smooth muscle α - actin . the cells were negative in mycoplasma assays . the cell proliferation assay was performed by counting the number of cells . first , vsmcs was seeded at a density of 3 × 10 3 cells / cm 2 in dmem supplemented with 10 % fbs in 25 cm 2 tissue culture flasks . the next day , the medium was discarded , and fresh dmem ( 10 % fbs ) containing various concentrations of tranilast was added to the cells . four days after the addition of tranilast , the number of cells was determined with a hematocytometer . cells were grown to confluence in 96 - well tissue culture dishes , and the growth was arrested for 48 hours in a serum - free medium consisting of dmem supplemented with 5 μg / ml insulin , 5 μg / ml transferrin , and 5 ng / ml selenium ( its ). the dmem - its medium was employed to maintain the vsmcs in a quiescent but not catabolic state , a condition that resembles that of healthy cells in the normal arterial wall in vivo ( libby and o &# 39 ; brien 1983 ). the dmem - its medium was then removed , and fresh dmem containing a growth factor was added to the quiescent cells . the cells were subsequently incubated for 20 hours in the absence or presence of tranilast . the cells were then incubated with [ 3 h ] thymidine ( 46 kbq / ml ) for 2 hours in the absence or presence of tranilast . next , ice - cold 10 % trichloroacetic acid was added to each well , and the plates were kept at 4 ° c . for 10 minutes . trichloroacetic acid insoluble materials were then harvested onto unifilter plates ( gf / b 96 , packard instrument , meriden , conn .) with a cell harvester . the extent of [ 3 h ] thymidine incorporation was determined by scintillation counting . the migration of cells was assayed by a modified boyden &# 39 ; s chamber method using a 96 - well boyden chamber apparatus ( neuroprobe inc ., cabin john , md .) ( grotendorst et al 1982 ). chemoattractant ( pdgf - bb ) was first diluted in dmem with or without tranilast and then loaded into the lower wells of the boyden chamber . the wells were subsequently covered with a standard 8 μm pore filter ( nucleopore corp ., pleasanton , calif .) coated with type i collagen . the cell suspensions ( 1 × 10 4 cells ) in dmem containing 0 . 1 % bovine serum albumin ( bsa ) with or without tranilast were then loaded into the upper wells of the chamber , after which the chamber was incubated for 4 hours at 37 ° c . in an atmosphere of 95 % air and 5 % co 2 . nonmigrated cells on the upper surface were scraped off . the filters were then fixed in methanol and strained with diff - quick staining solution ( international reagent corp ., kobe , japan ). the number of vsmcs per 400 × high power field ( hpf ) that had migrated to the lower surface of the filters was then determined microscopically . four hpfs were counted per well , and the values were averaged . tranilast significantly inhibited the proliferation of human vsmcs in a 100μ molar concentration . ( 2 ) effect of tranilast on pdgf - bb - induced dna synthesis in quiescent human vsmcs tranilast significantly inhibited dna synthesis in quiescent human vsmcs that were stimulated with 50 ng / ml pdgf - bb in a 100μ molar concentration . tranilast significantly inhibited the vsmcs migration elicited by 50 ng / ml pdgf - bb in a 100μ molar concentration . this example demonstrates a sufficient dosage period of tranilast for treatment or prevention of restenosis associated with ptca surgery . two hundred eighty eight patients had angina pectoris or myocardial infarction and who underwent successful elective ptca ( including repeat ptca ) in their significant stenotic lesion ( s ) participated in this study . these patients were divided into two groups , and all groups did not differ significantly in sex , age and body weight ; first group received placebo ( hereinafter identified p group ), second group received tranilast in a daily dose of 600 mg ( hereinafter identified t group ). and coronary angiography was performed immediately before and immediately after ptca , and 3 months ( or at the time of withdrawal ) after the completion of drug administration . two hundred fifty - six lesions of two hundred thirty - two patients whose ptca was successful and had not withdrawn participated in efficacy evaluation , and each lesion was evaluated based on the change in stenosis using the following grades . no restenosis : the loss in the stenotic region dilated by ptca was less than 50 % of the gain ( loss / gain & lt ; 50 %). restenosis : the loss in the stenotic region dilated by ptca was not less than 50 % of the gain loss / gain ≧ 50 %). ______________________________________a . patient background ( 188 cases used for analysis ofefficacy ) p group t groupitem classification ( 114 ps ) ( 118 ps ) test______________________________________sex male 86 94 ns female 28 24 p = 0 . 529age & lt ; 65 yrs old 58 68 ns 65 yrs old ≦ 13 17 p = 0 . 302 mean ± s . d . 63 . 8 ± 62 . 5 ± ns 0 . 8 0 . 9 p = 0 . 346body mean ± s . d 60 . 8 ± 60 . 8 ± nsweight 0 . 8 0 . 8 p = 0 . 936______________________________________b . baseline characteristics of lesions ( subjected toefficacy evaluation ) p group t groupitem classification ( 126 ls ) ( 130 ls ) test______________________________________ptca initial ptca 85 100 + repeat ptca 41 30 p = 0 . 096branch rca 40 40 ns lad 55 61 p = 0 . 838 lcx 31 29type type a 16 11 ns type b 107 117 p = 0 . 407 type c 3 2 length of 6 . 1 ± 6 . 3 ± + lesion ( mm ) 0 . 4 0 . 3 p = 0 . 097 mean ± s . d ( n = 67 ) ( n = 64 ) ( n = 63 ) ______________________________________c . resultssubst . admin . term p group t group test______________________________________ ( 1 ) restenosis rate by lesion & lt ; 8 weeks ( 3 ls ) ( 14 ls ) rate 33 . 3 % 42 . 9 % ns p = 1 . 00008 weeks ≦ ( 127 ls ) ( 112 ls ) rate 44 . 1 % 18 . 8 % * p = 0 . 0000 ( 2 ) restenosis rate by patient & lt ; 8 weeks ( 2 ps ) ( 14 ps ) rate 50 . 0 % 42 . 9 % ns p = 1 . 00008 weeks ≦ ( 112 ps ) ( 104 ps ) rate 47 . 3 % 20 . 2 % * p = 0 . 0000______________________________________	0
with reference to fig2 , an “ active cardstack ” 22 is shown as having five images 24 , 26 , 28 , 30 and 32 . the images extend diagonally and provide a perception of rearward images being partially covered by forward images , so that only the foremost image 24 is shown in its entirety . each of the images represents display information of a memory - stored item , such as image files in non - volatile memory or opened desktop windows from volatile memory ( random access memory ). the invention will be described primarily in the embodiment in which the memory - stored items are image files , such as digital photographs . however , other applications of the invention will be described below . since the active cardstack 22 is arranged such that each image 24 - 32 is at least partially exposed , a display icon , such as a cursor , may be moved into perceived contact with any one of the images . the images may be described as first - level images . however , when the cursor is brought into contact with one of the images , a second - level image is formed . thus , the cardstack is a dynamic stack that is manipulated merely by movement of the cursor onto the stack . it is not necessary to “ click ” the device that manipulates the cursor ( e . g ., a mouse ) or to register a keyboard keystroke . in the center portion of fig2 , a cursor 34 is shown as being positioned over the second image 26 . this causes a second - level image to be generated in a position offset from the original position . in the embodiment that will be described with reference to fig3 and 4 , the first - level image is preserved and the second - level image is shown in its entirety . regardless of whether the approach of fig2 or the approach of fig3 and 4 is utilized , the mere repositioning of the cursor causes the stack to be modified to an “ activated cardstack ” 36 . if the cursor 34 is scanned across the images 24 - 32 along a path in which the cursor is sequentially aligned with the images , a corresponding sequence of second - level images will be presented to a viewer . in this manner , each of the images 24 - 32 can be reviewed for content without requiring a repetitive point - and - click process . the number of images within the original cardstack 22 may be fixed or may be selected by the user . if the number of images 24 - 32 is less than the total number of images that can be browsed , the preferred embodiment allows continued browsing without requiring a user input beyond the positioning of the cursor 34 . for example , if the cursor 34 is located immediately to the right of the cardstack 36 , as viewed in fig2 , the next subset of images 38 , 40 , 42 , 44 and 46 is introduced as a second active cardstack 48 . for the purpose of reducing the likelihood that a new cardstack will be introduced unintentionally , there should be a threshold time for the positioning of the cursor before the cardstack is changed . moreover , stack - to - stack incrementing and decrementing icons may be formed to the right and left of the cardstack , respectively , as will be described with reference to fig3 . by positioning the cursor 34 over the decrementing icon , the cardstack 48 may be resubstituted with the original cardstack 22 . referring now to fig3 , a stack 50 of first - level images 52 , 54 , 56 , 58 and 60 is shown in greater detail . a cursor 62 is in perceived contact with the center image 56 , causing a second - level image 64 to be generated . unlike fig2 , the second - level image 64 is shown in its entirety . this is the preferred embodiment , but is not critical . as can be seen , a sufficient portion of each first - level image 52 - 60 is exposed to allow a user to utilize the exposed portions as mnemonic devices . as the number of images in the stack is increased , the ratio of the exposed portion to the overlapped portion will decrease , but the value of the mnemonic aid may be increased , since there will be more images to consider . the window 66 in which the stack 50 resides includes a stack - to - stack incrementing icon 68 and a stack - to - stack decrementing icon 70 . by positioning the cursor 62 in alignment with the incrementing icon 68 for a set period of time , a second stack will be presented to the user . for example , if there are 75 digital images within a library , the entire library will be displayed in stacks of five images if the cursor is left in position along the incrementing icon 68 . in the preferred embodiment , each image in a stack is displayed as a second - level image before the stack is changed . thus , the process will scan through all 75 images in the library . the decrementing icon 70 operates in the reverse manner . optionally , the controlling computer program is configured to allow instant incrementing or decrementing by clicking the computer mouse when the cursor 62 resides on the appropriate icon 68 or 70 . in addition to the display of the second - level image 64 , positioning the cursor 62 in perceived contact with the exposed region of the first - level image 56 triggers the display of file information 72 regarding the image . the file information shown in fig3 identifies the storage location and the size of the image . other information may be included . for applications in which the images 52 - 60 represent web pages , the file information may be the urls of the images . referring now to fig4 , the window 66 of fig3 is shown as being a component of a graphical user interface 74 that includes three other windows 76 , 78 and 80 . the window 76 displays a third - level image 82 that corresponds to the images 56 and 64 . while the second - level image 64 is transitory , since it is removed by moving the cursor 62 , the third - level image 82 will remain after the selection of a displayed stack has been incremented forward or decremented rearward . thus , the display within the window 76 is not based upon the current display of images within the window 66 . the “ loading ” of an image into the window 76 can be triggered by a combination of user designations , such as cursor positioning and mouse clicking . the window 78 presents a menu that is used to select the images for forming the displayed stack 50 within the window 66 . in the illustrated example , the images are stored in a folder 84 and the first - listed image ( i . e ., house 1 ) has been designated as the first image in the displayed stack 50 . the designated image and the following four images in the folder 84 are used to form the stack . the next five images can be used to form a “ next ” stack by positioning the cursor 62 in window 66 over the icon 68 for the set period of time . as an alternative , the first stack may be designated by selecting a folder in which the files are stored . thus , by designating the folder 84 , the first image files in the folder will be used to form the stack 50 . as a user option , the selection of the image files from an image library may be arbitrary . that is , rather than a stack that directly reflects the order of files within the folder 84 , there may be a degree of randomness in the selection of files for forming the stack . the window 80 may be used to transfer or organize the stored images . for example , the third - level image 82 within the window 76 may be transferred to the folder 86 in the window 80 . drag - and - drop techniques may be used to transfer the image 82 from the window 76 or to transfer the corresponding file designation from the window 78 . however , in the preferred embodiment , the manipulation of images can occur without moving the cursor 62 from the window 66 . a combination of computer mouse operations and / or a keystroke may be used to enter one of the images 52 - 60 of the stack 50 into the folder 86 . in this application of the invention , the stack 50 is used for selecting files that are of interest to the user . the image files within a folder having a large library of images can be sorted into a number of more manageable folders by segregating the images on the basis of content ( e . g ., family pictures , work - related pictures , etc ). instead of sorting , the selected images may be duplicated as a result of selections triggered within window 66 . for example , the window 80 in which folder 86 resides may be a window for an auxiliary or a removable storage device . thus , the invention may be used for its browsing - selection capability in addition to its browsing - viewing capability . in one alternative application of the invention , the images 52 - 60 are thumbnail images of video clips . the thumbnail images can be browsed in the same manner as described with reference to the scrolling of digital photographs from a digital camera . however , when a particular thumbnail image is designated for loading into the window 76 , the video clip is automatically run in the window . in another alternative embodiment , the images 52 - 60 in the stack 50 are representative of text documents . the images represent display information for the different text documents . this browsing approach is particularly useful if the text documents include banners or other features that distinguish one document from another . the operations of the invention will be described with reference to fig4 , 5 and 6 . fig5 is an example of a process flow of steps , while fig6 is a simplification of the components for implementing the steps . at step 88 , the system detects an input from a user regarding forming a stack . in fig4 , the image labeled “ house 1 ” is selected from the window 78 for forming the displayed stack 50 , as indicated at step 90 . the selected image is positioned as the first image in the displayed stack . as previously noted , the user input may be a selection of a folder rather than an image and / or may include a degree of randomness in the selection of available images for forming the stack . in fig6 , the images are stored in the image source 92 . the source may be a hard drive of a computer or may be a storage at a remote site , with the images being accessible via a network , such as the internet . for applications in which only the windows 66 and 78 are available , the process steps may be implemented entirely within the digital camera that is used to form the images . in this embodiment , the image source 92 is the memory of the camera . at least one central processing unit ( cpu ) 94 is used to execute the necessary instructions . the cpu is connected to a program 96 , which is stored in non - volatile memory . the user input device 98 may be any one of or a combination of known devices for manipulating a cursor , such as a computer mouse , a trackball or a keyboard . the graphical user interface of fig4 is presented on a display device 100 , such as a monitor . the movement of a cursor across the display device 100 is tracked by the cpu 94 , as indicated at step 102 in fig5 . as a result , the system will be able to detect when the cursor 62 of fig4 is positioned over one of the images 52 - 60 in the stack 50 . when the cursor is positioned over one of the images , the transitory second - level image 64 is presented . this display step 104 allows the user to efficiently browse through the images . the use of the window 76 is not critical to the invention . if the third - level image 82 is desired , the process includes a decision step 106 of determining whether an image has been selected . one acceptable mechanism for selecting the image may be “ clicking ” the computer mouse that controls the cursor 62 . the selection of an image generates the third - level image 82 , as indicated at step 108 . the selection may also be used to duplicate or move the image file to another folder , to print the image , or to otherwise manipulate the selected image or image file . the method also includes the step 110 of detecting when the user has generated a command to change the stack . the command may be a result of selecting another image from the window 78 or may be the result of using the incrementing icon 68 or the decrementing icon 70 . as previously described , merely by positioning the icon 62 over the incrementing icon 68 , a transitory image is formed for each of the first - level images 52 - 60 in the stack 50 before the stack is substituted at step 112 to present a different subset of images that will be scrolled with respect to generating the transitory images . in such a sequence , the step 104 of displaying the transitory images on the basis of cursor location results in all of the transitory images being generated as a result of the location of the cursor on the incrementing icon 68 . as will be well understood by persons skilled in the art , the sequence of steps shown in fig5 may be varied without diverging from the invention . moreover , the diagonal arrangement of images 52 - 60 in the stack 50 of fig4 is not critical . any other overlapping arrangement that conserves display real estate may be substituted . however , an advantage of the diagonal arrangement is that the cursor 62 may be moved in a straight line to sequentially generate a transitory image for each one of the first - level images . while the invention has been described primarily with respect to browsing image files within a computer or digital camera , applications within other equipment have been contemplated . for example , the graphical user interface may be a liquid crystal display ( lcd ) of a digital printer having a number of documents that are stored in memory . the images that represent the documents may be the first - level images that are browsed in the manner described with reference to fig1 - 6 . as the first - level images are browsed , second - level transitory images are presented . selecting a particular image causes the corresponding document to be identified as the document to be printed . in another contemplated embodiment , the invention is used to browse through computer windows . the conventional approach is illustrated in fig7 . a display 114 shows four opened windows 116 , 118 , 120 and 122 . in a lower portion of the display 114 are five icons 124 , 126 , 128 , 130 and 132 . each icon 124 - 132 corresponds to an open window . five icons are present , but only four open windows are shown , since one window is entirely covered by the apparent windows . in the display of fig7 , the “ forward ” window is window 116 . however , by clicking on any one of the five icons , the corresponding window is moved to the “ forward ” position . this procedure works well if the information on the icons easily distinguishes one window from the other windows and when the number of open windows is sufficiently low that the information on the icons is apparent . as the number of open windows increases , the available spacing for the icons decreases . referring now to fig8 , in accordance with this embodiment of the invention , a window - browsing region 134 of a display 136 includes display information for the various open windows . thus , the window 138 that was not apparent in fig7 is represented in the window - browsing region 134 of fig8 . in fact , it is this window that is indicated by the hovering of the cursor 140 , so that a transitory second - level image 142 is formed for the window 138 . by selecting the first - level image in the stack 144 , the window 138 is moved to the “ forward ” position within the display 136 . this provides an easily manipulated process for identifying the open windows and selecting one of the windows . as an alternative embodiment of fig8 , the movement of the cursor 140 over one of the icons in the stack 144 may automatically move the corresponding window 116 - 122 to the “ forward ” position within the display 136 . that is , the transitory window 142 is not critical . in another application , the stack 144 of icons within the window - browsing region 134 represents display information for documents or applications which have not been opened . thus , the icons within the stack 144 may be display information for various applications within a “ start ” list or may be documents that are available using a particular program , such as a word processing program .	6
