text stringlengths 1.55k 332k | label int64 0 8 |
|---|---|
several component parts of the trigger sprayer of the invention are found in the typical construction of a trigger sprayer , and therefore these component parts are described only generally herein . it should be understood that although the component parts are shown in the drawing figures and are described as having a certain construction , other equivalent constructions of the component parts are known . these other equivalent constructions of trigger sprayer component parts are equally well suited for use with the novel features of the invention to be described herein . the trigger sprayer includes a sprayer housing 12 that is formed integrally with a connector cap 14 . the connector cap 14 removably attaches the trigger sprayer to the neck of a bottle containing the liquid to be dispensed by the trigger sprayer . the connector cap 14 shown in the drawing figures has a bayonet - type connector on its interior . other types of equivalent connectors may be employed in attaching the trigger sprayer to a bottle . a liquid inlet opening 16 is provided on the sprayer housing 12 in the interior of the connector cap 14 . the inlet opening 16 provides access to a liquid supply passage 18 that extends upwardly through a cylindrical liquid column 22 formed in the sprayer housing 12 . the column 22 has a center axis 24 that is also the center axis of the liquid supply passage 18 . an air vent opening 26 is also provided on the sprayer housing 12 in the interior of the connector cap 14 . a cylindrical sealing rim 28 projects outwardly from the connector cap interior and extends around the liquid inlet opening 16 and the vent opening 26 . the rim 28 engages inside the neck of a bottle connected to the trigger sprayer to seal the connection . the sprayer housing includes a pump chamber 32 contained inside a cylindrical pump chamber wall 34 on the sprayer housing 12 . the pump chamber cylindrical wall 34 has a center axis 36 that is perpendicular to the liquid supply passage center axis 24 . the interior surface of the pump chamber wall 34 has a smaller interior diameter section adjacent a rear wall 38 of the pump chamber , and a larger interior diameter section adjacent an end opening 42 of the pump chamber . the smaller interior diameter portion of the pump chamber 32 functions as the liquid pump chamber , and the larger interior diameter portion of the pump chamber 32 functions as a portion of a venting air flow path through the sprayer housing 12 . the vent opening 26 in the sprayer housing connector cap 14 communicates the interior of the larger interior diameter portion of the pump chamber 32 with a bottle connected to the trigger sprayer . a pair of openings 46 , 48 pass through the pump chamber rear wall 38 and communicate the interior of the pump chamber with the liquid supply passage 18 . the first of the openings 46 is the liquid input opening to the pump chamber 32 , and the second of the openings 48 is the liquid output opening from the pump chamber . a liquid discharge tube 52 is also formed on the sprayer housing 12 . the liquid discharge tube is cylindrical and has a center axis 54 that is parallel with the pump chamber center axis 36 . the liquid discharge tube 52 defines the liquid discharge passage 58 of the sprayer housing . one end of the liquid discharge passage 58 communicates with the liquid supply passage 18 in the liquid column 22 , and the opposite end of the liquid discharge passage 58 exits the sprayer housing 12 through a liquid outlet opening 62 on the sprayer housing . the sprayer housing 12 is also formed with a pair of exterior side walls or side panels 64 that extend over opposite sides of the pump chamber wall 34 and over opposite sides of the discharge tube 54 . the side walls 64 extend over the pump chamber wall 34 in the area of the pump chamber rear wall 38 , but do not extend in the forward direction the full extent of the pump chamber wall 34 to the end opening 42 . the side walls 64 are spaced outwardly from the pump chamber wall 34 and the discharge tube 54 forming voids 66 between the side wall 64 and the pump chamber wall 34 and the discharge tube 54 . the side walls 64 have lengths on the opposite sides of the liquid discharge tube 54 that extend substantially the entire length of the discharge tube . a pair of pivot surfaces 70 are provided on the forward ends of the side walls 64 . as seen in fig2 , the pair of pivot surfaces 70 are positioned on opposite sides of the liquid discharge tube 54 . rear walls 68 of the sprayer housing 12 extend outwardly from opposite sides of the liquid column 22 and connect to the rearward edges of the side walls 64 . a valve assembly comprising an intermediate plug 72 , a resilient sleeve valve 74 and a resilient disk valve 76 is assembled into the liquid supply passage 18 . the valve assembly is inserted through the liquid inlet opening 16 and the valve assembly plug 72 seats tightly in the liquid supply passage 18 between the pump chamber input opening 46 and the pump chamber output opening 48 . thus , the plug 72 separates the liquid inlet opening 16 into the pump chamber 32 from the liquid outlet opening 62 from the pump chamber 32 . the disk valve 76 is positioned in the liquid supply passage 18 to control the flow of liquid from the liquid inlet opening 16 into the pump chamber 32 , and to prevent the reverse flow of liquid . the sleeve valve 74 is positioned to control the flow of liquid from the pump chamber 32 and through the liquid discharge passage 58 and the liquid outlet opening 62 , and to prevent the reverse flow of liquid . a valve plug assembly comprising a valve seat 78 , a dip tube connector 82 , and an air vent baffle 84 is assembled into the liquid inlet opening 16 inside the connector cap 14 . the valve seat 78 is cylindrical and seats against the outer perimeter of the valve assembly disk valve 76 . a hollow interior bore of the valve seat 78 allows liquid to flow through the bore and unseat the disk valve 76 from the seat 78 as the liquid flows from the inlet opening 16 to the pump chamber 32 . the periphery of the disk valve 76 seats against the valve seat 78 to prevent the reverse flow of liquid . the dip tube connector 82 is a cylindrical connector at the center of the plug assembly that connects to a separate dip tube ( not shown ). the valve plug assembly positions the dip tube connector 82 so that it is centered in the connector cap 14 of the sprayer housing . the air vent baffle 84 covers over but is spaced from the vent opening 26 in the connector cap 14 . the baffle 84 has a baffle opening 86 that is not aligned with the vent opening 26 , but communicates with the vent opening through the spacing between the air vent baffle 84 and the interior surface of the connector cap 14 . this allows air to pass through the vent opening 26 and through the baffle spacing and the baffle opening 86 to vent the interior of the bottle connected to the trigger sprayer to the exterior environment of the sprayer . because the vent opening 26 and baffle opening 86 are not directly aligned , the air vent baffle 84 prevents liquid in the bottle from inadvertently passing through the baffle opening 86 , the baffle spacing and the vent opening 26 to the exterior of the trigger sprayer should the trigger sprayer and bottle be inverted or positioned on their sides . a nozzle assembly 92 is assembled to the sprayer housing 12 at the liquid outlet opening 62 . the nozzle assembly 92 can have the construction of any conventional known nozzle assembly that produces the desired discharge pattern of liquid from the trigger sprayer . in the preferred embodiment of the invention , the nozzle assembly 92 has a rotatable nozzle cap 94 that selectively changes the discharge from a “ off ” condition where the discharge is prevented , to a “ spray ” condition , a “ stream ” condition and / or a foaming discharge . the nozzle assembly also has a tube 96 that attaches over the end of the liquid discharge tube 54 . this enables the liquid discharge tube 54 to have a smaller cross - sectional diameter dimension that increases the rate of liquid flow through the liquid discharge tube 54 and exiting the tube . a piston assembly comprising a liquid pump piston 102 and a vent piston 104 is mounted in the pump chamber 32 for reciprocating movement along the pump chamber axis 36 . the pump piston 102 reciprocates between a charge position and a discharge position in the pump chamber 32 . in the charge position , the pump piston 102 moves in a forward direction away from the pump chamber rear wall 38 . this expands the interior of the pump chamber creating a vacuum in the chamber that draws liquid into the pump chamber , as is conventional . in the discharge position , the pump piston 102 moves in an opposite rearward direction into the pump chamber toward the pump chamber rear wall 38 . this compresses the liquid drawn into the pump chamber 32 and forces the liquid through the output opening 48 , past the sleeve valve 74 and through the liquid discharge passage 58 and the liquid outlet opening 62 . as the pump piston 102 reciprocates in the pump chamber 32 between the charge and discharge positions , the vent piston 104 reciprocates between a vent closed position where the vent piston 102 engages against the interior surface of the pump chamber wall 34 , and a vent open position where the vent piston 104 is spaced inwardly from the interior of the pump chamber wall 34 . in the vent open position of the vent piston 104 , air from the exterior environment of the sprayer can pass through the pump chamber opening 42 , past the vent piston 104 to the vent opening 26 , and then through the spacing between the baffle 84 and the connector cap 14 , through the vent baffle opening 86 and to the interior of the bottle connected to the trigger sprayer . a manually operated trigger 112 is mounted on the sprayer housing 12 for movement of the trigger relative to the sprayer housing . the trigger 112 has a pair of pivot posts 114 that project from opposite sides of the trigger . the posts 114 engage in a sliding contact with the pivot surfaces 70 on the sprayer housing and thereby mount the trigger to the sprayer housing 12 for pivoting movement . a pair of tab abutments 116 project outwardly from the pivot posts 114 limit the pivoting movement of the trigger 112 toward the sprayer housing 12 . the tab abutments 116 are positioned to engage against the sprayer housing pivot surfaces 70 in the forwardmost position of the trigger 112 relative to the sprayer housing . in this way the pivot surfaces 70 function as stop surfaces that prevent any further forward pivoting movement of the trigger 112 . the construction of the trigger includes a finger engagement surface that is engaged by the fingers of a user &# 39 ; s hand . squeezing the trigger causes the trigger to pivot rearwardly toward the pump chamber 32 , and releasing the squeezing force on the trigger allows the trigger to pivot forwardly away from the pump chamber . the novel construction of the trigger sprayer of the invention includes a piston rod 122 that is operatively connected between the trigger 112 and the pump piston 102 and vent piston 104 . the piston rod 122 has a length with a annular collar or ring 124 at one end of the rod length . the ring 124 is assembled to the pump chamber 32 around the chamber end opening 42 . the opposite end 126 of the piston rod 122 engages with and is operatively connected to the trigger 112 . the novel construction of the trigger sprayer also includes a pair of springs 132 that are formed integrally with the piston rod 122 and the ring 124 . together the springs 132 , the piston rod 122 , and the ring 124 are one , monolithic piece of plastic material , thereby reducing the number of separate component parts that go into the construction of the trigger sprayer . the pair of springs 132 each have a narrow , elongate length that extends between opposite proximal 134 and distal 136 ends of the springs . the intermediate portions 138 of the springs between the proximal ends 134 and distal ends 136 have the same bent or inverted u - shaped configurations . the spring proximal ends 134 are connected to the piston rod 122 at the first end or forward end 126 of the piston rod . from the proximal ends 134 , the lengths of the springs angle upwardly away from the piston rod 22 and the pump chamber center axis 36 and then extend through the intermediate portions 138 of the springs . as the lengths of the springs extend through their u - shaped intermediate portions 138 , the springs extend along opposite sides of the liquid discharge tube 154 and over the pump chamber wall 34 . the springs then extend downwardly toward the pump chamber center axis 36 as the springs extend to their distal ends 136 connected to the ring 124 . the ring is attached around the pump chamber 32 at the end opening 42 and thereby connects the spring distal ends 136 to the sprayer housing 12 . the inverted , u - shaped configurations of the springs 132 bias the piston rod 122 and the connected pump piston 102 and vent piston 104 outwardly away from the pump chamber rear wall 38 . this biases the pump piston 102 toward its charge position relative to the pump chamber 32 and the sprayer housing 12 . by manually squeezing the trigger 112 , the spring proximal ends 134 move toward the spring distal ends 136 , narrowing the u - shaped bend in the intermediate portions 138 of the springs . when the squeezing force on the trigger 112 is removed , the resiliency of the springs pushes the trigger 112 away from the pump chamber rear wall 38 and moves the pump piston 102 back to its charge position relative to the pump chamber 32 . a shroud 142 is attached over the sprayer housing 12 to provide an aesthetically pleasing appearance to the trigger sprayer . the shroud 142 has a lower edge 144 that is positioned below the u - shaped bends in the pair of springs 132 . thus , the shroud 142 protects the springs 132 from contact with portions of the hand or other objects exterior to the trigger sprayer when the trigger sprayer is being operated . fig5 - 16 show a further embodiment of the trigger sprayer apparatus of the invention . many of the component parts of the trigger sprayer embodiment shown in fig5 - 16 are substantially the same as those of the embodiment shown in fig1 - 4 and described above . therefore , these same component parts will not be further described . the embodiment of the trigger sprayer shown in fig5 - 16 differs from the earlier described embodiment in the construction of the pivoting connection between the trigger 152 and the sprayer housing 154 . referring to fig5 and 11 - 16 , the sprayer housing 154 comprises a pump chamber 156 , a liquid inlet opening 158 , a liquid supply passage 162 that communicates the liquid inlet opening 158 with the pump chamber 156 , a liquid outlet opening 164 and a liquid discharge passage 166 that communicates the liquid outlet opening with the pump chamber 156 . except for the liquid discharge passage 166 , these are all basically the same as those of the embodiment of fig1 . the liquid discharge passage 166 extends through a liquid discharge tube 167 of the sprayer housing 154 . the discharge tube has a reduced cross - sectional area which reduces the cross sectional area of the liquid discharge passage 166 . the reduced cross - sectional area of the liquid discharge passage 166 increases the velocity of liquid flow and the force of liquid ejected from the liquid outlet opening 164 over that of prior art trigger sprayers . the liquid outlet opening 164 has a center axis 168 that defines an axial direction relative to the sprayer housing 154 . the axial direction extends forwardly to the left in fig5 and rearwardly to the right in fig5 . the sprayer housing 154 also has a pair of side walls 169 that are similar to those of the previously described embodiment . however , each of the sprayer housing side walls 169 has a socket hole 172 . the socket holes 172 are each partially defined by pivot surfaces 174 that are similar to the pivot surfaces 70 of the earlier described sprayer housing . the sprayer housing 154 is also formed with a pair of stop surfaces 176 on the sprayer housing side walls 169 . the stop surfaces 176 are positioned on the side walls 169 outside of the pivot surfaces 174 that define the socket holes 172 . both the stop surfaces 176 extend in the axial direction rearwardly from the pivot surfaces 174 of the socket holes 172 on opposite sides of the liquid outlet opening center axis 168 . the sprayer housing 154 is also formed with a pair of exterior flanges 178 . the pair of exterior flanges 178 are positioned on the sprayer housing 154 outside of the pair of stop surfaces 176 and outside the pair of pivot surfaces 174 . thus , there is a spacing between the sprayer housing side walls 169 that contain the socket holes 172 and the exterior flanges 178 . this spacing is occupied by the stop surfaces 176 . the trigger 152 of the embodiment shown in fig5 - 16 has a forwardly directed finger engagement surface 184 . a pair of spaced arms 186 project upwardly from the trigger finger engagement surface 184 . the arms 136 extend across opposite sides of the sprayer housing liquid discharge tube 167 . the arms 186 project from the trigger finger engagement surface 184 to distal ends 188 of the arms that are positioned above the liquid discharge tube 167 . the arm distal ends 188 are also positioned between the sprayer housing side walls 169 and the sprayer housing exterior flanges 178 . pivot posts 192 are provided on the arm distal ends 188 . the pivot posts 192 project from the arm distal ends 188 toward each other and into the spacing between the pair of arms 186 . the pivot posts 192 engage in a sliding contact with the pivot surfaces 174 of the sprayer housing 154 and thereby mount the trigger 152 to the sprayer housing 154 for pivoting movement of the trigger between a forward , charge position of the trigger relative to the sprayer housing and a rearward , discharge position of the trigger relative to the sprayer housing . the trigger 152 is also formed with a pair of abutments or tabs 194 that project from the pivot posts in the axial direction rearwardly from the trigger 152 . the pair of tabs 194 disengage from the stop surfaces 176 and move through an arc movement away from the stop surfaces 176 when the trigger 152 is moved from the charge position relative to the sprayer housing 154 toward the discharge position of the trigger relative to the sprayer housing . the tabs 194 are positioned to engage against the stop surfaces 176 as the trigger 154 is pivoted to its forward , charge position . the engagement of the tabs with the stop surfaces 176 prevents further forward movement of the trigger toward the nozzle assembly 196 . this prevents the trigger 152 from pushing against the nozzle assembly 196 and potentially pushing the nozzle assembly 196 off the sprayer housing 154 . although the trigger sprayer of the invention has been described above by reference to a specific embodiment , it should be understood that modifications and variations could be made to the trigger sprayer without departing from the intended scope of the following claims . | 1 |
a telephone circuit in accordance with the present invention , whose block diagram is shown in fig1 comprises a signal amplifier circuit sa , having at least one input terminal rt for connection to exchange components designed to generate a sinusoidal ac signal with a frequency identical to that of the ringing signals to be sent to the line , but having a smaller amplitude . the amplifer sa also has an enabling terminal e and first and second output terminals for connection to a two - wire telephone line ( not shown ). sgs microelettronica s . p . a . part no . l 3000 may be used for the amplifier circuit sa . the exchange components referred to in the description are not shown in fig1 . the telephone circuit of fig1 further comprises a timing signal generator circuit fc , having at least one input terminal connected to the input terminal rt and having at least one output terminal . the timing signal generator circuit fc generates a timing signal at each instant of time in which the amplitude of the sinusoidal signal supplied to the terminal rt passes through zero during signal variations of the same type , i . e . either only when the amplitude of the sinusoidal signal is monotonally increasing or only when the amplitude of the sinusoidal signal is monotonally decreasing . sgs microelettronica s . p . a . part no . lm 399 may be used for the generator circuit fc . in fig1 a logic control circuit c has a first terminal cs for connection to exchange components and generates control signals for supplying ringing signals to the line . these signals determine the beginning and end of the subscriber call signal and the ringing rhythm . a dc current detector circuit rs detects a dc current on the line , even when an ac current is simultaneously present on the line , and generates a signal when it detects a dc current on the line . a current comparator comp generates a signal when the value of the line current exceeds a predetermined value ( i ref ). fig1 a illustrates such a comparator circuit comp . the comparator i . c . may be formed of sgs microelettronica s . p . a . part no . l 339 . both the detector circuit rs and the current comparator comp have at least one input terminal il for connection to the line . the detector circuit rs has an output terminal connected to a second terminal ps of the logic circuit c , while the comparator comp has an output circuit connected to both a third terminal sc of the logic circuit c and to an input terminal of a transfer circuit hs also incorporated in the circuit . the logic control circuit c has a fourth input terminal ck connected to the timing generator circuit fc and may change its logic state only at the time of these signals . the logic circuit c has a first output terminal is connected to the enabling terminal e of the signal amplifier circuit sa and a second output terminal inh connected to an inhibiting terminal of the transfer circuit hs . the transfer circuit hs has at least one output terminal for connection to exchange control components ( not shown ) designed to recieve and process signals generated by the transfer circuit with a memory as signals advising that an off the hook condition has actually taken place . the following is an examination of the operation of a telephone circuit in accordance with the present invention describing possible practical embodiments on the various circuit blocks included in the diagram of fig1 . the signal amplifier circuit sa may be a normal amplifier of a type known to persons skilled in the art which is switched on and off by a control or &# 34 ; enabling &# 34 ; terminal e . the switching on and off of the amplifier gives rise , from the sinusoidal signal coming from the exchange components , to the ringing signals which are spaced in time and also have a sinusoidal wave shape . the amplifier circuit sa is in general not directly coupled to the telephone line , but rather via further circuit amplification and supply means of the line . the timing signal generator circuit fc may be constructed as a circuit known in the technical literature as a &# 34 ; zero crossing detector &# 34 ;. when an ac signal is supplied to the input of this known circuiit , it is possible to obtain a pulse signal output each time that the amplitude of the input signals passes through zero or reaches a predetermined threshold , or each time that it passes through zero in a predetermined manner . in the latter case , if a sinusoidal signal is supplied to the input terminal , the circuit generates pulse output signals with a frequency equal to the frequency of the sinusoidal input signal . in a telephone circuit in accordance with the present invention , these pulse signals act a timing signals to synchronize all of the functions of the circuit exactly with points in time in which the amplitude of the ringing signals to be supplied to the line pass through zero . the detector circuit rs may take the form , using known solutions , of a line current transducer and integrator circuit which integrates the current supplied by the transducer over one or more whole periods of the line voltage . a solution of this type is disclosed , for example , in italian patent application 23832 a / 83 , and the corresponding english language european cognate patent application no . 0143435 a 2 . when the integrator detects the presence on the line of a dc current having a value greater than a predetermined value , an information signal , showing that there is a dc current on the line and therefore that an off the hook condition may have taken place , is generated . this information signal supplied by the detector circuit rs is processed , however , by the logic control circuit c in such a way that the exchange components cannot be erroneously advised of an off the hook condition which has not , in fact , taken place . the logic circuit c is connected for this purpose to the current comparator comp , of a type known to those skilled in the art , which generates an information signal when the instantaneous value of the line current exceeds a predetermined value . this signal , which is taken by the logic circuit c as advice that an off the hook condition has taken place , is also transmitted to the exchange components via the transfer circuit hs which is driven , via its inhibiting terminal , by the logic circuit c such that the signal generated by the current comparator comp is transmitted only when the information that an off the hook condition has taken place is certain . the transfer circuit hs may simply be an electronic switch which prevents the transfer of the signal generated by the comparator when a signal generated by the logic circuit c is supplied to the inhibiting terminal . for particular design reasons , it may , however , take the form of the more complex circuit comprising a memory component shown in fig2 . in this case , the transfer circuit hs is designed , when no signal is being supplied to the inhibiting terminal , to transfer as output the signals supplied to the input terminal and is , in contrast , designed to store , at the instant in which a signal is supplied to the inhibiting terminal , the presence or absence of an input signal , generating , when a signal is supplied in this instant to the input terminal , an output signal until the signal supplied to the inhibiting terminal is discontinued . the main component of a telephone circuit of the invention is the logic control circuit c , whose operating stages are fully synchronized with the instants of time in which the ringing signal has a zero amplitude by the timing signals supplied to the input terminal ck . the logic control circuit c comprises circuit means designed to generate , via the output terminal is , a signal enabling the signal amplifier circuit sa to supply ringing signals to the line when a control signal from the exchange is supplied to the control terminal cs , starting to generate this signal , however , only after a predetermined number of timing signals from the instant of time in which the control signal is supplied and continuing to generate the signal , if no off the hook condition ( whether actual or assumed ) is detected , up to the instant of time in which the first timing signal following the cessation of the control signal is supplied to the terminal ck . this avoids uncertainties as regards the control signal from the exchange and avoids , as mentioned above , the generation of interference on the line . these circuit means included in the logic control circuit c are also designed to generate , via the output terminal inh , from the same instant of time as that in which the enabling signal begins to be generated via the output terminal is , a signal inhibiting the transfer circuit hs from transmitting any signals to the exchange control components . this inhibiting signal continues to be generated , when an off the hook condition has not been confirmed , up to the instant of time in which a predetermined timing signal , following the cessation of the control signal supplied to the terminal cs , is supplied to the terminal ck . this predetermined timing signal in not in general the first timing signal after the cessation of the control signal , but a subsequent signal , selected such that before transmission of an information signal advising that an off the hook condition has taken place to the exchange components , there is time for the confirmation of an off the hook condition by the logic control circuit c and such that this transmission takes place when the telephone network is stabilized after the supply of ringing signals to the line has been discontinued . the logic control circuit c also comprises a first and a second timed control circuit which make it possible to interrupt or prevent the generation of signals via the output terminals is and inh . the first timed control circuit is designed to detect any signal of an assumed off the hook condition supplied to the input terminal ps only in those instants in time in which a control signal is being supplied to the input terminal cs and a timing signal is simultaneously being supplied to the input terminal ck , with the exception of a predetermined number of such instants of time after each occasion in which the first timed control circuit detects the supply of a signal to the input terminal ps . when it detects the supply of a signal to the terminal ps , the first timed control circuit inhibits the generation , via the output terminal is , of the enabling signal until a predetermined timing signal is subsequently supplied to the input terminal ck . in this way the logic control circuit c , during the calls stage , as soon as it receives advice from the circuit means rs of a possible off the hook condition , discontinues for a predetermined period , needed for the subsequent confirmation of an actual off the hook condition , the supply of ringing signals to the line . if an off the hook condition has not in fact taken place , the supply of ringing signals may be restarted if , obviously , a control signal is still being supplied to the input terminal cs . the operation to check whether an off the hook condition has actually taken place is essentially carried out by the second timed control circuit , which detects , via the terminal sg , a possible signal generated by the current comparator comp only when the input terminal ck is being supplied with that predetermined timing signal which also enables the generation of the enabling signal to be continued via the output terminal is , after every interruption thereof , and when , at the same time , a control signal is being supplied to the input terminal cs . in this way the possible signal from the comparator comp may be detected in an instant of time in which the network is stabilized and there is still not ac current on the line , starting to supply ringing signals to the line only at that instant of time , since this possible signal is undoubtedly a confirmation of a dc current on the line due to an actual off the hook condition . when the second timed control circuit detects the supply of a confirmation signal to the terminal sg , it disables the first timed control circuit from detecting the supplying of signals to the input terminal ps and inhibits the generation of signals via the two output terminals is and inh until the first timing signal following the cessation of the supply of the control signal from the exchange components to the input terminal cs is supplied to the input terminal ck . as soon as the generation of the inhibiting signal via the terminal inh is discontinued , the transfer circuit hs enables the transmission of the signal generated by the current comparator comp to the exchange components as advice that an off the hook condition has taken place and this interrupts the control signal being supplied to the first input terminal cs of the logic control circuit c which , as is clearly shown form the mode of operation described below , returns to an initial state in which it waits for further control signals from the exchange . it should be noted that there is no difference between a discontinuation of the control signal designed to determine the ringing rhythm and a discontinuation due to the cessation of the call phase . a relatively simple circuit embodiment of the logic control circuit c is immediately suggested to persons skilled in the art on the basis of the characteristics described above with respect to the circuit means which generates the output signals and the first and the second timed control circuits . these may be constructed directly in a known manner , or , obviously to the person skilled in the art , using and gates , d type flip - flops and timing pulse signal counters . it is important to note , however , that the logic control circuit c may be constructed as a logic state machine designed to carry out a number of functions , not just those listed , comprising an assembly of constituent logic components from which is would not be possible to pick out , unequivocally in time , circuit means for generating signals and timed control circuits , even though it would be possible to pick out , at each instant of time , the various logic components designed to form them in practice . only the fact that the logic circuit always comprises these circuit means and timed control circuits is a feature of the present invention . fig3 thus shows a flow chart illustrating the evolution over time of the logic states of a logic state machine designed to form the logic control circuit c . a person skilled in the art could construct the circuit of the logic state machine directly from this flow chart using the circuit components which he has available . the form of the illustration of fig3 is of a conventionally known type . each rectangle , which represents a logic state , shows the state of the outputs of the logic control circuit c , indicating the symbol of the output terminal ( s ) via which a signal is being generated . each diamond , which represents a decision function of the logic circuit , shows the symbol of the input terminal to which a signal is being supplied causing the subsequent passage , shown by an arrow , to another logic state . the letter y indicates the passage caused by the supply of a signal to this terminal , while the letter n indicates the passage which takes place if no signal is being supplied . passage from one logic state to the next takes place at each timing signal supplied to the input terminal ck . the rectangles is dashed lines represent the possibility of one or more repetitions of the prior state shown by a rectangle in continuous lines . it is evident that telephone circuit in accordance with the present invention not only makes it possible to prevent interference on the line and to obtain at the same time reliable detection of an off the hook condition actually taking place , but also allows its integration in more complex interface circuits whose completely separate functions may be carried out by the same logic circuit . although a single embodiment of the invention has been described and illustrated it is evident that many variants are possible without departing from the scope of the invention . | 7 |
in the following detailed description , reference is made to the accompanying drawings which form a part hereof , and in which is shown by way of illustration specific embodiments by which the invention may be practiced . it should be understood that like reference numerals represent like elements throughout the drawings . these exemplary embodiments are described in sufficient detail to enable those skilled in the art to practice the invention . it is to be understood that other embodiments may be utilized , and that structural , logical and electrical changes may be made without departing from the spirit and scope of the present invention . the terms “ wafer ” and “ substrate ” are to be understood as including all forms of semiconductor wafers and substrates including , silicon , silicon - on - insulator ( soi ), silicon - on - sapphire ( sos ), doped and undoped semiconductors , epitaxial layers of silicon supported by a base semiconductor foundation , and other semiconductor structures . furthermore , when reference is made to a “ wafer ” or “ substrate ” in the following description , previous process steps may have been utilized to form regions or junctions in or above the base semiconductor structure or foundation . in addition , the semiconductor need not be silicon - based , but could be based on other semiconductors , for example , silicon - germanium , germanium , or gallium arsenide . the term “ pixel ” refers to a picture element unit cell containing circuitry including a photosensor and semiconductors for converting electromagnetic radiation to an electrical signal . for purposes of illustration , fabrication of a representative pixel is shown and described . typically , fabrication of all pixels in an imager will proceed simultaneously in a similar fashion . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined by the appended claims . although the invention is described herein with reference to the architecture and fabrication of one or a limited number of pixels , it should be understood that this is representative of a plurality of pixels as typically would be arranged in an imager array having pixel cells arranged in an array , for example , an array of pixel rows and columns . in addition , although the invention is described below with reference to a pixel array for a cmos imager , the invention has applicability to all solid - state imaging devices using pixels ( e . g ., a ccd imager ). the invention may also be employed in display devices where a pixel has a light emitter for emitting light . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined only by the appended claims . color filters in a trench recess are beneficial for reduced stack height and improved pixel optics . the recessed color filter array provides an improved acceptance angle range for incoming light , reducing optical crosstalk . the recessed color filter array essentially places the micro - lens and color filter substantially closer to the photosensor , thus reducing the amount of diffracted or misdirected light reaching - neighboring pixels . however , if the color filter array thickness , while recessed , is less than the depth of the trench , effective planarization by cmp is not possible . fig1 shows a cross sectional view of an image sensor pixel array constructed in accordance with an exemplary embodiment of the invention . the image sensor 100 comprises a photo - conversion device 170 , a micro - lens 110 , and a plurality of fabricated layers between the photo - conversion device 170 and the micro - lens 110 . the photo - conversion device could include a photosensor , which receives light and generates an electrical signal or a photo emitter , which receives an electrical signal and generates light . the plurality of fabricated layers typically include a clear polymide planarization layer 120 , a color filter array layer 130 , a silicon nitride passivation layer 140 , a plurality of interlayer dielectric layers 150 and associated metallization layers , and a boron - phosphorous glass layer ( bpsg ) 160 . the color filter array 130 is recessed into a trench 190 in a passivation layer 140 . the color filter array 130 thickness is less than the depth of the trench 190 . fig2 is a flow chart of a method for forming a color filter array according to the invention . fig2 a - 2d illustrate the fig1 structure prior to formation of an upper planarization layer 120 and micro - lens layer 110 . fig2 a shows a photosensor 170 in a substrate 180 . over that is bpsg layer 160 , which is below one or more interlayer dielectric layers 150 and associated metallization layers . above the uppermost interlayer dielectric layer 150 can be a passivation layer 140 , e . g ., a silicon nitride layer . according to an exemplary embodiment of the invention , in step 201 , and referring to fig2 and 2 a , a trench 190 is created in the passivation layer 140 above the photosensor 170 , which is filled partially with a color filter material 130 . the trench 190 may also be etched through passivation layer 140 , ild and associated metallization layers 150 and partially into the bpsg layer 160 . the color filter array 130 thickness is less than the depth of the trench 190 . at this stage , the color filter array 130 will have imperfect planarity . the color filter array 130 can be any thickness between a thin layer above the surface of the bottom of the trench 190 and filling the depth of the trench 190 completely . next , referring also to fig2 b , in step 202 any remaining trench above the color filter array 130 is filled with a fill material 125 such as a photoresist material . the photoresist material 125 can be a spin coated material but can be deposited as well . the photoresist material 125 fills the trench 190 until the material 125 exceeds the depth of the trench 190 . then in step 203 , referring also to fig2 c , the resist material 125 surface is planarized to the top surface of the passivation layer 140 . the preferred method for planarizing the resist material 125 surface is cmp . however , any of a number of other methods for planarizing already known in the art can be used . finally , referring to fig2 d , in step 204 the resist material 125 and color filter array 130 are dry etched back to form a planarized cfa surface . after the etch process , the thickness of the color filter array 130 will be uniform and is less than the depth of the trench 190 . the resist material 125 and color filter array 130 can also be etched back by any method known in the art , e . g ., wet etch . the preferred method is an unselective dry etch . it should be appreciated that the etch can be masked , if needed , by a suitable resist mask . by masking the etch , the passivation layer around the recessed area can be protected . after the etch , the optional upper planarization layer 120 and the micro - lens layer 110 are added . by recessing the color filters in a trench , a reduced stack height can be obtained and the lens 110 can be located closer to the photo - conversion device 170 . the recessed color filter helps reduce optical crosstalk due to diffracted or misdirected light , effectively increasing the angular acceptance range for incoming light and reducing color artifacts . it should be appreciated that in the exemplary embodiment discussed above the trench 190 has been described as recessed into the passivation layer 140 , however the trench 190 may be recessed from or continue into additional layers , i . e ., a plurality of fabricated layers , e . g ., layers 150 , 160 . for example referring to fig3 , trench 190 may begin at the level of micro - lens layer 110 , or at the level of upper planarization layer 120 and continue downward through the passivation layer 140 into the interlayer dielectric layers 150 and associated metallization layers . in other words , the trench 190 may recess through any other layer included within the image sensor 100 between the photosensor layer 170 and the micro - lens layer 110 . the invention may be used in solid state imagers employing various kinds of photosensors formed on a substrate in photosensor layer , including but not limited to photodiodes , photo transistors , photoconductors , and photogates . fig4 illustrates an exemplary cmos imager 1100 that may utilize the invention . the cmos imager 1100 has a pixel array 1105 comprising pixels constructed to include the recessed color filter array in accordance with the invention . the cmos pixel array 1105 circuitry are conventional and are only briefly described herein . array row lines are selectively activated by a row driver 1110 in response to row address decoder 1120 . a column driver 1160 and column address decoder 1170 are also included in the imager 1100 . the imager 1100 is operated by the timing and control circuit 1150 , which controls the address decoders 1120 , 1170 . a sample and hold circuit 1161 associated with the column driver 1160 reads a pixel reset signal vrst and a pixel image signal vsig for selected pixels . a differential signal ( vrst - vsig ) is amplified by differential amplifier 1162 for each pixel and is digitized by analog - to - digital converter 1175 ( adc ). the analog - to - digital converter 1175 supplies the digitized pixel signals to an image processor 1180 which forms a digital image . fig5 shows a processor system 1200 which includes an imaging device 1210 ( such as the imaging device 1100 illustrated in fig3 ) of the invention . the processor system 1200 is exemplary of a system having digital circuits that could include image sensor devices . without being limiting , such a system could include a computer system , camera system , scanner , machine vision , vehicle navigation , video phone , surveillance system , auto focus system , star tracker system , motion detection system , image stabilization system , and other systems employing an image sensor . system 1200 , for example a camera system , generally comprises a central processing unit ( cpu ) 1220 , such as a microprocessor , that communicates with an input / output ( i / o ) device 1270 over a bus 1280 . imaging device 1210 also communicates with the cpu 1220 over the bus 1280 . the processor system 1200 also includes random access memory ( ram ) 1290 , and can include removable memory 1230 , such as flash memory , which also communicate with the cpu 1220 over the bus 1280 . the imaging device 1210 may be combined with a processor , such as a cpu , digital signal processor , or microprocessor , with or without memory storage on a single integrated circuit or on a different chip than the processor . it should also be appreciated that the imager device 1100 of the claimed invention may also be used within display imager devices having light emitters fabricated on a substrate rather than photosensors . the processes and devices described above illustrate preferred methods and typical devices of many that could be used and produced . the above description and drawings illustrate embodiments , which achieve the objects , features , and advantages of the present invention . however , it is not intended that the present invention be strictly limited to the above - described and illustrated embodiments . any modification , though presently unforeseeable , of the present invention that comes within the spirit and scope of the following claims should be considered part of the present invention . | 7 |
the principles of the present invention are particularly useful when incorporated in a lithotripter , generally indicated at 1 in fig1 . the lithotripter 1 is composed of a first sub - housing 3 and a second sub - housing 5 , which are essentially rotationally symmetrical . the sub - housing 3 has an upper domed part 3a with a central opening 7 , which is covered by a coupling membrane 9 , which is over the opening . shockwave pulses generated in the lithotripter 1 will emerge through this opening 7 via the coupling membrane 9 into a patient 11 , which is to be treated . a lower , essentially annular part 3b of the first sub - housing 3 , is rotatably connected to the second sub - housing 5 by a plain cylindrical bearing 13 . the second sub - housing 5 includes a non - pivotable upper or first part 15 , which is fashioned as an annular member and whose outside surface is received by the part 3b to form the cylindrical bearing 13 . the sub - housing 5 has a pivotable pot - shaped or second part 17 , whose floor or base has an opening 18 on which a shockwave source 19 is secured . the shockwave source 19 can , preferably , be a shockwave tube , which is disclosed in greater detail in u . s . pat . no . 4 , 674 , 505 . the pivotable pot - shaped part 17 is pivotably mounted to tilt around a swivel axis 21 by a pair of trunnions 22 which , as illustrated , lie in the plane of the paper in fig1 . the exact arrangement of the swivel axis 21 shall be set forth in greater detail hereinafter . in order to achieve a water - tightness of the lithotripter housing 3 and 5 , the pivotable pot - shaped part 17 and the non - pivotable part 15 are interconnected to one another by an inwardly situated bellows 23 . given a pivot of the pot - shaped part 17 , one half of the bellows 23 will be compressed , while the other half is pulled or stretched apart . a filling of the housing parts 3 and 5 with a dielectric , such as , for example , water , is required for reasons of the shockwave propagation . the shockwave source 19 has a central axis z , which coincides with the central axis of a focussing means 25 , which is mounted in the housing parts 3 and 5 adjacent the membrane 9 . the focussing means 25 , as illustrated in the exemplary embodiment , is a biconcave lens . the convergent lens of the focussing means is arranged centrally relative to the central axis z and is mounted for displacement along the central axis z by displacement means 29 . to this end , the displacement means comprises , for example , three rotating rods 31 ( only one being shown for purposes of illustration in fig1 ) having threads , which rods are offset by an angle of 120 ° relative to one another . the threads are cut into the upper part of the revolving rod 31 , which is received in a lower part 31a of the revolving rod 31 . the lower rod 31a is mounted in the floor or base of the part 17 in a rotationally movable fashion . two respective locking rings 30 hold every rod 31 axially rigid with respect to the part 17 . to provide a seal for the rod , an o - ring 32 is situated in an annular channel which is formed in the part 31a between the locking rings 30 . the edges of the revolving threads 31 engage into the inside threads at an outer edge 27 of the lens or focussing means 25 . a uniform rotation of the three revolving threads 31 displaces the lens 25 along the central axis z and , thus , perpendicular to the shockwave emission surface formed by the membrane 9 . a gear wheel 34 is mounted on the ends of each of the three thread parts 31a to create this linear displacement . all three gear wheels 34 are driven by a common tooth belt ( not shown ), which is driven by a motor ( not shown ). the lens 25 has a focal point f , which , thus , remains on the central axis z during displacement . the heads 33a and 35a of the two ultrasound transmission and reception means 33 and 35 , respectively , are fashioned as sector scanners and are arranged on the edge 27 of the lens 25 with a relative offset to one another by a rigidly prescribed angle alpha with respect to the axis z . in the illustrated embodiment , the angle alpha amounts to 90 °. the first head 33a is shown in broken lines , since it is situated in front of the plane of the observation with respect to the cross section of fig1 . the scanning plane e1 of the first ultrasound transmission and reception apparatus 33 extends perpendicular to the plane of the paper and proceeds through the central axis z . the second scan plane e2 , which is produced by the second sector scanner or head 35a of the second ultrasound transmission and reception means lies in the plane of the paper and is illustrated by lines including dashes and three dots . the second scan plane e2 also extends through the axis z . the geometrical conditions for the scan planes e1 and e2 , which extend perpendicular to one another and both extend through the central axis z of the focussing means 25 , are rigidly prescribed . the ultrasonic heads 33a and 33b are illustrated as being inclined towards the focal point f and are accommodated in the periphery or at the edge 27 of the lens 25 and are , thus , firmly mounted therein . three or four reinforcements or bulges 37 ( only one is shown ) are provided on the part 3b of the first sub - housing 3 . each of these bulges has a bore 39 , which receives rods or members of a mounting means , which enable the lithotripter 1 to be moved into and out of engagement with the patient 11 . the process or method of locating the lithotripter 1 is illustrated in fig2 - 5 . fig2 illustrates a schematic plan view of the effective focussing means 25 , as well as the first sector scanner 33a with its first scan plane e1 in the plane x - z , and the second scanner head 35a with its second scan plane e2 , which is in the plane y - z . in order to pivot the second scan plane e2 around the swivel axis 21 of fig1 the y axis is provided with a symbolic swivel bearing 41 . the sector - shaped scan planes e1 and e2 can be viewed on a picture screen of the apparatus 33 or 35 . in broken lines , fig2 shows a constellation of the axis x &# 39 ;, y &# 39 ; and z &# 39 ;, wherein z &# 39 ; is identical to z of the lithotripter 1 relative to a calculus k in the inside of the patient 11 , as initially randomly derived when the lithotripter is coupled to the patient still undirected when first applied . the calculus or stone k lies at some location between the scan planes e1 &# 39 ; and e2 &# 39 ;, which are not yet aligned . as a first step for the exact location of the stone k in a lithotripter adjustment , the second sub - housing 5 is rotated around the central axis z with the assistance of the cylindrical bearing 13 upon entrainment of both the apparatuses 33 and 35 until the calculus or stone k appears in the first scan plane e1 of the first ultrasonic scanner head 33 . this corresponds to a solid line x , y axis in fig2 . for the sake of clarity , the apparatus 33 and 35 are shown outside of the lens 25 , however , in the present case , the overall arrangement of the lens 25 , with the heads 35a and 33a are all rotated together . with the stone or calculus k lying in the plane e1 , the apparatus will have the configuration or cross section illustrated in fig3 a . the picture screen image of the calculus k and the mixed - in focus f occurs , as illustrated in fig3 b . however , the scan plane e2 , which in fig3 a extends perpendicular to the plane of the paper through the axis z , still misses the calculus or stone k . the picture screen for the second sector scanner 35 , thus , does not yet show the calculus k . as illustrated in fig4 a , the next step is to pivot the shockwave source 19 and focussing means 25 , plus the rigidly connected ultrasound transmission and reception apparatuses 33 and 35 around the swivel axis 21 , which extends perpendicular to the plane of the paper from the position illustrated in broken lines to a position where the calculus k will lie in the plane e2 and will appear in the picture screen of the second sector scanner 35 . the swivel axis 21 is aligned so that the calculus or stone k simultaneously remains in the scan region of the first ultrasonic scanner 33a . this means that the axis 21 must be arranged to extend perpendicular to the central axis z and must also lie in the scan plane e2 of the second ultrasonic scanner head 35a , which is imaged as lying in the back side of the focussing means 25 . fig4 b is the image for the first sector scanner 33 with the position of the calculus k shown in broken lines before the pivoting and the position after pivoting is shown in bold lines . in fig4 c , the image for the sector scanner 35 illustrating the position of the calculi after the pivoting so that the calculi also lies in the plane e2 . after the second positioning step , which is the step of pivoting on the axis 21 , the lithotripter 1 is aligned so that the calculus or stone k lies on the central axis z and , thus , can be seen on both picture screens . the depth position of the calculus k on the central axis z , however , has not coincided with the focal point f of the focussing means 25 . the focal point f is now displaced towards the calculus k in a third adjustment step by turning the rotating threads or positioners 31 of the displacement means 29 . the focussing procedure is , thus , concluded and the first shockwave pulses can now be triggered to disintegrate the stone k . the displaceability of the focal point f , without having to modify the position of the coupling membrane 9 relative to the patient 11 is an advantage of the lithotripter of the present invention . the possibility of turning and / or swivelling the scanning planes e1 and e2 of the ultrasound scanners 33 and 35 , respectively , creates the possibility of undertaking a reliable positioning , even given complicated calculus positions , which occurs particularly with gall stones . in the above description , it is assumed that the calculus was in a fixed position . however , movement of the stone will occur because of breathing activities , and this movement is a continual appearance and disappearance in the two ultrasound images . the same , to a lesser degree , will also occur due to the heart activity . it is , therefore , advantageous when the registration of the ultrasound image respectively occurs in the same respiration and / or each ecg position at which the shockwave is likewise to be triggered . it is just as advantageous for the evaluation carried out by the attending physician when only these ultrasound images are displayed . in fig5 a common trigger mechanism or means 50 is provided for this purpose . this trigger mechanism is used both during the registration for the ultrasound images , as well as when triggering the shockwaves . to this end , a pickup or sensor 55 for the respiration and a pickup or sensor 57 for the heart activity ( ecg ) are arranged on the patient 11 , who is positioned on a patient supporting plate 51 . as illustrated , the plate 51 has an opening 53 , through which the lithotripter extends to apply the shockwaves to the patient . the output signal of the sensors 55 and 57 are supplied to correspondingly known evaluation devices or means 59 and 61 , respectively . the output signals of these evaluation devices or means are conducted in common to a trigger mechanism 50 in the present installation . it is adequate in many uses to only provide the one sensor 55 with its evaluation means or device 59 for supervising respiration and to omit the sensor , such as 57 , and its evaluation means 61 for heart activity . in a known way , the trigger mechanism 50 forms a trigger signal t from the supplied signals , and this trigger signal t is then supplied via a selective switch 63 , either to a trigger mechanism or starting means 65 for the shockwaves , or to an exposure starting means 67 for the ultrasound images . in the illustrated switch position , the shockwave supply or generator means 69 , which belongs to the shockwave source 19 , is driven with the trigger signal t . in the present case , the shockwave source 19 is shown as a known shockwave tube . in the other non - illustrated position of the switch 63 , the trigger signal t charges the exposure starting means or mechanism 67 for the ultrasound images of the two ultrasound scanners 33 and 35 . the echo signals picked up by the heads 33a or , respectively , 35a are portrayed on the picture screens ( not shown ) with the assistance of the apparatus or means 33 and 35 , respectively . according to the arrangement of fig5 the registration of the two ultrasound images respectively occurs in a respiratory position in which the shockwave will also be subsequently triggered . as explained , this can also apply to phase relationship of the heart activity . although various minor modifications may be suggested by those versed in the art , it should be understood that we wish to embody within the scope of the patent granted hereon all such modifications as reasonably and properly come within the scope of our contribution to the art . | 0 |
[ 0018 ] fig1 is a schematic diagram 100 of a computer 102 connected 104 to a printing apparatus 106 . the connection 104 may be a computer network such as an ethernet implementation ; a serial connection such as universal serial bus ( usb ) or ieee 1394 cable ; a parallel port connection ; or a wireless connection such as bluetooth or ieee 802 . 11 lb . the computer 102 preferably includes a print manager 103 . a plurality of remote computers 110 ( only one shown ) may also be communicatively coupled to the computer 102 via a packet switching network such as the internet 114 . images ( not shown ) 110 may be transferred from the remote computer 110 via the internet 114 to the print manager 103 in the computer 102 , or may originate in the computer 102 . [ 0019 ] fig2 is a block diagram of a preferred embodiment of the printing apparatus 106 shown in fig1 . the printing apparatus 106 includes a source of sheet material 204 which is preferably a web 202 . the sheet material 204 may be , for example , paper , film , metal , or cloth . the printing apparatus 106 also includes a first feed mechanism 206 for feeding the sheet material 204 from the web 202 to a print engine 208 which may be , for example , a laser - writer or an ink - jet print engine . the print engine 208 prints images onto the sheet material 204 . the images may be , for example , two or three dimensional images ; holographic images ; text ; or any combination thereof . the print engine 208 may print on either or both sides of the sheet material 204 to produce printed sheet material 212 . the printing apparatus 106 has a second feed mechanism 210 for feeding the printed sheet material 212 from the print engine 208 to a cutter 214 . the cutter 214 therefore includes a web input mechanism that includes the second feed mechanism 210 for receiving the printed sheet material from the print engine 208 . the cutter 214 cuts the printed sheet material 212 into sheets 218 of an appropriate size . the cutter 214 may constitute , for example , a blade , a laser or shearing mechanism . the printing apparatus 106 also has a third feed mechanism 216 for feeding the sheets 218 from the cutter 214 to a stacker 220 . the stacker 220 is an embodiment of a page laying unit adapted to lay the sheets 218 into a stack 222 of documents 224 . the stacker 220 may be , for example , a mechanism for sorting and / or collating documents ; or a tray for receiving pre - sorted / pre - collated documents . the printing apparatus 106 may include a processor 230 coupled by connections 235 , 246 , 248 , 250 to monitor or control other aspects of the printing apparatus 106 . for example , the processor 230 is coupled by connection 235 to sensor 260 , which senses a condition of the web 202 , such as a “ source empty ” condition . the processor 230 is coupled by connection 246 to the print engine 208 , whereby the processor 230 may transfer image data to the print engine 208 . the processor 230 is coupled by connection 248 to the cutter 214 for controlling the cutter 214 to cut the printed sheet material 212 into sheets 218 in accordance with available data and a predetermined program . finally , the processor 230 is coupled by connection 250 to the stacker 220 for controlling the operation of stacker 220 or for sensing a condition of the stacker 220 such as a “ tray full ” condition . the printing apparatus 106 also includes a communication interface 232 coupled by a connection 234 to the processor 230 and adapted to communicate with the computer 102 ( fig1 ) via the connection 104 , whereby print job information is obtained from the computer 102 . the processor 230 is also coupled by a connection 238 to a keypad 236 for a user ( not shown ) to input commands to the processor 230 , and coupled by a connection 242 to a display 240 to permit the user to receive messages generated by the processor 230 . a memory 244 is also coupled to the processor 230 by a memory bus 252 for intermediate storage and processing of images received from the printer manager 103 ( fig1 ) via the connection 104 and the communication interface 232 before the image data is transferred to the print engine 208 . the sheets 218 produced by the cutter 214 may be of a first size , such as letter , legal or a 4 , referred to herein as pages ; or a second size having a dimension , such as length or width , different from a corresponding dimension of the first size , referred to herein as flag sheets 226 . the dimension of the flag sheets 226 is preferably greater than the respective dimension of the pages . the flag sheets 226 separate the pages into logical groupings . an appropriate logical grouping may be a print job , a part of a document , or any other serial set of pages identified by a processor 230 . for convenience , such logical groupings are referred to herein collectively as documents 224 . the printing apparatus 106 produces the stack 222 of documents 224 that are partitioned by flag sheets 226 that facilitate identification and separation of individual documents in the stack 222 and reduce retrieval errors . advantageously , the flag sheets 226 facilitate the identification and / or separation of the documents 224 by a user ( not shown ). it should be noted that the documents 224 may be copies , unique documents , or any combination of 226 may be identical to one another the two . also , the flag sheets may have unique printed images to facilitate identifying individual documents 224 . preferably , the shape of the pages in a document 224 or of the flag sheet 226 separating the documents 224 is rectangular . the use of flag sheets 226 having a different dimension than the corresponding dimension of the pages constituting a document 224 provides a mechanism for easily identifying where a document 224 begins and ends , without mutilating the pages of the document 224 , such as is the case with the use of staples . additionally , the identification of where documents 224 remaining in a document stage 222 begin and end is maintained , even if a document 224 has been retrieved from the middle of the stack 222 . the embodiments of the invention described above are intended to be exemplary only . the scope of the invention is therefore intended to be limited solely by the scope of the appended claims . for example , it may not be strictly necessary for the printing apparatus 106 to use printed sheet material in a web , which material is cut to length by a cutter . rather , the printed sheet material may be pre - cut and an appropriate size of printed sheet material used for both the document pages and for the flag sheets . for example , a document consisting of letter - sized pages may be separated by a flag sheet of legal - size dimension . in such a case , the identification of the separating flag sheets may be enhanced by using printed sheet material for the flag sheet having a different colour , texture , thickness or consistency than that used for the pages of the document . | 1 |
fig1 illustrates an automatically controlled sheet cutting apparatus , indicated generally at 10 , and generally similar to that described in u . s . pat . no . 3 , 495 , 392 entitled &# 34 ; apparatus for working on sheet material &# 34 ;. the apparatus 10 also includes a blade sharpening device such as that shown in u . s . pat . no . 4 , 133 , 236 to the same inventor , david r . pearl . the apparatus 10 is numerically controlled by a computer controller 12 connected to it by a cable 14 . a tape storage 16 converts the data into machine commands for guiding the reciprocating blade 20 along a programmed path p , which path may be the periphery of a pattern piece or panel . in the present disclosure , the sheet material preferably comprises a single sheet or ply s rather than a layup , and more particularly , the sheet s comprises a composite of oriented space age fibers , such as boron or graphite , in an epoxy matrix which is generally uncured in this cutting stage . still with reference to fig1 the apparatus 10 includes a table 22 having a penetrable bed 24 , of upwardly projecting bristles as shown in fig3 to define a support surface for the sheet material s . these bristles are of plastic material , being relatively stiff and capable of reacting vertical forces imposed thereon by the cutting blade 20 , but also capable of moving or bending laterally as necessary to allow the blade 20 to follow the path p . a vacuum hold down system , such as shown and described in the above mentioned u . s . pat . no . 3 , 495 , 392 is also provided to hold the sheet material in fixed relation to the bed . a polyethelene sheet ( not shown ) may also be used to preserve the vacuum below the sheet . the blade 20 is mounted in a cutting head 18 which is movable in the x and y directions as a result of carriages 26 and 28 , the latter being movable along the former to cause cutting head 18 to move in a horizontal plane . carriage 28 is movable in the x direction on racks 30 and 31 at the sides of the table 22 , and carriage 26 is movable in the y direction by lead screw 38 . drive motors 34 and 36 are energized from the controller 12 to cause movement of the x and y carriages , 26 and 28 respectively . a drive motor ( not shown ) in the head 18 provides reciprocating movement of the blade 20 under the control of controller 12 , and at a frequency ( f ) such that the blade 20 moves through approximately five cycles ( 10 vertical up and down strokes ) as it moves a linear distance corresponding to it &# 39 ; s own width w ). the path of the reciprocating blade 20 is illustrated schematically in fig3 wherein the horizontal displacement of the blade has been expanded approximately 100 times to depict one vertical reciprocation cycle . the apparatus for moving the blade in it &# 39 ; s x and y direction ( horizontally ) must do so at a speed of 200 - 400 inches per minute , and the means for reciprocating the blade between the limit positions shown at a and b in fig3 preferably does so at approximatley 4000 cycles per minute . this speed relationship will provide a ratio of forward progress to frequency in the range of 200 / 4000 and 400 / 4000 inches per cycle ( that is 0 . 05 - 0 . 10 inches per cycle ). in order to achieve the desired condition referred to previously ( of five cycles per blade width ) it follows that the blade 20 should have a width of at least approximately 3 / 32 of an inch . this geometry will provide substantially all cutting action of the blade 20 to be accomplished by the most forward portions of vertically spaced chisel edges 20a and 20b of a notch 20c formed in the blade leading edge 20d . as best shown in fig3 the blade 20 has this relatively deep notch 20c , with a depth of approximately one half the blade width and a vertical height of approximately 60 percent the vertical stroke made by the blade during it &# 39 ; s reciprocating movement . this relationship assures that the vertical speed of the blade 20 will be at or near it &# 39 ; s maximum as the chisel edges 20a and 20b chop through the sheet s at blade positions e and d respectively . the motion of blade 20 is basically sinusoidal in its oscillatory advancing mode , and therefor maximum cutting speed occurs between the limit positions a and b in fig3 . as the upper chisel edge 20a chops down through the sheet s ( position e ) it will be apparent that the bristle bed 24 supports the sheet during this downward stroke of the blade . as best shown in fig2 and 5 a pressure foot 30 is provided on a depending post 33 to hold the sheet s downwardly during the upward stroke of the blade ( see position d in fig3 ). still with reference to the configuration of the blade 20 , fig4 shows the v - shaped leading edge 20d defined by opposed sharpened , or ground surfaces , and the lower end of which cooperates with a lower edge 20e which is also v - shaped and defined by opposed sharpened surfaces . these edges 20d and 20e define an included angle of approximately 135 degrees ( and which angle is preferably in the range between 120 - 150 degrees ). as so configured it will be seen from fig3 that this lower edge 20e does achieve some cutting of the sheet s during downward blade motion from the right hand limit position a of fig3 to the adjacent blade position . turning next to a more detailed consideration of the specific sheet material to be cut , fig6 shows the orientation of it &# 39 ; s parallel fibers of graphite or boron and also shows that the path p of the blade 20 can be either across these fibers or close to tangential with respect thereto . it is in this latter position that the blade 20 displays its most impressive advantages . as a result of the incremental chopping action of the chisel edges 20a and 20b the parallel fibers are cut only a few at a time and there is very little tendency for the blade 20 to tend to displace these fibers laterally in lieu of cutting them . thus , it is an important feature of the present invention that the notch 20c have generally horizontally extending chisel edges 20a and 20b for so chopping the fibrous sheet material . furthermore , the notch 20c has a non - sharpened inner boundary 20c and these upper and lower edges 20a and 20b are parallel to one another and generally horizontal . as best shown in fig5 these chisel edges 20a and 20b can be conveniently sharpened by moving a skewed sharpening device through the blade notch at an angle of approximately 45 degrees to the longitudinal axis of the blade 20 . although 45 degrees is the presently preferred skew angle for this single notch 20c in the blade 20 , any angle in the range between 30 degrees to 60 degrees will provide some of the advantages of the invention . finally , the blade 20 can be seen from fig4 to have its single notch 20c located close to the lower edge 20e in order to minimize the vertical stroke required to achieve the advantages alluded to above . thus , the lower edge 20b of notch 20c is located adjacent to this lower edge 20e and more particularly the vertical distance the middle of notch 20c and edge 20e between is in the same dimensional range as the height of the notch itself ( that is , in the range of 60 percent of the blade stroke ). the notch depth is preferably in the range of 40 - 60 percent of the blade width as mentioned above , and the said vertical distance between the notch lower edge 20b and the blade lower edge 20e is preferably comparable to the blade width so as to minimize the vertical stroke required to cut through the sheet material during both the downward and the upward movement of the blade . | 8 |