the present invention is based , in part , on the observation that transmitters of radio frequency signals are calibrated for particular load conditions . in a typical situation , a transmitter is calibrated with test equipment as the load and then used with an antenna as the load . the load conditions created by the test equipment are not necessarily exactly the same as the load conditions created by the antenna , and , moreover , different antennas have slightly different characteristics and may create different load conditions at the output of the transmitter . in some situations , the manufacturer may calibrate the transmitter with one kind of test equipment and a compliance verification laboratory may test the transmitter with another kind of test equipment ( e . g ., for fcc rules compliance ). transmitter load conditions may vary also with environmental changes such as temperatures and humidity variations . for this reason the present invention looked at ways to substantially overcome variations in load conditions and thereby improve power measurement and control in transmission systems . we will examine such ways with the examples that follow . in general , because it recognizes that load conditions are imperfect and often result in standing waves produced from reflected signals interfering with forward signal , the present invention proposes to substantially cancel the effects of the reflected waves . specifically , the present invention proposes to converge reflected waves which are out of phase at substantially 180 ° and thus cancel each other . one approach for implementing this involves quadrature sampling in a directional waveguide . fig3 illustrates a directional waveguide for power detection by quadrature sampling . as shown , the power detection system 100 includes a directional waveguide defined by top , down , input and output planes , 102 a - d , respectively . the bottom plane 102 b has two slots 104 a and 104 b spaced apart a quarter wave distance ( 90 °), based on the frequency band . two probes 106 a and 106 b ( labeled p 1 and p 2 , respectively ) protrude through the slots into the waveguide . the probes are therefore also spaced apart a quarter wave distance , or 90 °. the physical dimensions of the waveguide and , in particular , the distance between the slots 104 a and 104 b depend on the frequency range of transmission . thus , for instance , if the transmission frequency is 50 ghz and the bandwidth is 10 % of the transmission frequency , i . e ., +/− 2 . 5 ghz , a quarter wavelength would be 1 . 5 mm . in this configuration , the probes , p 1 and p 2 , are passive devices such as conductors ( traces ) on a printed circuit board ( pcb ) 120 . the pcb is shaped to allow passage of the two probes through the slots 104 a and 104 b . then , in addition to the probes , the pcb 120 holds detector circuit components such as a 90 ° delay line 108 , a power combiner 110 and a detector diode 112 . the power detector circuit on the pcb is formed with the probe p 1 connected to one side of the power combiner via the 90 ° delay line and with the probe p 2 connected to the other side of the power combiner . the detector diode 112 is connected across the power combiner 110 to receive a signal which represents the measured power . the power combiner in this circuit is a passive circuit such as a resistive connection that produces a voltage drop proportionate to the current induced from the power measured by the probes p 1 and p 2 . the buffer amplifier 114 and downstream stages ( not shown ) are located off the pcb 120 . the buffer amplifier protects the detector diode from the effects of downstream stages in order to maintain the diode &# 39 ; s signal integrity and reliably correlate the output of the diode with the measured power . in operation , the forward signals are any type of transmitted signals at a particular frequency range , having a particular power level and being modulated if they carry any information . un - modulated signals with a particular frequency do not contain any information and they are typically known as the carrier waves . modulated signals carry information and they are created by various modulation techniques examples of which include am ( amplitude modulation ), fm ( frequency modulation ), qam ( quadrature amplitude modulation ), and pwm ( pulse width modulation ). the forward signals travel from the input plane 102 c toward the output plane 102 d and because of imperfect load conditions reflected signals travel in the opposite direction . both forward and reflected signals are intercepted by the probes p 1 and p 2 , which are located 90 ° apart , and converge at the power combiner . as they travel through the waveguide , forward waves intercepted by probe p 1 pass through the 90 ° delay line and thus incur a 90 ° delay . at the same time , forward signals intercepted by probe p 2 pass directly to the power combiner , but they incur a 90 ° delay in reaching probe p 2 because of the 90 ° distance between probe p 1 and p 2 . in other words , because they are equally delayed by 90 °, the forward signals intercepted by probes p 1 and p 2 converge at the power combiner in phase relative to each other . this means that the forward signals &# 39 ; convergence is constructive and the resulting signal is the sum of both . by comparison , the reflected signals converge at the power combiner at opposite phases ( 180 °) relative to each and their convergence is destructive . more specifically , reflected waves intercepted by probe p 2 pass directly to the power combiner while reflected waves intercepted by probe p 1 travel 180 ° before they reach the power combiner ( 90 ° distance to p 1 and 90 ° delay at the delay line ). signals converging at 180 ° phase difference cancel each other . therefore , the destructive convergence of the reflected signals results in them canceling each other and not affecting the power measurement . in other words , the measured power as presented by the voltage across the power combiner is substantially free from load condition variations . the measured power is then reliably detected by the detector diode 112 and the value is passed along via the buffer amplifier 114 to downstream stages ( of the power control loop ). it is noted that the frequency range is scalable to other , higher frequencies simply with changes to the pcb layout design and changes to the waveguide dimensions and distance between the slots . in essence , there would be one set of dimensions for each frequency , but the fundamental design is similar for the various frequencies . the ease with which a pcb can be designed and made is one advantage of the present invention . it is further noted that the depth of insertion of the probes into the waveguide controls the sensitivity of the detector circuit ( i . e ., the power level detection voltage at the power combiner ). hence , the ease with which the pcb can be adjusted to achieve the proper depth of protrusion into the waveguide is yet another advantage of the present invention . furthermore , the pcb can be made sufficiently small that it fits easily inside the waveguide body . fig4 is an isometric view of a waveguide , taken apart , and a pcb with the power detection circuit . in this illustration , the waveguide is produced when the two semi - circular members 101 a and 110 b are joined . the material these members are made out of is suitable for microwave applications and is therefore suitable for producing the waveguide . when joined , the two members form a cylinder with a duct which , in this case , has a rectangular cross section and is substantially aligned with the axis of the cylinder . the length of the cylinder determines the length of the duct and , in turn , the length of the waveguide ( as necessary for the particular frequency band ). the shape and dimensions of the duct define the walls of the waveguide and particularly the top , bottom , input and load planes 102 a - d . the bottom plane 102 b has two notches that define the slots 104 a and 104 b through which the probes 106 a and 106 b can protrude into the waveguide . being smaller than the length of the waveguide , the distance between the slots , and in turn the probes , is set to a quarter wavelength ( 90 °) which varies with the transmission frequency band . one or both members accommodate the pcb and the slots . specifically , one or both members 101 and 101 b have a detector notch extending below the bottom plane ( not shown ) for fitting the pcb with the power detection circuitry between them when the members are joined such that the probes are allowed to protrude through the slots sufficiently to produce the desired sensitivity . moreover , the notches that define the slots 104 a and 104 b in the bottom plane 102 b are carved out of one or both members , depending on whether the detector notch is provided in one or both members . as mentioned before , the detector circuitry is mounted on the pcb and because the circuit components are small the pcb dimensions can be small as well . what changes with frequency is the waveguide dimensions and the distance between the probes and the slots . the frequency change requires very simple redesign of the pcb layout and mechanical dimensions of the members that produce the waveguide . therefore , this configuration is easy to manufacture in commercial applications and the results are easily repeatable . in sum , the present invention provides ways in which reliable power detection and control can be achieved despite variations in load conditions ; and the mechanical - electrical configuration of the power detection system is relatively simple and less costly to produce . thus , although the present invention has been described in considerable detail with reference to certain preferred versions thereof , other versions are possible . in other words , the spirit and scope of the appended claims should not be limited to the description of the preferred versions contained herein .	6
fig1 is a general plan view of a portion of a document processing machine , like a document sorting machine , designated generally as machine 10 . the document handling apparatus of this invention is included in the machine 10 and is designated generally as apparatus 12 . the apparatus 12 includes a receptacle means 14 for receiving or pocketing documents to be stacked therein ; an entry drive roller means 16 for receiving a document 18 from a document track 20 ; a cupping means 22 for cupping the document 20 to be stacked ; and a wave guide means 24 which facilitates moving the trailing edges of the documents already in the receptacle means 14 out of the way of the leading edge of a document to be pocketed in the receptacle means 14 . the receptacle means 14 , the entry drive roller means 16 , the cupping means 22 , and the wave guide means 24 are all mounted on a planar member or support 26 . the machine 10 may include a plurality of the &# 34 ; pockets &# 34 ;, like apparatus 12 shown in fig1 . as the document 18 moves along the document track 20 ( from left to right as viewed in fig1 ), a conventional pocket selector 28 is used to divert the document 18 from the document track 20 to the apparatus 12 . the selector 28 is controlled by a controller 30 shown in fig2 . in one position , the selector 28 is used to divert all those documents which should be pocketed in the apparatus 12 into the apparatus 12 , and in a second position , it is used to permit the documents to be pocketed in other pockets to be moved downstream to such additional pockets ( not shown ). a selector , like 32 ( fig2 ), may be used for such additional pockets or apparatuses . the entry drive roller means 16 ( fig1 ) includes a drive roller 16 - 1 and an associated pinch roller 16 - 2 to move a document 18 along the document track 20 . a conventional transport drive 34 , under the control of the controller 30 , is used to rotate the drive roller 16 - 1 . when a document 18 is to be pocketed in the apparatus 12 , the controller 30 actuates the selector 28 to divert the document 18 towards the apparatus 12 . the document 18 is partially bent as it travels around the periphery of the drive roller 16 - 1 in moving towards the cupping means 22 . the cupping means 22 includes an initial cupping rib 22 - 0 which is located on a guide member 24 - 1 associated with the wave guide means 24 . the guide member 24 - 1 is shown in more detail in fig3 along with the location and shape of the cupping rib 22 - 0 located thereon . one of the features of the apparatus 12 relates to a sloped wall 24 - 2 on the guide member 24 - 1 . when a very thin or flimsy document 18 passes around the drive roller 16 - 1 , centrifugal force tends to force the top edge of the document 18 away from the drive roller 16 - 1 . with the sloped wall 24 - 2 , a thin document 18 is supported as it rides up the sloped wall 24 - 2 in moving in the direction of arrow c in fig3 . the cupping rib 22 - 0 facilitates the start of the cupping process , and the cupping is completed by a cupping drive roller assembly which includes first , second , and third drive rollers 22 - 1 , 22 - 2 , and 22 - 3 , respectively , ( shown in fig5 ). the initial cupping rib 22 - 0 minimizes the noise generated by the document encountering the drive rollers 22 - 1 , 22 - 2 , and 22 - 3 . this is an important feature , especially when the apparatus 12 is to be used in an environment where excessive noise is undesirable , as in a banking environment . the first , second , and third drive rollers 22 - 1 , 22 - 2 , and 22 - 3 are mounted on a shaft 22 - 4 with suitable spacers 22 - 5 and 22 - 6 and o - ring drive portions 22 - 7 and 22 - 8 as shown in fig5 . the first and third rollers 22 - 1 and 22 - 3 are made of a &# 34 ; hard drive &# 34 ; material while the second drive roller 22 - 2 is made of a &# 34 ; soft drive &# 34 ; material , with the first and third rollers mentioned being equidistantly spaced from the second drive roller 22 - 2 . as used herein , a soft drive material has a higher coefficient of friction than does a hard drive material , and in the embodiment described , the second drive roller 22 - 2 is made of a resilient material like nitrile rubber , for example . for a hard drive material , polycarbonate plastic may be used . in effect , there are two drive forces being applied by two different materials ( those just named ) at three locations , namely , by drive rollers 22 - 1 and 22 - 3 and by the second drive force associated with the second drive roller 22 - 2 and its associated pinch roller 22 - 9 . the pinch roller 22 - 9 ( fig6 ) is resiliently biased into engagement with the second drive roller 22 - 2 and , in effect , is a steel roller bearing . by the construction described , the second drive roller 22 - 2 tends to supplement the pull of the document 18 from the entry drive roller means 16 . this action reduces a ripple effect caused when a document reacts to the usual &# 34 ; cornering motion &# 34 ; in prior art devices when passing around a drive roller prior to encountering a cupping device . reducing the ripple effect reduces the noise associated with the apparatus 12 . this is a feature of the apparatus 12 , with fig6 showing the document 18 ( in dashed outline ) being cupped by the cupping means 22 . another feature of the cupping means 22 is that it can be assembled one way or 180 degrees relative to this one way with no loss in function . this is because the first and third drive rollers 22 - 1 and 22 - 3 are equidistantly spaced from the second drive roller 22 - 2 , with the same being true for the o - ring drive portions 22 - 7 and 22 - 8 relative to second drive roller 22 - 2 . the rod 22 - 4 is supported in a support 36 secured to the planar support 26 . o - ring belts , like belt 34 - 1 shown in fig1 engage the drive portions 22 - 7 and 22 - 8 to rotate the first , second , and third drive rollers 22 - 1 , 22 - 2 , and 22 - 3 . the o - ring belts 34 - 1 are coupled to the drive rollers 16 - 1 . the dimensions and geometry of the drive rollers 16 - 1 and the drive rollers 22 - 1 , 22 - 2 , and 22 - 3 are such as to enable the second drive roller 22 - 2 to pull the document 18 from the drive rollers 16 - 1 as previously discussed . the wave guide means 24 , alluded to earlier herein with reference to fig1 includes a wave guide member or document spring 24 - 3 shown in fig1 . u . s . pat . no . 4 , 640 , 505 , which is assigned to the same assignee as is the present application , explains the general functioning of a document spring generally similar to the document spring 24 - 3 . fig1 shows the position of the document spring 24 - 3 when no documents are in the receptacle means 14 . ( the pressure plate 14 - 5 is displaced in fig1 from its normal position which is biased to the right as shown in fig7 .) one end of the document spring 24 - 3 passes through an opening 24 - 4 in the guide member 24 - 1 ( fig3 ), and the remaining end thereof passes through an opening 24 - 5 in the guide member 24 - 1 . each of the ends of the document spring 24 - 3 has a rectangular opening therein which passes over a circular post , like 40 and 42 shown in fig1 and fits on to a mating rectangular boss 56 ( fig1 ) as will be discussed hereinafter . the alignment of the post 42 is such that its longitudinal axis is substantially parallel to the direction that the document 18 assumes when being moved from the entry drive roller means 16 towards the guide member 24 - 1 . the post 40 is substantially perpendicular to the guide member 24 - 1 . a button 44 fits over the post 40 to retain the end of the document spring 24 - 3 on its associated rectangular boss and similarly , a button 46 fits over the post 42 to retain the remaining end of the document spring 24 - 3 on its associated rectangular boss 56 . the construction associated with the buttons 44 and 46 provides an easy way for an operator of the machine 10 to replace the document spring 24 - 3 when necessary . fig7 is a view , similar to fig1 showing how the trailing edges 18 - 1 of documents 18 already in the receptacle 14 means tend the block the entry of the next document to be pocketed therein . fig8 is a schematic showing of how a &# 34 ; wave &# 34 ; 24 - 6 , developed by the document 18 pushing the document spring 24 - 3 , tends to move the trailing edges 18 - 1 of those documents already in the receptacle means 14 out of the way of the next incoming document 18 . as the leading edge of the document 18 enters the receptacle means 14 , the wave 24 - 6 which was developed , tends to move out of the opening 24 - 4 ( fig3 ) in the guide member 24 - 1 . the wave guide means 24 also includes a rib 24 - 7 ( fig3 ) located on the guide member 24 - 1 which helps to maintain the cupping of the document 18 as it is moved towards the receptacle means 14 . there are also three ribs 24 - 8 ( fig3 ) located on the guide member 24 - 1 ; these three ribs assist the document spring 24 - 3 from exerting increasing pressure on the document 18 , and they provide a smooth transition to the drive rollers 14 - 2 and 14 - 3 ( fig1 ). ribs 24 - 9 located on opposed sides of the rib 24 - 7 also facilitate the cupping function . as the leading edge of the document 18 enters the receptacle means 14 , it encounters the lower and upper stacking drive rollers 14 - 2 and 14 - 3 ( fig1 ) which drive the leading edge of the document 18 towards a stop 14 - 4 . these stacking drive rollers 14 - 2 and 14 - 3 are conventionally driven in a counter - clockwise direction ( as viewed in fig8 ) by the transport drive 34 shown in fig1 . the receptacle means 14 also has a conventional pressure plate 14 - 5 which is conventionally biased to move towards the stacking guide 14 - 1 as shown in fig7 and 8 . the pressure plate 14 - 5 has clearances or openings 14 - 6 therein to prevent the lower and upper stacking drive rollers 14 - 2 and 14 - 3 from abrading thereagainst when the receptacle means 14 has no documents therein . the receptacle means 14 also includes ribs 14 - 7 and 14 - 8 which prevent a chatter caused by the first or first few documents 18 entering the receptacle means 14 . the rib 14 - 7 , shown in fig9 is located on the pressure plate 14 - 5 below the opening 14 - 6 , and the rib 14 - 8 is located on the stacking guide 14 - 1 above the stacking drive roller 14 - 2 . rib 14 - 9 is located on the stacking guide 14 - 1 and is centered between the drive rollers 14 - 2 and 14 - 3 . as documents 18 are stacked within the receptacle means 14 , the pressure plate 14 - 5 moves away from the stacking guide 14 - 1 until the pressure plate 14 - 5 cooperates with a &# 34 ; full &# 34 ; sensor 48 ( fig1 and 2 ) to indicate to the controller 30 and the operator of the machine 10 that then receptacle means 14 is full . the operator can the remove the stack of documents 18 from the receptacle means 14 to repeat the process . an additional full sensor 50 is shown for an adjacent apparatus ( not shown ) similar to apparatus 12 . an off / on switch 52 is shown for the controller 30 . fig1 shows the structure for securing the document spring 24 - 3 to the wave guide means 24 . in this regard , the post 42 receives the rectangular opening 54 in the end of the document spring 24 - 3 after being inserted through the opening 24 - 5 . the post 42 extends from a quadrilaterally or rectangularly - shaped boss 56 which is part of the wave guide means 24 . the rectangular opening 54 in the document spring 24 - 3 fits onto the rectangular boss 56 to maintain the document spring 24 - 3 in the proper position as shown in fig1 . the button 46 is made of a resilient material and has a round hole 58 therein to fit on the post 42 and a round hole 60 ( fig1 ) to fit on the rectangular boss 56 . the round hole 60 is forced over the square boss 56 without any need for orientation . this is a feature which enables an operator of the machine 10 to replace the document spring 24 - 3 when necessary . the post 40 and the button 44 have a construction which is similar to that just described relative to post 42 and button 46 . a feature of this invention is that the receptacle means 14 , the entry drive roller means 16 , the document track 20 , the cupping means 22 , and the wave guide means 24 are all mounted on the same level on the planar support 26 . in some of the prior art apparatuses , the receptacle means was lower than the document track ; this meant that as a document was fed from the document track to the receptacle means , the lower leading edge of the document would &# 34 ; crash &# 34 ; into the support plate , causing some crimping of the lower edge . this caused some jamming of documents at the receptacle means . another feature is that the cupping rib 22 - 0 initiates the cupping of the document 18 ; however , more importantly , it reduces the impact of the leading edge of the document 18 as it approaches the cupping means 22 , and this reduces the noise of such an impact . the clearance openings 24 - 5 and 24 - 4 ( fig3 ) in the guide member 24 - 1 enable the document spring 24 - 3 to provide an improved performance compared to prior art devices . in the embodiment described , the document spring 24 - 3 has a width of 0 . 334 inch , a thickness of 0 . 003 inch , and is made of kapton plastic material . the first opening 24 - 5 reduces the impact that the leading edge of the document 18 encounters when first contacting the document spring 24 - 3 ; however , it still permits the leading edge to create the wave 24 - 6 shown in fig8 . when the wave 24 - 6 ( formed by the document 18 ) reaches the second opening 24 - 4 , the document 18 forces the wave through the opening 24 - 4 . this construction consistently locates the entry point at which the document 18 enters the receptacle means 14 . because the stacking drive rollers 14 - 2 and 14 - 3 are located relative to the opening 24 - 4 , it means that the leading edge of each of the documents entering the receptacle means 14 does so at about the same point relative to these rollers 14 - 2 and 14 - 3 . with the construction described , the document spring 24 - 3 of the present apparatus 12 has been used to pocket over 7 , 000 , 000 documents while showing no signs of wear , whereas a document spring used in the apparatus disclosed in the patent mentioned earlier herein had a useful life of pocketing about 1 , 000 , 000 documents . the stacking drive rollers 14 - 2 and 14 - 3 are made of nitrile rubber and are spaced apart and parallel to each other so as to drive the document 18 towards the stop 14 - 4 without any tilting or skewing .	1
fig1 through 5 , discussed below , and the various embodiments used to describe the principles of the present invention in this patent document are by way of illustration only and should not be construed in any way to limit the scope of the invention . those skilled in the art will understand that the principles of the present invention may be implemented in any suitably arranged device . fig1 depicts a simplified cross section of a conventional high performance silicon germanium : carbon ( sige : c ) based heterojunction bipolar transistor ( hbt ) base structure 100 . two layers of sige : c 101 sandwich a dopant layer 102 . the base regions of most conventional sige : c hbts use phosphorus ( p ) as the dopant to form dopant layer 102 . fig2 depicts an example of a secondary ion mass spectrometry ( sims ) profile 200 of the dopant concentration , in atoms per cubic centimeter ( atom / cm 3 ), as a function of depth , in micrometers ( μm ), when conventional doping methods are used . in this case , the dopant , phosphorus ( p ), exhibits high levels of segregation as carbon ( c ) and germanium ( ge ) concentrations are varied . the concentration of c is shown by plot 201 and depicted by a thick solid line , while the concentration of ge is shown by plot 203 and depicted by a thin solid line . the concentration of p , on the other hand , is shown by plot 202 and depicted by a dotted line . the overall dopant profile resulting from conventional doping methods is not very sharp , but in fact relatively broad . the steepness or sharpness of the resulting curve due to phosphorus segregation is approximately 20 nanometers per decade ( 20 nm / dec ). high p segregation adversely affects important transistor characteristics such as the gain , early voltage , voltage between the base and collector , and cutoff frequency . accordingly , sige : c transistors made in accordance with conventional doping methods exhibit relatively poor rf and dc performance . fig3 depicts an exemplary process diagram 300 for atomic layer doping ( ald ) in accordance with an embodiment of the present disclosure . process 300 begins at step 301 with a silicon surface layer 401 a ( see fig4 ) in an ambient temperature of approximately 400 degrees celsius ( 400 ° c .). silicon surface layer 401 a is baked at about 900 ° c .) in step 302 to remove any residual contaminant from the surface . then , in step 303 , silicon surface layer 401 a is cooled to appropriately 600 - 650 ° c . at an ambient temperature of approximately 600 ° c ., a silicon buffer layer 401 b is grown on top of the silicon surface layer 401 a in step 304 . the thickness of silicon buffer layer 401 b is grown to about 2 - 10 nm . preferably , si buffer layer 410 b is grown to about 5 nm . the concentration of ge and c are preferably controlled to remain substantially matched during steps 305 through 310 . process 300 continues in steps 305 and 306 , where the ambient temperature is kept at approximately 600 ° c . and two epitaxial layers of germanium ( ge ) are purged into the silicon cap layer grown in step 304 . steps 305 and 306 control ge grading from essentially zero to about 20 %. preferably , ge grading is sustained at about 15 % ge . after purging the silicon cap layer grown in step 304 with ge , a sige : c layer 402 ( see fig4 ) is formed in step 307 . the thickness of sige : c layer 402 is generally kept between 30 - 100 nm . preferably , sige : c layer 402 is about 50 nm thick . sige : c layer 402 is then exposed to an nitrogen ( n 2 ) ambient and cooled to approximately 500 ° c . in step 308 . conventional ald doping processes typically expose a sige : c layer to an h 2 ambient during the purging cycle . process 300 continues by maintaining the deposition temperature at about 500 ° c . in steps 309 and 310 . this is a reduction in temperature over conventional ald doping processes . at 500 ° c ., doping segregation effects are minimized while maintaining a high epitaxial growth rate and complying with any other manufacturing requirements . in step 309 , the epitaxial growth process is temporarily interrupted and the surface of the sige : c layer 402 is exposed to dopant , preferably p , for about one minute . the result is phosphorous ald layer 403 ( see fig4 ). the concentration of dopant , p , is about 1 × 10 13 atoms / cm 2 and 1 × 10 14 atoms / cm 2 . preferably the concentration of dopant , p , is about 3 . 5 × 10 13 atoms / cm 2 . although phosphorus is a preferred dopant , it should be understood that other dopants , such as arsenic and antimony , may also be used in accordance with the present disclosure . after exposure to phosphorus in step 309 , sige : c spacer 404 ( see fig4 ) is allowed to grow in an n 2 ambient for a predetermined amount of time in step 310 . sige : c spacer 404 is grown to a thickness between about 2 - 20 nm . preferably , sige : c spacer 404 is grown to about 10 nm . in step 310 , the top surface of the sige : c spacer 404 , is exposed to an n , ambient to aid eventually reducing vapor pressure ( vp ) auto - doping due to any hydrogen carry - over or memory effect later in process 300 . in step 311 , the sige : c spacer 404 is exposed to a hydrogen ambient ( h 2 ). at this stage of process 300 preferably exposes the sige : c spacer to an h 2 ambient rather than an n 2 ambient . at higher temperatures , an n 2 ambient would adversely react with silicon , while an h 2 ambient facilitates building a silicon cap faster than the same in an n 2 ambient . process 300 continues in step 312 by increasing the ambient temperature to about 650 ° c . and growing a final silicon cap layer 405 ( see fig4 ). silicon cap layer 405 is grown to a thickness between about 20 nm and 60 nm . preferably , silicon cap layer 405 is about 40 nm thick . after cooling the temperature to about 600 ° c . in step 313 , the resulting base structure 400 ( see fig4 ) may be removed . in summary , process 300 results in the exemplary base structure 400 illustrated in fig4 . silicon surface layer 401 a is topped with silicon buffer layer 401 b . sige : c layer 402 is grown on top of silicon buffer layer 410 b . a phosphorous ald layer 403 is grown on top of the sige : c layer 402 . the sige : c layer 402 is topped with a sige : c spacer 404 . the resulting base structure 400 is finished off with a silicon cap layer 405 . fig5 depicts an example of a sims profile 500 illustrating dopant concentration ( atom / cm 3 ) as a function of depth ( μm ) when exemplary doping methods in accordance an embodiment of the present disclosure are used . the concentration of dopant , p , is shown by plot 501 in fig5 . on the other hand , the concentration of ge is shown by plot 502 , concentration of silicon is shown by plot 504 and c show in plot 503 . the concentrations of ge ( plot 502 ) and c ( plot 503 ) are substantially matched prior and post phosphorous ald . the steepness of the profile is optimized to about 6 nm / dec and full width at half maximum in less than 10 nm at 500 ° c . n 2 . preferably , the steepness of the profile should be minimized . thus , unlike conventional methods , preferred embodiments of the present disclosure match the percentage concentration of ge and c during the ald process , while controlling exposure to an ambient nitrogen at about 500 ° c . a sige : c spacer post ald deposition in n 2 is absent from conventional methods . the steepness of the base profile is optimized to at least 6 nm / dec at 500 ° c . n 2 versus a 20 nm / dec at 600 ° c . h 2 exhibited by conventional methods . accordingly , a robust process with sharp base profiles conducive for use in , for example , complimentary high speed bicmos where ald techniques are is disclosed . such techniques yield less sensitivity to process temperatures and make it possible to reduce exposure times while minimizing outdiffusion . it is important to note that while the present invention has been described in the context of a fully functional process , those skilled in the art will appreciate that at least portions of the process are capable of adapting to a variations within the process without deviating from the preferred embodiments described above . although the present invention has been described in detail , those skilled in the art will understand that various changes , substitutions , variations , enhancements , nuances , gradations , lesser forms , alterations , revisions , improvements and knock - offs of the invention disclosed herein may be made without departing from the spirit and scope of the invention in its broadest form .	7
the following detailed description and appended drawings describe and illustrate various exemplary embodiments of the invention . the description and drawings serve to enable one skilled in the art to make and use the invention , and are not intended to limit the scope of the invention in any manner . in respect of the methods disclosed and illustrated , the steps presented are exemplary in nature , and thus , the order of the steps is not necessary or critical . fig1 and 2 show a stator assembly 10 in accordance with an embodiment of the invention . the stator assembly 10 is adapted to be used in a motor ( not shown ). the stator assembly 10 includes a cylindrical hollow main body portion 12 having a longitudinal axis x . in the embodiment shown , the main body portion 12 is formed from an iron alloy . it is understood that other materials can be used to form the main body portion 12 without departing from the scope and spirit of the invention . the main body portion 12 is disposed around a rotor assembly 14 which is coupled to a driven member ( not shown ) such as a traction drive , a pump impeller , or a compressor impeller , for example , by a shaft 16 . the stator assembly 10 also includes a cooling jacket 18 disposed around and in thermal communication with the main body portion 12 . in the illustrated embodiment , the cooling jacket 18 is formed from aluminum . however , other materials can be used to form the cooling jacket 18 as desired . the cooling jacket 18 includes a plurality of fluid conduits 20 formed therein . in the embodiment shown , the fluid conduits 20 are formed substantially parallel to the longitudinal axis x of the main body portion 12 . it is understood that the fluid conduits 20 can be formed between the cooling jacket 18 and the main body portion 12 or otherwise , and can be formed in different directions and orientations as desired . the fluid conduits 20 are adapted to receive a coolant ( not shown ) from a source of coolant ( not shown ) therein . a first end plate 22 is disposed on a first end 24 of the stator assembly 10 . the first end plate 22 forms a substantially fluid tight seal with the first end 24 of the stator assembly 10 . a pair of apertures ( not show ) is formed in the first end plate 22 for receiving one of an inlet fitting 23 and an outlet fitting 25 therein . the fittings 23 , 25 are in fluid communication with the fluid conduits 20 formed in the cooling jacket 18 and the source of coolant . the first end plate 22 also includes a central groove 26 formed in a first surface 28 thereof . the central groove 26 receives a first bearing 30 that rotatingly supports the shaft 16 . it is understood that the first bearing 30 can be any type of bearing as desired such as an air bearing and a ball bearing , for example . optionally , one or more coolant channels ( not shown ) can be formed in the first end plate 22 . the coolant channels formed in the first end plate 22 can be in fluid communication with the inlet fitting 23 , the outlet fitting 25 , and / or the fluid conduits 20 formed in the cooling jacket 18 as desired . a second end plate 32 is disposed on a second end 34 of the stator assembly 10 . the second end plate 32 forms a substantially fluid tight seal with the second end 34 of the stator assembly 10 . the second end plate 32 includes a central groove 36 formed in a first surface 38 thereof adapted to receive a second bearing 40 that rotatingly supports the shaft 16 . it is understood that the second bearing 40 can be any type of bearing as desired such as an air bearing and a ball bearing , for example . a central aperture ( not shown ) is formed in the second end plate 32 . the shaft 16 extends through the central aperture to the driven member . optionally , one or more coolant channels ( not shown ) can be formed in the second end plate 32 . in this case , the fluid conduits 20 formed in the cooling jacket 18 would extend to the second end 34 of the stator assembly 10 and be in fluid communication with the coolant channels formed in the second end plate 32 . to produce the stator assembly 10 , a mold ( not shown ) for the cooling jacket 18 is disposed around the main body portion 12 and the cooling jacket 18 is cast directly over the main body portion 12 . as the cooling jacket 18 is being molded , the fluid conduits 20 are injection molded into the cooling jacket 18 . it is understood that the cooling jacket 18 can be formed prior to disposal over the main body portion 12 as desired . it is also understood that the fluid conduits 20 can be formed in the cooling jacket 