as shown in fig1 a switch 100 has four ports 105 a - 105 d . ports 105 a - 105 d are circuits that may include hardware , software , firmware or any combination thereof . the ports 105 a - 105 d are coupled to four buses 110 a - 110 d , respectively , and are used to transmit data from and receive data into switch 100 . ports 105 a - 105 d and buses 110 a - 110 d are full duplex in that they can transmit and receive data frames simultaneously . in one implementation , switch 100 is an ethernet switch . a receiving bus 115 a and a transmitting bus 115 c are coupled to ports 105 a - 105 d . receiving bus 115 a forwards received data frames from ports 105 a - 105 d to a control circuit 120 . an intermediate bus 115 b forwards received data frames from control circuit 120 to main memory 125 . a bus 150 forwards address data to main memory 125 for use in storing the received data frames . the transmitting bus 115 c forwards data frames stored in main memory 125 to ports 105 a - 105 d . four transmission queues 130 a - 130 d that are associated with ports 105 a - 105 d , respectively , are interspersed in switch 100 . control circuit 120 is coupled to the four transmission queues 130 a - 130 d and main memory 125 through control signal paths . it should be noted that control circuit 120 and transmission queues 130 a - 130 d may be implemented as logic circuits that may include gates , hardware , software , firmware or any combination thereof to perform the functions described . in general , the switch 100 receives data frames on buses 110 a - 110 d at ports 105 a - 105 d . the received data frames then are forwarded to control circuit 120 using receiving bus 115 a . control circuit 120 non - randomly determines particular locations in main memory 125 for storing the received data frame . control circuit 120 forwards the received data frame to main memory 125 for storage . transmission queues 130 a - 130 d determine when to output the stored data frame over buses 110 a - 110 d using ports 105 a - 105 d based upon control data received from control circuit 120 . as shown in fig2 exemplary port 105 a contains control circuit 210 and multiplexers 220 . exemplary port 105 a receives a data frame on transmitting bus 115 c for forwarding . the data frame received on transmitting bus 115 c is extracted from transmitting bus 115 c by multiplexers 220 . control circuit 215 exchanges control signals with ccslc 120 and oclcs 130 a - 130 d . as shown in fig3 control circuit 120 includes a memory 305 . memory 305 is smaller than main memory 125 and tracks the occupied and available locations in main memory 125 . control circuit 120 also includes a frame mapper circuit 310 and a frame address generator circuit 315 . frame mapper circuit 310 is a logic circuit that receives data from memory 305 and determines an empty or vacant ( i . e ., not currently storing valid data ) location in main memory 125 that will store the recently received data frame . in addition , frame address generator 315 also generates data or map codes that indicate the location in main memory 125 that will store the recently received data frame . frame address generator circuit 315 is also a logic circuit but it generates addresses based upon the data or map code it receives from the transmission queues 130 a - 130 d . the generated addresses are used to read out the desired data frame from its particular location in main memory 125 . as shown in fig4 a , an exemplary memory 305 may include an array of memory cells 405 , a channel decoder 410 and a segment decoder 415 . in one implementation , array 405 is four bits wide and sixteen bits long . this correlates to main memory 125 , which has four channels and sixteen segments . each cell in array 405 holds a single bit and correlates to a particular channel in a particular segment of main memory 125 . if a particular cell in memory 305 currently stores a 1 - bit , that is an indication that the corresponding channel of the corresponding segment of main memory 125 contains valid frame data and cannot presently accept a new data frame . alternatively , if a particular location in memory 305 currently stores a 0 - bit , that is an indication that the corresponding channel of the corresponding segment of main memory 125 contains invalid frame data , ( i . e ., it is empty ) and can presently accept new data . each cell in array 405 is individually addressable through channel decoder 410 and segment decoder 415 , which receive control signals from the frame mapper circuit 310 and frame address generator circuit 315 . in either implementation , the cells also may be addressable by row or column . as shown in fig4 b , each cell 420 of array 405 may be implemented as an s - r flip flop that is enabled by a combination of the appropriate channel decoder and segment decoder signals . the set input of the flip - flop is connected to a write signal , and the reset input is connected to a read signal . thus , the value of the cell is set to one when the write signal is asserted and the channel decoder and segment decoder signals indicate that data are being loaded into the corresponding portion of memory 125 , and is set to zero when the read signal is asserted and the decoder signals indicate that data are being read from the corresponding portion of main memory 125 . the cell 420 may be further configured to produce an output only when the enable signal is asserted so as to permit the controller to poll the memory 305 to detect cells having values indicative of available portions of main memory 125 . an exemplary main memory 125 may have four channels , each of which is 64 bytes wide , and sixteen segments . this means that main memory 125 can store 64 , 64 - byte data frames ( one in each channel in each segment ), sixteen , 256 - byte data frames ( one spanning all four channels in each segment ), or other combinations . [ 0035 ] fig5 shows a pair of exemplary cells 550 , 555 in main memory 125 that each store 64 bytes . each cell represents one location in main memory 125 ( i . e ., one channel of one segment ). a decoder 560 uses the address bus 150 to generate signals that are combined with read and write signals to enable writing to and reading of a particular one of the cells 550 , 555 . it should also be noted that any type of randomly accessible , writeable storage device may be used . examples include ram , sram , dram , rdram and sdram . when a data frame is received , a determination is made as to which portion of main memory 125 is to store the received data frame . the received data frame then is forwarded onto bus 115 b and the address bus 150 is used to identify one or more appropriate cells . the appropriate cells are activated by a combination of a signal from the decoder 560 and a write enable signal from the control circuit 120 . similarly , a stored data frame is forwarded onto bus 115 c by signals on the address bus 150 identifying the appropriate cells . the cells are activated by a combination of a signal from the decoder 560 and a read enable signal from the control circuit 120 . as shown in fig6 an exemplary frame mapper circuit 310 includes size determiner circuit 605 and port determiner circuit 610 . frame mapper circuit 310 also includes channel availability circuit 615 and segment availability circuit 620 . size determiner circuit 605 receives some of the header data from received data frames . more particularly , size determiner circuit 605 receives data that inform switch 100 of the size of the received data frame . these data are used to map wide data frames , typically wider than a single channel , to multiple channels in a single segment in main memory 125 . it should be noted that in other implementations , wide data frames may be written into multiple channels in multiple segments . port determiner circuit 610 performs two functions . the first function is to determine which port 105 a - 105 d received the data frame . an exemplary way to perform this function is to have each port output a unique signal onto receiving bus 115 a that port determiner circuit 610 decodes to determine which port 105 a - 105 d forwarded the data frame to it . one way of decoding the unique signal is to take the assigned port number and perform a modulo operation ( e . g ., if the switch has four ports , the decoder performs a modulo 4 operation ). the second function of port determiner circuit 610 is to determine which output port is to transmit the received data frame . one way to accomplish this function is to have port determiner circuit 610 receive a portion of the header data and read the destination address therein . port determiner circuit 610 then correlates this header data with the appropriate port 105 a - 105 d . channel availability circuit 615 receives data from memory 305 and determines which channel locations in main memory 125 are free of valid data frame data . it forwards these results to segment availability circuit 620 which then determines which segment locations in main memory 125 are free of valid frame data . in other implementations , both of these two circuits receive data directly from memory 305 ( this variation is represented by the dashed line in fig6 ). these circuits operate by simply polling memory 305 to determine where zeroes , indicative of empty locations in main memory 125 , are located . size determiner circuit 605 , port determiner circuit 610 , channel availability circuit 615 and segment availability circuit 620 all output data to look - up table 625 . look - up table 625 uses these data inputs to generate address signals for enabling the corresponding locations in main memory 125 to store the received data frame and associated map codes that are forwarded to the transmission queues 130 a - 130 d that are used to retrieve the stored data frame as is described later . since the look - up table 625 generates the same address when it receives a particular set of inputs , the look - up table 625 orders the received data frames to be stored systematically ( i . e ., not randomly ). in other words , this systematic storing of data frames is a result of an established one - to - one association or relationship between the data received by the look - up table 625 and the addresses it generates . in some implementations , look - up table 625 may only output addresses for contiguous channels . for example , if the received data frame is 128 bytes wide ( two channels ), look - up table 625 will only output contiguous addresses to adjacent channels . in alternative implementations , look - up table 625 may be programmed to output non - contiguous addresses . this feature allows for more efficient packing of the data frames in main memory 125 . as shown in fig7 frame address generator 315 includes collision detector circuit 705 . collision detector circuit 705 receives data from the four transmission queues 130 a - 130 d . collision detector circuit 705 outputs data to arbitrator circuit 710 . arbitrator circuit 710 outputs data to look - up table 715 . in general , exemplary collision detector circuit 705 looks for possible collisions when outputting data from main memory 125 . an example of a collision is attempting to output data from two different data frames from memory 125 onto the same portion of transmitting bus 115 c . another example of a collision is outputting too much data ( e . g ., the enabling of a pair of segments and a pair of channels , which would allow the output of four , 64 - byte quantities , where the ports are only ready to transmit three , 64 - byte quantities ). this second collision causes one location to be emptied before the ports 105 a - 105 d can output the data frame such that data stored in that particular location are lost . collision detection is accomplished by comparing the map codes received from the transmission queues 130 a - 130 d . collision detector 705 operates using a set of rules that may be programmed into software , hardware or firmware . an exemplary rule is the comparison of the received map codes to determine if two or more of the received map codes will cause data to be output onto the same portion of transmitting bus 115 c . if main memory 125 is configured to output one set of channel data onto a particular portion of transmitting bus 115 c , it follows that if two segments output data from the same channel simultaneously a data collision will occur . thus , a simple comparison to determine if the transmission queues 130 a - 130 d are requesting data from the same channel address on two different segment addresses is performed . collision detector 705 generates output data based upon the one or more comparisons it performs . the output data indicate which , if any , of the received map codes are colliding . arbitrator 710 uses this output data to select one or more map code combinations that instruct main memory 125 to output data frame data without causing collisions . in an alternative implementation , arbitrator 710 selects one or more colliding map codes for temporary removal and forwards the non - colliding map codes to look - up table 715 . look - up table 715 receives the non - colliding map codes from arbitrator 710 and translates those map codes into addresses . the addresses generated by look - up table 715 are used by main memory 125 to output data frames and by memory 305 to indicate newly vacated locations in main memory 125 . fig8 shows an alternative switch 800 that includes a general processor 820 . like exemplary switch 100 , switch 800 includes four ports 105 a - 105 d that are coupled with four external buses 110 a - 110 d and internal buses 115 a - 115 c . processor 820 is coupled with internal bus 115 a and intermediate bus 115 b . memory 125 is coupled with intermediate buses 115 b and internal bus 115 c . the function and operation of most of the elements of exemplary switch 800 have been previously described and will not be repeated . one difference between exemplary switches 100 and 800 is the use of a general purpose processor to perform the determining of acceptable memory locations to store the received data frames and the outputting of data frames from memory 125 to ports 105 a - 105 d for transmission over buses 110 a - 110 d . processor 820 contains memory such as rom or ram ( not shown ) that holds the instructions used to control the operation of processor 820 and therefore the operation of switch 800 . [ 0051 ] fig9 shows an exemplary process for storing a received data frame . this process is initiated when the switch receives a data frame ( step 905 ). the header information , which contains at least destination information and frame size , is extracted from the data frame ( step 910 ). using the header data , the size of the received data frame is determined ( step 915 ). in addition , the identity of the port that received the data frame is determined ( step 920 ). next , the empty locations in main memory are determined ( step 925 ). one exemplary method of performing this step is to store 1 - bits and 0 - bits in a separate memory that correspond to full and empty locations , respectively , in the data frame memory and to poll this separate memory to locate an adequate concentration of 0 - bits that correlate to the size in the data frame memory that can store the copies of the received data frame . once all of the suitable locations in frame memory have been identified , one or more locations are selected to store the copies of the data frame ( step 930 ). the data frame is then stored in the selected memory locations of the frame memory ( step 935 ). each data frame is associated with a port that will transmit it and this association , along with the locations in frame memory of the data frame , is stored in a memory ( step 940 ). the process then ends ( step 945 ). [ 0053 ] fig1 shows an exemplary process 1000 for outputting data frames from a switch . the process begins when multiple associations are selected ( step 1005 ). in other words , each port of the switch is polled to determine if it has a data frame in frame memory that is ready to be transmitted . one exemplary way of performing this step is to store the associations in a queue and read them in a first - in - first - out ( fifo ) order . with multiple ports requesting data from the frame memory at the same time , a conflict may arise such that two ports will require data from locations that share a data output bus in the frame memory . accordingly , a determination is made to see if there is a conflict ( step 1010 ). if there is no conflict such that every port that has data frames to output may do so simultaneously , then the data frames are read from the frame memory in parallel ( step 1015 ). the ports select the data frames that are to be output , based on the association described above , and output the selected data frames ( step 1020 ). the process then ends ( step 1025 ). if a conflict is determined ( see step 1010 ), then one of the ports that has a conflict is instructed to wait ( step 1030 ) and the remaining associations are checked again for a conflict ( step 1010 ). at worst case , ports will be instructed to wait until only one port remains and then the remaining port will be able to retrieve and output its data frames freely ( see steps 1015 - 1025 ). [ 0056 ] fig1 a - 11 d show portions of a main memory . fig1 a shows exemplary segment 9 and a portion of channel 0 . of the seven shown locations , six are currently holding data . when new data frame r is received , it is possible that the random address generation circuit ( not shown ) will randomly pick the six full locations before selecting the empty location . thus , in a worst - case scenario , the performance of the switch that randomly selects occupied locations will wait six cycles before properly placing the newly received data frame r in the empty location addressed by segment 9 , channel 0 . in contrast , a switch implementing the systems and methods described above will properly place the newly received data frame r in the vacant location at the first cycle . [ 0058 ] fig1 b shows a portion of a memory where the data frames are stored contiguously and random location selection was performed . since data frame m could not be divided , it was stored in segment 6 across all four channels . thus , at least four segments are needed to store the four received data frames . in addition , due to random location selection , the memory is not utilized to its maximum bandwidth potential . that is , data frame n is not stored in segment 3 , channels 2 and 3 but is instead stored in segment 5 . thus , to forward data frames l - o will require four clock cycles . as shown in fig1 c , data frame n is stored in segment 3 along with data frame l . by using a systematic method of storing data frames into the memory , the useful bandwidth of the memory increases . assuming there are not conflicts for output ports between data frames l and n , all of the data frames l - o can be forwarded in three clock cycles instead of four . as shown in fig1 d , allowing data frames to be divided allows the four received data frames to be stored in three segments . thus , implementations that allow data frames to be stored non - contiguously allows for increased useful bandwidth of a memory . that is , assuming there no conflicts for output ports between the various data frames , the four data frames l - o can be forwarded in three clock cycles instead of four . a number of implementations have been described . nevertheless , it will be understood that various modifications may be made . for example , in alternative implementations , the fifo function of the transmission queue is modified to take into account priority of the received frames . thus , a data frame that is added later to the queue but that has a high priority can be output before other data frames that were received earlier . | 7 |
the present system is exemplified with respect to a sagd well with an esp pump . however , this is exemplary only , and the invention can be broadly applied to any high vapor producing well wherein the downhole pump has a tendency to blow through by vapor . the invention also has the advantage of reducing gas - locking , although this is not the primary intent . the following examples are intended to be illustrative only , and not unduly limit the scope of the appended claims . downhole pumps in the oil industry are designed mainly for lifting liquids . they are designed on the assumption that vapor is separated downhole and directed to the casing annulus , thus not entering the pump and causing problems . depending on the pump specifications , the presence of vapor / gas phase more or less reduces the downhole pump efficiency . however , the amount of vapor that can be vented out from the annulus is restricted by the pressure of the casing gas treater . if the rate of the vapor accumulation is higher than the rate that expelled from the casing and tubing , e . g . : more vapor will be accumulated in the casing annulus , and the increased volume and / or pressure can lower the level of liquid above the pump . if this level lowers to the pump intake level , vapor will enter the pump and reduce the overall pump performance , producing periods where no or low liquid is produced . we have studied a variety of parameters during normal and no - flow or low - flow conditions in actual sagd wells , and our results are shown in simplified manner in fig1 a - e to 2 and described below . fig1 a illustrates a typical normal flow condition , where vapor in annular is produced at a level that matches the vapor shunted out of the casing . since gas removal occurs at levels equal to the rate of gas accumulation , the system is stable . in more detail , fig1 a ( not drawn to scale ) shows the sagd chamber 110 where oil gravity drains to the casing liner 120 . oil enters the downhole pump 130 , but vapor typically rises and is collected in the annular casing 150 , where it travels via through casing valve 153 to e . g ., casing gas treater 155 , and from there to various treatments and / or shipment . oil continues to flow up via production tubing 140 to valve 143 to e . g ., production separator 145 and from there to various treatments and / or shipment . in a desired and ideal operation , such as that shown here , the total vapor entering the system is equal the vapor exiting the system via the casing valve 153 . the system is thus stable . however , casing vapor removal is constrained by pressure and pipe size . when vapor accumulates faster than it can be removed , this results vapor column build up , as shown in fig1 b and 1c . this vapor continuously accumulates in the annular space and pushes the dynamic fluid level ( dfl ) down ( see arrows ). eventually vapor builds up to a sufficient level as to cause “ gas blow through ,” as shown in fig1 d . in detailed explanation , when the vapor volume is large enough and the dfl is low enough ( dfl = 0 ), vapor breaks through into the pump 130 and production tubing 140 . as a result , fluid density in the tubing 140 reduces due to vapor or gas emulsions in the tube and pump load reduces . at this time , well - head pressure approaches the level of casing head pressure . even though the downhole pump is running , it runs idle , meaning little or no liquid is being “ pumped ” to the surface since the tubing is filled with mostly vapor or a gassy emulsion , resulting in a nf / lf event . in the case of an esp pump , the pump current ( amperage ) drops due to the low load . some downhole temperature change due to the joule thompson effect may also occur , associated with gas expansion or compression . the blow through is typically of short duration because the annular space volume is relative small , and typically the vapor accumulation rate is much lower than the blow through rate . thus , the pressure is quickly released . after the blow through , the tubing / casing annular space refills with reservoir fluids ( fig1 e ), which makes the dynamic fluid level rise and production flow eventually recovers . the reservoir fluid may flow into the wellbore with a velocity that may create a temporary bottom hole pressure surging . this may be explained as a result of fluid velocity momentum due to the fact that reservoir fluid is hydraulically connected to the wellbore , and is many times larger in size than the wellbore . it is also noted that when fluid is filling up the wellbore the fluid column density increases from the prior vapor blow through condition , and that well head and / or bottom hole temperature changes may be observed due to joule thompson effect . the gas column build up may start again , and the cycle repeats . a simplified vapor blow through model indexes are shown in fig2 for an esp pump case . as can be seen , when gas blow through occurs , the pump current drops although the pump frequency remains the same . this is because the vapor or gassy emulsion weighs less , which reduces the load on the pump , resulting in reduced current draw ( amperage ). also seen in fig2 , the casing well - head pressure remains the same . bottom hole or pump intake pressure increases when tubing fluid falls down and back to the annulus . another reason for bottom hole pressure to increase is the wellbore is recharged by reservoir fluid . once the blow though completed , a liquid fill - up stage occurs , wherein pump temperature and bottom hole temperature rise , fluid density in the tubing recovers and bottom hole pressure and pump intake pressure increase . this cycle could repeat at various rates , depending on the existing well conditions . for instance , cycle repeat can happen in hours for some high vapor wells , while in days or weeks for low vapor wells . it is also noted that the production rate also impacts the cycle period . the solution to the problem of vapor blow through is the installation of a vapor blow through avoidance system , discussed next . the system typically requires the following components : 1 . a casing gas remover ( cgr ), which can be a any type of compressor or multiphase pump , but preferably a casing gas blower ( cgb ) or an adjustable choke ( ac ), or both . the cgr is installed at e . g ., the well - head casing to reduce casing gas pressure , removing it to e . g ., the casing gas treater or other unit . 2 . a dynamic fluid level ( dfl ) detector ( dfld ) is installed at the well - head or downhole ( as appropriate ) that can detect the dfl . such detectors detect e . g ., the interface between vapor and liquid ( or a pseudo interface ) numerically representing dfl . alternatively , this dfl can be calculated based on the bottom hole pressure if fluid density can be well defined . other ways to calculate dfl include detecting fluid density profile by series of density sensor or pressure sensors . buoyancy , sound wave detector , optic , temperature or acoustic , resistance or capacitance and other methods could be used as well . either gradient , absolute value or their profile can be used to detect the dfl . 3 . a downhole pump , which could be any pump used for lifting the fluid . it is noted that since esp is used as example in this disclosure , amperage is the pump load indicator . as a skilled person knows for other types of pump , pump load is indicated as : rod pump by its load cell on rod , pcp ( progress cavity pump ) by rod torque and hydraulic pumps by their power fluid pressure . 4 . a control processor that collects the related data , performs the analysis , and directs the action of the cgr and the dhp as needed . dfl is continuously collected with the dfld and the processor compares the collected dfl with the dflt . the system can also diagnose if vapor blow through is happening via checking other related production and pump performance data and comparison with the model index in fig2 . however , vapor blow through should not occur if the vapor blow through avoidance system is operating correctly . the cgr rate and dhp rate are then adjusted as needed based on the following logic ( see also fig3 ): a . increase cgr rate , or reduce dhp rate as a second option , if gas column building up is detected to the pre - set criteria ( dfl & lt ; dflt ). c . keep cgr and the dhp rates constant if dfl remains stable at the target level dflt or within the target dflt range . importantly , removing casing gas will result in pressure reduction in the casing , which may further promote gas break out or steam flashing . thus , the rate of gas exit through the cgb or ac should be controlled so the pressure does not get too low . of course , the cgr should have enough power and throughput to be able to remove adequate vapor for practical ranges of casing pressure . the dflt can be adjusted or changed any time between each logic cycle . setting or changing the target dflt is based on : pump submergible height request considering reservoir productivity and to allow the least frequent changes of the cgb and the highest possible pump rate . typically , a suitable range of dfls will be set as the target dfl , thus minimizing the on / off cycling of the systems . the schematic of the entire system is shown by fig4 . in fig4 , the sagd chamber is 410 and it is fluidly connected to the casing liner ( slotted liner ) 420 . fluid enters pump 430 and is pumped to the surface via tubing 440 where it passes valve 443 on its way to e . g ., unit 445 . vapor floats and is trapped in the annular space between casing 450 and pump tubing 440 , past valve 453 to e . g ., gas treater 455 . casing gas remover 454 is operably coupled to the control processor ( herein represented symbolically with dotted lines ). the control processor is also operably connected to a dfl detector 457 and pump 430 . the control processor controls dfl primarily by activating the cgr , and secondarily by controlling the pump 430 . the cgr 454 can be an adjustable choke or a casing gas blower or both can be used . fig6 shows a system using both . a group well application is illustrated in fig5 ( three shown , but could be any number ). three wells are shown , each with a dfld , pump , and ac . common cgb is shown and is connected to common casing gas line , downstream of the individual lines . the control processor can be single or multiple , as desired , but a single processor is shown and is more cost effective . the processor is operably connected ( see dotted line ) to the dflds , pumps , acs and common cgb . the dflt is set individually for each specific well , and individual casing pressure is primarily controlled through the separate adjustable chokes ( ac ) installed on each gas casing . a larger cgb is installed and connected to the combined casing gas flow line for all three wells , and the cgb rate can be increased if the pressure is too high for the ac to function . the cgb should have sufficient horsepower and created sufficient pressure sink and rate for the combined wells . one advantage of this embodiment is cost savings , since multiple ac &# 39 ; s are used instead of multiple cgbs . the acs are passive , thus also saving energy costs over cgb use . a schematic of an alternate embodiment is shown in fig6 . in fig6 , the sagd chamber is 710 and it is fluidly connected to production tubing ( slotted liner ) 720 . fluid enters pump 730 and is pumped to the surface via tubing 740 where it passes valve 743 on its way to e . g ., unit 745 . gas floats and is trapped in the annular space between outer casing 750 and pump tubing 740 , past valve 753 to e . g ., gas treater 755 . cgb 754 and adjustable choke 756 are fluidly connected to the casing gas exit line and operably coupled to the control processor ( herein represented symbolically with dotted lines ). the control processor is also operably connected to a dfld 757 and pump 730 . the control processor controls dfl primarily by activating the ac , because this is a passive system not requiring energy . if needed , the cgb can be activated as a secondary control measure , and as a ternary option , the dhp speed can by changed by controlling the pump 730 . the process is applicable to any high gas content producing well , where gas disturbs pump performance . the producing well could be crude oil or gas well or any subsurface reservoir fluid producing well , including horizontal , vertical , deviated and cluster wells , for instance coal bed methane water removing well or sagd bitumen producing well . equipment and process control computer program can be further developed and manufactured based on this innovation . | 4 |
as shown in fig1 , a stable stand 30 supports an arm or armature component 16 , which in turn supports the impulse treatment device head 28 . arm 16 is slidably enclosed by sleeve 19 . the stand 10 can raise or lower the arm 16 by a large retractable piston or linear actuator 12 that is operator controlled . the arm 16 is mounted at the top of the stand &# 39 ; s piston 12 at a complex joint with three degrees of freedom , called the stand coupling 14 . the stand coupling 14 allows the arm 16 to rotate in a horizontal plane , creating a yaw angle . the transducer head can tilt in this direction but the arm cannot . last , the stand coupling 14 allows a tilt of the aim 16 off the horizontal plane , creating a roll angle . the aim 16 slides forward and back in sleeve 19 relative to the stand 10 . releasing a lock 21 allows arm 16 to rotate within sleeve 19 . a groove in arm 16 and a biased ball bearing in the interior cylindrical surface of sleeve 19 pauses arm 16 to encounter the resistance of having to move the ball bearing out of the groove in arm 16 when rotating arm 16 relative to sleeve 19 . a yoke 18 has two arm components , which curve around and attach to the device head 28 by means of dual pivot points 20 on either side of the device head 28 . the yoke 18 is supported by arm 16 . the yoke 18 is best seen in the top view of the apparatus in fig1 a . there is a manual locking mechanism 17 close to the pivot point 20 on one side of the device head 28 . a touch screen 26 at the top of the device head 28 displays a user interface which is used for device positioning and control . a collapsible stylus 30 protrudes from the device head 28 and its end point 34 is used to deliver impulses to a predetermined contact point 35 on a patient &# 39 ; s body 32 . the point of contact 35 may be the top or atlas vertebra , behind the ear , as shown in fig1 . the patient 32 is lying on a bed 44 and the desired contact point 35 is in a fixed location . the many components and degrees of freedom of the device head 28 mounting scheme described above in combination , allow positioning of the linear axis 36 of the device head 28 and collapsible stylus 30 in any direction in three dimensions ( 3d ), while simultaneously keeping the end of the stylus end 34 at a desired fixed location in 3d . for treatment , this fixed location is the contact point 35 on the patient 32 . at the time of treatment , the linear axis of the stylus is in any selected angle 36 in 3d , and this angle is calculated relative to the vertical direction 8 in the preferred embodiment . angular control is explained below . also shown on fig1 is a remote computer 40 , which may be in any location and is not necessarily close to the treatment area . patient data from x - rays and overlaid drawings or other drawings are digitized and input to the remote computer 40 by means of a graphics tablet 42 peripheral . calculations are made in the remote computer 40 on the raw data and operating parameters are derived . these parameters are sent to the spinal and upper cervical impulse treatment device by means of any data communications link 38 , such as a serial data link or wireless link . the types of links are not limited . with reference to fig2 , the device head 28 includes a shielded enclosure 62 or housing , designed to conform to emi standards . a power supply has been removed from the view in fig2 . the main components of the device head 28 are a controller 22 section , a transducer 24 section , and the collapsible stylus 30 . the controller section includes a touchscreen 26 , which displays a user interface and an electronics motherboard 70 ( see fig3 ). the transducer 24 section includes a voice actuator , a stepper motor and other parts to connect them to the collapsible stylus 30 . a linear voice coil actuator 52 is attached at the top of the collapsible stylus 30 axis and is used to deliver sinusoidal impulse waveforms along the collapsible stylus 30 linear axis . a large gear 54 holds the collapsible stylus 30 in position along its longitudinally extending axis . the large gear 54 is movable in the axial direction , allowing easy linear motion , but is rigid torsionally . a flexible belt 56 having a toothed surface on one side which engages the large gear 54 is driven by a rotational stepper motor which causes the flexible belt 56 to rotate through a precise angle to deliver a required amount of rotational motion to the collapsible stylus 30 during the time it contacts the patient . sensors are employed in conjunction with the movement of the belt to limit the angle through which the probe can move . a constant torque is provided by the stepper motor . the voice coil actuator is a precision audio component and is readily commercially available . fig3 illustrates additional components of the device head , as needed for an electronic device . an optional cooling fan 72 is shown on the right and a large heat sink 76 and power supply 74 are shown on the left . the large heat sink 76 is connected to the transducer frame 60 to dissipate transducer heat and it is connected to the power supply 74 , another heat source in the device . the heat sink is aluminum and relatively light for its size , but weight is not a major issue , since the device head is mounted on a fixed stand . the size of the heat sink enables excellent heat dissipation , which is a concern in a medical device . a controller 22 , comprised of a touchscreen 26 and electronics motherboard 70 , is shown at the top . components may appear in alternate locations in different device embodiments , although a shielded housing 62 will always be on the outside . the collapsible stylus 30 will always have a linear axis with a measured direction and this will most often be placed approximately along the centerline of the transducer 24 component . a safety coupling 64 is incorporated along the stylus 30 linear axis as shown in fig2 . the safety coupling 64 is an important component , for patient safety , since the patient contact point and stylus end 34 are both in fixed locations in space . the safety coupling allows the stylus to collapse by up to one inch under a moderate applied force in the linear axis , however , the force must exceed the normal treatment force . this safety coupling on the stylus is referred to as the ‘ collapsible stylus ’. the safety coupling 64 is shown in more detail in fig2 a . the stylus is comprised of two separate parts , namely an outer sleeve 79 , at the top of the safety coupling 64 , and a lower stylus tube 30 , which fits into the safety coupling sleeve 79 . the range of motion 66 of the stylus tube 30 in the sleeve 79 is approximately one inch and is sufficient to avoid injury due to sudden movements by the patient . the range of motion 66 is controlled by a guide pin 78 and slot arrangement , which are also visible in fig2 . the degree of force needed to cause stylus 30 to collapse is controlled by an o - ring 77 which presses three steel , balls 67 against the walls of the stylus tube . the three steel balls 67 are at 120 degree angles to one another , as shown in the horizontal cross - section of the o - ring on the right side of fig2 a . during normal operation , the three steel balls 67 press into three spherical indents 65 along the stylus tube 30 wall creating a firm contact , so that the sleeve 79 and stylus tube 30 move in tandem . a sufficient force will allow the three steel balls 67 to expand the o - ring 77 so that the balls pop out of the indents 65 . the stylus tube 30 then collapses upward into the safety coupling sleeve 79 which incorporates a hall effect sensor which senses the collapsed position and turns the machine off . the stylus tube 30 is reset manually by pulling on the stylus end 34 until the balls clicks into place . as an additional safety feature , arm 12 cannot be lowered any further into stand 10 once the stylus tube 30 has been collapsed . in addition , the collapsing of the stylus tube 30 shuts off the machine . another safety feature is a deadman switch 33 that is operated by the patient to stop the machine in the event of any malfunction . transducer 24 design within the spinal and upper cervical impulse treatment device is also aimed at greater accuracy and consistency of operation than available in known devices . voice coil actuators 52 and 58 are used for both linear and rotational movements , enabling greater accuracy . these components are selected for stability over a range of operating temperatures and may be calibrated at the time of manufacture . displacement sensors and precision clocks ( crystal oscillators ) may be used to monitor performance and make dynamic adjustments , as directed by the controller 22 , to ensure that calibration is maintained . sinusoidal waveforms are used for both linear and rotational impulses . a typical , sine wave 80 is shown in the top half of fig4 . the smooth nature of the curve is noted , in contrast to the abrupt , and imperfect square wave 82 below . the smooth sinusoidal waveform is judged to be superior for medical applications . the accepted industry technique for generating analog waveforms , and sinusoidal waveforms 80 in particular , is known as pulse width modulation ( pwm ). creation of analog waveforms using pwm and low pass filters is well known and well documented . many companies manufacture and sell controllers or microprocessors that incorporate waveform tables and supply cookbook descriptions of analog waveform generation . practical low pass filter circuits and their characteristics are included in the documentation . in brief , a high frequency digital output has its duty cycle modified to reflect an analog data value , like a point on a sine wave . this pwm pulse then travels through a low pass filter . the resultant signal carries the desired analog waveform , without use of a digital to analog converter ( dac ). the impulse frequencies sought in the current invention are low , and a simple one - stage low pass filter , comprised of a resistor and capacitor , is sufficient to obtain a sine wave 80 . complex waveforms may be derived from multiple frequencies and these are limited in practice only by the performance characteristics of the voice coil actuators . precision audio voice coils 52 and 58 will typically operate in the range of 20 hz to 40 khz , as designed for stereo equipment and any complex waveform in that range may be produced and implemented in the icid . the amplitude of the waveform is also selected by the practitioner and represents the impulse energy to be delivered during treatment . maximum amplitude 96 and high end frequency are set for safety purposes . at present , the latter is set at 200 hz . the sinusoidal waveform selected for the current invention increases linearly in frequency as a function of time , as shown in fig5 and 6 . because of its audio characteristic , this waveform is called a chirp . in the preferred embodiment of the invention , the chirp starts with one cycle at 50 hz 90 , followed by cycles at 51 hz 92 , 52 hz 93 , and so on up to 99 hz 98 and 100 hz 100 . at that time , the frequency resets to 50 hz and the process starts again . the result is a linear frequency ramp as a function of time , as shown in fig6 . with an average frequency of 75 hz , reset will occur every 0 . 67 sec . the number of pulses delivered depends on the pulse duration set by the practitioner . this is calculated and known before starting treatment . the frequency ramp in fig6 shows a large discontinuity 102 , but this does not appear on the actual impulse waveform applied to the patient . the breakout , diagram on the right illustrates that the discontinuity 102 is just a small change in the slope of the sine wave near the zero crossing , at the transition from 100 hz to 50 hz . to recap , the use of a controller and pwm approach allows the creation of any complex waveform less than the 40 khz range of the voice coil actuator . the selected waveform for the preferred embodiment of the invention is a linear frequency ramp or chirp , which cycles through 50 hz to 100 hz as shown in fig5 and 6 . square waves 82 will not be implemented in the current invention . a smooth sinusoidal waveform , like one with gradually increasing frequency , is viewed as an ideal impulse waveform for medical treatments . rotational impulses are also produced by a geared stepper motor . typically the angle of rotation will be small , but this is not limited by the stepper motor , but rather by limit switches incorporated into the rotational gear system . the stylus end in contact with the patient has a non - smooth surface , in order to apply the rotational force . the irregular stylus end will have a bar pattern , or cross hairs , or multiple small protrusions . the irregular surface will have smooth edges , as necessary for patient comfort . a means to measure direction in 3d is shown in fig7 . the linear axis 36 of the stylus is represented relative to the vertical direction 48 , which corresponds to the z axis on a conventional 3d cartesian co - ordinate system . at right angles to the vertical 48 , the conventional cartesian x and y axes are shown lying in the horizontal plane 104 . the direction of the patient bed 44 , and zero position and direction of all spinal and upper cervical impulse treatment device components , are known relative to the selected x , y , z co - ordinate system . the angular direction of the linear axis 36 is therefore uniquely defined in 3d by the angle from the vertical , alpha 106 , and a rotational angle from the x axis , beta 108 , in the horizontal plane 104 . a desired treatment angle is determined by a practitioner on the basis of morphological data such as x - rays , physical examination , other inputs , and considerable clinical experience . practitioners will record and track the efficacy of selected treatment angles across many patients and many situations . it is important to apply linear impulses at a correct treatment angle to obtain consistent results . the current invention includes “ data validation ” to improve reliability . the actual angle 36 of the linear axis of the collapsible stylus 30 is measured in near real - time , at microsecond intervals , by any common angular measurement device . for example , accelerometers measure angular direction relative to vertical . as shown in fig8 , the actual angle 36 of the linear axis of the stylus is compared to the preset treatment angle 110 , as defined by the practitioner . the measured linear axis angle 36 and the preset treatment angle 110 must be very close to one another before the device will start - delivering impulses . a maximum angular difference 112 is set by the device manufacturer and higher accuracy options are available to the practitioner . locking mechanisms are engaged when the correct angular direction is achieved . if the locks fail and angular alignment is lost , the device will stop operating immediately ( within microseconds ). this approach removes human error entirely from active treatment . care must still be taken in setup and automated setup improvement methods are described further below . the current invention overcomes shortcomings in previous devices by preventing operation when the angle of the stylus axis 36 is misaligned relative to the preset treatment , angle 110 . data validation has many elements . additional controls are imposed on the device . the time duration of impulses , or number of impulses to be delivered , is automatically controlled in the current invention . operation does not depend oh a human depressing and releasing a trigger , an approach that lacks accuracy and repeatability . data validation also pertains to selection of impulse energy or intensity . a maximum impulse energy or sine wave amplitude is built into the transducer and this can be reduced by the practitioner . maximum rotational angle is predefined . this is a minimum set of controls for the current invention . additional elements of data validation may be incorporated into the spinal and upper cervical impulse treatment device , based on experience by practitioners . for example , experience may show that certain frequencies have the best results in certain situations . extensions in data parameter input , and associated data validation , are within the expected embodiments of the device . the spinal and upper cervical impulse treatment device is comprised primarily of a touchscreen 26 input panel and electronics motherboard 70 . a controller will typically include a microprocessor and various input and output interfaces . as an alternative to the touchscreen 26 , the user input panel may be implemented as any convenient combination of display and input components , such as a regular lcd display and keypad , or any other display and input mechanisms , which provide a friendly user interface ( ui ). distinctive characteristics of the controller and input means of the spinal and upper cervical impulse treatment device include mounting on or near the device head , as shown in fig2 , as well as the friendly ui . by placing the controller 22 in the proximity of the transducer 24 , the current , invention ensures that the attention of the practitioner can be focused on the region of the device . this design is preferred to separation of the impulse transducer from its controller , with some displacement between these two components of the system , a situation where a practitioner &# 39 ; s attention is split across different regions of the system , and operational errors may occur . a user friendly interface via a touchscreen 26 is shown at the top of the device head 28 in fig1 a . the user interface is menu driven . there is a logical sequence to the functions displayed to the practitioner , to enable walk - through of the spinal and upper cervical impulse treatment device operational setup with relative ease . default parameter settings are allowed as appropriate within treatment protocols . final treatment parameter settings are to be displayed . changes may be applied to the setting . there is no need to follow a sequence to adjust settings . other means of device setup , such as automated data parameter input , are discussed next . automated data input is an optional but integral part of the spinal and upper cervical impulse treatment , device . a graphics tablet 42 is used to capture information from x - rays and overlaid , diagrams or other diagrams . the input is digitized , allowing the data to be manipulated by computer algorithms . an experienced practitioner has defined the calculations needed to produce the correct preset treatment angle 110 . this is matched by the actual angle 36 of the linear axis of the impulse stylus in three dimensions . other treatment parameters , such as linear and rotational impulse parameters , defining frequency and energy , are then added to fully define the spinal and upper cervical impulse treatment for a particular patient . all treatment data parameters are organized so that they may be interpreted by the spinal and upper cervical impulse treatment device 22 , data parameters are transferred from a remote computer to the spinal and upper cervical impulse treatment device by any standard communications link 38 , such as a serial link , or universal serial bus ( usb ) port , or wireless data link and the means of communications are not limited . there are several advantages to automated data input . first , it is more convenient to digitize data from a graphics tablet 42 , than to manually calculate and input numbers from a diagram . once data is in digital form , it can be manipulated by algorithms . data may be archived on a computer 40 , representing many patients and treatment situations . such historic data and data patterns can be applied to new situations to improve the efficacy of treatment protocols . once treatment parameters have been defined , these may be automatically compared to other data , as well as being reviewed by an experienced practitioner . thereafter , treatment parameters are applied by the spinal and upper cervical impulse treatment device , in an accurate and consistent manner , providing overall confidence in treatment protocols . the therapeutic application of the spinal and upper cervical impulse treatment device is described as a flow chart of operations in fig9 . a patient examination and consultation takes place at step 120 . at step 122 pre - treatment x - rays are taken as well as static measurements of pelvic / shoulder level and leg length discrepancy , using calipers on the body . data points of interest are marked on the graphics tablet , such as cervical tilt , head tilt and atlas position , relative to the skull and cervical spine . at step 124 , digitised data points are transferred from the graphics tablet to a computer . x - ray analysis is conducted in three dimensions using custom spinal and upper cervical impulse treatment software . at step 126 , data parameters for device operation are derived from the spinal and upper cervical impulse treatment software and data archives , including : ( a )— linear impulse frequency and duration , ( b )— linear impulse angle , ( c )— linear impulse force , and ( d )— rotational angle . data parameters are transferred to the spinal and upper cervical impulse treatment software , manually via touch - screen , or automatically via a serial data communications link at step 128 . at step 130 , impulse parameters are validated in the spinal , and upper cervical impulse treatment software , including maximum impulse force , frequency and duration . settings are displayed on the touchscreen 26 . at step 132 , whether the measured linear impulse angular direction is in close agreement with the preset treatment angular direction is tested . the allowed difference is preset . if correct alignment is not achieved , then the system goes to step 134 . if alignment is acceptable , then the system goes to step 136 . at step 134 , the angle of the stylus linear axis is adjusted to try to achieve correct alignment . the system then returns to step 132 . at step 136 , once angular alignment is achieved , the angle of the linear axis of the stylus is fixed or locked and the location of the stylus end is locked . the spinal and upper cervical impulse treatment transducer is then allowed to start operation . if angular alignment is lost , operation will cease . the calculations in steps 132 and 134 are ongoing during treatment . at step 138 , post spinal and upper cervical impulse treatment includes measurement of the impact of treatment on pelvic / shoulder unlevelling and leg length discrepancy , using body calipers . at step 140 , following review and recommendations , the patient &# 39 ; s next appointment is scheduled as needed . at step 142 , post - treatment , x - ray analysis is conducted after 5 weeks , to determine progress and the efficacy of the treatment . the assembly , generally referred to as 208 is shown in fig1 . the assembly includes a body imaging device 209 , for example , but not limited to , x - ray , magnetic resonance imaging ( mri ) or computed axial tomography ( ct ) machines . a treatment device includes an impulse delivery mechanism comprising a stylus used to deliver waveforms of various frequencies , and amplitudes , both linearly and rotationally to the vertebrae of the spine . a stable stand 210 supports an arm or armature component 216 , which in turn supports the impulse treatment device head 228 . arm 216 is slidably enclosed by sleeve 219 . the stand 210 can raise or lower the arm 216 by a large retractable piston or linear actuator 212 that is operator controlled . the arm 216 is mounted at the top of the stand &# 39 ; s piston 212 at a complex joint with three degrees of freedom , called the stand coupling 214 . the transducer head can tilt in this direction but the arm cannot . the stand coupling 214 allows a tilt of the arm 216 off the horizontal plane , creating a roll angle . the arm 216 slides forward and back in sleeve 219 relative to the stand 210 . releasing a lock 221 allows arm 216 to rotate within sleeve 219 . a groove in arm 216 and a biased ball bearing in the interior cylindrical surface of sleeve 219 causes arm 216 to encounter the resistance of having to move the ball bearing out of the groove in arm 216 when rotating arm 216 relative to sleeve 219 . a yoke 218 has two arm components , which curve around and attach to the device head 228 by means of dual pivot points 220 on either side of the device head 228 . the yoke 218 is supported by arm 216 . there is a manual locking mechanism 217 close to the pivot point 220 on one side of the device head 228 . a touch screen 226 at the top of the device head 228 displays a user interface which is used for device positioning and control . a collapsible stylus 230 protrudes from the device head 228 and its end point 234 is used to deliver impulses to a predetermined contact point 235 on a patient &# 39 ; s body 232 . the point of contact 235 may be the top or atlas vertebra , behind the ear , as shown in fig1 . the patient 232 is lying on a treatment bed 244 and the desired contact point 235 is in a fixed location . the many components and degrees of freedom of the device head 228 mounting scheme described above in combination , allow positioning of the linear axis 236 of the device head 228 and collapsible stylus 230 in any direction in three dimensions ( 3d ), while simultaneously keeping the end of the stylus end 234 at a desired fixed location in 3d . for treatment , this fixed location is the contact point 235 on the patient 232 . at the time of treatment , the linear axis of the stylus is in any selected angle 236 in 3d , and this angle is calculated relative to the vertical direction 208 in the preferred embodiment . also shown on fig1 is a remote computer 240 , which can be any processor , which may be in any location and is not necessarily close to the treatment area . patient data from x - rays and overlaid drawings or other drawings are digitized and input to the remote computer 240 by means of a graphics tablet 242 peripheral . calculations are made in the remote computer 240 on the raw data and operating parameters are derived . these parameters are sent to the spinal and upper cervical impulse treatment device by means of any data communications link 238 , such as a serial data link or wireless link . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a lumbar vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 5 pounds , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a thoracic vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 5 lbs , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 5 minutes , more preferably 10 minutes , and can be as long as 15 minutes . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a cervical vertebrae in the vicinity of the transverse process of the selected vertebrae — it need not be c1 . treatment will be at a force of less than about 5 lbs , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . large animals , for example , but not limited to , horses and cattle can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the hide of a patient adjacent a lumbar vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 9 pounds , preferably less than about 7 lbs , and most preferably less than about 5 lbs ( about 40 n , about 31 n and about 22 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 5 minutes , more preferably 10 minutes , and can be as long as 15 minutes . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . large animals , for example , but not limited to , horses and cattle can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the hide of a patient adjacent a thoracic vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 9 pounds , preferably less than about 7 lbs , and most preferably less than about 5 lbs ( about 40 n , about 31 n and about 22 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . large animals , for example , but not limited to , horses and cattle can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the hide of a patient adjacent a cervical vertebrae in the vicinity of the transverse process of the selected vertebrae — it need not be c1 . treatment will be at a force of less than about 9 pounds , preferably less than about 7 lbs , and most preferably less than about 5 lbs ( about 40 n , about 31 n and about 22 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . small animals , for example , but not limited to , dogs and cats , can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a lumbar vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 5 lbs , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . small animals , for example , but not limited to , dogs and cats , can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a thoracic vertebrae in the vicinity of the transverse process of the vertebrae . treatment will be at a force of less than about 5 lbs , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . small animals , for example , but not limited to , dogs and cats , can be treated using the method of the present technology . x - ray images or other images suitable for showing spinal alignment will be viewed prior to treatment . if images are not available , imaging will be conducted . a device having a stylus and a driver to generate a sinewave of about 5 hz to about 200 hz , more preferably about 8 hz to about 150 hz , still more preferably about 25 hz to about 100 hz and most preferably about 50 hz to about 100 hz will be located on the skin of a patient adjacent a cervical vertebrae in the vicinity of the transverse process of the selected vertebrae — it need not be c1 . treatment will be at a force of less than about 5 lbs , more preferably less than about 4 pounds and most preferably less than about 2 . 5 lbs ( about 22 n , about 18 n and about 11 n , respectively ). the average z - axis acceleration will be about 2 . 2 g , but can range from about 1 . 7 g to about 5 g , including 3 . 65 g . the treatment time will be at least about 2 minutes , more preferably 5 minutes , and can be as long as 10 minutes . treatment may involve one session , two sessions or multiple sessions . the results will show at least one of reduced pain , reduced disability , increased mobility and increased alignment . x - ray images or other images suitable for demonstrating spinal alignment will be used to determine whether or not the treatment results in increased spinal alignment . axial vibration was applied by placing individual discs into a chamber filled with cell culture medium . the lid on the chamber was fixed with a spring ( k = 26 . 2 n / cm ) that applied static axial load ( mean 40 . 6 n ) on the disks during the unconstrained vibration . the chamber had an ± 1 . 7 g accelerometer fixed to it to track the vibration load when the chamber was mounted to a voice coil . the accelerometer was previously calibrated . the vibration of the voice coil was controlled with the output of a linear current amplifier module which received its command signal from a function generator . the voice coil and chamber were secured with damping to a shelf in a 37 ° c . and 5 % co2 environmental control chamber . the control signal to the voice coil and the accelerometer output was monitored in real - time via an oscilloscope during the loading . vibration was applied at various frequencies ( 0 , 8 , 16 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 160 , 200 hz ) and amplitudes ( 0 - 0 . 54 g rms ) for either 10 or 60 minutes . the order of both amplitude and frequency selection was randomly assigned to eliminate any time - dependent trends due to sample storage . all conditions were run on a minimum of 5 separate discs ( from at least two different bovine tails ). the results indicated that frequency significantly affected expression of collagen type ii , decorin , and versican mrna . the regression slopes for each of these genes were not significant . amplitude significantly affected expression of biglycan , collagen type i , collagen type ii , decorin , and versican mrna . the regression slopes for these genes were significant and positive for all of these genes , with the exception of versican , which was not significant . in general , the results indicated a positive effect of axial vibration on extracellular matrix gene expression . most genes were at or above control levels for most frequencies and amplitude &# 39 ; s , with the notable exceptions of biglycan and versican . both of these genes exhibit complex expression patterns with high and low regions throughout the amplitude spectrum . regardless of frequency and amplitude , versican expression was reduced after 60 minutes of exposure . in general , it was concluded that the conditions that promoted nucleus pulposus gene expression were about 0 . 5 g , about 16 hz for half the time with a sweep from about 50 to about 80 hz for half the time for 10 minutes . vibration was applied by placing the stylus of the device disclosed in ca2005 / 000353 to khan et al . onto the sensitive region of a 450 n load cell that was fixed over the area of the spinous process of the center vertebrae of the 5 segment bovine tail . three dimensional ± 10 g accelerometers were mounted on a cube and aligned with the axes of the disc ( x - axial compression / tension , y - shear 90 deg out of alignment with applied load , z - shear parallel with applied load ) and glued to the bone using cyanoacrylate to track acceleration of both the loaded and adjacent vertebral bodies . the accelerometers were previously calibrated using a 1 g shaker plate . the voice coil mounted and producing the vibration from within the device was controlled with the output of a linear current amplifier module which received its command signal from a function generator . the current going to the voice coil and the accelerometer output was monitored in real - time via an oscilloscope during the loading . imparted mechanics vibration was tested at four different current values (˜ 0 . 9 - 1 . 9 amp driving current ). the testing vibration was applied at two static frequencies ( 0 or 16 hz ) and / or one sweep frequency ( 50 - 80 hz ) that would step up the frequency by 2 hz every two cycles of oscillation . each frequency treatment was applied for 10 minutes and one treatment alternated combined frequencies of 16 and 50 - 80 hz for 5 minutes each to maintain the overall 10 minute application . all amplitudes were sustained at 0 . 5 - 5 g peak root mean square [ rms ] of the vertebrae directly receiving the load . this is similar to current clinical treatments using the device , and corresponds to those stimuli eliciting peak responses in previous experiments . the order of control samples versus actual vibration samples was randomly assigned to eliminate any time - dependent trends due to sample storage . all conditions were run on a minimum of 6 separate discs ( from at least three different tails ). control discs were treated equally ( stored , handled , dissected , and snap - frozen ) in order to perform as true unloaded controls . the results showed non - significant changes in expression of collagen type i and increased expression of aggrecan , collagen type ii and versican . this suggests a potential beneficial effect of the current vibration loading pattern tested in the study . when compared to example 10 , it can be concluded that the placement of the stylus of the device on the vertebrae rather than providing unconstrained vibration to the vertebrae provides a further improvement in maintaining and potentially improving disc health through increased gene expression . on the basis of the results of this study and the clinical studies of spinal intervention , a suitable treatment for human patients was determined to be exposing at least one intervertebral disc to a repetitive sinewave impulse at a force of about 5 . 5 n to about 12 . 2 n , each sinewave impulse having an acceleration of about 0 . 5 g to about 5 g , at 16 hz followed by a sweep between about 50 to about 80 hz . the preferable treatment was at a force of 0 . 5 n with an acceleration of 0 . 5 g . the method is preferably effected using the treatment device disclosed in ca2005 / 000353 to khan et al . using saggital plane cervical x - rays , pre and post intervention mars were calculated for 44 patients with chronic neck pain . the study used a randomized , single blinded , and sham controlled design for comparisons of outcome measures . the intervention input was assessed using a load cell and vertebral acceleration and the outcome measures were : 1 . cervical mars , 2 . self - reported neck pain [ 11 - point scale ], 3 . neck disability index scores , 4 . psycho - social assessments for stress , anxiety , and depression . the device used was a spinal and upper cervical treatment device consisting of a controller mounted on top of an impulse delivery mechanism , or device head , which is mounted on a movable armature to a fixed stand . the device head generates waveforms [ sinewave at 50 - 110 hz ] and the stylus located at the base of the device head mechanically transduces the waveforms through the skin and ultimately to the spine , causing minor vibration of the vertebrae and minor repetitive stretching / activation of the attached soft tissues . the stylus amplitude is controlled by a touch screen setting called the “ intensity ” which ranges from 0 to 1 and controls the amplitude of current that is supplied to the stylus actuator . treatment is typically given at 0 . 5 and stylus imparted mechanics has been quantified using in situ bovine tail here in . patients in both groups were required to undergo treatment , either actual or sham , two or three times per week for a period of four to six weeks with each treatment lasting about 10 minutes . the preferred treatment was an acceleration of about 0 . 5 g to about 2 . 2 g , at a force of about 9 n to about 10 . 5 n and a frequency sweep from about 40 hz to about 120 hz for a period of about 30 seconds to about 5 minutes , with repeated individual treatments for 4 to 6 weeks . the more preferred treatment was an acceleration of about 0 . 5 g to about 1 . 5 g , at a force of about 9 . 5 n to about 10 . 4 n and a frequency sweep of about 45 hz to about 115 hz for a period of about 30 seconds to about 2 minutes . the most preferred treatment was an acceleration of about 0 . 5 g , at a force of 10 . 3 n , and a frequency sweep of about 50 to about 110 hz for a period of 30 sec to 2 min , with repeated individual treatments for 4 - 6 weeks . the treatment improved pain and neck disability scores significantly compared to sham controls , corrected 62 percent of abnormal mars with significantly larger mar vector magnitude differences [ pre - post ] at the c5 - c6 level than shams , and in patients without changes in mar locations , the treatment significantly improved neck disability scores above the sham group . mar correction was significantly related to improving both pain and neck disability across all subjects . hence the study provided biomechanical evidence of spinal “ re - alignment ” and its ability to improve both pain and neck disability . caliper measurements were used to determine alignment of the spine , by measuring the shoulder tilt and the hip tilt . as would be known to one skilled in the art , any means that allows a practitioner to assess tilt can be used , for example , but not limited to optical devices or a tape measure . a top skull x - ray image , a lateral x - ray image and a frontal x - ray image were taken to determine the location and orientation of the atlas . as would be known to one skilled in the art , any body imaging device that allows a practitioner to identify spinal vertebrae can be used , for example , but not limited to ct scans or mri . on the basis of the location and orientation , the physician determined the vector for treatment . for example , if the atlas is tilted up the treatment vector will be down . the vector can be determined manually , but preferably is determined with a suitable processor , for example , but not limited to a computer . the stylus can be placed in the general vicinity of the altas . he then ensured that the stylus angle was correct and positioned the stylus into position on the patient &# 39 ; s neck using the pen mark as a locator . the stylus is aligned along the treatment vector . the stylus caused a depression of approximately 2 mm below the skin surface and was on a bony landmark of the transverse process of the atlas , however , the stylus need not be placed on a bony landmark of the transverse process — it can be placed in the general vicinity of the altas . further , there may be more than one probe , for example two probes . the preferred device for the treatment is one that controls the location and angle of the stylus relative to the patient and provides a highly controlled impulse in the form of a sinusoidal wave . the preferred treatment was an acceleration of about 0 . 5 g to about 2 . 2 g , at a force of about 9 n to about 10 . 5 n and a frequency sweep from about 40 hz to about 120 hz for a period of about 30 seconds to about 5 minutes , with repeated treatments weekly , or every two weeks , or every three weeks or every month for 4 to 6 weeks or 6 to 8 weeks , or more , as needed . the more preferred treatment was an acceleration of about 0 . 5 g to about 1 . 5 g , at a force of about 9 . 5 n to about 10 . 4 n and a frequency sweep of about 45 hz to about 115 hz for a period of about 30 seconds to about 2 minutes . the most preferred treatment was an acceleration of about 0 . 5 g , at a force of 10 . 3 n , and a frequency sweep of about 50 to about 110 hz for a period of 30 sec to 2 min , with repeated individual treatments . the results showed at least one of an improvement of spinal alignment , a reduction in shoulder and / or hip tilt , a reduction in pain , a reduction in swelling and an improvement in mental health . the foregoing is a description of the technology . as would be known to one skilled in the art , variations are contemplated that do not alter the scope of the technology . | 0 |
the following description is of the best - contemplated mode of carrying out the invention . this description is made for the purpose of illustrating the general principles of the invention and should not be taken in a limiting sense . the scope of the invention is best determined by reference to the appended claims . fig3 shows an embodiment of a data receiver 300 according to the invention . the data receiver 300 comprises a data extractor 304 for sampling the equalized signal # d q and outputting an output value # d out . the data extractor 304 is also able to detect signal quality of the equalized signal # d q and accordingly adjust the boost value of equalizer 202 . in the embodiment , a boost value generator 412 is dedicated to provide the boost value . the boost value may be dynamically adjusted according to the signal quality detected by the data extractor 304 . the adjustment may be performed by various approaches . for example , the data extractor 304 may perform a calibration to directly determine an optimal boost value associated with the present cable . first , the boost value generator 412 recursively and incrementally issues various boost values to the equalizer 202 during an interval containing multiple symbol periods t p . the interval is used for calibration . the interval should contain sufficient symbol periods to get a meaningful result . in response to every incremental boost value , the data extractor 304 acquires corresponding quality information from the equalized signal # d q . basically , the estimated signal quality is proportional to the boost value , thus , the outcomes may organize a line of positive slope . when the signal quality is saturated no matter how the boost value increases , the boost value at the saturation point is deemed to be an optimal one . hence , the boost value generator 412 stops the incremental adjustment , and the equalizer 202 switches to normal mode and operates at the optimal boost value . in fig3 , the data extractor 304 uses an over sampler 404 to sample the equalized signal # d q , by which a plurality of sampled values # d s may be acquired per symbol period t p . the sampled values # d s are buffered in a buffer 406 for further analysis before an output value # d out is determined . the buffer 406 has a capacity to store a plurality of sampled values # d s correspondingly obtained from a plurality of consecutive symbol periods t p , and an edge detector 410 reads them to detect locations of transition edges of each symbol period t p . the equalizer 202 may use an inadequate boost value to equalize a distorted input signal # d in , rendering an unstable equalized signal # d q in which transition edges rapidly change throughout consecutive symbol periods t p . the more edge uncertainty increases , the shorter the hold time t h ′ where an output value is ensured valid . the edge detector 410 may determine the transition edges by comparing amplitude levels of two consecutive time points . for example , two sampled values # d s sampled before and after the transition edge may have significant amplitude difference . a transition edge can be deemed found when the amplitude difference between two consecutive sampled values # d s exceeds a predetermined threshold . the edge detection may also be accomplished by various conventional approaches , however , it is assumed that those skilled in the art are knowledgeable of these approaches , thus , detailed examples are not provided further . thereafter , the edge detector 410 sends a location signal # edge to the quality controller 408 , providing location information of the transition edges of every symbol period t p for further analysis . the quality controller 408 receives the location signal # edge , and accordingly selects one optimal sampled value # d as an output value # d out of a symbol period t p . specifically , the over sampler 404 is performing an over - sampling operation whereby the equalized signal # d q is sampled at different phases within each symbol period t p . for example , a symbol can be sampled at 5 different phases within one period to obtain 5 values of the equalized signal # d q . according to the location signal # edge , the quality controller selects one of the sampled values # d s to be the output value # d out , which is associated with a time point most close to the center of two transition edges within the symbol period t p . in other words , if the first and fifth sampled values # d s are deemed to be on the transition edges , the third sampled value # d s would be chosen to be the output value # d out . for the quality controller 408 , there is a current pointer p pointing to the optimal phase ( or time point ) within a sample period . the current pointer p could be determined by previous 4 sample periods ( s 0 , s 1 , s 2 , and s 3 ). during the next 4 sample periods ( s 0 ′, s 1 ′, s 2 ′, and s 3 ′), the quality controller 408 determines transition edges of the sample periods ( s 0 ′, s 1 ′, s 2 ′, and s 3 ′). the quality controller 408 also checks whether the current pointer p is pointing to the middle of each sample period of the 4 sample periods ( s 0 ′, s 1 ′, s 2 ′, and s 3 ′). if the pointer p is pointing to the left side of the middle point of a sample period , the quality controller 408 may determine that the pointer p should jump up to be more close to the middle point . conversely , if the pointer p is pointing to the right side of the middle point of a sample period , the quality controller 408 may determine that the pointer p should jump down to be more close to the middle point . in this embodiment , the quality controller 408 determines a jump up or jump down every 4 sample periods . jump ups or downs are represented by a pointer shift flag . the quality controller 408 records the total number of shifts ( jump ups or downs ) over a long period ( 1000 sample periods for example ). the more the number , the more frequently the pointer shifts . frequent pointer shifts means that the quality of the equalized signal is poor . the shifts should be as less as possible . by testing several transfer functions of the equalizer 202 , one can determine a best transfer function that results in minimum shifts . it means that the particular transfer function is the optimum choice to compensate the input signal d in . fig4 shows an embodiment of sampling an equalized signal # d q . a plurality of consecutive symbol periods t p is illustrated , in which distortions are represented as shadowed areas where sampled data is deemed invalid . four sampled values # d s are obtained correspondingly at five time points t 1 to t 4 in each symbol period t p , among which an optimal one would be selected as the output value # d out ( denoted as o 1 to o 4 ). in one symbol period t p , the time points t 1 to t 4 may be five equivalently distributed points . the output value # d out tends to be the most central one within the white area of each symbol period t p . other than that , amplitudes v 1 to v 4 of the output values # d out o 1 to o 4 may also be considered as references for signal quality . hence , the data extractor 304 sequentially receives and analyzes the equalized signals # d q and outputs corresponding output values # d out . alternatively , the over sampler may comprise five different samplers each tracking a different phase in the symbol period t p . the embodiment does not limit the implementation of the over sampler 404 . the optimal sampling point for the sample period s 0 is t 3 , which is denoted by o 1 . however , the current pointer p may point to t 4 . the pointer p is pointing to the right side of o 1 . therefore , for the sample period s 0 , it would be better to shift the current pointer p to t 3 , which is the optimal sampling point determined by the quality controller 408 . similarly , for the sample period s 1 , it would be better to shift the current pointer p to t 3 , which is the optimal sampling point determined by the quality controller 408 . after checking 4 sample periods ( s 0 - s 3 ), the quality controller 408 may determine to shift the current pointer p to t 3 , and then proceeds similar checking flow during the next 4 sample periods ( s 0 ′- s 3 ′). obtaining 5 sampling points for each sample period and checking 4 sample periods to decide to shift the current pointer are merely an example . one can determine the number of sampling points for each sample period and the number of sample periods to be checked according to different design requirements . fig5 is a more detailed embodiment of the data receiver 300 shown in fig3 . with reference to fig5 , an input signal # d in is distorted because of cable transmission . an equalizer 504 is used to compensate the distorted input signal # d in and generates an equalized ( compensated ) signal # d q . the equalizer 502 has several transfer functions for a boost value to select . the equalized signal # d q is determined by a selected transfer function . an over - sampling operation is performed by the k * n sampler 506 . in this embodiment k can be 4 and n can be 5 . a sample period of the equalized signal # d q is sampled at 5 ( k ) different phases within a single period . 4 ( n ) consecutive sample periods ( s 0 , st , s 2 , and s 3 ) will be sampled 20 times at 20 different phases . in this embodiment , 20 sampled values are produced before determining the quality of the equalized signal # d q . however , the sampling number ( k * n ) is not a limitation . one can determine the sampling number depending on different design requirements . the frequency of the input signal # d in can be , for example , 1 g hz . the clock frequency can be , for example , 100m hz . a pll or dll module 514 can produce 20 sampling signals fs , where each sampling signal fs has a phase shift relative to another sampling signal . the 20 sampling signals fs can be used by the k * n sampler 506 to sample 4 consecutive sample periods at 20 different phases and then produce 20 sampled values # d s . subsequently , the 20 sampled values # d s are input to a data pick up 508 . the data pick up 508 can be a buffer , which is corresponding to the buffer 406 in fig3 . the 20 sampled values # d s are then output as the output values # d out . a transition edge detection / shift decision module 510 also receives the 20 sampled values # d s . the transition edge detection / shift decision module 510 determines the edges of the 4 consecutive sample periods . a current pointer p is stored in the transition edge detection / shift decision module 510 . the current pointer p is determined by previous 4 consecutive sample periods . the transition edge detection / shift decision module 510 also determines the optimal sampling point for each sample period based on the 20 sampled values and the edges . the transition edge detection / shift decision module 510 compares the optimal sampling points ( denoted by o 1 - o 4 in fig4 ) with the current pointer p ( pointing to t 4 in fig4 ) and then determines whether to shift the current pointer p to a new position ( denoted by p ′ hereafter ). in the example given by fig4 , the current pointer p will shift left ( jump down ) to match the newly decided optimal sampling points o 1 - o 4 . the transition edge detection / shift decision module 510 sends shift instruction ( up / down ) to a digital loop filter & amp ; data pick - up pointer adjustment module 512 . the transition edge detection / shift decision module 510 also sends shift instruction ( up / down ) to an equalizer controller 504 . over a long period ( 1000 sample periods for example ), the equalizer controller 504 accumulates the number of shifts ( or jumps ) of the current pointer p . the accumulated number of shifts denotes the quality of the compensation performed by the equalizer 502 . the more the accumulated number , the worse the compensation is . then , based on the accumulated number , the equalizer controller 504 sends a boost value to the equalizer 502 to select another transfer function . the equalized signal # d q is determined by the newly selected transfer function and then a next round of quality determination process is performed . during the next 1000 sample periods , the quality of the newly selected transfer function will be examined to see whether the compensation is better . after certain rounds , a best compensation quality using an optimal transfer function of the equalizer 502 will be picked and the calibration is accomplished . the following input signal # d in can be compensated by the best transfer function the equalizer controller 504 could provide . the transition edge detection / shift decision module 510 and the digital loop filter & amp ; data pick - up pointer adjustment module 512 are examples of the quality controller 408 shown in fig3 . the equalizer 202 is an example of the boost value generator 412 . fig6 shows another embodiment of the data receiver 300 shown in fig3 . the embodiment is the same as that shown in fig5 except a transition edge detection module 610 and a shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 . part of the functions performed by the transition edge decision and shift decision / shift decision module 510 is moved to the shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 . in this embodiment , the transition edge detection module 610 only takes care of transition edge determination and sends the edge information to the shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 . the shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 does most of the work , including shift of the current pointer p and data pick - up pointer adjustment . the transition edge detection module 610 and the shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 do the same thing as the combination of the transition edge detection / shift decision module 510 and the digital loop filter & amp ; data pick - up pointer adjustment module 512 . the transition edge detection module 610 and the shift decision & amp ; digital loop filter & amp ; data pick - up pointer adjustment module 612 are also examples of the quality controller 408 shown in fig3 . any portions of functions can be separately or integrally performed by a specific module . this is merely variations of the invention . while the invention has been described by way of example and in terms of preferred embodiment , it is to be understood that the invention is not limited thereto . to the contrary , it is intended to cover various modifications and similar arrangements ( as would be apparent to those skilled in the art ). therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements . | 7 |
a substance 11 , which emerges for example from the column of a liquid chromatograph ( not shown ) and is dissolved in a solvent 10 , is collected in a relatively large - capacity collecting vessel 12 . the latter has a receiving capacity of at least approximately 1 cm 3 . the solvent 10 is then evaporated in the said collecting vessel 12 so that the substance 11 , which is to be analysed for example in a mass spectrometer ( not shown ) is left as a residue in the collecting vessel 12 . a sample holder 13 of relatively small dimensions is arranged inside the collecting vessel 12 or forms a part thereof . the design of the said sample holder 13 and its position relative to the collecting vessel 12 are such that , when or after the solvent 10 is evaporated , the substance 11 is left as a residue in or on the sample holder 13 . the said sample holder can then be introduced directly into the mass spectrometer or into an ionisation chamber thereof . in the exemplary embodiment according to fig1 the lower section of the collecting vessel 12 is funnel - shaped as a result of having a converging inner bottom face 14 . at the lowest point on the bottom face 14 , which point is central in the present case , the collecting vessel 12 forms an opening 15 . the sample holder 13 fits into the said opening in such a way that the bottom face 14 is completed by the upper side of the sample holder 13 . in the exemplary embodiment according to fig1 and 2 , the funnel - shaped bottom face 14 is continued in a likewise funnel - shaped recess 16 on the upper side of the sample holder 13 . as a result , in the arrangement according to fig1 the lower part of the interior of the collecting vessel 12 is generally funnel - shaped in such a way that , upon evaporation of the solvent 10 , the substance 11 automatically collects in the area of the recess 16 and therefore at the desired place on the sample holder 13 . as a result of the recess 16 , the said sample holder acts in principle like a known crucible for further processes , i . e . like a sample holder having a recess for receiving the substance . in the alternative according to fig3 the sample holder 13 is of substantially flat form in the section receiving the substance 11 . the sample holder 13 acts in this case as a plate 17 which , however , similarly to the exemplary embodiment according to fig1 and 2 , is adjacent to the bottom face 14 of the collecting vessel 12 in the area of the lowest point thereon . similary , the sample holder according to fig4 is attached to a collecting vessel 12 in such a way that a wire 18 , which is in the form of a loop , spiral or of similar design , projects into the collecting vessel 12 . in this case also , the arrangement relative to the collecting vessel 12 is such that the substance 11 collects at or on the wire 18 upon evaporation of the solvent 10 . therefore , virtually all the known conventional types of sample holders can be used in the described sense when they are correspondingly designed . this makes it also possible to use various ( known ) ionisation processes . for example , the wire 18 can be heated ( electrically ) in order that the sample may be evaporated in the ionisation chamber in this way . such a solution ( heatisng for evaporation ) can also be implemented with regard to the sample holders 13 according to fig1 to 3 . however , through &# 34 ; activation &# 34 ; the wire 18 can also be provided with a large number of tips which make it possible to carry out field desorption as an ionisation process . the sample holders 13 are designed so that they can be positively connected to and fitted on the collecting vessel 12 in the area of the opening 15 . for this purpose the sample holders 13 shown in this case are provided with a projection 19 which is limited by a ledge and which fits into the correspondingly formed opening 15 of the collecting vessel 12 . a shoulder 20 , which is connected to the said projection , on the sample holder 13 abuts on the flat underside of the collecting vessel 12 . moreover , the collecting vessel 12 and the sample holder 13 also can be made of different materials in such a way that they are optimally adapted to each field of used . the collecting vessels 12 which are designed in the manner described can be used particularly for the automatic transfer of samples using magazines . an example of a suitable sample magazine 21 is illustrated in fig5 to 8 . the sample magazine 21 is in the present case in the form of a rotating disc . the collecting vessels 12 are received in an upper magazine disc 22 . for this purpose , the said magazine disc is provided along its periphery with suitable holders in the form of through - holes 23 , each serving to receive a collecting vessel 12 . the upper sections of the collecting vessel 12 are provided for this purpose with supporting flanges 24 which rest on the magazine disc 22 . the collecting vessels 12 pass through the magazine disc 22 in such a manner that , in the starting position ( fig5 ), the sample holders 13 rest on a second lower magazine disc 25 . the position of the magazine discs 22 and 25 relative to one another is such that collecting vessels 12 and sample holders 13 are kept in a sealing contact with one another . the lower magazine disc 25 is provided for this purpose with cup - shaped recesses 26 which correspond to the holes 23 of the magazine disc 22 . the lower parts of the sample holders 13 are received in the recesses 26 , that is , while being supported on a flexible base which in this case is in the form of a compression spring 27 . in the starting position according to fig5 the liquid ( solvent and substance ) emerging from an lc is introduced into the collecting vessels 12 by a filling device 28 connected to the lc . for this purpose the sample magazine 21 is rotated cyclically by a stepping motor 29 which acts on a driving shaft 30 carrying the magazine discs 22 and 25 . the filling device 28 , which is pivotably mounted on a supporting column 31 , is in this case pivoted into a position above the magazine discs 22 , 25 . after the collecting vessels 12 of the sample magazine 21 are filled , the filling device 28 is pivoted into a lateral position ( fig6 ). then the upper magazine disc 22 is moved upwards , i . e . is separated from the lower magazine disc 25 . as a result , the collecting vessels 12 are separated from the sample holders 13 retained on the magazine disc 25 . the sample holders 13 provided with the samples can now be appropriately removed from the sample magazine 21 , namely the magazine disc 25 . the sample magazine 21 , namely the upper magazine disc 22 , can be heated . a heating system 32 , ( electrical heating or a flowing heating medium ), which is arranged in the area of the outer periphery and extends around the magazine disc , is provided in the present exemplary embodiment . the said heating system causes the solvent 10 to be evaporated or the evaporation to be accelerated . | 6 |
with reference to the accompanying drawings in which like numerals indicate like elements , fig1 shows a portable commode with lift assist seat which is generally indicated by the numeral 10 . the portable commode 10 of fig1 generally has a floor stand 12 which as shown in the drawings is self - supporting and free standing on four legs , and a seat assembly 14 . the floor stand 12 further has four upright legs including two front legs 22 and two rear legs 24 . a side brace 26 connects each front leg to a corresponding rear leg , a first cross - brace 28 interconnects the side braces , and a second cross brace 29 connects the rear legs to each other , giving structural rigidity to the floor stand . the stand has two opposite sides , each side made up of a front leg , a rear leg and a side brace . the legs and braces are preferably made of lightweight aluminum tubing in order to maintain a low overall weight of the commode 10 . seat assembly 14 includes a seat frame 31 having a generally u - shaped element 30 which has two side portions 32 connected by a rear cross - portion 34 , and two front ends 36 . the side portions 32 are also connected by a front cross - brace 38 . the seat assembly also includes a generally annular seat 40 having a central opening 42 . the seat 40 is securely mounted on the seat frame 31 between the rear cross - portion 34 and the front cross - brace 38 by suitable fasteners , not shown in the figure . the rear legs 24 extend upwardly above the seat 40 and are bent to a generally horizontal position to define an armrest 41 on each side of the seat , which may be grasped by an infirm user for support and balance while lowering himself or herself onto the seat 40 or while rising therefrom . the rear legs 24 and arm rests 41 are defined by a continuous length of tubing , and each arm rest is a generally horizontal portion of the continuous length , terminating in a free end 43 . in the depicted embodiment of the invention , the arm rests 41 are consequently supported only on the rear legs 24 . each front end 36 of the seat frame is connected by a bolt 44 and nut 46 , as shown in fig5 to the top end 48 of a corresponding front leg 22 to form two hinges 52 connecting the seat assembly to the floor stand . the rear cross - brace of the seat assembly is supported on the second cross - brace of the floor stand in a lowered or depressed condition of the seat assembly illustrated in fig3 such that the body weight of a person seated on seat 40 in this condition is carried by the four legs of the floor stand . the commode 10 has a pair of pneumatic springs 50 each of which has a lower end 54 and an upper end 56 . as shown in the drawings , the preferred pneumatic springs 50 are self - contained and are not connected to any external source of power . each lower end is pivotably connected to the floor stand 12 , specifically , at the junction of the side brace 26 and the rear leg 24 . the upper end of each spring is connected to the seat frame 31 by means of a pivot assembly 58 depicted in detail in fig6 . the pivot assembly 58 has a pivot bolt 62 extending transversely to the longitudinal dimension of the spring 50 and passing through an attachment hole 64 in a plate 66 which is affixed as by welding along the underside of each side portion 32 of the seat frame 31 . a nut 63 threaded on the bolt 62 secures the pivot connection . the two springs 50 are selected so that in a fully extended condition of the two springs the seat assembly is lifted to a forwardly tilted position illustrated in fig1 and 4 , with the rear 43 of the seat 40 elevated at approximately a 45 degree angle relative to its aforementioned depressed , generally horizontal position of fig3 . the plate 66 is perforated with a series of such attachment holes 64 evenly spaced apart in a direction generally towards and away from the hinge line defined by hinges 52 . that is , the attachment holes 64 lie along a line which is transverse and approximately radial to that hinge line . each hole 64 defines an attachment point for the upper end of the corresponding spring so . in effect , the different attachment points provide a range of leverage factors by which the force of the springs 50 acting on the seat assembly 14 can be selectively modified . the effective spring force is the actual expansion force of the springs 50 compressed between the floor stand 12 and the seat assembly 14 , adjusted for the leverage effect of the selected attachment point along the plates 66 . in general , the effective spring force acting to lift the seat 40 increases as the attachment point is displaced away from the hinges 52 towards the rear of the seat , and conversely is at its minimum when the upper ends of the springs 50 are connected at the holes 64 closest to the hinges . as shown in fig3 and 4 , the attachment points are sufficiently spaced away from the hinge connection 52 of the stationary lower portion of the tubular frame with the seat frame 14 so that when installed at the attachment point nearest to the hinge the pneumatic springs 50 will provide the aforementioned effective spring force is obtained at any of the attachment points 64 of the springs 50 . furthermore , it will be seen from fig3 and 4 that the angle of the spring 50 remains approximately the same during the lifting of the seat assembly 14 from the generally horizontal position of fig3 to the elevated position in fig4 . the springs 50 are selected to provide an effective spring force normally urging the seat assembly upwardly towards its elevated , tilted position with sufficient spring force to support and carry a significant portion of the body weight of an intended infirm user of the commode 10 . the effective lifting force of the seat 40 can therefore be adjusted by repositioning the attachment point of the springs between the floor stand and the seat assembly , to suit the needs of a particular user . a greater or lesser degree of lift assist to the user can be provided by appropriate adjustment of the spring connections . it will be appreciated that an equivalent range of leverage factors can be achieved by providing a series of attachment points for the lower ends 54 of the springs 50 while providing a single pivotable attachment point for the upper ends 56 . the commode of fig1 is configured as a self - contained portable toilet by providing an on - board waste receptacle 70 supported under the central seat opening 42 between the first and second cross - braces of the floor stand on mounting flanges 72 , 74 which are best seen in fig4 . the receptacle 70 is removable from the commode for waste disposal and cleaning . it will be appreciated that the waste of receptacle 70 is supported on the stationary portion of the floor stand , and does not lift with the seat assembly 14 . in this configuration the commode is suited for use where a nearby bathroom is not available or the condition of the user is such that a toilet closely adjacent to a bed is needed . removal of the waste receptacle 70 configures the commode 10 for use with a conventional toilet fixture in an existing bathroom . the width of the commode measured between the opposite sides and the height of at least the second cross - brace 29 , and preferably both first and second cross - braces 28 , 29 , are such as to span the bowl b of a conventional toilet fixture f as illustrated in fig2 . the rear legs 24 are spaced apart to admit the width of the bowl b while the height of the second cross - brace 29 admits the height of the same bowl into position between the opposite sides of the floor stand and under the central opening 42 of the seat 40 , as illustrated in fig2 . springs other than pneumatic springs can be used with the commode 10 , including mechanical springs such as coil springs , or hydraulic springs . it must be understood that these and other changes , modifications and substitutions to the preferred embodiment , which has been described and illustrated for purposes of clarity and example , will be apparent to those having ordinary skill in the art without thereby departing from the scope and spirit of the present invention , which is defined by the following claims . | 0 |
the various aspects of the present invention provide methods for preparing bcc , the latter being represented by the formula ( cuco 3 ) x ( cu ( oh ) 2 ) y , wherein x & gt ; 0 and y & gt ; 0 . desirably , in this formula , when y is 1 , x may be 1 or 2 , may range from about 0 . 95 to less than 1 or to 1 , and , more desirably , x is 1 or 2 when y is 1 . more than one species of bcc may be prepared by the inventive methods . for example , malachite ( cu 2 ( oh ) 2 co 3 , wherein x and y are 1 in the formula ) or azurite ( cu 3 ( oh ) 2 ( co 3 ) 2 , wherein x is 2 and y is 1 in the formula ) may be prepared , as may mixtures thereof . in one aspect , the invention provides a method of preparing bcc comprising : ( a ) providing a solution of copper ( ii ) in a reaction vessel , the solution comprising copper ( ii ), an amine , carbonic acid , and water , adjusting the ph of the solution until bcc is provided ; and recovering the bcc . the foregoing method may be practiced in any suitable reaction vessel , e . g ., a spray chamber , a stirred tank reactor , a rotating tube reactor , or a pipeline reactor , in either a continuous or batch process . it is desirable to practice the method as a continuous process , more desirably using a continuous stirred tank reactor . the type of reaction vessel may influence the morphology of the bcc formed therein , such as particle size and particle shape . for example , a constantly stirred tank reactor ( cstr ) tends to provide fairly uniform spherical agglomerated bcc particles , whereas a rotary evaporator - type reactor , as exemplified in u . s . pat . no . 4 , 686 , 003 , produces more rod - like bcc particles . thus , bcc particle size and shape may be influenced in connection with the inventive method via appropriate reactor vessel selection . the particle size of bcc may also be controlled by varying the concentrations of copper ( ii ) and ammonia in the solution , as well as by regulating the input rate of copper solution and / or co 2 into the reaction vessel , and / or the endpoint of the precipitation reaction . the particle size may also be controlled by other process parameters , such as residence time or temperature . in the solution provided in the reaction vessel , or feed solution , the copper ( ii ) included therein may originate from any suitable source . in practice , a typical copper ( ii )- containing feed stream contains ammonia , water , carbonic acid , and other components . a typical feed stream will include components , in certain amounts , as follows : copper ( ii ), from about 10 g / l to about 160 g / l , desirably from about 70 g / l to about 105 g / l ; water ; ammonia , from about 3 g / l to about 110 g / l , desirably from about 50 g / l to about 90 g / l ; and ammonia to copper ( ii ) molar ratio from about 2 . 5 to about 3 . 3 , desirably from about 2 . 8 to about 3 . 1 ; and carbonic acid from about 15 g / l to about 130 g / l , desirably from about 95 g / l to about 110 g / l . generally , as the content of the feed stream is known , one skilled in the art should be able to create the feed stream with the amount of each component needed to be present in the reaction vessel to practice the inventive methods . in the aspect of the invention that involves introducing a copper metal - containing material into a copper ( ii )- depleted solvent system to provide an enriched copper ( ii ) solution , an additional amount of an amine may be added to assist in solubilizing the copper metal in the aqueous medium . the amine is desirably ammonia ( which exists in the aqueous medium in equilibrium with ammonium hydroxide ). the amount required to effect this dissolution will vary , but will generally range from about 0 . 5 : 1 to about 4 : 1 , and desirably from about 1 : 1 to about 2 : 1 , moles of amine to moles of copper metal . on an absolute basis , the amount of amine in the aqueous solution is desirably limited , ranging from about 15 g / l to about 105 g / l , and more desirably from about 60 g / l to about 96 g / l , of nh 3 . in general , as the pressure in the reactor vessel increases , the allowable amine concentration may be increased . the carbonic acid may be provided in the reaction vessel by any suitable means , but is preferably provided by introducing co 2 into the reaction vessel , e . g ., by bubbling co 2 through the aqueous solution , or by providing a relative increase in the partial pressure of co 2 within the reaction vessel . as used herein , the term carbonic acid includes carbonic acid as well as bicarbonate and carbonate ions , as it will be appreciated by one of ordinary skill in reading this disclosure that all of these species may be present when co 2 is introduced into the aqueous solution . following precipitation and separation of the solids , it may be necessary to reduce the carbonate level , or increase the ph , in the solution to provide a suitable solution for copper leaching . this can be accomplished by reducing the partial pressure of co 2 in the vessel , or nominally through a reduction of the total pressure within the reaction vessel . the relationship between the components in the system , while not being bound by theory , may be simplistically explained in terms of an equation : [ cu 2 + ] n [ oh − ] m [ co 3 2 − ] p = k sp , wherein n , m , and p are greater than 0 , and k sp is a solubility product for bcc . when the product of certain ionic concentrations exceed the solubility constant for bcc ( i . e ., k sp ) bcc will precipitate out of the solution . not shown in the k sp equation is the solvating ligand ammonia that influences the concentration of copper ions available for bonding . in the inventive methods , selectively increasing the concentration of one or more of copper ( ii ), hydroxide ions or carbonate ions , or decreasing the ammonia concentration may be sufficient to cause bcc to precipitate from the solution . for this invention addition of the co 2 also adjusts the ph of the solution in order to precipitate bcc . in this regard , the ph of the solution is desirably relatively low , for example less than about 10 , during the formation of bcc . more desirably , the ph may range from about 7 to about 10 , preferably from about 7 to about 9 , and more preferably from about 7 to about 8 . preferably , the ph of the solution is adjusted by the introduction and removal of co 2 from the reaction vessel . one of the advantages of the inventive methods is that bcc may be obtained from copper ( ii )- containing solutions using less energy relative to known methods . while the methods may be carried out at any suitable temperature , e . g ., from about 25 ° c . to the boiling point of the solution , it is desirable that a limited amount or no heat need be added to the solution during the formation of the bcc . for example , the methods desirably contemplate maintaining the temperature of the solution from about 15 ° c . to about 100 ° c . more desirably from about 21 ° c . to about 82 ° c ., and even more desirably from about 38 ° c . to about 79 ° c . preferably , the temperature of the solution may range from about 60 ° c . to about 77 ° c . the preparation of azurite , malachite or a mixture thereof may be controlled by controlling the temperature of the solution in the reaction vessel . more specifically , azurite is provided in relatively greater quantities when the temperature of the solution is relatively low , while malachite is provided in relatively greater quantities when the temperature of the solution is relatively high . while these temperatures may vary depending on the operating pressure in the reaction vessel , at 100 psig pressure the temperature of the solution to provide azurite is desirably between about 4 ° c . and about 71 ° c ., and more desirably between about 38 ° c . and about 68 ° c . ; to provide malachite the temperature is desirably between about 65 ° c . and about boiling , and more desirably between about 68 ° c . and about 79 ° c ., and to provide a mixture the temperature of the solution is desirably between about 65 ° c . and about 71 ° c ., and more desirably between about 65 ° c . and about 68 ° c . at relatively lower pressures , the temperature ranges will be relatively lower than those disclosed above . while the preparation of bcc may be carried while the reaction vessel is at ambient pressure , it may be desirable to increase the pressure in the reaction vessel in order to increase the yield per liter of feed solution . if desired , the pressure in the reaction vessel may desirably range from about 0 psig to about 1500 psig , more desirably range from about 0 psig to about 300 psig , and preferably range from about 50 psig to about 200 psig . in a related aspect , the inventive methods provide for the preparation of bcc by the introduction of a copper metal - containing material into a solution of copper ( ii ), the solution comprising copper ( ii ), an amine , carbonic acid , and water . illustrative of suitable copper materials are copper metal , bronze , copper - containing plastics , alloys , compounds , and clads . the aforesaid copper ( ii ) solution includes a relatively low concentration of copper ( ii ) therein , as it is preferably the solvent system which remains after a copper ( ii ) solution having a relatively high copper ( ii ) concentration has been processed in accordance with the methods described herein to provide bcc . the copper in the aforementioned copper - containing solution is oxidized prior to introduction into the primary reaction vessel . oxygen , and more desirably , air , is used as the oxidizer . the conditions under which oxidation will occur are well known to those skilled in the art . desirably , and prior to introduction into the reaction vessel , the copper metal - containing material is dissolved in a copper ( ii )- depleted solvent system comprising an amine to provide a solution which contains a relatively high concentration of copper ( ii ), which is preferably at least 88 g / l , more preferably at least 92 g / l , and most preferably at least 96 g / l copper ( ii ). desirably , the ammonia concentration ranges from about 60 g / l to about 96 g / l , and the primary reaction vessel is at about 50 psig to about 200 psig , wherein this copper ( ii ) replenished solution is then introduced into the primary reaction vessel wherein bcc is formed . desirably , the methods of the invention contemplate that , in the reaction vessel , the molar ratio of ammonia to copper ( ii ) ranges from about 2 . 6 to about 3 . 9 ; the temperature of the solution in the reaction vessel ranges from about 20 ° c . to near boiling ; and the pressure in the reaction vessel ranges from about 0 psig to about 1500 psig . more desirably , in the reaction vessel , the molar ratio of ammonia to copper ( ii ) in the solution ranges from about 2 . 7 to about 3 . 8 ; the temperature of the solution in the reaction vessel ranges from about 48 ° c . to about 80 ° c . ; and the pressure in the reaction vessel ranges from about 20 psig to about 500 psig . preferably , in the reaction vessel , the molar ratio of ammonia to copper ( ii ) ranges from about 2 . 7 to about 3 . 2 ; the temperature of the solution in the reaction vessel ranges from about 60 ° c . to about 75 ° c . ; and the pressure in the reaction vessel ranges from about 80 psig to about 250 psig . as mentioned previously , an aspect of the inventive methods desirably provides a means for the continuous preparation of bcc . fig1 is a schematic diagram which provides an exemplary operational flow of a method of providing bcc in according with this aspect of the invention . referring to this figure , the method includes processing stages which may be referred to as precipitation 1 , filtration 3 , co 2 separation 5 , and leaching 7 . in the precipitation process , bcc is formed and precipitated from an aqueous solution comprising copper ( ii ), ammonia , and carbonic acid ( provided via the introduction of co 2 2 , as described herein ), as described in more detail herein . after bcc formation is completed , the solution may be filtered 3 to recover the bcc 4 . the filtration process contemplated by the invention may be performed by any suitable means , but is desirably performed under pressure ( e . g ., between about 1 psig and about 1500 psig ) to prevent the desorption of co 2 , the latter potentially causing solids to re - dissolve in the solvent solution . further , filtration under pressure ( above ambient ) may prevent the solids from agglomerating at the bottom of the filter . after filtration is completed , the copper ( ii )- depleted solvent desirably may be degassed to remove excess co 2 by boiling for a designated time in a vessel equipped with a condenser ( to collect the distillate ). alternatively , or in addition , co 2 may be removed by air stripping or pressure reduction . the co 2 removed by degassing may be reused by recycling 6 it back to the precipitation vessel 1 . the copper ( ii )- depleted solvent may then be used in a leaching / oxidation process 7 to obtain a replenished copper ( ii ) solution , which solution then may be recycled and utilized in the method described herein ( to provide bcc ). as this method provides for continuous processing in a closed loop , waste production is minimized and lower energy consumption is achieved . the exemplary continuous processing illustrated in fig1 is provided as one possible embodiment of the inventive method , and may be modified as desired . for example , the replenished copper ( ii ) solution may be diluted with water prior to its use in the method in order to restore an appropriate solution concentration . also , after bcc is formed , and prior to filtration , the resultant slurry may be subjected to a thickening process . additionally , after the copper metal is added to the copper ( ii )- depleted solvent system ( after the leaching process ), the resulting aqueous solution may be oxidized to obtain a solution having a relatively higher amount of copper ( ii ) ( for example , higher than 1 g / l ) and a lower amount of copper ( i ) ( for example , lower than 1 g / l ). the solution may also be heated after this oxidizing process to control the temperature of the solution as desired , which would permit some control over the type of bcc formed using the method , as described herein . this temperature control also may be implemented after oxidation , or at a different processing juncture , e . g ., prior to and / or during the precipitation process . the inventive method also contemplates preparing bcc by contacting copper metal with an aqueous solution comprising an amine , carbonic acid ( which may be present as a carbonate , as described herein ), and oxygen under conditions where the copper metal is converted into bcc ; and recovering the bcc . the invention further contemplates a method of forming bcc comprising the steps of providing copper ( ii ) hydroxide in an aqueous solution comprising an amine and a sufficient amount of carbonic acid to convert at least one fourth of the copper hydroxide to bcc ; under conditions where the copper hydroxide is converted to bcc ; and recovering the bcc . in this aspect of the invention , the amine is desirably ammonium hydroxide , and the copper hydroxide is desirably formed by contacting copper metal with an oxidant and an aqueous solution comprising ammonium hydroxide under conditions that the copper metal is converted to copper ( ii ) hydroxide . those skilled in the art will appreciate that copper ( ii ) hydroxide may be formed when the solution has a high concentration of hydroxide ions relative to carbonate ions , and that the copper ( ii ) hydroxide is disassociated in the presence of water , providing copper ( ii ) ions in the aqueous solution . desirably , the solution may contain from about 0 . 1 gram to 15 grams of soluble copper ions per liter of soluble copper . the following examples further illustrate the invention but , of course , should not be construed as in any way limiting its scope . this example demonstrates production of bcc by reducing the ph of a plant solution left from caustic boil production of bcc and containing copper ( ii ), ammonia and co 2 . 3 l of an aqueous solution containing 48 g / l co 2 , 48 g / l nh 3 , 54 g / l copper ( ii ), and at a ph of 10 were added to a stoppered erlenmeyer flask whose side - arm was open to the atmosphere ; the stopper held a gas dispersion tube connected to a source of co 2 gas , and a thermometer . the starting temperature was 22 . 9 ° c . co 2 gas was bubbled into the solution at a rate of 0 . 5 lpm , with constant mixing . at 1 . 5 hours , the ph was 8 . 07 and the temperature had risen to 31 . 1 ° c . ; solids started to form . after 3 . 5 hours , 10 g of blue solids were collected by filtration . the remaining solution had a ph of 7 . 7 and a temperature of 29 . 7 ° c ., and contained 94 g / l co 2 , 47 g / l nh 3 , and 49 g / l copper ( ii ). the collected solids constituted 53 . 84 % copper determined by electrogravimetry , 24 . 38 % co 2 determined by differential pressure , and 0 . 68 % nh 3 determined by the kjeldhal method . this example illustrates the preparation of bcc from a copper ( ii ) solution by lowering the ph , and without additional energy input ( e . g ., the solution was not heated after introduction into the reaction flask ). this example demonstrates leaching of copper metal into an aqueous solution containing copper ( ii ), ammonia and co 2 . after the filtration of bcc therefrom , the resultant copper ( ii )- depleted solution was boiled to remove excess co 2 . after boiling , the aqueous solution contained 16 . 4 g / l copper ( ii ), 18 . 9 g / l nh 3 , and 25 . 6 g / l co 2 , and had a ph of 8 . 3 . 1 . 0468 kg of 78 % copper - on - steel wire was added to 9 . 0 l of the boiled solution in a 10 l cylindrical glass reactor with a peristaltic feed pump . at time zero , the solution had a temperature of 28 ° c ., which was brought to and maintained at 38 - 40 ° c . during the leaching . air was sparged through system . at the end of 8 . 0 hours , the solution contained 22 . 8 g / l copper ( ii ), 20 g / l nh 3 , 24 . 3 g / l co 2 , and had a ph of 8 . 15 . the boiled solution was enriched by the leaching of 6 . 4 g / l copper ( ii ) from copper metal . this copper - enriched solution is suitable as the feed solution for use in the bcc preparation process described herein . this experiment demonstrates that bcc may be precipitated from a copper - depleted solution that had been enriched by dissolving copper metal . 10 l of enriched solution from a leaching test was put into a stirred tank reactor . the initial conditions of the aqueous solution were : 21 . 7 g / l copper ( ii ), 17 . 7 g / l nh 3 , 30 . 1 g / l co 2 , ph 9 . 0 , and temperature 24 ° c . the co 2 flow rate was set to 2 . 0 lpm . after 1 hour , the ph had dropped to 7 . 46 , the temperature was 46 ° c . and solids had started to form . after 3 hours , 156 . 7 g of dark green solids were collected by filtration . the final solution had 11 . 1 g / l copper ( ii ), 18 . 2 g / l nh 3 , 37 . 8 g / l co 2 , a ph of 7 . 6 and a temperature of 43 ° c . the dried solids were 56 . 7 % copper . thus , a process loop was achieved . all references , including publications , patent applications , and patents , cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context . | 2 |
the present invention will now be described in detail with reference to the appended drawings showing preferred embodiments of the invention . firstly referring to fig1 to 4 , coins are successively fed to a coin guide passage 1 and conveyed through the passage by a conveyor belt 2 . the coin guide passage 1 is provided with means for rejecting coins of different species , for example a coin rejection hole or slot 3 , sensors for detecting the passage of coins comprising photoelectric elements 4 and 4 , a stopper 5 for stopping passage of coins after a pre - set number of coins has been passed to a coin accumulator tube 7 and adapted to rotate to a normal position for allowing the coins to pass in response to a signal for instructing to start the next cycle operation , and another conveyer belt 6 moving at a relatively higher speed than the conveyor belt 2 so as to increase the gaps between adjacent coins . a coin accumulator tube , designated by numeral 7 , has a hollow cavity 7 &# 39 ; in which coins are accumulated . the diameter of the cavity 7 &# 39 ; may be varied in accordance with the diameter of coins to be accumulated therein , or a coin accumulator tube having a cavity for snugly receiving coins of single species may be selected from a group of accumulator tubes to be assembled in the system . a coin reception recess 7 &# 34 ; is formed on the top of the coin accumulator tube 7 . the coin accumulator tube 7 is assembled such that the top face of the coin reception recess 7 &# 34 ; is flush with the guide face of the coin guide passage 1 or positioned at the level slightly lower than the latter . a vertically - extending slit 8 is cut through the peripheral wall of the tube 7 , and a circumferential slit 9 is formed at the lower portion of the cylindrical tube 7 . a radial through - hole 10 for an upper photoelectric sensor 10 &# 39 ; for sensing the height of accumulated coins is provided at the upper portion of the tube 7 . another radial through - hole 11 for a lower photoelectric sensor 11 &# 39 ; for detecting the presence of a carrier bar 12 ( see fig3 ) is provided at the lower portion of the tube 7 . a movable shutter mechanism b is associated with the coin accumulator tube 7 . the movable shutter mechanism b of this embodiment comprises shutter plates 13 and 13 &# 39 ; each having a generally semicircular free end , an elongated stem portion and a generally trapezoidal base portion . in the normal closed position , both shutter plates 13 and 13 &# 39 ; engage with each other with their free ends forming a generally circular shutter which is inserted in the cavity of the coin accumulator tube 7 to form the bottom thereof and to support the accumulated coins until a pre - set number of coins is stacked in the tube 7 . the base portions of the shutter plates 13 and 13 &# 39 ; are pivoted by pins 15 and 15 &# 39 ; of a support member 14 and moved by rollers 16 and 16 &# 39 ; mounted on lugs of the base portions to open or close the shutter formed by the generally semicircular free ends of the shutter plates 13 and 13 &# 39 ;. an operation pin 17 is mounted to another lug of the base portion of the one shutter plate 13 &# 39 ;. the support member 14 has a threaded hole for engaging with a screw shaft 18 and another hole through which a guide rod 19 extends to prevent the support member 14 from rotating . the screw shaft 18 is rotated by a driving system 30 to lower or raise the support member 14 . when the support member 14 is lowered to the lowermost position , the operation pin 17 engages with a hole 21 of an operating lever 22 . the operating lever 23 is connected to a solenoid 23 . referring now to fig3 the lower movement of the shutter plates 13 and 13 &# 39 ; which is controlled on the basis of the output signal generated from the upper photoelectric sensor 10 &# 39 ; will be first explained . at the beginning of the accumulation operation , in order to raise the support member 14 to its uppermost position , as shown in dot - and dash line , a reversible motor 25 is actuated to rotate the screw shaft 18 in a reverse direction . when the support member 14 reaches the uppermost position , a cam 24 mounted to the support member 14 engages with an actuator of a limit switch a to switch - off the limit switch a thereby to stop the motor 25 . in the state , the shutter plates 13 and 13 &# 39 ; are closed and supported at a level slightly lower than the top face of the recess 7 &# 34 ; of the coin accumulator tube 7 . coins a are successively fed by a conveyer belt 2 and the gaps therebetween are increased by the action of the high speed conveyer belt 6 . the coins are then passed through the recess 7 &# 34 ; to be placed on the shutter plates 13 and 13 &# 39 ;. since the difference in height between the top face of the recess 7 &# 34 ; and the shutter plates 13 and 13 &# 39 ; is small , the distance of falling movement of individual coins within the hollow cavity 7 &# 39 ; of the tube 7 is limited . as coins a are stacked on the shutter plates 13 and 13 &# 39 ; and the through - hole 10 is shielded by the accumulated coin pile , a signal is generated to actuate the reversible motor 25 to rotate the same in the forward direction , whereby the screw shaft 18 is rotated through the driving system 20 in the direction to lower the support member 14 . the lowering speed of the support member can be controlled by detection , by the sensor 10 &# 39 ;, of the coins accumulated in the accumulator tube or by the combination of the pitch of the screw and the rotational speed of the shaft 18 , so that the shutter mechanism is lowered in synchronized with the coin feeding rate . the shutter mechanism is thus lowered stepwisely or continuously while maintaining the distance between the top face of the lastly stacked coin and the top face of the recess 7 &# 34 ; at a small limited value . coins a fed to the accumulator tube 7 are counted by the counting elements 4 as described before , and when the counted number reaches the pre - set number , the stopper 5 is rotated to interrupt the coin flow in the coin guide passage 1 to stop coin supply . at that time , the shutter plates 13 and 13 &# 39 ; are lowered to the lowermost position , shown by the solid line in fig3 to be aligned with the circumferential slit 9 . in the meanwhile , the tube 7 may have a height such that the shutter plates 13 and 13 &# 39 ; clear the bottom peripheral face thereof when the pre - set number of coins is stacked thereon and the shutter plates 13 and 13 &# 39 ; reach their lowermost position . in such a case , the circumferential slit 9 may be dispensed with . anyway , when the shutter plates 13 and 13 &# 39 ; are lowered to the lowermost position , the cam 24 depresses the actuator of a limit switch b to stop the reversible motor 25 and the carrier bar 12 is raised beneath the shutter plates 13 and 13 &# 39 ; to be ready for receiving the coin pile . when the lower through - hole 11 is shielded by the thus raised carrier bar 12 , a signal is generated from the lower photoelectric sensor 11 &# 39 ; for energizing the solenoid 23 , whereupon the operating lever 22 is drawn or retracted by the solenoid 23 with its hole 22 receiving the operating pin 17 to swing the base portions of the shutter plates 13 and 13 &# 39 ;. as the result of these swinging movements of the base portions , the shutter plates 13 and 13 &# 39 ; are opened to pass the stack of coins accumulated thereon to the carrier bar 12 . the coin stack is then carried by the carrier bar 12 to be moved to a wrapping station ( not shown ). the shutter plates 13 and 13 &# 39 ; are kept open until the top face of the uppermost coin clears the level of the through - hole 11 , since the hole 11 is shielded by the descending coin stack until then . when the coin stack clears the level of the through - hole 11 , the solenoid 23 is deenergized and the operating lever 22 is returned back to the normal extended position , whereby the shutter plates 13 and 13 &# 39 ; are swinged back to the closed position . then , the reversible motor 25 is actuated to rotate the screw shaft 18 in the reverse direction to raise the shutter mechanism b to the uppermost position to be ready for the next cycle operation . although not specifically shown , the screw shaft 18 may be replaced by a rack which is meshed with a pinion rotated by a suitable motor mounted on the support member 14 . a further modified arrangement is shown in fig5 which comprises a swingable arm 26 having one end engaging with the support member 14 . the arm 26 is swinged by a roller 28 mounted on a rotatable cam plate 27 to lower or raise the support member 14 . the limit switches a and b are also operated by the cam plate 27 to be brought to the on or off position . there is provided means for controlling the swinging movement of the arm 26 thereby to lower the support member 14 from the uppermost position to the lowermost position at a substantially constant speed . such means include an electric circuit for controlling the rotating speed of the motor by changing the pulse number depending on the number of counted coins , and a servo or pulse ( step ) motor assembled in place of the reversible motor 25 . the control of the above mentioned movable shutter mechanism b will be now explained . as a first embodiment , the control system which is made by utilizing the outputs from the upper photoelectric sensor 10 &# 39 ; ( hereinafter referred to as an upper photo ) associated with the through - hole 10 will be first explained . this control system is based on the idea that if the counted coins are detected by the upper photo , it is clear that the counted coins are stacked at least up to the position where the upper photo is located or the height of the upper photo . in such a case , the shutter plates 13 and 13 &# 39 ; are lowered until the coins are not detected by the upper photo . fig6 diagrammatically shows the above - mentioned control in a block diagram . the upper and lower photos 10 &# 39 ; and 11 &# 39 ; are actuated by the coins a ; by these photos 10 &# 39 ; and 11 &# 39 ;, and the upper and lower limit switches a and b , the motor 25 and the solenoid 23 are electrically actuated ; and by the motor 25 and the solenoid 23 , the movable shutter mechanism b is mechanically actuated . in turn , by the movable shutter mechanism 6 , the coin a and the upper and lower limit switches a and b are mechanically actuated . fig7 is a flow - chart for explaining a sequence of operations of the above - mentioned control system and fig8 shows its embodied circuit . the circuit of fig8 will be explained with reference to the flow chart of fig7 . to a terminal 801 , the h level of a pulse signal is put in by a start operation ( which corresponds to start 701 of the flow chart of fig7 ; only numerals will be indicated hereinafter ) and the signal is put in a set terminal s of a flip - flop ff1 through an or gate or1 . furthermore , the flip - flop ff1 is provided for memorizing a condition that the shutter plates 13 and 13 &# 39 ; should be returned to their initial position . the h level signal is put out from the output terminal q of the flip - flop ff1 and is put in an and gate and1 . at another input terminals of the and gate and1 , a signal which is turned to the h level when the limit switch a is turned on is put in from a terminal 803 through an inverter inv1 , and in addition , a signal which is turned to the h level when the upper photo 10 &# 39 ; detects a certain coins a is put in from a terminal 804 through an inverter inv2 . for this , the output of the and gate and1 maintains the h level from the time when the flip - flop ff1 is set until the time when the limit switch a is turned on , and this signal of the h level output of the and gate and1 is given to the motor 25 as a reverse rotation signal through a buffer amplifier ba1 and a terminal 809 ( 702 , 703 of fig7 ) to raise the shutter plates 13 and 13 &# 39 ; of the movable shutter mechanism b to their initial position . in such a case , if there are coins a on the shutter plates 13 and 13 &# 39 ;, the shutter plates cannot be raised to their initial position . therefore , if any coin is detected by the upper photo 10 &# 39 ;, the output of the inverter inv2 is turned to the l level to make the output of and gate and1 to be at the l level , for safety . when the shutter plates 13 and 13 &# 39 ; are raised to the initial position , the limit switch is turned on and , therefore an h level signal is put in at a terminal 803 . this h level signal causes the output of the reverse rotation signal ( put out from the terminal 809 ) to be stopped and at the same time resets the flip - flop ff1 since the signal is put in at a reset terminal r of the flip - flop ff1 ( 703 , 704 of fig7 ). furthermore , the signal which is put in at the terminal 803 is also put in an and gate and2 at one terminal thereof and at the other terminal , a start hold signal is put in . this start hold signal is one which is maintained to be at an h level from the time when the start operation ( 701 of fig7 ) is made to the time when the operation is ended , for example , by a stop operation or an actuation of an automatic stop mechanism due to detection of nonpresence of coins ( 728 , 729 of fig7 ). the output of the and gate and2 is put in at a set terminal of a flip - flop ff2 , and the output from the output q of the flip - flop ff2 is fed as a coin transfer signal to a motor , not shown , for driving the conveyor belt 2 , through a buffer amplifier ba2 from a terminal 810 . consequently , as soon as the shutter plates 13 and 13 &# 39 ; return to their initial position , the flip - flop ff2 is caused to be set to start the transfer of the coins ( 705 of fig7 ). furthermore , at the reset terminal r of the flip - flop ff2 , a count end signal which is turned to the h level when the coins a reaches predetermined number ( or wrapping number ) is put in from a terminal 805 and the flip - flop ff2 is reset so as to stop the transfer of the coins a at the time of the count end . in a meanwhile , attendent on the transfer and accumulation of the coins , the coins a are detected by the upper photo 10 &# 39 ;. the detection signal of the upper photo 10 &# 39 ; is put in an and gate and3 through a fall edge delay circuit nd and an or gate or2 . at the other input terminal of the or gate or2 , the signal from the output terminal q of a flip - flop ff3 is put in the flip - flop ff3 puts out its h level signal when the count end signal put in from the terminal 805 is put in at the set terminal of the flip - flop ff3 and puts out its l level signal when a shutter plate closing signal , hereinafter described , is put in at the reset terminal r of the flip - flop ff3 . furthermore , at the other input terminal of the aforementioned and gate and3 , a signal which is turned to the h level when the limit switch b for detecting the shutter plates 13 and 13 &# 39 ; being lowered up to their open position is turned on , is put in through an inverter inv3 through from a terminal 806 . the output of the aforementioned and gate and3 is fed to the motor 25 as a forward rotation signal through a buffer amplifier ba3 from a terminal 811 . when the coin a is detected by the upper photo 10 &# 39 ;, an h level singal is put in at the fall edge delay circuit nd ( 706 of fig7 ). this h level signal is put in the and gate and3 through the or gate or2 . in a meanwhile , since the counting operation has been just started , the flip - flop ff3 is maintained to be reset and since the shutter plates 13 and 13 &# 39 ; is not in the open position , an l level signal is supplied to the terminal 806 . this l level signal is put in the and gate and3 as a h level signal through the inverter inv3 . for this , an h level signal is put out from the and gate and3 to issue the forward rotation signal from the terminal 811 ( 707 of fig7 ). while the coins a are successively transferred , counted and accumulated , the detection signals by the upper photo 10 &# 39 ; are intermittently put out at a very short interval . for this , if the forward rotation signals put out from the terminal 811 are intermittently put out at a very short interval , such intermittent output are not suitable for the motor 25 . in order to avoid these intermittent outputs , the fall edge delay circuit nd is provided for absorbing the intermittent condition and putting out a smoothed or continuous forward rotation signal as a whole . consequently , when the coins a are successively accumulated and detected by the upper photo 10 &# 39 ;, the motor 25 is caused to continue its forward rotation and if the coins a are intermittently detected beyond a predetermined interval , the motor 25 is caused to be stopped at each time of detection ( 708 , 709 , 710 of fig7 ). thus , mainly , the motor 25 is controlled by the detection signals of the upper photo 10 &# 39 ; until the shutter plates 13 and 13 &# 39 ; reach their open position to make the limit switch on and thereby putting the l level signal from the inverter inv3 in the and gate and3 . in other words , in case where the coins a are successively accumulated , before the shutter plates 13 and 13 &# 39 ; reach the open position , the count operation is ended . at the time , the h level of the count end signal is put in from the terminal 805 at the reset terminal r of the flip - flop ff2 and the set terminal s of the flip - flop ff3 . the resetting of the flip - flop ff2 causes the transfer of the coins a to be stopped ( 712 , 713 of fig7 ). on the other hand , the flip - flop ff3 is caused to be set . the flip - flop ff3 is provided for automatically lowering the shutter plates 13 and 13 &# 39 ; up to the open position , regardless of the condition of the detection signal of the upper photo 10 &# 39 ; in case where the count operation is ended before the shutter plates 13 and 13 &# 39 ; reach the open position . when the flip - flop ff3 is set , the h level signal is fed from its output terminal q to the and gate and3 through the or gate or2 to continue to put out the forward rotation signal until the limit switch b is turned on . on the other hand , in case where the coins a are intermittently accumulated , there is a possibility that the shutter plates 13 and 13 &# 39 ; reach the open position before the end of count . in such a case , the limit switch b is turned on and an h level signal is put in from the terminal 806 , inverted into a l level signal through the inverter inv3 and then put in the and gate and3 . consequently , thereafter the forward rotational signal is not put out from the terminal 811 ( 711 , 717 of fig7 ). in this state , the shutter plates 13 and 13 &# 39 ; are stand - by until the count end and at the time of the count end , the transfer of the coins a is stopped in a similar manner mentioned above ( 718 , 719 of fig7 ). in either case of the above , at the time when the coin count is ended , a signal for starting a wrapping operation is put out by a conventional control , not shown . then , the carrier bar 12 starts to be upwardly moved toward the shutter plates 13 and 13 &# 39 ; up to just below the same in order to receive the coins a accumulated in the tube 7 and transfer the same to a wrapping mechanism , not shown . when the carrier bar 12 is moved just below the shutter plate 13 and 13 &# 39 ; in open position , the shutter plates 13 and 13 &# 39 ; are opened to transfer the accumulated coins a onto the carrier bar 12 . more particularly , when the lower photo 11 &# 39 ; detects the carrier bar 12 and the transferred coins a to put out a detection signal , the detection signal is put in an and gate and4 from an terminal 807 . at the other terminals of the and gate and4 , the signal from the output terminal q of the flip - flop ff3 and the detection signal from the limit signal b are put in . then , the output signal of the and gate and4 is put out as a shutter plate open signal to the solenoid 23 through buffer amplifier ba4 from a terminal 812 and simultaneously put in a fall edge detection circuit ndf . this fall edge detection circuit ndf puts out an h level pulse signal by detecting the time when an input signal is fallen from h level to l level and the output signal is fed to the or gate 1 and the reset terminal r of the flip - flop ff3 as a shutter closing signal showing that the shutter plate open signal is not put out from the terminal 812 . under a condition that the count end signal is put out , that is , the h level signal is put out from the output terminal q of the flip - flop ff3 , and when the limit switch b is on , as the carrier bar 12 is detected by the lower photo 11 &# 39 ;, the h level signal is put out from the and gate and4 to be fed as the shutter plate open signal to the solenoid 23 from the terminal 812 ( 720 , 721 of fig7 ). thus , the accumulated coins a are dropped on the carrier bar 12 from the shutter plates 13 and 13 &# 39 ;. thereafter , when the carrier bar 12 is started to be lowered so as to transfer the coins a to the wrapping mechanism , not shown , the lower plate 11 &# 39 ; continues to detect the carrier bar 12 and the accumulated coins . when the carrier bar 12 is further lowered and then the accumulated coins a are not detected , since the h level signal is put in at the terminal 807 , the h level of the shutter plate open signal is not put out from the terminal 812 ( 722 , 723 of fig7 ). for this , due to deenergization of the solenoid 23 , the shutter plates 13 and 13 &# 39 ; are closed by an action of the spring . on the other hand , when the shutter plate open signal is not put out , the h level of pulse signal is put in the set terminal s of the flip - flop ff1 and the reset terminal r of the flip - flop ff3 from the fall edge detection circuit ndf . then , when the flip - flop ff1 is set , the shutter plates 13 and 13 &# 39 ; are actuated to be returned to the initial position ( 724 - 726 of fig7 ) in a similar manner to initial operations at the starting time ( 701 - 704 of fig7 ). furthermore , by the resetting of the flip - flop ff3 , the forward rotation signal is inhibited not to be put out to the motor 25 from the terminal 811 even when the shutter plates 13 and 13 &# 39 ; are moved from the open position . furthermore , when all operations for the coin a are ended , the h level of the start hold signal which has been supplied to the terminal 802 is reset ( 727 - 729 of fig7 ). moreover , in case where a step motion or a pulse motor may be used as the motor 25 in order to perform a reliable position control of the shutter plates 13 and 13 &# 39 ;, the outputs of the and gates and1 and and3 may be put in and gate and5 and and6 , respectively , and at the other input terminals of the and gates and5 and and6 , the pulse signal may be put in from the terminal 808 , as shown in dotted lines of fig8 . each output of two and gates and5 and and6 may be fed to the motor as the reverse rotation signal or the forward rotation signal through each buffer amplifier ba5 , ba6 from each terminal 813 , 814 . as a second embodiment , the control system which utilizes the outputs of the counter elements 4 provided for counting the number of the coins a will be explained . this control system is based on the idea that from the counted number of the coins a counted by the counting elements 4 , the accumulated height of the coins a accumulated in the tube can be calculated since a specific kind of the coins to be counted is preset and , therefore , the thickness of the one coin can be found . in the case , the shutter plates 13 and 13 &# 39 ; are lowered in accordance with the accumulated height of the coins a corresponding to the number of the accumulated coins a . fig9 diagrammatically shows the above - mentioned control in a block diagram . the coin kind signal which is issued from a coin kind setting switch 901 associated with coin kind setting means , such as a dial or a button switch , not shown for selecting a specific kind of coins to be counted , is put in a pulse member setting circuit 902 . the pulse number setting circuit 902 determines a pulse number per one number of coin corresponding to the selected kind of the coins and feeds a pulse number signal to a pulse generator 902 . the pulse generator 903 feeds pulses per one number of coin to the step motor 25 through a driver d each time when it receives a count pulse from count elements 4 . then , the movable shutter mechanism b is driven by the step motor 25 . consequently , the shutter plates 13 and 13 &# 39 ; are caused to be lowered by the height corresponding to the number of the accumulated coins a . furthermore , the pulse generator 903 is operated by the limit switches a and b which are actuated by the movable shutter mechanism b , and the lower photo 11 &# 39 ; for detecting the transfer of the accumulated coins a by the carrier bar 12 so as to move the shutter plates 13 and 13 &# 39 ; to the initial position or the open position . fig1 is a flow - chart from explaining a sequence of operations of the above control system and fig1 shows its embodied circuit . since the main portions of the circuit elements shown in fig1 are similar to these of fig8 the different points will be explained mainly . relationship among the coin kind setting switch 901 , the pulse number setting circuit 902 and the pulse generator 903 is mentioned above , and in the illustrated embodiment , there are six kinds of coins and four kinds of coin thickness ( the pulse numbers n 1 , n 2 , n 3 , n 4 ). the pulse generator 903 receives four pulse number signals representative of the coin thicknesses at its terminals n 1 , n 2 , n 3 and n 4 . the pulse generator 903 also receives the reverse rotation signal put out from the and gate and1 at its terminal r , receives a coin signal put out from the and gate and3 at its terminal f , and receives the forward rotation signal put out from the and gate and4 . in addition , the pulse generator 903 further receives a drive signal put out from the or gate or2 when either one of these reverse rotation signal , coin signal and forward rotation signal are put in the or gate or2 . in accordance with combination of the above - mentioned input signals , the pulse generator 903 feeds a reverse rotation drive signal from its terminal rd or a forward rotation drive signal from its terminal fd , respectively , through the driver d from a terminal 1111 or 1112 . the reverse rotation signal put out from the and gate and1 is put out in a similar manner to that of the first embodiment , and similarly the coin transfer signal put out from a terminal 1109 and the shutter plate open signal put out from a terminal 1110 are also constructed in a similar manner to those of the first embodiment . that is , the pulse signal by the start operation , the start hold signal , the signal by on operation of the limit switch a , the detection signal of the upper photo 10 &# 39 ;, the count end signal , the signal by on operation of the limit switches 13 , and the detection signal of the lower photo 11 &# 39 ; are put in at terminals 1101 , 1102 , 1103 , 1104 , 1106 , 1107 and 1108 , respectively . from each terminals , these signals are put in a group of gates constructed in a similar manner to those of the first embodiments . therefore , detailed explanations on functions of the gates will be omitted . in case where the lowering of the shutter plates 13 and 13 &# 39 ; is controlled by the number of the coins a , the count is always ended before the shutter plates 13 and 13 &# 39 ; reach the open position . therefore it is necessary to drive the step motor 25 until the shutter plates 13 and 13 &# 39 ; reaches the open position . then , the drive by the count elements and the drive after the count end must be controlled , which will be explained . at the terminal 1105 , the coin count signal from the count elements 4 is put in , and this signal is fed to the and gate and3 at one terminal thereof through the delay circuit td . furthermore , the delay circuit td is provided in view of the transfer period of the coins from count element position to accumulator tube position . at the other terminal of the and gate and3 , the signal by on operation of the limit switch b which is put in from the terminal 1107 is put in through the inverter inv3 and while the coin count signal is put in the and gate and3 , the limit switch b is usually not actuated . therefore , as mentioned above , each coin signal per each coin is put in at the terminal f of the pulse generator 903 from the and gate and3 and the drive signal is put in at the terminal d of the pulse generator 903 through the or gate or2 so as to issue a predetermined pulse number ( either one of n 1 , n 2 , n 3 and n 4 ) of the forward rotation drive signal per each coin from the terminal fd ( 1008 - 1011 of fig1 ). the output terminal q of the flip - flop ff3 which memorizes the count end condition by receiving the count end signal from the terminal 1106 is connected to one input terminal of the and gate and4 , and at the other input terminal , the signal by on operation of the limit switch b is put in through the inverter inv3 from the terminal 806 . consequently , when a predetermined number of the coins a , the flip - flop ff3 is set and , thereby the forward rotation signal for moving the shutter plates 13 and 13 &# 39 ; to the open position is put in at the terminal ff of the pulse generator 903 from the and gate and4 . the pulse generator 903 continues to put out the forward rotation drive signal from the terminal fd until the forward rotation signal put in from the terminal ff disappears . thus , the step motor 25 is actuated to move the shutter plates 13 and 13 &# 39 ; to the open position ( 1011 - 1016 of fig1 ). the second embodiment can allow the fall distance of each coin in the accumulator tube to be maintained to be a minimum , comparing with the first embodiment . | 8 |
the preferred embodiment of the method for measuring the lifetime of a semiconductor material and the apparatus therefor according to the present invention will be explained with reference to the drawings . according to the apparatus of the present invention , as shown in fig7 a , a quartz glass plate 24 is placed on a metal table 25 , and a semiconductor material 10 to be measured is placed on the quartz glass plate 24 . a more detailed view is shown in fig7 b . in the operation of the measurement apparatus shown in fig7 a and 7b , a portion of the microwave energy irradiated from a waveguide 8 ( for outputting and receiving microwave energy ) reflects on the semiconductor material 10 and another portion of the microwave energy passes through the semiconductor material 10 . a portion of the microwave energy which has passed through the semiconductor material 10 reflects on the quartz glass plate 24 and another portion of this microwave energy passes through the quartz glass plate 24 and reaches the surface of the metal table 25 . it is understood that the reflected microwave energy received by the waveguide 8 is mainly that which has reflected from the semiconductor material 10 and the metal table 25 . the phasic relation between these two reflected microwave energy is determined by the distance between the semiconductor material 10 and the metal table 25 . accordingly , it is possible to determine this distance using the effect of the portion of the microwave energy reflected from the metal table 25 to the portion of the microwave energy reflected from the semiconductor material 10 by continuously checking the phasic relation . when the thickness of the semiconductor material 10 to be measured is previously determined , the distance between the semiconductor material 10 and the metal table 25 is controlled by adjusting the thickness ( for example , 2 to 3 mm ) of the quartz glass plate 24 . accordingly , it is possible to maximize the intensity of the effective reflective microwave energy . further , when the thickness of the semiconductor material 10 varies a little ( for example , it is shown by p or q ), the position of the waveguide 8 for outputting and receiving the microwave is finely adjusted to instantly obtain the maximum reflective microwave energy as shown in fig8 . according to the preferred embodiment of the measurement method of the present invention , the metal plate 23 shown in fig3 c is used and a quartz glass plate having a fixed - thickness is introduced . the quartz glass plate is employed in the preferred embodiment as anon - metal material of the measurement table 21 in fig3 c . however , it is apparent that any non - metal material other than quartz glass may be used in the method of the present invention . it is noted that the method for measuring the lifetime of the semiconductor material according to the present invention enables an increased output precision by more than several fold in comparison to the conventional measurement method and a constant generation of highly reliable lifetime signals having no - strain through the reflective microwave energy . when the semiconductor material to be measured by the present invention is the widely employed cz - silicon , the signals containing the lifetime information can be treated without applying any amplifying steps , can enjoy a wide range of measurable proportional resistivities and can result in a significantly improved s / n ratio . in addition , notwithstanding the relatively easy and simple treatment of the output signals , it is possible to obtain an improved reliability , economy and maintenance . in fig9 the microwave energy oscillated by a microwave oscillator 1 is directed to a waveguide 8 via a magic tee 4 and irradiated onto a semiconductor material ( not shown ) which is an object of the measurement . the microwave energy is reflected by the semiconductor material to return to the waveguide 8 , passed through the magic tee 4 and detected by a detector 7 . the waveguide 8 is provided with a stub tuner 12 . the stub tuner 12 has a structure which is shown in the enlarged view of fig1 wherein the distance d between three screws 13 1 , 13 2 and 13 3 is determined by the frequency of the microwave energy to be used . the distribution circuit of the waveguide 8 may be made variable by providing the stub tuner 12 on the waveguide 8 and by adjusting the lengths l 1 , l 2 and l 3 inserted within the waveguide 8 . the above arrangement can also transform the characteristic curve of the reflected microwave signals from the curve a denoting the arrangement without the stub tuner ( to position where measurement is impossible being at z 01 ) to the curve b as shown in fig1 . the point where a measurement is impossible may be avoided for almost all materials by setting the resistivity , for example , at 100 ωm in the case of a si - wafer . accordingly , the reflected microwave signals are outputted as an ideal waveform as shown in fig5 a . the curve b in fig1 is improved to assume a relatively linear form relative to the non - linear characteristics in the region extending toward a point z 02 , and the amplitude variation or distortion of the reflected microwave can also be restricted . although a stub tuner is used as the means to make the equivalent distribution circuit of the waveguide variable in the above embodiment , such means is in no way limited to the above and various modifications are possible , without departing from the scope of the appended claims . as described in the foregoing , the method and apparatus for measuring the lifetime of the semiconductor material according to the present invention is highly effective since it can measure all the semiconductor materials to obtain accurate reflected microwave signals , it can significantly enhance the overall measurement reliability as well as data reproducibility and it can realize a flexible measurement arrangement . as shown in fig1 , a heat - resisting or refractory member 35 is placed on an x - y stage 36 and a heater 37 is buried in the upper portion of the refractory member 34 . on the refractory member 34 , a non - metal refractory plate 33 is placed . the semiconductor material 10 to be measured is placed on the system consisting of the non - metal refractory plate 33 and the refractory member 34 and the x - y stage 36 . in operation , microwave energy irradiates through a waveguide 8 ( for outputting and receiving the microwave energy ) which is placed above the semiconductor material 10 and excitation rays of wavelengths λ 1 and λ 2 are outputted from the laser diodes 9 1 and 9 2 . the semiconductor material 10 which is polluted by metal taints is gradually heated by the heater 37 embedded in the refractory member 34 then a lifetime of the semiconductor 10 is measured using the reflective microwave energy passing therethrough . the measurement results as shown in fig1 a depict large changes in the lifetime of the semiconductor material at a certain temperature . this phenomenon is generated because the energy levels of very small metal taints contained in the silicon material approach those of electrical conductors when the silicon is heated and the excited electrons are apt to disappear . fig1 b shows an example of the lifetime changes of measurement data in which graphed on the abscissas is the inverse temperature 1 / temperature ( 1 / t ) and on the ordinates is lifetime τ . measurement data was obtained on a sample a of a semiconductor material having metal diffused and a second sample b having no metal . the lifetime of the second sample b is lengthened when the temperature of the semiconductor material 10 exceeds a certain level . however , the lifetime of the first sample a doesn &# 39 ; t extend as much , generating a large difference between the lifetimes of the two samples . the above result has a correlation with the peak in the measurement data obtained the dlts method as shown in fig1 c . by previously determining on an experimental basis a relation between the temperature 1 / ta shown in fig1 b and the temperature tb shown in fig1 c , according to the non - contact and non - destructive method for measuring the lifetime of the semiconductor material 10 of the present invention , it is possible to judge an existence of very small metal taints and to determine the type of such a metal . it is possible to presume that almost all of the pollutants in the semiconductor material concentrates in the surface of the semiconductor chip , so that heating the semiconductor chip and measuring its lifetime results in a lifetime of the much polluted surface of the semiconductor material and another lifetime of the little polluted interior of the semiconductor chip , and thus a separative analysis of the surface and bulk lifetimes is possible at a high s / n ratio . while the preferred embodiments employs a heater as the heating means as herein disclosed , it is to be understood that other forms of heating might be adopted . by measuring the lifetime of the semiconductor material after it is warmed according to the present invention , it is possible to determine the existence of fine heavy metal taints which are identified conventionally only by destructive type methods , and to separately evaluate the surface recombination velocity ( surface lifetime ), thus obtaining an advantageous lifetime measurement system . it should be understood that many modifications and adaptations of the invention will become apparent to those skilled in the art and that the invention is intended to encompass such obvious modifications and changes in the scope of the claims appended hereto . | 6 |
the present invention describes a method of carrier frequency synchronization supported by special synchronization signals , which avoids the above - described disadvantages and is distinguished by its particular simplicity . the synchronization signals used can be respectively interpreted as a group of 2l + 1 ( l = 1 , 2 , 3 , . . . ) sinusoidal tones whose frequency f 1 is a function of ## equ1 ## relative to a medium frequency f 0 ( hereinafter also called carrier frequency ). here w is the bandwidth of the channel available for carrier frequency synchronization . because such sinusoidal tone groups are broadband signals , they are not as strongly affected by the fading as an individual sinusoidal tone . different base stations generate the sinusoidal tones at identical frequencies but different phases , that is , if φ il is the phase of the lth sinusoidal tone of the ith base station , the following usually applies : if , therefore , the respective lth sinusoidal tones of the base stations i and j eliminate one another because φ il =- φ jl , then φ ik =- φ jk typically does not apply , i . e ., the respective kth sinusoidal tones do not cancel one another out . moreover , a device ( matched filter ) with which carrier frequency synchronization can be performed efficiently is described further below , in section &# 34 ; 2 . algorithm for carrier frequency estimation .&# 34 ; we assert that the arrangement ( in a base station ) illustrated in fig1 generates a group of 2l + 1 sinusoidal tones at the frequencies ## equ2 ## where f 0 is the carrier frequency and the lth sinusoidal tone has the power of ## equ3 ## here p is the total power of the signal . the m generator generates a maximum - periodic series of the period length ( number of cycles ) 2l + 1 , where must apply as the boundary condition . series of this type can be generated by feedback m - digit shift registers , in which instance the feedback can be represented by a primitive polynomial of gf ( 2 m ) ( gf means galois field -- see 3 !). the maximum - periodic series here is defined such that its elements can only assume the values + 1 and - 1 . ( alternatively , it could also be defined such that the elements assume the values 0 and 1 .) the maximum - periodic series is supplied to a so - called pulse modulator that generates a pulse function having the weight s ( k ) at a time t = k / w . the following therefore applies with the dirac &# 39 ; s function δ : ## equ4 ## this pulse function series is now supplied to a low - pass with the dirac pulse response h s ( t ) or transmission function ## equ5 ## the output signal of this low - pass , then , is ## equ6 ## ideally , the low - pass should have the same amplification factor at the frequencies ## equ7 ## moreover , a linear phase is desired , that is , the phase shift ψ l dictated by the filter at the frequency f 1 is a linear function in f l where c is a constant . the third condition on the transmission function of the filter is the filtered signal is modulated to a carrier having the frequency f 0 , and the transmission signal is now a sinusoidal tone group having the frequencies ## equ8 ## in a mobile radio network , the individual base stations can generate the synchronization signals according to the same method , but each station uses a different feedback polynomial to generate the maximum - periodic series . the number of possible feedback polynomials is e ( 2 m - 1 )/ m . where m is the number of shift register cells and e is the so - called eulerian function 4 ! : if z is a natural number , e ( z ) is the number of natural numbers x , with 1 ≦ x & lt ; z , which are relatively prime to z . the limitedness of the number of possible feedback polynomials does not imply a limitedness of the total number of base stations . base stations located far enough apart can readily use the same feedback polynomial . the above - described method of generating a sinusoidal tone group is not totally optimal . ideally , all of the sinusoidal tones should have the same power , which is not quite the case here ( for large l , however , the deviations are negligible ). furthermore , the limited number of different feedback polynomials means a limitation in the signal design . the advantages of this method lie in the simplicity of the generation of synchronization signals ( with the aid of a maximum - periodic series -- the sinusoidal tones of the group must not be generated individually ) and the fact that the discrete - time signals s ( k ) in the base band have a constant amplitude . consequently , the transmission signals ( radiated synchronization signals ) also have a virtually constant amplitude , which is desirable for numerous applications . fig2 shows an arrangement that serves to determine the carrier frequency of the synchronization signal . in the mobile station , the reception signal r b ( t ) is converted into the base band with a variable quadrature demodulator . at the beginning of the synchronization process , f e is the oscillator frequency . this frequency is varied continuously during the synchronization process ; v is the detuning normalized to the signal bandwidth w . the two quadrature components are respectively supplied to a low - pass , which is expected to meet the same requirements as the transmitter low - pass . it is assumed that the transmission signal s b ( t ) is linearly distorted during transmission , and is additionally disturbed by white gaussian noise n b ( t ). the reception signal is therefore the linear distortions are therefore described as a folding of the transmission signal with the dirac pulse response h c ( t ) of the channel . the output signals of the low - passes are respectively scanned at the rate w ; the scanning values are processed in a digital matched filter . the dirac pulse response of this matched filter comprises n scanning values of any maximum - periodic series of the period length 2l + 1 , i . e ., if s ( k ) is a maximum - periodic series of period length 2l + 1 , then it must be taken into consideration that h ( k ) can be derived from any maximum - periodic series ; it need not be the one used in the transmitter . the only condition is that the transmitter and receiver use a maximum - periodic series of the same period . in a mobile radio application , however , this means that the receiver of the mobile station automatically evaluates the synchronization signals of all receivable base stations . because the dirac pulse response coefficients of the channel that have been derived from the maximum - periodic series only assume the values of + 1 and - 1 , the digital matched filter can be configured without a multiplier . from 2l + 1 sequential output values of the matched filter , the detector squares the amounts and adds them . a maximum results with detuning or at one of the frequencies f 0 set by the quadrature demodulator . this frequency is a nearly optimum maximum likelihood estimation value for the actual carrier frequency . it is noted here that the arrangement shown in fig2 can be used not only when the synchronization signals are generated according to the arrangement shown in fig1 but whenever the synchronization signal is a group of sinusoidal tones having the frequencies ## equ9 ## where the number of sinusoidal tones must fulfill the condition following is a detailed description of the invention and a demonstration of its functionality . 1 . generation of a sinusoidal tone group with the aid of maximal - periodic series a periodic series { s ( k )} is given . the period length is 2l + 1 , that is , s ( k + 2l + 1 )= s ( k ). the interval between two scanning values is 1 / w . the spectrum of this series therefore exclusively comprises lines at the frequencies ## equ10 ## having the amplitudes ## equ11 ## the power of the lth spectral line is therefore ## equ12 ## if a maximum - periodic series is selected for { s ( k )}, then 4 ! is therefore , if { s ( k )} is a maximum - periodic series and 2l + 1 is the period length , then these series has 2l spectral lines of identical power . only the power of the line at f = 0 is smaller by the factor 2l + 2 . the functionality of the arrangement shown in fig2 is demonstrated in this paragraph . first , the optimum ml estimation algorithm is derived , which is essentially based on the ideas of rife and boorstyn 5 !, 6 !. it will be shown subsequently how this algorithm can be structured particularly favorably as a matched filter . first , f c is the reception frequency set by the oscillator of the quadrature demodulator . the digital matched filter then sees a signal scanning series of the form ## equ14 ## here δf is the difference between the oscillators in the receivers and transmitters , which has been normalized to the signal bandwidth w , ## equ15 ## and a ( 1 ) is the ( complex ) amplitude of the lth sinusoidal tone . it must be considered here that this amplitude is not only a function of signal generation , but also of the dirac pulse response of the channel and the time delay of the signal , and is therefore unknown to the receiver . gaussian - distributed white noise is symbolized by n ( k ). a maximum - likelihood ( ml ) formulation can be used as a synchronization formulation for simultaneously estimating δf and all a ( 1 ). if v is the ml estimation value for δf and α ( 1 ) is the ml estimation value for a ( 1 ), according to the ml rule , ## equ16 ## is minimal for α ( 1 )= α ( 1 ) and v = v , or ## equ17 ## is maximal for the same choice . it was assumed here that a total of n scanning values of the received signals r ( k ) were evaluated . the second term is ## equ18 ## if it is assumed that n is a whole multiple of 2l + 1 , then ## equ19 ## it follows that ## equ20 ## therefore , from ( 1 ), ## equ21 ## with the use of the abbreviation ## equ22 ## ( λ ( f ) is the fourier - transformed scanned input signal at the point f ), and ( 2 ) can be written as ## equ23 ## with a simple variation calculation , it can now be shown that the relationship ## equ24 ## applies for the maximum points of this expression . if this relationship is used in ( 3 ), it can be seen that the maximum of the expression ( 3 ) can be written thus : ## equ25 ## in this case , generally here υ v ( f ) can be generated , for example , by detuning the carrier oscillator by - vw . the ml algorithm derived for determining a suitable estimation value v for the carrier frequency offset δf can be realized by the arrangement illustrated in fig3 . up to the post - scanning components , the arrangement corresponds to the arrangement shown in fig2 . the oscillator of the quadrature demodulator is detuned by - vw ; the scanned received signal is then υ v ( k ). from this , the ml tester then calculates the value ## equ26 ## the detuning for which the highest value results corresponds to the optimum estimation value for the carrier frequency error , i . e ., during this detuning the receiving oscillator is optimally synchronized to the carrier frequency in the sense of the ml rule . to bring to a close the demonstration of the functionality of the arrangement shown in fig2 it only remains to be shown that the relatively complicated block ml test can be replaced by the matched filter described in section 2 . the values ## equ27 ## can be generated by supplying r v ( k ) to a bank of 2l + 1 filters with the dirac pulse responses ## equ28 ## and taking the output value at the time k = 0 . if g 1 ( n ) is the output signal of the lth filter at time n , then ## equ29 ## the ml tester therefore calculates ## equ30 ## that is , it squares the output values of the 2l + 1 filters at time 0 and adds them . if n is large compared to 2l + 1 , then the following applies with good precision for n = 0 , . . . , 2l ## equ31 ## this conversion allows the use of a simple filter having the dirac pulse response of ## equ32 ## instead of the above filter bank . points of interest here are not only the filter output value at time k = 0 , but also 2l + 1 sequential filter output values . these values are squared and added . because the phases of the individual partial oscillations are insignificant , only one filter is required whose transmission function comprises 2l + 1 same - magnitude lines at the points f = 1w /( 2l + 1 ), 1 =- l , . . . ,+ l . the dirac pulse response of this type of filter can be realized with good approximation in that n scanning values of a maximum - periodic series of period length 2l + 1 are taken . as shown in the last section , a filter having such a dirac pulse response has the desired transmission function , except at the point f = 0 . 1 ! cept / cch / gsm recommendation 05 . 02 : multiplexing and multiple access on the radio path , 1988 . 5 ! d . c . rife , r . r . boorstyn , &# 34 ; single - tone parameter estimation from discrete - time observations ,&# 34 ; ieee transactions on information theory , vol . it - 20 , pp . 591 - 598 , 1974 . 6 ! d . c . rife , r . r . boorstyn , &# 34 ; multiple tone parameter estimation from discrete - time observations ,&# 34 ; bell system technical journal , vol . 55 , pp . 1389 - 1410 , nov . 1976 . john wiley & amp ; sons , 1982 . | 7 |