18 subsequent to the molding of the cooling jacket 18 as desired . it is further understood that the mold for the cooling jacket 18 may include structure for forming the fluid conduits 20 as desired . the main body portion 12 and the cooling jacket 18 are disposed around the rotor assembly 14 and the shaft 16 . the first end plate 22 including the first bearing 30 is sealed to the first end 24 of the stator assembly 10 and the shaft 16 is rotatably secured in the first bearing 30 . it is understood that the first end plate 22 can be sealed to the first end 24 of the stator assembly 10 by any means , such as with tie rod screws ( not shown ), for example . the inlet fitting 23 and the outlet fitting 25 are disposed in the apertures formed in the first end plate 22 to communicate with the fluid conduits 20 formed in the cooling jacket 18 . the shaft 16 is inserted through the central aperture formed in the second end plate 32 . the second end plate 32 , including the second bearing 40 , is sealed to the second end 34 of the stator assembly 10 , and the shaft 16 is rotatably secured in the second bearing 40 . it is understood that the second end plate 32 can be sealed to the second end 34 of the stator assembly 10 by any means , such as with tie rod screws ( not shown ), for example . in use , the shaft 16 is coupled to the driven member . a magnetic field is generated by the stator assembly 10 , which causes the rotor assembly 14 and the shaft 16 to rotate about the longitudinal axis x of the main body portion 12 . the rotation of the rotor assembly 14 and shaft 16 is transferred to the driven member . heat is produced during operation of the stator assembly 10 . coolant from the coolant source is caused to flow into the inlet fitting 23 and through the first end plate 22 into the fluid conduits 20 formed in the cooling jacket 18 . the coolant absorbs heat energy from the main body portion 12 to cool the main body portion 12 . if coolant channels are formed in the endplates 22 , 32 , coolant flowing therethrough can be used to cool the first end 24 and the second end 34 of the stator assembly 10 . the coolant then flows out of the stator assembly 10 through the outlet fitting 25 . the coolant can be recirculated between the coolant source and the fluid conduits 20 formed in the cooling jacket 18 to maintain the temperature of the stator assembly 10 within a desired range . fig3 shows a stator assembly 110 in accordance with another embodiment of the invention . similar structure discussed above for fig1 and 2 includes the same reference numeral followed by a prime “′” symbol . a conduit 111 is disposed in a mold ( not shown ) for forming a cooling jacket 118 . in the embodiment shown , the conduit 111 is formed from a stainless steel alloy . it is understood that other materials may be used to form the conduit 111 , such as an aluminum alloy or brass , for example . the conduit 111 includes a fluid inlet 123 and a fluid outlet 125 in fluid communication with a source of coolant . although the conduit 111 is shown , as a helically wound coil , other conduit shapes and flow patterns can be used as desired . to form the cooling jacket 118 , the conduit 111 is disposed around a main portion 12 ′ of the stator assembly 110 . the cooling jacket 118 is molded around the conduit 111 . the fluid inlet 123 and the fluid outlet 125 are then connected to the source of coolant to provide fluid communication between the source of coolant and the conduit 111 . the remaining assembly process for the stator assembly 110 is substantially the same as described above for fig1 and 2 . in use , the stator assembly 110 is coupled to a driven member ( not shown ) as described above for fig1 and 2 . a magnetic field is generated by the stator assembly 110 which results in the generation of heat . coolant from the coolant source is caused to flow through the conduit 111 . the coolant absorbs heat energy from the main body portion 12 ′. the coolant can be recirculated between the coolant source and the piping 111 disposed in the cooling jacket 118 to maintain the temperature of the stator assembly 110 within a desired range . from the foregoing description , one ordinarily skilled in the art can easily ascertain the essential characteristics of this invention and , without departing from the spirit and scope thereof , can make various changes and modifications to the invention to adapt it to various usages and conditions .	8
preferred embodiments of the present invention will be described in detail herein below with reference to the annexed drawings . in the drawings , the same or similar elements are denoted by the same reference numerals even though they are depicted in different drawings . in the following description , a detailed description of known functions and configurations incorporated herein will be omitted when it may make the subject matter of the present invention rather unclear . fig1 is a block diagram illustrating an apparatus for controlling a sar of a mobile terminal in accordance with a preferred embodiment of the present invention . referring to fig1 , the apparatus for controlling the sar of the mobile terminal includes a controller 1 , a voice processor 5 , a user interface unit ( not shown ) having a display 3 and a key entry unit 7 , a memory 9 , and a tpc ( transmit power control ) unit 10 . the controller 1 controls an overall operation of a mobile terminal . in a clpc ( closed loop power control ) mode , the controller 1 controls a transmission power of the mobile terminal upon receiving tpc information from a bts ( base transceiver station ). in the case of an olpc ( open loop power control ) mode , the controller 1 controls a transmission power of the mobile terminal upon receiving an intensity of a reception signal from a bts . particularly , the controller 1 generates a signal for controlling an amplification gain of the tpc unit 10 according to a user - selected sar control mode of a mobile terminal . the present invention is based on the assumption that the sar control mode is classified into a normal mode and a sar safe mode . however , it should be noted that the sar safe mode can be subdivided into a plurality of sub - modes according to the degree of sar attenuation . in addition , although the present invention will hereinafter be described on the assumption that a gain of a drive amplifier 103 is controlled according to a sar control mode , it should be noted that the present invention can also be applicable to a power amplifier 107 other than the drive amplifier 103 . the display 3 displays a variety of messages under the control of the controller 1 . the voice processor 5 converts audio data received from the tpc unit 10 into audible sound through a speaker upon receiving a control signal from the controller 1 , converts an audio or voice signal received through a microphone into predetermined data , and transmits the predetermined data to the tpc unit 10 . the key entry unit 7 includes a plurality of number keys and a plurality of function keys , and outputs key entry data entered by user to the controller 1 . the memory 9 stores program data needed to control the mobile terminal , and also stores any data created while executing program and user data created by a user . particularly , the memory 9 stores various sar control mode information predetermined by a user along with code tables showing the drive amplifier &# 39 ; s gains in response to individual sar control modes . representative examples are shown in tables 1 and 2 . the code shown in the tables 1 and 2 denote a plurality of relative values versus code values at a maximal transmission power of 24 dbm on the assumption that the transmission power for 1150 reverse channels is in the dynamic range from − 40 dbm to 24 dbm . however , it should be noted that code values can be indicated as absolute values . table 1 is a code table referenced by the controller 1 when the sar control mode is set to a normal mode , and table 2 is a code table referenced by the controller when the sar control mode is set to a safe mode . individual gains of the code table shown in table 2 are lower than those of the code table shown n table 1 by a predetermined value at a maximal transmission power of 24 dbm . in more detail , the safe mode restricts a transmission power of a weak electric field requiring a high transmission power on the basis of the code table of table 2 , resulting in sar attenuation . on the other hand , in an intermediate electric field or a strong electric field requiring a low transmission power , the safe mode and the normal mode have the same code values . in this case , the transmission power is determined in light of power control information received from a bts in a closed loop power control mode , and is also determined in light of signal intensity received from the bts in an open loop power control mode . although it is assumed that a weak electric field gain of a sar safe mode is set to 96 % as compared to that of a sar normal mode in the present invention , the gain can be variable . in order to effectively reduce a sar in the weak electric field , for which rf signals must be transmitted with a high transmission power , without excessively reducing the number of successful phone calls , weak electric field gains in the sar safe mode should be determined in light of the relationship between a ratio of the successful phone calls and a sar . further , although the present invention discloses an example for reducing only a gain at a maximal transmission power , it will be understood by those skilled in the art that the present invention is applicable to other modifications such as an example for reducing individual gains attained at 20 dbm or 16 dbm at which a relatively high transmission power is required . in addition , although the safe mode and the normal mode each have code tables in the present invention , the present invention is applicable to other modifications for subtracting a prescribed value from any code value of the normal mode &# 39 ; s code table in the safe mode while having only a code table for the normal mode . when a gain of the power amplifier 103 is controlled according to a sar control mode as described above , the memory 9 stores gain code tables of the power amplifier 103 . the tpc unit 10 modulates or demodulates rf signals containing audio or control data received through an antenna upon receiving a control signal of the controller 1 . the tpc unit 10 includes a mixer 101 , a drive amplifier 103 , a bpf ( band pass filter ) 105 , a power amplifier 107 , and a duplexer 109 . the mixer 101 functions as an up - converter for converting an if ( intermediate frequency ) signal into an rf signal having a prescribed bandwidth , and mixes the if signal with a local oscillator frequency . the drive amplifier 103 enables an output signal of the mixer 101 to be an optimal signal , and thereby enables the power amplifier 107 to sufficiently amplify the output signal of the mixer 101 . provided that the power amplifier 107 is not driven by an optimal signal , its own efficiency may be seriously deteriorated . in accordance with the present invention , an amplification factor of the drive amplifier 103 is variable with a gain control signal generated from the controller 1 . the bpf 105 selects only a transmission ( tx ) frequency , performs a band - pass - filtering on the selected transmission frequency with a low insertion loss , and removes the remaining unnecessary frequencies , i . e ., frequencies other than the selected transmission frequency . the power amplifier 107 amplifies rf signals generated from the bpf 105 such that a signal with the sufficient power is transmitted from the mobile terminal to a bts through the antenna . fig2 is a flow chart illustrating a method for controlling a sar of a mobile terminal in accordance with the preferred embodiment of the present invention . referring to fig2 , the mobile terminal controller 1 checks a sar control mode selected by a user in step 21 . the controller 1 provides a user with a user interface for setting up the sar control mode . typically , the user interface adds a sar control mode setup function to a selection menu of a mobile terminal , and enables a user to select either a safe mode or a normal mode on the key entry unit 7 . information of the sar control mode selected by a user is stored in the memory 9 . such sar control mode information may be indicated as a flag . where the sar control mode is set to a normal mode in step 21 , the controller 1 calls a gain code table of a drive amplifier in association with the normal mode stored in the memory 9 in step 23 . although the present invention will control a gain of the drive amplifier 103 according to a sar control mode , the present invention may also control that of the power amplifier . on the other hand , when the sar control mode is set to a safe mode in step 21 , the controller 1 calls a gain code table of a drive amplifier in association with a safe mode stored in the memory 9 in step 24 , and then proceeds to step 25 . the controller 1 outputs a code value in response to a transmission power selected by either one of code tables in step 25 . in a closed loop power control mode , the controller 1 selects a code value in response to tpc information received from a bts . in an open loop power control mode , the controller 1 selects a code value in response to signal intensity received from the bts . the controller 1 controls a gain of the drive amplifier 103 according to the selected code value in step 27 . rf signals pre - amplified at the drive amplifier 103 are re - amplified at the power amplifier 107 over the bpf 105 , and then transmitted over a duplexer 109 in step 29 . as is apparent from the description above , an apparatus and method for controlling a sar of a mobile terminal according to the present invention enables a user to freely select a desired sar , resulting in more reliability of a mobile terminal for the user . that is , the present invention attenuates a sar according to a user &# 39 ; s selection , resulting in less danger for the user to be exposed to emi , and providing greater convenience to the user . although preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims .	7
fig1 is a schematic diagram showing the essential portions of a first embodiment of the present invention as it is applied to a three - plate type ccd color camera ( image pickup apparatus ). in fig1 the reference numeral 101 designates a variable apex angle prism as optical image deflecting means . the variable apex angle prism 101 is removably mounted forward of a photo - taking optical system 102 in such a manner that it is difficult for the other aberrations ( distortion , etc .) than chromatic aberration to occur . the reference numeral 103 denotes a color dividing prism for dividing the light beam from the photo - taking optical system 102 into three color lights , i . e ., red ( r ), green ( g ) and blue ( b ). in the present embodiment , images based on the respective color lights are formed on the photosensitive surfaces of image pickup elements 104 - 106 each comprising a ccd by the photo - taking optical system 102 through the color dividing prism 103 . the reference numerals 107 - 109 designate image shift circuits as electronic image shift means corresponding to r light , g light and b light , respectively . each of the image shift circuits 107 - 109 has an a / d converter , an image memory , a d / a converter , etc . images formed on the surfaces of the image pickup elements by the image pickup optical system 102 are converted into image information of each color light by the image pickup elements 104 - 106 and input to the image shift circuits 107 - 109 . at this time , image memory read - out addresses are controlled by a calculation circuit 116 , whereby the positions of the images are two - dimensionally shifted . the reference numeral 113 denotes an angle sensor as a camera angle detector . the angle sensor 113 comprises a gyroscope or the like and detects angles of inclination . o slashed . x and . o slashed . y resulting from the vibration of the image pickup apparatus . the reference numeral 100 designates driving means having , for example , a gimbals structure . the driving means 100 mechanically or magnetically drives the prism apex angles of the variable apex angle prism 101 in two x and y directions on the basis of output signals . o slashed . x and . o slashed . y from the camera angle detector 113 . the reference numeral 111 denotes a deflection angle detector which detects the apex angles of the variable apex angle prism 101 in the x direction and the y direction and outputs detection signals ε x and ε y . the reference numeral 112 designates a focal length detector which detects the focal length of the image pickup optical system 102 in a predetermined zoom position . the image pickup optical system 102 may be comprised of a lens system of a single focal length , and in this case , the focal length is constant . the reference numeral 116 denotes a calculation circuit which calculates the amount of image shift by a method to be described by the use of output signals from the deflection angle detector 111 and the focal length detector 112 and a signal from an rom 117 storing therein the refractive indices n r , n g and n b of the material of the variable apex angle prism 101 for the respective color lights r , g and b . the reference numeral 110 designates an encoder which converts signals from the image shift circuits 107 - 109 , for example , into standardized image signals of the ntsc type or the pal type . the encoder 110 includes means for γ correction , outline correction , white balance , etc . a description will now be given of a method of correcting the movement of the image on the surfaces of the image pickup elements caused when the image pickup apparatus vibrates in the present embodiment . first , in the present embodiment , the angles of inclination . o slashed . x and . o slashed . y caused by the vibration or the like of the image pickup apparatus are detected by the camera angle detector 113 , and on the basis of the result of the detection , the apex angle of the variable apex angle prism 101 as the optical image deflecting means is varied by the driving means 100 to thereby correct the movement of the images . that is , the optical image deflecting means two - dimensionally deflects the images formed on the respective image pickup elements 104 - 106 by the image pickup optical system 102 , thereby optically correcting the movement of the images . at this time , the deviation of the images based on chromatic aberration created when the apex angle of the variable apex angle prism 101 is varied is shifted by electronic image shift means and is corrected thereby . that is , in the present embodiment , the image shift circuits 107 - 109 constituting the electronic image shift means effect image shift ( trimming ) two - dimensionally for each channel in accordance with the direction and angle of deflection of the optical image deflecting means and the focal length of the image pickup optical system 102 . in the present embodiemnt , the image signals of the ccd &# 39 ; s 104 , 105 and 106 are processed by the use of the shift circuits 107 , 108 and 109 ( image signal processing means ), respectively , but in principle , the shift circuit 108 can be eliminated if the design is made such that the image of a certain channel , for example , the g channel , as the reference channel coincides with the images formed by the other two channels . let it be assumed that the amounts of image shift of the respective color lights in the x and y directions relative to the image pickup elements 104 - 106 are δx r , δy r , δx g , δy g , δx b and δy b . these values are found by the calculation circuit 116 on the basis of the value of the apex angle of the variable apex angle prism 101 detected by the deflection detecting circuit 111 , the value of the focal length of the image pickup optical system 102 detected by the focal length detector 112 , and the values of the refractive indices n r , n g and n b of the material of the variable apex angle prism 101 for the respective color lights stored in the rom 117 . fig3 is an illustration showing an example of the positional relation among the then - existing amounts of image shift δx r , δy r , δx g , δy g , δx b and δy b . when as previously described , the focal length of the image pickup optical system is f and the emergence angle of inclination from the variable apex angle prism is τ n , the chromatic aberration δy n created by a variation in the apex angle of the variable apex angle prism 101 can be found by the aforementioned equation ( 1 ), i . e ., accordingly , when the apex angles of the variable apex angle prism in the x direction and the y direction are ε x and ε y , respectively , and the refractive index of the material of the variable apex angle prism is n , the chromatic difference of magnification can be found from the equation ( 1 ). so , the amounts of image shift δx r , δy r , δx g , δy g , δx b and δy b are found by the calculation circuit 116 on the basis of the following equations : the image shift circuits 107 - 109 effect the shift of the images in conformity with the amounts of image shift found by the calculation circuit 116 , and transmit the calculated image signals to the encoder 110 . the encoder 110 converts the signals from the image shift circuits 107 - 109 into standardized image signals of the ntsc type or the pal type . in the present embodiment , the chromatic difference of magnification created by the angle of deflection of the variable apex angle prism 101 is corrected in the manner described above , and as a whole , the movement of the images by the vibration of the image pickup apparatus is corrected well . in the present embodiment , instead of the angle sensor , an angular velocity sensor may be used as the camera angle detector 113 to detect the angular velocity , and use may be made of the output signal thereof which has been integrated , or the angular acceleration which has been double - integrated . further , as proposed in japanese laid - open patent application no . 