the invention offers advantages in the field of open coil resistance heaters in that the problems in noise generation and premature failure of heater components are minimized . in addition , the inventive open coil electrical resistance heater is advantageous in reducing the amount of shadowing that occurs in prior art heaters and promoting a longer life operation of the heater . the invention is particularly adapted for heaters that employ resistance wire coils that are aligned with the flow of air through the heater . it is these coils that are susceptible to the problem of shadowing and the offsetting of the insulators to create the sinusoidal shape in the coil minimizes this problem . the offsetting that creates the sinusoidal coil configuration also contributes to filling the volume of the heater that air passes through for better heating efficiency . 1 ) an open coil electric heater for heating moving air with the heating element made up of sections of coils such that one end of a given coil section is located on the inlet air portion and the other end is at the exit air portion . 2 ) insulators engage sufficient numbers of convolutions at points along each coil section supporting the coil thereby holding the heater coils section in place as each insulator is retained by a metal plate . 3 ) the insulators are retained in the metal plate by cutouts in the metal plate engaging slots and possibly arms in the insulators . 4 ) each cutout in the metal plate is designed so as to engage the corresponding slots and possibly arms in the insulators retained yet allow for expansion and contraction resulting from the heating and cooling of the heater . 5 ) the insulators supporting a given coil section are arranged so as to create a sinuous path for the coil section . the sinuous coil path thereby creates sufficient tension so as to dampen vibration of the insulators against the metal plate . 6 ) the sinuous coil passes effectively expose a greater portion of each coil pass to the moving air stream for greater transfer of heat to the moving air stream being heated . 7 ) the sinuous coil passes effectively reduce the “ shadowing ” relative to a straight coil section arranged parallel to the air flow direction . referring now to fig3 - 7 , one embodiment of a partial assembly of open coil electrical resistance heater is illustrated . the embodiment depicts components of a heater assembly critical to the invention , but omits those components that are well known , e . g ., terminals and terminal blocks , means for fastening the plate to the duct , the necessary lead wiring to connect lead ends of the resistance wire coils to a source of power for energizing the heater , etc . fig4 depicts a plate 40 , with surface 40 a , which is especially configured to orient the insulators and a resistance wire coil in the inventive configuration . the plate 40 includes a number of cutouts 41 and 42 . the cutouts 41 are shown on path x with the cutouts 42 aligned with path y . the cutouts 42 on path y are offset from the cutouts 41 on path x to provide improved performance in terms of noise reduction , reducing the shadowing effect , and other advantages as explained in more detail below . the plate 40 also includes tabs 43 and 45 , which interface with a duct for attachment thereto . the other features of the plate are conventional and do not require further explanation for understanding of the invention . referring now to fig4 - 7 , the plate 40 and its other side 40 b , is shown in combination with resistance wire formed schematically into coils 47 and insulators 49 . the insulators 49 are configured with tabs 51 , formed to create spaces 53 to receive segments 55 of the resistance wire forming the coil 47 to hold the coil in place . the insulators also have slots 57 sized to receive a portion of the plate and arms 59 intended to abut a plate surface when the insulators are mounted in the cutouts . the cutouts as well as the slots and arms should be configured so that the insulator is held in place while allowing the metal plate to expand and contract as a result of the heater operation . fig4 best shows one effect of the offset created by the cutouts 41 and 42 and insulators 49 mounted therein when the configured coils 47 are aligned with a path of the air passing through the heater . by offsetting the cutouts 41 and 42 , the coils 47 takes on a sinusoidal shape at least along a portion of their length . in this embodiment , only a portion of the cutouts are offset from each other , with the cutout 41 a at the end of the plate 40 where the wire crossover 54 occurs , lying on the same path x . in this embodiment , the cutout 41 a is not offset from its adjacent cutout so that the coils are centralized for the crossover . the invention is ideally adapted for a heater that has the path of air aligned with the longitudinal orientation of the coils 47 . this path of air is shown in fig4 as path q . by offsetting the cutouts and mounted insulators such that the coils 47 follows a sinusoidal or at least partially sinusoidal path overcomes three of the prior art problems noted above . first , by arranging the insulators 49 of a given coil section in an offset fashion , tension forces resulting from the coil seats each insulator against a side of the cutout , see side 44 in fig3 as an example . this has the effect of dampening the vibration of the insulator against the metal plate 40 , thus reducing the vibration or “ rattling ” of the heater coil support insulator 49 against the plate 40 thereby reducing noise , which is desirable . second , by arranging the insulators 49 supporting a given coil section in an offset fashion , the resultant sinuous pattern of the heating coil reduces the tendency for vibration resonance to occur as compared to a straight coil pattern . third , by arranging certain of the insulators of a given coil in an offset fashion , shadowing of downstream heater coil convolutions in any given straight section by upstream heater coil convolutions from that same given straight coil section is reduced . shadowing results when air heated by an upstream helix flows over and heats down stream helixes . by reducing shadowing , the operating temperature of the heater coil is reduced which is desirable . this is best seen in fig4 and 6 . here , the coil 47 is identified by coil segments 47 a and 47 b that make up part of the sinusoidal shape . by offsetting the support of the coil using the cutout 42 and insulator 49 , the coil segment 47 b is exposed . this exposure means that the air entering the heater along path q contacts the coil 47 . the air strikes not only the initial coil segment 47 a but also the coil segment 47 b , created by the offset insulator 49 . since the coil segment 47 b is exposed to the air traveling on path q , coil segment 47 b is not subjected to the increased heating that would occur if the coil 47 had a straight alignment and the portion of the coil downstream of initial coil segment 47 a is contacted by hot air already heated by coil segment 47 a . fig6 also shows the plate 40 in combination with a circular duct 61 . the circular duct is one option , but other duct cross sectional configurations could be employed , oval , rectangular , square , and the like . fourth , by arranging the insulators of a given coil section in an offset fashion , each subsection of the given heater coil will be angled relative to the axis of airflow through the duct and arranged so as much of the duct cross section as possible is filled or covered by heating element material to maximize heat transfer to the air stream . the cutouts 41 and 42 are exemplary of ways in which the insulators can be mounted to the plate 40 . other modes of mounting could be employed if so desired . the important aspect is that a certain number of the insulators that support the resistance wire are offset from other insulators to create the sinusoidal shape of the coil and the advantages discussed above , e . g ., noise reduction and minimizing shadowing . also , while a plate is employed to support the insulators , other types of supports could also be used . for example , a wire frame could be employed , with clips that hold the insulators as are found in some open coil electrical resistance heater configurations . also , differently - configured insulators could also be employed with the support and resistance wire coil . the degree of offset of certain of the insulators can also vary . the degree of offset can be gauged by the distance between the two paths x and y of fig4 . the greater the distance between x and y , the greater the offset and the higher the amplitude of the sinusoidal shape of the coil . using an offset distance that is too small approximates the straight line coils of the prior art and the advantages of the invention discussed above are lost . the offset distance can be measured in terms of the resistance wire coil diameter since a smaller resistance wire coil will allow more offset than a larger resistance wire coil , all other things being equal . thus , a minimum offset guideline can be ½ to 2 times the diameter of the resistance wire coil . also , while the offset of the cutouts 42 is shown to be the same along the paths x and y , the offset could vary along the path . thus , one cutout could be offset more than another cutout so that the sinusoidal shape of the resistance wire coil would not be uniform along the length of the coil . while fig3 - 7 depict a heater that employs three coils 47 for heating purposes , wherein the cutouts 41 and 42 defining a path for the resistance wire coil 47 are shown in three sets , a single coil could be employed on just one side the plate 40 so that it would start and end on opposite ends of the plate , and only one set of cutouts would be needed . alternatively , a single coil could be employed that would start on one end of the plate 40 , crossover at the other end and terminate at the starting point end . in this latter case , the insulator would be configured to hold the resistance wire coil above and below the plate . if the resistance wire coil is positioned on only one side of the plate , the insulators 49 could be configured to support such one segment of the coil rather than two as shown in fig5 . as such , an invention has been disclosed in terms of preferred embodiments thereof which fulfills each and every one of the objects of the present invention as set forth above and provides a new and improved open coil resistance heater with a specially configured coil and a method of heating using the specially configured coil . of course , various changes , modifications and alterations from the teachings of the present invention may be contemplated by those skilled in the art without departing from the intended spirit and scope thereof . it is intended that the present invention only be limited by the terms of the appended claims . | 7 |
a typical bridge crane , as shown in fig1 includes a runway 4 formed by a pair of overhead parallel rails , a transverse bridge 6 spanning the rails of the runway 4 and movable along the runway by a conventional bridge trolley mechanism , and a hoist trolley 8 either suspended from or supported on a linear track running the length of the bridge 6 . the hoist trolley 8 carries a trolley motor for moving the hoist along the bridge 6 and hoisting apparatus including suitable tackle powered by a reversible hoist motor for raising and lowering the hoisting hook . in the circuit of fig2 power is supplied to operate a hoist motor or the like by means of a stationary control circuit 10 via a stationary bus bar or trolley wire 12 to a movable control circuit 14 which would be mounted on the hoist trolley 8 . thus the bus bar 12 symbolically represents both runway and bridge electrification . the bus bar on the bridge 6 would be connected via another collector to the corresponding bus bar along the runway 4 . in the embodiment described herein , the control circuit 10 is stationary in the true sense , for example , as a panel mounted on a wall of a building . however , in crane installations where an operator cab on the bridge 6 is necessary , the control circuit 10 would be located in the cab , and &# 34 ; stationary &# 34 ; in that situation would mean stationary relative to the bridge . bus bar control would still be used in that case for the hoist motor and the control circuitry would be substantially as described herein . the stationary circuit 10 employs a dc power supply with the output arranged like four 12 volt batteries connected in series with the center connection grounded . the power supply thus provides positive terminals 16 and 18 at 24 and 12 volts respectively , negative terminals 20 and 22 at 12 volts and 24 volts respectively and a common ground terminals 24 . the positive terminals , 16 and 18 are used in connection with two - speed operation of the hoist motor while raising the hook . likewise , the negative terminals 20 and 22 are used for lowering the hook at two different speeds . raising and lowering the hoisting hook is directly analogous to running the hoist trolley 8 back and forth on the bridge 6 or the bridge 6 back and forth along the runway 4 . thus the description of this embodiment as a control circuit for the hoist motor is merely illustrative of the type of control functions accomplished by this circuit . the positive high voltage terminal 16 is connected via push - button switch contacts 26 to a series diode d1 connected to be forward - biased by positive voltage from the terminal 16 . the positive low voltage terminal 18 is similarly connected via a pair of push - button contacts 28 to a similarly oriented series diode d2 . diodes d1 and d2 are connected in common via push - button safety switch contacts 30 to a feeder line 32 connected directly to the bus bar 12 . on the negative side , the low and high negative voltage terminals 20 and 22 are connected respectively via push - button switch contacts 34 and 36 to respective diodes d3 and d4 connected in the opposite fashion from the diodes d1 and d2 so as to be forward - biased by reverse current flowing to the negative voltage terminals 20 and 22 . the diodes d3 and d4 are connected in common via push - button safety switch contacts 38 to the line 32 and bus bar 12 . the six pairs of push - button switch contacts described above are operated by a pair of ganged push - button switches 40 and 42 . the ganged switch 40 is a conventional break - before - make push - button switch having two discrete operative levels of depression . depression of switch 40 to the first level causes normally closed safety switch contacts 38 on the negative side to be opened and contacts 28 for low positive voltage to be closed for raising the hoist at low speed ( up low ) without closing the contacts 26 for the high speed raising operation at high voltage . further depression of the push - button switch 40 to the second level first breaks the connection between contacts 28 ( up low ) and then closes contacts 26 ( up high ). the normally closed contacts 38 remain open at both levels of depression of the push - button switch 40 . the ganged push - button switch 42 operates in the same manner for two - speed lowering . the normally closed safety contacts 30 and 38 insure against the effects of accidental actuation of both switches 40 and 42 at the same time . the diodes d1 and d4 insure complete isolation of the positive and negative high and low voltage terminals . the movable control circuit 14 is powered via a collector , shoe or pantograph 44 which slides along the bus bar as the hoist trolley moves along the bridge or as the bridge moves along the runway . the collector 44 is connected directly to three parallel branch circuits 46 , 48 and 50 . the left - hand branch 46 includes a pair of normally closed contacts 52a operated by the down relay 52 in series with the right - hand branch 50 . the contacts 52a are connected in series with alternate parallel paths 54 and 56 in the left - hand branch 46 . in the path 54 , normally closed contacts 58a are operated by a high relay coil 58 connected to common ground via a resistor r2 in the middle branch 48 . the alternate path 56 includes a resistor r1 in series with a normally open contact 58b operated by the high coil 58 . the alternate paths 54 and 56 are connected in series with an up relay coil 60 , which in turn is connected in series to common ground via a diode d5 connected such that current can only flow in the left - hand branch 46 when one of the positive terminals 16 and 18 is interconnected with bus bar 12 . the right - hand branch 50 includes normally closed relay coil contacts 60a operated by the up coil 60 in the left - hand branch circuit . the relay coil contacts 60a are connected in series to alternate paths 62 and 64 implemented in exactly the same fashion as in the left branch 46 . the path 62 thus includes normally closed high relay contacts 58c and the path 64 includes normally open high relay contacts 58d connected in series with a resistor r3 . the alternate paths 62 and 64 are connected in common to the down relay coil 52 which in turn in connected to common ground via a diode d6 connected to be forward - baised by the negative terminal 20 or 22 in the stationary control circuit 10 . in operation , by pressing the up push button 40 in until the up low contacts 28 close , plus 12 volts current flows to the up relay coil 60 via diode d2 , normally closed contacts 30 , bus bar 12 , collector 44 , normally closed down contacts 52a and normally closed high contacts 58a , through the up relay coil 60 and diode d5 to common ground for a complete circuit . further depression of the up button 40 breaks the positive 12 volt up low circuit and closes the up high 24 volt circuit . the high positive current flows through diode d1 , normally closed contacts 30 , bus bar 12 , collector 44 , high relay coil 58 , resistor r2 , to common ground . the current at this level flowing through the high coil 58 is sufficient to energize the coil to switch the high relay coil contacts 58a through 58d . the 24 volt positive current also flows from the collector 44 to the normally closed down contacts 52a , normally open high contacts 58b ( now closed ), resistor r1 , up coil 60 and diode d5 to common ground , maintaining the upward direction of travel at the higher speed . the resistors r1 and r2 bias the 12 volt relays for 24 volt operation . thus all of the relay coils 52 , 58 and 60 are interchangeable . the operation of the circuit for downward travel with one of the negative voltage terminals connected is analogous to operation in the upward direction . the invention may be embodied in other specific forms without departing from its spirit or essential characteristics . for example , the same circuit can be implemented with equivalent solid state logic circuitry . moreover additional speeds ( voltage levels ) beyond the two described herein can be implemented in an iterative fashion . the present embodiment is , therefore , to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the claims rather than by the foregoing description ; and all changes which come within the meaning and range of the equivalents of the claims are therefore intended to be embraced therein . | 1 |
the invention will now be described by way of exemplary embodiments shown by the drawing figures , in which like reference numerals indicate like elements in all of the several views . turning to fig1 , a data processing host system 2 that may be used to implement the invention is configured with a collection of shared data processing hardware resources that include one or more central processing units ( cpus ) 4 1 , 4 2 . . . 4 n , a memory 6 , and a set of input / output ( i / o ) facilities 8 . a hypervisor program 10 , also known as a virtual machine monitor or vmm , executes as firmware ( or software ) on the system 2 to provide logical partitions for various operating system instances and application programs to be described in more detail below . the hypervisor 10 is assumed to be conventional in nature . as such , it can be implemented according to any of the vmm design concepts that have been in use since hypervisors were first developed in the late 1960s ( taking into account the vm support capabilities of the underlying hardware ). well known examples of commercial hypervisors include the cp control program used in the ibm vm / 370 ® mainframe product introduced by international business machines corporation in 1972 , the current z / vm ® hypervisor used in the ibm zseries ® mainframe product , and the hypervisor used in ibm pseries ® products . note that the references to the foregoing commercial products are not intended to suggest that the invention is limited to any particular system or vendor . as is known to persons skilled in the art , a conventional hypervisor or vmm is a low level service that virtualizes the underlying hardware to provide a subset of the cpu , memory and i / o resources ( i . e ., a virtual machine ) on behalf of higher level “ guests .” in fig1 , the hypervisor 10 is shown to provide four logical partition environments 12 1 , 12 2 , 12 3 and 12 4 on behalf of four operating system instances 14 , 16 , 18 and 20 . each operating system instance 14 , 16 , 18 and 20 , in turn , respectively supports an application space 22 , 24 , 26 and 28 for running user applications . as described in more detail below , one or more of the user applications could be a database server providing database and database management functions on behalf of one or more database clients ( not shown in fig1 ). the hypervisor 10 performs various functions that support concurrent operation of the operating systems 14 - 20 and their applications 22 - 28 on the system 2 . in particular , the hypervisor 10 provides the plural logical partition environments 12 1 , 12 2 , 12 3 and 12 4 by allocating cpu bandwidth , memory and i / o resources , for use by each partition . each operating system 14 - 20 within a partition 12 1 - 12 4 behaves as if it were operating on real hardware , with the hypervisor facilitating such operation by ( 1 ) translating accesses to virtual memory and i / o space to real memory and i / o space accesses , ( 2 ) selectively distributing interrupts from i / o devices to the various operating systems for servicing , and ( 3 ) scheduling cpu process execution on a prioritized basis . note that the operating systems 14 - 20 need not necessarily be unaware of the hypervisor 10 insofar as there are some operating systems that are designed , for efficiency reasons , to cooperate with a hypervisor . the ibm ® aix ® 5l operating system is an example of such a program . lastly , and of significance to the present invention , the data processing system 2 supports conventional dynamic logical partitioning , meaning that the partitions 12 1 - 12 4 can be dynamically reconfigured by adding or removing resources such as processors , memory and i / o slots , or by moving such resources between partitions , without rebooting the operating system instances 14 , 16 , 18 , 20 running therein . as indicated by way of background above , the ibm ® aix ® 5l operating system is an example of an operating system that supports dynamic logical partitioning and does not have to be rebooted when partition reconfiguration occurs . a conventional dynamic partitioning api is also provided by the data processing system 2 so that dynamic logical partitioning requests can be made using automated software control . with additional reference now to fig2 , which presents a different view of the data processing system 2 of fig1 , reference numeral 30 of fig2 illustrates a dynamic partitioning api that is accessible from each of the partitions 12 1 - 12 4 , as is known in the art . as is further conventionally known , the dynamic partitioning api 30 in the fig2 view of the data processing system 2 also maintains an interface to a network 32 configured as a lan ( local area network ) or other communication system . as additionally shown in fig2 , the network 32 connects to the partitions 12 1 - 12 4 , and optionally to one or more remote data processing systems , such as a data processing host 34 . with this connectivity , the dynamic partitioning api 30 can be accessed from each of the partitions 12 1 - 12 4 , and from other systems , such as the host 34 . as mentioned by way of background above , one example of a data processing platform that provides the foregoing dynamic logical partitioning functionality is the ibm pseries ® line of products , such as the p690 and p670 systems , running the ibm ® aix ® 5l operating system . these pseries ® products support a user interface for managing dynamic logical partitioning via a hardware management console ( hmc ). the hmc allows administrators to manually perform dynamic logical partition reconfiguration . in addition , the software supporting the hmc can be accessed by a component found in version 5 . 2 of the ibm ® aix ® 5l operating system known as the dr ( dynamic reconfiguration ) manager . each partition running an instance of the ibm ® aix ® 5l operating system can issue dynamic logical partitioning requests via its dr manager . each partition &# 39 ; s dr manager is in turn accessible to user applications running in the same partition . support is also provided for remote secure shell ( ssh ) execution of dynamic logical partitioning commands sent over a network by software entities running on remote systems . the same kind of local and remote execution support can be provided by the dynamic partitioning api 30 shown in fig2 , as could other conventional forms of command interaction . turning now to fig3 , a database server application 36 is shown that provides database and database management functions for data resident on one or more data storage subsystems 38 . for purposes of example only , it is assumed that there are four of the data storage subsystems 38 , and that these subsystems are respectively associated with four instances of the database server application 36 . each instance of the database server application 36 is assumed to respectively run in one of the application spaces 22 , 24 , 26 and 28 shown in the fig1 view of the data processing system 2 . each such instance could operate separately to implement an independent database on one of the data storage subsystems 38 , or alternatively , each instance could be configured to operate cooperatively with other instances to provide a single distributed database . as is conventionally known , a distributed database can be distributed over multiple physical or logical partitions to facilitate parallel processing on defined subsets of data . in the context of the data processing system 2 , one instance of the database server application 36 could be installed on each logical partition to collectively provide a distributed database with four partitions ( with additional instances physically partitioned on other data processing hosts also being possible ). the database server application 36 is conventionally adapted to communicate with one or more clients 40 issuing database query requests by way of a network 42 , which could be the same as or different than the network 32 of fig2 . the database server application 36 services these client query requests by invoking appropriate database query functions , and returning the query results to the requesting client ( s ), as is conventional . the programming in the database server application 36 is assumed to implement the usual set of database and database management functions . these include , but are not necessarily limited to , various transaction management functions , scheduling functions and data management functions , including but not limited to query optimization , scan processing , join processing , aggregation processing , sort processing , convergence processing , final result set processing , logging , recovery , index management , concurrency control , buffer pool management , and parallel query processing . the database server application 36 may need to accommodate a variety of clients 40 issuing potentially diverse types of database query requests . these requests could include routine online transaction processing ( oltp ) queries in which relatively few database records need to be processed with sub - second response time . the clients 40 could also issue , on an ad hoc basis , processor - intensive decision support system ( dss ) requests requiring hours to complete . to support such query diversity , the database server application 36 is assumed to possess autonomic self - tuning functionality of the type found in modern database management systems . as indicated by way of background above , self - tuning allows various database and database manager parameters to be automatically assigned values based upon current workload and the availability of resources such as cpu ( central processing unit ) cycles , memory , and i / o ( input / output ). given a particular workload and resource availability , parameter values are selected that will produce optimal performance . version 8 of the ibm ® db2 ® database manager product is one example of a database program that may be used to implement the database management server application 36 . tunable parameters associated with database management operations of this partitioned database product include : 1 ) maximum number of parallel operations per sql statement ; 2 ) partition memory available for database server application instance management ; 3 ) number of inter - partition communications buffers ; 4 ) processor speed per instruction ; 5 ) inter - partition communications bandwidth ; 6 ) system monitor switches ; and 7 ) index recreation scheduling . with respect to storage and integrity of the database itself ( as opposed to database management ), tunable parameters in the ibm ® db2 ® database manager product include : 1 ) catalog cache size ; 2 ) utility heap size ; 3 ) database heap size ; 4 ) sort heap size ; 5 ) statement heap size ; 6 ) degree of intra - partition parallelism ; 7 ) table space extent size ; 8 ) extent prefetch size ; 9 ) average number of active applications ; 10 ) maximum number of active applications ; 11 ) package cache size ; 12 ) maximum storage for lock list ; 13 ) maximum number of locks ; 14 ) default query optimization class ; and 15 ) number of commits per commit group . it will be appreciated that other database programs could be used to implement the database server application 36 . thus , the foregoing listing of tunable parameters associated with the ibm ® db2 ® database manager product are set forth for the purpose of illustration only , and not by way of limitation . as indicated by way of summary above , the present invention allows whatever autonomic self - tuning functions that may be present in the database server application 36 to be extended and complemented using the dynamic partitioning functions of the data processing system 2 . this is accomplished by 1 ) defining ( at application deployment time ) one or more desired operational parameters relating to application level resource utilization and / or operating system level performance , 2 ) monitoring the defined parameters during application execution ; and 3 ) performing dynamic logical partition reconfiguration as necessary if the parameters are violated . each instance of the database server application 36 has an associated set of defined parameters that may be referred to as a service level agreement or sla . there is one sla associated with each database server application instance , and each sla can define any number of different parameters . by way of example only , and not by way of limitation , an sla associated with one ( or more ) instances of the database server application 36 might specify the following parameters : 1 ) processor load should be in a range 80 %- 90 % on partition ; 2 ) database buffer pool hit ratio should be & gt ; 95 %; 3 ) database client response time should be & lt ; 5 seconds ; 4 ) . . . . [ others ]. an sla can be continuously ( or periodically ) monitored and whenever one of its parameters is violated , as by the parameter going outside of a defined range for a specified period of time , the associated partition can be dynamically reconfigured . for example , using the exemplary sla above , if the current processor load for a partition is 99 % for five minutes , the partition could be reconfigured by adding a new processor to keep the processor load at or under 90 %. similarly , for database buffer pools , a partition could be reconfigured by adding additional memory if the current buffer pool hit ratio is , for example , 50 % for two minutes . the same is true for processor / memory removal . if there is processor under - utilization and unused buffer pool pages in a partition , a processor and memory could be removed from the partition and placed in a free pool . these resources would then be available in the future to the same partition or to other partitions that need them . note that when partition resources are not available in the free pool , they can be obtained from one or more other partitions that are not as resource sensitive or are defined as lower priority sla partitions . a partition priority and arbitration mechanism can be used to implement such reallocations . the monitoring function for monitoring the slas associated each instance of the database server application 36 can be provided by a monitor running as a thread , process or other execution context in a partition that concurrently runs a database server application instance ( or in any other partition ). for example , as shown in fig2 , if partitions 12 1 , 12 2 , 12 3 and 12 4 each run an instance of the database server application 36 , there could be a monitor mon 1 , mon 2 , mon 3 and mon 4 respectively running on each partition . each monitor can be implemented to run in either operating system kernel mode or user application mode . however , it will be appreciated that the latter requires no operating system modifications and thus may be less costly to implement . as indicated above , each of the monitors mon 1 , mon 2 , mon 3 and mon 4 can track conditions associated with the sla parameters of the database server application instance running in its partition , and initiate responsive action whenever a parameter is violated . this responsive action involves notifying the dynamic partitioning api 30 that partition reconfiguration is required . although it would be possible for each monitor to provide such notification directly to the dynamic partitioning api 30 , efficiency can be improved by providing an intelligent intermediary that controls the manner in which dynamic reconfiguration requests are made to the dynamic partitioning api 30 . in an exemplary embodiment of the invention , this intelligence is provided by a dynamic reconfiguration ( dr ) suggestion listener that can run as a thread , process or other execution context on one of the partitions 12 1 , 12 2 , 12 3 and 12 4 . in fig2 , the dynamic reconfiguration listener ( drl ) is shown by way of example only to run on the partition 12 4 . its function is to receive dynamic reconfiguration suggestions from the monitors mon 1 , mon 2 , mon 3 and mon 4 and then determine what dynamic reconfiguration requests need to be made to the dynamic partitioning api 30 . communication between the listener drl and the monitors mon 1 , mon 2 , mon 3 and mon 4 can be implemented over the network 32 , or by way of a conventional inter - partition communication mechanism provided by the data processing system 2 , if present . the discussion of fig4 below will illustrate the kind of decision making that can be performed by the listener drl following the receipt of dynamic reconfiguration suggestions from the monitors mon 1 , mon 2 , mon 3 and mon 4 . however , before turning to fig4 , it should be pointed out with reference to fig2 that the illustrated arrangement in which the monitors mon 1 , mon 2 , mon 3 and mon 4 and the listener drl are installed on the various partitions of the data processing system 2 is not the only way that these functions can be implemented . as further shown in fig2 , all monitor and listener functions could be implemented on the host 34 , due to that system &# 39 ; s ability to communicate with each partition of the data processing system 2 , as well as the dynamic partitioning api 30 , via the network 32 . relatedly , all of the monitor and listener functions could likewise be implemented on a single one of the partitions 12 1 , 12 2 , 12 3 and 12 4 of the data processing system 2 . turning now to fig4 a and 4b , the illustrated flow diagram represents exemplary processing steps that may be performed in accordance with the invention to support autonomic self - tuning of a database management system in a dynamic logically partitioned environment . in a first step 50 , an sla for a database server application 34 running on the data processing system 2 is accessed by a monitor of the type described above . in step 52 , the monitor continuously ( or periodically ) monitors the partition resources defined in the sla . in fig4 a , this includes the monitoring of processor usage in step 52 ( 1 ) , the monitoring of buffer pool usage in step 52 ( 2 ) , and the monitoring of one or more other partition resources , as shown by step 52 ( n ) . note that all monitoring of partition resources can be performed using conventional operating system calls of the type provided by most modern operating systems . in step 54 , the monitor determines whether the partition resources being monitored are consistent with the corresponding sla parameters . in fig4 a , this includes determining whether processor usage is within the corresponding sla processor usage parameter in step 54 ( 1 ) , whether buffer pool usage is within the corresponding sla buffer pool parameter in step 54 ( 2 ) , and performing similar evaluations for one or more other partition resources being monitored , as shown by step 54 ( n ) . if an sla parameter is not found to be violated in step 54 , processing returns to step 52 . if an sla parameter is found to be violated in step 54 , a test is made in step 56 to determine whether the corresponding processor resource is above or below the sla parameter value . for example , in fig4 a , the illustrated decision box for step 56 represents a determination by the monitor as to whether partition processor resources are being underutilized or over utilized . the monitor then performs suggestion processing , as exemplified by the remaining steps of fig4 a , to determine an appropriate dr suggestion to be made to a listener of the type described above . steps 58 and 60 are performed if processor usage is below the sla parameter . in step 58 , the monitor determines the number of processors that the partition has available to send to a free pool of resources maintained by the data processing system 2 . conventional linear interpolation / extrapolation algorithms are available to make the processor availability determination . for example , if a partition has four running processors and processor usage is 40 %, donating two processors should boost processor usage to a more efficient 80 %. note that the concept of a free pool for logically cataloging available resources is a well - known feature of dynamic logical partitioning environments . in step 60 , the monitor generates a dr suggestion to the listener for processor removal using the number of processors determined in step 58 . steps 62 and 64 are performed if processor usage is above the sla parameter . in step 62 , the monitor determines the number of processors needed by the partition . again , conventional linear interpolation / extrapolation algorithms are available to make this determination . for example , if a partition has four running processors and the processor usage is 100 %, acquiring one more processor will reduce processor usage to 80 %. in step 60 , the monitor generates a dr suggestion to the listener for processor addition using the number of additional processors determined in step 58 . although not shown in fig4 a , similar processing is performed in connection with other partition resources being monitored . as shown in fig4 b , the dr suggestion is processed by the listener in step 66 . if the dr suggestion involves removing resources from the partition issuing the dr suggestion , this is accomplished without further processing by the listener issuing an appropriate remove request to api 30 of fig2 . if the dr suggestion involves adding resources to the partition issuing the dr suggestion , the listener issues an appropriate call to the api 30 in step 68 to determine the availability of resources in the free pool of unassigned resources maintained by the data processing system 2 . based on the response from the api 30 , the listener determines in step 70 whether there are enough of the requested resources in the free pool . if enough resources are available , step 72 is performed in which the listener requests the api 30 to add the requested resources . if there are not enough resources in step 70 , step 74 is performed in which the listener determines the availability of resources in other partitions . this is done by issuing conventional queries to the operating systems in these partitions . in step 76 , the listener evaluates the responses received from the partition ( s ) being queried and determines whether there are available resources that can be borrowed . if there are , step 72 is invoked and the listener requests the api 30 to deliver the required resources from the other partition ( s ) in which the resources are available . if there are not enough resources available in other partitions , the listener performs step 78 to determine whether there are enough resources to partially satisfy the dr suggestion . if there are , the listener requests the api 30 to deliver whatever partial resource requirement can be obtained from the other partitions . if it is determined in step 78 that a partial request cannot be satisfied , processing returns to step 66 . note that the decision making of steps 76 and 78 can involve arbitration by the listener to determine the partitions that are the most likely candidates to give up resources . this arbitration can be based on the evaluation of factors such as partition priority , partition resource sensitivity , sla priority , etc . thus , by way of example only , if all partitions lack extra resources , or are perhaps even low on resources , one or more partitions with the lowest ranking ( s ) according to the factors being evaluated could be selected to satisfy some or all of the resource needs of a requesting partition with higher priority . accordingly , a database partition monitoring and reconfiguration system for supporting an autonomic self - tuning database management system running in a dynamic logical partitioning operating system environment has been disclosed . it will be appreciated that the inventive concepts may be variously embodied in any of a data processing system , a machine implemented method , and a computer program product in which programming means are recorded on one or more data storage media for use in controlling a data processing system to perform the required functions . exemplary data storage media for storing such programming means are shown by reference numeral 100 in fig5 . the media 100 are shown as being portable optical storage disks of the type that are conventionally used for commercial software sales . such media can store the programming means of the invention either alone or in conjunction with an operating system or other software product that incorporates read - copy update functionality . the programming means could also be stored on portable magnetic media ( such as floppy disks , flash memory sticks , etc .) or on magnetic media combined with drive systems ( e . g . disk drives ) incorporated in computer platforms . while several embodiments of the invention have been shown and described , it should be apparent that many variations and alternative embodiments could be implemented . it is understood , therefore , that the invention is not to be in any way limited except in accordance with the spirit of the appended claims and their equivalents . | 6 |
this invention pertains to a novel approach to covalently attach organic molecules to a surface of a type ii , iii , iv , v , or vi material , a doped variant thereof and / or an oxide thereof . in general the method involves : 1 ) providing a heat resistant organic molecule comprising an attachment group and / or derivatized with an attachment group ; and 2 ) contacting the derivatized heat resistant organic molecule a surface comprising a group ii , iii , iv , v , or vi material ; and 3 ) heating the surface and / or molecule to a temperature of at least about 200 ° c . whereby the attachment group forms a covalent bond with the surface . in certain embodiments , the heat resistant organic molecule is dissolved in an organic solvent ( e . g ., thf , mesitylene , durene , o - dichlorobenzene , 1 , 2 , 4 - trichlorobenzene , 1 - chloronaphthalene , 2 - chloronaphthalene , n , n - dimethylformamide , n , n - dimethylacetamide , n , n - dimethylpropionamide , benzonitrile , anisole , and the like ). the solvent containing the molecule can then be applied to the surface . heating can be accomplished by any of a variety of conventional methods . for example , the solvent can be heated before application to the surface . in certain embodiments , both the solvent and the surface can be heated before the solvent is applied to the surface . in certain preferred embodiments , the surface is heated after application of the solvent . this is conveniently accomplished by baking the surface ( e . g ., in an oven ). in certain preferred embodiments , the surface is heated ( e . g ., baked ) under an inert atmosphere ( e . g ., argon or other inert gas ( es )). various parameters can be optimized for attachment of any particular organic molecule . these include ( 1 ) the concentration of the molecule ( s ), ( 2 ) the baking time , and ( 3 ) the baking temperature . fig2 , and 4 show the results of these studies for a representative porphyrin ( molecule 104 in fig1 ). in each figure , the left panel shows the cyclic voltammogram of the covalently attached molecule . the characteristic features of the voltammograms are indicative of covalent attachment and robust electrochemical behavior ( see , e . g ., li et al . ( 2002 appl . phys . lett . 81 : 1494 - 1496 ; roth et al . ( 2003 ) j . am . chem . soc . 125 : 505 - 517 ). the right panel shows the molecular coverage . saturating coverage for this type of molecule is in the range of 10 − 10 mol cm − 2 . although the three parameters above are not independent , the figures illustrate the following key observations . first , using the methods described herein , the molecules can be attached at relatively high surface coverage ( in the range of 5 × 10 − 11 mol cm − 2 ) using micromolar concentrations of materials ( see , e . g ., fig2 ). facile attachment using extremely small amounts of material ( e . g ., concentration less than about 5 mm , preferably less than about 1 mm , more preferably less than about 500 μm or 100 μm , still more preferably less than about 10 μm , and most preferably less than about 1 μm ) is distinctly different from other procedures that have been used to anchor molecules to silicon . these procedures typically use very high concentrations of molecules in solution or neat molecules . the use of very small amounts of material indicates that a few grams of information storage molecules could be used to make millions of chips . the use of small amounts of material also indicates that relatively small amounts of organic solvents can be used , thereby minimizing environmental hazards . in addition , it was a surprising discovery that baking times as short as a few minutes ( e . g ., typically from about 1 sec to about 1 hr , preferably from about 10 sec to about 30 min , more preferably from about 1 minute to about 5 , 10 , or 15 minutes , and most preferably from about 30 sec to about 1 or 2 minutes ) afford high surface coverage ( fig3 ). short times minimize the amount of energy that is used in the processing step . it was also a surprising discovery that baking temperatures as high as 400 ° c . can be used with no degradation of the molecules ( fig4 ). this result is of importance in that many processing steps in fabricating cmos devices entail high temperature processing . in certain embodiments , preferred baking temperatures range from about 125 ° c . to about 400 ° c ., preferably from about 200 ° c . to about 400 ° c ., more preferably from about 250 ° c . to about 400 ° c ., and most preferably from about 300 ° c . to about 400 ° c . a further significant point is that diverse functional groups on the information storage molecules are suitable for use in attachment to silicon or other substrates . the groups include , but are not limited to , alcohol , thiol , s - acetylthiol , bromomethyl , allyl , iodoaryl , carboxaldehyde , ethyne , vinyl , hydroxymethyl . it is also noted that such groups such as ethyl , methyl , or arene afforded essentially no attachment as demonstrated by the failure to achieve substantial attachment with the zinc chelates of octaethylporphyrin , meso - tetraphenylporphyrin , meso - tetra - p - tolylporphyrin , and meso - tetramesitylporphyrin . the successful attachment via s - acetylthiol , bromomethyl , iodoaryl , carboxaldehyde , and ethyne is unprecedented . the successful attachment via the iodoaryl group is extraordinarily valuable in affording a direct aryl - si attachment . the resulting information - storage molecules can be positioned vertically from the surface , which facilitates subsequent patterning . the ability to attach via such diverse functional groups provides great versatility . while in certain embodiments , heating is accomplished by placing the substrate in an oven , essentially any convenient heating method can be utilized , and appropriate heating and contacting methods can be optimized for particular ( e . g ., industrial ) production contexts . thus , for example , in certain embodiments , heating can be accomplished by dipping the surface in a hot solution containing the organic molecules that are to be attached . local heating / patterning can be accomplished using for example a hot contact printer , or a laser . heating can also be accomplished using forced air , a convection oven , radiant heating , and the like . the foregoing embodiments , are intended to be illustrative rather than limiting . it was a surprising discovery that a large number of organic molecules , including redox - active organic molecules , are sufficiently heat resistant to be amenable and even quite effective in the methods of this invention . suitable heat resistant organic molecules typically include , but are not limited to metallocenes ( e . g ., ferrocene ), porphyrins , expanded porphyrins , contracted porphyrins , linear porphyrin polymers , porphyrin sandwich coordination complexes , and porphyrin arrays . certain preferred heat resistant organic molecules include , but are not limited to 5 -[ 4 -( s - acetylthiomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( mercaptomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( hydroxymethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( hydroxymethyl ) phenyl ]- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - formylphenyl )- 15 - phenyl - 10 , 20 - di - p - tolylporphinatozinc ( ii ), 5 -( 4 - bromomethylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - ethynylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - iodophenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - bromophenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - hydroxyphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylphenyl )- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -[ 4 -( 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 , 2 - dioxaborolan - 2 - yl ) phenyl ]- 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 - iodo - 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - iodophenyl )- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -[ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - iodophenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 10 , 15 - tris ( 4 - ethynylphenyl )- 20 - mesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl ) porphinatozinc ( ii ), 5 , 15 - bis ( 3 - ethynylphenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 10 , 15 , 20 - tetrakis ( 4 - ethynylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis [ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -( 3 , 5 - diethynylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 3 , 7 - dibromo - 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 -[ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -[ 4 -( se - acetylselenomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - iodophenyl )- 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylphenyl )- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylbiphen - 4 ′- yl )- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 -( 4 - vinylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - vinylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( hydroxymethyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatocopper ( ii ), type c triple decker [( tert - butyl ) 4 phthalocyaninato ] eu [( tert - butyl ) 4 phthalocyaninato ] eu [ 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - bis ( 4 - tert - butylphenyl ) porphyrin ], type c triple decker [( tert - butyl ) 4 phthalocyaninato ] eu [( tert - butyl ) 4 phthalocyaninato ] eu [ 5 -[ 4 -[ 2 -( 4 -( hydroxymethyl ) phenyl ) ethynyl ] phenyl ]- 10 , 15 , 20 - tri - p - tolylporphyrin ] 5 , 10 - bis [ 4 -( 2 -( triisopropylsilyl ) ethynyl ) biphen - 4 ′- yl ]- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis [ 4 -( 2 -( triisopropylsilyl ) ethynyl ) phenyl ]- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), and the like . the suitablility of particular molecules for use in the methods of this invention can readily be determined . the molecule ( s ) of interest are simply coupled to a surface ( e . g ., a hydrogen passivated surface ) according to the methods of this invention . then sinusoidal voltammetry can be performed ( e . g ., as described herein or in u . s . pat . nos . 6 , 272 , 038 , 6 , 212 , 093 , and 6 , 208 , 553 , pct publication wo 01 / 03126 , or by ( roth et al . ( 2000 ) vac . sci . technol . b 18 : 2359 - 2364 ; roth et al . ( 2003 ) j . am . chem . soc . 125 : 505 - 517 ) to evaluate 1 ) whether or not the molecule ( s ) coupled to the surface , 2 ) the degree of coverage ( coupling ); and 3 ) whether or not the molecule degraded during the coupling procedure . table 1 illustrates the test results ( electrochemical characteristics ) of a number of porphyrins examined using the attachment procedure described herein . for those porphyrins that attached a subjective egfp scale was used to rate their electrochemical behavior . it is noted that the above - described compounds are meant to be illustrative and not limiting . other suitable compounds can readily be ascertained using routine screening procedures as described herein . it is also noted that where certain organic molecules decompose at particular sites at high temperature ( e . g ., 200 ° c . to 400 ° c .) the “ reactive ” site can often be derivatized with a stable protecting group . the molecule can be coupled to the surface according to the methods of this invention and the protecting group can then be chemically removed from the organic molecule . the organic molecule is typically provided in a solvent , dispersion , emulsion , paste , gel , or the like . preferred solvents , pastes , gels , emulsions , dispersions , etc ., are solvents that can be applied to the group ii , iii , iv , v , and / or vi material ( s ) without substantially degrading that substrate and that solubilize or suspend , but do not degrade the organic molecule ( s ) that are to be coupled to the substrate . in certain embodiments , preferred solvents include high boiling point solvents ( e . g ., solvents with an initial boiling point greater than about 130 ° c ., preferably greater than about 150 ° c ., more preferably greater than about 180 ° c .). such solvents include , but are not limited to benzonitrile , dimethylformamide , zylene , orthodichlorobenzene , and the like . to effect attachment to the substrate ( e . g ., a group ii , iii , iv , v , or vi element , semiconductor , and / or oxide ) the heat resistant organic molecule either bears one or more attachment group ( s ) ( e . g ., as substituent ( s )) and / or is derivatized so that it is attached directly or through a linker to one or more attachment groups . a wide variety of attachment molecules ( groups ) are suitable for use in the methods of this invention . such attachment groups include , but are not limited to alcohols , thiols , s - acetylthiols , bromomethyls , allyls , iodoaryls , carboxaldehydes , ethynes , and the like . in certain embodiments , the attachment groups include , but are not limited to 4 -( hydroxymethyl ) phenyl , 4 -( s - acetylthiomethyl ) phenyl , 4 -( se - acetylselenomethyl ) phenyl , 4 -( mercaptomethyl ) phenyl , 4 -( hydroselenomethyl ) phenyl , 4 - formylphenyl , 4 -( bromomethyl ) phenyl , 4 - vinylphenyl , 4 - ethynylphenyl , 4 - allylphenyl , 4 -[ 2 -( trimethylsilyl ) ethynyl ] phenyl , 4 -[ 2 -( triisopropylsilyl ) ethynyl ] phenyl , 4 - bromophenyl , 4 - iodophenyl , 4 - hydroxyphenyl , 4 -( 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 , 2 - dioxaborolan - 2 - yl ) phenyl bromo , iodo , hydroxymethyl , s - acetylthiomethyl , se - acetylselenomethyl , mercaptomethyl , hydroselenomethyl , formyl , bromomethyl , chloromethyl , ethynyl , vinyl , allyl , 4 -[ 2 -( 4 -( hydroxymethyl ) phenyl ) ethynyl ] phenyl , 4 -( ethynyl ) biphen - 4 ′- yl , 4 -[ 2 -( triisopropylsilyl ) ethynyl ] biphen - 4 ′- yl , 3 , 5 - diethynylphenyl , 2 - bromoethyl , and the like . these attachment groups are meant to be illustrative and not limiting . the suitability of other attachment groups can readily be evaluated . a heat resistant organic molecule bearing the attachment group ( s ) of interest ( directly or on a linker ) is coupled to a substrate ( e . g ., hydrogen - passivated si ) according to the methods described herein . the efficacy of attachment can then be evaluated electrochemically , e . g ., using sinusoidal voltammetry as described above . the attachment groups can be substituent ( s ) comprising the heat - resistant organic molecule . alternatively , the organic molecule can be derivatized to covalently link the attachment group ( s ) thereto either directly or through a linker . means of derivatizing molecules , e . g ., with alcohols or thiols are well known to those of skill in the art ( see , e . g ., gryko et al . ( 1999 ) j . org . chem ., 64 : 8635 - 8647 ; smith and march ( 2001 ) march &# 39 ; s advanced organic chemistry , john wiley & amp ; sons , 5th edition , etc .). where the attachment group comprises an alcohol , in certain embodiments , suitable alcohols include , but are not limited to a primary alcohol , a secondary alcohol , a tertiary alcohol , a benzyl alcohol , and an aryl alcohol ( i . e ., a phenol ). certain particularly preferred alcohols include , but are not limited to 2 to 10 carbon straight chain alcohols , benzyl alcohol , and phenethyl alcohol . when the attachment group comprises a thiol , in certain embodiments , suitable thiols include , but are not limited to a primary thiol , a secondary thiol , a tertiary thiol , a benzyl thiol , and an aryl thiol . particularly preferred thiols include , but are not limited to 2 to 10 carbon straight chain thiols , benzyl thiol , and phenethyl thiol . the methods of this invention are suitable for covalently coupling organic molecules to essentially any or all group ii , iii , iv , v , or vi materials ( e . g ., group ii , iii , iv , v , or vi elements , semiconductors , and / or oxides thereof ), more preferably to essentially any or all group iii , iv , or v materials ( e . g ., carbon , silicon , germanium , tin , lead ), doped group ii , iii , iv , v , and vi elements , or oxides of pure or doped group ii , iii , iv , v , or vi elements . in certain preferred embodiments the surface is group iii , iv , or v material , more preferably a group iv material ( oxide , and / or doped variant ), still more preferably a silicon or germanium surface or a doped and / or oxidized silicon or germanium surface . the group ii , iii , iv , v , or vi element can be essentially pure , or it can be doped ( e . g ., p - or n - doped ). p - and n - dopants for use with group ii - vi elements , in particular for use with groups iii , iv , and v elements , more particularly for use with group iv elements ( e . g ., silicon , germanium , etc .) are well known to those of skill in the art . such dopants include , but are not limited to phosphorous compounds , boron compounds , arsenic compounds , aluminum compounds , and the like . many doped group ii , iii , iv , v , or vi elements are semiconductors and include , but are not limited to zns , znse , znte , cds , cdse , cdte , mgs , mgse , mgte , cas , case , cate , srs , srse , srte , bas , base , bate , gan , gap , gaas , gasb , inp , inas , insb , als , alp , alsb , pbs , pbse , ge and si and ternary and quaternary mixtures thereof . the surface can take essentially any form . for example , it can be provided as a planar substrate , an etched substrate , a deposited domain on another substrate and the like . particularly preferred forms include those forms of common use in solid state electronics fabrication processes . although not necessarily required , in certain embodiments the surface is cleaned before use , e . g ., using standard methods known to those of skill in the art . thus , for example , in one preferred embodiment , the surface can be cleaned by sonication in a series of solvents ( e . g ., acetone , toluene , acetone , ethanol , and water ) and then exposed to a standard wafer - cleaning solution ( e . g ., piranha ( sulfuric acid : 30 % hydrogen peroxide , 2 : 1 )) at an elevated temperature ( e . g ., 100 ° c .). in certain embodiments , oxides can be removed from the substrate surface and the surface can be hydrogen passivated . a number of approaches to hydrogen passivation are well known to those of skill in the art . for example , in one approach , a flow of molecular hydrogen is passed through dense microwave plasma across a magnetic field . the magnetic field serves to protect the sample surface from being bombarded by charged particles . hence the crossed beam ( cb ) method makes it possible to avoid plasma etching and heavy ion bombardment that are so detrimental for many semiconductor devices ( see , e . g ., balmashnov , et al . ( 1990 ) semiconductor science and technology , 5 : 242 ). in one particularly preferred embodiment , passivation is by contacting the surface to be passivated with an ammonium fluoride solution ( preferably sparged of oxygen ). other methods of cleaning and passivating surfaces are known to those of skill in the art ( see , e . g ., choudhury ( 1997 ) the handbook of microlithography , micromachining , and microfabrication , soc . photo - optical instru . engineer , bard & amp ; faulkner ( 1997 ) fundamentals of microfabrication , and the like ). in certain embodiments , the heat - resistant organic molecules are attached to form a uniform film across the surface of the group ii , iii , iv , v , or vi material . in other embodiments , the organic molecules are separately coupled at one or more discrete locations on the surface . in certain embodiments , different molecules are coupled at different locations on the surface . the location at which the molecules are coupled can be accomplished by any of a number of means . for example , in certain embodiments , the solution ( s ) comprising the organic molecule ( s ) can be selectively deposited at particular locations on the surface . in certain other embodiments , the solution can be uniformly deposited on the surface and selective domains can be heated . in certain embodiments , the organic molecules can be coupled to the entire surface and then selectively etched away from certain areas . the most common approach to selectively contacting the surface with the organic molecule ( s ) involves masking the areas of the surface that are to be free of the organic molecules so that the solution containing the molecule ( s ) cannot come in contact with those areas . this is readily accomplished by coating the substrate with a masking material ( e . g ., a polymer resist ) and selectively etching the resist off of areas that are to be coupled . alternatively a photoactivatible resist can be applied to the surface and selectively activated ( e . g ., via uv light ) in areas that are to be protected . such “ photolithographic ” methods are well known in the semiconductor industry ( see e . g ., van zant ( 2000 ) microchip fabrication : a practical guide to semiconductor processing ; nishi and doering ( 2000 ) handbook of semiconductor manufacturing technology ; xiao ( 2000 ) introduction to semiconductor manufacturing technology ; campbell ( 1996 ) the science and engineering of microelectronic fabrication ( oxford series in electrical engineering ), oxford university press , and the like ). in addition , the resist can be patterned on the surface simply by contact printing the resist onto the surface . other approaches involve contact printing of the reagents , e . g ., using a contact printhead shaped to selectively deposit the reagent ( s ) in regions that are to be coupled , use of an inkjet apparatus ( see e . g ., u . s . pat . no . 6 , 221 , 653 ) to selectively deposit reagents in particular areas , use of dams to selectively confine reagents to particular regions , and the like . in certain preferred embodiments , the coupling reaction is repeated several times . after the reaction ( s ) are complete , uncoupled organic molecules are washed off of the surface , e . g ., using standard wash steps ( e . g ., benzonitrile wash followed by sonication in dry methylene chloride ). the foregoing methods are intended to be illustrative . in view of the teachings provided herein , other approaches will be evident to those of skill in the semiconductor fabrication arts . it was a surprising discovery of this invention that coupling of redox - active molecules to a doped or undoped substrate ( e . g ., a substrate comprising a group iii , iv , or v element ) results in higher and more uniform packing of the organic molecules ( e . g ., redox - active species ) than other previously known methods . with redox - active organic molecules this manifests as lower oxidative current at higher anodic potentials observed in voltametric measurements . in addition , a cyclic voltammogram shows sharper and more symmetric peaks . in addition , the improved uniformity and higher packing density of redox - active molecules on the substrate results in materials capable of storing a significantly higher charge density . thus , in preferred embodiments , this invention provides a group iv element substrate having coupled thereto one or more redox - active species that can store charge at a charge density of at least about 75 μcoulombs / cm 2 , preferably at least about 100 μcoulombs / cm 2 , more preferably at least about 150 μcoulombs / cm 2 , and most preferably of at least about 200 or 250 μcoulombs / cm2 per non - zero oxidation state of the redox - active molecules . such materials are useful in the fabrication of molecular memories ( memory chips ). where various binding moieties are used instead of redox - active species , the high uniformity and molecule density provides sensors having greater sensitivity and selectivity for a particular analyte . [ heading - 0101 ] vii . uses of organic molecules coupled to a group iv material . the methods of this invention can be used to attach essentially any heat - resistant organic molecule to a group ii , iii , iv , v , or vi material surface , preferably to a group iii , iv , or v surface . in certain preferred embodiments , the molecule is a redox - active molecule and can be used to form a molecular memory . in other preferred embodiments , the molecule can be essentially any other heat - resistant molecule . certain other heat - resistant molecules include , but are not limited to binding partner ( e . g ., certain antibodies , ligands , nucleic acids , sugars , etc .) and can be used to form a sensor for detecting particular analyte ( s ). in “ molecular memory ” redox - active molecules ( molecules having one or more non - zero redox states ) coupled to the group ii , iii , iv , v , or vi materials are used to store bits ( e . g ., each redox state can represent a bit ). the redox - active molecule attached to the substrate material ( e . g ., silicon , germanium , etc .) forms a storage cell capable of storing one or more bits in various oxidation states . in certain embodiments , the storage cell is characterized by a fixed electrode electrically coupled to a “ storage medium ” comprising one or more redox - active molecules and having a multiplicity of different and distinguishable oxidation states . data is stored in the ( preferably non - neutral ) oxidation states by the addition or withdrawal of one or more electrons from said storage medium via the electrically coupled electrode . the oxidation state of the redox - active molecule ( s ) can be set and / or read using electrochemical methods ( e . g ., cyclic voltammetry ), e . g ., as described in u . s . pat . nos . 6 , 272 , 038 , 6 , 212 , 093 , and 6 , 208 , 553 and pct publication wo 01 / 03126 . because group ii , iii , iv , v , and vi materials , in particular group iv materials ( e . g ., silicon , germanium , etc . ), are commonly used in electronic chip fabrication , the methods provided herein readily lend themselves to the fabrication of molecular memory chips compatible with existing processing / fabrication technologies . in addition , details on the construction and use of storage cells comprising redox - active molecules can be found , in u . s . pat . nos . 6 , 272 , 038 , 6 , 212 , 093 , and 6 , 208 , 553 and pct publication wo 01 / 03126 . certain preferred redox - active molecules suitable for use in this invention are characterized by having a multiplicity of oxidation states . those oxidation states are provided by one or more redox - active units . a redox - active unit refers to a molecule or to a subunit of a molecule that has one or more discrete oxidation states that can be set by application of an appropriate voltage . thus , for example , in one embodiment , the redox - active molecule can comprise two or more ( e . g ., 8 ) different and distinguishable oxidation states . typically , but not necessarily , such multi - state molecules will be composed of several redox - active units ( e . g ., porphyrins or ferrocenes ). each redox - active molecule is itself at least one redox - active unit , or comprises at least one redox - active unit , but can easily comprise two or more redox - active units . preferred redox - active molecules include , but are not limited to porphyrinic macrocycles . particularly preferred redox - active molecules include a porphyrin , an expanded porphyrin , a contracted porphyrin , a ferrocene , a linear porphyrin polymer , a porphyrin sandwich coordination complex , and a porphyrin array . in certain embodiments , the redox - active molecule is a metallocene as shown in formula i . where l is a linker , m is a metal ( e . g ., fe , ru , os , co , ni , ti , nb , mn , re , v , cr , w ), s 1 and s 2 are substituents independently selected from the group consisting of aryl , phenyl , cycloalkyl , alkyl , halogen , alkoxy , alkylthio , perfluoroalkyl , perfluoroaryl , pyridyl , cyano , thiocyanato , nitro , amino , alkylarnino , acyl , sulfoxyl , sulfonyl , imido , amido , and carbamoyl . in preferred embodiments , a substituted aryl group is attached to the porphyrin , and the substituents on the aryl group are selected from the group consisting of aryl , phenyl , cycloalkyl , alkyl , halogen , alkoxy , alkylthio , perfluoroalkyl , perfluoroaryl , pyridyl , cyano , thiocyanato , nitro , amino , alkylamino , acyl , sulfoxyl , sulfonyl , imido , amido , and carbamoyl . certain suitable substituents include , but are not limited to , 4 - chlorophenyl , 3 - acetamidophenyl , 2 , 6 - dichloro - 4 - trifluoromethyl , and the like . preferred substituents provide a redox potential range of less than about 2 volts . x is selected from the group consisting of a substrate , a reactive site that can covalently couple to a substrate ( e . g ., an alcohol , a thiol , etc .). it will be appreciated that in some embodiments , l - x is an alcohol or a thiol . in certain instances l - x can be replaced with another substituent ( s 3 ) like s 1 or s 2 . in certain embodiments , l - x can be present or absent , and when present preferably is 4 - hydroxyphenyl , 4 -( 2 -( 4 - hydroxyphenyl ) ethynyl ) phenyl , 4 -( hydroxymethyl ) phenyl , 4 - mercaptophenyl , 4 -( 2 -( 4 - mercaptophenyl ) ethynyl ) phenyl , 4 - mercaptomethylphenyl , 4 - hydroselenophenyl , 4 -( 2 -( 4 - hydroselenophenyl ) ethynyl ) phenyl , 4 - hydrotellurophenyl , 4 -( hydroselenomethyl ) phenyl , 4 -( 2 -( 4 - hydrotellurophenyl ) ethynyl ) phenyl , 4 -( hydrotelluromethyl ) phenyl , and the like . the oxidation state of molecules of formula i is determined by the metal and the substituents . various suitable metallocenes are disclosed in u . s . pat . nos . 6 , 272 , 038 , 6 , 212 , 093 , and 6 , 208 , 553 , and pct publication wo 01 / 03126 . other suitable redox - active molecules include , but are not limited to porphyrins illustrated by formula ii . where , f is a redox - active subunit ( e . g ., a ferrocene , a substituted ferrocene , a metalloporphyrin , or a metallochlorin , etc . ), j 1 is a linker , m is a metal ( e . g ., zn , mg , cd , hg , cu , ag , au , ni , pd , pt , co , rh , ir , mn , b , al , ga , pb , and sn ), s 1 and s 2 are independently selected from the group consisting of aryl , phenyl , cycloalkyl , alkyl , halogen , alkoxy , alkylthio , perfluoroalkyl , perfluoroaryl , pyridyl , cyano , thiocyanato , nitro , amino , alkylamino , acyl , sulfoxyl , sulfonyl , imido , amido , and carbamoyl wherein said substituents provide a redox potential range of less than about 2 volts , k 1 , k 2 , k 3 , and k 4 are independently selected from the group consisting of n , o , s , se , te , and ch ; l is a linker ; x is selected from the group consisting of a substrate , a reactive site that can covalently couple to a substrate . in preferred embodiments , x or l - x is an alcohol or a thiol . in some embodiments l - x can be eliminated and replaced with a substituent independently selected from the same group as s 1 or s 2 . other suitable molecules include , but are not limited to 5 -[ 4 -( s - acetylthiomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( mercaptomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( hydroxymethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -[ 4 -( hydroxymethyl ) phenyl ]- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - formylphenyl )- 15 - phenyl - 10 , 20 - di - p - tolylporphinatozinc ( ii ), 5 -( 4 - bromomethylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - ethynylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - iodophenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - bromophenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - hydroxyphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylphenyl )- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -[ 4 -( 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 , 2 - dioxaborolan - 2 - yl ) phenyl ]- 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 - iodo - 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - iodophenyl )- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -[ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - iodophenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 10 , 15 - tris ( 4 - ethynylphenyl )- 20 - mesitylporphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 15 - bis ( 4 - ethynylphenyl ) porphinatozinc ( ii ), 5 , 15 - bis ( 3 - ethynylphenyl )- 10 , 20 - dimesitylporphinatozinc ( ii ), 5 , 10 , 15 , 20 - tetrakis ( 4 - ethynylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis [ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 15 , 20 - dimesitylporphinatozinc ( ii ), 5 -( 3 , 5 - diethynylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 3 , 7 - dibromo - 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 -[ 4 -( 2 -( trimethylsilyl ) ethynyl ) phenyl ]- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -[ 4 -( se - acetylselenomethyl ) phenyl ]- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - iodophenyl )- 10 , 20 - bis ( 3 , 5 - di - tert - butylphenyl )- 15 - mesitylporphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylphenyl )- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis ( 4 - ethynylbiphen - 4 ′- yl )- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 -( 4 - vinylphenyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - vinylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( hydroxymethyl )- 10 , 15 , 20 - trimesitylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatozinc ( ii ), 5 -( 4 - allylphenyl )- 10 , 15 , 20 - tri - p - tolylporphinatocopper ( ii ), type c triple decker [( tert - butyl ) 4 phthalocyaninato ] eu [( tert - butyl ) 4 phthalocyaninato ] eu [ 5 , 15 - bis ( 4 - ethynylphenyl )- 10 , 20 - bis ( 4 - tert - butylphenyl ) porphyrin ], type c triple decker [( tert - butyl ) 4 phthalocyaninato ] eu [( tert - butyl ) 4 phthalocyaninato ] eu [ 5 -[ 4 -[ 2 -( 4 -( hydroxymethyl ) phenyl ) ethynyl ] phenyl ]- 10 , 15 , 20 - tri - p - tolylporphyrin ] 5 , 10 - bis [ 4 -( 2 -( triisopropylsilyl ) ethynyl ) biphen - 4 ′- yl ]- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), 5 , 10 - bis [ 4 -( 2 -( triisopropylsilyl ) ethynyl ) phenyl ]- 15 , 20 - bis ( 4 - tert - butylphenyl ) porphinatozinc ( ii ), and the like . control over the hole - storage and hole - hopping properties of the redox - active units of the redox - active molecules used in the memory devices of this invention allows fine control over the architecture of the memory device . such control is exercised through synthetic design . the hole - storage properties depend on the oxidation potential of the redox - active units or subunits that are themselves or that are used to assemble the redox - active storage media used in the devices of this invention . the hole - storage properties and redox potential can be tuned with precision by choice of base molecule ( s ), associated metals and peripheral substituents ( yang et al . ( 1999 ) j . porphyrins phthalocyanines , 3 : 117 - 147 ). the design of molecules for molecular memory is discussed in detail in u . s . pat . nos . 6 , 272 , 038 , 6 , 212 , 093 , and 6 , 208 , 553 , and pct publication wo 01 / 03126 . in still another embodiment , this invention provides kits for practice of the method of this invention or for use of the materials produced by methods of this invention . in one embodiment , the kit comprises one or more reagents used to couple an organic molecule to a type ii , iii , iv , v , or vi material according to the methods of this invention . such reagents include , but are not limited to reagents for cleaning and / or passivating the material surface , and / or the organic molecule ( s ) that are to be coupled to the surface , and / or attachment molecules for derivatizing the organic molecule ( s ) ( e . g ., reagents for derivatizing an organic molecule with an alcohol or a thiol ), and / or solvents for use in coupling the derivatized organic molecule to the surface , and / or reagents for washing the derivatized surface , and the like in certain embodiments , the kits comprise a type ii , iii , iv , v , or vi material having a heat - resistant organic molecule ( e . g ., a redox - active molecule ) coupled thereto as described herein . the type ii , iii , iv , v , or vi material can , in certain embodiments , comprise a molecular memory and in , certain embodiments , comprise a sensor . in addition , the kits can optionally include instructional materials containing directions ( i . e ., protocols ) for the practice of the methods of this invention . preferred instructional materials provide protocols utilizing the kit contents for coupling a heat - resistant organic molecule to a type ii , iii , iv , v , or vi material according to the methods of this invention , and / or for using type ii , iii , iv , v , or vi materials having coupled organic molecules as memory elements or as sensors . while the instructional materials typically comprise written or printed materials they are not limited to such . any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention . such media include , but are not limited to electronic storage media ( e . g ., magnetic discs , tapes , cartridges , chips ), optical media ( e . g ., cd rom ), and the like . such media may include addresses to internet sites that provide such instructional materials . the following examples are offered to illustrate , but not to limit the claimed invention . molecules can perform in electronic devices under real - world processing and operating conditions the central tenet of the field of molecular electronics is that molecular components can be used as functional elements in place of the semiconductor - based devices present in conventional microcircuitry ( kwok and ellenbogen ( 2002 ) materials today , 28 - 37 ; carroll and gorman ( 2002 ) angew . chem . int . ed . 41 : 4378 - 4400 ). to serve in this role , the molecular components should remain robust under daunting conditions including high - temperature ( e . g ., 400 ° c .) processing steps during manufacture and very large numbers ( 10 9 - 10 12 ) of operational cycles over a lifetime ( international technology roadmap for semiconductors ( itrs ), semiconductor industry association , san jose , calif . ( 2000 )). there has been considerable skepticism whether molecular materials possess adequate stability to meet such requirements . herein , we demonstrate that porphyrin - based information storage media meet the processing and operating challenges required for use in computational devices . our approach for molecular - based information storage employs redox - active porphyrin molecules as charge - storage elements ( roth et al . ( 2000 ) vac . sci . technol . b 18 : 2359 - 2364 ). we have shown that these molecules can be covalently attached to device - grade silicon platforms to form the basis of first - generation hybrid molecular / semiconductor devices ( roth et al . ( 2003 ) j . am . chem . soc . 125 : 505 - 517 ). the porphyrin - based information storage elements exhibit charge - retention times that are long ( minutes ) compared with those of the semiconductor elements in dynamic random access memory ( milliseconds ) ( roth et al . ( 2000 ) vac . sci . technol . b 18 : 2359 - 2364 ; roth et al . ( 2003 ) j . am . chem . soc . 125 : 505 - 517 ). these molecules also exhibit redox characteristics that make them amenable for use as multibit information - storage media . fig5 a shows the cyclic voltammetric behavior of a porphyrin monolayer tethered to si ( 100 ) via a si — o — c linkage . this monolayer was formed by placing a small amount (˜ 1 μl ) of a dilute solution (˜ 100 μm ) on a micron - scale photolithographically patterned , hydrogen - passivated si ( 100 ) platform and baking the sample at 400 ° c . for several minutes under inert atmosphere conditions . the voltammetric response of the porphyrin monolayer is identical to that of porphyrin monolayers formed at much lower temperatures ( 100 - 200 ° c . for several hours ) ( roth et al . ( 2003 ) j . am . chem . soc . 125 : 505 - 517 ) and demonstrates that molecular integrity is maintained at temperatures where most organic molecules thermally decompose . the high - temperature procedure is readily adaptable to current semiconductor fabrication technology and has the important added benefit that extremely small quantities of material are needed to make a device . the robustness of the porphyrin information - storage medium was examined by repeatedly performing the cycle of ( 1 ) oxidizing the electrically neutral monolayer and ( 2 ) reducing the resulting positively charged monolayer to its electrically neutral state . the oxidation event is equivalent to writing a bit of information ; the reduction event is equivalent to erasing or destructively reading out the information . the five voltammograms in fig5 a show the response of the system after 0 , 2 . 5 × 10 4 , 1 . 8 × 10 6 , 1 . 1 × 10 9 , and 1 . 0 × 10 10 oxidation / reduction cycles . during the experiment , the nature of the electrical cycling was varied . on some days , the system was continuously cycled for 24 hrs . on others , cycling was stopped intentionally for periods ranging from a few minutes up to 12 hrs . at one point , cycling was stopped unintentionally due to an electrical power failure . the data indicate that after an initial “ burn - in ” period of ˜ 10 7 cycles the voltammetric response stabilizes . this robustness of the system is further illustrated in fig5 b wherein the integrated voltammetric signal ( corresponding to the charge in the monolayer ) is plotted as a function of the number of cycles . these data indicate that the charge - storage characteristics of the monolayer exhibit minimal variation ( few percent ) over the course of the entire experiment . at the time cycling was arbitrarily stopped (& gt ; 10 10 cycles ; ˜ 27 days ), the system showed no signs of degradation . collectively , these data indicate that the porphyrin - based information storage medium is extremely robust and augur well for the use of selected molecules in hybrid molecular / semiconductor electronic devices . it is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims . all publications , patents , and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes . | 8 |
referring to the drawings in detail , depicts a conventional hair clipper 1 is provided with the bottom blade 2 attached at the front end of the clipper 1 with the usual reciprocating blade 3 mounted above the bottom fixed blade 2 and having a space 20 between the two blades . on the underside of the clipper 1 , the wedge 5 can be mounted . the hair clipper blade illustrated is a conventional example of one type of hair clipper on which the invention may be mounted . the wedge 5 can be one piece ( as shown in fig4 ) or two pieces ; the preferred embodiment is in two pieces . the wedge 5 is made up of a left portion 6 and a right portion 7 which are generally mirror images of each other . each portion has a top side 8 and 9 , respectively , a bottom side , 10 and 11 , respectively , and a predetermined angle 12 in the range of 1 degree to 90 degrees formed at an apex 50 . the bottom sides , 10 and 11 , can easily slide or glide over a cutting surface 30 , allowing for hair 40 to pass through the bottom fixed blade 2 and the reciprocating blade 3 to get cut . the uncut hair then passes under the bottom sides . the wedge 5 supports the clipper 1 at a selected angle 12 and retains the blades 2 and 3 at a desired elevation and angle relative to the cutting surface 30 . at the outside leading edge 13 of each top side of the portions is fixedly mounted is a front leading - edge tab 14 , a rear leading - edge tab 15 , and a back tab 16 which slide into the space 20 and frictionally grip the bottom blade 2 . the left portion 6 has a fixedly mounted protruding clip 17 which aligns with the receiving dip 18 on the right portion 7 . the protruding clip 17 is inserted into the receiving clip 18 which secures the left portion and the right portion to form the wedge 5 as a whole . the user can depress the nodule 19 on the protruding clip to release the protruding clip from the receiving clip which will release the left and right portions which can then be removed from the bottom blade . there are various attachment mechanisms that would allow the wedge to remain as a fixed , but removable , attachment to the clipper besides the frictional gripping of the portions by the tabs mentioned above . limiting movement of the wedge upon the clippers is paramount . other attachment mechanisms could include magnets , screws , hook and loop material , or any other suitable manner . it is to be noted that with the attachment of the wedge 5 to the clippers 1 , the bottom blade 2 and reciprocating blade 3 is disposed in a downward direction toward the cutting surface 30 forming a constant angle 12 as long as the bottom side of the wedge is sliding along the cutting surface whereby the blades of the clipper is positioned close to , but nevertheless spaced above , the cutting surface so as to cut the hair to a uniform , length . the foregoing description is for purposes of illustration only and is not intended to limit the scope of protection accorded this invention . the scope of protection is to be measured by the claims , which should be interpreted as broadly as the inventive contribution permits . the wedge 5 can also be attached to the clipper 1 by a magnet 60 . the wedge 5 can also be attached to the bottom fixed blade 2 by penetrating screws 70 . although exemplary embodiments of the invention have been shown and described , many changes , modifications and substitutions may be made by one having ordinary skill in the art without necessarily departing from the spirit and scope of this invention . | 1 |
in the following description , certain specific details are set forth in order to provide a thorough understanding of various embodiments of the invention . however , one skilled in the art will understand that the invention may be practiced without these details . in other instances , well - known structures associated with computers , computer networks , data structures , databases and networks such as the internet , have not been described in detail to avoid unnecessarily obscuring the descriptions of the embodiments of the invention . unless the context requires otherwise , throughout the specification and claims which follow , the word “ comprise ” and variations thereof , such as “ comprises ” and “ comprising ” are to be construed in an open , inclusive sense , that is as “ including but not limited to .” [ 0017 ] fig1 shows a parts identification and tracking system 10 including a number of client computing systems 12 and a server computing system 14 that communicate over a network , such as the world wide web portion of the internet 18 . the client computing systems 12 each include a display 20 , screen 22 , cabinet 24 , keyboard 26 and mouse 28 . the mouse 28 can have one or more user selectable buttons for interacting with a graphical user interface (“ gui ”) displayed on the screen 22 . the cabinet 24 includes a slot 30 for receiving computer - readable media , such as a cd - rom disk 32 . although the computer - readable media is represented as a cd - rom disk 32 , the parts identification and tracking system 10 can employ other computer - readable media , including but not limited to , floppy disks , tape , flash memory , system memory , and hard drives . the server computing system 14 includes a cabinet 24 having a slot 30 for receiving computer - readable media , such as a cd - rom disk similar to the cd - rom disk 32 . the server computing system 14 can optionally include a display , screen , keyboard , and / or mouse as described above . the server computing system 14 also includes a server database 34 . the server database 34 is shown as being external to the cabinet 24 for ease of representation in the drawings , although in many embodiments the server database 34 can be located within the cabinet 24 . the network 18 can take the form of any conventional network , such as one or more local area networks (“ lans ”), wide area networks (“ wans ”), and / or extranets , intranets , or the internet . [ 0020 ] fig2 shows a system block diagram of the client computing systems 12 used in executing an illustrated embodiment of the present invention . as in fig1 the client computing systems 12 each include the display 20 , keyboard 26 and mouse 28 . additionally , each of the client computing systems 12 can include subsystems , such as a processor 36 , system memory 38 , fixed persistent memory 40 , media drive 42 , display adapter 44 , sound card 46 , speakers 48 , and network interface 50 . arrows 52 represent the system bus architecture of the client computing systems 12 . the client computing systems 12 can take any of a variety of forms , such as a micro - or personal computer , a mini - computer , a workstation , or a palm - top or hand - held computing appliance . the processor 36 can take the form of any suitable microprocessor , for example , a pentium ii , pentium iii , power pc 603 or power pc 604 processor . the system memory 38 can take the form of random access memory (“ ram ”) or other dynamic storage that temporarily stores instructions and data for execution by the processor 36 . the fixed persistent memory 40 can take the form of a hard drive or other nonvolatile computer - readable media . the media drive 42 can take the form of a cd - rom reader , dvd reader , optical disk reader , floppy disk reader , or other similar device that reads instructions and / or data from computer - readable media . while not shown in detail , the server computing system 14 can have a similar structure to the client computing systems 12 , as shown in fig2 . in practice , the server computing system will typically take the form of a web server , the details of which are commonly understood by those skilled in the art . the server computing system 14 employs database software , such as structured query language (“ sql ”) software , to store and retrieve data within the server database 34 . the computing systems 12 , 14 are illustrative of the numerous computing systems suitable for use with the present invention . other suitable configurations of computing systems will be readily apparent to one of ordinary skill in the art . other configurations can include additional subsystems , or fewer subsystems , as is suitable for the particular application . for example , a suitable computing system 12 , 14 can include more than one processor 36 ( i . e ., a multiprocessor system ) and / or a cache memory . the arrows 52 are illustrative of any interconnection scheme serving to link the subsystems . other suitable interconnection schemes will be readily apparent to one skilled in the art . for example , a local bus could be utilized to connect the processor 36 to the system memory 38 and the display adapter 34 . [ 0024 ] fig3 shows a portion of a bill of material data structure 40 for a particular machine , such as a power turbine . the bill of material data structure 40 is illustrated as a bill of material table 42 including parts information for the various parts of the machine , although other formats may be suitable . the bill of material data structure 40 can take the form of an computer - readable file resulting directly from the design / manufacturing process , or can be an computer - readable file populated from a prior existing set of legacy data , such as by typing or scanning data from a paper bill of material . the bill of material table 42 includes a number of rows 44 corresponding to the individual parts and / or groups of parts forming the machine . the bill of material table 42 includes a number of columns for detailing information regarding each of the parts . for example , a “ unit identifier ” column 46 (“ unit num ”) contains an identifier such as a serial number for a unit to which the corresponding part belongs . the unit identifier can , for example , identify a model of machine . a “ parent ” column 48 (“ mpl items ”) identifies a assembly or sub - assembly to which the part belongs , if any . for example , a joint vent tube is a component of a connection joint insulation and hardware assembly . a “ parent part description ” column 50 (“ parent part desc ”) provides a brief textual description of the assembly or sub - assembly . often , the designers and engineers create the brief textual description , and intend the description only for internal use . thus , the brief textual description is typically cryptic , employing jargon such as abbreviations and acronyms that are not readily understood by those who are not intimately familiar with the machine . for example , the textual description for a connection joint insulation and hardware sub - assembly may be “ b7k - joint insul & amp ; hdwr .” a “ child part identifier ” column 52 (“ child part ”) contains an identifier such as a serial number identifying the part to which the row corresponds . a “ child part description ” column 54 (“ child part desc ”) includes a brief textual description of the part . again , the legacy textual description is likely to employ jargon such as abbreviations and acronyms that are not readily understood by those who are not intimately familiar with the machine . for each of the parts , a “ quantity description ” column 56 (“ quantity ”) identifies the number of the corresponding parts for the machine , assembly and / or sub - assembly . a “ unit of measure ” column 58 (“ um ”) identifies the units of measure in which the quantity is specified . for example , the unit of measurement can be “ each ” (“ ea ”) referring to each individual part . an “ mpl item number ” column 60 (“ mli ”) contains a part identifier from the original master parts list . in many cases , the part identifier is the only piece of part information that is not lost or changed as the master parts list evolves into the bill of materials . a “ distribution code ” column 62 (“ code ”) identifies a distribution code for the part . a “ category identifier ” column 64 (“ category ”) identifies a category to which the part belongs . for example , a part may form a portion of a stator (“ s ”) of a turbine . [ 0027 ] fig3 also shows a portion of a translation data structure 66 for company &# 39 ; s machines . the translation data structure 66 is illustrated as a translation table 68 including parts information for the various parts , assemblies and / or sub - assemblies . the parts identification and tracking system 10 generates the translation data structure from the bill of materials data structure 40 , with or without human assistance . a single translation data structure 66 can store all the parts information for one or more machines . thus , the company can make available a single parts listing for each of its products . the translation table 68 includes a number of rows 70 corresponding to each of the individual parts and / or groups of parts . the translation table 68 also includes a number of columns for detailing information regarding each of the parts . several of these columns are similar to the columns from the bill of material table 42 . for example , an “ mpl item number ” column (“ mli ”) 72 is similar to the “ mpl item number ” column 60 of the bill of material table 42 , containing the part identifier from the original master parts list . a “ distribution code ” column 74 (“ code ”) is similar to the “ distribution code ” column 62 of the bill of materials table 42 , containing a distribution code for the part . a “ category identifier ” column 76 (“ category ”) is similar to the “ category identifier ” column 64 of the bill of materials table 42 , containing an identifier corresponding to the category to which the part belongs . additionally , the translation table 68 includes a “ title ” column 78 (“ title ”), containing a title for the part . the translation table 68 also includes a “ plain language title ” column 80 (“ extranet title if different from title ”) containing a plain language version of the title or description of the part . the plain language version of the title or description is written to clearly identify the part to those who would likely be searching for the part , such as a technician or repair person . the parts identification and tracking system 10 employs a user interface (“ ui ”) for allowing users , such as technicians and repair persons , to identify and / or order replacement parts . the parts identification and tracking system 10 implements the ui functionality in software which can reside on the server computing system 14 and / or the client computing system 12 . for example , the ui can take the form of a web site having one or more web pages hosted on the server computing system 14 . the web pages are transmitted to the client computing systems 12 in response to requests placed by web browsers executing on the client computing systems 12 . alternatively , the ui can take the form of one or more screens stored in the memory 38 of the client computing system 12 , or the server computing system 14 . in response to a user query made via the ui , the server computing system 14 makes one or more database quires of the bill of materials data structure 40 and the translation data structure 66 to generate a response providing requested parts information . the response can take the form of a response data structure 82 . the response data structure 82 is illustrated as a response table 84 , although other formats may be suitable . the response table 84 includes a number of rows 86 corresponding to parts and groups of parts satisfying the parameters of the user query . the response table 84 also includes a number of columns for detailing information regarding each of the parts . for example , a “ title ” column 88 (“ title ”) includes a title for the part or group of parts . a “ part number ” column 90 (“ part #”) includes the corresponding identifier from the “ parent ” column 48 or “ child part identifier ” column 52 of the bill of material table 42 . a “ bill of material quantity ” column 92 (“ bom qty ”) includes the corresponding number of parts from the “ quantity description ” column 56 of the bill of material table 42 . an “ assembly ” column 94 identifies whether the corresponding row identifies an individual part or a group of parts ( e . g ., assembly , sub - assembly ). for example , if a row such as row 96 includes a checkbox 98 in the “ assembly ” column 94 , the row 96 corresponds to a group of parts . otherwise , the row 86 corresponds to an individual part . the user can select the checkbox 98 to view the individual parts of the group of parts . a check 100 in the checkbox 98 provides a visual indication that the user has selected the checkbox 98 . a notation “ part break down ” in row 102 indicates that the parts that follow belong to the group of parts . some or all of the information from the response data structure 82 can be provided to the user , for example via the display 20 of the client computing system 12 . the plain language title 80 provided in the translation table 68 allows people unfamiliar with the precise naming convention employed by designers of the machine to successfully search the parts information . [ 0034 ] fig4 shows a method 104 of providing legacy parts information in a computer - searchable form , that begins at a start step 106 . the method 104 may employ legacy parts information in electronic form , or may require the conversion of legacy parts information from paper form to electronic form , for example by keying or scanning . in particular , fig4 shows the creation of the translation data structure 66 of fig3 . in step 108 , the parts identification and tracking system 10 identifies a part using a part identifier . for example , the parts identification and tracking system 10 can employ the mpl item number from the “ mpl item number ” column 60 of the bill of material table 42 ( fig3 ). in step 110 , the parts identification and tracking system 10 creates an entry in the computer - searchable database 34 ( fig1 ) corresponding to the part . in step 112 , the parts identification and tracking system 10 provides a category identifier in the computer - searchable database 34 . the category identifier identifies a category to which the part belongs , if any . for example , the parts identification and tracking system 10 can employ the category identifier from the “ category identifier ” column 64 of the bill of material table 42 ( fig3 ). this allows a user to quickly identify a needed part based on the part &# 39 ; s functionality within a system or subsystem . for example , all stator related parts can be rapidly identified . in step 114 , the parts identification and tracking system 10 provides a distribution code the computer - searchable database 34 . the distribution code can identify a salable part or group of parts as a salable unit , filtering out non - salable items from the machine parts list or bill of material such as raw material , manufacturing operations , manufacturing processes and strategic parts not intended to be sold as stand alone parts . for example , the parts identification and tracking system 10 can employ “ distribution code ” column 62 of the bill of materials table 42 ( fig3 ). this is particularly useful where the parts are intended to be sold via electronic commerce . the parts identification and tracking system 10 can ensure that the user only selects parts in predefined packages . this results in the user receiving all of the parts necessary for a particular repair or rehabilitation job . this also permits the company to pre - package parts , which can later be easily and quickly shipped upon request . in step 116 , the parts identification and tracking system 10 provides a plain language title and / or description in the computer - searchable database 34 . the plain language title can be entered by a human , or the parts identification and tracking system 10 can automatically generate the plain language title / description by automatically substituting plain language words for previously defined jargon such as abbreviations and acronyms . in step 118 , the parts identification and tracking system 10 determines if all of the parts for the machine have been entered into the translation data structure 66 . if last part has been entered , the method 104 terminates at an end step 120 . if not , control returns to step 108 for creating an entry in the translation data structure 66 for the next part . [ 0040 ] fig5 shows a method 122 of accessing parts information , that starts at step 124 . in step 126 , the parts identification and tracking system 10 receives a search request in the form of a plain language parts description . for example , a user can submit a plain language description of the part to the server computing system via the keyboard and / or mouse of the client computing system . in step 128 , the parts identification and tracking system 10 automatically locates at least one machine part that corresponds to the received plain language parts description . for example , the server computing system 14 can employ a database query of the “ plain language title ” column 80 of the translation table 68 ( fig3 ). in step 130 , the parts identification and tracking system 10 transmits part information to the user for a corresponding salable part . for example , the server computing system 14 can transmit parts information as web page to the client computing system 12 . the method 122 terminates at end step 132 . although specific embodiments , and examples for , the invention are described herein for illustrative purposes , various equivalent modifications can be made without departing from the spirit and scope of the invention , as will be recognized by those skilled in the relevant art . the teachings provided herein of the invention can be applied to other parts tracking and distribution systems , not necessarily the exemplary machine parts tracking and distribution system generally described above . for example , the teachings can be employed with a tracking and identification system for products other than machines . the various embodiments described above can be combined to provide further embodiments . the system can employ communications channels other than the internet , for example lans , or wans . additionally , or alternatively , the described methods can omit some steps , can add other steps , and can execute the steps in other orders to achieve the advantages of the invention . these and other changes can be made to the invention in light of the above detailed description . in general , in the following claims , the terms used should not be construed to limit the invention to the specific embodiments disclosed in the specification , but should be construed to include all computers , networks and distribution systems that operate in accordance with the claims . accordingly , the invention is not limited by the disclosure , but instead its scope is to be determined entirely by the following claims . | 6 |
the method of the invention uses non - invasive sensors placed at one or more sites on a patient &# 39 ; s body to monitor primary and reference parameters , as follows : a non - invasive sensor array that includes sensors for emg , amg ( in the below - described study ), and peripheral temperature ( fig1 a ) is placed at each monitor site ; ekg and reference sensors are applied where and / or as appropriate ( fig1 b ). splash - proof coverings can be used to protect each monitor site . to discriminate the cephalo - caudal spatial effect of the neural block it is preferable to use multiple monitor sites as shown in fig1 . in the clinical tests described below , three specific sites were identified for use : the fourth thoracic dermatome ( nipple , t4 ) and tenth thoracic dermatome ( umbilicus , t10 ) levels on the anterior axillary line and the anterior of the thigh , representing the second lumbar dermatome ( l2 ). for muscle innervation the level and density of the neural blockade is quantified by , respectively , the placement of the sensor array and a change in the signal amplitude of the surface emg , wherein the density is inversely proportional to the signal amplitude . for skin temperature , the level and density of the neural blockade is quantified by , respectively , the placement of the sensor array and a change in skin temperature , wherein the density of the neural blockade is directly proportional to skin temperature . finally , for heart rate , the level and density of the neural blockade are quantified by a change in heart rate , wherein the density of the neural blockade is inversely proportional to heart rate . the invention was demonstrated in a study involving seven men ( table 1 ) who were all undergoing elective radical retropubic prostatectomy using lumbar epidural blockade . table 1______________________________________subject demographics epi - time - to - sub - age weight asa dural incisionject ( years ) ( kg ) status site ( min ) notes______________________________________1 55 85 . 7 2 l4 - 5 n / a combined ga and regional due to history of apnea ; epidural dosed after incision2 42 83 2 l4 - 5 17 . 03 47 78 2 l2 - 3 17 . 74 63 104 2 l2 - 3 12 . 55 55 103 2 l3 - 4 15 . 06 65 110 2 l3 - 4 29 . 3 converted to combined ga and regional7 60 88 2 l - 5 15 . 5______________________________________ time from main epidural dose to start of incision spontaneous surface electromyogram ( emg ), acoustomyogram ( amg ) and temperature ( t ) measurements were made along the anterior axillary line at t4 , t10 , and l2 dermatomal levels along with lead - ii electrocardiogram ( ekg ). reference measurements included tympanic and ambient temperature , and ambient sound . as discussed below , time - series data were acquired before epidural dosing and at predefined intervals after dosing . a dedicated pc - based system provided system control and data storage . based on the predicted temporal response to epidural dosing , data epochs were collected immediately prior to the main epidural dose ( baseline ) and at 2 , 5 , 10 , 15 , 20 , 25 , 30 , 45 , 60 , 75 , and 90 minutes after dosing . the epochs were designed to have a minimum duration of 20 seconds . temperature data records were time - continuous , starting immediately after the thermocouples were placed and ending approximately 2 minutes after the last emg / amg / ekg sampling epoch . table 2 below summarizes the data acquisition conditions for the parameters of interest . table 2______________________________________data acquisition conditions for monitored parameters sampling rate no . ofparameter passband ( hz ) ( sec . sup .- 1 ) channels______________________________________amg 0 . 5 - 100 1000 4ekg 2 - 100 1000 1emg 10 - 500 2000 3temperature dc - 0 . 02 0 . 2 6______________________________________ as discussed below , root - mean - square ( rms ) of emg and amg , average t , and average heart rate ( r - r interval ) were assessed for the levels as a function of time relative to epidural dosing . changes in objectively monitored variables were compared to qualitative assessment ( e . g ., pinch test ) of the block effectiveness . both emg and amg are broadband signals that contain information in the time and frequency domains . what is needed is a single derived value that is descriptive of the instantaneous physiological condition of the patient . typically , the power in the signal provides such an indication in the time domain . power is proportional to the square of the amplitude of the signal . and , for a signal that has a non - constant ( e . g ., alternating current ) component , it is necessary to average over a finite period of the signal in order to generate a meaningful value . emg assessments have traditionally computed the average rectified emg ( aremg ) or the rectified integrated emg ( riemg ), given by : ## equ1 ## the historical computation methods are clearly not power indicators , so the invention uses the root - mean - square ( rms ) estimator : ## equ2 ## ( note , other methods , e . g ., spectral analysis , bi - spectral analysis , etc ., may also be useful . the gradient of the signals may also provide useful information .) regardless of the method used , selection of the integration interval ( i . e ., the value of n ) is an important factor . the value of n is inversely proportional to the upper frequency response characterized by the computation . an integration interval was selected that retained as much of the passband information as is practical . emg are integrated over 50 msec ( n = 100 ) and amg signals are integrated over 250 msec ( n = 250 ). many discrete rms computations are possible within 20 - second sampling epochs . running rms values are computed . the rms value at t = 0 includes the first n data points in a series . subsequent rms values incrementally delete the earliest data point and add the next latest point of the series . the minimum value of the computed rms sequence is selected as representative of the muscle - only condition for any pre - defined sampling epoch . the time - series data from the study subjects demonstrated that emg and amg signals contained noise artifacts that correlated to the use of the electrocautery , suction , and other electronic systems . the slope and intercept of the frequency spectra of the data were used as acceptance criteria to validate that the rms data values were devoid of noise . the absolute value of emg signals can be influenced by conditions such as skin conductance , skin temperature , electrode displacement , and site preparation . to mitigate discrepancies , the emg data were normalized , which involved applying a gain factor that resulted in an expansion or compression of the histogram of the raw data sets . based on a common time epoch for all study subjects , emg data were normalized such that the basis histogram contained 50 % of all data values between ± 5 mv . other epochs were scaled by the same gain factor calculated for the basis . it was apparent that amg signal artifacts were correlated to motions directly induced by the surgeons or indirectly induced by movements near the patient . amg data are compensated , on a sample - by - sample basis , for the presence of acoustically transmitted noise by subtraction of the ambient signal level . changes in skin temperature are adversely influenced by changes in both body core temperature and ambient air temperature . to accommodate these conditions , the raw ( t dl , si ) dermatome temperature value is standardized ( t dl , si ) by the tympanic and ambient temperatures as in the following : where dl is the dermatome level and si is the sampling interval . si = 0 correlates to the data epoch before the main epidural dose . standardized temperature data were then parsed into 20 - second segments that correlated with the emg / amg / ekg sampling epochs . the average of each of the normalized epochs was computed as a simple arithmetic mean of the data . each study subject &# 39 ; s average heart rate was determined from the lead - ii ekg data sets . the average for the 20 - second data intervals was computed as a simple arithmetic mean of the related r - to - r intervals . the occurrence of the leading edge of the r peak was determined by an automated algorithm . the data revealed three notable aspects of the emg signals . first , emg signal amplitude decreased at a rate inversely related to the number of dermatomal levels separating the monitor site and the epidural catheter . that is , the signals at the more cephalad dermatomal levels decreased later than the more caudal levels . second , after a period of time ( between 15 and 30 minutes ), all emg signal amplitudes assumed a generally constant and lower level than at initiation of the primary dose . third , the constant level at the l2 dermatomal level was approximately 30 % lower than that of the t4 and t10 dermatomal levels , perhaps indicating that effective block was created at this discrete level simply by the test dose . average temperature trends for the tympanic - and ambient - compensated data all showed a gradual increase as a function of time ; longer onset was noted at more rostral dermatomal levels . heart rate increased by an average of 7 . 8 ± 9 . 2 bpm to 10 minutes following initiation of the primary dose , then decreased an average of 19 . 0 ± 10 . 8 bpm in the following 15 minutes . in sum , temporal changes in emg , skin surface temperature , and heart rate were associated with adequate blockade and correlated to the clinical assessment of the level and density of the block . during block onset the rms emg signal level decreased & gt ; 15 mv , temperature increased & gt ; 1 ° c ., and ekg decreased & gt ; 7 beats per minute ( bpm ). amg showed primary correlation to external influences ; response to the block was not evident in the presence of noise . fig2 shows a set of curves of the rms emg signal amplitudes for all seven subjects . the data are fifth - order polynomial curves fit to the normalized signal amplitudes for the seven study subjects at each of three monitor levels . the plot also indicates the typical dermatomal level of blockage achieved , according to pinch tests administered by the attending anesthesiologist . time is referenced to the administration of the main epidural dose ( t = 0 ) and the baseline data set is plotted at t =- 1 minute . the traces are normalized to the baseline by subtracting the respective baseline value from each successive data point . the time between the main dose and the surgical incision was 17 ± 6 minutes . lower amplitude limits of the l2 and t10 signals are reached sooner ( t = 15 minutes ) than the t4 signal ( t = 30 minutes ). this suggests that the l2 and t10 levels achieve onset before the t4 level , as expected . fig3 presents average temperature data for the dermatomal levels for all seven subjects . all levels exhibit the same upward trend as a function of time ; they approach a relative increase of approximately 3 . 5 ° c . over the 90 - minute data collection period . the changes in temperature reflect the effect of sympathectomy upon administration of local anesthetic . these changes also suggest differences in the contribution of blood volume changes and vascular relaxation at each dermatomal level . the average heart rate for all seven subjects is shown in fig4 . these data conform to the previously reported effect of local anesthetic on the cardiac accelerator fibers in the t1 - t4 spinal segments . the use of passive and non - invasive monitors to objectively distinguish the level and density of neural blockade as a function of time , and as related to the administration of local anesthetic , has been examined . the data from the emg , temperature , and ekg monitors , combined with the clinical assessment provided by the anesthesiologist and the conditions of the operative procedure , confirm that an objective measure of block level and density can be performed in the clinical setting . a universal neural blockade monitor must be fully functional regardless of when it is applied , relative to the administration of the anesthetic agent . the rate of change , or gradient , of the absolute signals presents salient information . the most compelling indicator is the change in emg signal level between the time of zero minutes and 10 minutes , as shown in fig2 . level l2 decreases approximately 1 . 5 times that of t10 and 2 . 5 times that of t4 . using the monitored parameters in combination rather than singly will enhance the utility of a universal monitor . the weighted summation of emg and temperature will likely satisfy the basic requirement for a level - discriminating determination of block density . the method of the invention can be integrated into an automated system for controlling drug delivery to the patient or simply notifying the physician or nurse about patient status , e . g ., during post - op recovery . the invention is also applicable to use with animal patients . the onset of neural blockade can be objectively monitored by placement of one or more sensors and quantifying a decrease in signal amplitude of a surface emg ; an increase in skin temperature ; and changes in heart rate . moreover , the blockade density determined by these objective means appears to compare favorably with the traditional subjective method of pinch - tests . the invention provides the anesthesiologist with a passive , objective tool for real - time , non - invasive monitoring of the level and density of neural blockade . | 0 |
referring to fig1 - 2 , a robotic handler 2 for moving a wafer 4 has two primary components , namely , a robotic arm 6 and an end effector 8 attached to one end of robotic arm 6 . end effector 8 is used to grab , hold and orient a wafer 4 . robotic arm 6 , which includes various motors and mechanical mechanisms not shown in the figures , moves end effector 8 and the wafer that it holds within its grasp . wafer 4 is typically a circular disk of semiconductor material , e . g . silicon . it generally is of uniform thickness and has an alignment feature 11 at one location on its circumference . alignment feature 11 is typically a v - shaped notch , as depicted in fig1 - 2 . the alignment feature serves as a reference that can be used to align the wafer to a known orientation . as will be described in greater detail below , end effector 8 includes a frame 9 attached to robotic arm 6 and a movable drive housing 10 for grasping and rotating wafer 4 as it is being held by the end effector . the end effector also includes sensor circuitry 100 for detecting the alignment feature and thereby determining and establishing the orientation of wafer 4 . in the described embodiment , the gripping mechanism includes two pairs of idler rollers 12 a - b and 12 c - d mounted at the remote ends of a support frame 9 , and a pair of drive rollers 12 e - f mounted in a drive housing 10 . all of the rollers 12 a - 12 f are arrayed in a common plane having parallel axes of rotation . referring to fig1 - 3 , drive housing 10 includes bearings 22 and 24 , and bearing 26 , that slide over shafts 30 and 32 , respectively . shafts 30 and 32 are connected at one end to frame 9 . drive housing 10 also includes a linear drive motor 34 that has a splined drive shaft 36 extending into a gear chamber 60 . splined shaft 36 is connected to mesh with a gear 38 that is connected to mesh with linear shaft 32 . thus , in response to a control signal , the rotational movement of drive shaft 36 causes housing 10 ( and drive rollers 12 e - f ) to move towards , or away from , idler roller pairs 12 a - b and 12 c - d . when housing 10 is moved away from idler roller pairs 12 a - b and 12 c - d , a separation space 40 ( see fig1 ) becomes large enough to accept wafer 4 ( separation space 40 is defined by the three rollers pairs 12 a - b , 12 c - d and 12 e - f ). once wafer 4 is located within separation space 40 , motor 34 is actuated to move housing 10 towards idler roller pairs 12 a - b and 12 c - d until all three pairs of rollers contact the outer periphery of and hold wafer 4 ( see fig2 ). roller pairs 12 a - b , 12 c - d and 12 e - f are positioned so that they contact the periphery of wafer 4 at locations which are separated sufficiently from each other so that that wafer readily slides into the grasp of the rollers and is held securely there . referring to fig4 a bearing 93 a and shaft 91 a supports idler roller 12 a , so that roller 12 a rotates freely . idler rollers 12 b - 12 d are supported similarly on corresponding bearings ( not shown ) and shafts 91 b - 91 d , respectively . referring to fig3 and 4 , each drive roller 12 e and 12 f is mounted on a rotating shaft 18 e and 18 f , respectively , that are supported by bearing pairs , mounted in housing 10 . bearing pair 20 a and 20 b , which support both ends of shaft 18 e , respectively , is shown in greater detail in fig4 . a similar bearing pair ( not shown ) supports shaft 18 f in drive housing 10 , and is constructed similarly . the mechanism for rotating drive rollers 12 e - f includes a rotational drive motor 50 mounted on drive housing 10 . drive motor 50 is a servo - controlled motor that has a splined drive shaft 52 , which extends into gear chamber 60 . drive shaft 52 meshes with a large spur gear 56 . large spur gear 56 is connected to mesh with two smaller spur gears 58 and 59 that are connected to an upper end of rotating shafts 18 e and 18 f , respectively . thus , when actuated , drive motor 50 causes both drive rollers 12 e - f to rotate in the same direction and speed . and when drive rollers 12 e - f are contacting the periphery of wafer 4 , it causes wafer 4 to rotate within the grasp of the three roller pairs 12 a - b , 12 c - d and 12 a - f . each individual roller within a roller pair 12 a - b , 12 c - d and 12 e - f is mounted with a slight separation between its partner in the pair , for example roller 12 a is mounted with a slight separation from roller 12 b . therefore , as the alignment notch 10 is rotated past a roller pair an un - notched section of the wafer edge is always fully in contact with one of the rollers in the roller pair . the use of closely - spaced roller pairs , rather than single rollers , to support the wafer edge reduces the potential skip and noise caused by the detent of the alignment notch rotating past each roller . still referring to fig3 drive housing 10 is partitioned into two particle containment chambers , a gear chamber 60 and a drive roller chamber 70 . gear chamber 60 surrounds gears 56 , 58 and 59 , and motor shafts 36 and 52 . and drive roller chamber 70 surrounds drive rollers 12 e and 12 f . a vacuum source ( not shown ) is connected to draw air from chambers 60 and 70 , thereby removing particles that may be generated by the meshing of gears in gear chamber 60 and generated by the rotation of the wafer edge against drive rollers 12 e - f in roller chamber 70 , respectively . referring to fig3 and 4 , roller chamber 70 includes a cover 72 attached to a side of drive housing 10 to more fully enclose drive rollers 12 e and 12 f . cover 72 includes a longitudinal access slot 74 that extends end - to - end into a side of cover 72 . slot 74 allows wafer 4 to be inserted into roller chamber 70 and make contact with drive rollers 12 e and 12 f . access slot 74 is beveled at edges 76 and 78 to guide a slightly mis - aligned wafer into slot 74 . each of the idler roller pairs 12 a - b and 12 c - d are contained with idler roller chambers 80 and 90 , respectively . the construction of idler roller chamber 80 is shown in greater detail in fig4 . idler roller chamber 90 is constructed similarly . a cover 82 is attached to frame 9 and defines the upper section of chamber 80 surrounding rollers 12 a and 12 b . cover 82 includes a longitudinal access slot 86 that extends end - to - end into a side surface of cover 82 and allows a wafer to be inserted into chamber 80 and make contact with idler rollers 12 a and 12 b . slot 86 is beveled at edges 88 and 89 to guide a slightly mis - aligned wafer into slot 86 . an airflow channel 84 is formed into frame 9 with an end of channel 84 directly below and into chamber 80 . a vacuum source ( not shown ) connected to the airflow channel draws air into chamber 80 and draws any particles away from idler roller chamber 80 . in one embodiment , airflow channel 84 is formed internally within frame 9 , as shown in fig4 . alternatively , as shown in fig5 airflow channel 84 is formed into a surface of frame 9 and covered with a channel cover 92 to direct an airflow through channel 84 . typically , end effector 8 is housed in a clean room environment with highly filtered air surrounding end effector 8 . therefore , a vacuum source ( not shown ) connected to draw air from chambers 60 , 70 , 80 and 90 causes a flow of filtered air from the clean room into the respective chambers and draws any particles away from the clean room environment . the geometry of drive roller 12 e is shown in greater detail in fig4 . the other rollers 12 a - d and 12 f are constructed similarly . roller 12 e has a substantially cylindrical outer rim 26 , which includes a v - shaped positioning groove 94 formed around its outer circumference . when the rim of the roller is brought into contact with the periphery of the wafer , positioning groove 94 receives and holds the edge of the wafer thereby preventing the wafer from sliding either up or down on the roller . since all six rollers 12 a - f have a similar positioning groove , when the rollers are contacting the periphery of the wafer and the wafer sits in the corresponding positioning grooves of the six rollers , the plane of the wafer is fixed and precisely determined . to reduce the generation of particles and noise while spinning a wafer , the outer surfaces of rollers 12 a - f are made from a polyethyletherkeytone - filled ( peek - filled ) material . for similar reasons , in an embodiment , v - groove 94 has a polished finish with pits and valleys that measure sixty - four micro - inches or less . for similar reasons , in an embodiment , the maximum speed of wafer rotation is less than , or equal to , two revolutions per second , and the side load pressure applied against the wafer edge by the roller pairs is in the range of one to three pounds . referring to fig3 and 6 , end effector 8 has an optical sensing system 100 for detecting the presence of the alignment feature 11 on wafer 4 as it passes by while the wafer is being rotated . examples of sensing system 100 are described in the &# 39 ; 342 application , which was previously incorporated by reference . sensing system 100 has an upper arm 102 that contains the light emitting components and a lower arm 104 that contains the light detecting components . when the wafer is being held by rollers 12 a - 12 f , the edge of the wafer lies between upper and lower arms 102 and 104 . upper arm 102 includes a light source 106 ( shown in phantom ) that is used to illuminate the edge of the wafer ( light source 106 may be implemented , for example , as a diode , a fiber optic or a bulb ). the light from light source 106 passes through a cylindrical tube 108 that acts as a collimator to guide the light from light source 106 . tube 108 includes an aperture opening 110 that directs the light down through aperture 110 toward the wafer . aperture 110 is narrow and long , with its longer dimension oriented perpendicular to the edge of the wafer . lower arm 104 includes a silicon diode receiver 112 which has a detecting window that is also long and narrow , and is aligned with the aperture of the tube 108 . the signal generated by diode receiver 112 is proportional to the amount of light from aperture 110 that reaches it . when wafer 4 is rotated within the grasp of end effector 8 , the edge of the wafer passes between the light emitting and light detecting components . optical housing 100 is positioned so that the edge of the wafer prevents some of the light from tube 108 from reaching diode receiver 112 . when the alignment feature passes between the light emitting and light detecting components , more light is allowed to reach diode receiver 112 and its output signal increases . and as the alignment feature moves past the sensor , the signal decreases to its previous value . thus , by monitoring the output signal of the diode receiver , the electronics can detect the presence of the alignment feature , can determine its precise angular location as a function of the rotational position of the wafer , and can precisely align the angular orientation of the wafer . in an embodiment of sensing system 100 , the interior walls of tube 108 are coated with a diffusing material , e . g ., a white paint . the diffusing coating on the interior surface causes the light passing through the tube to be diffused and reflected and may increase the amount of light passing through aperture 110 . in another embodiment , the end of tube 108 , opposite from the light source 106 , is capped ( not shown ) with a cap having an interior surface coated with a diffusing material , e . g ., a white paint . the cap &# 39 ; s diffusing interior coating causes the light passing through the tube to be diffused and may increase the amount of light , or intensity of the light , passing through aperture 110 . in either of these two embodiments , an increase in the amount or intensity of the light emitted from aperture 110 may reduce the required sensitivity of receiver 112 , or may reduce the amount or intensity required from light source 106 . the techniques for determining the angular location of the alignment feature and then aligning the wafer based on that information are well known to persons skilled in the art . such techniques are typically used in connection with standalone pre - aligners of the type briefly mentioned earlier . an example of one such technique that can be used is described in u . s . pat . no . 4 , 457 , 664 , entitled “ wafer alignment station ” and incorporated herein by reference . end effector 8 is coupled to a processor ( not shown ) which implements the electrical control functions that are necessary . for example , it generates the control signals for the drive motor and the linear motor , and it analyzes the sensing signal to determine and establish the orientation of the alignment feature of the wafer . referring to fig7 a typical use of the end effector is to grab wafers from a wafer storage rack 120 and then transfer them to a masking station ( not shown ). generally , rack 120 has a wafer holder 122 mounted on a platform 124 that can be displaced in a direction z . the wafer holder holds wafers 130 a - c , which are spaced apart by spaces 132 a , 132 b . there are numerous illumination and imaging (“ i / i ”) schemes in the prior art that are usable for the reading of markings on a surface of a wafer , e . g ., optical character recognition ( ocr ) markings , dot - t7 codes , bar codes , and the like . for example , u . s . pat . nos . 5 , 231 , 536 , 5 , 737 , 122 and 5 , 822 , 053 describe i / i schemes . a conventional i / i system includes an illumination component that shines light onto a wafer , for example , and a camera system that captures a reflected image of the ocr , bar code , or dot - t7 code from the wafer surface . typically , the i / i systems project light from various selectable angles onto the smooth , mirror - like wafer surface . the relative angles of incidence of this illumination is sometimes very close to on - axis and is called bright field illumination , or at steep angles and is called dark field illumination . typically , the information being imaged by the camera is not the relatively shiny surface of the wafer , but instead , what is imaged are the micro pits of the markings that have been etched into the wafer surface , that is , it is the slope of these pits that is actually imaged . conventional i / i system typically require a fairly large amount of space to hold the various components in the system , e . g ., using a package that may measure 3 ″ wide , 2 ″ high and 5 ″ long . the relatively large size of the conventional i / i system may not be easily adapted to operate as part of applicants &# 39 ; edge effector , since it would occupy too much room on the pre - aligner and hinder the movement and access of the pre - aligner to close - fitting spaces for wafer pickup and deposit . moreover , the use of a conventional i / i system typically requires a separate station apart from the pre - aligner station , which would , therefore , require additional time to perform that step in the process of wafer fabrication . in an embodiment , edge effector 8 includes a low - profile i / i system 140 ( see fig1 and 2 ) that illuminates and images wafer surface markings as part of the pre - aligner 4 . described below are a number of embodiments of the low - profile i / i system that typically occupy about ¼ ″ of space above or below the wafer surface . an embodiment of the low - profile i / i system may be included as part of pre - aligner 4 , therefore the pre - aligner may be used to perform the grabbing , orienting and imaging of a wafer in a single pre - aligner station . referring to fig8 a first embodiment of a low - profile i / i system 140 is shown . i / i system 140 includes a light source that emits light that is diffused by one or more diffusing elements and reflected by a reflective element ( e . g ., a mirror ) onto a surface of a wafer . the diffused light from the wafer surface is reflected and detected by a camera as an image that may be used to determine the markings on the wafer surface . in the described embodiments of i / i system , the diffused light is produced by passing light beams through a diffusing element ( e . g ., a frosted glass element and / or a diffuser element ). the diffused light source ( e . g ., the frosted glass element and / or diffuser element ) is located adjacent to the wafer being illuminated , therefore the distance the diffused light must travel to illuminate the wafer surface is reduced . the relatively close proximity of the diffused light source to the wafer surface may reduce the required amount and / or intensity of the light from the light source . therefore a smaller light source may be used and the size of other components included in a low - profile i / i system may also be reduced . still referring to fig8 in this embodiment , system 140 includes an led array 142 that acts as a light source . during operation , led array 142 is turned on to shine light beams through a set of diffusers 146 a - b , and a frosted glass 150 towards a beam - splitter 160 . the diffused light beams are partially reflected by a beam - splitter 160 towards two mirrors , 152 a and 152 b , that are mounted above and below a wafer 4 , respectively . mirrors 152 a and 152 b reflect the diffused light towards the edge of the upper and lower surfaces of wafer 4 , respectively . the diffused light reflects off of the upper and lower surfaces of wafer 4 , and in turn , is reflected back by mirrors 152 a and 152 b towards beam - splitter 160 . beam - splitter 160 passes part of the reflected light towards lenses 166 , which focuses the reflected light onto a charge - coupled detector ( ccd ) array 169 of camera 170 . the reflected light received on ccd array is usable as an image to determine the markings on the edge surfaces of wafer 4 . referring to fig9 the two mirrors , 152 a and 152 b , are arranged to reflect the light from both the upper and lower surfaces of wafer 4 , so that an image 180 is obtained that includes an image of the upper surface 182 , the wafer edge 186 and the lower surface 184 . in an embodiment , i - i system 140 includes mirrors 152 a and 152 b that are each located about ¼ ″ above and ¼ ″ below wafer 4 , respectively . the overall package size containing the other components of system 140 may be relatively larger . referring to fig1 , a second embodiment of a low - profile i / i system is shown as system 200 . system 200 includes a led array 202 that shines light that is first diffused by one or more diffusers 206 a and 206 b . the diffused light is reflected by mirror 208 and further diffused by passing through frosted glass 210 . the further diffused light is partially reflected by a beam - splitter 212 onto mirror 216 that reflects the further diffused light onto the lower surface of wafer 4 . the further diffused light is reflected by wafer 4 onto mirror 216 and back through beam - splitter 212 , through lenses 218 and onto ccd array 221 or camera 220 . in this case only one surface of wafer 4 is illuminated and imaged . also , in this embodiment , an absorber 214 is included to reduce back - reflections of light passing through beam - splitter 214 . referring to fig1 , a third embodiment of low - profile i / i system is shown as system 240 . system 240 includes only a single mirror , mirror 246 . the use of fewer mirrors may reduce the amount of error included in a reflected image . system 140 includes a led array 242 that shines light through a diffuser element 244 , the diffused light is reflected on a mirror 246 and through a frosted glass 248 . the diffused light that passes through frosted glass 248 is partially passed through beam - splitter 250 and onto the lower surface of wafer 4 . the diffused light is reflected from the lower surface of wafer 4 back onto beam - splitter 250 which partially reflects the light towards lenses 260 which focus the light onto a ccd array 272 of camera 270 . although the described embodiments of the i / i systems included multiple diffuser elements , a single diffuser element may be used . in the described embodiments of the i / i systems an led array was described as the light source . in an embodiment , individual rows of the led array may be turned on or off to produce on - axis or off - axis illumination of the wafer surface . a number of embodiments of the invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . for example , more than three roller pairs may be used to grasp the periphery of the wafer and the transport mechanism for rotating the wafer . we also mentioned specific geometries and construction materials of the rollers used in the end effector . however , other roller materials and geometries could be used . we also mentioned opening and closing the gripping mechanism with a linear drive motor and associated gearing . however , other devices could be used to open and close the gripping mechanism , for example , a hydraulically operated device . also , other kinds of sensors may be used to sense the orientation of the wafer . the sensors may detect the presence of the alignment feature by physical contact , magnetic fields , or capacitance , just to name a few possible ways . accordingly , other embodiments are within the scope of the following claims . | 7 |
the general structure and techniques , and more specific embodiments which can be used to effect different ways of carrying out the more general goals , are described herein . the present application describes an automatic cable handling system , which allows automated processing of the cable . one of the issues found with cable handling in the prior art is that the cable was effectively stretched across a work floor . this stretching and the subsequent coiling was done manually , and required significant manual effort . the cables laid across the floor , hence causing a hazard . moreover , the cables got very dirty during their time on the floor . the stretched cables were then bundled up . one aspect of this application cleans the cable while the cable is being conveyed . a cable clamp holds various sizes of cable , conveying the cable along a conveyor . in operation , the cable is first sorted by type . the cable sorting may be done on a dock or other table . the cables may then be sent , for example , to the input stage of the conveyor shown in fig1 - 3 . the cables are initially placed in cable holders such as 145 . the cable holders move along a support , forming the conveyance path in the direction of arrow 105 . cable clamp 145 holds the cables as they are moved . the cable clamps 145 , 155 may be located on the support 160 every 20 feet , for example ; see fig2 . the clamps are driven to move in a continuous loop , so that clamps such as 145 are driven in a first direction to stretch the cable , and 150 is driven in a second direction to return the clamp back to the cable - initiation point at which point a new cable can be attached and stretched . after attachment , the cables are first conveyed to a soap and water wash spot , which may include a presoak area 129 which presoaks the cables . the cables are then each washed by brushes . brushes 125 , 126 are shown for a first cable , and 127 , 128 for a second cable . it should be understood that there may be other brushes in other locations . the cables are then rinsed with water or solvent in a rinse area 130 . water is blown off the cables at 135 by an air blower device . the cables pass through area 140 , held by the cable clamp / grippers 145 in fig2 . this shows a second area of the conveyor , along which the cables are allowed to dry , and / or blown off . in the embodiment , the cable grippers may be located on 20 foot centers . the cable continues being conveyed to the section of fig3 . the cable is then passed to a bundler 130 , which rotates a wrapper 160 , for example , to bundle the cables into any desired configuration , such as bundles or spools . the wrapper 160 may also include a label printer 161 which automatically affixes information indicative of the cables . for example , this can be an inventory number or the like to facilitate the tracking . since the conveyance path is along a support , the conveyance surface can be open , to allow foreign objects such as dirt and liquid , to fall off . this is different than a belt style conveyance , in which all dirt and foreign objects would fall on the belt , for example . a side view of the conveyor is shown in fig4 a - 6 . fig4 a illustrates the conveyor support including the cable grippers 145 , 150 , 155 and other structures . 145 is conveying a cable in the direction of stretching , 150 is a cable clamp that is returning back toward the origin . the returning clamp 150 is conveyed around a curved support area 161 , after which it is ready to receive another cable . fig4 b shows another view of the conveyance path , which shows the different stations , including the presoak station 129 , the rollers 125 , 126 , the rinse station 128 , and the air blower station 130 . the different structures which hold the washing material are also shown . fig4 b , for example , shows the fresh water tank 400 , soap concentrate held in receptacle 402 , and also shows a soap drain tank 404 for receiving the dirty water . input 408 represents an air compressor , for the air blower 130 . the area under the conveyance path , in the area of washing and rinsing , is preferably a mesh structure , e . g ., a metal mesh . fig5 a illustrates a close - up of the different structure including the presoak , brushes , and the motor . fig5 c shows a perspective view with presoak , rinses and drying , as well as the brushes . fig5 b illustrates the end part of the conveyance path . note that the clamp 155 is holding the cables such as cable 500 . at degrip zone 510 , the cables are released from their clamps . this may be automatically done when sensing the position of a mechanical part 504 . the cable 501 , once so released , may be loaded onto a desired caddie for coiling . a roller device 520 may also be provided , to facilitate rolling up bundles of cable . fig5 b also illustrates the second end portion 602 of the support 600 , in which the clamps such as 145 are turned around to be returned to the origin . since these cables are heavy and bulky , an important feature is the emergency switch . an emergency off switch 530 is located within the reach of each operator . fig6 shows an alternative view of the fig5 embodiment , showing how the cables can be released from the different grippers . fig7 shows a top view of the conveyor including two cables 700 , 702 . emergency stop buttons 710 and 720 are located on opposite sides of the table . fig8 a , 8b , 9 a and 9 b illustrate a more detailed view of the cable gripper . the cable gripper is formed of a first holding piece and a second holding piece 800 , 805 . the gripper 145 rides on , and moves along , an edge surface 811 of a support piece 810 . for example , the support piece 810 can be an “ i beam ”, and the edge surface 811 can be the portion of the i beam that is substantially perpendicular to the main support piece . the two pieces 800 , 805 are opened by the movement of a linear driving part such as piston 820 . this causes the bottom piece 805 to tilt downward , opening the area between the top and bottom pieces . fig8 a and 8b illustrate the pieces 800 , 805 in their open position . in this position , the cables 830 , 832 can be inserted therein . fig9 a and 9b illustrate the cylinder in its closed position , with two cables , 830 and 832 , held between the two gripper parts 800 , 805 . in this way , a number of cables of similar sizes can all be held by the same device . the opening and closing can be via an air operated part , such as an air piston , the device in essence self - adjusts — closing with a certain amount of force to thereby hold the cables of any size automatically . note that the cables are held between a first movable surface 801 that is controlled by the piston 820 , and a second surface 802 . the second surface may also move against a spring force . accordingly , any size cable can be held by the gripper . the gripper assembly itself is connected to a carriage 850 but moves on rollers 852 along the conveyor . in an embodiment , a foot pedal may be provided that allows the operator to press the foot pedal to raise the first movable surface , after which the cables are placed into position , and the foot pedal is released to lower the first movable surface . an important feature of this system is that pans and troughs may be located under the device to catch runoff . fig1 illustrates a cross - section along the line 10 - 10 in fig5 . this shows , for example , how the presoak nozzles 1000 , 1002 , 1004 , 1006 can be used to spray presoak water onto the cables . drain pans 1010 and 1020 are located under this area of the conveyor , to capture the overflow water . the brushes are shown in fig1 , where brushes are formed in an area so that the cable needs to pass between the brushes . in the area of the brushes 1100 , there may be splash guards 1102 to prevent the water from splashing . the brushes 1100 have indentations which are intended to provide additional surfaces for cleaning the cable . a piston drives the position of the brushes . fig1 illustrates a side view of the rinsing station , again with nozzles such as 1200 , and splash areas 1202 . this structure allows the cable to be pulled and washed at the same time . all customer markings can be removed by washing , as well as dirt and the like . an automatic release system allows the end of the cable to be released once the cable end reaches the correct area . an automatic bundling system may be used at that area . the printer may print a barcode that is associated with the cable , and which states characteristics of the cable . after bundling the cable , a barcode may be scanned into an inventory management system , which indicates that a bundle , having those specific characteristics , is ready to rent . the cable is then placed on pallets for storage , for example , and when rented , the barcode is scanned again , removing the cable from inventory . in operation , operators may be on each side of the conveyor . a conveyor button may be pressed when the conveyor is ready for work . the next available cable gripper opens automatically , on the side of the operator where the conveyor button was pressed . the operator inserts the cable into the open gripper area , and then presses a pre - start part , for example a prestart switch on the floor , to close the gripper . as a safety measure , the operator may be forced at that point to press either a wash , or a pass selector switch to start the operation . the wash switch causes the cables to be washed , by raising the brushes via the piston 1105 , while the pass switch just passes the cables without washing . the cable , while gripped , is passed through the washer area . depending on the buttons which are pressed , either wash operations or no wash operations is performed . if wash has been selected , a selected sensor will read the cable gripper and start a wash cycle . the different structure shown along the conveyor includes a prewash cycle which begins using a water and soap solution . the cable is then passed through foam brushes where one brush moves over the cable , and a second brush moves up from the bottom . the cable is then rinsed with water , and finally passes through an air blower area . cable droop may prevent some part of the cable from being washed . when the cable reaches the end of the conveyor , the clamping device automatically releases the cable at the discharge area via the unclamping ramp in the area 510 . in one embodiment , emergency stop buttons are mounted in each corner of the conveyor , near each location where a worker might be located . pressing any of the emergency stop buttons causes all equipment functions to stop . the general structure and techniques , and more specific embodiments which can be used to effect different ways of carrying out the more general goals are described herein . although only a few embodiments have been disclosed in detail above , other embodiments are possible and the inventor ( s ) intend these to be encompassed within this specification . the specification describes specific examples to accomplish a more general goal that may be accomplished in another way . this disclosure is intended to be exemplary , and the claims are intended to cover any modification or alternative which might be predictable to a person having ordinary skill in the art . for example , other kinds of bundling can be used . also , the inventor ( s ) intend that only those claims which use the words “ means for ” are intended to be interpreted under 35 usc 112 , sixth paragraph . moreover , no limitations from the specification are intended to be read into any claims , unless those limitations are expressly included in the claims . the computers described herein may be any kind of computer , either general purpose , or some specific purpose computer such as a workstation . the computer may be a pentium class computer , running windows xp or linux , or may be a macintosh computer . the computer may also be a handheld computer , such as a pda , cellphone , or laptop . the programs may be written in c , or java , brew or any other programming language . the programs may be resident on a storage medium , e . g ., magnetic or optical , e . g . the computer hard drive , a removable disk or media such as a memory stick or sd media , or other removable medium . the programs may also be run over a network , for example , with a server or other machine sending signals to the local machine , which allows the local machine to carry out the operations described herein . | 1 |