61 - 269572 , the design may be made such that the shake of the camera is detected from the image signal obtained by the image pickup apparatus , by an image processing circuit corresponding to the camera angle detector 113 and is corrected thereby . fig4 is a schematic diagram showing the essential portions of a second embodiment of the present invention . in this embodiment , a signal system is added to the embodiment of fig1 to improve the image stabilizing characteristics of the image stabilizing image pickup apparatus . since the driving means 100 and the variable apex angle prism 101 are mechanically connected together , the frequencies which can respond to the detected vibration are low , e . g . up to the order of 10 hz . accordingly , it is difficult to effect correction for vibrations having a frequency component higher than this frequency . so , in the present embodiment , the correction of the movement of images when the image pickup apparatus vibrates minutely at a high frequency , e . g . of 10 hz or higher is effected by image - shifting all channels by the same amount in the same direction by the image shift circuits 107 - 109 . generally , the vibration of the image pickup apparatus is great in amplitude for low frequency components ( with 0 - 10 hz ) and small in amplitude for high frequency components ( 10 hz or higher ). in the present embodiment , the movement of images of low frequency components and great amplitude is corrected chiefly by optical deflecting means and the movement of images of high frequency components and small amplitude is corrected by electronic image shift means and as a whole , the movement of images based on a wide range of oscillation frequency and amplitude is corrected . in the present embodiment , the differences (. o slashed . x - ε x ) and (. o slashed . y - ε y ) between the output values . o slashed . x and . o slashed . y as the angles of inclination from the camera angle detector 113 and the angles of deflection ε x and ε y when the apex angle of the variable apex angle prism 101 is varied are information corresponding to the amount of the angle of deflection which the driving means 100 and the variable apex angle prism 101 could not completely follow . so , in the present embodiment , the amount of deflection which the driving means 100 and the variable apex angle prism 101 could not completely follow , i . e ., the under - corrected amount , is input to the calculation circuit 116 and the images are electronically shifted and corrected in the direction opposite to the minute vibration by the image shift circuits 107 - 109 , whereby there are obtained images whose vibration has been precisely corrected even for high frequencies . in the present embodiemnt , the amounts of image shift δx r , δy r , δx g , δy g , δx b and δy b when the correction accompanying minute vibrations of high frequencies is effected simultaneously with the chromatic aberration correction of the first embodiment for the electronic image shift means are : here , if the amounts of image shift reach too high values ( several percent or more of the size of the picture plane ), it will cause the breakage of the picture plane by an image shift , or the distortion or shading created by the image pickup optical system 102 will be observed as vibration on the output picture plane , thus causing the quality of image to be deteriorated . therefore , in the present embodiment , it is preferable to provide limiter means for limiting the amounts of image shift so as to be of the order of several percent of the size of the picture plane . fig5 is a schematic diagram of the essential portions neighboring the electronic image shift means of a third embodiment of the present invention . in this embodiment , there is shown image shift means for directly controlling the read - out positions of image pickup elements . the reference numerals 204 - 206 designate image pickup elements such as ccd &# 39 ; s or saticons , and the reference numerals 207 - 209 denote read - out area control circuits for controlling the read - out positions of images . in the image pickup elements 204 - 206 , the timing ( the phase for each of three color lights ) and scanning speed of the scanning signal of an electron beam are changed , whereby apparently the images can be minutely shifted . in the present embodiment , the scanning signal is controlled on the basis of the amounts of image shift δx r , δy r , δx g , δy g , δx b and δy b from the calculation circuit 116 , not shown , to thereby obtain an effect similar to that of the second embodiment . also , in the solid state image pickup elements such as ccd &# 39 ; s , the clocks of ccd transfer registers in the horizontal direction ( h direction ) and the vertical direction ( v direction ) are controlled , whereby apparently the images can be shifted by a technique similar to that proposed , for example , in u . s . pat . no . 4 , 593 , 311 . such image shift means can also be realized in a color camera of the one plate type . that is , the image is read out by a conventional method , whereafter the image is divided into color lights r , g and b , which are input to the image shift circuits 107 - 109 of fig1 and image shift is effected therein , whereby a similar effect can be obtained . according to the present invention , there can be achieved an image stabilizing image pickup apparatus suitable for a video camera , a broadcasting hand - held camera or the like in which the movement of an image caused by the vibration or the like of the image pickup apparatus is corrected by the use of optical image deflecting means and electronic image shift means to thereby prevent a reduction in the resolving power of the image and which is made compact as a whole and yet can quickly and highly accurately correct the movement of the image , for example , of a wide range of oscillation frequencies . also , according to the present invention , there can be achieved an image stabilizing image pickup apparatus characterized in that the influence of the color dispersion of the material of a variable apex angle prism can be corrected well and therefore the use of vap material of high refractive index becomes possible and that the vap driving angle ε can be made small and driving means can readily be made compact .	7
among the compounds of formula ( 1 ), those having the ( s )- configuration at position 20 of the e - ring are preferred for pharmaceutical use . r 1 and r 2 are preferably and independently ( the same or different ) h , a hydroxyl group , a halo group , an amino group , a nitro group , a cyano group , a c 1 - 3 alkyl group , a c 1 - 3 perhaloalkyl group , a c 1 - 3 alkenyl group , a c 1 - 3 alkynyl group , a c 1 - 3 alkoxyl group , a c 1 - 3 aminoalkyl group , a c 1 - 3 alkylamino group , a c 1 - 3 dialkylamino group , or r 1 and r 2 together form a group of the formula — o ( ch 2 ) n o — wherein n represents the integer 1 or 2 . more preferably , r 1 and r 2 are independently ( the same or different ) h , a methyl group , an amino group , a nitro group , a cyano group , a hydroxyl group , a hydroxymethyl group , a methylamino group , a dimethylamino group , an ethylamino group , a diethylamino group , an aminomethyl group , a methylaminomethyl group , a dimethylaminomethyl group , and the like . r 3 is preferably f , an amino group , or a hydroxyl group . r 4 is preferably h or f . r 5 is preferably an ethyl group . r 6 , r 7 and r 8 are preferably independently ( the same or different ) a c 1 - 6 alkyl group , a phenyl group or a —( ch 2 ) n r 10 group , wherein n is an integer within the range of 1 through 6 and r 10 is a halogen or a cyano group . the compounds of the present invention can be prepared according to the general synthetic scheme shown in fig1 . in the synthetic scheme of fig1 , an iodopyridone 2 is first n - alkylated with a propargyl derivative 3 to produce radical precursor 4 . radical precursor 4 then undergoes a radical cascade with arylisonitrile 5 to generate product 1 . the n - alkylation proceeds smoothly following optimized conditions . see curran , d . p . et al ., tetrahedron lett ., 36 , 8917 ( 1995 ), the disclosure of which is incorporated herein by reference . the synthesis of iodopyridone 2 and the conditions of the radical cascade have been previously reported . the propargylating agent 3 is readily prepared by the standard silylation of the dianion of propargyl alcohol with a suitable sylating agent r 6 r 7 r 8 six followed by conversion of the propargyl alcohol to a leaving group such as a bromide , iodide or sulfonate . see curran , d . p . et al ., angew . chem . int . ed . engl ., 34 , 2683 ( 1995 ), the disclosure of which is incorporated herein by reference , and u . s . patent application ser . no . 08 / 436 , 799 , filed may 8 , 1995 , the disclosures of which are incorporated herein by reference . generally , various reagents can be used in the radical cascade including , but not limited to , hexamethyltin , hexamethyldisilane , or tetrakis ( trimethylsilyl ) silane . the source of energy for this reaction can be a sun lamp or an ultraviolet lamp . the temperature is preferably set between approximately 25 and 150 ° c . more preferably , the temperature is set at approximately 70 ° c . there are generally no limitations upon the choice of solvent used other than inertness to the radical cascade . preferred solvents include benzene , toluene , acetonitrile , thf and tert - butanol . also , there is very broad latitude in the choice of substituents on the alkyne and the isonitrile because of the mildness of the reaction conditions . fig2 illustrates an embodiment of a general synthetic scheme for the synthesis of ( 20s )- 11 - fluoro - 7 - trimethylsilylcamptothecin 12 . a problem in this synthetic scheme is to control the regioselectivity of the radical cascade when both ortho positions in the arylisonitrile are available for cyclization ( that is , r 4 is h in the final compound of formula 1 ). one solution to this problem relies upon the introduction of a trimethylsilyl group on the aryl isonitrile , ( e . g . 3 - fluoro - 2 - trimethylsilylphenyl isonitrile 9 ). the trimethylsilyl substituent blocks one of the ortho sites of the isonitrile toward cyclization and can be removed after the cascade reaction by hydrodesilylation . in this example , the selectivity proceeds further in the sense that only one of the trimethylsilyl groups is removed in the last step . other embodiments of the general synthetic scheme for the preparation of several novel camptothecin derivatives are illustrated in fig3 to 6 , and in the examples . the present invention provides a short and efficient synthetic scheme well suited to known structure - activity relationships in the camptothecin family . indeed , the biological activity of the camptothecin skeleton is generally intolerant or has very little tolerance to substituents other than at the 7 and / or 9 - 11 positions . following synthesis , these substituents are introduced via the alkynylderivative 3 and arylisonitrile 5 , respectively . the antitumor activities of several compounds of formula 1 are shown in table 1 and compared to those of several well known camptothecin analogs . the syntheses of the various exemplary compounds of the present invention set forth in table 1 are discussed in further detail in an example section following this section . the camptothecin derivatives were evaluated for their cytotoxic effects on the growth of hl - 60 ( human promyelocytic leukemic ), 833k ( human teratocarcinoma ) and dc - 3f ( hamster lung ) cells in vitro . the cells were cultured in an initial density of 5 × 10 − 4 cell / ml . they were maintained in a 5 % co 2 humidified atmosphere at 37 ° c . in rpmi - 1640 media ( gibco - brl grand island , n . y .) containing penicillin 100u / ml )/ streptomycin ( 100 μg / ml ) ( gibco - brl ) and 10 % heat inactivated fetal bovine serum . the assay was performed in duplicate in 96 - well microplates . the cytotoxicity of the compounds toward hl - 60 cells following 72 hr incubation was determined by xtt - microculture tetrazolium assay . scudiero , d . a ., et al ., cancer res ., 48 , 4827 ( 1988 ), the disclosure of which is incorporated herein by reference . 2 ′, 3 ′- bis (- methoxy - 4 - nitro - 5 - sulfheny )- 5 -[( phenylamino ) carbonyl ]- 2h - tetrazolium hydroxide ( xtt ) was prepared at 1 mg / ml in prewarmed ( 37 ° c .) medium without serum . phenazine methosulfate ( pms ) and fresh xtt were mixed together to obtain 0 . 075 mm pms - xtt solution ( 25 μl of the stock 5 mm pms was added per 5 ml of 1 mg / ml xtt ). fifty μl of this mixture was added to each well of the cell culture at the end of 72 hr incubation . after incubation at 37 ° c . for 4 hr ., absorbance at 450 nm and 630 nm was measured with a microplate reader ( el340 , bio - tek instruments , inc ., winooski , vt .). the cytotoxicity of the camptothecin compounds toward 833k teratocarcinoma solid tumor cells and dc - 3f hamster lung cells was determined in 96 - well microplates by a method described by skehan et al . for measuring cellular protein content . skehan et al ., “ new colorometric cytotoxicity assay for anticancer drug screening ,” j . nat &# 39 ; l cancer inst ., 82 , 1107 ( 1990 ), the disclosure of which is incorporated herein by reference . cultures were fixed with trichloroacetic acid and then stained for 30 minutes with 0 . 4 % sulforhodamine b dissolved in 1 % acetic acid . unbound dye was removed by acetic acid washes , and the protein - bound dye was extracted with an unbuffered tris base [ tris ( hydroxy - methyl ) aminomethan ] for determination of absorbance at 570 nm in a 96 - well microplate reader . the experiments were carried out in duplicate using five to six concentrations of the drugs tested . data were analyzed via computer software . see , chou , j , and chou , t . c ., dose - effect analysis with microcomputers : quantitation of ed 50 , ld 50 , synergism , antagonism , low - dose risk , receptor - ligand binding and enzyme kinetics , 2 nd ed ., biosoft , cambridge ( 1987 ); and chou , t . c ., “ the median - effect principle and the combination index for quantitation of synergism and antagonism ,” synergism and antagonism in chemotherapy , academic press , san diego , 61 - 102 ( 1991 ), the disclosures of which are incorporated herein by reference . for dna cleavage assay the reaction mixture comprised tris - hcl buffer 10 mm , ph7 . 5 ; pbr 322 supercoiled double stranded circular dna ( 4363 base pairs , from bochringer mannheim biochemicals ) 0 . 125 μg / ml , drug ( camptothecin or its derivatives ) concentration at 1 , 10 and 100 μm , in the presence of purified dna topoisomerase i with final volume of 20 μl as described previously . hsiang , y . h ., et al ., “ camptothecin induces protein - linked dna breaks via mammalian dna topoisomerase i ,” j . biol . chem ., 260 , 14873 ( 1985 ), the disclosure of which is incorporated herein by reference . incubation was carried out at 37 ° c . for 60 min . the reaction was stopped by adding the loading buffer dye ( 2 % sodium dodesyl sulfate , 0 . 05 % bromophenol blue and 6 % glycerol ). electrophoresis was carried cut on 1 % agarose gel plus ethidium bromide ( 1 μg / ml ) in tbe buffer ( tris - base - boric acid - edta ) and ran at 25 v for 18 hrs . photographs were taken under uv light using polaroid film type 55 / n and developed as indicated by the manufacturer . to study the inhibiting effect on dna topoisomerase i mediated relaxation of dna , the method described by liu and miller was used . liu , h . f . et al ., “ cleavage of dna by mammalian dna topoisomerase ii ,” j . biol . chem ., 258 , 15365 ( 1980 ), the disclosure of which is incorporated herein by reference . for this assay , 0 . 18 μg of pbr 322 dna , 0 . 5 u of topo i ( gibco - brl ), various concentrations ( 1 - 100 μm of camptothecin or an analog , in a reaction mixture ( 20 μl ) containing 50 mm tris - hcl , ph 7 . 5 , 120 mm kcl , 10 mm mgcl 2 , 0 . 5 mm dtt , 0 . 5 mm edta , 30 μg / ml bsa , 20 μg / ml pbr 322 dna and various amounts of the enzyme was incubated at 37 ° c . for 30 min ., and stopped with 5 % sbs and 150 μg / ml proteinase k . the samples were loaded onto 1 % agarose in tae running buffer , electrophoresed overnight at 39 v , stained with etbr , and photographed under uv light . antitumor activities of camptothecin derivatives were tested in b 6 d 2 f 1 mice bearing sarcoma - 180 or lewis lung murine solid tumor . for s - 180 , 3 × 10 6 cells were innoculated subcutaneously on day 3 . antitumor treatment started on day 1 intraperitoneously twice daily for five days . tumor volumes on day 7 and day 14 were measured . average tumor volumes were described as the ratio of treated versus untreated control ( t / c ). the control ( treated with dmso vehicle only ) tumor volumes for day 7 and day 14 were 0 . 11 cm 3 and 0 . 