the preferred embodiment of the invention is shown in and described with reference to fig1 to 8 , and will be described first . fig1 diagrammatically illustrates a radial arm saw 20 according to the present invention and comprising a saw assembly 22 , a saw table frame 24 , and a wall support 26 securely mounted on a wall 28 . the wall 28 may be a brick or block wall or a wooden framed wall of a workshop or other room in a building . the saw assembly 22 comprises a saw unit 30 having a circular saw blade 32 and a handle 34 . the saw unit 30 is suspended by a carriage 36 from a radial arm 38 and along which the saw unit 30 is translatable by grasping and moving the handle 34 . the radial arm 38 is mounted on and cantilevered from the upper end of an upright , vertical column 40 the lower end of which is clamped in a socket 42 . the radial arm 38 can be moved up and down the column 40 by means of a handle 44 for adjusting the height of the saw blade 32 . the radial arm 38 can be pivoted about the column 40 in horizontal planes and locked in any selected position by a lever 46 . the frame 20 comprises a frame structure 48 having mounted thereon a horizontal work table 50 comprising a front fixed section 52 , removable middle and rear sections 54 , 56 , with an upstanding fence 58 removably disposed between the sections 54 , 56 . the sections 54 , 56 and the fence 58 are forwardly clamped against the rear edge of the fixed front section 52 . the frame structure 48 is pivotally mounted between upstanding side plate extensions 60 of the wall support 26 on bolts 62 , one on each side . the wall support 26 has a hollow box portion 64 from which the extensions 60 extend upwardly from adjacent the front thereof . the rear of the box portion 64 has a vertical leg 66 securely attached to each side thereof . each leg 66 has a pair of brackets 68 , one at the top and the other partway along its length , which are securely fixed to the wall 28 by screws 70 . at the lower end of each leg 66 is provided a plumb adjuster 72 and a height adjuster 74 which are adjusted to compensate for any variations in the wall 28 and the floor 75 so that the lower end of each leg 66 firmly engages both the wall 28 and the floor 75 . it should be noted that the brackets 68 and the adjuster 72 space the leg 66 a short distance from the surface of the wall 28 ; this also helps in accommodating any variations in the surface of the wall 28 . a pair of foldway legs 76 , one on each side , are pivotally connected at their upper ends by pivot bolts 78 to opposite sides of the frame structure 48 adjacent the front thereof . a bracing strut 80 is pivotally connected at one end , its forward end , to an upper portion of each leg 76 by a pivot bolt 82 . both the strut 40 and the leg 76 are of u - shaped channel section , and the forward end of the strut 80 is located inside the leg 76 . the rear end of each bracing strut 80 is pivotally attached to the wall support 26 by a pivot bolt 84 located adjacent the top of the box portion 64 just rearwardly of the upstanding side plate extension 60 . as can be seen , the rear end of the strut is curved upwardly , and the remainder of the strut 80 extends forwardly and upwardly at a small angle to the horizontal . the bottom of each leg 76 is provided with an adjustable foot 86 which telescopically extends upwardly inside the leg 76 ( as shown in broken lines ) and is secured in the adjusted position by a locking bolt 88 . a locking sleeve 90 of rectangular tubular cross section is a loose sliding fit on the upper portion of each leg 76 , and is located between the pivot bolts 78 and 82 which may act as stops to limit the sliding travel of the sleeve 90 . as can be seen in fig1 the lower edge of the sleeve 90 rests on the extended strut 80 and is thereby spaced a short distance d above and from the pivot bolt 82 . at its upper forward edge the sleeve 90 is provided with a forwardly extending tab handle 92 . from the operative position shown in fig1 the radial arm saw 20 can be folded away into a stored position adjacent the wall 28 . first , the column socket 42 is unlatched and pivoted about a horizontal axis 91 until the column 40 lies along the back edge of the table 50 , the radial arm 38 lies along the far side of the table 50 , and the saw unit 30 extends downwardly partway through the table 50 to the position shown in fig3 and as will be described more fully later . secondly , the front of the table part 52 is then grasped in one or both hands and raised upwards and backwards to pivot the frame structure 48 upwardly about the pivot bolt 62 . the table part 52 is so pivoted until it reaches the broken line position shown in fig1 with its lower surface now in the vertical plane v . during this pivoting of the table 50 and frame structure 48 , each leg 76 pivots about its pivot bolt 78 and hangs therefrom vertically , the strut 80 pivoting upwardly about its pivot 84 and also pivoting relative to the leg 76 about the pivot bolt 82 . the final vertical position of the leg 76 is shown in broken lines in fig1 and as can be appreciated , in this stored position the strut 80 becomes nested inside the leg 76 . as the leg 76 reaches its stored position and the strut 80 folds inside the leg , the locking sleeve 90 is free to slide down the leg 76 until arrested by the pivot bolt 82 . in this position , the locking sleeve 90 prevents downward return pivoting of the table 50 , as will be described in more detail later , and so locks the radial arm saw in the stored position . during the folding ( and subsequent unfolding ) of the table 52 from the extended position shown in fig1 full lines to the stored position shown in broken lines , the arcs along which various parts move are shown in broken lines . the front edge of the table 50 moves along a circular arc 94 centered on the axis of pivot bolt 62 . the pivot 78 at the top of the leg 76 moves along a circular arc 96 also centered upon the axis of pivot bolt 62 . the pivot bolt 82 , connecting the strut 80 and the leg 76 , moves along a circular arc 98 centered upon the axis of pivot bolt 84 at the rear end of the strut 80 . the adjusting foot 86 at the bottom of the leg 76 moves along an arc 100 so that in the stored position the adjustable foot 86 is located outside and just above the bottom of the box portion 64 of the wall support 26 as shown in broken lines . thus , it will be appreciated , that in the stored position , the leg 76 , the frame structure 48 , the table 50 , and the saw assembly 22 are all positioned above the bottom of the box portion 64 and also are all positioned rearwardly of the front face of the box portion 64 . the box portion 64 is hollow and is bounded by side plates , a top , a bottom , and a back . the front of the hollow box portion 64 is closed by a door 102 ( shown in broken lines in fig1 ) which is pivoted at its lower edge to the side plates of box portion 64 by pivot hinges 104 . when the radial arm saw is in the stored position , the door 102 is readily accessible and can be pivoted downwardly and forwardly to store in or remove from the inside of the box portion 64 accessories , tools etc . usable in association with the radial arm saw . in the operative position of the radial arm saw shown in fig1 the frame structure 48 is securely supported by the wall support 26 at the rear and the pair of legs 76 at the front with the bracing struts 80 therebetween . however , if desired , means may be provided to lock or latch the frame structure 48 in its operative , extended position . for example , a locking bolt 106 can be inserted through each side plate extension 60 into the frame structure 48 , such bolt 106 being manually removed before pivoting the frame structure 48 to the stored position . alternatively , a releasable latch may be provided between each side plate extension 60 and the associated side of the frame structure 48 . at a location between the pivot bolts 78 and 82 , and just above the sleeve 90 , the pair of legs 76 are rigidly secured together by a handle bar 107 which extends forwardly from each leg 76 just above the tab handle 92 on each sleeve 90 . the purpose of the handle bar 107 is to facilitate unfolding the table 50 and frame structure 48 from the stored position to the operative position . to perform this unfolding operation , the handle bar 107 is grasped on each side by each hand , a finger of each hand used to engage the tab handle 92 of each sleeve 90 and raise that sleeve to unlock each leg 76 from its associated strut 80 , and then the table unit pivoted downwardly using the handle bar 107 . once this downward pivoting has commenced , the fingers can release each tab handle 92 as each strut 80 becomes separated from inside the associated leg 76 . in a desirable modification of the locking sleeve arrangement , the head and nut of the pivot bolt 82 may be recessed in the sides of the leg 76 and / or otherwise shaped and dimensioned so that the sleeve 90 passes over the pivot bolt 82 in the folded - away position of the saw table , each sleeve 90 then in such position sliding all the way down the leg 76 until it is stopped by the curved portion of the strut 80 extending rearwardly out of the leg 76 . with this modification , to unfold the saw table the sleeves 90 are first slid upwardly to a position above the pivot bolts 82 and held in this raised position by a finger of each hand while the ends of the bar handle 107 are then grasped to lower the saw table . it should be noted that the pivot bolt 84 is disposed rearwardly of the frame structure pivot bolt 62 so that the pivot bolt 84 will not interfere with the vertical stored position of the leg 76 ; and the rear end of the strut 80 is curved to accommodate this . fig2 is a diagrammatic front elevational view of the radial arm saw and shows the electric motor 108 of the saw unit extending to the opposite side of the radial arm 38 to the saw blade 32 . the two parallel legs 76 can be seen connected together by the handle bar 107 . the lower portion of the right hand front leg 76 has been broken away to show the bottom of the right hand rear leg 66 of the wall support 26 . the four brackets 68 can be seen extending sideways outside the legs 76 and 66 . the upstanding side plate extensions 60 can be seen spaced outwardly from the frame structure 48 with the two pivot bolts 62 bridging the gaps therebetween . the downwardly pivoting door 102 of the box portion 64 is provided with a handle 110 which can also be used to lock the door in the closed position . an on / off switch 105 for the motor 108 is located in the front face of the radial arm 38 . fig3 is a diagrammatic top plan view of the saw table , with parts omitted and a portion broken away to show more details of the frame structure 48 . the front portion 52 of the table is screwed to the frame structure 48 . the middle portion 54 , the fence 58 , and the rear portion 56 of the table top are clamped by clamps 112 against the rear edge of the fixed portion 52 . the clamps 112 may be tightened and loosened by rotating handles 114 . by loosening the handles 114 , the back portion of the table top comprising the parts 54 , 58 and 56 can be removed . after removal of the parts 54 , 58 and 56 , the saw assembly 22 can be pivoted to the inoperative position shown in broken lines . to reach this position , the column 40 and socket 42 pivot about the horizontal pivot bolt 115 ( shown in broken lines ) until the column 40 and the radial arm 38 lie outside the saw table in substantially the plane thereof . during the final portion of this pivoting , the motor 108 enters and is partly housed in a cavity 109 between members of the frame structure 48 , this cavity 109 being exposed when the table parts 54 , 58 , 56 are removed . after the saw unit 22 has been pivoted to the inoperative position shown in fig3 the saw table and frame structure 48 are then ready to be pivoted upwardly and backwardly to the stored position indicated in broken lines in fig1 . i it will thus be appreciated that in the stored position , the saw assembly , particularly the saw blade 32 , is positioned between the wall 28 and the now upright saw table 50 and frame structure 48 , so shielding the saw assembly and the saw blade from access and accidental interference . also , the on / off switch 105 of the saw will be adjacent the top of the stored radial arm so pointing upwards towards the ceiling ; in this position the on / off switch is most inaccessible . fig4 diagrammatically shows a section on the line 4 -- 4 in fig1 with the sleeve 90 resting on top of the bracing strut 80 . the u - shaped channel form of the leg 76 inside the sleeve 90 is clearly shown as is the tab handle 92 extending from the front of the sleeve 90 . fig5 is a diagrammatic section on the line 5 -- 5 in fig1 and shows the u - shaped channel sectioned bracing strut 80 nested inside the leg 76 . in this position the sleeve 90 has dropped down over the upper end of the nested strut 80 so preventing the strut 80 from pivoting relative to the sleeve 90 or the leg 76 . to render this locking position of the sleeve 90 more effective , a cutout 116 is provided in the lower portion of each side of the sleeve to accommodate the head of the pivot bolt 82 and its nut 118 and allow the sleeve 90 to slide partially past the pivot bolt 82 . each cutout 116 extends approximately halfway up the height of the sleeve 90 , as shown in fig1 . fig6 and 8 illustrate a latch mechanism 120 for locking the column 40 in the upright , vertical operative position ( fig6 and 7 ), and also for locking the column 40 in the horizontal inoperative position ( fig8 ). an arm 122 extends at right angles to the socket 42 from one side thereof below the pivot 115 ( fig7 ) about which the socket 42 is pivotal . in the upright vertical position of the column 40 , an arm assembly 126 carrying an l - shaped bracket 124 is resiliently biased about a pivot 128 to cause the base of the l - shaped bracket 124 to engage over the free end of the arm 122 and latch the socket 42 in its vertical position -- as shown in fig7 . to pivot the column 40 to the inoperative position , the l - shaped bracket 124 is manually pivoted clockwise in fig7 to unlatch the arm 122 , so allowing the socket 42 to be pivoted counter - clockwise to its inoperative , stored horizontal position . when the l - shaped bracket 124 is released , its upper end is resiliently biased counter - clockwise to engage the base of the socket 42 and also engage under a ramp - like detent 130 extending from the base of the socket 42 to latch the socket 42 and column 40 in the horizontal collapsed position . to again erect the column 40 to its vertical position , the bracket 124 is manually moved clockwise against the spring bias to disengage the bracket 124 from the detent 130 so allowing the column 40 to be pivoted clockwise . this column latching arrangement 120 is more fully disclosed in u . s . pat . no . 4 , 523 , 504 in which it is illustrated in fig9 and 11 thereof . also , the manner of pivoting the saw assembly into and around the frame structure of a radial arm saw to collapse such for storage is more fully described and illustrated in u . s . pat . no . 4 , 523 , 504 the whole disclosure of which is hereby incorporated herein by reference . fig9 and 11 illustrate a second embodiment of the present invention . in this embodiment the saw table 50 , the saw unit 30 , the radial arm 38 , and the column 40 are the same as previously described with respect to the previous embodiment . however , the base of the column socket 140 is provided with a flange which is mounted on the top of a box - like wall support 142 and secured thereto by four bolts 144 ( only two of which can be seen ). the box - like wall support 142 is hollow to form a storage compartment and has a downwardly pivoting front door similar to that previously described in relation to fig1 and 2 . the box - like support 142 is mounted on and secured to the wall 28 by four screws 145 ( two of which are shown in broken lines ) which are driven home into the wall 28 from inside the support 142 . the saw table 50 is supported on a frame structure 146 which is provided at its rear lower edge with a pair of downwardly extending lugs 148 each of which is pivotally mounted on a side of the wall support 142 by a pivot bolt 150 . a bracing strut 152 comprising two part - struts 154 and 156 is pivotally attached at its lower end to the wall support 142 by a pivot 158 , spaced below the pivot 150 , and at its upper end the strut 152 is pivoted to the side of the frame structure 146 adjacent the front thereof by a pivot bolt 160 . the two strut parts 154 , 156 are pivoted together at 162 . a releasable latch means may be provided to prevent the strut parts 154 and 156 pivoting relative to each other when in the supporting position of fig9 ; this releasable latch means is schematically shown and identified by the reference numeral 164 . alternatively , or in addition , one of the strut parts 154 , 156 could be provided with a flange at one edge and abutting the other strut part to prevent the bracing strut 152 folding and moving the pivot 162 upward under the weight of the saw table 50 and the frame structure 146 . a releasable latch may be provided between the wall support 142 and the frame structure 146 to releasably lock the frame structure 146 in the extended , horizontal operative position shown in fig9 ; such a releasable latch is schematically illustrated by the broken line 166 . fig1 illustrates the stored position of the radial arm saw ; this position has been obtained from fig9 by releasing the lever 46 , pivoting the radial arm 38 on the column 40 until parallel to the wall 28 , locking the radial arm 38 in this position with the lever 46 , and then releasing the latch 164 with movement of the pivot 162 downwards to enable the saw table 50 and frame structure 146 to be pivoted downwardly about the pivot 150 to extend downwardly in a vertical position in front of the wall support 142 . the storage position of the saw table 50 and frame structure 146 is shown in solid lines in fig1 and broken lines in fig9 . the extended operative position of the saw table and frame structure is shown in solid lines in fig9 and broken lines in fig1 . the front edge of the saw table 50 moves through a circular arc 168 about the axis of the pivot 150 when moving between the operative and stored positions . as will be appreciated , the surface of the saw table 50 lies in a horizontal plane h 1 in the extended operative position , and in a vertical plane v 1 in the stored position . it will also be appreciated that there is a pivot 150 on each side of the wall support 142 , and also a pair of bracing struts 152 one on each side of the frame structure . fig1 is a top plan view of this second embodiment viewed along the line 11 -- 11 in fig9 . in broken lines the radial arm 38 and saw unit 30 are shown swung counter - clockwise about the vertical column 40 to nearly the stored position shown in fig1 . during swinging movement of the saw unit 30 to and from the stored position of fig1 , the radially outer end of the radial arm 38 moves along an arc 170 centered on the vertical axis of the column 40 . a third embodiment of the present invention is illustrated in fig1 and 13 . fig1 shows the radial arm saw in the operative position with the saw table 50 extended . fig1 shows the radial arm saw in the stored position with the saw table 50 folded upwardly to a vertical position and the column 40 , radial arm 38 , and saw unit 30 stored between the saw table 50 and the wall 28 . in this embodiment , the wall support 176 is similar to that in the previous embodiment except it has a pair of upstanding lugs 182 at the top front edge . each lug 182 supports a pivot 184 on which the frame structure 180 of the saw table is pivotally mounted . the socket 172 of the column 40 is provided with a base flange 174 and a front flange 178 . the base flange 174 is mounted on the top of the box - like wall support 176 and releasably secured thereto by four machine screws 175 . the forward flange 178 is releasably secured to the rear edge of the frame structure 180 by machine screws 179 . thus , in the operative position shown in fig1 , the saw table 50 and its frame structure 180 are cantilevered forwardly from the wall support 176 and immoveably secured in this position to the wall support via the flanges 178 and 174 of the socket 172 . in this operative position the top of the saw table 50 lies in a horizontal plane h 2 . to move the radial arm saw into the stored position shown in fig1 , the machine screws 175 and 179 are removed ; then the saw unit and column 40 lifted up and stored on the wall support 176 with the socket 172 and column 40 lying along the top of the wall support 176 , and with the saw blade guard of the saw unit 30 being positioned adjacent the wall 128 . the removable rear portions of the saw table 50 are now removed , i . e . the parts 54 , 56 , and 58 , and placed on top of the wall support 176 in the space between the column and radial arm unit 40 , 38 and the wall 28 , as illustrated in fig1 . the saw table 50 and frame structure 180 are then pivoted upwardly about the pivot 184 until the surface of the saw table 50 lies in a vertical plane v 2 . during this upward pivoting of the saw table 50 , the end of the motor 108 extending away from the wall 28 enters into and is stored in a recess in the frame structure 180 exposed by removal of the rear portion of the saw table 50 ( similarly as described with references to fig3 ). when the frame structure 180 has reached the vertical position shown in fig1 , it is latched in position by latch means operative between the wall support 176 and the frame structure 180 as indicated schematically by the broken line 186 . in the embodiment of fig1 to 8 , the removable rear parts 54 , 56 and 58 of the saw table 50 can , in the stored position of the radial arm saw , also be stored on top of the wall support between the wall 28 and the column 40 in a similar manner to that shown in fig1 . the above described embodiments , of course , are not to be construed as limiting the breadth of the present invention . modifications , and other alternative constructions , will be apparent which are within the spirit and scope of the invention as defined in the appended claims . | 1 |
hoat polypeptide is defined as a polypeptide sequence that is at least about 85 % homologous by amino acid sequence ( ordinarily at least about 90 %, and prefereably at least about 95 %) with the sequence of fig1 ( reference sequence hoat ). an expressed sequence tag ( est ) of approximately 200 bp having high homology to a segment of hoat is found in the genbank est entries under accession no . r25797 . invention hoat nucleic acids per se as defined herein exclude any expressed sequence tag ( est ) or other nucleic acid sequences found in public databases on the filing date ( such databases being expressly incorporated by reference ), including the sequence of accession no . r25797 as well as the rat roat1 and oat1 , and mouse nkt , sequences of the prior art . however , other inventive subject matter such as isolated protein , methods for screening and the like as set forth above do not ( unless expressly stated to the contrary ) exclude the use of the r25797 sequence or its expression product . “ homology ” is defined as the percentage of residues in a candidate amino acid sequence that is identical with the residues in the reference sequence hoat after aligning the two sequences and introducing gaps , if necessary , to achieve the maximum percent homology . methods and computer programs for the alignment are well know in the art . one computer program which may be used or adapted for purposes of determining whether a candidate sequence falls within this definition is “ align 2 ”, authored by genentech , inc ., which was filed with user documentation in the united states copyright office , washington , d . c . 20559 , on dec . 10 , 1991 . “ isolated ” hoat nucleic acid is one that has been separated from its environment as it is found in nature , i . e ., from the genome in the case of dna or from cellular environment in the instance of rna . “ isolated ” hoat polypeptide is one that has been separated from its normal cellular environment , and includes hoat protein that is homogeneous by sds - page using silver stain . in calculating amino acid sequence homology the candidate and reference sequences are aligned in the fashion that produces the maximum number of aligned residues , with insertions and deletions of residues represented by gaps in the aligned sequences . for example , a 120 residue polypeptide containing a 100 residue reference sequence fragment fused at its n - terminus to a 6 residue polyhistidine affinity tag , but with a single substitution in the hoat domain , is calculated to be 99 % homologous to the hoat reference sequence since the sequence of the fragment corresponds exactly to the maximally aligned hoat reference sequence except for a single residue substitution and the 6 residue n - terminal fusion . thus , if the alignment - maximizing comparison of the candidate and reference sequences reveals an insertion ( or deletion ) of one or more amino acid residues , then these residues are ignored for the purposes of making the homology calculation . applicant recognizes that this convention gives rise to theoretical 100 % homology between 2 differing sequences , but has chosen to establish his own definition for the purposes of this filing . analysis of homology is based on any one or more of the sequences imputed from the nucleic acid used to express the hoat , the sequence of the product as first produced in vitro , or the sequence after any post - translational modification . thus , if the reference and candidate sequences are identical when expressed , but a glutamine residue is later deaminated to glutamic acid , the first candidate is 100 % homologous , but the deaminated sequence is not . for the purposes herein “ hoat activity ” means any one or more of the functions performed by hoat in the human , including in particular the transport of organic anions . it is not necessary for a polypeptide to have anion transport activity in order to fall under the definition of hoat herein . for example , in some embodiments hoat polypeptides possess at least one immune epitope that is capable of substantial cross - reaction with an antibody raised against reference sequence hoat , and thus are useful in immunoassays for hoat , but may possess mutations that render the polypeptide incapable of anion transport . the hoat polypeptides of this invention comprise substitutions for , deletions of , or insertions of any amino acid residue adjacent to any of the reference sequence amino acid residue sites shown in fig1 . substitutional hoats are those in which at least one amino acid residue in the reference sequence has been removed and a different amino acid inserted in its place at the same position . one or more residues are substituted . alanine is a common substitution for any residue , and is commonly used in alanine scanning to identify functional residues , but it is within the scope of this invention to substitute other residues into the hoat reference sequence . the introduced residues generally are naturally occurring amino acids , commonly g , a , y , v , l , i , s , t , d , e , q , c , m , n , f , p , w , k , r or h ( using conventional single letter code ; ep 323 , 149 ). suitable residues also include hydroxyproline , beta - hydroxyaspartic acid , gamma - carboxyglutamic acid , hydroxylysine or norleucine , to be employed as alternatives to their namesakes . these substitutions may be conservative , i . e ., the substituting residue is structurally or functionally similar to the substituted residue . other substitutions will be less conservative in that they constitute an exchange between different structural or functional classes of residues . for the purposes herein , these classes are as follows : 1 . electropositive : r , k , h ; 2 . electronegative : d , e ; 3 . aliphatic : v , l , i , m ; 4 . aromatic : f , y , w ; 5 . small : a , s , t , g , p , c ; 6 . charged : r , k , d , e , h ; 7 . polar : s , t , q , n , y , h , w ; and 8 . small hydrophilic : c , s , t . intergroup substitutions generally will have greater effects on protein function than conservative ( intraclass ) substitutions . thus , it is particularly within the scope of this invention to introduce conservative substitutions into hoat and , if the results are not satisfactory , to introduce non - conservative substitutions at the sites . typically , however , proline , glycine , and cysteine substitutions or insertions into the sequence are not favored . an example of an expressed variant is a change at codon 498 from agc to atc , resulting in expression of isoleucine in place of serine . other variants are introduced into dna encoding hoat without resulting in a change in protein sequence , e . g . from atc to att at codon 453 or from ggg to ggt at codon 491 . hoat variants are readily identified by methods apparent to the ordinary artisan . for example , sites shown by alanine scanning to influence selected biological activity are subjected to saturation mutagenesis to identify the optimal modification for the activity in question , e . g . selectivity for transport of a particular anion . hoats representing combinations of sequence variants are within the scope of this invention . 2 , 3 , 4 , 5 , or more substitutions , deletions or insertions are introduced into hoat as defined herein . typically , a deletion of a single residue will be accompanied by an insertion within 1 to about 3 residues of the deletion site . generally , deletions of larger domains unnecessary for anion transport activity need not be accompanied by an insertion . the results of individual amino acid substitutions are generally additive except when the residues interact with each other directly or indirectly . they are readily screened using the same procedures described in sweet et al . or sekine et al . ( supra ) in order to identify those having the properties of reference sequence hoat or the desired modified properties . included within the scope of this invention are hoats having one or more amino acids inserted immediately adjacent to a hoat amino acid at any position in the reference sequence . insertional hoats generally will have a polypeptide structure comprising the sequence nh 2 - pp - a -( x ) n1 - b - pp - cooh , wherein x is the inserted residue ( s ) ( which may be the same or different ), n1 is an integer ( generally 1 – 30 , typically 1 or 2 ), either a or b are the designated residue sites for insertion and pp represents the remainder of the hoat or a bond at the hoat n or c terminus . the invention includes fusions of hoat and selected antibody recognition sequences ( heterologous polypeptides ) for immunoaffinity purification of hoat from cell culture , fusions of hoat sequences with affinity tags such as flag or polyhistidine , and chimeric sequences ( particularly fusions of hoat sequence fragments with fragments of other receptors of the 12 - transmembrane spanning region class ). also included within the scope of this invention are hoats in which a glycosylation site is introduced or removed from the reference sequence , whether by substitution , insertion or deletion of one or more amino acid residues . such changes will result in the installation or removal of the sequence nxs or nxt , where x can be any residue . thus , asparagine can be substituted for any residue located 2 residues n - terminal to serine or threonine to introduce a glycosylation site . alternatively , single glycosylation can be omitted by substituting glycosylated asp with any residue , deleting site - adjacent serine or threonine substituting any residue into the glycosylation site to perturb the nxs or nst sequence . also included within the scope of this invention are deletional hoats , i . e ., hoats in which one or more amino acid residues of the reference sequence have been removed at a designated site , whereby flanking residues are now joined by a peptide bond in the ordinary fashion . it generally is not preferred to delete p , c or g residues . typically , deletions or insertions are relatively small , on the order of 1 to 10 residues and generally no more than 2 , although deletions or insertions can be quite large if they are not in critical portions of the reference sequence , or the additional sequence is to be removed at some point during post - translational or post - recovery processing . the number of residues that are deleted or inserted in part will depend upon whether or not they are found in secondary structural components such as helices or sheets ( whereupon only 1 or , preferably 2 residues are inserted or deleted ), or are in less structurally confined domains such as loops , where larger numbers of residues may be deleted or inserted without unduly perturbing the structure of hoat . the hoats of this invention may be subject to post - translational covalent modification , e . g . deamidation of asparagine or glutamine , or oxidation of cysteine residues . glycosylation can be variant or absent depending upon the host cell used to express the variant . hoats containing such modifications are included within the scope of this invention . if hoat is glycosylated in recombinant cell culture , it preferably is glycosylated with carbohydrates characteristic of mammalian cells , although it also may bear fungal ( such as yeast ) glycosylation patterns . glycosylation is acceptable which is characteristic of expression of hoat from one or more of fibroblast , kidney , brain , lung , skin , neural , liver or bone marrow cells or cell lines , or from any mammalian cell line such as cho or embryonic kidney cells . naturally occurring human alleles are included within the scope of this invention . these readily are identified by obtaining nucleic acid samples from individuals in a population , sequencing hoat from such individuals and determining residues at which variation is found . once each variation is identified , it is straight - forward to determine the frequency of the putative allele in other individuals by pcr using primers specific for the domain in question , or such other methods as are conventional in the field for determining proportions of alleles in human populations . the hoats of this invention are readily prepared by methods known in the art . in general , nucleic acid encoding the hoat is prepared by pcr , by in vitro synthesis ( vasser et al ., “ n . a . r .” 18 ( a0 ): 3089 [ 1990 ]), by cloning from a human genomic or kidney cdna library or combinations thereof . site - directed mutagenesis of hoat - encoding nucleic acid is used to prepare nucleic acid encoding sequence variants . the + ( coding ) and − strands ( antisense ) of hoat are included within the scope of hoat nucleic acids , as are hoat - encoding cdna , genomic dna and rna . hoat dna includes 5 ′ and 3 ′ regions of the hoat gene that are not transcribed but serve as transcription control domains , and transcribed but not expressed domains such as introns ( including splice junctions ), polyadenylation signals , ribosomal recognition domains and the like . the hoat nucleic acid is expressed in in vitro systems or in recombinant host cells . one method for expression is ribosome based synthesis using dedicated trnas ( benner , “ tibtech ” 12 : 158 – 163 [ 1994 ] and robertson et al ., “ j . am . chem . soc .” 113 : 2722 – 2729 [ 1991 ]). ordinarily , however , the hoat - encoding nucleic acid ( generally dna ) is inserted into an appropriate expression vector recognized ( transcribed and translated ) by the host cells , host cells are transfected with the expression vector , the recombinant host cells are grown in suitable culture medium , and optionally the desired hoat is recovered from the recombinant cell culture by chromatographic or other purification methods . it is also within the scope of this invention to partially synthesize the hoat in recombinant cell culture or by in vitro methods and then ligate the polypeptide fragments by peptide ligase ( reverse proteolytic synthesis ). the nucleic acid for expression of the hoat may comprise an exogenous signal sequence . here , the hoat is expressed as a preprotein of hoat , whereby the hoat is expressed as a precursor that is processed to mature hoat . suitable presequences include those of ( a ) microbial proteases such as subtilisin , ( b ) mammalian polypeptides , ( c ) cytokines such as gamma interferon or an interleukin , ( d ) growth factors such as growth hormone or tgf - alpha , ( e ) polypeptides or proteins having n - terminal mature sequences that are homologous to human hoat , ( f ) immunoglobulins , ( g ) receptors , or ( h ) other presequences of secreted or cell membrane bound proteins . signal sequences optionally are derived from or are homologous to the host cell , or at least the phylogenetic branch to which the host cell belongs . for example , one ordinarily would use a presequence of a yeast protein , such as mating factor , in a yeast expression system , or of a bacterium , such as st - ii or beta - lactamase , in bacterial cell culture systems . a wide variety of suitable signal sequences are known and can be used in methods for the preparation of the hoats described herein . the nucleic acid constructs encoding hoat generally are spliced into expression vectors where they will be under the control of sequences controlling transcription , translation and rna stability . these sequences include promoters , operators , enhancers and polyadenylation sequences , and are generally known in the art . constructing suitable expression vectors for hoats of this invention is a matter of routine for those skilled in the art , and will be accomplished using the conventional tools of molecular biology , including nucleic acid synthesis in vitro , pcr , adapters , ligases , restriction enzymes , expression and shuttle plasmids , transfection aids and the like , all of which are publicly ( and for the most part commercially ) available . suitable host cells for transfection with nucleic acid encoding hoat are well known . some are mentioned above while others are described in wo 93 / 13208 at page 12 , line 21 – page 19 , line 5 , and ep 319 , 312 b1 , page 16 , lines 10 – 18 and table ii thereof . it may be optimal to use host cells that are capable of glycosylating hoat , typically including mammalian cells such as embryonic kidney 293 cells , cos cells , cho , bhk - 21 cells and the like . xenopus oocytes are suitable for expression of hoat rna . in addition , host cells that have been used heretofore to express anion transporter polypeptides in recombinant cell culture are suitable . the host - vector system should yield substantially homogeneous hoat , thereby avoiding the need to purify various hoat alleles , isoforms or cleavage products from one another . if the host cell is capable of glycosylation , essentially all of the hoat molecules should be glycosylated . in addition , host cells optimally will not proteolyse hoat . cells can be selected that contain no protease , e . g ., in the periplasm , that will cleave hoat . for example , e . coli and other microbial strains are known that possess little or no extracellular or periplasmic proteolytic activity ( other than signal peptidases ). the absence of deleterious proteases helps to ensure that the product is not rendered microheterogenous as to chain length by host - endogenous proteases acting on the hoat expression product . in addition , or alternatively , basic residues of hoat that define sites for proteolytic cleavage are substituted with residues other than k or r . the hoat recombinant cells are cultured under conventional conditions using conventional culture media heretofore employed with the cells in question . these conditions and media are widely known . freshly transfected cells may only transiently express the hoats , but stable transformants readily are obtained in accord with conventional practice using cotransformation with a selection gene such as dhfr or glutamine synthetase and serial culture in the presence of a selection agent such as methotrexate or methionine sulfoximine , respectively . yields of hoats can differ substantially despite minor differences in the character of substituents or insertions . in such cases , it is desirable to screen for an expression system that will yield a quantity of hoat that is at least about 75 % of that obtained with the reference hoat in the same expression system . the hoat may be expressed in bacteria in the form of retractile bodies , in which base the insoluble hoat is recovered and refolded using known methods , e . g . dissolution in a denaturant such as guanidinium hydrochloride followed by gradual removal of the denaturant . directly expressed hoats of this invention may have an extra n - terminal methionine or blocked methionine residue , although host cells can be employed that will cleave away such n - terminal methionine residues if they are extraneous to the protein as found in nature . in order to avoid difficulties with insoluble expression products it is preferable to express hoat in eukaryotic , more preferably mammalian , cells . hoat is isolated or purified from recombinant cell culture by methods heretofore employed for other proteins , e . g ., native or reducing / sds gel electrophoresis , isoelectric focusing , immobilized ph gradient electrophoresis , salt precipitation , solvent fractionation ( using ethanol for example ) and chromatography such as gel filtration , ion exchange ( cation or anion ), ligand affinity ( cibacron blue f3ga or p - aminobenzamidine ), immunoaffinity , chromatofocusing , reverse phase or hydrophobic interaction chromatography . typically , the hoat will be isolated so as to be & gt ; 95 % pure by weight of protein , and preferably greater than 99 % pure . however , the term “ isolated ” as used in reference to hoat protein or nucleic acid refers to the absence of one or more of the normal human polypeptides or nucleic acids found in association with hoat in its natural environment , and does not necessarily imply that the hoat is purified to any degree free of non - hoat proteins . since hoat is normally found in the cell membrane , it is preferable to recover recombinant hoat as a membrane preparation ; otherwise the function of hoat may be perturbed . in any case , many utilities for hoat do not require purification of the protein at all ; screening assays for agonists or antagonists are best conducted in intact host cells . the hoat polypeptides or their fragments optionally are prepared in vitro , especially if they are relatively small , e . g . on the order of about 30 residues or less . for example , hoats are prepared by synthesis using standard solid - phase peptide synthesis procedures as described by merrifield “ j . am . chem . soc .” 85 : 2149 ( 1963 ). these then are ligated together by the use of peptide ligase reverse proteolysis ). in vitro methods of protein synthesis also are used to prepare hoats without the need for recombinant cell culture . such methods are useful for small - scale preparations , and have the advantage of reducing the possible effect on yields of host cell proteases . in vitro hoat protein synthesis has one additional quite substantial advantage in that it permits the site - specific introduction into the hoat of a non - naturally occurring amino acid residue . accordingly , when the term “ amino acid residue ” is used herein ( in connection with hoat modification by substitution or insertion , especially by a single amino acid ) it will be understood that the amino acid is not limited to the naturally occurring residues associated with native trnas . aminoacyl trna is efficiently prepared using a variety of non - naturally occurring amino acid residues (“ non - naturally occurring ” means not naturally found in proteins , although the amino acid might be found elsewhere in nature ). since the trna is selected to be incorporated at a codon not recognized by any of the trnas normally involved in protein synthesis , the selected non - naturally occurring amino acid residue is incorporated only at the particular site in the hoat sequence chosen for the unique codon . thus , in these cases the hoat is encoded by a nucleic acid having a nonsense codon , e . g ., uag , at the desired unique insertion or substitution site . suitable non - naturally occurring amino acids are described for example in greenstein et al ., “ chemistry of the amino acids ” vols . 1 – 3 , 1986 . in general , one will use pharmaceutically innocuous l - amino acids that are found in nature but ordinarily not incorporated into proteins . such amino acids typically will be structurally related to a naturally occurring residue that produces the desired effect at a given site and will be used to further resolve and optimize the desired property of the hoat . the hoats of this invention also include hoats that have been substituted by a non - peptidyl moiety , either for purposes of preparing the hoat to begin with or as a subsequent modification of the hoat prepared by amino acid substitution , insertion or deletion as described elsewhere herein . covalent modification may accomplish essentially the same objective as a site - directed mutant at the same location using a naturally occurring residue . tryptophan is a relatively rare amino acid in hoat . accordingly , this residue is an attractive site for post - translational convalent modification because substitution at other sites is expected to be less than may be the case with more common residues . reaction of trp with an oxidant such as a halogen donor , e . g . bromine , will yield the side chain structure this reaction should be conducted in aqueous solvent and at low halogen concentrations . other covalent modifications of hoats will be apparent to the artisan . sensitive side chains are protected by masking them with antibodies directed against an epitope that includes the residue to be protected . reagents for accomplishing such modifications are well - known and have been widely used in the diagnostic and preparative fields . see t . creighton , proteins : structure and molecular properties , 1983 . hoats are cross - linked to a water insoluble matrix or incorporated into a lipid vehicle such as a liposome , usually a ulv . cross - linking is accomplished by reacting the hoat and matrix with a bifunctional agent . examples of suitable bifunctional agents include 1 , 1 - bis ( diazoacetyl )- 2 - phenylethane , glutaraldehyde , n - hydroxysuccinimide esters , for example , esters with 4 - azidosalicylic acid , homobifunctional imidoesters , including disuccinimidyl esters such as 3 , 3 ′- dethiobis ( succinimidylpropionate ), and bifunctional maleimides such as bis - n - maleimido - 1 , 8 - octane . derivatizing agents such as methyl - 3 -[( p - azidophenyl ) dithio ] propioimidate yield photoactivatable intermediates that are capable of forming crosslinks in the presence of light . alternatively , hoat is immobilized on reactive water - insoluble matrices such as cyanogen bromide - activated carbohydrates and the reactive substrates described in u . s . pat . nos . 3 , 969 , 287 ; 3 , 691 , 016 ; 4 , 195 , 128 ; 4 , 247 , 642 ; 4 , 229 , 537 ; and 4 , 330 , 440 . hoats also are covalently modified by linking the hoat to various nonproteinaceous polymers , e . g ., polyethylene glycol ( peg ), polypropylene glycol or polyoxyalkylenes , in the manner set forth for example in u . s . pat . nos . 4 , 640 , 835 ; 4 , 496 , 689 ; 4 , 301 , 144 ; 4 , 670 , 417 ; 4 , 791 , 192 or 4 , 179 , 337 . peg is a non - immunogenic , linear , uncharged polymer with three water molecules per ethylene oxide unit . see maxfield , et al ., “ polymer ” 16 : 505 – 509 ( 1975 ); bailey , f . e . et al ., in “ nonionic surfactants ”, schick , m . j ., ed , pp . 794 – 821 ( 1967 ). several therapeutic enzymes have been conjugated to peg to increase their in vivo half - life ( abuchowski , a ., et al ., “ j . biol . chem .” 252 : 3582 – 3586 ( 1977 ); abuchowski , a . et al ., “ cancer biochem . biophys .” 7 : 175 – 186 ( 1984 ). an il - 2 ( interleukin - 2 )- peg conjugate has been reported to increase circulatory life and potency ( katre , n . v . et al ., “ proc . natl . acad . sci .” 84 : 1487 – 1491 ( 1987 ); goodson , r . et al ., “ bio / technology ” 8 : 343 – 346 ( 1990 )). see also abuchowski , a . et al ., “ j . biol . chem .” 252 : 3578 – 3581 ( 1977 ). any of the methods for peg conjugation used in these citations is acceptable for use with the hoats of this invention . the hoats of this invention are useful in therapeutic , diagnostic and preparatory methods . their use will depend upon the properties that they possess , as will be apparent to the ordinary artisan . for the most part , all of the hoats will retain hoat immune epitopes , so they are useful in place of hoat in hoat immunoassays whether or not they possess any anion transport activity . the hoats of this invention are useful in identifying substances that bind to hoat ( hoat binding partners , or “ tbp ”). of particular interest are substances that are capable of binding to hoat to substantially inhibit the anion transport activity of hoat , or , preferably , to introduce favorable selectivity into the transport activity such that nephrotoxic drugs such as amphotericin or cidofovir are not taken up as avidly as in the absence of the substance . tbp &# 39 ; s ability to bind to hoat also is useful in methods for recovering hoat from contaminated mixtures such as cell culture supernatants of recombinant hoat - expressing cells ( including the hoat amino acid sequence hoats herein ). typically , hoats can be used in place of hoat standards in immunoassays for hoat if they possess at least one hoat epitope recognized by the antibody used in the hoat immunoassay in question , while the tbps are used in place of antibodies for hoat . the hoats also are useful , as appropriate , in functional assays for certain individual properties of hoat . peptide tbps are obtained by the use of in vitro directed evolutionary methods such as those employing filamentous phage to present candidate sequences ( otherwise known as phage display ) and similar methods known per se which rely on the systematic generation and screening of peptides for activity . these typically are rather small molecules , containing on the order of about 5 to 20 residues . antibody tbps are immunoglobulins , ordinarily monoclonal antibodies , which ( in preferred embodiments ) are capable of specifically inhibiting the transport function of hoat . antibodies are raised in conventional fashion by immunizing an animal with an immunogenic hoat conjugate , e . g . hoat crosslinked to keyhole limpet hemocyanin . the term “ monoclonal antibody ” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies , i . e . the individual antibodies comprising the population are essentially identical in specificity and affinity . monoclonal antibodies include hybrid and recombinant antibodies ( e . g . “ humanized ” antibodies ) regardless of species of origin or immunoglobulin class or subclass designation , as well as antibody fragments ( e . g ., fab , f ( ab ′) 2 ′ , and fv ). thus , “ monoclonal ” antibodies are produced by any particular method that will yield a substantially homogeneous population . for example , monoclonal antibodies may be made using the methods described by kohler & amp ; milstein , “ nature ” 256 : 495 ( 1975 ), goding , monoclonal antibodies : principles and practice pp . 59 – 103 ( 1986 ), kozbor , “ j . immunol .” 133 : 3001 ( 1984 ), or brodeur , et al ., monoclonal antibody production techniques and applications , pp . 51 – 63 ( 1987 ), or may be made by recombinant dna methods . cabilly , et al ., u . s . pat . no . 4 , 816 , 567 . in a preferred embodiment of the invention , the monoclonal antibody will have an affinity for reference sequence hoat of at least about 10 9 moles / liter , as determined , for example , by the scatchard analysis of munson & amp ; pollard , “ anal . biochem .” 107 : 220 ( 1980 ). also , the monoclonal antibody typically will inhibit the transport activity of hoat ( using a standard organic anion such as para - aminohippurate ) by at least about 50 %, preferably greater than 80 %, and most preferably greater than 90 %, as determined by conventional methods . dna encoding the monoclonal antibody is readily isolated and sequenced using conventional procedures ( e . g ., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies ). hybridoma cells serve as a preferred source of such dna . once isolated , the dna may be placed into expression vectors , which are then transfected into host cells such as simian cos cells , chinese hamster ovary ( cho ) cells , or myeloma cells that do not otherwise produce immunoglobulin protein , to obtain the synthesis of monoclonal antibodies in the recombinant host cells . the dna optionally may be modified in order to change the character of the immunoglobulin produced by its expression . for example , humanized forms of murine antibodies are produced by substituting a complementarity determining region ( cdr ) of the murine antibody variable domain for the corresponding region of a human antibody . in some embodiments , selected framework region ( fr ) amino acid residues of the murine antibody also are substituted for the corresponding amino acid residues in the human antibody . humanized forms of murine antibodies also may be produced by substituting the coding sequence for human heavy and light constant chain domains in place of the homologous murine sequences . morrison , et al ., “ pnas ” 81 : 6851 ( 1984 ). tbp also includes nucleic acid sequences that bind hoat . evolutionary selection methods for oligonucleotides that bind to target proteins are well known ( wo 92 / 14843 ; ellington et al ., “ nature ” 355 : 850 ( 1992 ); bock et al ., “ nature ” 355 : 564 ( 1992 ); ellington et al ., “ nature ” 346 : 818 ( 1990 ); tuerk et al ., “ science ” 249 : 505 ( 1990 ). these oligonucleotides , commonly known as aptamers , generally contain the usual a , t , g , c or u bases or derivatives thereof , and comprise sequences that bind to a predetermined site on a target protein . a selection method for tbps that inhibit the transport function of hoat comprises ( a ) preparing a pool of candidates ( oligonucleotides , peptides , extracts , proteins , etc . ), ( b ) contacting the candidates with hoat having anion transport activity ( typically reference sequence hoat ) ( c ) isolating from the hoat those candidates that are able to bind to hoat , ( d ) contacting the candidates from step c ) with an hoat in which the hoat transport function has been mutated substantially out of the hoat , and ( e ) recovering those candidates that do not bind to the mutated form . for diagnostic applications , the hoats of this invention optionally are labeled with a detectable moiety , either in vivo or in vitro . the detectable moiety can be any substituent which is capable of producing , either directly or indirectly , a detectable signal . for example , the detectable moiety may be a radioisotope , such as 3 h , 14 c , 32 p , 35 s , or 125 i , a fluorescent or chemiluminescent compound , such as fluorescein isothiocyanate , rhodamine , or luciferin ; a radioactive isotopic label , such as , 125 i , 32 p , 14 c , or 3 h , or an enzyme , such as alkaline phosphatase , beta - galactosidase or horseradish peroxidase . any method known in the art per se can be used to conjugate the hoat to the detectable moiety . see the methods described supra and hunter , et al ., “ nature ” 144 : 945 ( 1962 ); david , et al ., “ biochemistry ” 13 : 1014 ( 1974 ); pain , et al ., “ j . immunol . meth .” 40 : 219 ( 1981 ); and nygren , j . “ histochem . and cytochem .” 30 : 407 ( 1982 ). oligonucleotide tbps are labeled in the conventional fashion heretofore employed in the diagnostic probe art . the tbps or hoats of the present invention optionally are employed in known immunoassay techniques , such as competitive binding assays , direct and indirect sandwich assays , and immunoprecipitation assays . zola , monoclonal antibodies : a manual of techniques , pp . 147 – 158 ( 1987 ). competitive binding assays rely on the ability of a labeled standard ( which may be hoat , or an immunologically reactive portion thereof such as a labeled hoat of this invention ) to compete with the test sample hoat for binding with a limited amount of tbp . the amount of hoat in the test sample is inversely proportional to the amount of standard that becomes bound to the tbp . to facilitate determining the amount of standard that becomes bound , the tbp generally is insolubilized before or after the competition , so that the standard and analyte that are bound to the tbp conveniently are separated from the standard and analyte which remain unbound . sandwich assays involve the use of two tbps , each capable of binding to a different target portion , or epitope , of hoat . in a sandwich assay , the test sample analyte is bound by a first tbp which is immobilized on a solid support , and thereafter a second tbp binds to the analyte , thus forming an insoluble three part complex . david & amp ; greene , u . s . pat . no . 4 , 376 , 110 . the second antibody may itself be labeled with a detectable moiety ( direct sandwich assays ) or may be measured using an anti - tbp antibody that is labeled with a detectable moiety ( indirect sandwich assay ). for example , one type of sandwich assay is an elisa assay , in which case the detectable moiety is an enzyme . the tbps of this invention also are useful for in vivo imaging , wherein a tbp labeled with a detectable moiety is administered to a host , preferably into the bloodstream , and the presence and location of the labeled tbp in the host is assayed . hoat nucleic acids or tbps also can be used in a method for identifying isoforms or alleles of hoat nucleic acids or polypeptides that place a patient at particular risk for nephrotoxicity . such variants , alleles or isoforms will exhibit different selectivity towards uptake of certain anions . if these anions are nephrotoxic drugs or drug metabolites , then a patient may be at particular risk of injury . the patient can be tested ( e . g ., by amplifying genomic hoat - encoding dna from a blood sample ) to determine if the at - risk variant , isoform or allele is present . if so , then the dosage of the drug can be reduced or an alternative drug used . this method comprises identifying one or more naturally - occurring sequence variations in the human population and determining the selectivity of such variations for transport of a selected nephrotoxic substance . then a patient is tested for the variation associated with relatively selective transport of the nephrotoxic substance . similarly , allelic variation in the transcriptional control regions of the hoat gene can be analyzed for correlation with susceptibility to uptake and transport of selected nephrotoxic drugs ; here the correlation will be with the amount of expression of hoat as opposed to the selectivity of the hoat protein . this method comprises identifying one or more naturally - occurring sequence variations in the expression control domain of hoat in the human population and determining the expression levels of hoat in cells containing such variant . patients having relatively high levels of expression of hoat may not be considered suitable for treatment with nephrotoxic drugs , or the dosage of such drugs may be reduced . since at least a domain of hoat is expressed in the brain as well as the kidney ( cf brain est r25797 and example 3 below ), it is also within the scope of this invention to probe a brain library to obtain the full length gene corresponding to r25797 . the sequence of this gene may or may not diverge substantially from the reference sequence hoat . this notwithstanding , the brain - expressed gene is also a suitable subject for determination of sequence variants such as alleles and isoforms . these may be involved in important neural functions and are suitable subjects for screening to identify them . hoat also is useful in screening methods for compounds that can act to suppress or enhance anion uptake and transport by hoat . suppression of hoat activity ( antagonism ) is useful in reducing the nephrotoxicity of drugs , i . e ., to serve as nephroprotective agents , while enhancement of hoat activity ( agonism ) is useful in the treatment of kidney dysfunction . the screening methods comprise providing a candidate hoat agonist or antagonist , contacting the candidate with hoat nucleic acid or polypeptide , determining the effect of the candidate on the transcription of the hoat nucleic acid ( or the expression or biological activity of the hoat polypeptide ), identifying a hoat agonist or antagonist , and optionally preparing additional quantities of the agonist or antagonist that is so identified . biological activity of hoat is assayed using the stable cell line of example 1 as shown in example 2 . hoat is useful in screening assays for modified forms of heretofore nephrotoxic drugs , or as part of a toxicology screening program to determine the potential nephrotoxicity of new therapeutic compounds . accumulation of the candidate in hoat transformants as opposed to control cells is an indicia of potential nephrotoxicity . determining cc 50 &# 39 ; s using the hoat transformants would produce a direct measure of potential nephrotoxicity . a candidate form of a suspected compound or a known nephrotoxic drug , e . g ., a prodrug , is contacted with the hoat and its effect on the transport by hoat of a benchmark anion is determined . transport of the test compound itself ( usually in an isotopically labeled form ) also can be determined . alternatively , transport of the compound in the presence of probenecid can be assayed . if the compound is no longer transported , or the benchmark anion transport is not affected by the compound , or probenecid has no influence on whether or not the compound is transported , then the candidate is suitable for further study in animals as a potential non - nephrotoxic drug , for example , in the case of a prodrug as a non - nephrotoxic form of the parental drug . prodrugs of nucleotide phosphonate analogues such as cidofovir , pmea or pmpa suitable for testing include mono and di - esters and amidates of the phosphonyl group . a cell line stably expressing hoat1 was prepared and characterized to ultimately prove that the isolated cdna encodes functional hoat1 protein . the expression construct containing hoat1 gene was prepared as follows . hoat1 coding sequence was pcr amplified from plasmid isolated from human kidney cdna library . pcr reaction was performed under standard conditions using expand high fidelity pcr system ( boehringer mannheim ). oligonucleotides 5 ′- accgtctagaatt ctttttatttttaattttctttcaaatac gtccaccatggcctttaatgacctcctgcagcagg - 3 ′ ( seq . id no . 3 ) and 5 ′- tactcacgtggatcctgatcagacgtctgtaggaccttccctccctttagg - 3 ′ ( seq . id no . 4 ) were used as a sense and antisense primer to introduce ecori and bamhi restriction site , respectively . in addition , the sense primer contained truncated 5 ′- untranslated sequence of alfalfa mosaic virus ( underlined ) and favorable kozak consensus sequence ( ccaccatgg ) ( seq . id no . 5 ) to maximize initiation of translation . the pcr product was digested with ecori / bamhi and cloned into piresneo expression vector ( clontech , palo alto , calif .) using the corresponding restriction sites to yield pires - hoat plasmid . after cloning , the correct nucleotide sequence of the whole fragment generated by pcr was verified . pires - hoat plasmid was transfected into cho - k1 cells ( atcc ccl61 ) growing in f - 12 nutrient mixture supplemented with 10 % fetal bovine serum , 100 u / ml penicillin , and 100 μg / ml streptomycin . 24 hours before transfection , approximately 6 × 10 6 cho - k1 cells were seeded into 100 - mm petri dish . at the time of transfection , media was aspirated and 6 ml of fresh media containing 12 μg of pires - hoat and 60 μg of cytofectin gsv cationic lipid ( glen research , sterling , va .) was added to the cells . following overnight incubation , selection of stable transformants started in phenol red - free f - 12 nutrient mixture containing fetal bovine serum , penicillin and streptomycin as above , plus 1 mg / ml g418 ( clontech ). viable colonies were isolated after 2 - week selection and tested for uptake of p - aminohippuric acid ( pah , a prototype substrate of organic anion transport systems ) in the presence and absence of probenecid ( inhibitor of organic anion transport ). for the pah uptake assay , the cells were seeded into 12 - well plates at the density of 2 × 10 5 cell / well . after 48 hours , growth media was aspirated and the cells were washed twice with phosphate buffered saline ( pbs ). the uptake assay was performed in transport buffer ( 135 mm nacl , 5 mm kcl , 2 . 5 mm cacl 2 , 1 . 2 mm mgcl 2 , 0 . 8 mm mgso 4 , 28 mm glucose , and 13 mm hepes ph 7 . 2 ) containing 5 μm [ 3 h ] pah ( new england nuclear , spec . activity 1 . 2 ci / mmol ) ± 1 mm probenecid . after 90 min incubation at 37 ° c . in the transport buffer , the cells were washed 3 - times with ice - cold pbs ( 2 ml / well ) and lysed directly on the plate in the presence of 0 . 3 % triton x - 100 ( 0 . 5 ml / well ) for 20 min at room temperature . plates were washed with additional 0 . 5 ml / well of triton x - 100 , the lysate and wash were combined , scintillation fluid was added , and the radioactivity counted . as a result of this assay , a transformed clone with 30 - fold increase in pah uptake compared to parental cho - k1 cells was identified and designated cho - hoat . kinetics of hoat1 - mediated pah uptake was characterized using cho - hoat cells . the uptake assay was performed as described above with various concentrations of [ 3 h ] pah ranging from 5 to 160 μm . to assess net hoat1 - specific uptake , background uptake measured in parental cho - k1 cells at each substrate concentration was subtracted from that determined in cho - hoat cells . kinetic constants were calculated using enzyme kinetics software ( chemsw , fairfield , calif .). as expected , pah uptake in cho - hoat cells was saturable with k m = 13 μm and vmax = 42 pmol / 10 6 cells . as oppose to the background uptake of pah in cho - k1 cells , uptake in cho - hoat cells was strongly sensitive to probenecid with ic 50 = 6 . 2 μm when measured at pah concentration equal to its k m . in addition , pah accumulation in cho - hoat was stimulated approximately 2 . 5 - fold by preloading the cells with 10 mm glutarate indicating that the hoat protein functions as an organic anion / dicarboxylate exchanger . a human multiple tissue northern blot ( clontech ) was used for localization of hoat1 expression in human tissues . a hoat1 - specific [ 32 p ] datp labeled probe was generated by random priming the bsrgi / bsu36i dna fragment corresponding to nucleotides 420 – 854 of the hoat1 coding sequence . the membrane was hybridized for 1 hour at 68 ° c . in expresshyb hybridization buffer ( clontech ) and then washed twice in 2 × ssc with 0 . 05 % sds for 30 minutes at room temperature followed by a single wash in 0 . 1 × ssc with 0 . 1 % sds at 50 ° c . a strong signal was detected in kidney corresponding to a 2 . 5 kb hoat1 transcript . no positive signal was found in the other tested tissues ( brain , heart , skeletal muscle , colon , thymus , spleen , small intestine , placenta , lung , or peripheral blood leukocytes ). in addition , hoat1 expression in various human tissues was examined by more sensitive rt - pcr amplification . for this purpose , the multiple choice cdna kits i and ii containing tissue specific cdnas ( origene technologies , rockville , md .) and two sets of hoat1 - specific primers were used for pcr detection of hoat1 expression . the oligonucleotides , 5 ′- cccgctggcactcctcctccgggag - 3 ′ ( seq . id no . 6 ) ( sense ), and 5 ′- gtagagctcggcagtcatgctcacca - 3 ′ ( seq . id no . 7 ) ( antisense ), was used to amplify a 606 - bp fragment from the hoat1 coding region ( nucleotides 815 – 1420 ). in the independent set of pcr reactions , a 295 - bp hoat1 fragment ( comprised of the last 175 coding nucleotides and 120 nucleotides of the 3 ′- utr ) was amplified using the oligonucleotides , 5 ′- ccagcgctgtcactgtcctcctgc - 3 ′ ( seq . id no . 8 ) ( sense ), and 5 ′- aacccccacacttgggtcaccatttcctc - 3 ′ ( seq . id no . 9 ) ( antisense ). pcr reactions were carried out using the expand high fidelity pcr system ( boehringer mannheim ) in a total volume of 25 μl containing 1 μg of tissue - specific cdna . thirty - five amplification cycles ( 95 ° c . for 40 s , 58 ° c . for 1 min , and 72 ° c . for 45 s ) were performed . positive tissues were identified after separation of pcr reactions on a 1 % agarose gel . as expected , a strong positive signal was consistently detected in kidney . in contrast with the northern analysis , brain and skeletal muscle was also positive for hoat1 expression although to lesser extent compared to kidney . presence of hoat protein in human kidney tissue was verified by an immunoblot analysis with rabbit anti - hoat1 polyclonal antibody prepared at anaspec ( san jose , calif .) using standard immunological techniques . briefly , an immunogenic peptide , nh2 - tvqdlesrkgkqtr - cooh ( seq . id no . 10 ), corresponding to hoat1 amino acids 515 – 528 was conjugated to keyhole limpet hemocyanine through a cysteine residue added to the peptide &# 39 ; s c - terminus . animal serum was collected after 4 immunizations in the presence of complete freund &# 39 ; s adjuvant and affinity - purified against the immunogenic peptide immobilized on a sepharose resin . for immunoblot analysis , human kidney cortex was extractracted with a buffer containing 20 mm tri - hcl , ph 7 . 5 , 150 mm nacl , 1 % np - 40 , 0 . 5 % deoxycholate , and 0 . 1 % sds . after homogenization in the presence of complete proteinase inhibitor cocktail ( boehringer mannheim ) the extract was clarified by high - speed centrifugation , separated by electrophoresis on an 8 % sds - polyacrylamide gel and electroblotted onto a nitrocellulose membrane ( millipore , bedford , mass .). the membrane was blocked in pbs / 5 % dry milk ( pbs - m ) for 1 hour , washed 3 times in pbs / 0 . 05 % tween 20 ( pbs - t ), and incubated overnight in pbs - m with the anti - hoat antibody . following wash in pbs - t , the membrane was incubated in pbs - m with goat anti - rabbit antibody conjugated to horseradish peroxidase ( zymed , south san francisco , calif .). after an additional wash and incubation with a chemiluminescent substrate ( amersham , arligton heights , ill . ), the immunoblot was exposed to x - ray film . the antibody recognized a heterogeneous product with an apparent molecular weight of 80 to 90 kda . this was significantly larger than the predicted molecular weight from the hoat1 amino acid sequence ( 60 . 3 kda ). however , when the cortex extract was treated with peptide : n - glycosidase f , which specifically cleaves n - linked oligosaccharide chains , a homogeneous product of 60 kda was detected on the immunoblot . determination of nephrotoxic potential by cell culture assay using hoat transformants adefovir ( adv ) is an anti - hiv nucleotide analog with unique resistance profile currently undergoing phase iii clinical evaluation . the most important clinical toxicity of adv is nephrotoxicity associated with changes in laboratory markers of renal functions . adv is a substrate for human renal organic anion transporter 1 ( hoat ) located in the basolateral membrane of the proximal convoluted tubules . in this example , the role of hoat in the mechanism of adv nephrotoxicity was investigated . chinese hamster ovary cells ( cho ), which exhibit low sensitivity to adv cytotoxicity due to its limited uptake , were stably transformed with hoat cdna to generate cho - hoat cells as described above . uptake and cytotoxicity of adv in the two cell lines was compared . cho - hoat accumulated adv to levels & gt ; 300 - fold higher compared to cho . uptake of adv by cho - hoat was saturable ( k m = 23 um , v max = 390 pmol / 10 6 cells ) and sensitive to the hoat inhibitor probenecid ( pbc ; ic 50 = 6 . 5 um ). importantly , adv was ˜ 500 - fold more cytotoxic in cho - hoat compared to cho cells . however , in the presence of 1 mm pbc , cho - hoat were only 3 - fold more susceptible to adv than were cho . another antiviral nucleotide , cidofovir ( cdv ), but not its cyclic prodrug ( ccdv ), also efficiently accumulated in cho - hoat ( k m = 70 um , v max = 1 , 110 pmol / 10 6 cells ). accordingly , cdv was & gt ; 400 - fold more cytotoxic in cho - hoat compared to cho . in contrast , cytotoxicity of ccdv was increased to much lesser extent in cho - hoat cells corresponding with the lack of ccdv nephrotoxicity . similar to adv , cdv cytotoxicity was also significantly reduced by pbc . expression of hoat enhances cytotoxicity of adv . since high - level expression of hoat is specific to renal tubules , hoat plays a crucial role in the mechanism of adv nephrotoxicity . thus , hoat inhibitors ( e . g . pbc ) may be useful to overcome adv nephrotoxicity . observations with cdv and ccdv correlate with their nephrotoxic potential and provide additional support for the involvement of hoat in this process . | 2 |
before explaining the present invention in detail , it is to be understood that the invention is not limited in its application to the particular arrangement shown since the invention is capable of other embodiments . referring first to fig1 viewed from the outside the present display unit has a thin , flat , letter - size housing or casing made up of a rectangular base 10 and a similar front or top cover 11 detachably connected to the base in any suitable fashion and covering it when the display unit is in use . the cover 11 presents a flat lcd ( liquid crystal display ) panel or screen 14 of substantially rectangular outline . for supporting the screen 14 the cover has a rectangular frame with opposite , narrow , flat side walls 15 and 16 , a narrow , flat top wall 17 , and a narrow , flat bottom wall 18 , and a border for the screen 14 with narrow , flat front segments 15 b , 16 b , 17 b , and 18 b which extend in from the correspondingly numbered side , bottom and top walls of the frame . preferably , the frame is substantially the same size as a standard letter - size sheet of paper , i . e ., 8 . 5 inches wide by 11 inches long , so that the user handling or viewing it receives a mental impression similar to what he or she would get while reading from a standard letter - sized sheet of paper . the base 10 of the housing has opposite side walls 115 and 116 , a top wall 117 , and a bottom wall 118 which merge smoothly with the correspondingly numbered ( minus 100 ) walls of the cover when it is closed , as shown in fig1 . on the left front segment 15 of the cover near the top are led &# 39 ; s 20 , 21 , 22 and 23 for indicating various functions associated with the display unit , such as “ power ,” “ battery ,” “ memory ,” and “ test .” on the right front segment 16 b of the cover are manually operable push - buttons 24 , 25 , 26 , 27 and 28 for initiating various commands to the electronic circuitry that determine what appears on the screen 14 , such as “ file ,” “ document ,” “ next ,” “ back ,” and “ system .” also on the right front segment 16 b near the top is located a mouse - like scroll bar 29 which the user may slide up and down to quickly locate a document , file or particular line of text displayed on the screen 14 . referring to fig2 and 3 , the base 10 supports on the inside of the housing the following electronic components of the present display unit : a microprocessor 30 , memory chips , 31 , a battery pack 32 , and a microprocessor 34 . a data input port 35 of known design ( fig2 ) is located in the bottom wall 118 of the base . a flexible multi - conductor cable 37 connects the output of microprocessor 30 to the lcd screen 14 . the microprocessors 30 and 34 , memory chips 31 , and various other components of the display unit &# 39 ; s electronic circuitry are on a circuit board 38 located on the inside of base 10 . on the back or inner side of the cover 11 a circuit board 40 carries a backup battery 41 for the ram , a co - processor 42 , chips 43 for sound and infra - red functions , and various other electronic components . a backup power input terminal 44 ( fig3 ) is located in the top wall 17 of the cover . in the use of this device , the user can take it to the location of any computer whose data the user wants to access at his or her convenience . this can be the user &# 39 ; s own desktop computer or portable computer , or a computer to which the user has authorized access , or a central network or another electronic image display unit . the user by a well known technique downloads data from that computer into the user &# 39 ; s portable display unit via the input port 35 . that data now is available for display on the screen 14 any time the user chooses to do so . thus , an abundance of information is readily and conveniently available to the user without the exchange of any paper documents . since the present display unit is limited to read - only operation , there is no possibility for the user to alter or corrupt the downloaded data in any way . the flow chart of fig4 is self - explanatory and does not require extensive reiteration . depressing files displays all files loaded into memory ; depressing doc . displays all documents in a selected file ; depressing next advances to next document in file ; depressing back returns to previous document in file . fig5 shows the unit as a removable screen for a laptop computer . the unit functions as normal after removal . | 8 |
fig1 is an overall block diagram of a data receiver which includes a timing recovery circuit and a jitter canceller circuit in accordance with the present invention . this receiver could be used in a modem designed for a modulated carrier transmission system ; other uses for the invention are described below . the signal s ( t ) received via a transmission channel on line 101 is applied first to a bandpass filter 102 which separates the frequency band of interest . the output s ( t ) of filter 102 is applied both to an analog - to - digital converter 103 and to a timing recovery circuit 105 , which may be arranged as shown in fig2 and as discussed in more detail below . the purpose of timing recovery circuit 105 is to generate a sampling clock signal f s on line 115 which controls the time at which s ( t ) is sampled . diagramatically , control is shown in fig1 by provision of switch 105 which is closed under control of clock signal f s . generally , f s must be at least twice the highest frequency contained in the received signal ; illustratively , f s is chosen at 9600 samples per second . samples s ( nt s ) where t s represents the assumed sampling period , are output from converter 103 and applied to the input of a digital hilbert filter 106 , which resynthesizes the in - phase and quadrature - phase components of the received signal from its real part s ( nt s ) in a manner that is well known to those skilled in the art . these components ( on output lines 107 and 108 , respectively ) are then subsampled at a rate determined by the type of equalizer used ; illustratively , subsampling may occur at a rate of 1200 samples per second , corresponding to a t / 2 fractionally spaced equalizer , where 1 / t represents an assumed symbol rate of 600 symbols per second . again , for diagramatic purposes , subsampling is accomplished in fig1 via closure of switches 109 and 110 . the in - phase and quadrature - phase components of the analytic signal output from filter 106 are designated respectively , and are applied to jitter cancellation circuit 120 which is at the heart of the present invention . this circuit is intended to remove from the applied signal the effects of phase or timing jitter introduced by timing recovery circuit 105 . its construction and manner of operation will be described more fully below . the in - phase and quadrature - phase outputs of jitter cancellation circuit 120 are designated respectively , and are applied to an adaptive equalizer 130 which ideally , removes all intersymbol interference present in the signal as well as all other linear spectral degradations imposed on the signal by the transmission channel . the output of equalizer 130 , designated q i ( nt ) and q g ( nt ), is again subsampled but now at the symbol rate 1 / t ; subsampling is again diagramatically illustrated by provision of switches 131 and 132 . the subsampled output is then applied to demodulator 140 to yield complex information bearing quantities a n and a n &# 39 ;, respectively . when particular carrier frequencies and sampled rates are used , the equalizer subsampling operation partially performs the demodulation . the complex demodulated samples a n and a n &# 39 ; are applied to a decision circuit 150 which determines what symbol a n , a n &# 39 ; in a signalling alphabet used during modulation at the transmitter is closest to the received signal . a decoder 160 then converts each symbol back into its corresponding data bits , which are then applied to a descrambler 170 to provide on line 175 a replica of the original data . outputs a n and a n &# 39 ; from demodulator 140 , as well as the outputs a n , a n &# 39 ; from decision circuit 150 , are also applied to an equalizer update circuit 135 which recursively updates coefficients used to perform equalization . see , for example u . s . pat . no . 4 , 237 , 554 , issued dec . 2 , 1980 to r . d . gitlin et al entitled &# 34 ; coefficient tap leakage for fractionally - spaced equalizers &# 34 ;, u . s . pat . no . 4 , 247 , 940 , issued jan . 27 , 1981 to k . h . mueller et al entitled &# 34 ; equalizer for complex data signals &# 34 ;, and u . s . pat . no . re . 27 , 047 issued feb . 2 , 1971 to r . w . lucky entitled &# 34 ; digital adaptive equalizer system &# 34 ; for an explanation of various aspects of adaptive equalization . the same outputs from demodulator 140 and decision circuit 150 are also applied to a carrier recovery circuit 145 to generate a carrier signal f c on line 146 which is used in demodulator 140 . carrier recovery circuit 145 typically includes a phase locked loop which derives the exact carrier frequency ( which may not precisely agree with frequencies generated by a local oscillator ) and tracks any phase changes acquired by the received signal due to phase jitter or frequency offset . fig2 is a block diagram of one arrangement for implementing timing recovery circuit 105 of fig1 . a hilbert filter 201 ( similar to filter 106 in fig1 ) is arranged to receive the output s ( t ) from bandpass filter 102 and generate in - phase and quadrature - phase components r ( t ) and jr &# 39 ;( t ) on lines 202 and 203 , respectively . these signals are squared in circuits 205 and 206 , the outputs of which are algebraically combined in adder circuit 207 . squaring is used to obtain the envelope of the signal ; alternatively , fourth power circuits may be employed . ( see , for example , bell system technology journal , vol . 57 , no . 5 , may - june 1978 , pp . 1489 - 1498 , &# 34 ; jitter comparison of tones generated by squaring and by fourth power circuits ,&# 34 ; j . e . mazo .) the output of adder circuit 207 is applied to a bandpass filter 210 having its passband centered at the symbol frequency . the output of filter 210 is hard limited in limiter 215 , the output of which supplies the input to a phase locked loop 220 . at this point , the signal has been transformed into a square wave signal of desired amplitude at the symbol frequency . various arrangements for phase locked loop 220 may be used , all of which are intended to provide a sampling clock signal f s on line 115 which controls the sampling performed by analog - to - digital converter 103 of fig1 . as shown in fig2 phase locked loop 220 may include a comparator 222 arranged to compare the input received from limiter 215 with clock signal f s output from counter 224 . the difference or error signal generated by comparator 222 is applied to a control circuit 225 which generates an up / down signal k &# 39 ; which controls the operation of a divider circuit 223 . this signal can take on the value of ± 1 , depending on whether the output from counter 224 is leading or trailing the output of limiter 215 . divider circuit 223 also receives a clock signal f clkv from a fixed rate oscillator 221 illustratively at frequency 2 . 4576 mhz and divides these pulses by a nominal integral factor , illustratively four . in order to obtain the desired nominal frequency for clock signal f s and the desired symbol frequency 1 / t , the output of divider circuit 223 is applied to a count down chain circuit 224 . once per symbol , however , a correction is made by altering the operation of divider circuit 223 in accordance with the value of k &# 39 ;. if the output of control circuit 225 indicates that a phase advance is required , divider circuit 223 divides the output of oscillator 221 by three ; if a retard condition exists , divider circuit 223 switches to division by five . while the arrangement of phase locked loop 220 ensures the sampling frequency f s on line 115 tracks the input applied from bandpass filter 102 , it is observed that each time an adjustment is made , the time at which the next input sample is taken changes by one period of oscillator 221 . this change appears to the receiver as a small phase hit , which reduces the overall receiver performance or gain . similar problems exist with other implementations of phase locked loop 220 . in order to avoid the problems just discussed , the apparatus and method of the present invention uses information derived from the up / down signal , the frequency f clkv of oscillator 221 , as well as the frequency f c of the recovered carrier to generate a recursively updated correction factor e j θ . sbsp . n . each sample output from digital hilbert filter 106 is then corrected in accordance with the corresponding factor . a timing jitter cancellation circuit 120 in accordance with the present invention for use with timing recovery circuit of fig2 is shown in fig3 . as stated previously , the purpose of circuit 120 is to compensate for the phase hits or jumps which are caused by corrections occurring in timing recovery circuit 105 . such phase hits are &# 34 ; permanent ,&# 34 ; since each adjustment in the timing loop corresponds to a hit that never recovers . while the magnitude of the phase hit is reduced as the period of f clkv is reduced , the smallest usable period must be consistent with the ability of the receiver to meet ccitt specified tolerances . for a 600 hz symbol rate , a frequency f clkv near 2 . 4576 mhz has been found to be reasonable . even at this high rate ( with a period of 407 ns ), a phase hit of 0 . 35 degrees occurs at a 2 . 4 khz carrier frequency ; this phase jitter is easily visible on the receiver constellation . the jitter cancellation circuit of fig3 is arranged to correct each sample by performing a complex multiplication of the analytic output r q &# 39 ; ( nt ) and r i &# 39 ; ( nt ) of hilbert filter 106 by a correction factor e j θ . sbsp . n which is a complex vector of unity magnitude having phase θ n . once per symbol interval , at rate 1 / t , θ n is updated , such that ; where ( as stated previously ) k is ± 1 , depending upon the direction ( advance or retard ) of the correction occurring in recovery circuit 105 , f c is the nominal carrier frequency used in the receiver , and f clkv is the clock frequency of oscillator 221 within phase locked loop 220 . it is thus seen that k2πf c / f clkv is a correction term having a magnitude determined by the amount of discrete phase change introduced into the received signal when the timing recovery circuit adjusts to keep f s aligned with the input signal . the sign of this quantity depends upon the direction ( advance or retard ) of the correction . in fig3 arithmetic circuit 301 is arranged to receive information representing the values of f clkv and f c , as well as a delayed version k of the value of k &# 39 ;. this delay is introduced in order to compensate for the delay incurred in processing within hilbert filter 106 . the phase correction term θn for the n th sample generated by circuit 301 on line 303 is also fed back to the input of circuit 301 to generate the correction term θ n + 1 for the ( n + 1 ) th sample in accordance with equation ( 1 ). the correction term θ n is applied to a look up circuit 304 which generates the values of sinθ n and cosθ n on lines 305 and 306 , respectively . this enables correction of the output of filter 106 by the e j θ . sbsp . n = cosθ n + jsinθ n via a complex multiplication . the outputs of circuit 310 , r i ( nt / 2 ) and r q ( nt / 2 ), are used as inputs to adaptive equalizer 130 . a more detailed illustration of the present invention in block diagram form is found in fig4 . as shown , the product of 2πf c / f clkv ( supplied on line 122 from a register 121 ) and the value ( sign ) of k ( supplied on line 123 ) is formed in a multiplier 401 which provides a first input to a summation circuit 402 . the second input to circuit 402 is the value of the phase correction term θ n for the n th sample stored in a one sampled delay element 403 . thus , in accordance with equation ( 1 ), the output of summation circuit 402 provides the updated value θ n + 1 of the correction term for the ( n + 1 ) th sample . the current value of θ n is applied to a read only memory 410 which operates as a look - up table in order to derive the values of sinθ n and cosθ n on lines 412 and 411 , respectively . the value of sinθ n is extended to first inputs of multipliers 421 and 422 , while the value of cosθ n is extended to first inputs of multipliers 420 and 423 . second inputs to multiplier 420 and 421 are derived from the output of switch 109 and represent the value of r i &# 39 ; ( nt / 2 ) second inputs to multipliers 422 and 423 represent r q &# 39 ; ( nt / 2 ) output of switch 110 . the outputs of multipliers 420 and 422 are algebraically combined in a first adder circuit 430 such that r i ( nt ) is given by : in like fashion , the outputs of multipliers 421 and 423 are combined in an algebraic combining circuit 431 to yield r q ( nt ) which is given by the outputs of circuits 430 and 431 represent the complex product of each sample and the corresponding correction factor and provide the inputs to adaptive equalizer 130 of fig1 . fig5 and 6 show the receiver constellations with correction in accordance with the present invention ( fig6 ) and without jitter cancellation ( fig5 ). as can be clearly seen , significant reduction in divergence is attained by use of the method and apparatus described above . fig7 illustrates the bit error rate observed with and without jitter cancellation . as can be seen , about 2 db in signal - to - noise ratio improvement was attained . the present invention is most useful when low symbol rates are employed , because timing changes then occur at a slower rate , resulting in larger step size changes in the output of timing recovery circuit 105 . the invention is also most useful in situations in which large variations in clock frequency drift are expected . in most ddd applications where communications occur between modems of different manufacturers , such large variation can be expected . various adaptations and modifications of the present invention can be made by those skilled in the art without departing from the spirit and scope of the invention . accordingly , it is intended that the invention be limited only by the following claims . for example , in fig1 it is possible to locate the timing jitter canceller 120 at the output of adaptive equalizer 130 rather than proceeding its input . however , with this modification , the delay occasion by processing in the equalizer must be estimated such that the value of k used in circuit 120 corresponds to the value used to control sampling of the output of analog - to - digital converter 103 . it is also possible to use an analog hilbert filter instead of digital hilbert filter 106 of fig1 . in this event , a / d converters , placed after the hilbert filter instead of using converter 103 , sample at rate f s / 2 . with this modification , delay element 310 is adjusted accordingly or eliminated . | 7 |