61 cm 3 , respectively . the t / c camptothecin is designated with “+++.” an increment or decrement of 10 % as compared to the camptothecin t / c on day 14 at 2 mg / kg dosage is designated with increase or decrease of one “+” unit , respectively . for lewis lung carcinoma , tumor cells ( 1 × 10 6 ) were inoculated subcutaneously on day 0 and treatment started on day 1 , intraperitoneously twice daily for five days . the grading of effects was as described above . as shown table 1 , many of the camptothecin derivatives tested for the antitumor cytotoxicity in vitro exhibited higher potency than camptothecin in one to three cell lines . most of those compounds exhibiting higher antitumor cytotoxicity also exhibited higher potency in enhancing the dna - topoisomerase i - mediated cleavage of pbr 322 dna , or in inhibiting the dna - topoisomerase i - mediated relaxation of pbr 322 dna . these results suggest excellent correlation between the antitumor cytoxicity of the camptothecin compounds with their ability to inhibit the functions of dna - topoisomerase i . for in vivo chemotherapeutic effects in tumor - bearing mice , for example , 7 - trimethylsilyl camptothecin showed better activity than camptothecin against sarcoma 180 in b 6 d 2 f 1 mice at several equivalent doses in a dose dependent manner in terms of tumor volume reduction . similarly , for lewis lung carcinoma , 7 - trimethylsilyl - 11 - fluoro camptothecin exhibited a similar antitumor effect to camptothecin in terms of tumor volume reduction at 4 - fold lower doses than camptothecin . thus , 7 - trimethylsilyl - 11 - fluoro camptothecin is more efficacious than camptothecin in its antitumor effects in vivo . the present inventors have thus discovered that introduction of a silyl group ( for example , a trimethylsilyl group ) at position 7 of the camptothecin structure typically results in a compound with better anti - tumor activity than camptothecin ( see , for example , the compound of example 1 as compared to ( 20s )- cpt ). the silyl group is also beneficial in the irinotecan series ( see , for example , the compound of example 6 as compared to irinotecan ). the anti - tumor activity remains essentially unchanged when a hydroxy group is introduced at position 10 of the compound of example 1 to produce the compound of example 5 . the compound of example 6 is a relative of sn - 38 , the active metabolite of irinotecan . some of the highest activities were observed in the present studies when a trimethylsilyl group was introduced in conjunction with a fluoro atom at position 11 ( see , for example , the compound of example 7 ), or a primary amine group at positions 10 or 11 ( see , respectively , examples 8 and 9 ). introduction of a fluoro atom in position 12 also results in an analog only approximately 2 times less potent than camptothecin ( see , example 11 as compared to ( 20s )- cpt ). this result is surprising considering the poor activity of the 12 - substituted camptothecins reported previously in the literature . a mammal ( human or animal ) may thus be treated by a method which comprises the administration to the mammal of a pharmaceutically effective amount of a compound of formula ( 1 ) or a pharmaceutically acceptable salt thereof . the condition of the mammal can thereby be improved . the compounds of the present invention can be administered in a variety of dosage forms including , for example : parenterally ( for example , intravenously , intradermally , intramuscularly or subcutaneously ); orally ( for example , in the form of tablets , lozengers , capsules , suspensions or liquid solutions ); rectally or vaginally , in the form of a suppository ; or topically ( for example , as a paste , cream , gel or lotion ). optimal dosages to be administered may be determined by those skilled in the art and will vary with the particular compound of formula ( 1 ) to be used , the strength of the preparation , the mode of administration , the time and frequency of administration , and the advancement of the patient &# 39 ; s condition . additional factors depending on the particular patient will result in the need to adjust dosages . such factors include patient age , weight , gender and diet . dosages may be administered at once or divided into a number of smaller doses administered at varying intervals of time . the following examples are provided for illustration of the invention and are not intended to be limiting thereof . to a solution of ( s )- 4 - ethyl - 4 - hydroxy - 6 - iodo - 3 - oxo - 1h - pyrano [ 3 , 4 - c ]- 8 - pyridone [ iodopyridone ( 2 ), 250 mg , 0 . 746 mmol ] in dme ( 2 . 5 ml ) and dmf ( 0 . 60 ml ) at 0 ° c . under argon was added 60 % nah in mineral oil ( 31 . 3 mg , 0 . 783 mmol ). libr ( 150 mg , 1 . 75 mmol ) was added 10 min latter . after 15 min at room temperature , 3 - trimethylsilyl - 2 - propynyl bromide ( 430 mg , 2 . 24 mmol ) was injected and the reaction mixture was heated in the dark at 65 ° c . for 20 h . the final solution was poured into brine ( 20 ml ), extracted with acoet ( 6 × 15 ml ) and dried ( na 2 so 4 ). the residue obtained after removal of the solvents was subjected to flash - chromatography ( chcl 3 / acoet 95 : 5 ) to give 283 mg ( 85 %) of a foam : [ α ] 20 d + 36 . 7 ( c 1 , chcl 3 ); ir ( neat , cm − 1 ) 3384 , 2940 , 2166 , 1730 , 1634 , 1518 , 1406 , 1130 , 841 , 752 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 14 ( s , 9 h ), 0 . 95 ( t , j = 7 . 4 hz , 3 h ), 1 . 77 ( m , 2 h ), 3 . 66 ( s , 1 h ), 5 . 00 ( d , j = 17 . 2 hz , 1 h ), 5 . 10 ( d , j = 16 . 4 hz , 1 h ), 5 . 15 ( d , j = 17 . 2 hz , 1 h ), 5 . 49 ( d , j = 16 . 4 hz , 1 h ), 7 . 16 ( s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ − 0 . 40 , 7 . 7 , 31 . 5 , 44 . 5 , 66 . 3 , 71 . 8 , 90 . 9 , 97 . 9 , 116 . 5 , 118 . 1 , 148 . 6 , 157 . 9 , 173 . 3 ; hrms ( ei ) m / z calcd for c 16 h 20 ino 4 si ( m + ) 445 . 0206 , found 445 . 0203 ; lrms ( ei ) m / z 445 ( m + ), 430 , 416 , 386 . a solution of the compound prepared in ( 1 ) ( 36 . 6 mg , 0 . 082 mmol ), phenyl isonitrile ( 0 . 25 mmol ) and hexamethylditin ( 42 mg , 0 . 123 mmol ) in benzene ( 1 . 3 ml ) under argon was irradiated at 70 ° c . with a 275w ge sunlamp for 10 h . the final reaction mixture was concentrated and subjected to flash - chromatography ( chcl 3 / meoh 96 : 4 ) to provide 18 . 8 mg ( 54 %) of a slightly yellow solid : [ α ] 20 d + 39 . 0 ( c 0 . 2 , chcl 3 / meoh 4 : 1 ); 1 h nmr ( 300 mhz , cdcl 3 / cd 3 od 3 : 1 ) δ 0 . 50 ( s , 9 h ), 0 . 83 ( t , j = 7 . 4 hz , 3 h ), 1 . 74 ( m , 2 h ), 3 . 72 ( br s , 1 h ), 5 . 12 ( d , j = 16 . 4 hz , 1 h ), 5 . 16 ( br s , 2 h ), 5 . 47 ( d , j = 16 . 4 hz , 1 h ), 7 . 49 ( t , j = 8 . 1 hz , 1 h ), 7 . 54 ( s , 1 h ), 7 . 62 ( t , j = 8 . 1 hz , 1 h ), 8 . 02 ( d , j = 8 . 1 hz , 1 h ), 8 . 07 ( d , j = 8 . 1 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 / cd 3 od 3 : 1 ) δ 0 . 9 , 7 . 2 , 29 . 3 , 31 . 0 , 51 . 7 , 65 . 5 , 98 . 3 , 118 . 4 , 127 . 3 , 128 . 0 , 129 . 7 , 130 . 0 , 131 . 8 , 134 . 3 , 144 . 7 , 145 . 6 , 147 . 3 , 151 . 1 , 173 . 5 ; hrms ( ei ) m / z calcd for c 23 h 24 n 2 o 4 si ( m + ) 420 . 1505 , found 420 . 1501 ; lrms ( ei ) m / z 420 ( m + ), 391 , 376 , 361 , 347 , 320 , 291 . following the procedure described in example 1 -( 1 ), iodopyridone ( 2 ) ( 200 mg , 0 . 60 mmol ) and 3 - tert - butyldimethylsilyl - 2 - propynyl bromide ( 280 mg , 1 . 20 mmol ) provided , after flash - chromatography ( ch 2 cl 2 / acoet 9 : 1 ), 173 mg ( 59 %) of a white foam : [ α ] 20 d + 58 ( c 0 . 2 , chcl 3 ); ir ( chcl 3 , cm − 1 ) 3548 , 2950 , 2927 , 2859 , 1745 , 1648 , 1526 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 08 ( s , 6 h ), 0 . 92 ( m , 12 h ), 1 . 79 ( m , 2 h ), 3 . 77 ( br s , 1 h ), 5 . 00 - 5 . 25 ( m , 3 h ), 5 . 50 ( d , j = 16 . 4 hz , 1 h ) 7 . 19 ( s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ − 4 . 9 , 7 . 63 , 16 . 6 , 26 . 0 , 31 . 6 , 44 . 5 , 66 . 3 , 71 . 8 , 89 . 4 , 98 . 6 , 100 . 0 , 116 . 5 , 118 . 1 , 148 . 6 , 158 . 0 , 173 . 2 ; hrms ( ei ) m / z calcd for c 19 h 26 ino 4 si ( m + ) 487 . 0679 , found 487 . 0676 ; lrms ( ei ) m / z 487 ( m + ), 430 , 386 , 96 , 81 , 57 . following the procedure described in example 1 -( 2 ), the compound prepared in ( 1 ) ( 48 . 7 mg , 0 . 10 mmol ) afforded , after flash - chromatographies ( ch 2 cl 2 / meoh 96 : 4 ; ch 2 cl 2 / acetone 9 : 1 ), 24 . 8 mg ( 54 %) of an off yellow solid : [ α ] 20 d + 35 . 5 ( c 0 . 2 , chcl 3 ); ir ( chcl 3 , cm − 1 ) 3028 , 2980 , 2960 , 2932 , 2859 , 1741 , 1658 , 1600 , 1555 , 1257 , 1198 , 1158 , 1045 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 69 ( s , 6 h ), 0 . 98 ( s , 9 h ), 1 . 03 ( t , j = 7 . 3 hz , 3 h ), 1 . 86 ( m , 2 h ), 3 . 86 ( s , 1 h ), 5 . 29 ( d , j = 16 . 3 hz , 1 h ), 5 . 31 ( s , 2 h ), 5 . 73 ( d , j = 16 . 3 hz , 1 h ), 7 . 60 ( t , j = 6 . 3 hz , 1 h ), 7 . 60 ( t , j = 7 . 0 hz , 1 h ), 7 . 66 ( s , 1 h ), 7 . 74 ( t , j = 7 . 3 hz , 1 h ) 8 . 20 ( t , j = 8 . 1 hz , 2 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ − 0 . 56 , 7 . 80 , 19 . 2 , 27 . 1 , 31 . 6 , 52 . 4 , 66 . 3 , 72 . 8 , 97 . 7 , 118 . 2 , 127 . 0 , 129 . 5 , 129 . 6 , 130 . 8 , 132 . 7 , 136 . 0 , 143 . 0 , 146 . 4 , 148 . 0 , 150 . 1 , 150 . 6 , 157 . 4 , 173 . 9 ; hrms ( ei ) m / z calcd for c 26 h 30 n 2 o 4 si ( m + ) 462 . 1974 , found 462 . 1975 ; lrms ( ei ) m / z 462 ( m + ), 450 , 361 , 331 , 304 , 245 , 223 , 57 . following the procedure described in example 1 -( 1 ), iodopyridone ( 2 ) ( 200 mg , 0 . 60 mmol ) and 3 - tert - butyldiphenylsilyl - 2 - propynyl bromide ( 428 mg , 1 . 20 mmol ) provided , after flash - chromatography ( ch 2 cl 2 / acoet 9 : 1 ), 258 mg ( 70 %) of a white foam : [ α ] 20 d + 45 . 1 ( c 0 . 2 , chcl 3 ); ir ( chcl 3 , cm − 1 ) 3546 , 2928 , 2855 , 1741 , 1658 , 1526 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 97 ( t , j = 7 . 3 hz , 3 h ), 1 . 08 ( s , 9 h ), 1 . 80 ( m , j = 7 . 1 hz , 2 h ), 3 . 76 ( br s , 1 h ), 5 . 13 ( d , j = 16 . 4 hz , 1 h ), 5 . 29 ( d , j = 2 . 5 hz , 2 h ), 5 . 52 ( d , j = 16 . 4 hz , 1 h ), 7 . 22 ( s , 1 h ), 7 . 32 - 7 . 40 ( m , 6 h ), 7 . 76 - 7 . 78 ( m , 4 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 7 . 6 , 18 . 6 , 27 . 0 , 31 . 6 , 44 . 6 , 60 . 4 , 66 . 3 , 71 . 8 , 86 . 5 , 99 . 9 , 102 . 2 , 116 . 6 , 127 . 7 , 129 . 6 , 132 . 6 , 135 . 6 , 148 . 7 , 157 . 8 , 173 . 2 ; hrms ( ei ) m / z calcd for c 25 h 21 ino 4 si ( m - c 4 h 9 + ) 554 . 0279 , found 554 . 0285 ; lrms ( ei ) m / z 554 ( m - c 4 h 9 + ), 587 , 510 , 220 , 143 , 105 . following the procedure described in example 1 -( 2 ), the compound prepared in ( 1 ) ( 61 . 1 mg , 0 . 10 mmol ) yielded , after flash - chromatographies ( ch 2 cl 2 / meoh 96 : 4 ; ch 2 cl 2 / acetone 9 : 1 ), 26 . 5 mg ( 45 %) of a light yellow solid : [ α ] 20 d + 35 . 2 ( c 0 . 2 , chcl 3 ); ir ( chcl 3 , cm − 1 ) 3003 , 2984 , 2969 , 2958 , 2935 , 1741 , 1658 , 1599 , 1555 , 1428 , 1226 , 1216 , 1158 , 1102 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 00 ( t , j = 7 . 3 hz , 3 h ), 1 . 44 ( s , 9 h ), 1 . 84 ( m , 2 h ), 3 . 75 ( s , 1 h ), 4 . 21 ( d , j = 5 . 7 hz , 2 h ), 5 . 19 ( d , j = 16 . 3 hz , 1 h ), 5 . 64 ( d , j = 16 . 3 hz , 1 h ), 7 . 43 ( m , 5 h ), 7 . 51 ( t , j = 7 . 3 hz , 2 h ), 7 . 62 ( s , 1 h ), 7 . 69 ( m , 5 h ), 8 . 10 ( d , j = 8 . 5 hz , 1 h ), 8 . 22 ( d , j = 8 . 2 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 7 . 9 , 20 . 4 , 30 . 2 , 31 . 6 , 52 . 2 , 66 . 4 , 72 . 8 , 97 . 5 , 118 . 2 , 126 . 3 , 128 . 6 , 129 . 8 , 130 . 3 , 130 . 7 , 131 . 9 , 132 . 2 , 134 . 6 , 134 . 64 , 136 . 4 , 136 . 5 , 138 . 1 , 140 . 9 , 146 . 2 , 148 . 4 , 149 . 9 , 151 . 3 , 157 . 1 , 174 . 1 ; hrms ( ei ) m / z calcd for c 36 h 34 n 2 o 4 si ( m + ) 586 . 2281 , found 586 . 2288 ; lrms ( ei ) m / z 586 ( m + ), 542 , 529 , 485 , 428 , 407 , 321 , 181 , 131 , 69 . to a solution of 4 - acetoxyformanilide ( 13 ) ( 358 mg , 1 . 0 mmol ) in ch 2 cl 2 ( 10 ml ) at 0 ° c . were successively added tetrabromomethane ( 0 . 70 g , 2 . 1 mmol ), triphenylphosphine ( 525 mg , 2 . 1 mmol ), and triethylamine ( 320 ml , 2 . 1 mmol ), and the resulting mixture was refluxed in the dark for 3 h . after evaporation of the solvents , the crude was triturated in ice - cooled et 2 o ( 20 ml ) and filtered . the solvent was evaporated and the residue was purified by flash - chromatography ( hexanes / acoet 8 : 2 ) to afford 243 mg ( 76 %) of a slightly brown solid : ir ( neat , cm − 1 ) 2127 , 1768 , 1501 , 1370 , 1201 , 1180 , 909 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 2 . 29 ( s , 3 h ), 7 . 11 ( d , j = 8 . 8 hz , 2 h ), 7 . 38 ( d , j = 8 . 8 hz , 2h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 21 . 0 , 122 . 8 , 127 . 6 , 150 . 8 , 164 . 3 , 168 . 8 ; hrms ( ei ) m / z calcd for c 9 h 7 no 2 ( m + ) 161 . 0477 , found 161 . 0474 ; lrms ( ei ) m / z 161 ( m + ), 133 , 119 , 91 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 44 . 5 mg , 0 . 10 mmol ) and the compound prepared in ( 1 ) ( 48 . 3 mg , 0 . 30 mmol ) provided , after flash - chromatography ( chcl 3 / acetone 10 : 1 ), 29 . 9 mg ( 63 %) of a slightly yellow oil : [ α ] 20 d + 29 . 9 ( c 0 . 5 , chcl 3 ); 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 61 ( s , 9h ), 0 . 98 ( t , j = 7 . 4 hz , 3 h ), 1 . 86 ( m , 2 h ), 2 . 38 ( s , 3 h ), 4 . 13 ( br s , 1 h ), 5 . 24 ( d , j = 16 . 4 hz , 1 h ), 5 . 27 ( s , 2 h ), 5 . 68 ( d , j = 16 . 4 hz , 1 h ), 7 . 46 ( dd , j = 9 . 2 , 2 . 5 hz , 1 h ), 7 . 60 ( s , 1 h ), 7 . 96 ( d , j = 2 . 5 hz , 1 h ), 8 . 13 ( d , j = 9 . 2 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 4 , 7 . 8 , 21 . 4 , 31 . 5 , 51 . 7 , 66 . 2 , 97 . 6 , 118 . 3 , 118 . 9 , 124 . 6 , 132 . 1 , 135 . 0 , 145 . 7 , 146 . 1 , 148 . 9 , 150 . 1 , 150 . 7 , 157 . 3 , 169 . 1 , 173 . 7 ; hrms ( ei ) m / z calcd for c 25 h 26 n 2 o 6 si ( m + ) 478 . 1560 , found 478 . 1582 ; lrms ( ei ) m / z 478 ( m + ), 436 , 392 , 377 , 336 , 277 . a solution of the compound ( 15 ) prepared in example 5 -( 2 ) ( 16 . 8 mg , 0 . 035 mmol ) and k 2 co 3 ( 9 . 6 mg , 0 . 070 mmol ) in meoh ( 100 ml ) and h 2 o ( 100 ml ) was stirred 1 h 30 at room temperature . the reaction mixture was acidified with acoh ( 2 drops ), diluted with brine ( 10 ml ) and extracted with acoet ( 10 × 10 ml ). the combined organic layers were dried ( na 2 so 4 ) and evaporated , and the residue was purified by flash - chromatographies ( chcl 3 / meoh / acoh 90 : 10 : 2 ; chcl 3 / acetone 2 : 1 ) to give 15 . 1 mg ( 99 %) of a white solid : [ α ] 20 d + 18 . 9 ( c 0 . 2 , chcl 3 / meoh 4 : 1 ); 1 h nmr ( 300 mhz , cdcl 3 / cd 3 od 4 : 1 ) 60 . 45 ( s , 9 h ), 0 . 84 ( t , j = 7 . 3 hz , 3 h ), 1 . 75 ( m , 2 h ), 5 . 12 ( br s , 2 h ), 5 . 12 ( d , j = 16 . 3 hz , 1 h ), 5 . 48 ( d , j = 16 . 3 hz , 1 h ), 7 . 24 ( dd , j = 9 . 1 , 2 . 5 hz , 1 h ), 7 . 39 ( d , j = 2 . 5 hz , 1 h ), 7 . 87 ( d , j = 9 . 1 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 / cd 3 od 4 : 1 ) δ 0 . 8 , 7 . 4 , 31 . 1 , 51 . 8 , 65 . 7 , 97 . 5 , 109 . 8 , 117 . 5 , 122 . 3 , 131 . 3 , 133 . 7 , 134 . 6 , 141 . 7 , 142 . 6 , 146 . 3 , 147 . 5 , 151 . 1 , 156 . 3 , 157 . 6 ; hrms ( ei ) m / z calcd for c 23 h 24 n 2 o 5 si ( m + ) 436 . 1454 , found 436 . 1450 ; lrms ( ei ) m / z 436 ( m + ), 392 , 377 , 336 , 323 . reaction of this compound with nh 2 ch 2 ch 2 nme 2 followed by etcocl provided the open e - ring analog for biological testing . to a solution of 4 - nitrophenyl chloroformate ( 31 ) ( 5 . 15 g , 25 . 6 mmol ) in 150 ml of dry thf at − 78 ° c . was added triethylamine ( 10 . 7 ml , 76 . 2 mmol ), followed by a solution of 4 - piperidinopiperidine ( 30 ) ( 4 . 51 g , 25 . 6 mmol ) in 40 ml of thf . this solution was stirred for two hours , after which the solvent was removed , and the residue was taken up in acoet , filtered and evaporated . the crude yellow solid was passed through a pad of neutral alumina using acoet as an eluent to yield , after evaporation , 6 . 73 g ( 79 %) of a white solid : ir ( chcl 3 , cm − 1 ) 3046 , 2937 , 2859 , 1704 , 1620 , 1513 , 1466 , 1242 , 1197 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 20 - 1 . 80 ( m , 8 h ), 1 . 90 ( d , j = 12 . 7 hz , 2 h ), 2 . 20 - 2 . 70 ( m , 5 h ), 2 . 87 ( t , j = 12 hz , 1 h ), 3 . 01 ( t , j = 12 hz , 1 h ), 4 . 30 ( br s , 2 h ), 7 . 29 ( d , j = 9 hz , 2 h ), 8 . 26 ( d , j = 9 hz , 2 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 24 . 6 , 26 . 3 , 27 . 5 , 28 . 2 , 40 . 1 , 44 . 4 , 50 . 1 , 62 . 0 , 122 . 2 , 124 . 9 , 144 . 8 , 151 . 9 , 156 . 3 ; hrms ( ei ) m / z calcd for c 17 h 23 n 3 o 4 ( m + ) 333 . 1676 , found 333 . 1688 ; lrms ( ei ) m / z 333 ( m + ), 195 , 167 , 124 , 110 , 96 , 55 . to a solution of the compound prepared in ( 1 ) ( 1 . 012 g , 3 . 03 mmol ) in acoet ( 125 ml ) was added 10 % pd / c ( 0 . 15 g ). the system was purged several times with argon , and a 1 l balloon of h 2 was added . after stirring the resulting mixture at room temperature for 12 hours , the catalyst was removed by filtration through celite and the solvent was evaporated to give 835 mg ( 91 %) of a white solid : ir ( chcl 3 , cm − 1 ) 3453 , 3400 , 3028 , 2936 , 2859 , 1703 , 1513 , 1429 , 1242 , 1226 , 1210 , 1197 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 30 - 1 . 70 ( m , 8 h ), 1 . 86 ( d , j = 12 . 6 hz , 2 h ), 2 . 33 - 2 . 62 ( m , 5 h ), 2 . 68 - 3 . 04 ( m , 2 h ), 3 . 58 ( br s , 2h ), 4 . 30 ( br s , 2 h ), 6 . 64 ( d , j = 6 . 0 hz , 2 h ), 6 . 87 ( d , j = 6 . 0 hz , 2 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 24 . 6 , 26 . 3 , 27 . 5 , 28 . 1 , 43 . 8 , 43 . 9 , 50 . 1 , 62 . 3 , 115 . 4 , 122 . 3 , 143 . 4 , 143 . 7 , 154 . 1 ; hrms ( ei ) m / z calcd for c 17 h 25 n 3 o 2 ( m + ) 303 . 1944 , found 303 . 1947 ; lrms ( ei ) m / z 303 ( m + ), 195 , 167 , 124 , 108 , 96 , 80 , 65 , 55 . to a stirred solution of dicyclohexylcarbodiimide ( 272 mg , 1 . 32 mmol ) in ch 2 cl 2 ( 5 ml ) at 0 ° c . was added 98 % formic acid ( 60 . 7 mg , 1 . 32 mmol ) dropwise . after 10 minutes , the resulting mixture was added via syringe to a solution of the compound prepared in example ( 2 ) ( 200 mg , 0 . 66 mmol ) in pyridine ( 5 ml ) at 0 ° c . the reaction mixture was then allowed to warm to room temperature and stirred 3 h . the pyridine solvent was evaporated and the residue was taken up in ch 2 cl 2 , filtered , evaporated and subjected directly to a basic alumina column ( ch 2 cl 2 / meoh 95 : 5 ) to give 118 mg ( 83 %) of a white solid , which consists , at room temperature , of a mixture of the cis and trans rotamers originating from hindered rotation around the formamide carbon - nitrogen bond : ir ( chcl 3 , cm − 1 ) 3025 , 3013 , 2937 , 2888 , 2861 , 1703 , 1517 , 1466 , 1275 , 1226 , 1210 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 38 - 1 . 80 ( m , 8 h ), 1 . 90 ( d , j = 12 hz , 2 h ), 2 . 40 - 2 . 70 ( m , 5 h ), 2 . 83 ( t , j = 12 hz , 1 h ), 2 . 97 ( t , j = 12 hz , 1 h ), 4 . 32 ( m , 2 h ), 7 . 03 - 7 . 11 ( m , 3 h ), 7 . 37 ( br s , 0 . 5 h ) ( cis ), 7 . 46 ( d , j = 10 hz , 1 h ), 7 . 53 ( d , j = 11 hz , 0 . 5 h ) ( trans ), 8 . 32 ( d , j = 2 hz , 0 . 5 h ) ( cis ), 8 . 59 ( d , j = 11 hz , 0 . 5 h ) ( trans ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 24 . 6 , 26 . 3 , 27 . 6 , 28 . 1 , 44 . 2 , 44 . 0 , 50 . 1 , 82 . 2 , 120 . 0 , 121 . 0 , 122 . 1 , 123 . 0 , 133 . 9 , 134 . 3 , 147 . 5 , 148 . 9 , 153 . 9 , 153 . 4 , 159 . 1 , 162 . 5 ; hrms ( ei ) m / z calcd for c 18 h 25 n 3 o 3 ( m + ) 331 . 1884 , found 331 . 1896 ; lrms ( ei ) m / z 331 ( m + ), 244 , 202 , 167 , 124 , 80 , 55 . to a solution of the compound prepared in example ( 3 ) ( 90 . 1 mg , 0 . 272 mmol ) in ch 2 cl 2 ( 10 ml ) were successively added triethylamine ( 69 . 5 mg , 0 . 688 mmol ) them dropwise , at 0 ° c ., a solution of triphosgene ( 68 mg , 0 . 229 mmol ) in dry ch 2 cl 2 ( 10 ml ). the mixture was stirred 2 hours at room temperature , washed with 7 % nahco 3 ( 5 ml ) and dried ( mgso 4 ). the crude brown residue obtained after evaporation of the solvent was subjected to flash - chromatography ( et 2 o / et 2 nh 95 : 5 ) to yield 67 . 2 mg ( 79 %) of a white solid : ir ( chcl 3 , cm − 1 ) 3034 , 2937 , 2131 , 1718 , 1504 , 1429 , 1233 , 1224 , 1213 , 1198 , 1184 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 32 - 1 . 75 ( m , 8 h ), 1 . 90 ( br d , j = 12 . 4 hz , 2 h ), 2 . 32 - 2 . 65 ( m , 5 h ), 2 . 84 ( t , j = 12 . 3 hz , 1 h ), 2 . 98 ( t , j = 12 . 1 hz , 1 h ), 4 . 20 - 4 . 40 ( m , 2 h ), 7 . 14 ( d , j = 8 . 8 hz , 2 h ), 7 . 37 ( d , j = 8 . 8 hz , 2 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 25 . 0 , 26 . 5 , 27 . 8 , 28 . 5 , 44 . 4 , 50 . 6 , 62 . 7 , 123 . 3 , 127 . 