the following table provides a dictionary of the terms used in the description of the invention . table i______________________________________abbreviateddesignation______________________________________ amino acidala l - alaninephe l - phenylalaninehomophe s - 2 - amino - 4 - phenylbutyric acidlys l - lysinenaphthylala 1 - naphthylalaninecyclohexylala cyclohexylalaninetyr ( ome ) o - methyl - l - tyrosinetyr l - tyrosinetza s - 2 - amino - 3 -( 4 - thiazolyl ) propionic acid ( thiazolylalanine ) his l - histidinegly glycineleu l - leucinemet l - methioninealg s - 2 - amino - 4 - pentenoic acid ( allyl glycine ) ppg s - 2 - amino - 4 - pentynoic acid ( propargyl glycine ) pgy s - 2 - amino - pentanoic acid ( propyl glycine ) bgy s - 2 - amino - hexanoic acid ( butyl glycine ) nia s - 2 - amino - 3 - cyanopropanoic acid ( nitrile alanine ) z benzyloxycarbonylboc tert - butyloxycarbonyltr triphenylmethyl acylsiva isovalerylbnma bis -( 1 - naphthylmethyl )- acetyl esters with -- och . sub . 3 methanol -- oc . sub . 2 h . sub . 5 ethanol -- och ( ch . sub . 3 ). sub . 2 2 - propanol -- oc ( ch . sub . 3 ). sub . 3 tert - butanol solvents and reagentschcl . sub . 3 chloroformdmf n , n - dimethylformamidedmso dimethylsulfoxidehobt hydroxybenzotriazoledcc n , n &# 39 ;- dicyclohexyl - carbodiimidehoac acetic acidet . sub . 3 n triethylaminethf tetrahydrofuranch . sub . 2 cl . sub . 2 dichloromethanemeoh methanoletoac ethyl acetate______________________________________ a is boc , iva , bma , ## str5 ## wherein : r , r 1 are each independently h , ch 3 , c 2 h 5 , n - c 3 h 7 or i - c 3 h 7 ## str6 ## is a saturated ring containing two to five carbon atoms with q = o , s , n - boc , n - z , nr or ch 2 - d is ## str7 ## or ch 3 ; x is absent , phe , homophe , naphthylala , cyclohexylala , tyr or tyr ( ome ) with the proviso that when a = ## str8 ## y is leu , ala , gly pgy , ppg , bgy , met , his , tza , alg , nia ## str9 ## wherein : ( r 1 is as defined above r 2 is ## str10 ## b a straight chain of from two to six carbons that is saturated , olefinic or acetylenic . r 3 = r 1 and r 2 . ## str11 ## is as defined above ; w is ## str12 ## wherein : r 4 =-- ch 2 ch ( ch 3 ) 2 , -- ch 2 ph , -- ch 2 - chexyl , -- ch 2 - cpentyl , or - chexyl ; r 5 = ## str13 ## or r 5 is a keto group with the proviso that either r 6 or r 7 is absent . r 6 , r 7 are each independently -- h , ## str14 ## wherein r , r 1 and ## str15 ## are as defined above . preferred compounds of the present invention are those of formula i wherein ## str16 ## r and r 1 are each independently h , ch 3 , c 2 h 5 , n - c 3 h 7 or i - c 3 h 7 ; ## str17 ## is a saturated ring containing two to five carbon atoms and q is o , s , nr or ch 2 with r defined above . more preferred compounds of the present invention are those of formula i wherein ## str18 ## wherein r and r 1 are each independently ch 3 , c 2 h 5 , n - c 3 h 7 or i - c 3 h 7 . particularly preferred compounds falling within the scope of the invention include the following compounds , their isomers , and pharmaceutically acceptable acid addition salts : ## str19 ## the compounds of the present invention have the advantage of increased hydrophilicity . this property makes the compounds more readily absorbed . the compounds include solvates and hydrates and pharmaceutically acceptable acid addition salts of the basic compounds of formula i above . certain novel intermediates are useful in the preparation of the compounds of the instant invention . they include but are not limited to : ## str21 ## compounds of formula i may be prepared by a process which comprises : ( a ) condensing ## str22 ## with excess organometallic reagent in an inert solvent to produce ## str23 ## wherein r 8 is ethyl , vinyl , isopropyl or 1 , 3 - dithian - 2 - yl ; ( b ) reducing with kbh 4 the product of step ( a ) above to produce ## str24 ## wherein r 8 is c 2 h 5 , c 2 h 3 , ch ( ch 3 ) 2 , ## str25 ## ( c ) modifying the product of step ( a ) above wherein r 8 is vinyl by reacting with amines or mercaptans to produce ## str26 ## wherein r 1 is lower alkyl and then reducing the product with kbh 4 to produce ## str27 ## wherein r 9 is n ( r 1 ) 2 or sr 1 ( d ) reacting ## str28 ## from step ( b ) or ( c ) above with ## str29 ## in a protic solvent to produce ## str30 ## wherein r 10 is ethyl , vinyl , isopropyl , 1 , 3 - dithian - 2 - yl , ## str31 ## or ch 2 ch 2 sr 1 which are then separated by column chromatography ; or ( e ) alternatively reacting ## str32 ## from step ( b ) or ( c ) above with methanolic hydrogen chloride in dichloromethane to produce ## str33 ## wherein r 10 is as defined above which are separated by column chromatography ; and ( f ) using the products of step ( d ) above to produce by known means the desired compound of formula i above . the term pharmaceutically acceptable acid addition salt is intended to mean a relatively nontoxic acid addition salt either from inorganic or organic acids such as , for example , hydrochloric , hydrobromic , hydroiodic , sulfuric , phosphoric , acetic , citric , oxalic , malonic , salicylic , malic , benzoic , gluconic , fumaric , succinic , ascorbic , maleic , tartaric , methanesulfonic , and the like . the salts are prepared by contacting the free base form with a sufficient amount of the desired acid to produce a salt in the conventional manner . the free base forms may be regenerated by treating the salt form with a base . the modified peptides of the present invention possess one or more chiral centers and each center may exist in either the r or s configuration . the present invention includes all enantiomeric and epimeric forms as well as the appropriate mixtures thereof . additionally , the preferred absolute configuration is shown on two illustrative examples below : ## str34 ## the stereocenter marked with an asterisk is preferred in both r and s configurations as both show renin inhibitory action . some of the above novel peptides may be prepared in accordance with well - known procedures for preparing peptides from their constituent amino acids . other of the novel peptides of the present invention are prepared by a step - wise procedure or by a fragment coupling procedure depending upon the particular final product desired . the following scheme illustrates novel methods of preparing certain peptides of the present invention . ## str35 ## according to scheme i above , the boc - lactam , ( 1 ) ( prepared according to methods found in u . s . pat . no . 4 , 876 , 343 is reacted with excess grignard reagent such as vinyl or ethyl magnesium bromide in an inert solvent such as ether or thf to afford the ring opened product , ( 2 ). in the case of the vinyl adduct the r - side chain may be further modified by michael additions with amines and mercaptans . scheme i shows the addition of n - methyl - aminoethane to give ( 3 ). reduction with a hydride agent such as nabh 4 , kbh 4 , znbh 4 , libh 4 and the like in a protic solvent , such as meoh , etoh , iproh , h 2 o , followed by removal of protecting groups with acidic reagents such as meoh . hcl or tfa affords the aminodiol , ( 4 ) as a mixture of two diastereomers that are separated by flash chromatography . stepwise coupling and deprotection of z - his ( tr ) and ## str36 ## ( prepared according to epa 314060 by methods which are standard to the art of peptide chemistry affords the renin inhibitor , ( 6 ). alternatively , intermediate ( 5 ) may be coupled to the carboxylic acid ( 7 ) to give the renin inhibitor , ( 8 ) after removal of protecting groups . both diastereomers of intermediate ( 4 ) lead to active renin inhibitors . an alternative , highly convergent strategy for synthesis of compounds of the present invention is shown in scheme ii . selective removal of the thp protecting group from 12 , using a mildly acidic reagent such as pyridinium p - toluenesulfonate in a protic solvent such as ethanol , methanol or isopropanol at 20 °- 70 ° c . gives the diastereomeric 1 , 3 - diols , 13 and 14 . these diols are readily separated by flash chromatography on silica gel . compounds 13 and 14 are then individually coupled to an a - x - y fragment such as 15 to afford the desired renin inhibitors , 16 and 17 . the a - x - y fragments are prepared by methods standard to the art of peptide chemistry . ## str37 ## the strategy of peptides chain assembly and selection and removal of protecting groups is discussed in chapter 1 , &# 34 ; the peptide bond ,&# 34 ; in &# 34 ; the peptides . analysis , synthesis , biology ,&# 34 ; e . gross and j . meienhofer , eds ., academic press , new york , n . y ., 1979 , vol . 1 , pp . 42 - 44 . the dcc / hobt method of coupling is well - known to those skilled in the art and is discussed in chapter 5 , &# 34 ; the carbodiimide method &# 34 ; by d . h . rich and j . singh in &# 34 ; the peptides . analysis , synthesis , biology ,&# 34 ; e . gross and j . meienhofer , eds ., academic press , new york , n . y ., 1979 , vol . 1 , pp . 241 - 261 . peptide coupling depends on activating the carboxy terminus of the amino protected amino acid and condensing it with another peptide containing a free amino terminus . in addition to the dcc coupling method described above , other methods of activating the carboxyl group of a protected amino acid include : 1 ) the azide method -- described in chapter 4 of the above reference . 2 ) the mixed anhydride method -- described in chapter 6 of the above reference . 3 ) the active ester method -- described in chapter 3 of the above reference . the term lower alkyl refers to straight or branched chain alkyl radicals containing from one to six carbon atoms including but not limited to methyl , ethyl , n - propyl , isopropyl , n - butyl , iso - butyl , sec - butyl , 2 - methylhexyl , n - pentyl , 1 - methylbutyl , 2 , 2 - dimethylbutyl , 2 - methylpentyl , 2 , 2 - dimethylpropyl , n - hexyl , and the like . aryl means phenyl , naphthyl or other aromatic groups , including mono - or bicyclic , which may be substituted , especially monosubstituted , by f , cl , br , i , cf 3 , oh , or , or r , wherein r is lower alkyl . heteroaryl means aromatic heterocyclic rings containing at least one heteroatom selected from o , s , and n and from three to five carbon atoms including but not limited to thiazoles and imidazoles . aralkyl is as described above for alkyl and aryl , including but not limited to benzyl . the compounds of the present invention are useful for treating renin - associated hypertension , congestive heart failure , and hyperaldosteronism . they are also useful as diagnostic tools for determining the presence of renin - associated hypertension or hyperaldosteronism . pharmaceutical compositions which comprise an effective amount of the compound in combination with a pharmaceutically acceptable carrier are part of the present invention . an important aspect of the present invention is a method of treating renin - associated hypertension in a mammal which comprises administering a pharmaceutical composition containing an effective amount of a compound of the invention in combination with a pharmaceutically acceptable carrier to the mammal . another equally important aspect of the present invention is a method of treating hyperaldosteronism in a mammal which comprises administering a pharmaceutical composition containing an effective amount of a compound of the invention in combination with a pharmaceutically acceptable carrier to the mammal . an additional aspect of the present invention is a method for treating congestive heart failure in a mammal which comprises administering a pharmaceutical composition containing an effective amount of a compound in combination with a pharmaceutically acceptable carrier to the mammal . the effectiveness of the aforementioned compounds is determined by a test for in vitro renin inhibitory activity . this activity is determined by a standard radioimmunoassay for angiotensin i . in this assay the enzyme , renin , incubated for two hours at 37 ° in the presence of a substrate , angiotensinogen , generates the product , angiotensin i . test compounds are added to the incubation mixture . relative activity is reported as the ic 50 , which is the molar concentration of test compound causing a 50 % inhibition of the renin activity . table ii__________________________________________________________________________compound ic . sub . 50__________________________________________________________________________ ( nm ) ## str38 ## 18 ## str39 ## ( fast isomer ) ( slow 11 1 . 1 ) ## str40 ## ( fast isomer ) ( slow 280 220 ## str41 ## 500 ## str42 ## ( fast isomer ) ( slow 0 . 90 0 . 24 ## str43 ## ( slow isomer ) 0 . 26 ## str44 ## ( slow isomer ) 0 . 47 ## str45 ## ( slow isomer ) 1 . 35 ## str46 ## ( fast isomer ) ( slow & gt ; 100 43 . 8 ## str47 ## ( slow isomer ) & gt ; 100 ## str48 ## ( fast isomer ) 13 . 0 ## str49 ## ( fast isomer ) ( slow 5 . 8 0 . 75 ## str50 ## ( slow isomer ) 2 . 1 ## str51 ## ( fast isomer ) ( slow 17 . 0 4 . 95 ## str52 ## 36 . 4__________________________________________________________________________ as can be seen from the above table , the compounds of the present invention have a significant effect on the activity of renin and thus are useful for the treatment of hypertension , hyperaldosteronism , and congestive heart failure . for preparing pharmaceutical compositions from the compounds described by this invention , inert , pharmaceutically acceptable carriers can be either solid or liquid . solid form preparations include powders , tablets , dispersible granules , capsules , cachets , and suppositories . a solid carrier can be one or more substances which may also act as diluents , flavoring agents , solubilizers , lubricants , suspending agents , binders , or tablet disintegrating agents ; it can also be encapsulating material . in powders , the carrier is a finely divided solid which is in admixture with the finely divided active compound . in the tablet the active compound is mixed with carrier having the necessary binding properties in suitable proportions and compacted in the shape and size desired . the powder and tablets preferably contain from 5 to 10 to about 70 percent of the active ingredient . suitable solid carriers are magnesium carbonate , magnesium stearate , talc , sugar , tragacanth , methylcellulose , a low melting wax , cocoa butter , and the like . the term &# 34 ; preparation &# 34 ; is intended to include the formulation of the active compound with encapsulating material as carrier providing a capsule in which the active component ( with or without other carriers ) is surrounded by carrier , which is thus in association with it . similarly , cachets are included . tablets , powders , cachets , and capsules can be used as solid dosage forms suitable for oral administration . the compound of the present invention may be administered orally , buccally , parenterally , by inhalation spray , rectally , or topically in dosage unit formulations containing conventional nontoxic pharmaceutically acceptable carriers , adjuvants and vehicles as desired . the term parenteral as used herein includes subcutaneous injections , intravenous , intramuscular , intrasternal injection , or infusion techniques . for preparing suppositories , a low melting wax such as a mixture of fatty acid glycerides or cocoa butter is first melted , and the active ingredient is dispersed homogeneously therein by stirring . the molten homogeneous mixture is then poured into convenient sized molds , allowed to cool , and thereby solidify . liquid form preparations include solutions , suspensions , and emulsions . as an example may be mentioned water or water / propylene glycol solutions for parenteral injection . liquid preparations can also be formulated in solution in aqueous polyethyleneglycol solution . aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material , i . e ., natural or synthetic gums , resins , methylcellulose , sodium carboxymethylcellulose , and other well - known suspending agents . also included are solid form preparations which are intended to be converted , shortly before use , to liquid form preparations for either oral or parenteral administration . such liquid forms include solutions , suspensions , and emulsions . these particular solid form preparations are most conveniently provided in unit dosage form and as such are used to provide a single liquid dosage unit . alternately , sufficient solid may be provided so that after conversion to liquid form , multiple individual liquid doses may be obtained by measuring predetermined volumes of the liquid form preparation as with a syringe , teaspoon , or other volumetric container . when multiple liquid doses are so prepared , it is preferred to maintain the unused portion of said liquid doses at low temperature ( i . e ., under refrigeration ) in order to retard possible decomposition . the solid form preparations intended to be converted to liquid form may contain , in addition to the active material , flavorants , colorants , stabilizers , buffers , artificial and natural sweeteners , dispersants , thickeners , solubilizing agents , and the like . the liquid utilized for preparing the liquid form preparation may be water , isotonic water , ethanol , glycerine , propylene glycol , and the like , as well as mixtures thereof . naturally , the liquid utilized will be chosen with regard to the route of administration , for example , liquid preparations containing large amounts of ethanol are not suitable for parenteral use . preferably , the pharmaceutical preparation is in unit dosage form . in such form . the preparation is subdivided into unit doses containing appropriate quantities of the active component . the unit dosage form can be a packaged preparation , the package containing discrete quantities of preparation , for example , packeted tablets , capsules , and powders in vials or ampules . the unit dosage form can also be a capsule , cachet , or tablet itself , or it can be the appropriate number of any of these in packaged form . the quantity of active compound in a unit dose of preparation may be varied or adjusted from 1 mg to 500 mg , preferably 5 to 100 mg according to the particular application and the potency of the active ingredient . the compositions can , if desired , also contain other compatible therapeutic agents . in therapeutic use as renin inhibitors , the mammalian dosage range for a 70 kg subject is from 1 to 1500 mg / kg of body weight per day or preferably 5 to 750 mg / kg of body weight per day optionally in divided portions . the dosages , however , per day may be varied depending upon the requirements of the patient , the severity of the condition being treated and the compound being employed . determination of the proper dosage for a particular situation is within the skill of the art . generally , treatment is initiated with small dosages which are less than the optimum dose of the compound . thereafter the dosage is increased by small increments until the optimum effect under the circumstances is reached . for convenience , the total daily dosage may be divided and administered in portions during the day if desired . [ 1 -( cyclohexylmethyl )- 4 - oxo - 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center is rs ; other centers are s ) a solution of 15 . 16 g ( 0 . 040 mole ) of 5 -( cyclohexylmethyl )- 4 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ]- 2 - oxo - 1 - pyrrolidinecarboxylic acid , 1 , 1 - dimethylethyl ester , mixture of [ 4s -[ 4r *( r *), 5r *] and [ 4s -[ 4r *( s *), 5r *]] isomers , in 200 ml of dry tetrahydrofuran is cooled to 5 ° c . under nitrogen and with stirring , 27 . 5 ml ( 0 . 055 mole ) of 2m ethylmagnesium bromide in tetrahydrofuran is added over a period of five minutes , preventing the temperature from rising above 12 ° c . with mild cooling . after stirring at 10 ° c . for one - half hour , the reaction solution is poured , under nitrogen , into a stirred mixture of 300 g of ice and water . saturated citric acid ( 200 ml ) and 300 ml of ether are added . the organic layer is washed well with water , dried ( magnesium sulfate ) and concentrated to give 15 . 80 g of crude product . silica gel chromatography eluting with hexane to 2 : 1 hexane - ethyl acetate gives 9 . 40 g ( 57 %) of pure product ; tlc ( silica gel , 2 : 1 hexane - ethyl acetate ) rf 0 . 6 ; fab - ms , mw = 411 . [ 1 -( cyclohexylmethyl )- 4 - hydroxy - 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran and 4 - hydroxy centers are rs ; other centers are s ) a solution of 9 . 30 g ( 0 . 023 mole ) of [ 1 -( cyclohexylmethyl )- 4 - oxo - 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center is r , s ; other centers are s ) in 100 ml of absolute ethanol is treated with 0 . 85 g ( 0 . 023 mole ) of sodium borohydride . after one and one - half hours stirring at room temperature , acetone ( 10 ml ) is added with mild cooling . after 15 minutes the solution is concentrated at reduced pressure , water ( 100 ml ) is added and the separated oil is extracted into 200 ml of petroleum ether . the dried ( potassium carbonate ) ether solution is concentrated to give 7 . 90 g ( 83 %) of alcohol product ; tlc ( silica gel , 2 : 1 hexane - ethyl acetate ) double spot rf 0 . 4 - 0 . 5 ; fab - ms , mw = 413 . a solution of 7 . 80 g ( 0 . 019 mole ) of the product from example 2 in 100 ml of methylene chloride and 50 ml of methanol is cooled to 5 ° c . and saturated with hydrogen chloride gas . the solution is allowed to stand at room temperature for six hours and then concentrated at reduced pressure to remove solvent . the crude hydrochloride salt is purified by silica gel chromatography eluting with chloroform to 20 % methanol - chloroform ; weight 4 . 10 g ( 81 %); tlc ( silica gel , 2 : 10 methanol - chloroform ) one spot , rf 0 . 4 . the purified hydrochloride is converted to the base by dissolution in 50 ml of water , addition of 10 % potassium carbonate and extraction into 150 ml of ether ; ms , mw = 229 . n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ n ( α )-( phenylmethloxy ) carbonyl - n ( τ )- triphenylmethyl ] histidinamide ( two diastereomers isolated : 4 - hydroxy center is r or s , other centers are s ) a solution of 2 . 60 g ( 0 . 011 mole ) of 6 - amino - 7 - cyclohexyl - 3 , 5 - heptanediol from example 3 in 50 ml of methylene chloride is treated successively with 1 . 68 g ( 0 . 011 mole ) of 1 - hydroxybenztriazole hydrate , 5 . 85 g ( 0 . 011 mole ) of z -( trt ) his and 2 . 27 g ( 0 . 011 mole ) of dicyclohexylcarbodiimide . after standing at room temperature the dicyclohexylurea is filtered and the filtrate is concentrated to ca 15 ml volume . ether ( 100 ml ) is added and the solution is washed with 100 ml of 3 % sodium bicarbonate and then 50 ml of water . after drying over sodium sulfate the ether solution is concentrated to give 8 . 20 g of crude product . purification by silica gel chromatography eluting with chloroform to 5 % methanol - chloroform gives a fraction enriched in &# 34 ; fast &# 34 ; moving diastereomer ( tlc ; silica gel , 1 : 10 methanolchloroform , major spot rf 0 . 7 , trace spot rf 0 . 6 ) and a fraction enriched in &# 34 ; slow &# 34 ; moving diastereomer with major spot at rf 0 . 6 and a trace of rf 0 . 7 . each diastereomer shows fab - ms , mw = 742 . 4 . n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ n ( τ )- triphenylmethyl ) histidinamide (&# 34 ; fast &# 34 ;) isomer : 4 - hydroxy center is r or s ; other centers are s ) a solution of 2 . 30 g ( 0 . 0031 mole ) of enriched &# 34 ; fast &# 34 ; diastereomer from example 4 in 30 ml of methanol is reduced at low pressure for eight hours with 100 mg of 20 % palladium on carbon and hydrogen . the catalyst is filtered and the methanol solution concentrated at reduced pressure . the crude product is chromatographed with silica gel and elution with chloroform to 5 % methanol - chloroform to give 1 . 60 g of a single spot material , rf 0 . 3 - 0 . 4 ( tlc ; silica gel , 1 : 10 methanol - chloroform ); fab - ms , mw = 608 . 3 . n - 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ n ( τ )- triphenylmethyl ] histidinamide (&# 34 ; slow &# 34 ;) isomer : 4 - hydroxy center is either r or s ; other centers are s ) the &# 34 ; slow &# 34 ; diastereomer from example 4 is subjected to catalytic debenzylation and purified as in example 5 to similarly obtain the &# 34 ; slow &# 34 ; isomer , rf 0 . 2 - 0 . 4 with a trace of rf 0 . 3 - 0 . 4 ; fab - ms , mw = 608 . 3 . n -( 4 - morpholinylsulfonyl )- l - phenylalanyl - n - 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l - histidinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; fast &# 34 ; isomer ) a solution of 1 . 45 g ( 0 . 0024 mole ) of &# 34 ; fast &# 34 ; isomer from example 5 in 25 ml of methylene chloride is treated successively with 0 . 37 g ( 0 . 0024 mole ) of 1 - hydroxybenztriazole hydrate , 0 . 76 g ( 0 . 0024 mole ) of morpholineosulfonyl - l - phenylalanine and 0 . 50 g ( 0 . 0024 mole ) of dicyclohexylcarbodiimide . after standing at room temperature overnight the urea is filtered and the filtrate is concentrated at reduced pressure to remove most of methylene chloride . the residue is taken up into 100 ml of ether and the solution is washed with 50 ml of saturated sodium bicarbonate and 50 ml of water . the dried ( sodium sulfate ) organic phase is concentrated to give 2 . 00 g of crude product . purification by silica gel chromatography eluting with chloroform to 5 % methanolchloroform gives the trityl protected product ; weight 1 . 65 g ; tlc ( silica gel , 1 : 10 methanol - chloroform ) rf 0 . 5 ; fab - ms , mw = 904 . 4 . a solution of 1 . 60 g ( 0 . 0018 mole ) of the above adduct in 16 ml of glacial acetic acid is treated with 4 ml of water . the solution is heated at 95 ° c . for six minutes . water ( 25 ml ) is added to precipitate triphenylmethyl alcohol . the mixture is cooled in an ice bath and filtered . the filtrate is concentrated at reduced pressure and 75 ml of saturated sodium bicarbonate and 100 ml of methylene chloride are added . the bottom organic layer is separated , dried over potassium carbonate and concentrated to give 1 . 00 g of crude product . this material is purified by silica gel chromatography eluting with chloroform to 5 % methanol - chloroform to give the desired product ; tlc ; ( silica gel , 2 : 10 methanol - chloroform ) rf 0 . 6 ; fab - ms , mw = 662 . 3 . n -( 4 - morpholinylsulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l - histidinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomer ) the &# 34 ; slow &# 34 ; diastereomer from example 6 is coupled to morpholinosulfonyl - l - phenylalanine as in example 7 giving a material moving slower on tlc ( silica gel , 1 : 10 methanol - chloroform ) rf 0 . 45 with traces at rf 0 . 4 and 0 . 5 ; fab - ms , mw = 904 . 4 . this isomer is detritylated as in example 7 for the &# 34 ; fast &# 34 ; isomer to give &# 34 ; slow &# 34 ; moving product on tlc ( silica gel , 2 : 10 methanol - chloroform ) rf 0 . 55 ; fab - ms , mw = 662 . 3 . note : the slow and fast isomers were compared side by side and mixed on tlc . also , the nmr showed diastereomeric differences . [ 1 -( cyclohexylmethyl )- 4 - oxo - 2 -[ tetrahydro - 2 - h - pyran - 2 - yl ) oxy ]- 5 - hexenyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center is rs ; other centers are s ) a solution of 51 . 36 g ( 0 . 135 mole ) of 5 -( cyclohexylmethyl )- 4 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ]- 2 - oxo - 1 - pyrrolidinecarboxylic acid , 1 , 1 - dimethylethyl ester , mixture of [ 4s -[ 4r *( r *), 5r *] and [ 4s -[ 4r *( s *), 5r *]] isomers , in 500 ml of tetrahydrofuran is cooled to 5 ° c ., under nitrogen with stirring . a quantity of 175 ml ( 0 . 175 mole ) ( 30 % excess ) of 1m vinylmagnesium bromide in tetrahydrofuran is added over 20 minutes , keeping the temperature at 5 ° c . the solution is allowed to warm to 15 ° c . and maintained there for one - half hour . the solution is poured into 800 ml of ice and water with stirring . saturated citric acid ( 300 ml ) and ether ( 800 ml ) are added . the aqueous layer is separated . the organic layer is washed well with water , dried ( magnesium sulfate ) and concentrated ; wt 57 . 0 g . silica gel chromatography , eluting with hexane and then 2 : 1 hexane - ethyl acetate gives purified vinyl ketone ; tlc ( 2 : 1 hexane - ethyl acetate ) rf 0 . 6 . [ 1 -( cyclohexylmethyl )- 6 -( ethylmethylamino )- 4 - oxo - 2 -[( tetrahydro - 2 - h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center is rs ; other centers are s ) a solution of 14 . 33 g ( 0 . 035 mole ) of the vinyl ketone from example 9 in 100 ml of methylene chloride is treated with 4 . 14 g ( 0 . 07 mole ) of n - ethylmethylamine . after one hour the solvent and excess amine are evaporated to give product ; tlc ( 2 : 1 hexane - ethyl acetate , silica gel ) rf 0 . 1 ; fab - ms shows mw = 468 . [ 1 - cyclohexylmethyl )- 6 -( ethylmethylamino )- 4 - hydroxy - 1 , 1 - dimethylethyl ester ( pyran center and 4 - hydroxy center are rs ; other centers are s ) a quantity of 20 ml of water is added to a solution of 16 . 40 g ( 0 . 035 mole ) of the amino ketone in 200 ml of methanol . this solution is treated with a solution of 1 . 89 g ( 0 . 035 mole ) of potassium borohydride in 20 ml of water , cooling to keep the temperature at 20 ° c . after one hour , 20 ml of acetone is added . after 15 minutes the methanol is removed at reduced pressure and the separated gum is extracted into a solution of 300 ml of ether and 50 ml of methylene chloride . the organic phase is dried ( potassium carbonate ) filtered and evaporated to give product ; tlc ( 2 : 10 methanol - chloroform , silica gel ) rf 0 . 2 - 0 . 4 , two overlapping spots ); dei - ms shows mw = 470 . a solution of 16 . 0 g ( 0 . 034 mole ) of the blocked amino alcohol from example 11 in 100 ml of methylene chloride is diluted with 200 ml methanol and cooled on an ice bath under nitrogen . the cold solution is then charged with a vigorous stream of dry hydrogen chloride for five minutes and subsequently allowed to stand at room temperature overnight . the solvent and excess hydrogen chloride are removed at reduced pressure . the dihydrochloride residue is converted to the base by dissolution is 20 ml of water , charcoaling , filtering , saturating with potassium carbonate and extracting into 300 ml of methylene chloride ( top layer ). the organic solution is dried ( potassium carbonate ) and concentrated ; wt 11 . 00 g of mixed diastereomers as a crude oil . purification is effected by silica gel chromatography as follows : the column is packed with 1 : 10 methanol - chloroform . the column is further deactivated by passage of two column volumes of 3 : 10 : 0 . 3 methanol - chloroform - conc . ammonium hydroxide and then two column volumes of chloroform . the diamino diol is placed on the column as a chloroform solution and eluted to separate diastereomers with 3 : 10 : 0 . 3 methanol - chloroform - conc . ammonium hydroxide , giving 2 . 98 g of fast spot material , tlc ; rf 0 . 4 ( 3 : 10 : 0 . 3 methanol - chloroform - ammonium hydroxide , silica gel , and 3 . 69 g of slow spot material , rf 0 . 3 ( same tlc system ); dei - ms shows mw = 286 for both diastereomers . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 6 -( ethylmethylamino )- 2 , 4 - dihydroxyhexyl ]- l - histidinamide (&# 34 ; fast &# 34 ; isomer : 4 - hydroxy center is r or s , other centers are s ) the diaminodiol &# 34 ; fast &# 34 ; isomer from example 12 is sequentially coupled to histidine and n - morpholinosulfonyl - l - phenylalanine as described in examples 5 and 7 lo afford the &# 34 ; fast &# 34 ; isomer of the desired product ; tlc ( silica gel , chloroform - methanol - conc . nh 4 oh . sub . ( aq ), 10 : 3 : 0 . 3 ) r 0 . 4 ; fab - ms shows mw = 720 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 6 -( ethylmethylamino )- 2 , 4 - dihydroxyhexyl ]- l - histidinamide (&# 34 ; slow &# 34 ; isomer : 4 - hydroxy center is r or s , other centers are s ) the diaminodiol &# 34 ; slow &# 34 ; isomer from example 12 is sequentially coupled to histidine and n - morpholinosulfonyl - l - phenylalanine as described in examples 5 and 7 to afford the &# 34 ; slow &# 34 ; isomer of the desired product ; tlc ( silica gel , chloroform - methanol - conc . nh 4 oh . sub . ( aq ), 10 : 3 : 0 . 3 ) rf 0 . 3 ; fab - ms shows mw = 720 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n - 1 -( cyclohexylmethyl )- 6 -( ethyldimethylammonium )- 2 , 4 - dihydroxyhexyl ]- l - histidinamide iodide (&# 34 ; slow &# 34 ; isomer : 4 - hydroxy center is r or s , other centers are s ) a solution of 0 . 33 g ( 0 . 00045 mole ) of the &# 34 ; slow &# 34 ; isomer of example 14 in 5 ml of methylene chloride is diluted with 1 ml of ether and cooled to 10 ° c . a solution of 0 . 065 g ( 0 . 0045 mole ) of methyl iodide in 1 ml of methylene chloride is added and the solution is allowed to warm to room temperature . after three days standing the supernatant is decanted from the separated gum and the gum is triturated with 5 ml of methylene chloride . decantation leaves 0 . 45 g of product . purification is effected by dissolution in ca . 2 ml of methanol and precipitation as an amorphous solid with 25 m of ether . filtration gives 0 . 49 g of product ; hplc , 92 . 7 %; nmr ( δ , dmso - d 6 ), 2 . 98 ( s , 6h , + n ( me ) 2 ). a mixture of n -( 4 - morpholinosulfonyl )- phe ( 3 . 15 g , 10 mmol ), dcc ( 2 . 1 g , 10 mmol ), hobt ( 1 . 35 g , 10 mmol ) and dmf ( 20 ml ) was stirred at 20 ° c . for five minutes . the resulting slurry was treated consecutively with n ( ε )- z - lys ( ome ). hcl ( 3 . 32 g , 10 mmol ), triethylamine ( 1 . 4 ml , 10 mmol ) and ch 2 cl 2 ( 10 ml ). the reaction was stirred for 48 hours at 20 ° c . then ch 2 cl 2 was evaporated . ethyl acetate was added and the solids were removed by filtration . evaporation of the filtrate gives a wet solid that was triturated with water , dissolved in chcl 3 and washed with 5 % k 2 co 3 ( aq ). the organic layer was dried over mgso 4 and evaporated to a pale yellow solid . trituration with ethyl acetate gives 5 . 3 g of a colorless solid . tlc ( silica gel , chcl 3 - meoh , 9 : 1 ); rf 0 . 75 . a solution of the product from example 16 ( 5 . 28 g , 8 . 95 mmol ) in thf ( 125 ml ) was treated with 20 % pd / c ( 0 . 55 g ) under an atmosphere of hydrogen . after three hours , methanol ( 125 ml ) was added and catalyst removed by filtration . the resulting solution was treated with methyl isothiocyanate ( 0 . 7 g , 9 . 6 mmol ) and stirred 18 hours at 20 ° c . evaporation gave a solid that was recrystallized from hot chcl 3 by dropwise addition of ether to give the desired product ( 4 . 25 g ); fab - ms , mw = 529 . the product from example 17 ( 4 . 25 g , 8 ,. 02 mmol ) was dissolved in thf ( 50 ml ) and 1n naoh ( 20 ml ) added . the reaction mixture was stirred at ambient temperature for 24 hours and the solution diluted with water ( 200 ml ). the mixture was acidified to ph 2 with 2n hcl and extracted three times with methylene chloride . the combined organic layers were dried over anhydrous magnesium sulfate , filtered , and evaporated to dryness to give 3 . 98 g ; fab - ms , mw = 515 . [ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( two diastereomers isolated : 4 - hydroxy center is either r or s , other centers are s ) to a solution of the product from example 2 ( 14 . 1 g , 34 . 09 mmol ) in absolute ethanol ( 140 ml ) was added pyrridinium - p - toluene - sulfonate ( 0 . 86 g , 3 . 41 mmol ). the reaction mixture was heated at 55 ° c . for three hours and the solvent removed under reduced pressure . the residue was taken up in ethyl acetate and extracted twice with water . the organic layer was dried over anhydrous magnesium sulfate , filtered , and the filtrate evaporated under reduced pressure to give 13 . 74 g of a mixture of diastereomers . the diastereomers were separated by flash chromatography eluting with a solvent gradient of 5 to 40 % ethyl acetate in hexane to give 5 . 72 g ( 51 % yield ) of the fast isomer and 4 . 72 g ( 42 % yield ) of the slow isomer ; ci - ms shows mw = 329 for both diastereomers . 6 - amino - 7 - cyclohexyl - 3 , 5 - heptane diol hydrochloride (&# 34 ; slow &# 34 ; isomer : 3 - hydroxy center is either r or s , other centers are s , one of two diastereomers found in example 3 ) the slow isomer from example 19 ( 2 . 25 g , 6 . 83 mmol ) was dissolved in methylene chloride ( 25 ml ) and meoh / hcl ( 0 . 029 g / ml hcl , 20 . 14 mmol ) ( 25 ml ) added to this solution . the reaction mixture was stirred at ambient temperature for 23 hours and the solvent removed under reduced pressure . the residue was triturated with ether and the suspension evaporated to dryness to give 1 . 86 g ( quantitative yield ); dei - ms shows mw = 229 . 6 - amino - 7 - cyclohexyl - 3 , 5 - heptane diol hydrochloride (&# 34 ; fast &# 34 ; isomer : 3 - hydroxy center is either r or s , other centers are s , one of two diastereomers found in example 3 ) the fast isomer from example 19 was treated as in example 20 to give the analogous product ; dei - ms shows mw = 229 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl - l - n ( ε )-( n - methylthiocarbamyl )] lysinamide (&# 34 ; slow &# 34 ; isomer : 4 - hydroxy center is either r or s , other centers are s ) to a 5 ° c . solution of the product from example 20 ( 0 . 92 g , 3 . 47 mmol ), the product from example 18 ( 1 . 68 g , 3 . 47 mmol ), hobt ( 0 . 94 g , 6 . 95 mmol ) and triethylamine ( 0 . 70 g , 3 . 47 mmol ) in dmf ( 25 ml ) was added dcc ( 0 . 72 g , 3 . 47 mmol ). the reaction mixture was stirred at 5 ° c . for one hour , then at ambient temperature for 18 hours . the resulting suspension was filtered and the filtrate was evaporated at reduced pressure . the residue was purified by flash chromatography , eluting with 2 to 10 % methanol in methylene chloride to give 1 . 48 g of product ; fab - ms shows mw = 727 . n -( 4 - morphoinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl - l - n ( ε )-( n - methylthiocarbamyl )] lysinamide (&# 34 ; fast &# 34 ; isomer : 4 - hydroxy center is either r or s , other centers are s ) the product from example 21 was coupled to the product from example 18 as in example 22 to give the desired compound ; fab - ms shows mw = 727 . 1 - cyclohexylmethyl )- 4 -( 1 , 3 - dithian - 2 - yl )- 4 - oxo - 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] butyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center is rs ; others are s ) preparation of anion of 1 , 3 - dithiane : a solution of 12 . 4 g ( 0 . 10 mole ) of 97 % 1 , 3 - dithiane in 200 ml of thf is cooled to - 30 ° c . a quantity of 62 . 5 ml ( 0 . 1 mole ) of 1 . 6m n - butyllithium is added with stirring under nitrogen over a period of 10 min ant - 30 °. after 15 min a solution of 42 . 0 g ( 0 . 011 mole ) of 5 - cyclohexylmethyl )- 4 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ]- 2 - oxo - 1 - pyrrolidinecarboxylic acid , 1 , 1 - dimethylethyl ester , mixture of [ 4s -[ r *( r *), 5r *] and [ 4s -[ 4r *( s *), 5r *]] isomers , in 200 ml of thf is added to the above prepared 1 , 3 - dithiane anion over a period of 10 min at - 30 °. the reaction solution is allowed to warm to room temperature over ca . 2 hours . after another hour at room temperature the solution is poured ( under n 2 ) into a stirred mixture of 500 g of ice and water . saturated citric acid solution ( 200 ml ) and ether ( 600 ml ) are added . the aqueous layer is separated and the organic phase is dried ( mgso 4 ), filtered and concentrated to give crude gum . silica gel chromatography eluting with 1 to 30 % etoac - hexane gives 29 . 30 g ( 59 %) of product as a gum ; tlc ( 2 : 1 hexane - etoac ) major spot rf 0 . 7 , trace rf 0 . 8 . the product crystallizes and is recrystallized from etoac ; mp 129 °- 131 °; cl - ms shows mw = 501 . 1 - cyclohexylmethyl )- 4 -( 1 , 3 - dithian - 2 - yl )- 4 - hydroxy - 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] butyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center and 4 - hydroxy centers are rs ; others are s ). a quantity of 0 . 70 g ( 0 . 014 mole ) of ketone from example 24 is dissolved in 150 ml of warm methanol . the cooled solution ( 25 ° c .) is treated with 1 ml of water and then a solution of 0 . 10 g ( 0 . 002 mole ) of kbh 4 in 1 ml of water . after 1 hour acetone ( 5 ml ) is added to the reaction solution . after 15 min the solvent is removed at reduced pressure , water ( 5 ml ) is added and the separated gum is extracted into 20 ml of ch 2 cl 2 . the solution is dried ( k 2 co 3 ), filtered and concentrated to give crude product as a mixture of diastereomers ; tlc ( 2 : 1 hexane - etoac ) 2 spots , rf 0 . 3 and 0 . 5 ; fab - ms shows mw = 503 . 3 . a solution of 0 . 40 g ( 0 . 0008 mole ) of the blocked amino diol from example 25 in 20 ml of 50 % meoh -- ch 2 cl 2 is cooled to 10 ° and saturated with hcl gas . the solution is allowed to warm to room temperature and to stand overnight . the solvent is stripped off at reduced pressure and the residue is dissolved in 5 ml of water . the solution is treated with activated charcoal , filtered , and saturated with solid k 2 co 3 . the separated gum is extracted into etoac , and the organic layer is dried over mgso 4 and evaporated ; wt . 0 . 15 g of mixed diastereomers ; tlc ( 1 : 10 meoh -- chcl 3 - saturated with nh 3 ) 2 spots , rf 0 . 5 and 0 . 7 ; ms shows mw = 320 . 1 . separation of diastereomers is accomplished by silica gel chromatography eluting with from 1 to 10 % meoh -- chcl 3 , saturated with nh 3 . [ 1 -( cyclohexylmethyl )- 6 -( 1 - methylethyl ) thio ]- 4 - oxo - 2 -[ tetra - hydro - 2h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethyl - ethyl ester ( pyran center is rs ; others are s ) a solution of 20 . 50 g ( 0 . 05 mole ) of the vinyl ketone from example 9 in 100 ml of meoh is treated with 5 . 70 g ( 0 . 075 mole ) of isopropyl mercaptan and then 8 . 10 g ( 0 . 080 mole ) of triethylamine . after 15 min at room temperature the solvent is removed at reduced pressure and 200 ml of cold saturated citric acid and 300 ml of 25 % ch 2 ch 2 - ether are added to the residue . the dried ( mgso 4 ) extract is concentrated ; wt . 21 . 00 g ( 86 %); tlc ( 2 : 1 hexane - etoac ) one spot , rf 0 . 8 ( visualized with ninhydrin and heat ); analysis , calcd for c 26 h 47 no 5 s : c , 64 . 29 ; h , 9 . 75 ; n , 2 . 88 ; s , 6 . 60 . found : c , 65 . 08 ; h , 9 . 91 ; n , 2 . 76 ; s , 5 . 90 . [ 1 -( cyclohexylmethyl )- 4 - hydroxy - 6 -[( 1 - methylethyl ) thio ]- 2 -[( tetrahydro - 2h - pyran - 2 - yl ) oxy ] hexyl ] carbamic acid , 1 , 1 - dimethylethyl ester ( pyran center and 4 - hydroxy centers are rs ; others are s ) water ( 2 ml ) is added to a solution of 2 . 80 g ( 0 . 0058 mole ) of ketone from example 27 in 20 ml of methanol . a solution of 0 . 31 g ( 0 . 0058 mole ) of kbh 4 in 2 ml of water is added . after one hour at room temperature , 5 ml of acetone is added . the solvent is stripped off at reduced pressure . ice water ( 10 ml ) is added and the product is extracted into 50 ml of ether ; wt . 2 . 58 g ( 91 %); tlc ( 2 : 1 hexane - etoac ) one spot , rf 0 . 55 ; fab - ms shows mw = 487 . 3 . a solution of 2 . 40 g ( 0 . 005 mole ) of blocked amino diol from example 28 in 50 ml of ch 2 cl 2 is treated with 25 ml of methanolic hcl ( methanol saturated with hcl at 10 °). after four hours at room temperature the volatiles are removed at reduced pressure and the residue is dissolved in 100 ml of water . the charcoaled solution is saturated with k 2 co 3 and the mixed diastereomers are extracted into 100 ml of 25 % ch 2 cl 2 - ether ; wt . 0 . 70 g ( 47 %); tlc ( 1 : 10 meoh - chcl 3 - saturated with nh 3 ) two spots , rf 0 . 4 and 0 . 5 . separation of diastereomers is accomplished by silica gel chromatography eluting with 2 - 5 % meoh - chcl 3 ( saturated with nh 3 ); isomer a , tlc ( above system ) rf 0 . 5 ; ms shows mw = 303 . 2 ; isomer b , tlc ( above system ) rf 0 . 4 ; ms shows mw = 303 . 2 . dimethyl aminomalonate was coupled to n -( 4 - morpholinosulfonyl )- phe as described in example 16 . the product was crystallized from methyl , t - butyl ether ; fab - ms shows mw = 443 . the product from example 30 ( 10 g , 22 . 6 mmol ) was dissolved in a mixture of thf ( 50 ml ) and methanol ( 25 ml ) and treated at 0 ° c . with 2n naoh ( 23 ml , 46 mmol ). after 15 min the reaction was quenched with 2n hcl ( 23 ml , 46 mmol ) and partitioned between ethyl acetate and sat . nacl . sub . ( aq ). the organic layer was dried over mgso 4 and evaporated . the residue was redissolved in ethyl acetate ( 40 ml ), treated at 0 ° c . with diisopropylamine ( 4 . 5 ml , 22 . 6 mmol ) and allowed to stand at room temperature . the crystalline product was collected to give 12 . 9 g ; mp 122 - 123 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ l -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- dl -( 2 - carbomethoxy ) glycinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow isomer &# 34 ;) the aminodiol . hcl from example 20 was coupled with the dicyclohexylamine salt from example 31 by treatment with dcc and hobt in dmf . work - up and chromatography was performed in a manner analogous to example 22 to afford the desired product ; fab - ms shows mw = 640 . 1 - cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ n ( α )- 1 , 1 - dimethylethoxy ) carbonyl - 2 -( 2 - propenyl )] glycinamide ( 4 - hydroxy center is r or s ; others are s )(&# 34 ; slow &# 34 ; isomer ) the aminodiol from example 20 was coupled to boc - alg and purified in a manner analogous to example 4 to give the product as a single stereoisomer ; fab - ms shows mw = 426 . n - 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ 2 -( 2 - propenyl )] glycinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomer ) the product from example 33 was dissolved in dichloromethane and treated with methanolic hcl at rt for 1 hour . evaporation afforded the desired product as its hydrochloride salt . the free base was regenerated by partitioning between ethyl acetate and dilute k 2 co 3 ( aq ). the organic layer was dried over mgso 4 and evaporated to a foam ; fab - ms shows mw = 326 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n - 1 - cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ 2 -( 2 - propenyl )] glycinamide ( 4 - hydroxy center is r or s ; others are s (&# 34 ; slow &# 34 ; isomer ) the product from example 34 was coupled to n -( 4 - morpholinosulfonyl )- phe in a manner analogous to example 7 to give the desired product ; fab - ms shows mw = 622 . n -[ 4 -( 1 , 1 - dimethylethoxycarbonyl )- 1 - piperazinosulfonyl ]- l - phenylalanyl - n -[ 1 - cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ]- l -[ 2 -( 2 - propenyl )] glycinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomer ) the product from example 34 was coupled to n -( 4 - boc - 1 - piperazinosulfonyl )- phe in a manner analogous to example 7 to give this product ; fab - ms shows mw = 721 . n -( 1 - piperazinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl )- l - 2 -( 2 - propenyl )] glycinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomer ) the product from example 36 was dissolved in dichloromethane and treated with methanolic hcl to remove the boc group . evaporation of solvents and regeneration of the free base by partitioning between ethyl acetate and dilute k 2 co 3 , drying the organic layer over mgso 4 , and evaporating the organic layer gives the product as a foam ; fab - ms shows mw = 621 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxyhexyl ] glycinamide ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomer ) n -( 4 - morpholinosulfonyl )- l - phenalalanyl glycine was prepared in a manner analogous to examples 30 and 31 , substituting glycine ethyl ester for dimethyl aminomalonate . this material was subsequently coupled to the aminodiol from example 20 in a manner analogous to example 22 to afford the desired product ; fab - ms shows mw = 582 . n -( 4 - morpholinosulfonyl )- l - phenylalanyl - n -[ 1 -( cyclohexylmethyl )- 2 , 4 - dihydroxy - 6 -[( 1 - methylethyl ) thio ]- dl -( 2 - carboxymethyl )- glycine . ( 4 - hydroxy center is r or s ; others are s ) (&# 34 ; slow &# 34 ; isomers ) the aminodiol . hcl from example 29 was coupled to the dicyclohexylamine salt from example 31 by treatment with dcc and hobt in dmf . work - up and chromatography was performed in a manner analogous to example 22 to afford the desired product ; fab - ms shows mw = 696 . | 2 |
hereinafter , some exemplary embodiments of the present invention are described in detail with reference to the accompanying drawings . fig1 is a perspective view illustrating an exemplary embodiment of the present invention and shows a battery pack 1 . further , fig2 is a diagram showing one of battery modules 2 constituting the battery pack 1 . in a description relating to the exemplary embodiment of the present invention , it is assumed that the battery module 2 ( refer to fig2 ) forms a basic unit capable of supplying a power source and a number of the battery modules 2 , coupled together at regular intervals so that they can be dismantled and assembled in a casing 3 ( refer to fig1 ), form the battery pack 1 . meanwhile , the battery module 2 preferably includes a tray 5 , a battery cell 7 , a cell charger 9 , a cell controller 11 , a heating mat 13 , and a temperature sensor 15 as one set . further , in the exemplary embodiment of the present invention , the battery modules 2 preferably are configured to be easily assembled in the casing 3 using fastening members 16 ( refer to fig1 ), such as screws , and to be easily replaced in the casing 3 as occasion demands . the exemplary embodiment of the present invention is described in more detail below . the casing 3 includes a reception space in which the battery modules 2 can be accommodated . the casing 3 further includes an opening 3 a having one face opened . a plurality of guide slots 3 b is formed in the opposite sides of the casing 3 ( both internal faces on the basis of the front face of fig2 ). the trays 5 are inserted into the guide slots 3 b , provided in the opposite internal faces of the casing 3 , at regular intervals . the guide slots 3 b are disposed at regular intervals in a certain direction . the trays 5 inserted into the guide slots 3 b are stacked in a certain direction . each of the trays 5 has extension portions 5 a on its both sides . the extension portions 5 a are inserted into the guide slots 3 b . that is , the extension portions 5 a are inserted into the guide slots 3 b provided in the casing 3 . further , the trays 5 can be robustly fastened to the casing 3 using the fastening members 16 , such as screws . the trays 5 are fastened to the casing 3 using the fastening members 16 , such as screws , so that the battery module 2 can be easily detached from the casing 3 when the corresponding battery module 2 is defective or run down and a new battery module 2 can be easily coupled to the casing 3 by unfastening the fastening members 16 , such as screws . since the trays 3 and the casing 3 are coupled together by the fastening members 16 such as screws , the maintenance and repair of the battery pack 1 is facilitated , and the life span of the battery pack 1 can be prolonged . the battery cells 7 are provided in the respective trays 5 . the battery cells 7 are charged with a power source and so they can supply a power source externally . the battery cell 7 is coupled to the tray 5 . the battery cell 7 includes terminals 7 a and 7 b connecting an electrode of a negative polarity and an electrode of a positive polarity . the terminals 7 a and 7 b can be used to drain a power source , charged in the battery cell 7 , externally or to charge the battery cell 7 with a power source . the cell charger 9 and the cell controller 11 , as shown in fig3 and 4 , can be coupled to a printed circuit board ( pcb ) or can be provided in the form of a chip . the cell charger 9 functions to charge the battery cell 7 . the cell charger 9 preferably corresponds to one battery cell 7 . the cell controller 11 can control a corresponding cell charger 9 . further , the heating mat 13 and the temperature sensor 15 are electrically connected to the cell controller 11 . that is , the cell controller 11 can receive a value measured by the temperature sensor 15 and control the heating mat 13 . a connector 11 a ( refer to fig2 ) is provided in the printed circuit board ( pcb ) in which the cell controller 11 is provided . the cell controller 11 is electrically connected to the temperature sensor 15 through the connector 11 a . the number of cell controllers 11 preferably corresponds to the number of battery modules 2 . further , a communication connector 11 b connected to a main controller 17 ( refer to fig5 to 7 ) ( i . e ., a battery management system ( bms ) is provided in the printed circuit board ( pcb ) in which the cell controller 11 is provided . accordingly , the cell controller 11 can send and receive data to and from the main controller 17 through the communication connector 11 b . the temperature sensor 15 can measure the temperature of the battery cell 7 and send a measured value to the cell controller 11 or the main controller 17 . when the temperature of the battery cell 7 is low , the heating mat 13 can be controlled by the cell controller 11 in order to raise the temperature of the battery cell 7 . the heating mat 13 , as shown in fig1 and 2 , preferably is configured to surround the battery cell 7 or provided in one side of the battery cell 7 . meanwhile , the battery module 2 can be supplied with a power source for driving the elements of the battery module 2 . fig6 is a diagram illustrating an exemplary embodiment of the present invention and is a block diagram showing the main elements of the battery management system . referring to fig6 , the battery modules 2 of the present invention are electrically connected to each other and connected to each other so that they can be controlled by the respective main controllers 17 . to the main controller 17 are electrically connected a current sensor 19 for sensing current coming from the battery pack 1 and a current breaking switch 21 for breaking current coming from the battery pack 1 . the current breaking switch 21 preferably includes elements suitable for power control , such as a number of insulated gate bipolar transistors ( igbt ) or power fets which are coupled in parallel and are capable of controlling high power . the main controller 17 , as shown in fig6 , includes a charging control module 23 for receiving information about a state of charge ( soc ) of each of the battery cells 7 from the cell controllers 11 and controlling each of the cell chargers 9 based on the information . the charging control module 23 is a control program for controlling the cell chargers 9 . the charging control module 23 can receive data , such as a voltage and a charging current of the battery cell 7 , from the cell controller 11 , analyze the received data , and send a charging command to the cell charger 9 if the battery cell 7 needs to be charged . the main controller 17 further includes a temperature control module 27 . the temperature control module 27 receives signals corresponding to values measured by the temperature sensors 15 and controls the heating mats 13 or the cooling fan 25 for controlling the temperature of the battery cells 7 . the cooling fan 25 is installed in the casing 3 and it can function to lower the general temperature of the battery pack 1 . the temperature control module 27 is a control program for appropriately maintaining the temperature of the battery cells 7 . the main controller 17 includes a battery cell protection control module 29 for controlling the current breaking switch 21 in response to an input signal from the current sensor 19 . the battery cell protection control module 29 is a control program capable of protecting the battery cells 7 from overcurrent or overcharging . the main controller 17 further includes a cell grading control module 31 . the cell grading control module 31 performs a cell grading process of checking the capacities of the battery cells 7 based on signals received from the respective cell controllers 11 and determining whether the battery cells 7 are appropriate . the cell grading control module 31 is a control program for performing the cell grading process for the battery cells 7 . the cell grading control module 31 can determine the remaining life span of the battery cells 7 by calculating the life span of the battery cells 7 based on respective signals received from the cell controllers 11 . if the cell grading control module 31 determines that a specific battery cell 7 is inappropriate and run down , the battery module 2 including the corresponding battery cell 7 can be removed or replaced , thereby prolonging the life span of the battery pack 1 . in this description , for convenience &# 39 ; sake , the cell grading process is illustrated to determine a state of charge ( soc ), a state of health ( soh ), etc . of the battery cell . the main controller 17 further includes a communication control module 33 for sending data , related to the battery cells 7 and received from the cell controllers 11 , and data processed in relation to the data to an external memory 39 or for communicating the data with an external computer . the communication control module 33 is a control program capable of sending and receiving data to and from an external device , such as a computer device . meanwhile , the main controller 17 , as shown in fig5 , includes communication ports 47 , such as a can communication port 41 , a tcp / ip communication port 43 , and a usb communication port 45 . the communication ports 47 can exchange data with the external computer device in various ways under the control of the communication control module 33 . further , internal memories 35 ( refer to fig6 ) are connected to the respective cell controllers 11 . the main controller 17 further includes a history management control module 37 for recording and managing the history of each of the battery cells 7 in the respective internal memories 35 . the history management control module 37 functions to manage data , such as the history of the past of each of the battery cells 7 so that the battery pack 1 can be managed in an optimal state . the operation and function of the battery pack 1 configured as above according to an exemplary embodiment of the present invention is described in detail below . first , a worker inserts the battery modules 2 , included in the battery cell 7 , into the guide slots 3 b provided in the casing 3 and couples the battery modules 2 to the casing 3 using the fastening members 16 , such as screws . next , the worker inserts the extension portions 5 a , provided on both sides of each of the trays 5 constituting the battery modules 2 , into the guide slots 3 b . next , the worker couples the trays 5 to the casing 3 using the fastening members 16 , such as screws . as described above , since the battery modules 2 are sequentially inserted into the casing 3 and fastened thereto using the fastening members 16 , the battery pack 1 of an assembly form can be completed . the number of battery modules 2 connected to the battery pack 1 can be different according to a necessary capacity of power in order to appropriately control the capacity of the battery pack 1 as occasion demands . further , a control process through the main controller 17 according to an exemplary embodiment of the present invention is described below . the cell controller 11 checks a voltage , a charging current , etc . of the battery cell 7 . further , the temperature sensor 15 senses the temperature of the battery cell 7 and sends the sensed temperature to the cell controller 11 . further , the cell controller 11 stores information about the battery cell 7 in the internal memory 35 and simultaneously sends the information to the main controller 17 . further , the current sensor 19 senses the current of the battery pack 1 and sends the sensed current to the main controller 17 . the main controller 17 inputs information about the battery cell 7 to the external memory 39 through the communication control module 33 . further , the main controller 17 can load information about the battery cell 7 , stored in the external memory 39 . the main controller 17 sends a signal to a corresponding cell controller 11 if it determines that a corresponding battery cell 7 needs to be charged based on the information about the corresponding battery cell 7 and the data received from the current sensor 19 . in response to the signal , the cell controller 11 controls a corresponding cell charger 9 so that it charges the corresponding battery cell 7 . the temperature control module 27 of the main controller 17 sends a control signal to the cell controller 11 when the temperature of a specific battery cell 7 has a set value or less . in response to the control signal , the cell controller 11 operates the heating mat 13 in order to raise the temperature of the specific battery cell 7 . further , when the temperature of the battery cells 7 is higher than a set value or more , the temperature control module 27 of the main controller 17 operates the cooling fan 25 . when the cooling fan 25 is operated as described above , the temperature of the battery cells 7 is generally lowered . if the battery cell protection control module 29 of the main controller 17 determines that a specific battery cell 7 has been overdischarged or overcharged or the temperature of the battery cell 7 has exceeded a normal range based on the data received from a corresponding cell controller 11 , it operates the current breaking switch 21 in order to protect the battery pack 1 . meanwhile , the cell grading control module 31 of the main controller 17 can pick out an inappropriate battery module 2 by checking the capacity of a corresponding battery cell 7 , received from the cell controller 11 . accordingly , the worker can remove the inappropriate battery module 2 from the casing 3 and install an appropriate battery module 2 in the casing 3 . consequently , since a battery cell grading process can be performed in a process of manufacturing the battery pack 1 , the battery pack 1 with an excellent quality can be fabricated . further , the cell grading control module 31 calculates the life span of the battery cell 7 based on the data received from the cell controller 11 . accordingly , the general life span of the battery pack 1 can be prolonged by replacing the battery module 2 , including a run - down battery cell 7 , with the battery module 2 including a new battery cell 7 . the signals sent to the main controller 17 can be stored in the external memory 39 through the communication control module 33 . in particular , the history management control module 37 of the main controller 17 databases the histories of the battery modules 2 and stores and manages the data . in accordance with the exemplary embodiments of the present invention , a process of manufacturing the battery pack can be simplified and the manufacturing cost can be reduced because battery cell - balancing needs not to be performed through additional processes . fig8 to 10 are exemplary photographs to which the exemplary embodiments of the present invention are applied . while this invention has been described in connection with what is presently considered to be practical exemplary embodiments , it is to be understood that the invention is not limited to the disclosed embodiments , but , on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . | 7 |
fig1 shows a counterholding tool 1 , which has a housing 2 and a box - end wrench insert 3 , which is placed over a screw nut 4 . if the screw 5 is now tightened by suitable means ( not shown ) from the other side of the illustrated flange 6 , and if the screw nut 4 then also rotates in the direction of the arrow under the influence of the coupling forces exerted upon it by friction , then this torque must be absorbed by the counterholding tool 1 . in the type of use illustrated in fig1 which shows the screw - fastening of a flange 6 , this torque is absorbed by having the housing 2 rest against a further nut 4 &# 39 ;. the housing 2 thus forms the stop of the counterholding tool 1 and the nut 4 &# 39 ; acts as the stationary abutment . the torque exerted upon the nut 4 as the screw is tightened is thus absorbed , and the holder 2 is is pressed against the nut 4 &# 39 ;. when the tightening of the screw 5 is finished , the counterholding tool 1 then has to be removable from the screw nut 4 . this is possible only if the pressure exerted by the housing 2 against the nut 4 &# 39 ;, resulting from the tightening of the screw 5 , can be made to disappear in some manner or other . this is accomplished by having the box - end wrench insert 3 pivotable in the housing 2 with the aid of bolts 7 , 7 &# 39 ; ( fig1 and 4 ), and also by providing a locking mechanism in the housing 2 . if the housing 2 and the box - end wrench insert 3 are fixed relative to one another ( that is , locked ) while the screw 5 is being tightened , then this locking action can be released again after the end of the screwing procedure , by actuating the handle 8 . rotational movement in the housing 2 relative to the box - end wrench insert 3 is thus restored . then the pressure exerted against the nut 4 &# 39 ; by the housing 2 is eliminated , and the entire counterholding tool 1 can be removed easily from the nut 4 . fig2 shows a further possible use from the field of crane erection . the screw head 9 , onto which the box - end wrench insert 3 is placed , is positioned geometrically relative to the rectangular element 10 such that it is not possible for the housing 2 to rest directly on any stationary abutment . in order nevertheless to assure reliable support , the counterholding tool 1 is provided on its underside with a slide track 11 , on which a support element 12 is disposed such that it can be displaced and , with the aid of an arresting lever 13 , arrested . this support element 12 may be adjusted along the slide track 11 such that at a suitable point it presses against some stationary part of the apparatus to be assembled , as shown in fig2 . the handle 8 , which serves to unlock the locking mechanism , is located in an opening 14 in the housing 2 formed by means of a bracket 15 . fig4 shows the reception of the box - end wrench insert 3 in the housing 2 as well as the locking mechanism . the box - end wrench insert 3 is inserted in a receptacle 16 , which in turn , as already noted , is received in a rotatable manner in the housing 2 with the aid of bolts 7 , 7 &# 39 ;. a leaf spring 17 is riveted to the receptacle 16 and is provided with a small pin 18 , which in the illustrated position protrudes through an opening in the receptacle 16 and on into a hold in the box - end wrench insert 3 , thus fixing it within the receptacle 16 . if the leaf spring 17 is bent downward , then the pin 18 moves out of the hole in the box - end wrench insert 3 , so that the insert 3 can be removed or exchanged for another . the receptacle 16 , rotatably supported in the housing 2 with the aid of the bolts 7 , 7 &# 39 ;, has a slide cam 19 whose surface is rounded . the surface of the slide cam 19 rests on the surface of a wedge 20 , which is displaceably supported in a guideway 21 in the housing 2 . the wedge 20 is connected with a rod 22 , which in turn carries a spring plate 23 , against which a spring 24 disposed in a sheath 25 presses . the surface of the slide cam 19 and of the wedge 20 are inclined or adapted to one another such that when the support element 12 presses against an abutment , a displacement force is exerted upon the wedge 20 acting in the direction of the guideway 21 . the wedge 20 is held in the illustrated position by an arresting member 26 ( see fig1 as well ). this arresting member 26 is rotatably supported in the housing 2 by a bolt 27 and presses with its notched edge 28 against the righthand shoulder 29 ( extending vertically in fig4 ) of the wedge 20 . the arresting member 26 is pressed into the position shown in fig4 by a spring 30 , which is held in place by a bolt 31 attached to the arresting member and by a bolt 32 attached to the housing 2 . in the locking position shown in fig4 the notched edge 28 of the arresting member 26 is in engagement with the shoulder 29 of the wedge 20 . if torque is now exerted upon the counterholding tool in the manner shown in fig2 then the slide cam 19 presses with a resultant force against the oblique face of the wedge 20 ; however , the wedge 20 is not capable of following the resultant displacement force in the direction of its guideway 21 , because the displacement force s acts in the direction of the arrow shown in fig1 , toward the notched edge 28 of the arresting member 26 . as also shown in fig1 , the arresting member 26 is embodied with a right angle . the bearing on the bolts 27 , 27 &# 39 ; ( fig1 ) has so much play that the displacement force s in the direction of the arrow is absorbed by a bearing block 33 attached to a holder plate 34 . the arresting member 26 also has a tongue 35 , on which a further tongue 36 rests , which is firmly connected with the handle 8 and can be pivoted with this handle 8 about bolt 50 . now if the bracket 15 and the handle 8 are grasped ( see fig4 ), then the tongue 36 presses against the tongue 35 in such a manner that the arresting member 26 is pivoted upward , counter to the force of the spring 30 . the shoulder 29 of the wedge 20 is thus released , and ( in fig4 ) the wedge 20 is abruptly pressed toward the right by the slide cam 19 on the receptacle 16 for the box - end wrench insert 3 . the slide cam 19 ( fig4 ) is then capable of moving downward . however , the position of the box - end wrench insert 3 in the housing 2 is now no longer fixed ; instead , the arresting action has now been released , and free play exists between the box - end wrench insert 3 and the housing 2 , so that the box - end wrench insert 3 can be removed without difficulty from the nut 4 or from the screw head 9 . as shown , the spring 24 serves the purpose of damping the movement of the wedge 20 toward the right ( in fig4 ) during the unlocking process , and also serves to force the displaceable wedge 20 automatically back to the left again ( fig4 ) after the locking action has been released . the holder plate 34 is still supported relative to the rear side of the housing by the support plate 38 , which at the same time defines the opening 14 . fig6 and 7 show two further inserts , in the form of a fork wrench insert 3 &# 39 ; or square - box wrench insert 3 &# 34 ; for power - tightened nuts intended for further uses ; fig8 - 10 show three further support elements 12 &# 39 ;, 12 &# 34 ;, 12 &# 34 ;&# 39 ;, again for further uses . fig1 shows a second exemplary embodiment , having a hydraulic locking mechanism . the wedge 20 is connected with the piston rod 40 of a hydraulic cylinder 41 . a closed - loop hydraulic line 42 leads from one end of the cylinder 41 to the valve 43 and from there back again to the other end of the cylinder 41 . the valve 43 can be opened by means of a handle 44 ; a thrust plate 45 presses against the shoulder 29 of the wedge 20 and is connected with a guide rod 46 , which is pressed to the left by a spring 47 . in the position shown in fig1 , with the valve 43 closed , the hydraulic fluid keeps the piston rod and thus the wedge 20 in the illustrated position . if the valve 43 is opened by the actuation of the handle 44 , then hydraulic fluid flows through the line 42 from the right - hand end of the cylinder 41 into the left - hand end thereof . the piston rod 40 and with it the wedge 20 thus move toward the right . the locking mechanism is thus unlocked , and the housing 2 has free play again above the receptacle 16 or the box - end wrench insert 3 . the spring 47 subsequently forces the thrust plate 45 to the left , and the thrust plate 45 in turn forces the wedge 20 to the left , back into the illustrated position . the valve 43 is then closed once again , and the counterholding tool is again ready for use . the foregoing relates to preferred exemplary embodiments of the invention , it being understood that other embodiments and variants thereof are possible within the spirit and scope of the invention , the latter being defined by the appended claims . | 1 |