8 , 152 . 1 , 153 . 1 , 164 . 4 ; hrms ( ei ) m / z calcd for c 18 h 23 n 3 o 2 ( m + ) 313 . 1779 , found 313 . 1790 ; lrms ( ei ) m / z 313 ( m + ), 195 , 167 , 124 , 110 , 84 , 55 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 44 . 5 mg , 0 . 10 mmol ), the compound prepared in ( 4 ) ( 93 . 9 mg , 0 . 3 mmol ), and hexamethylditin ( 50 mg , 0 . 15 mmol ) in dry benzene ( 1 . 5 ml ) were irradiated for 9 hours at 70 ° with a 275w ge sunlamp . the reaction was evaporated , dissolved in meoh with a few drops of dmso to aid solubility and injected into a waters reverse phase hplc . the conditions used to effect separation were as follows . a waters 600e system controller with a waters 490e programmable multiwavelength detector , a sargent welch plotter and waters c - 18 25 × 10 cartridge columns were employed . a gradient elution , [ 5 : 95 mecn / h 2 o ( 0 . 1 % tfa ) to 30 : 70 mecn / h 2 o ( 0 . 1 % tfa )], over 40 minutes time at 20 ml / min gave a semipurified grey solid after lyophilization . the grey solid was further purified ( ch 2 cl 2 / etoh 70 : 30 ) on a chromatotron using a 1 mm plate to give 12 mg ( 19 %) of a yellow solid : [ α ] 20 d + 14 . 8 ( c 0 . 2 , chcl 3 ); ir ( chcl 3 , cm − 1 ) 3023 , 2957 , 2933 , 1720 , 1659 , 1601 , 1216 , 1191 , 1175 , 1158 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 64 ( s , 9 h ), 1 . 03 ( t , j = 7 . 3 hz , 3 h ), 1 . 50 - 1 . 51 ( br m , 2 h ), 1 . 51 - 1 . 52 ( br m , 6 h ), 1 . 84 ( m , j = 7 . 3 hz , 2 h ), 2 . 01 - 2 . 10 ( br m , 2 h ), 2 . 60 - 2 . 75 ( br s , 5 h ), 2 . 75 - 3 . 12 ( br m , 2 h ), 4 . 30 - 4 . 50 ( br m , 2 h ), 5 . 30 ( d , j = 16 . 3 hz , 1 h ), 5 . 31 ( s , 2 h ), 5 . 74 ( d , j = 16 . 3 hz , 1 h ), 7 . 55 ( dd , j = 9 . 0 , 2 . 4 hz , 1 h ), 7 . 63 ( s , 1 h ), 8 . 01 ( d , j = 2 . 3 hz , 1 h ), 8 . 19 ( d , j = 9 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 5 , 7 . 8 , 25 . 4 , 29 . 7 , 31 . 5 , 43 . 8 , 50 . 1 , 51 . 8 , 62 . 5 , 66 . 3 , 72 . 8 , 97 . 5 , 118 . 1 , 119 . 0 , 125 . 1 , 132 . 0 , 132 . 3 , 134 . 9 , 143 . 4 , 145 . 6 , 146 . 4 , 150 . 1 , 150 . 5 , 152 . 8 , 157 . 4 , 174 . 0 ; hrms ( ei ) m / z calcd for c 34 h 42 n 4 o 6 si ( m + ) 630 . 2898 , found 630 . 2874 ; lrms ( ei ) m / z 630 ( m + ), 586 , 501 , 457 , 195 , 167 , 153 , 124 , 111 , 96 , 84 . the preparation of 3 - fluoro - 2 - trimethylsilylbenzaldehyde proceeds through a selective ortho - metallation . see comins , d . l . et al ., j . org . chem ., 49 , 1078 ( 1984 ). see also snieckus , v ., chem . rev ., 90 , 879 ( 1990 ). to a solution of n , n , n ′- trimethylethylenediamine ( 2 . 70 ml , 20 mmol ) in thf ( 50 ml ) was slowly added 1 . 6 n n - buli in hexanes ( 13 ml , 21 mmol ) at − 20 ° c ., followed by 3 - fluorobenzaldehyde ( 2 . 10 ml , 20 mmol ) 15 min latter . after 15 minute at this temperature , 1 . 6 n n - buli in hexanes ( 38 ml , 60 mmol ) was injected and the solution was stirred 1 h 30 at − 35 ° c . chlorotrimethylsilane ( 15 ml , 120 mmol ) was added and the reaction mixture was stirred overnight at room temperature . the final solution was poured into ice - cooled 1 n hcl ( 150 ml ), quickly extracted with et 2 o ( 3 × 100 ), washed with brine and dried ( na 2 so 4 ). after evaporation of the solvents , the residue was purified by flash - chromatography ( hexanes / acoet 95 : 5 ) to provide 3 . 25 g ( 83 %) of an oil : ir ( neat , cm − 1 ) 1701 , 1440 , 1252 , 1233 , 1109 , 848 , 764 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 40 ( d , j = 2 . 6 hz , 9 h ), 7 . 18 ( br t , j = 9 . 0 hz , 1 h ), 7 . 47 ( ddd , j 1 = j 2 = 8 . 1 hz , j 3 = 5 . 4 hz , 1 h ), 7 . 70 ( br d , j = 7 . 5 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 8 , 120 . 8 ( d , j cf = 29 hz ), 126 . 8 , 128 . 2 , 131 . 2 , 143 . 3 , 167 . 6 ( d , j cf = 244 hz ), 192 . 4 ; hrms ( ei ) m / z calcd for c 9 h 10 fosi ( m - ch 3 + ) 181 . 0485 , found 181 . 0482 ; lrms ( ei ) m / z 181 ( m - ch 3 + ), 151 , 125 , 103 , 91 . a classical oxidation to the free acid was then performed . see hill , l . r . et al ., j . org . chem ., 50 , 470 ( 1985 ). to a solution of the compound prepared in ( 1 ) ( 3 . 41 g , 17 . 3 mmol ) in tert - butanol ( 20 ml ) were successively added a 2 n solution of 2 - methyl - 2 - butene in thf ( 55 ml , 110 mmol ) then slowly , over a period of 10 minutes , a solution of 80 % naclo 2 ( 2 . 55 g , 22 . 5 mmol ) and nah 2 po 4 . h 2 o ( 3 . 10 g , 22 . 5 mmol ) in water ( 18 ml ). the resulting mixture was stirred 16 h at room temperature , the tert - butanol was evaporated , and the residue was taken up in 1 n naoh ( 50 ml ) and washed with hexanes ( 3 × 20 ml ). the aqueous layer was acidified with 1 n hcl to ph 2 , saturated with nacl , and extracted with et 2 o ( 3 × 50 ml ). the combined organic layers were dried ( na 2 so 4 ) and evaporated to provide 3 . 13 g ( 85 %) of a white solid : ir ( nacl , cm − 1 ) 2982 , 1700 , 1434 , 1294 , 1271 , 1253 , 1230 , 849 , 763 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 39 ( d , j = 2 . 6 hz , 9 h ), 7 . 16 ( br t , j = 9 . 1 hz , 1 h ), 7 . 41 ( ddd , j 1 = j 2 = 7 . 9 hz , j 3 = 5 . 6 hz , 1 h ), 7 . 73 ( br d , j = 7 . 7 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 3 , 119 . 5 ( d , j cf = 27 hz ), 126 . 0 , 127 . 3 , 130 . 9 , 138 . 0 , 167 . 5 ( d , j cf = 243 hz ), 174 . 5 ; hrms ( ei ) m / z calcd for c 9 h 10 fo 2 si ( m - ch 3 + ) 197 . 0434 , found 197 . 0433 ; lrms ( ei ) m / z 197 ( m - ch 3 + ), 179 , 133 , 115 , 105 . preparation of the intermediate isocyanate was carried out via a curtius rearrangement . see capson , t . l . et al ., tetrahedron lett ., 25 , 3515 ( 1984 ) and references herein . to a solution of the compound prepared in ( 2 ) ( 3 . 03 g , 14 . 3 mmol ) in ch 2 cl 2 ( 20 ml ) was added oxalylchloride ( 1 . 30 ml , 15 . 0 mmol ) and the resulting mixture was stirred 3 h at room temperature . the residue obtained after evaporation of the solvent was diluted with thf ( 10 ml ) and injected with vigorous stirring to a ice - cooled solution of nan 3 ( 3 . 70 g , 57 mmol ) in h 2 o ( 20 ml ) and acetone ( 50 ml ). after 15 min at 0 ° c . and 1 min at room temperature , the solution was extracted with et 2 o ( 4 × 50 ml ) and dried ( na 2 so 4 ). the residue obtained after evaporation of solvents was refluxed in toluene for 1 h 30 to provide , upon solvent removal , 2 . 85 g ( 79 %) of a slightly yellow oil : ir ( neat , cm − 1 ) 2269 , 1598 , 1433 , 1252 , 1228 , 846 , 788 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 38 ( d , j = 1 . 9 hz , 9 h ), 6 . 82 ( br t , j = 8 . 3 hz , 1 h ), 6 . 90 ( br d , j = 8 . 2 hz , 1 h ), 7 . 25 ( ddd , j 1 = j 2 = 8 . 1 hz , j 3 = 6 . 6 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 0 . 4 , 112 . 6 ( d , j cf = 26 hz ), 120 . 5 , 122 . 5 , 131 . 5 , 139 . 2 , 167 . 4 ( d , j cf = 241 hz ). a deoxygenation then afforded the expected isonitrile . see baldwin , j . e . et al ., tetrahedron , 39 , 2989 ( 1983 ). triethylamine ( 4 . 10 ml , 29 . 3 mmol ) was added slowly at 0 ° c . to a 2 n solution of trichlorosilane in ch 2 cl 2 ( 8 . 40 ml , 16 . 8 mmol ) followed , 5 min latter , by the compound prepared in example ( 3 ) ( 2 . 35 g . 11 . 2 mmol ). after 1 h 30 at 0 ° c . and 30 min at room temperature , the solution was saturated with nh 3 , filtered over celite , washed with 5 % nah 2 po 4 and dried ( na 2 so 4 ). the crude obtained after evaporation of the solvent was then subjected to flash - chromatography ( hexanes / acoet 95 : 5 ) to afford 1 . 42 g ( 66 %) of a slighly purple liquid : ir ( neat , cm − 1 ) 2114 , 1598 , 1440 , 1254 , 1237 , 1110 , 943 , 848 , 793 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 45 ( d , j = 1 . 8 hz , 9 h ), 7 . 01 ( br t , j = 8 . 3 hz , 1 h ), 7 . 17 ( br d , j = 7 . 7 hz , 1 h ), 7 . 32 ( ddd , j 1 = j 2 = 8 . 0 hz , j 3 = 6 . 1 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 0 . 1 , 116 . 5 ( d , j cf = 26 hz ), 124 . 3 , 131 . 6 , 166 . 8 ( d , j cf = 243 hz ), 166 . 9 ; hrms ( ei ) m / z calcd for c 10 h 12 fnsi ( m + ) 193 . 0723 , found 193 . 0715 ; lrms ( ei ) m / z 193 ( m + ), 178 , 150 , 116 , 105 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 43 . 5 mg , 0 . 098 mmol ) and the compound prepared in example ( 4 ) ( 76 mg , 0 . 39 mmol ) provided , after flash - chromatography ( chcl 3 / acetone 20 : 1 ), 33 . 4 mg ( 67 %) of a slighly yellow oil : [ α ] 20 d + 23 . 6 ( c 0 . 2 , chcl 3 ); 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 53 ( d , j = 1 . 7 hz , 9 h ), 0 . 60 ( s , 9 h ), 1 . 02 ( t , j = 7 . 4 hz , 3 h ), 1 . 88 ( m , 2 h ), 3 . 82 ( br s , 1 h ), 5 . 28 ( d , j = 16 . 3 hz , 1 h ), 5 . 29 ( br s , 2 h ), 5 . 72 ( d , j = 16 . 3 hz , 1 h ), 7 . 31 ( t , j = 8 . 7 hz , 1 h ), 7 . 46 ( s , 1 h ), 8 . 18 ( dd , j = 9 . 2 , 5 . 9 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 6 , 1 . 7 , 7 . 7 , 31 . 4 , 51 . 8 , 66 . 3 , 72 . 7 , 97 . 2 , 117 . 8 ( d , j cf = 33 hz ), 124 . 3 ( d , j cf = 28 hz ), 128 . 9 , 131 . 1 , 133 . 1 , 144 . 4 , 146 . 7 , 150 . 1 , 153 . 4 , 157 . 4 , 167 . 6 ( d , j cf = 245 hz ), 173 . 9 ; hrms ( ei ) m / z calcd for c 26 h 31 fn 2 o 4 si 2 ( m + ) 510 . 1806 , found 510 . 1806 ; lrms ( ei ) m / z 510 ( m + ), 495 , 466 , 451 , 395 , 319 . a solution of the compound prepared in example ( 5 ) ( 19 . 5 mg , 0 . 038 mmol ) in 48 % hbr ( 1 ml ) was heated at 50 ° c . for 20 h . the reaction mixture was slowly poured with vigorous stirring into saturated nahco 3 ( 10 ml ), extracted with acoet ( 6 × 20 ml ) and dried ( na 2 so 4 ). after evaporation of the solvent , the residue was purified by flash - chromatography ( chcl 3 / acetone 8 : 1 ) to give 12 . 5 mg ( 83 %) of a slighly yellow solid : [ α ] 20 d + 39 . 6 ( c 0 . 2 , chcl 3 ); 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 62 ( s , 9 h ), 1 . 01 ( t , j = 7 . 4 hz , 3 h ), 1 . 87 ( m , 2 h ), 3 . 81 ( br s , 1 h ), 5 . 28 ( d , j = 16 . 4 hz , 1 h ), 5 . 28 ( br s , 2 h ), 5 . 72 ( d , j = 16 . 4 hz , 1 h ), 7 . 31 ( ddd , j = 9 . 6 , 7 . 8 , 2 . 8 hz , 1 h ), 7 . 61 ( s , 1 h ), 7 . 78 ( dd , j = 9 . 7 , 2 . 7 hz , 1 h ), 8 . 19 ( dd , j = 9 . 4 , 5 . 8 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 6 , 7 . 8 , 31 . 5 , 51 . 7 , 66 . 3 , 72 . 7 , 97 . 8 , 114 . 3 ( d , j cf = 20 hz ), 117 . 7 ( d , j cf = 26 hz ), 118 . 5 , 128 . 9 , 130 . 0 , 133 . 9 , 144 . 4 , 146 . 1 , 149 . 3 , 150 . 1 , 151 . 7 , 157 . 4 , 162 . 6 ( d , j cf = 250 hz ), 173 . 9 ; hrms ( ei ) m / z calcd for c 23 h 23 fn 2 o 4 si ( m + ) 438 . 1411 , found 438 . 1412 ; lrms ( ei ) m / z 438 ( m + ), 409 , 394 , 379 , 365 , 338 , 309 . the isonitrile was prepared in 2 steps via classical boc - protection followed by dehydration . see einhorn , j . et al ., synlett , 37 ( 1991 ). a mixture of 4 - aminoformanilide ( 1 . 71 g , 12 . 6 mmol ), di - tert - butyl dicarbonate ( 2 . 87 g , 13 . 2 mmol ) and nahco 3 ( 1 . 11 g , 13 . 2 mmol ) in absolute etoh ( 50 ml ) was sonicated in a cleaning bath for 4 h . the final solution was filtered through a pad of celite and concentrated to dryness . the residue was taken up in half brine ( 50 ml ), extracted with acoet ( 6 × 30 ml ) and dried ( na 2 so 4 ). after evaporation of the solvent , the residual oil was subjected to flash - chromatography ( chcl 3 / meoh 95 : 5 ) to give 2 . 85 g ( 96 %) of 4 - tert - butyloxycarbonylaminoformanilide , as a white solid . this intermediate ( 945 mg , 4 . 0 mmol ) was subjected to the conditions described in example 5 -( 1 ) to provide , after flash - chromatography ( hexanes / acoet 9 : 1 ), 502 mg ( 58 %) of a slighly brown solid : ir ( nacl , cm − 1 ) 3370 , 2121 , 1691 , 1524 , 1412 , 1364 , 1239 , 1158 , 832 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 48 ( s , 9 h ), 6 . 75 ( br s , 1 h ), 7 . 26 ( d , j = 8 . 8 hz , 2 h ), 7 . 37 ( d , j = 8 . 8 hz , 2 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 28 . 2 , 81 . 3 , 118 . 5 , 127 . 1 , 139 . 4 , 152 . 3 , 162 . 7 ; hrms ( ei ) m / z calcd for c 12 h 14 n 2 o 2 ( m + ) 218 . 1055 , found 218 . 1044 ; lrms ( ei ) m / z 218 ( m + ), 162 , 144 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 44 . 5 mg , 0 . 10 mmol ) and the compound prepared in example ( 1 ) ( 65 mg , 0 . 30 mmol ) provided , after flash - chromatography ( chcl 3 / acetone 6 : 1 ), 32 . 5 mg ( 60 %) of a slighly yellow solid : [ α ] 20 d + 28 . 0 ( c 0 . 2 , chcl 3 ); 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 63 ( s , 9 h ), 0 . 99 ( t , j = 7 . 4 hz , 3 h ), 1 . 53 ( s , 9 h ), 1 . 86 ( m , 2 h ), 4 . 03 ( br s , 1 h ), 5 . 24 ( d , j = 16 . 2 hz , 1 h ), 5 . 26 ( s , 2 h ), 5 . 70 ( d , j = 16 . 2 hz , 1 h ), 7 . 00 ( br s , 1 h ), 7 . 47 ( dd , j = 9 . 2 , 2 . 3 hz , 1 h ), 7 . 55 ( s , 1 h ), 8 . 02 ( d , j = 9 . 2 hz , 1 h ), 8 . 56 ( br s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 3 , 7 . 8 , 28 . 2 , 31 . 5 , 51 . 8 , 66 . 3 , 72 . 8 , 97 . 1 , 114 . 4 , 117 . 8 , 122 . 6 , 131 . 3 , 132 . 8 , 135 . 0 , 137 . 2 , 142 . 9 , 144 . 3 , 146 . 6 , 149 . 2 , 150 . 1 , 157 . 4 , 173 . 9 ; hrms ( ei ) m / z calcd for c 23 h 25 n 3 o 4 si ( m - boc + ) 435 . 1614 , found 435 . 1612 ; lrms ( ei ) m / z 535 ( m + ), 479 , 435 , 391 , 362 , 335 . a solution of the compound prepared in example ( 2 ) ( 75 . 5 mg , 0 . 141 mmol ) and tfa ( 500 ml ) in ch 2 cl 2 ( 2 ml ) was stirred 3 h at room temperature . the reaction mixture was then poured into saturated nahco 3 ( 50 ml ), extracted with acoet ( 10 × 15 ml ) and dried ( na 2 so 4 ). the residue obtained after evaporation of the solvents was purified by flash - chromatography ( chcl 3 / meoh 95 : 5 ) to afford 55 . 4 mg ( 90 %) of a yellow solid : [ α ] 20 d + 18 . 7 ( c 0 . 15 , chcl 3 / meoh 4 : 1 ); 1 h nmr ( 300 mhz , cdcl 3 / cd 3 od 4 : 1 ) δ 0 . 40 ( s , 9 h ), 0 . 80 ( t , j = 7 . 4 hz , 3 h ), 1 . 70 ( m , 2 h ), 5 . 05 ( s , 2 h ), 5 . 08 ( d , j = 16 . 3 hz , 1 h ), 5 . 43 ( d , j = 16 . 3 hz , 1 h ), 7 . 05 ( br s , 1 h ), 7 . 07 ( d , j = 8 . 0 hz , 1 h ), 7 . 38 ( s , 1 h ), 7 . 74 ( d , j = 8 . 0 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 / cd 3 od 4 : 1 ) δ 0 . 6 , 7 . 2 , 30 . 8 , 51 . 8 , 65 . 5 , 72 . 7 , 97 . 0 , 107 . 2 , 116 . 8 , 122 . 0 , 130 . 7 , 134 . 0 , 134 . 7 , 139 . 9 , 141 . 7 , 145 . 8 , 146 . 9 , 151 . 2 , 157 . 5 , 173 . 7 ; hrms ( ei ) m / z calcd for c 23 h 25 n 3 o 4 si ( m + ) 435 . 1614 , found 435 . 1613 ; lrms ( ei ) m / z 435 ( m + ), 391 , 376 , 335 , 290 . the isonitrile was prepared in 2 steps following the same procedures as described in example 9 -( 1 ). in the first step , the boc - protection of 3 - aminoformanilide ( 1 . 80 g , 13 . 2 mmol ) provided , after flash - chromatography ( chcl 3 / meoh 95 : 5 ), 2 . 65 g ( 85 %) of 3 - tert - butyloxycarbonylaminoformanilide , as a white solid . this intermediate ( 412 mg , 1 . 74 mmol ) was then subjected to the conditions described in example 5 -( 1 ) to provide , after flash - chromatography ( hexanes / acoet 9 : 1 ), 190 mg ( 50 %) of a brown solid : ir ( nacl , cm − 1 ) 3318 , 2126 , 1715 , 1603 , 1547 , 1433 , 1236 , 1162 , 782 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 49 ( s , 9 h ), 6 . 67 ( br s , 1 h ), 7 . 00 ( m , 1 h ), 7 . 20 - 7 . 30 ( m , 2 h ), 7 . 60 ( br s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 28 . 2 , 81 . 3 , 116 . 0 , 118 . 9 , 120 . 6 , 129 . 8 , 139 . 5 , 152 . 3 , 163 . 6 ; hrms ( ei ) m / z calcd for c 12 h 14 n 2 o 2 ( m + ) 218 . 1055 , found 218 . 1047 ; lrms ( ei ) m / z 218 ( m + ), 196 , 162 , 152 , 118 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 44 . 5 mg , 0 . 10 mmol ) and the compound prepared in example ( 1 ) ( 65 . 5 mg , 0 . 3 mmol ) afforded , after flash - chromatographies ( chcl 3 / meoh 95 : 5 ; chcl 3 / acetone 5 : 1 ), 23 . 1 mg ( 43 %) of a slighly yellow oil . this intermediate ( 14 . 7 mg , 0 . 027 mmol ) was then deprotected following the conditions described in example 9 -( 3 ) to provide , after flash - chromatography ( chcl 3 / meoh 9 : 1 ), 11 . 8 mg ( 99 %) of ( 20s )- 11 - amino - 7 - trimethylsilylcamptothecin , as a yellow solid and with the exclusion of other isomers : [ α ] 20 d + 15 . 0 ( c 0 . 1 , chcl 3 / meoh 4 : 1 ); 1 h nmr ( 300 mhz , cdcl 3 / cd 3 od 4 : 1 ) δ 0 . 44 ( s , 9 h ), 0 . 86 ( t , j = 7 . 4 hz , 3 h ), 1 . 76 ( m , 2 h ), 5 . 08 ( s , 2 h ), 5 . 14 ( d , j = 16 . 4 hz , 1 h ), 5 . 50 ( d , j = 16 . 3 hz , 1 h ), 6 . 97 ( dd , j = 9 . 2 , 2 . 5 hz , 1 h ), 7 . 07 ( d , j = 2 . 5 hz , 1 h ), 7 . 50 ( s , 1 h ), 7 . 84 ( d , j = 9 . 2 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 / cd 3 od 4 : 1 ) δ 1 . 1 , 7 . 4 , 31 . 0 , 51 . 7 , 65 . 6 , 97 . 9 , 107 . 9 , 117 . 8 , 119 . 7 , 125 . 9 , 127 . 1 , 129 . 0 , 130 . 4 , 135 . 4 , 144 . 3 , 149 . 5 , 149 . 9 , 151 . 1 , 157 . 6 , 175 . 3 ; hrms ( ei ) m / z calcd for c 23 h 25 n 3 o 4 si ( m + ) 435 . 1614 , found 435 . 1626 ; lrms ( ei ) m / z 435 ( m + ), 406 , 391 , 376 , 335 . to a solution of 2 - fluoro - 4 - nitroaniline ( 21 ) [ prepared according to katritsky , a . r . et al ., j . org . chem ., 51 , 5039 ( 1986 )] ( 2 . 16 g , 13 . 9 mmol ) in ch 2 cl 2 ( 25 ml ) were successively added di - tert - butyl dicarbonate ( 3 . 19 g , 14 . 6 mmol ), triethylamine ( 2 . 95 ml , 20 . 8 mmol ) and 4 - dimethylaminopyridine ( 210 mg , 1 . 67 mmol ) and the reaction mixture was stirred 16 h at room temperature . the final solution was diluted with ch 2 cl 2 ( 75 ml ), washed with ice - cooled 5 % citric acid ( 4 × 50 ml ) and dried ( na 2 so 4 ). after evaporation of the solvent , the residue was subjected to flash - chromatography ( hexanes / acoet 9 : 5 ) to provide , in order of elution , first 1 . 95 g ( 55 %) of the mono - protected derivative , 4 - tert - butyloxycarbonylamino - 3 - fluoro - 1 - nitrobenzene , secondly 1 . 13 g ( 23 %) of the bis - protected derivative , 4 - di - tert - butyloxycarbonylamino - 3 - fluoro - 1 - nitrobenzene . the characteristics of the mono - protected derivative are as follows : 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 52 ( s , 9 h ), 6 . 99 ( br s , 1 h ), 7 . 95 ( m , 1 h ), 8 . 03 ( br d , j = 9 . 2 hz , 1 h ), 8 . 34 ( br t , j = 8 . 5 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 28 . 1 , 82 . 5 , 110 . 9 ( d , j cf = 23 hz ), 118 . 3 , 120 . 8 , 133 . 5 , 141 . 7 , 150 . 1 ( d , j cf = 243 hz ), 151 . 4 ; hrms ( ei ) m / z calcd for c 11 h 13 fn 2 o 4 ( m + ) 256 . 0859 , found 258 . 0854 ; lrms ( ei ) m / z 256 ( m + ), 200 , 182 , 57 . reduction of the nitro group to the amine function was carried out following a classical procedure . see ram , s . et al ., tetrahedron lett ., 25 , 3415 ( 1984 ). to a solution of the compound prepared in example ( 1 ) ( 1 . 62 g , 6 . 32 mmol ) and ammonium formate ( 1 . 70 g , 27 mmol ) in anhydrous meoh ( 12 ml ) was added 10 % pd — c ( 400 mg ) in one portion . after 2 h at room temperature , the final solution was filtered over celite , concentrated and the residue was directly subjected to flash - chromatography ( chcl 3 / meoh 9 : 1 ) to provide 1 . 40 g ( 98 %) of a slighly yellow oil : 1 h nmr ( 300 mhz , cd 3 socd 3 ) δ 1 . 40 ( s , 9 h ), 5 . 22 ( s , 2 h ), 6 . 25 - 6 . 35 ( m , 2 h ), 6 . 93 ( br t , j = 8 . 0 hz , 1 h ), 8 . 29 ( br s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 28 . 5 , 80 . 4 , 102 . 1 ( d , j cf = 24 hz ), 110 . 7 , 117 . 2 , 122 . 8 , 143 . 4 , 153 . 1 , 154 . 1 ( d , j cf = 244 hz ); hrms ( ei ) m / z calcd for c 11 h 15 fn 2 o 2 ( m + ) 226 . 1118 , found 226 . 1116 ; lrms ( ei ) m / z 226 ( m + ), 170 , 126 , 83 , 57 . to a stirred solution of dicyclohexylcarbodiimide ( 1 . 51 g , 7 . 31 mmol ) in ch 2 cl 2 ( 15 ml ) at 0 ° c . was added formic acid ( 275 ml , 7 . 31 mmol ) dropwise . after 10 minutes , the resulting mixture was added over a period of 5 minutes to a solution of the compound prepared in example ( 2 ) ( 1 . 28 g , 5 . 66 mmol ) in ch 2 cl 2 ( 10 ml ) and pyridine ( 0 . 61 ml , 7 . 50 mmol ) at 0 ° c . the reaction mixture was then allowed to warm to room temperature and stirred 16 h . after filtration over celite , the final solution was concentrated and subjected to flash - chromatography ( chcl 3 / acoet 85 : 15 ) to give 1 . 44 g ( 100 %) of 4 - tert - butyloxycarbonylamino - 3 - fluoroformamide , as a white solid . this intermediate ( 1 . 38 g , 5 . 43 mmol ) was dissolved in ch 2 cl 2 ( 20 ml ) and , at 0 ° c ., were successively added tetrabromomethane ( 1 . 93 g , 5 . 80 mmol ), triphenylphosphine ( 1 . 52 g , 5 . 80 mmol ), and 1 , 4 - diazabicyclo [ 2 . 2 . 2 ] octane ( dabco , 650 mg , 5 . 80 mmol ). the reaction mixture was allowed to warm to room temperature and stirred 2 h . after evaporation of the solvent , the crude was triturated in ice - cooled et 2 o ( 20 ml ) and filtered over celite . the residue obtained after evaporation of the solvent was purified by flash - chromatography ( hexanes / acoet 95 : 5 to 9 : 1 ) to provide 660 mg ( 51 %) of a slighly brown solid : 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 51 ( s , 9 h ), 6 . 76 ( br s , 1 h ), 7 . 05 - 7 . 20 ( m , 2 h ), 8 . 17 ( br t , j = 8 . 6 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 28 . 1 , 81 . 8 , 113 . 3 ( d , j cf = 25 hz ), 119 . 7 , 123 . 0 , 128 . 6 , 150 . 6 ( d , j cf = 242 hz ), 151 . 8 , 164 . 2 ; hrms ( ei ) m / z calcd for c 12 h 13 fn 2 o 2 ( m + ) 236 . 0961 , found 236 . 0952 ; lrms ( ei ) m / z 236 ( m + ), 180 , 163 , 136 , 08 , 57 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 66 . 8 mg , 0 . 15 mmol ) and the compound described in example ( 3 ) ( 110 mg , 0 . 50 mmol ) provided , after flash - chromatographies ( chcl 3 / meoh 96 : 4 ; chcl 3 / acetone 10 : 1 ), 47 . 6 mg ( 57 %) of a slighly yellow oil containing the above regioisomers : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 54 ( d , j = 4 . 9 hz , 9h minor ), 0 . 65 ( s , 9h major ), 0 . 99 ( t , j = 7 . 3 hz , 3h ), 1 . 86 ( m , 2h ), 3 . 93 ( br s , 1h ), 5 . 24 ( d , j = 16 . 3 hz , 1h minor ), 5 . 25 ( br s , 2h major ), 5 . 25 ( d , j = 16 . 3 hz , 1h major ), 5 . 30 ( br s , 2h minor ), 5 . 68 ( d , j = 16 . 3 hz , 1h minor ), 5 . 69 ( d , j = 16 . 3 hz , 1h major ), 6 . 98 ( d , j = 3 . 6 hz , 1h minor ), 7 . 02 ( d , j = 3 . 6 hz , 1h major ), 7 . 52 ( s , 1h minor ), 7 . 53 ( s , 1h major ), 7 . 74 ( d , j = 12 . 1 hz , 1h major ), 7 . 92 ( br d , j = 9 . 3 hz , 1h minor ), 8 . 60 ( br t , j = 8 . 4 hz , 1h minor ), 9 . 08 ( d , j = 8 . 7 hz , 1h major ); hrms ( ei ) m / z calcd for c 28 h 32 fn 3 o 6 si 553 . 2044 , found 553 . 2022 ; lrms ( ei ) m / z 553 ( m + ), 493 , 479 , 453 , 435 , 424 , 409 , 394 , 380 , 353 . the compound prepared in example ( 4 ) ( 41 . 3 mg , 0 . 0746 mmol ) was deprotected following the conditions described in example 9 -( 3 ). after workup , the crude was subjected to a flash - chromatography ( chcl 3 / acetone / meoh 70 : 10 : 1 . 5 ) to provide , in order of elution , first 14 . 1 mg ( 42 %) of the pure ( 20s )- 10 - amino - 11 - fluoro - 7 - trimethylsilyl - camptothecin , then a 15 . 2 mg of a c . a . 1 : 1 mixture of ( 20s )- 10 - amino - 11 - fluoro - 7 - trimethylsilylcamptothecin and ( 20s )- 10 - amino - 9 - fluoro - 7 - trimethylsilylcamptothecin . the characteristics of ( 20s )- 10 - amino - 11 - fluoro - 7 - trimethylsilylcamptothecin are as follows : [ α ] 20 d + 20 . 0 ( c 0 . 2 , chcl 3 / meoh 4 : 1 ); 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 59 ( s , 9h ), 1 . 00 ( t , j = 7 . 4 hz , 3 h ), 1 . 86 ( m , 2 h ), 3 . 86 ( br s , 1 h ), 4 . 31 ( br s , 2 h ), 5 . 21 ( br s , 2 h ), 5 . 26 ( d , j = 16 . 4 hz , 1 h ), 5 . 69 ( d , j = 16 . 4 hz , 1 h ), 7 . 30 ( d , j = 9 . 3 hz , 1 h ), 7 . 50 ( s , 1 h ), 7 . 69 ( d , j = 11 . 8 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 / cd 3 od 10 : 1 ) δ 1 . 4 , 7 . 7 , 31 . 4 , 51 . 9 , 66 . 1 , 72 . 7 , 97 . 1 , 109 . 4 , 113 . 6 ( d , j cf = 20 hz ), 117 . 3 , 130 . 8 , 134 . 4 , 136 . 4 , 140 . 2 , 142 ., 146 . 5 , 147 . 6 , 150 . 6 , 153 . 9 , 154 . 0 ( d , j cf = 251 hz ), 157 . 6 , 173 . 9 ; hrms ( ei ) m / z calcd for c 23 h 24 fn 3 o 4 si ( m + ) 453 . 1520 , found 453 . 1500 ; lrms ( ei ) m / z 453 ( m + ), 424 , 409 , 394 , 352 , 181 , 131 , 119 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 44 . 5 mg , 0 . 10 mmol ) and 2 , 3 - difluorophenyl isonitrile [ prepared in 20 % yield following the procedure of weber , w . p . et al ., tetrahedron lett ., 13 , 1637 ( 1972 ) with stirring 2 days at room temperature before workup ] ( 42 mg , 0 . 30 mmol ) afforded , after flash - chromatographies ( chcl 3 / meoh 95 : 5 ; chcl 3 / acetone 10 : 1 to 4 : 1 ), 22 . 6 mg ( 50 %) of a slighly yellow oil containing the above regioisomers : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 56 ( d , j = 4 . 8 hz , 1h minor ), 0 . 65 ( s , 9h major ), 1 . 00 ( t , j = 7 . 4 hz , 3 h ), 1 . 86 ( m , 2 h ), 3 . 87 ( br s , 1h minor ), 3 . 97 ( br s , 1h major ), 5 . 0 - 5 . 47 ( m , 3 h ), 5 . 68 ( d , j = 16 . 5 hz , 1 h ), 5 . 70 ( d , j = 16 . 4 hz , 1h minor ), 7 . 31 ( m , 1h minor ), 7 . 44 ( dt , j = 9 . 4 , 7 . 4 hz , 1h major ), 7 . 59 ( s , 1h minor ), 7 . 60 ( s , 1h major ), 7 . 68 ( m , 1h minor ), 7 . 93 ( m , 1h major ); hrms ( ei ) m / z calcd for c 23 h 22 f 2 n 2 o 4 si ( m + ) 456 . 1317 , found 456 . 1321 ; lrms ( ei ) m / z 456 ( m + ), 438 , 428 , 412 , 383 , 356 , 327 . following the procedure outlined in example 1 -( 1 ), iodopyridone 2 , ( 200 mg , 0 . 598 mmol ) was combined with triisopropylsilyl - 2 - propynyl bromide ( 329 mg , 1 . 196 mmol ). chromatography ( ch 2 cl 2 / acoet 9 : 1 ) gave 41 . 1 mg ( 13 %) of a white foam : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 91 ( t , j = 7 hz , 6 h ), 0 . 99 ( s , 18 h ), 1 . 71 ( m , j = 7 hz , 2 h ), 3 . 65 ( s , 1 h ), 5 . 0 - 5 . 2 ( m , 3 h ), 5 . 45 ( d , j = 16 hz , 1 h ), 7 . 13 ( s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 7 . 7 , 11 . 2 , 18 . 7 , 31 . 7 , 44 . 6 , 66 . 5 , 71 . 9 , 87 . 7 , 100 . 1 , 116 . 6 , 118 . 2 , 148 . 6 , 158 . 0 , 173 . 4 ; hrms ( ei ) m / z calcd for c 22 h 32 ino 4 si ( m + ) 529 . 1162 , found 529 . 1145 ; lrms ( ei ) m / z 529 ( m + ), 486 , 442 , 82 , 59 . following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 41 mg , 0 . 077 mmol ) yielded 23 . 3 mg ( 60 %) of a light yellow solid : [ α ] 20 d + 31 . 7 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3026 , 3008 , 2996 , 2962 , 2950 , 2932 , 2892 , 2869 , 1742 , 1658 , 1598 , 1555 , 1466 , 1230 , 1220 , 1158 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 02 ( t , j = 7 hz , 3 h ), 1 . 18 ( d , j = 7 hz , 18 h ), 1 . 60 - 2 . 0 ( m , 5 h ), 2 . 17 ( s , 1 h ), 5 . 31 ( d , j = 16 hz , 1 h ), 5 . 41 ( s , 2 h ), 5 . 76 ( d , j = 16 , 1 h ), 7 . 61 ( t , j = 7 hz , 1h ), 7 . 69 ( s , 1 h ), 7 . 78 ( t , j = 7 hz 1 h ), 8 . 20 ( t , j = 7 hz , 2 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 7 . 9 , 13 . 5 , 19 . 2 , 31 . 7 , 52 . 6 , 66 . 5 , 72 . 9 , 98 . 4 , 118 . 6 , 127 . 1 , 129 . 7 , 130 . 2 , 130 . 4 , 133 . 6 , 136 . 3 , 145 . 0 , 146 . 0 , 150 . 3 , 150 . 6 , 157 . 4 , 174 . 1 ; hrms ( ei ) m / z calcd for c 29 h 36 n 2 o 4 si ( m + ) 504 . 2444 , found 504 . 2436 ; lrms ( ei ) m / z 504 ( m + ), 461 , 433 , 419 , 405 , 391 , 375 , 361 , 347 , 311 , 275 , 174 , 93 , 69 , 59 . following the procedure outlined in example 1 -( 1 ), iodopyridone 2 , ( 150 mg , 0 . 450 mmol ) was combined with triethylsilyl - 2 - propynyl bromide ( 210 mg , 0 . 90 mmol ). chromatography ( ch 2 cl 2 / acoet 9 : 1 ) gave 97 . 0 mg ( 45 %) of a white foam : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 54 ( q , j = 8 hz , 6 h ), 0 . 92 ( t , j = 8 hz , 12 h ), 1 . 74 ( m , j = 7 hz , 2 h ), 3 . 57 ( s , 1 h ), 4 . 9 - 5 . 1 ( m , 3 h ), 5 . 46 ( d , j = 16 hz , 1 h ), 7 . 13 ( s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 4 . 1 , 7 . 4 , 7 . 6 , 31 . 5 , 44 . 5 , 66 . 3 , 71 . 8 , 88 . 7 , 99 . 2 , 100 . 0 , 116 . 5 , 118 . 1 , 148 . 5 , 158 . 0 , 173 . 2 ; hrms ( ei ) m / z calcd for c 19 h 26 ino 4 si ( m + ) 487 . 0676 , found 487 . 0688 ; lrms ( ei ) m / z 487 ( m + ), 458 , 430 , 420 , 402 , 360 , 332 , 153 , 141 , 125 , 96 , 83 , 68 , 57 . following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 48 . 7 mg , 0 . 1 mmol ) yielded 29 . 8 mg ( 65 %) of a light yellow solid : [ α ] 20 d + 35 . 9 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3015 , 3002 , 2960 , 2935 , 1741 , 1658 , 1599 , 1219 , 1199 , 1158 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 80 - 1 . 00 ( m , 12 h ), 1 . 0 - 1 . 18 ( m , 6 h ), 1 . 70 - 1 . 90 ( m , 2 h ), 5 . 22 - 5 . 27 ( m , 3 h ), 5 . 69 ( d , j = 16 hz , 1 h ), 7 . 58 ( t , j = 7 hz , 1 h ), 7 . 63 ( s , 1 h ), 7 . 72 ( t , j = 7 hz 1 h ), 8 . 18 ( m , 2 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 5 . 0 , 7 . 6 , 7 . 9 , 31 . 7 , 52 . 1 , 66 . 5 , 72 . 9 , 97 . 7 , 118 . 3 , 127 . 4 , 127 . 9 , 129 . 7 , 131 . 2 , 132 . 6 , 136 . 1 , 142 . 6 , 146 . 6 , 147 . 9 , 150 . 2 , 150 . 9 , 157 . 6 , 174 . 1 ; hrms ( ei ) m / z calcd for c 26 h 30 n 2 o 4 si ( m + ) 462 . 1975 , found 462 . 1982 ; lrms ( ei ) m / z 462 ( m + ), 433 , 418 , 405 , 389 , 361 , 256 , 220 , 205 , 189 , 178 , 149 , 137 , 123 , 109 , 95 , 81 , 69 , 57 . following the procedure outlined in example 1 -( 1 ), iodopyridone 2 ( 150 mg , 0 . 450 mmol ) was combined with dimethyl -( 1s , 2s , 5s ) 7 , 7 dimethylnorpinylsilyl - 2 - propynyl bromide ( 281 mg , 0 . 90 mmol ). chromatography ( ch 2 cl 2 / acoet 9 : 1 ) gave 100 . 8 mg ( 39 %) of a white foam : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 10 ( d , j = 2 hz , 6 h ), 0 . 48 - 0 . 70 ( m , 2 h ), 0 . 72 ( s , 3 h ), 0 . 93 ( t , j = 7 hz , 3 h ), 1 . 10 ( s , 3 h ), 1 . 15 - 1 . 40 ( m , 3 h ), 1 . 60 - 1 . 85 ( m , 6 h ), 1 . 88 - 2 . 00 ( m , 1 h ), 2 . 05 - 2 . 20 ( m , 1 h ), 3 . 58 ( s , 1 h ), 4 . 95 ( m , 3 h ), 5 . 46 ( d , j = 16 hz , 1 h ), 7 . 13 ( s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 0 . 78 , 7 . 8 , 20 . 2 , 23 . 1 , 24 . 0 , 24 . 8 , 25 . 3 , 27 . 0 , 31 . 3 , 31 . 7 , 39 . 7 , 40 . 7 , 44 . 7 , 49 . 1 , 66 . 5 , 71 . 9 , 91 . 0 , 98 . 5 , 100 . 3 , 116 . 6 , 118 . 3 , 148 . 7 , 158 . 0 , 173 . 4 . following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 57 . 0 mg , 0 . 1 mmol ) yielded 29 . 4 mg ( 54 %) of a light yellow solid : [ α ] 20 d + 29 . 2 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3020 , 3000 , 2980 , 2972 , 2939 , 2914 , 2824 , 2867 , 1741 , 1658 , 1599 , 1556 , 1264 , 1231 , 1201 , 1157 , 843 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 50 - 0 . 70 ( m , 8 h ), 0 . 90 - 1 . 10 ( m , 9 h ), 1 . 10 - 1 . 35 ( m , 4 h ), 1 . 40 - 1 . 60 ( m , 3 h ), 1 . 72 ( m , 1 h ), 1 . 80 - 1 . 95 ( m , 2 h ), 2 . 05 - 2 . 11 ( m , 2 h ), 5 . 25 ( d , j = 16 hz 1 h ), 5 . 27 ( s , 2 h ), 5 . 69 ( d , j = 16 hz , 1 h ), 7 . 58 ( t , j = 8 hz , 1 h ), 7 . 62 ( s , 1 h ), 7 . 72 ( t , j = 8 hz , 1 h ), 8 . 10 - 8 . 2 ( m , 2 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 1 . 4 , 7 . 9 , 19 . 9 , 23 . 0 , 24 . 6 , 25 . 3 , 26 . 8 , 31 . 6 , 31 . 7 , 39 . 6 , 40 . 5 , 49 . 3 , 52 . 0 , 66 . 5 , 72 . 9 , 97 . 7 , 118 . 3 , 127 . 3 , 128 . 3 , 129 . 7 , 131 . 2 , 132 . 1 , 134 . 6 , 144 . 6 , 146 . 6 , 148 . 0 , 150 . 2 , 150 . 9 , 157 . 6 , 174 . 0 ; hrms ( ei ) m / z calcd for c 32 h 38 n 2 o 4 si ( m + ) 542 . 2601 , found 542 . 2588 ; lrms ( ei ) m / z 542 ( m + ), 498 , 487 , 460 , 443 , 431 , 406 , 387 , 377 , 362 , 333 , 318 , 304 , 289 , 275 , 219 , 178 , 166 , 141 , 115 , 95 , 67 . following the procedure cited by rico and co - workers ( j . org . chem . 1994 , 59 , 415 ), iodopyridone 2 , ( 150 mg , 0 . 450 mmol ) was combined with 3 - cyanopropyldimethylsilyl - 2 - propynyl bromide ( 165 mg , 0 . 678 mmol ), k 2 co 3 ( 124 mg , 0 . 90 mmol ), bu 4 n + br − ( 14 . 5 mg , 0 . 045 mmol ), h 2 o ( 0 . 02 ml ) and toluene ( 3 . 6 ml ). this mixture was refluxed for 1 h . after filtration and chromatography ( ch 2 cl 2 / acoet 9 : 1 ) 34 . 0 mg ( 15 %) of a white oil was obtained : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 17 ( s , 6h ), 0 . 70 - 0 . 80 ( m , 2 h ), 0 . 98 ( t , j = 7 hz , 3 h ), 1 . 70 - 1 . 90 ( m , 4 h ), 2 . 39 ( t , j = 7 , 2 h ), 3 . 66 ( s , 1 h ), 4 . 9 - 5 . 22 ( m , 3 h ), 5 . 51 ( d , j = 16 hz , 1 h ), 7 . 19 ( s , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ − 2 . 1 , 7 . 8 , 15 . 4 , 20 . 5 , 20 . 6 , 31 . 6 , 44 . 6 , 66 . 4 , 71 . 9 , 89 . 1 , 99 . 6 , 100 . 0 , 116 . 7 , 118 . 3 , 119 . 7 , 148 . 8 , 158 . 0 , 173 . 3 ; hrms ( ei ) m / z calcd for c 19 h 23 in 2 o 4 si ( m + ) 498 . 0472 , found 498 . 0480 ; lrms ( ei ) m / z 498 ( m + ), 483 , 470 , 445 , 430 , 416 , 402 , 392 , 371 , 348 , 335 , 306 , 290 , 266 , 223 , 202 , 185 , 163 , 136 , 126 , 109 , 98 , 81 , 69 , 57 . following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 25 . 0 mg , 0 . 05 mmol ) yielded 9 . 8 mg ( 41 %) of a light yellow solid : [ α ] 20 d + 34 . 3 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3025 , 3016 , 1741 , 1659 , 1600 , 1264 , 1222 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 71 ( s , 6 h ), 1 . 05 ( t , j = 7 hz , 3 h ), 1 . 26 ( m , 2 h ), 1 . 66 ( m , 2 h ), 1 . 90 ( m , 2 h ), 2 . 35 ( t , j = 7 hz , 2 h ), 3 . 76 ( s , 1 h ), 5 . 31 ( d , j = 16 hz , 1 h ), 5 . 31 ( s , 2 h ), 5 . 75 ( d , j = 16 hz , 1 h ), 7 . 67 ( m , 2 h ), 7 . 82 ( t , j = 8 hz , 1 h ), 8 . 17 ( d , j = 8 hz 1 h ), 8 . 24 ( d , j = 8 hz , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 0 . 2 , 7 . 9 , 16 . 8 , 20 . 7 , 20 . 73 , 31 . 7 , 50 . 9 , 66 . 5 , 72 . 8 , 97 . 9 , 118 . 5 , 119 . 2 , 127 . 7 , 127 . 8 , 130 . 0 , 131 . 4 , 131 . 9 , 135 . 2 , 141 . 9 , 146 . 3 , 148 . 1 , 150 . 3 , 151 . 1 , 157 . 5 , 174 . 0 ; hrms ( ei ) m / z calcd for c 26 h 27 n 3 o 4 si ( m + ) 473 . 1771 , found 473 . 1755 ; lrms ( ei ) m / z 473 ( m + ), 444 , 429 , 414 , 400 , 389 , 373 362 , 344 , 331 , 303 , 289 , 2 . 75 , 245 , 219 , 166 , 152 , 130 , 98 , 71 . following the procedure outlined in example 1 -( 1 ), [ iodopyridone 2 ( 150 mg , 0 . 450 mmol ) was combined with 3 - chloropropyldimethylsilyl - 2 - propynyl bromide ( 228 mg , 0 . 90 mmol ). chromatography ( ch 2 cl 2 / acoet 9 : 1 ) gave 75 . 4 mg ( 33 %) of a clear oil . analysis of the nmr showed the presence of the alkyl bromide in addition to the desired chloro derivative in a 1 . 6 : 1 ratio in favor of the former : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 09 ( s , 6 h ), 0 . 60 - 0 . 70 ( m , 2 h ), 0 . 85 - 0 . 89 ( t , j = 7 hz , 3 h ), 1 . 60 - 1 . 95 ( m , 4 h ), 3 . 33 ( t , j = 7 hz , 2 h , assigned to iodo ), 3 . 44 ( t , j = 7 hz , 2 h , assigned to bromo ), 3 . 75 ( s , 1 h ), 4 . 91 - 5 . 18 ( m , 3 h ), 5 . 42 ( d , j = 16 hz , 1 h ), 7 . 12 ( s , 1 h ). following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 51 mg , 0 . 1 mmol ) yielded 23 mg ( 49 %) of a light yellow solid . analysis of the spectral data identified this solid as a 3 component mixture corresponding to the chloro , bromo and the iodo derivatives in a 1 . 6 : 1 : 1 . 3 ratio : [ α ] 20 d + 30 . 8 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3029 , 3012 , 2980 , 2963 , 2933 , 1742 , 1658 , 1600 , 1556 , 1258 , 1233 , 1218 , 1200 , 1158 , 1045 , 843 , 822 , 794 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 69 ( s , 6 h ), 1 . 04 ( t , j = 7 hz , 3 h ), 1 . 18 - 1 . 30 ( m , 2 h ), 1 . 60 - 2 . 0 ( m , 4 h ), 3 . 15 ( t , j = 7 hz , 2 h , assigned to iodo ), 3 . 36 ( t , j = 7 hz , 2 h , assigned to bromo ), 3 . 48 ( t , j = 7 hz , 2 h , assigned to chloro ), 3 . 88 ( s , 1 h ), 5 . 30 ( d , j = 16 hz , 1 h ), 5 . 31 ( s , 2 h ), 5 . 74 ( d , j = 16 hz , 1 h ), 7 . 62 - 7 . 66 ( m , 2 h ), 7 . 87 ( t , j = 8 hz , 1 h ), 8 . 18 ( d , j = 8 hz , 1 h ), 8 . 22 ( d , j = 8 hz , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 0 . 2 , 7 . 9 , 14 . 7 , 27 . 5 , 31 . 7 , 47 . 4 , 51 . 9 , 66 . 4 , 72 . 8 , 98 . 2 , 118 . 6 , 127 . 7 , 127 . 9 , 130 . 0 , 131 . 0 , 132 . 0 , 135 . 2 , 146 . 1 , 147 . 6 , 150 . 2 , 157 . 5 , 174 . 0 ; hrms ( ei ) m / z calcd for c 25 h 27 cln 2 o 4 si ( m + ) 482 . 1429 , found 482 . 1413 ; lrms ( ei ) m / z 482 ( m + ), 453 , 438 , 361 , 305 , 275 . following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 34 . 5 mg , 0 . 071 mmol ) and p - acetoxyisonitrile yielded 21 . 3 mg ( 58 %) of a light yellow solid : [ α ] 20 d + 36 . 2 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3029 , 3000 , 2958 , 2931 , 2902 , 2885 , 2859 , 1742 , 1659 , 1600 , 1557 , 1504 , 1464 , 1371 , 1256 , 1232 , 1195 , 1166 , 1045 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 69 ( s , 6 h ), 0 . 90 ( s , 9 h ), 1 . 04 ( t , j = 7 hz , 3 h ), 1 . 80 - 2 . 00 ( m , j = 7 hz , 2 h ), 2 . 40 ( s , 3 h ), 3 . 81 ( s , 1 h ), 5 . 30 ( d , j = 16 hz 1 h ), 5 . 31 . ( s , 2 h ), 5 . 75 ( d , j = 16 hz , 1 h ), 7 . 53 ( dd , j 1 = 9 hz , j 2 = 2 hz , 1 h ), 7 . 65 ( s , 1 h ), 8 . 08 ( d , j = 2 hz , 1 h ), 8 . 21 ( d , j = 9 hz , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 0 . 6 , 7 . 9 , 19 . 3 , 21 . 5 , 27 . 2 , 31 . 7 , 52 . 5 , 66 . 5 , 72 . 9 , 97 . 7 , 118 . 4 , 120 . 4 , 124 . 8 , 132 . 1 , 133 . 2 , 136 . 7 , 142 . 8 , 146 . 2 , 146 . 4 , 149 . 0 , 150 . 2 , 150 . 8 , 157 . 5 , 169 . 1 , 174 . 1 ; lrms ( ei ) m / z 520 ( m + ), 478 , 463 , 421 , 377 , 347 , 320 , 291 , 57 . following the procedure outlined in example 2 -( 2 ), the pyridone described above ( 34 . 5 mg , 0 . 071 mmol ) yielded , using the same chromatographic conditions , 21 . 3 mg ( 58 %) of a light yellow solid : [ α ] 20 d + 36 . 2 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3029 , 3000 , 2958 , 2931 , 2902 , 2885 , 2859 , 1742 , 1659 , 1600 , 1557 , 1504 , 1464 , 1371 , 1256 , 1232 , 1195 , 1166 , 1045 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 69 ( s , 6 h ), 0 . 90 ( s , 9 h ), 1 . 04 ( t , j = 7 hz , 3 h ), 1 . 80 - 2 . 00 ( m , j = 7 hz , 2 h ), 2 . 40 ( s , 3 h ), 3 . 81 ( s , 1 h ), 5 . 30 ( d , j = 16 hz 1h ), 5 . 31 . ( s , 2h ), 5 . 75 ( d , j = 16 hz , 1 h ), 7 . 53 ( dd , j 1 = 9 hz , j 2 = 2 hz , 1 h ), 7 . 65 ( s , 1 h ), 8 . 08 ( d , j = 2 hz , 1h ), 8 . 21 ( d , j = 9 hz , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 0 . 6 , 7 . 9 , 19 . 3 , 21 . 5 , 27 . 2 , 31 . 7 , 52 . 5 , 66 . 5 , 72 . 9 , 97 . 7 , 118 . 4 , 120 . 4 , 124 . 8 , 132 . 1 , 133 . 2 , 136 . 7 , 142 . 8 , 146 . 2 , 146 . 4 , 149 . 0 , 150 . 2 , 150 . 8 , 157 . 5 , 169 . 1 , 174 . 1 ; hrms ( ei ) m / z calcd for c 28 h 32 n 2 o 6 si ( m + ) 520 . 2030 , found 520 . 2014 lrms ( ei ) m / z 520 ( m + ), 478 , 463 , 421 , 377 , 347 , 320 , 291 , 57 . following the procedure outlined in example 5 , ( 13 . 4 mg , 0 . 026 mmol ) of the compound described in example 18 was converted to the hydroxy derivative . purification ( 2 : 1 ch 2 cl 2 : acetone ) on a preparative tlc plate gave 10 . 6 mg ( 85 %) of a yellow solid : [ α ] 20 d + 17 . 4 ( c 0 . 2 , 3 : 1 ch 2 cl 2 / meoh ); 1 h nmr ( 300 mhz , 3 : 1 cdcl 3 / cd 3 od ) δ 0 . 66 ( s , 6h ), 0 . 88 - 1 . 05 ( m , 12h ), 1 . 80 - 2 . 00 ( m , 2h ), 5 . 25 - 5 . 30 ( m , 3 h ), 5 . 70 ( d , j = 16 hz , 1 h ), 7 . 37 ( dd , j 1 = 9 hz , j 2 = 2 hz , 1 h ), 7 . 54 ( d , j = 2 hz , 1 h ), 7 . 60 ( s , 1 h ), 8 . 05 ( d , j = 9 hz , 1 h ); 13 c nmr ( 125 mhz , ( 3 : 1 ) cdcl 3 : cd 3 od ) δ 8 . 1 , 20 . 6 , 27 . 6 , 30 . 4 , 31 . 9 , 53 . 6 , 66 . 5 , 73 . 9 , 98 . 6 , 112 . 1 , 118 . 8 , 123 . 3 , 132 . 1 , 135 . 6 , 137 . 4 , 141 . 6 , 143 . 8 , 147 . 3 , 148 . 4 , 152 . 6 , 157 . 5 , 158 . 7 , 174 . 7 ; hrms ( ei ) m / z calcd for c 26 h 30 n 2 o 5 si ( m + ) 478 . 1924 , found 478 . 1947 lrms ( ei ) m / z 478 ( m + ), 434 , 421 , 377 , 304 , 284 , 227 , 178 , 149 , 137 , 109 , 97 , 83 , 69 , 57 . although the present invention has been described in detail in connection with the above examples , it is to be understood that such detail is solely for that purpose and that variations can be made by those skilled in the art without departing from the spirit of the invention except as it may be limited by the following claims .	2

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.