next , preferred embodiments of the present invention will now be described in details with reference to the accompanying drawings . fig1 shows an outer appearance of a photographic film printing apparatus 4 . numeral 1 denotes a film magazine to be detailed later , and numeral 3 denotes a winding device for taking up a film 30 from in the film magazine 1 or reversely discharging the film 30 located in the printing apparatus 4 to the film magazine 1 . the film 30 wound by the winding device 3 is conveyed to a printing exposure stage x by means of a conveyer device including a plurality of rollers 22 , where the film is exposed and printed . numeral 41 denotes a light source , numeral 42 denotes a light modulating filter , numeral 43 denotes a mirror tunnel , and a numeral 44 denotes a negative mask . as these components are not directly related to the present invention , they will not be detailed herein . fig3 and 4 show the entire film magazine 1 to which the present invention relates . this film magazine 1 includes a case 13 principally constituting the overall outer appearance of the magazine , a rotary drum 10 rotatable about a rotation axis 100 disposed centrally of the drum , a drum driving means 21 for rotatably driving the drum 10 , and a plurality of rollers 22 constituting the conveying device ( alias , ` conveying means `) for conveying the film 30 to the drum 10 . the drum 10 equidistantly defines , in its outer periphery , a plurality of slits 11 . through each of these slits 11 , the film 30 is inserted into the drum 10 to be stored therein or discharged from the inside of the drum 10 . adjacent each slit , there is provided a plate spring 15a as a retaining mechanism 15 for retaining an end of the film 30 . further , adjacent a certain plate spring , i . e . the plate spring 15a in this illustrated condition , located at an upper left position in fig4 there is provided a retention releasing cam 16 , as a retention releasing mechanism , which is placed under urged contact with the plate spring 15a . this retention releasing cam 16 , by contacting the plate spring 15a , elastically deforms a free end of this plate spring 15a downwardly , thereby to form a gap ( s ) for allowing insertion of the film 30 therethrough . incidentally , as may be apparent from fig4 the retention releasing mechanism is disposed adjacent a pair of upper and lower guide plates 23a , 23b which are disposed on the left side in the same figure . thus , only the plate spring 15 provided adjacent the slit 11 most adjacent the releasing cam 16 is released . each plate spring 15a is normally under the retaining state for retaining the film 30 . and , the plate spring 15a is elastically deformed to release the film only when the spring 15a comes into contact with the retention releasing mechanism 16 . a roller denoted with numeral 24 functions as a drive transmitting means for transmitting a drive force to the rollers 22 disposed adjacent a film entrance of the magazine 1 when the magazine 1 is attached to the film printing apparatus 4 . in addition to the above - described components , the film magazine 1 further includes a rotation restricting arm denoted with numeral 14 and a position detecting means denoted with numeral 25 for detecting an angular position of the rotary drum 10 . the rotation restricting arm 14 is pivotally supported to the magazine case 13 via a pivot portion 14c provided at the center of the arm . further , a right side end portion 14b in the same figure of the arm 11 is urged by such an urging member as a spring 14e , into loaded contact with the outer periphery of the drum 10 , thereby applying a braking force to the outer periphery of the drum 10 against rotation thereof . when the right - side arm end portion 14b is placed under the loaded contact with the outer periphery of the drum 10 , a left side end portion 14a of the arm projects to the outside of the case 13 . accordingly , when this film magazine 1 is attached to the winding device 3 of the printing apparatus 4 , the winding device 3 come into abutment against a left side face of the magazine case 13 thus depressing the left end portion 14a of the rotation restricting arm 14 . hence , the rotation restricting arm 14 is pivoted so as not to restrict rotation of the drum 10 , in association with attachment of the film magazine 1 to the winding device 3 . the drum driving means 21 for rotatably driving the drum 10 includes a plurality of rollers 21a , 21b and the drive force thereof is supplied from the printing apparatus 4 . more particularly , the roller 21b is constantly placed in contact with the outer periphery of the drum 10 , so that the outer periphery of the drum 10 is rotated in unison with rotation of this roller 21a . incidentally , on and above the outer periphery of the drum 10 , the end of the film 30 is exposed . then , the rollers 21a , 21b , which come into contact with this exposed end of the film , are formed of soft material such as rubber so as not to damage the end of the film . alternatively , in order to avoid contact between the rollers 21a , 21b with the end of the film 30 , these rollers may be constructed so as to contact only a bottom edge of the outer periphery of the drum 10 . the drum position detecting sensor ( alias , ` drum sensor `) 25 detects the angular position of the drum 10 relative to a gap 23c formed between the guide plates 23a , 23b . namely , the condition in which the slit 11 of the drum 10 is aligned with the gap 23c is the position allowing insertion or discharge of the film 30 . then , the sensor 25 detects this condition and outputs its detection data to the control device 2 to be detailed later . more specifically , the drum sensor 25 detects whether or not the drum 10 is located at the position allowing insertion or discharge , by detecting , from the outside , a projecting portion of an unillustrated element inserted into a hole 12 provided for drum position detection . fig5 shows a film magazine having a retaining mechanism different from that of the magazine shown in and described hereinbefore with reference to fig3 and 4 . this retaining mechanism employs an endless belt denoted with numeral 150 . this belt 150 is placed in contact with the outer periphery of the drum 10 over a substantial length of the belt , and the belt 150 functions to bind and retain the film 30 between an inner peripheral portion 151 thereof and the outer periphery 152 of the drum 10 . this belt 150 is driven by means of a plurality of rollers 21a , 21b , 21d , 21e , 21f as the drum driving means 21 , so as to rotatably drive , in turn , the drum 10 . further , the belt 150 has the dual - function , i . e . the function as the film retaining mechanism and the further function as the drum driving means . the roller 24 transmits the driving force from the printing apparatus to the roller 22a . as described hereinbefore , the belt 150 does not contact the drum 10 over the entire periphery thereof , rather , the belt includes a non - contact region not contacting the drum adjacent an entrance for introducing the film 30 into the slit 11 . in this manner , the non - contact region of the belt 150 not contacting the drum 10 is used as an entrance opening for allowing insertion into the drum 10 of the film 30 which is conveyed from the winding device 3 by means of the conveying device 22 , and the retained condition of the film end is released at this non - contact region . therefore , this alternative construction too allows discharge of the film 30 from the drum 10 as well as insertion of the film 30 into the drum 10 . the film magazine shown in fig5 too includes a rotation restricting arm 14 &# 39 ;, which is similar to the arm 14 shown in fig1 . unlike the restricting arm 14 , however , this rotation restricting arm 14 &# 39 ; does not restrict rotation of the drum 10 by being urged against the outer periphery of the drum 10 . rather , this arm 14 effects the restriction of drum rotation by means of a left end portion 14b &# 39 ; thereof which comes into contact with the roller 21e , i . e . the drum driving means , thereby to restrict rotation thereof . incidentally , the left end portion 14b &# 39 ; of this arm 14 &# 39 ; also projects from the left side face of the case 13 , just like the end portion 14b of the arm 14 . then , when the magazine 1 is attached to the winding device 3 , the arm 14 &# 39 ; is pivoted counterclockwise in the figure , thereby to release the rotation restriction to the drum drive transmitting means 21 . next , with reference to fig6 and 7 , the process for feeding the film 30 from the winding device 3 into the film magazine i will be described . in the following description relating to the feeding order , the terms : ` leading end of the film ` and ` trailing end of the film ` are used for the sake of convenience . here , it is understood that the leading end of the film refers to the portion of the film 30 which is first discharged from the winding device 3 , i . e . the portion of the film 30 which is to be first introduced into the film magazine 1 and also that the trailing end of the film refers to the opposite end of the film which is to be last discharged from the winding device 3 into the magazine . incidentally , in the subsequent description relating to the reverse feeding operation of the film 30 from the magazine 1 to the winding device 3 , the terms : ` leading end ` and ` trailing end ` are also used , in spite of the difference in the feeding directions . for conveying the film 30 stored within the winding device 3 to the film magazine 1 , by activating the conveying device of the winding device 3 and the conveying device incorporated within the film magazine , the film 30 is inserted into the slit 11 of the drum 10 . first , the film magazine 1 is attached to the winding device 3 ( the condition illustrated in fig6 a ). with this attachment , the rotation restricting arm 14 of the film magazine 1 is pivoted to release the restriction of rotation of the drum 10 . and , the drum sensor 25 detects whether the angular position of the drum 10 is presently located at the position allowing insertion of the film 30a or not . then , based on this detection , if the drum 10 is not located at the predetermined position allowing film insertion , the drum 10 is driven to rotate via the drum drive transmitting means 21 clockwise in the same figure . when the drum sensor 25 detects the position of the drum position detecting hole 12 defined in a segment 17 of the drum 10 , the rotation of the drum 10 is stopped ( the condition illustrated in fig6 b ). by activating the conveying device 22c , 22d of the winding device 3 and the conveying rollers 22a , 22b incorporated within the magazine , a conveying operation of the film 30a is started ( the condition illustrated in fig6 c ), and the leading end of the film 30a is introduced into the slit 11 ( the condition illustrated in fig6 d ). from the above condition , the conveying operation of the film 30a is continued , until a film sensor 27 is rendered into a non - detecting condition and then a predetermined time period has lapsed . namely , at the moment of detecting absence of the trailing end of the film , there still remains a significant distance between the trailing end of the film 30a and the slit 11 of the drum 10 , thus it is still difficult for the retaining mechanism to retain the film 30 . for this reason , the drum 10 keeps taking up the remaining length of the film therein , and when the length has become suitable for the retention by the film retaining mechanism , the activation of the conveying devices is stopped . as illustrated in fig6 f , after the conveying devices are stopped , the drum 10 is rotated clockwise in the figure . and , this clockwise rotation of the drum 10 is stopped when the drum sensor 25 detects the predetermined position of the drum 10 allowing film insertion . this is the condition under which the film 30b can be inserted into the drum 10 . thereafter , the conveying devices are activated again to convey the next film 30b ( the condition illustrated in fig7 g ). then , as illustrated in fig7 h , the film 30b is conveyed into the drum and the trailing end of this film 30b is conveyed across the position of the film sensor 27 ( the condition of fig7 h ). then , as described hereinbefore , after the lapse of the predetermined time period , the conveying devices are stopped . thereafter , the drum 10 is again rotated clockwise . this rotation of the drum 10 is continued until the drum sensor 25 detects the predetermined position of the drum 10 allowing film insertion ( the condition of fig7 i ). when the sensor 25 detects that the drum 10 has been rotated to the predetermined position , the drum 10 is stopped , and the magazine is ready for receiving the next film 30c . thereafter , as illustrated in fig7 j , 7k , 7l , the steps for inserting this next film 30c into the drum 10 are repeated in the same manners as described above . next , the reverse process for discharging the films 30 from the film magazine 1 will be described with reference to fig8 and 9 . first , from the condition illustrated in fig8 a , the drum 10 is driven , via the drum drive transmitting means 21 , to rotate counter - clockwise in the figures so as to be set to the predetermined position allowing film discharge . this rotation of the drum 10 is stopped when the drum sensor 25 detects the discharging , i . e . predetermined , position of the drum 10 ( the condition illustrated in fig8 b ). then , the drum 10 is again rotated counter - clockwise so as to bring the trailing end of the film 30g past between the pair of guide plates 23a and 23b and to cause the film end to be retained between the rollers 22a , 22b of the conveying device ( the condition illustrated in fig8 c ). incidentally , simultaneously with the counter - clockwise rotation of the drum 10 , the pair of rollers 22a , 22b of the conveying device 22 are driven in the direction for discharging the film . and , as illustrated from fig8 c to fig8 d , the trailing end of the film 30g is wound by the conveying device . then , as illustrated in fig8 e , when the leading end of the film 30g passes the film sensor 27 , like the case described hereinbefore , following the condition illustrated in fig9 f , when the drum 10 is rotated to the discharging position , the rotation of the drum 10 is stopped . and , the trailing end of the film 30f is taken up by the rollers 22a , 22b as the conveying device . thereafter , following the conditions illustrated in fig9 g , 9h , when the leading end of the film 30f passes the film sensor 27 as illustrated in fig9 i , the drum 10 is rotated to the position ready for discharging the next film 30e . then , by repeating the above - described steps , in the reverse order of the take - up order of the films into the film magazine 1 , the films 30e , 30d , 30c , 30b and 30a are discharged one after another from the magazine 1 . in the above - described case , the films are taken up into the magazine 1 in the order of the film 30a , film 30b , film 30c , film 30d , film 30e , film 30f , and the film 30g , and the films are discharged from the magazine 1 in the reverse order of the film 30g , film 30f , film 30e , film 30d , film 30c , film 30b and the film 30a . next , with reference to fig1 , a different case will in described in which the films are discharged from the magazine 1 in the same order as their taken - up order into the magazine 1 . fig1 a illustrates a condition in which the last film 30g has been just taken up and stored in the film magazine 1 . as shown , under this condition , the trailing end of the last film 30g remains between the guide plates 23a , 23b . for this reason , in order to discharge the first film 30a , first , the drum 10 is rotated clockwise by an amount corresponding to two times the angular pitch of the slits . fig1 b illustrates a transitional condition in which from the condition of fig1 a the drum 10 has been rotated clockwise by an amount of one angular pitch of the slits 11 . under this condition of fig1 b , the trailing end of the film 30a to be discharged is not yet present between the guide plates 23a , 23b . hence , if the conveying device 22 is driven under this condition , the target film 30a cannot be discharged . therefore , the drum 10 is further rotated to the condition illustrated in fig1 c . however , under this condition too , the trailing end of the target film 30a is not yet retained between the pair of rollers 22a , 22b . hence , the drum 10 is rotated counter - clockwise and the conveying device 22 is driven at the same time . incidentally , this counter - clockwise angular displacement of the drum 10 corresponds to one pitch of the slits . with this , the trailing end of the film 30a is moved past between the guide plates 23a , 23b and then the film is conveyed by the rollers 22a , 22b . in this way , the target film 30a may be discharged from the magazine 1 . when the leading end of the film 30a is moved past the film sensor 27 , the system is ready for discharging the next film 30b . the discharging operation of the next film 30b is possible by effecting the same steps as described above . that is , from the condition upon completion of the discharging of the film 30a , the drum 10 is again rotated clockwise by the amount corresponding to twice the angular pitch of the slits 11 , so as to cause the leading end of the film 30b retained between the pair of rollers 22a , 22b . thereafter , the conveying device 22 is driven to discharge the film 30b out of the magazine 1 completely . by repeating the above - described steps in series for the following films , i . e . the film 30c , film 30d , film 30e , film 30f and the film 30g , the films 30 may be discharged from the magazine 1 in the same order as they were taken up in the magazine 1 . incidentally , as described hereinbefore , the term : ` angular pitch ` of the slits 11 refers to the angular pitch between adjacent ones of the slits 11 which are formed equidistantly in the outer periphery of the drum 10 . next , with reference to fig1 , a still further case will be described in which a desired , i . e . randomly selected , one of the films is discharged from the magazine . this discharging operation of a selected film is possible by utilizing the same methods described above for sequentially discharging the films in the same order as or reverse order of charging them into the magazine . suppose that e . g . the film 30d is to be selectively discharged from the magazine 1 charged with the films 30 into the plurality of slits 11 as illustrated in fig1 . for this purpose , as described hereinbefore , the system needs to be set to the predetermined condition allowing discharge of this film 30d . that is , to this end , it is necessary for the trailing end of the film 30d to be moved past between the guide plates 23a , 23b and then retained between the rollers 22a , 22b . fig1 a shows the condition in which the magazine 1 is charged with the plurality of films 30 . then , in order to discharge the target film 30d from this condition , the drum 10 is rotated clockwise by three times the angular pitch of the slits 11 . this condition is illustrated in fig1 b . in this condition , the trailing end of the film 30d is not yet retained between the rollers 22a , 22b . thus , the drum 10 is then rotated counter - clockwise by one angular pitch of the slits 11 . this condition is illustrated in fig1 c . in this condition , the trailing end of the film 30d is retained between the rollers 22a , 22b , so that the conveying devices are driven to discharge the film 30d as illustrated in fig1 d . by effecting the above - described steps , any desired one of the films may be discharged from the drum 10 . fig1 is a block diagram of a control device for controlling the rotation of the drum 10 and the activation and deactivation of the conveying device 22 . the detection in the magazine 1 is effected by means of the drum sensor 25 which detects whether the drum 10 is located at the predetermined , charging / discharging position or not . further , the winding device 3 incorporates a film sensor 27 which detects whether the trailing or leading end of the film 30 has been moved past the conveying device 22 or not . and , the detection data from these sensors , i . e . the drum sensor 25 and the film sensor 27 , are all inputted to the control device 2 . this control device 2 includes a conveyer drive instructing means 29 for generating a signal for activating the conveying device 22 in response to the input signals from the sensors 25 , 27 and a drum drive instructing means 28 for generating a signal for driving the drum driving means 20 . a further embodiment of the present invention will be described next . in the case of the construction of the retaining mechanism shown in fig3 and 4 , the plate springs 15 are employed as this mechanism and the releasing cam 16 is provided as the retention releasing means for releasing the retention by the plate springs . however , considering the stiffness of the film in the charging / discharging direction thereof , the releasing cam 16 as the retention releasing means may be eliminated . specifically , by appropriately adjusting the urging force of the plate spring 15 , when the leading end of the film 30 is fed from the winding device into the slit 11 of the drum 10 , this leading end of the film may be inserted , against the urging force of the spring , between the plate spring 15 and upper wall of the slit ( i . e . the side face of the segment 17 of the drum 10 ) against which the plate spring contacts , in the foregoing embodiment , the control device 2 executes control of the driving of the drum 10 and the activation / deactivation of the conveying device . instead , the timings of driving of the drum 10 and of activation and deactivation of the conveyer device may be controlled manually . further , in the foregoing embodiment , the drum 10 obtains its drive force from the printing apparatus . instead , the drum 10 may be driven manually . further , the detection of the film charging position of the slit 11 can be detected as long as the relative position between the projecting portion of the unillustrated element inserted into the hole 12 defined in the segment 17 of the drum 10 and the slit 11 is maintained constant . hence , the slits 11 may be formed in the outer periphery of the drum 10 with unequal inter - distances therebetween . further , in the foregoing embodiment , the total of eight slits 11 are formed in the drum 10 . however , the number of slits may vary as desired , by adjusting the diameter of the drum 10 . also , the drum 10 of the above - described film magazine 1 has a hollow construction . thus , not only the film pieces having 2 to 6 frames , a longer film roll having e . g . 24 frames may be retained to the drum by increasing the entire capacity of the drum 10 . the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the present embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than the foregoing description and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . | 6 |
referring to fig1 , a uav 10 may be embodied as a fixed - wing aircraft having a fuselage 12 . wings 14 extend laterally from the fuselage 12 may define an airfoil contour . one or more propulsion sources 16 are mounted to the fuselage 12 or the wings 14 . the propulsion source 16 may be embodied as an internal combustion engine coupled to a propeller , turbo fan , or the like . the propulsion source 16 may also be embodied as a jet engine coupled to a propeller or turbo fan or used alone . one or more tail planes 18 defining an empennage of the uav 10 may secure to a rearward end of the fuselage 12 . the tail planes 18 may define a conventional horizontal stabilizer and vertical stabilizer with corresponding elevator and rudder control surfaces . alternatively , tail planes 18 may include a pair of angled tail planes each with a corresponding control surface and protruding upwardly or downwardly from the fuselage 12 . referring to fig2 , a cradle 20 may include a rear clamping member 22 and a front clamping member 24 . the front clamping member 24 may pivotally secure to the rear clamping member 22 by means of a pivot 26 defining a pivot axis 28 . in the illustrated embodiment , the pivot axis 28 is substantially parallel to a longitudinal direction 30 . the longitudinal direction 30 may be defined along a longitudinal direction of a wing clamped within the cradle 20 . a vertical direction 32 may also be defined as perpendicular to the longitudinal direction 30 . the vertical direction 32 may be substantially parallel to the chord line of a wing positioned in the cradle 20 . for purposes of this disclosure “ substantially ” parallel or perpendicular may be interpreted as within 10 degrees of perpendicular or parallel , preferably within 5 degrees , and preferably within 1 degree , of perpendicular or parallel . likewise , “ substantially ” equal to a value may mean within +/− 5 % of the value , preferably within 1 % of the value . in some embodiments , troughs 34 may extend on either side of the front and rear clamping members 22 , 24 . the troughs 34 may be positioned on one or both sides of the clamping members 22 , 24 along the longitudinal direction 30 . as shown in fig2 , pivot axis 28 may be located vertically adjacent the troughs 34 . stated differently , the troughs 34 may be secured to the rear clamping member 24 near the pivot axis 28 . in some embodiments , the extent of each trough 34 in the longitudinal direction is between 0 . 5 and 2 , preferably between 0 . 9 and 1 , times a width of the rear clamping member 22 . in the illustrated embodiment , each trough 34 has a width substantially equal to the width of the rear clamping member 22 . a locking member 36 engages the front and rear clamping members 22 , 24 . the locking member 36 may selectively lock the front and rear clamping member 22 , 24 relative to one another with a desired amount of locking force . for example , the locking member 36 may be any over - center latch known in the art . inasmuch as a wing stored in the cradle 20 may be shipped by air , the over - center latch is preferably lightweight . the latching force may be defined by the latch and may be adjustable as known in the art . referring to fig3 , in some embodiments a rear clamping member 22 may be as illustrated . the rear clamping member 22 may include cushioning members 40 . for example , one or more cushioning members 40 may be positioned between end plates 38 . in the illustrated embodiments , the cushioning members 40 are sheets of a cushioning material cut to a desired shape . the illustrated rear clamping member 22 may be symmetric about a plane perpendicular to the longitudinal axis 30 . accordingly , for the illustrated end plate 38 a corresponding end plate 38 is located on an opposite side in a mirror configuration . the plates 38 may be fastened to one another such that the cushioning members 40 are captured between the plates . for example , each rod 42 of a plurality of rods 42 may secure to both plates 38 and further extend through the cushioning members 40 positioned between the plates 38 . the rods 42 and plates 38 may be formed of a rigid but light weight material such as aluminum , a rigid plastic , composite material , or the like . the rods 42 may therefore serve to limit compression of the cushioning member 40 . the rods 42 may have circular , rectangular , or some other cross section . in the illustrated embodiment , the rods 42 are secured to the end plates 38 by means of fasteners 44 passing through end plates 38 and engaging an end portion of a rod 42 . in some embodiments , a rod 42 may define interior or exterior threads engaging corresponding threads on the fastener 44 . in other embodiments , the fasteners 44 may be embodied as star fangled nuts and a rod 42 may define a hollow end portion for securing to a star fangled nut . in some embodiments , a backing plate is secured to both end plates 38 , such as by means of welds or other fasteners , and the cushioning members 40 are secured to the backing plate by means of adhesive or some other means . in a like manner , a trough 34 may be defined by cushioning members 48 defining the contour of the trough 34 . the cushioning members 48 may be captured between an end plate 38 and an end plate 46 . likewise , rods 50 may secure to the end plate 38 and the plate 46 in order to capture the cushioning members 48 . the rods 50 may pass through the cushioning members 48 . the rods 50 may secure to the end plate 46 and end plate 38 by any of the fastening means noted above , such as fasteners 52 embodied as star fangled nuts or some other fastener . in some embodiments , a locking member 36 may mount to the rear clamping member 22 by means of a lock mount 54 secured thereto . in the illustrated embodiment , one or more of the cushioning members 40 may define a cutout portion 56 for receiving the lock mount 54 . as is apparent in fig3 , the cutout portion 56 does not extend completely through the cushioning member such that the hard material forming the lock mount 54 does not contact a wing positioned in the cradle 20 . stated differently , a portion of one or more of the cushioning members 40 remains positioned between the lock mount 54 and a wing positioned between the clamping members 22 , 24 . the lock mount 54 may include a back plate 58 and side plates 60 extending outwardly from the back plate 58 . the side plates 60 may secure to the back plate 58 by means of screws , bolts , welds , or some other fastening means . in some embodiments , the back plate 58 and side plates 60 are formed from one monolithic member , such as a channel or rectangular tube having one wall removed . in the illustrated embodiment , the side plates 60 secure to the end plates 38 by means of rods 62 extending through one or more of the cushioning members and secured to the end plates 38 and plates 60 by means of fasteners 64 , such as star fangled nuts or some other fastening means . one or both of the end plates 38 and side plates 60 may define an aperture 66 for receiving a pivot 26 , such as one or more pivot pins 26 , extending through the apertures 66 . referring to fig4 , in some embodiments a front clamping member 24 may be as illustrated . the front clamping member 24 may include cushioning members 70 . for example , one or more cushioning members 70 may be positioned between end plates 68 . in some embodiments , the cushioning members 40 , 48 , 70 may include a polymer , such as a foam polymer , that has a modulus of elasticity of between 0 . 001 and 1 gpa , and preferably between 0 . 01 and 0 . 1 gpa . this modulus of elasticity may refer to the polymer itself or the polymer after any foaming process . the illustrated front clamping member 24 is symmetric about a plane perpendicular to the longitudinal axis 30 . accordingly , for the illustrated end plate 68 a corresponding end plate 68 is located on an opposite side in a mirror configuration . the plates 68 may be fastened to one another such that the cushioning members 70 are captured between the plates 68 . for example , each rod 72 of a plurality of rods 72 may secure to both plates 78 and further extend through the cushioning members 70 positioned between the plates 68 . the rods 72 may have circular , rectangular , or some other cross section . in the illustrated embodiment , the rods 72 are secured to the end plates 68 by means of fasteners 74 passing through end plates 68 and engaging an end portion of a rod 72 . in some embodiments , a rod 72 may define interior or exterior threads engaging corresponding threads on a fastener 74 . in other embodiments , the fasteners 74 may be embodied as star fangled nuts and the rods 72 may define a hollow end portion for securing to a star fangled nut . in some embodiments , a backing plate is secured to both end plates 68 , such as by means of welds or other fasteners , and the cushioning members 70 are secured to the backing plate by means of adhesive or some other means . in some embodiments , a locking member 36 may mount to the front clamping member 24 by means of a lock mount 76 secured thereto . in the illustrated embodiment , one or more of the cushioning members 70 may define a cutout portion 78 for receiving the lock mount 76 . as is apparent in fig3 , the cutout portion 78 does not extend completely through the cushioning member 70 such that the hard material forming the lock mount 76 does not contact a wing positioned in the cradle 20 . stated differently , a portion of the cushioning member 70 is interposed between the lock mount 76 and a wing clamped by the front clamping member 24 . the lock mount 76 may include a back plate 80 and side plates 82 extending outwardly from the back plate 80 . the side plates 82 may secure to the back plate 80 by means of screws , bolts , welds , or some other fastening means . in some embodiments , the back plate 80 and side plates 82 are formed from one monolithic member , such as a channel or rectangular tube having one wall removed in the illustrated embodiment , the side plates 82 secure to the end plates 68 by means of rods 84 extending through one or more of the cushioning members 70 and secured to the end plates 68 and plates 82 by means of fasteners 86 , such as star fangled nuts or some other fastening means . one or both of the end plates 68 and side plates 82 may define an aperture 86 for receiving a pivot 26 , such as one or more pivot pins 26 , extending through the apertures 86 and the apertures 66 of the rear clamping plate 22 . in some embodiments , a bushing 90 extends between the side plates 82 . a rod 90 may pass between opposing end plates 68 and pass through the bushing 90 as well as the side plates 82 . the rod 90 may secure to the end plates 68 by means of fastener 92 in the same manner of other rods discussed hereinabove . referring to fig5 , the front clamping member 24 pivotally secures to the rear clamping member 22 by means of the pivot 26 . in this manner , the front clamping member 24 may be pivoted away from the rear clamping member 22 in order to permit insertion of a wing , as shown by the dotted representation 102 of the front clamping member . the cushioning members 40 of the rear clamping member 22 and the cushioning members 70 of the front clamping member 24 define conformal surfaces 96 , 100 that are shaped to conform to surfaces of a wing . likewise , the cushioning members 48 of the trough 34 define conformal surfaces 100 conforming to one of a leading edge portion and a trailing edge portion of a wing . as noted above , in some embodiments , contact between the cradle 20 and the trailing edge of the wing 14 and any control surfaces is avoided . as known in the art , the cross - sectional shape of a wing preferably varies along the length thereof . accordingly , the conformal surfaces 96 , 98 , 100 may conform to the surface of a wing at a particular longitudinal position . likewise , for a given cradle 20 , the plurality of cushioning members 40 may each have a unique corresponding conformal surface 96 corresponding to a contour of the wing at a particular longitudinal position . likewise each of the plurality of cushioning members 48 may have a unique conformal surface 100 and each of the plurality of cushioning members 70 may have a unique conformal surface 98 . in some embodiments , the conformal surfaces 96 , 98 , 100 are cut such that they are contoured in both vertical 32 and horizontal directions ( e . g . in the plane of the page of fig5 ) and the longitudinal direction 30 in order to conform to variation in the contour of the wing in three dimensions . in other embodiments , the conformal surfaces 96 , 98 , 100 are uniform in the longitudinal direction such that the conformal surfaces 96 , 98 , 100 are contoured in only two dimensions ( horizontal and vertical ). for example , the arbitrary contours of the conformal surfaces 96 , 98 , 100 may be machined using a water jet cutter or other machining process that may machine precise contours in two dimensions . in some embodiments , some or all of the conformal surfaces 96 , 98 , 100 may include a pattern of ridges or other protuberances that are positioned to be located over structural reinforcements under the skin of the wing 14 at the longitudinal location at which the conformal surfaces 96 , 98 , 100 engage the wing 14 . in this manner , pressure exerted on the wing is more concentrated on those areas that are better able to bear such pressure . in some embodiments , the end plates 38 , 46 , 68 may define conformal edges 104 , 106 , 108 respectively that extend along the conformal surfaces 96 , 98 , 100 . the conformal edges may substantially conform to a surface that is offset from a contour of the wing contour by some constant or variable gap , such that during use , the cushioning members 40 , 48 , 70 will not compress to the point that the wing contacts the end plates 38 , 46 , 68 under expected compression forces and amounts . as noted above , the various cushioning members 40 , 46 , 70 of a cradle may not all have conformal surfaces 96 , 98 , 100 of the same shape . in such embodiments , each end plate 38 may have a conformal edge 104 , 106 , 108 that is offset from the conformal surface 96 , 98 , 100 of the cushioning members 40 , 46 , 70 adjacent thereto ( e . g . the outermost cushioning members 40 , 46 , 70 . referring to fig6 , in use a wing 14 may be placed between the front and rear clamping members 22 , 24 and the front clamping member 24 may be pivoted toward the rear clamping member 22 . as shown in fig6 , the leading edge portion of the wing 14 rests in a concave portion of the rear clamping member 22 and the trough 34 . the locking member 36 ( fig2 ) may then be engaged to apply a consistent clamping force between the clamping members 22 , 24 . as a result of the clamping force , the cushioning members 40 , 46 , 70 may compress due to engagement of the wing 14 with the conformal surfaces 96 , 98 , 100 . as noted above , the compression is preferably such that the wing 14 does not contact the end plates 38 , 46 , 68 . referring to fig7 , to facilitate shipping and storage , the uav 10 may be disassembled . as shown in fig7 at least the wings 14 may be removed to reduce the footprint of the uav 10 . other parts of the uav 10 such as the propulsion source 16 and tail planes 18 may also be removed . the wings 14 may secure to the fuselage by means of a wing spar 120 . as known in the art , a wing spar 120 provides structural rigidity to the wing 14 for transferring lift forces to the fuselage 12 . in some embodiments , wings 14 may secure by some other means or interface other than wing spars 120 , such as a plate or other structure defining a hole pattern for receiving fasteners . following shipment or storage according to methods disclosed herein , the wings 14 may be reattached to the fuselage 12 using the wing spars 120 in order to deploy the uav 10 . the fuselage 12 may have indexing members 122 fastened thereto using a fastening system 124 . the fastening system 124 may be a fastening system and corresponding indexing members 122 as disclosed in u . s . application ser . no . 13 / 974 , 350 filed aug . 23 , 2013 and entitled fuselage indexing system and method ( attorney docket no . ecsc - 1 - 1026 ), which is hereby incorporated herein by reference . referring to fig8 , as noted above , the wings 14 may be supported by means of cradles 20 as described herein . as also noted above , the cradles 20 may not provide significant resistance to longitudinal movement of the blade 20 . accordingly , the wing spar 120 may be fastened to a storage container by means of a spar retention system 130 . the spar retention system 130 may be understood with respect to a longitudinal direction 132 that is substantially parallel to the longitudinal axis of the wing 14 used with the spar retention system 130 . a vertical direction 32 may be defined as substantially parallel to a line parallel to a line normal to a surface on which the spar retention system 130 is resting . the spar retention system 130 may include a lock down clamp 134 and a post 136 . the lock down clamp 134 may be any lock down clamp 134 known in the art . as known in the art , a lock down clamp 134 has an open position and a closed position . the lock down clamp 134 provides a determined amount of travel between the open and closed position and may be adjustable as to travel and clamping force in the closed position . the post 136 is coupled to the lock down clamp 134 , such as by means of a fastener 138 . the post 136 is translated upward when the clamp 134 is moved from the closed to the open position and translated downward when the clamp 134 is moved from the open to the closed position . a stop 140 may be selectively secured to the post 136 . for example , the stop 140 may define a slot 142 sized to receive a distal portion of the post 136 . the post 136 may define a distal portion that is wider than the slot 142 to hinder removal of the stop 140 . for example , in the illustrated embodiment , a washer 144 or other structure secures to a distal end of the post 136 , such as by means of a fastener 146 , e . g . screw . in some embodiments , the stop 140 includes a seat , e . g . countersink , sized to receive the washer 144 or other widening structure . inasmuch as the stop 140 is removable from the post , the stop 140 may include an aperture 150 or other structure for receiving a lanyard ( not shown ). the lanyard may be anchored to an anchor 152 secured to a base 154 . the base 154 may support a wing spar 120 secured using the spar retention system 130 . the base 154 may define a rigid and substantially planar surface or have a contour corresponding to a contour of a wing spar 120 . for example , the base 154 may be embodied as an aluminum plate . the base 156 may be interposed between the stop 140 and the clamp 134 . the base 156 may define an aperture 156 through which the post 136 passes . in some embodiments , a cushioning member 158 secures to an upper surface of the plate 154 , e . g . opposite the clamp 134 and facing the stop 140 . the cushioning member 158 may define an aperture 160 through which the post 136 passes . the cushioning member 158 may be include a flexible polymer such as polyurethane or the like . the cushioning member 158 may have a modulus of elasticity such that the cushioning member 158 deforms in response to clamping force exerted by the clamp 134 on the stop 140 . for example , the cushioning member 158 may have a module of elasticity of between 0 . 001 and 1 gpa and , preferably between 0 . 01 and 0 . 1 gpa . in some embodiments , the stop 130 may also have a modulus of elasticity within either of these ranges and may include the same or different material and have the same or different modulus of elasticity as the cushioning member 158 . a die spring 162 may encircle the post 136 . the die spring 162 may be compressed by the stop 140 when the clamp 134 is in the closed position . as a result of the compression , the die spring 162 may also expand outwardly from the post 136 . in some embodiments , the cushioning member 158 may define a seat 164 , e . g . counterbore , that has a diameter that is larger than an undeformed diameter of the die spring 162 . the seat 164 may receive a bushing or other structure secured to a wing spar 120 used in combination with the spar retention system 130 . in some embodiments , the aperture 160 defined by the cushioning member 158 is slightly smaller ( e . g . between 5 and 10 % smaller ) than an undeformed diameter of the die spring 162 passing there through . in this manner , the cushioning member 158 may hinder movement of the die spring 162 when the post 136 is moved upward and downward . in some embodiments , the spar retention system 130 may be mounted to a container or other storage facility directly or by means of one or more intervening members . for example , the spar retention system 130 may mount to a beam 166 that secures to a container or secures to some other member mounted to the container . referring to fig9 and 10 , in use the stop 140 may be removed from the post 136 as shown by the dotted representation 168 . removing the post 136 may be accomplished by sliding the post 136 out of the slot 142 . where the stop 140 includes a seat 148 , the stop 140 may be slid downwardly to disengage the washer 144 from the seat 148 prior to sliding the post 136 out of the slot 142 . in preparation for placement of the wing spar 120 , the clamp 134 may be placed at or near the open position such that the top of the post 136 is elevated above the base 154 and cushioning member 158 is not compressed and therefore small enough to insert through the wing spar 120 . referring specifically to fig1 , with the stop 140 removed , a wing spar 120 may be positioned over the post 136 and die spring 162 . for example , the wing spar 120 may define an aperture 170 and in the open position of the clamp 134 , the uncompressed ( or less compressed due to an open position of the clamp 134 ) die spring 162 may be sized to fit through the aperture 170 as is the washer 144 . the stop 140 may be placed in the position shown having the washer 144 in the seat 148 as shown in fig8 by sliding the post 136 into the slot 142 . the clamp may then be moved to the closed position as shown in fig1 . in the closed position , the die spring 162 may be deformed such that it presses against the aperture 170 and if unconstrained by the aperture 170 would be larger than the aperture 170 . in some applications , the aperture 170 is tapered or has some shape other than cylindrical . the deformation of the die spring 162 may accommodate this geometry by expanding to at least partially fill part of the aperture 170 and thereby hinder movement of the wing spar 120 . the resilience of the cushioning member 158 and the stop 140 may result in deformation of these members due to the clamping force of the clamp 134 thereby reducing any scratching or denting of the wing spar 120 and providing additional grip on the wing spar 120 . fig1 illustrates an example use for the spar retention system 130 . as illustrated the beams 166 form part of a frame 172 that is mounted to a container . in some embodiments , the frame 172 may include structures for retaining or supporting other parts of the uav 10 . for example , the frame 172 may include tail plane supports 174 that are angled or otherwise positioned to support the tail planes 18 of the uav . the tail plane supports 174 may include cushioning surface made having some or all of the properties of other cushioning materials described herein . also shown in fig1 is a lanyard coupled to the stop 140 , such as by means of the aperture 150 . the lanyard may also be connected to some other portion of the frame 172 or spar retention system 130 , such as the anchor 152 ( fig8 ). referring to fig1 , the cradles 20 as disclosed herein above may be used in the storing and shipping of a uav 10 . for example , a container 178 may store a disassembled uav 10 . in such embodiments , a plurality of cradles 20 may secure to the container 178 either directly or indirectly by means of a fixture or frame member . the wing 14 mounts within the cradles 20 as described herein and is thereby retained against movement during shipping . in some embodiments , the cushioning members 40 , 48 , 70 may be configured relative to the end plates 38 , 46 , 68 such that the wing will not contact the plates 38 , 46 , 68 in response to deflection of the cushioning members 40 , 48 , 70 due to expected acceleration of the container 110 . the remainder of the uav 10 may also secure within the container 178 , including the fuselage 12 . as noted above , the fuselage 14 may have a fastening system 124 and indexing members 22 secured thereto as described u . s . application ser . no . 13 / 974 , 350 filed aug . 23 , 2013 and entitled fuselage indexing system and method ( attorney docket no . ecsc - 1 - 1026 ), which is hereby incorporated herein by reference . the container 178 may further have receivers 180 for engaging the indexing members 122 and a corresponding frame 182 mounting the receivers to the container 178 as described in u . s . application ser . no . 13 / 974 , 350 filed aug . 23 , 2013 and entitled fuselage indexing system and method , which is hereby incorporated herein by reference . the container 178 may be a container as described in u . s . application ser . no . 13 / 974 , 322 filed aug . 23 , 2013 and entitled closure system for containers , which is hereby incorporated herein by reference . the spar 120 of the wing 14 may be further restrained by means of the spar retention system 130 as described hereinabove . in this manner , movement of the wing 14 transverse to the longitudinal axis thereof may be restrained by means of the cradles 14 and movement along the longitudinal axis may be restrained by the spar retention system 130 . while the preferred embodiment of the invention has been illustrated and described , as noted above , many changes can be made without departing from the spirit and scope of the invention . for example , although the cradle described herein is shown being used for a wing of a fixed wing aircraft , the cradle may also be used for wings of a rotary wing aircraft , windmill blades , or other long and / or delicate structures . accordingly , the scope of the invention is not limited by the disclosure of the preferred embodiment . instead , the invention should be determined entirely by reference to the claims that follow . | 1 |
fig1 shows a high level block diagram of the overall physical architecture for an example systems engineering model data distribution and communications network arrangement . an information distribution network arrangement of this sort , indicated generally by numeral 100 , conventionally comprises a number of independent and geographically distributed interconnected computer systems or network servers . typically , as might be needed by a public utility company or an electrical power transmission / distribution company or other large company having geographically distributed facilities , an information distribution network of this sort might include , for example , at least some sort of engineering model data publisher or source , such as a geographical information system ( gis ) 101 , and have one or more engineering model data consumers or distributers , such as distribution management system ( dms ) 102 and / or other enterprise management server ( ems ) 103 . a non - limiting hardware arrangement of such an example information distribution network , as generally illustrated in fig1 , may also include a model exchange platform or model manager system / assembly ( mep ) comprising one or more core servers for efficiently managing the notification , distribution and exchange of , among other things , systems engineering model data and notifications between entities across the network at numeral 104 . preferably , the mep includes at least one server on which the non - limiting illustrative example method and program product for phase connectivity evaluation and validation disclosed herein below is implemented . one non - limiting example conventional hardware implementation of the mep would comprise a pair of servers each having , for example , a 2 . 66 ghz quadcore processor , 20 gb or more of ecc sram with 4 × 146 gb of internal hard disk space , raid controllers and redundant network cards and power supplies ( conventional hardware configuration not illustrated herein ). an example information distribution network for a utility or power transmission / distribution company , such as illustrated in fig1 , might also include other computing and communication handling elements or servers such as an mep bridge extension server 105 for traversing external security zones , a thin client mep user interface ( u 1 ) computer 106 and connections to one or more other ems 103 . in fig2 , a functional block diagram illustrates a non - limiting illustrative example conceptual architecture for a model manager / exchange platform ( mep ) as employed in the information distribution and management system of fig1 . in this particular non - limiting example , the mep server core 104 ( fig1 ) is contemplated as providing a variety of information handling and distribution services including user interface services , model update handling , model and profile validation services , model meta - data management services , model version management and repository services , notification management , open profile repository services , security certificate management , email and sms text user notification services and , in addition , provides database storage and integration adapters for gis . dms and ems systems , as indicated by the respective functional blocks shown in fig2 . in particular , a network model and profile validation service , generally indicated at functional block 201 , is contemplated to provide specific checking , verification and validation of engineering models , design specification profiles and the like that are distributed or exchanged between various authoring and end - user entities connected to the network . the model / profile validation service functions 201 provided by the mep is just one example of a contemplated environment for implementing the non - limiting illustrative example method and program product for circuit component phase connectivity evaluation and validation disclosed herein below . fig3 shows a non - limiting illustrative example process flow diagram for a model data and information synchronization process which may be implemented by a model manager system such as mep 104 of fig1 . in general , a publishing entity 301 produces an initial or incremental data information load , for example , in the form of a conventional cim - xml file , gml file or both . in the example of a cim file , the data may be assembled using cim - xml formatting which is a commonly known protocol conventionally used for sending cim messages on top of http . the file is provided to the mep and the engineering / circuit model specification information contained therein may be read out as strings of xml data . a system integration adapter 302 detects the profile of the specific file type / system and adds metadata to the published message / information / model indicating the profile type . a model normalization adapter 303 then determines if the information is of a specific type , e . g ., an initial load , an incremental update of either cim , gml or both . next , a series of services represented by model profile and validation services block 304 performs various checks of the distributed information and engineering model data including performing both phase connectivity evaluations and validating component connections of circuit models . a model validation service process , such as the example process indicated at functional block 304 , embodies the non - limiting illustrative example process for circuit component phase connectivity evaluation and validation disclosed herein below . next , as illustrated in block 305 , a model metadata management services process gets metadata associated with the incoming transaction and stores the information in a database ( not shown ). the information may be versioned by a version management service 306 and notifications concerning the transaction are sent out by a notification management service 307 . a model update handler 308 sends the information to an open profile repository and also sends a proper profiled response to an end user / subscriber 310 . acceptance or rejection of network changes by the distribution management system ( dms ) results in notification to all subscribing systems of an accepted change or rejection message . accordingly , engineering model changes / updates among other information , may be efficiently managed , versioned , archived , distributed and timely made available to appropriate users / subscribers of such information , such as , in the case of a power distribution company , grid operators , field engineers , service technicians and the like . in a non - limiting example implementation of the phase connectivity evaluation and validation process disclosed herein , different binary bit mask values are assigned for each of the different enumerated phase connectivity types possible at a connection node of a conducting component in a circuit model . in this non - limiting example , there are sixteen different possible phase connectivity types which are enumerated as indicated in table 1 below . alternatively , as shown in table 1 , each phase connectivity type may be identified by a decimal integer value . as also illustrated in table 1 , each possible phase connectivity type for a conducting component in a circuit model is uniquely enumerated and each enumeration is assigned a corresponding unique four bit binary mask number . effectively , the bit mask arrangements of table 1 are based upon the assignment of a separate binary bit location to each of the three different possible types of ac electrical phase present in a circuit , enumerated here as a , b and c , as well as one bit location assigned for neutral or ground , enumerated here as n , thus enabling a unique binary mask representation for all of the possible different phase connectivity types of components . for example : referring now to fig4 a , a block diagram is used to generally illustrate an example pair of conducting electrical components / devices and their respective connection node phase connectivity designations as may be specified by component parameter data for a particular circuit model provided , for example , in a cim - xml file . in this first example , a pair of connected components 401 and 402 of a particular circuit is specified by the circuit model parameter data as having respective associated connection nodes 403 and 404 of different phase connectivity characteristics . more specifically , for this example , component 401 is specified as having a connection node 403 designated as an ‘ abn ’ phase connectivity type and that component 401 is connected to component 402 which is specified as having a connection node 404 designated as an ‘ an ’ phase connectivity type . consequently , in order to validate this connection between components 401 and 402 , the connection of node 403 to node 404 must first be evaluated to determine if the connection between an ‘ abn ’ phase connectivity type component and an ‘ an ’ phase connectivity type component is a compatible / permissible connection . next in fig4 b , a functional block diagram is shown which effectively illustrates the basic phase connectivity evaluation and validation process used for evaluating the connection between components 401 and 402 via their respective connection nodes 403 and 404 . at the outset , a unique binary phase - type connectivity mask value is assigned to each of the different possible electrical phase connection types , for example , as enumerated in table 1 . in this example , component 401 has a phase connectivity type of “ abn ” and has an assigned a bit mask value of “ 1101 ” ( block 406 ). similarly , a second component 402 has a phase connectivity type of “ an ” and has an assigned a bit mask value of “ 1001 ” ( block 407 ). as illustrated , a bit - wise logical “ and ” operation is performed between the two respective phase connectivity bit mask values . if the logical operation result matches the bit mask value of either connection node 403 or connection 404 , then the two connection nodes are deemed to be of compatible phase connectivity and the connection between the two nodes is given a passing validation . conversely , if neither comparison results in a match , then the phase connectivity between the two nodes is considered as not being electrically connectable . in this example , the logical operation result , in this case “ 1001 ”, does not match the bit mask value “ 1101 ” for the “ abn ” type component node ( block 406 ), however , it does match the bit mask value “ 1001 ” for the “ an ” type component node ( block 407 ). consequently , the connection between the two nodes is given a “ passed ” validation ( block 408 ) in this case . in fig5 a , a second example pair of conducting electrical components / devices is illustrated along with their respective connection node phase connectivity designations . in this second example , a pair of connected components 501 and 502 of a particular circuit is specified by the circuit model parameter data as having respective associated connection nodes 503 and 504 of different phase connectivity characteristics . specifically , in this second example , component 501 is specified as having a connection node 503 designated as an ‘ abn ’ phase connectivity type and that component 501 is connected to component 502 which is specified as having a connection node 504 designated as an ‘ cn ’ phase connectivity type . consequently , in order to validate this connection between components 501 and 502 , the connection of node 503 to node 504 must first be evaluated to determine if the connection between an ‘ abn ’ phase connectivity type component and a ‘ cn ’ phase connectivity type component is a compatible / permissible connection . next in fig5 b , a functional block diagram is shown which effectively illustrates the basic phase connectivity evaluation and validation process used for evaluating the connection between components 501 and 502 via their respective connection nodes 503 and 504 . in this second example , a component 501 has a phase connectivity type of “ abn ” and is assigned ( from table 1 ) a bit mask value of “ 1101 ” ( block 506 ). a second component 502 has a phase connectivity type of “ cn ” and is assigned ( from table 1 ) a bit mask value of “ 1001 ” ( block 507 ). as illustrated , a bit - wise logical “ and ” operation is performed between the two respective phase connectivity bit mask values . if the logical operation result matches either bit mask value , then the two connection nodes are deemed to be of compatible phase connectivity and the connection between the two nodes is given a passing validation . conversely , if neither comparison results in a match , then the phase connectivity between the two nodes is considered as not being electrically connectable . in this example , since the logical operation result , in this case “ 0001 ”, does not match either the bit mask value “ 1101 ” for the “ abn ” type component node ( block 506 ) or the bit mask value “ 0011 ” for the “ abn ” type component node ( block 507 ), the connection between the two nodes is given a “ failed ” validation ( block 508 ). consequently , in this case , a “ failed ” validation error notice or message may need to be generated referencing that particular circuit connection . referring now to fig6 , a process flow diagram illustrates a set of non - limiting example processing operations which may be executed by a digital computer / processor or network server of an mep / model manager system to provide fast and efficient circuit model component connection evaluation and validation . initially , as indicated at blocks 601 and 602 , a cim - xml file containing circuit specifications / model data is received over the communications network by an mep / model manager system from an authoring producer / source ( not shown ) and appropriate circuit information , such as constituent component and connection node object specifications , is parsed into strings of xml data . at block 603 , each of the different phase connectivity types possible in a circuit model are given different enumerations and assigned specific corresponding binary bit masks ( e . g ., see table 1 above ). at blocks 604 through 609 , comparison operations are performed on xml data strings for connection node data objects of the circuit components to label each connection node with the appropriate phase connectivity type enumeration and assign to it the associated bit mask . for example , at decision block 604 , a connection node data xml string indicating the phase connectivity type of a particular node is examined to determine if it is of the phase type “ a ”. if so , a connection node data object is created , labeled as a type “ a ” phase connectivity node , assigned the associated binary bit mask of “ 1000 ” and saved , as indicated at block 605 . if it is determined that the xml string data is not the “ a ” phase connectivity type , then it is next examined to determine if it is of a second type . for example , at decision block 606 , the phase indicative xml data string for the node is next examined to determine if it is of the phase type “ b ”. if this turns out to be true , a connection node data object is created and labeled as a type “ b ” phase connectivity node and assigned the associated binary bit mask of “ 0100 ” and that information is saved , as indicated at block 607 . if it turns out that the xml string data is not a “ b ” phase connectivity type , the data string is next examined to determine if it is of yet a another phase type , and so on . as indicated by the flow diagram ellipsis leading from block 606 to block 608 and block 609 , this phase type determination and bit mask assignment process continues until the particular connection node xml data string has been identified as one of the possible different phase connectivity types and is assigned the appropriate associated bit mask as indicated in table 1 . after this process is finished for one connection node , xml data string from the cim - xml file for a particular circuit model are parsed is parsed for another connection node data object and the above processing repeats until all connection node data objects in the cim - xml file have been parsed , as indicated by blocks 610 and 611 . next , once all of the connectivity node data objects for a particular circuit model are parsed , pairs of connected component are selected , as indicated at block 612 , and operations for evaluation and validation of connected component pairs begins . as indicated at block 613 , assigned phase connectivity bit masks for a first pair of connected components are first retrieved and then a logical ‘ and ’ operation is performed between the two bit mask values . next , as indicated at block 614 , the result of the logical ‘ and ’ operation between the two bit mask values is separately compared against the individual bit mask for each component of the pair . if , as determined in block 615 , the result of either comparison is true ( i . e ., the binary value of the logical ‘ and ’ result and the binary value of either bit mask are a match ), then the phase validation is indicated as good ( block 617 ), however , if the result of the comparison does not yield at least one matching value , then the phase validation is considered as bad ( block 616 ). as indicated at block 618 , the operations for evaluating and validating connected component pairs described in blocks 612 through 617 is repeated for each pair of connected components of the circuit model until all connections of the circuit model are evaluated . as indicated at block 619 , the evaluation / validation results , including “ passed validation ” or “ failed validation ” notifications or messages for particular circuit connections , may then be stored and / or delivered via the network to interested user / subscribers . as described above , an implementation of the method disclosed herein may be in the form of computer - implemented process and / or program product for practicing those processes . an implementation may also be practiced or embodied in the form of computer program code containing instructions embodied in tangible media , such as floppy diskettes , cd roms , hard drives , or any other computer - readable storage medium , wherein when the computer program code is read and executed by a computer , the computer becomes an apparatus for practicing the disclosed process or method . an implementation may also be embodied in the form of computer program code , for example , whether stored in a storage medium , loaded into and / or executed by a computer , or transmitted over some transmission medium , such as over electrical wiring or cabling , through fiber optics , or via electromagnetic radiation , wherein when the computer program code is read and / or executed by a computer , the computer becomes an apparatus for practicing the disclosed process or method . when implemented on a general - purpose programmable microprocessor or computer , the computer program code configures the programmable microprocessor or computer to create specific logic circuits ( i . e ., programmed logic circuitry ). while disclosed method and apparatus is described with reference to one or more exemplary embodiments , it will be understood by those skilled in the art that various changes may be made and equivalence may be substituted for elements thereof without departing from the scope of the claims . in addition , many modifications may be made to the teachings herein to adapt to a particular situation without departing from the scope thereof . therefore , it is intended that the claims not be limited to the specific embodiments disclosed , but rather include all embodiments falling within the scope of the intended claims . moreover , the use of the terms first , second , etc . and indicia such as ( i ), ( ii ), etc . or ( a ), ( b ), ( c ) etc . within a claim does not denote any order of importance , but rather such terms are used solely to distinguish one claim element from another . the above written description uses various examples to disclose exemplary implementations of the invention , including the best mode , and also to enable any person skilled in the art to practice the invention , including making and using any devices or systems and performing any incorporated methods . the patentable scope of the invention is defined by the claims which follow , and may include other examples that occur to those skilled in the art . while an exemplary implementation has been described herein in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the claimed invention is not to be limited to the disclosed example embodiments , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . | 6 |
a general principle of the invention is illustrated by referring to fig1 . nav of mutual fund shares is typically calculated at 4 : 00 p . m . eastern time ( et ), i . e ., at the close of the u . s . financial markets ( including the nyse , ase , and nasdaq markets ). this is well after many , if not most , foreign markets already have closed . thus , events , news and other information observed between the close of the foreign market and 4 : 00 p . m . et may have an effect on the opening price of foreign securities on the next business day ( and thus is likely also to have an effect on the next day &# 39 ; s closing price ), that is not reflected in the calculated nav based on the current day &# 39 ; s closing price . fig1 illustrates an example of the opportunity for trading profit . stock bsy ( british sky broadcasting plc ) is traded on the london stock exchange ( lse ). on may 16 , 2001 , the stock closed at 767 pence at 11 : 30 a . m . et . after the lse &# 39 ; s close , the us stock market had a significant increase — between 11 : 30 a . m . and 4 p . m . et , the s & amp ; p 500 index had risen by 1 . 6 %. as seen from the chart , during the time that both the lse and the u . s . stock exchanges were open , the price of bsy had a high correlation with the s & amp ; p 500 index . the closing price of bsy obviously did not reflect the increase of the u . s . market between 11 : 30 a . m . and 4 : 00 p . m . et . but bsy &# 39 ; s next day opening price increased by 1 . 56 % ( to 779 pence ) due mostly to the u . s . market rise the previous day . an obvious arbitrage strategy would have suggested buying a mutual fund that included stock bsy on may 16 , with the fund &# 39 ; s nav based on bsy &# 39 ; s closing price of 767 , and then selling it on the next day . this is a very efficient and low - risk strategy , since most likely bsy &# 39 ; s closing price for may 17 would have been higher as a result of the higher opening price . to exclude the possibility of such an arbitrage , bsy &# 39 ; s closing price for may 16 could be adjusted to a “ fair ” price based on a fair value model ( fvm ). because there is no direct observation of the fair value price of a foreign stock at 4 p . m . et , the next day opening price is commonly used as a proxy for a “ fair value ” price . such a proxy is not a perfect one , however , since there is a possibility of events occurring between 4 p . m . et and the opening of a foreign market , which may change stock valuations . however , there is no reason to believe that the next day opening price proxy introduces any systematic positive or negative bias . the goal of fvm research is to identify the most informative factors and the most efficient framework to estimate fair prices . the goal assumes also a selection of criteria to facilitate the factor selection process . in other words , it needs to be determined whether factor x needs to be included in the model while factor y doesn &# 39 ; t add any useful information , or why framework a is more efficient than framework b . unlike a typical optimization problem , there is no single criterion for the fair value pricing problem . several different statistics reflect different requirements for fvm performance and none of them can be seen as the most important one . therefore a decision on selection of a set of factors and a framework should be made when all or most of the statistics clearly suggest changes in the model when compared with historical data . all the criteria or statistics are considered below . there are many factors which can be used in fvm : the u . s . intra - day market and sector returns , currency valuations , various types of derivatives — adrs ( american depository receipts ), etfs ( exchange traded funds ), futures , etc . the following general principles are used to select factors for the fvm : economic logic — factors must be intuitive and interpretable ; the factors must make a significant contribution to the model &# 39 ; s in - sample ( i . e ., historical ) performance ; the factors must provide good out - of - sample or back - testing performance . it must be understood that good in - sample performance of factors does not guarantee a good model performance in actual applications . the main purpose of the model is to provide accurate forecasts of fair value prices or their proxies — next day opening prices . therefore , only factors that have a persistent effect on the overnight return can be useful . one school of thought holds that the more factors that are included in the model , the more powerful the model will be . this is only partly true . the model &# 39 ; s in - sample fit may be better by including more parameters in the model , but this does not guarantee a stable out - of - sample performance , which should be the most important criterion in developing the model . throwing too many factors into the model ( the so - called “ kitchen sink ” approach ) often just introduces more noise , rather than useful information . r i is the overnight return for stock i in a foreign market , which is defined as the percentage change between the price at the foreign market close and that market &# 39 ; s price at the open on the next day ; m is the snapshot u . s . market return between the closing of a foreign market and the u . s . closing using the market capitalization - weighted return based on russell 1000 stocks as a proxy ; s j is the snapshot excess return of the j - th u . s . sector over the market return , where the return is measured between the closing of a foreign market and the u . s . closing , again using the russell 1000 sector membership as a proxy , where sector is selected appropriately ; ε represents price fluctuations . in developing an optimized fair value model , the following statistics should be considered . these statistics measure the accuracy of a fair value model in forecasting overnight returns of foreign stocks by measuring the results obtained by the fair value model using historical data with a benchmark . average arbitrage profit ( arb ) measures the profit that a short - term trader would realize by buying and selling a fund with international holdings based on positive information observed after the foreign market close . thus , when a fund with international holdings computes its net asset value ( nav ) using stale prices , short - term traders have an arbitrage opportunity . to take advantage of information flow after the foreign market close , such as a large positive u . s . market move , the arbitrage trader would take a long overnight position in the fund so that on the next day , when the foreign market moves upwards , the trader would sell his position to realize the overnight gain . however , once a fair value model is utilized to calculate nav , any profit realized by taking an overnight long position represents a discrepancy between the actual overnight gain and the calculated fair value gain . a correctly constructed fair value model should significantly minimize such arbitrage opportunities as measured by the out - of - sample performance measure as arbitrage profit with fvm ( arb ) = 1 t ∑ m ≥ 0 ( q t - q ^ t ) + 1 t ∑ m & lt ; 0 ( q ^ t - q t ) , ( 1 ) arbitrage profit without fvm = 1 t ∑ m ≥ 0 q t - 1 t ∑ m & lt ; 0 q t , ( 2 ) where t is the number of out - of - sample periods , q t is the overnight return of an international fund at time t , and { circumflex over ( q )} t is the forecasted return by the fair value model . the above statistics provide average arbitrage profits over all the out - of - sample periods regardless of whether there has been a significant market move . a more informative approach is to examine the average arbitrage profits when the u . s . market moves significantly . without loss of generality , we define a market move as significant if it is greater in magnitude than half of the standard deviation of daily market return . arbitrage profit with fvm for large moves ( arbbig ) = 1 t lp ∑ m ≥ σ / 2 ( q t - q ^ t ) + 1 t lp ∑ m ≤ - σ / 2 ( q ^ t - q t ) , ( 3 ) arbitrage profit without fvm for large moves = 1 t lp ∑ m ≥ σ / 2 q t - 1 t lp ∑ m ≤ - σ / 2 q t , ( 4 ) where σ is the standard deviation of the snapshot u . s . market return and t lp is the number of large positive moves ( i . e . the number of times m ≧ σ / 2 ). the surviving observations cover approximately 60 % of the total number of trading days . the arbitrage profit statistics are calculated as follows : for any given stock and any given estimation window , run the regression and compute the forecasted overnight return ; compute the deviation of the realized overnight returns from the forecasted returns ; depending on the size of u . s . market moves , take the appropriate average of the deviation over a selected stock universe and over all estimation windows . it is to be noted that the arbitrage profit statistic is potentially misleading . this happens when the fair value model over - predicts the magnitude of the overnight return , and thus reduces the arbitrage profit because such over - prediction would result in a negative return on an arbitrage trade . for this reason , use of arbitrage profit does not lead to a good fair value model because the fair value model should be constructed to reflect as accurately as possible the effect of observe information on asset value rather than to reduce arbitrage profit . mean absolute error ( mae ). while mutual funds are very concerned with reducing arbitrage opportunities , the sec is just as concerned with fair value issues that have a negative impact on the overnight return of a fund with foreign equities . this information is useless to the arbitrageur because one cannot sell short a mutual fund . nonetheless , evaluation of a fair value model must consider all circumstances in which the last available market price does not represent a fair price in light of currently available information . mae measures the average absolute discrepancy between forecasted and realized overnight returns : for any given stock and any given estimation window , run the regression and compute the forecasted overnight return ; compute the absolute deviation between the realized and the forecasted overnight returns ; take an average of the absolute deviation over a selected universe and over all estimation windows . time - series out - of - sample correlation between forecasted and realized returns ( cor ) measures whether the forecasted return of a given stock varies closely related to the variation of the realized return . it can be computed as follows : for any given stock and any given estimation window , run the regression and compute the forecasted overnight return and obtain the actual realized return ; keep the estimation window rolling to obtain a series of forecasted returns and a series of realized returns for this stock and compute the correlation between the two series ; take an average over a selected stock universe . hit ratio ( hit ) measures the percentage of instances that the forecasted return is correct in terms of price change direction : for any given stock and any given estimation window , run the regression and compute the forecasted overnight return ; define a dummy variable , which is equal to one if the realized and the forecasted overnight returns have the same sign ( i . e ., either positive or negative ) and equal to zero otherwise ; take an average of the defined dummy variable over a selected stock universe and over all estimation windows . similar to how arbbig is defined above , it is more useful to calculate the statistics only for large moves . values of hit in the tables in the appendix below are calculated for all observations . the methodology for obtaining an optimized fair value model are now described . the overnight returns of foreign stocks are computed using bloomberg pricing data . the returns are adjusted if necessary for any post - pricing corporate actions taken . the fvm universe covers 41 countries with the most liquid markets ( see all the coverage details in appendix 1 ), and assumes bloomberg sector classification including the following 10 economic sectors : basic materials , communications , consumer cyclical , consumer non - cyclical , diversified , energy , financial , industrial , technology and utilities . since all considered frameworks are based on overnight returns , it is important to determine if overnight returns behave differently for consecutive trading days versus non - consecutive days . such different behavior may reflect a correlation between length of time period from previous trading day closing and next trading day opening and corresponding volatility . if such difference can been established , a fair value model would have to model these two cases differently . to address this issue , the average absolute value of the overnight returns for any given day was used as the measure of overnight volatility and information content . the analysis , however , demonstrated that there is no significant difference between the overnight volatility of consecutive trading days and non - consecutive trading days for all countries ( see results of the study in appendix 2 ). these results are consistent with several studies , which demonstrate that volatility of stock returns is much lower during non - trading hours . the following regression models are examples of possible constructions of a fair value model according to the invention . in the following equations , the return of a particular stock is fitted to historical data over a selected time period by calculating coefficients β , which represent the influence of u . s . market return or u . s . sector return on the overnight return of the particular foreign stock . the factor ε is included to compensate for price fluctuations . model 1 assumes that the overnight return is determined by the u . s . snapshot market return m and the respective snapshot sector return s j . model 2 is similar to capital asset pricing model ( capm ) and is a restricted version of model 1 . fig2 illustrates how regression of a stock &# 39 ; s overnight return on the u . s . snapshot return can be built . the observations were taken for australian stock wpl ( woodside petroleum ltd .) for the period between jan . 18 , 2001 and mar . 21 , 2002 . model 3 is based on the theory that the stock return is only affected by sector return . the term s j + m represents the sector return rather than the sector excess return . the sector can be selected based on various rules , as described below . it may be possible that a stock &# 39 ; s price reacts to market and sector changes as a function of the magnitude of the market return . intuitively , asset returns might exhibit higher correlation during extreme market turmoil ( so - called systemic risk ). such behavior can be modeled by the so - called switching regression model , which is a piece - wise linear model as a generalization of a benchmark linear model . taking model 1 as the benchmark model , a simple switching model is described as follows this model assumes the sensitivities of stock return r i to the market and the sector are β i m and β i s if the market change is less than the threshold c in magnitude . however , when the market fluctuates significantly , the sensitivities become β i m + δ i m and β i s + δ i s respectively . alternately , multiple thresholds can be specified , which would lead to more complicated model structures but not necessarily better out - of - sample performances . although this model specifies the stock return as a non - linear function of market and sector returns , if we define a “ dummy ” variable r i = β im m + δ im ( m * d )+ β is s i + δ is ( s i * d )+ ε i . standard tests to determine whether the sensitivities are different as a function of different magnitudes of market changes are t - statistics on the null hypotheses δ i m = 0 and δ i s = 0 . according to the invention , once a fair value regression model is constructed using one or more selected factors as described above , an estimation time window or period is selected over which the regression is to be run . historical overnight return data for each stock in the selected universe and corresponding u . s . market and sector snapshot return data are obtained from an available source , as is price fluctuation data for each stock in the selected universe . the corresponding β coefficients are then computed for each stock , and are stored in a data file . the stored coefficients are then used by fund managers in conjunction with the current day &# 39 ; s market and / or sector returns and price fluctuation factors to determine an overnight return for each foreign stock in the fund &# 39 ; s portfolio of assets , using the same fvm used to compute the coefficients . the calculated overnight returns are then used to adjust each stock &# 39 ; s closing price accordingly , in calculating the fund &# 39 ; s nav . fig3 is a flow diagram of a general process 300 for determining a fair value price of an international security according to one preferred embodiment of the invention . at step 302 , the stock universe ( such as the japanese stock market ) and the return factors as discussed above are selected . at step 304 , the overnight returns of the selected return factors are determined using historical data . at step 306 , the β coefficients are determined using time - series regression . at step 308 , the obtained β coefficients are stored in a data file . at step 310 , fair value pricing of each security in a particular mutual fund &# 39 ; s portfolio is calculated using the fair model constructed of the selected return factors , the stored coefficients , and the actual current values of the selected return factors , in order to obtain the projected overnight return of each security . the projected overnight return thus obtained is used to adjust the last closing price of each corresponding international security accordingly , so as to obtain the fair value price to be used in calculating the fund &# 39 ; s nav . fig4 shows a general purpose computer 420 that can be used to implement a method according to a preferred embodiment of the invention . the computer 420 includes a central processing unit ( cpu ) 422 , which communicates with a set of input / output ( i / o ) devices 424 over a bus 426 . the i / o devices 424 may include a keyboard , mouse , video monitor , printer , etc . the cpu 422 also communicates with a computer - readable storage medium ( e . g ., conventional volatile or non - volatile data storage devices ) 428 ( hereafter “ memory 428 ”) over the bus 426 . the interaction between a cpu 422 , i / o devices 424 , a bus 426 , and a memory 428 are well known in the art . memory 428 can include market and accounting data 430 , which includes data on stocks , such as stock prices , and data on corporations , such as book value . the memory 428 also stores software 438 . the software 438 may include a number of modules 440 for implementing the steps of process 300 . conventional programming techniques may be used to implement these modules . memory 428 can also store the data file ( s ) discussed above . the sector for models 1 , 2 , 4 can be selected by different rules described as follows . a ) sector determined by membership : the sector by membership usually does not change over time if there is no significant switch of business focus . b ) sector associated with largest r 2 : this best - fitting sector by r 2 changes over different estimation windows and depends on the specific sample . it usually provides higher in - sample fitting results by construction but not necessarily better out - of - sample performance . this approach is motivated by observing that the sector classification might not be adaptive to fully reflect the dynamics of a company &# 39 ; s changing business focus . c ) sector associated with the highest positive t - statistic : once again , this best - fitting sector changes over different estimation windows and depends on the specific sample . it has the same motivation as the prior sector selection approach . in addition , it is based on the prior belief that sector return usually has positive impact on the stock return . models 1 , 2 , 4 may use one of these types of selection rules ; in exhibits of appendix 3 they are referenced as 1b or 2c , indicating the sector selection method . to evaluate fair value model performance for different groups of stocks , all models defined above have been run , the market cap - weighted r 2 values were computed for different universes , and an average was taken over all estimation windows . each estimation window for each stock includes the most recent 80 trading days . the parameter selected after several statistical tests was chosen as the best value , representing a trade - off between having stable estimates and having estimates sensitive enough for the latest market trends . tables 3 . 1 , 3 . 2 , and 3 . 3 present the results using model 1 a , model 1 b , and model 1c . results on the other models suggest similar pattern and are not presented here . the results clearly suggest that all the models work better for large cap stocks than for small cap stocks . in addition , it can be observed that the r 2 values of model 1b are the highest by construction and the r 2 values of model 1a are the lowest . standard statistical testing has been implemented to examine whether switching regression provides a more accurate framework to model fair value price . one issue arising with the switching regression model is how to choose the threshold parameter . since it is known that the selection of the threshold does not change the testing results dramatically as long as there are enough observations on each side of the threshold , we chose the sample standard deviation as the threshold . therefore , approximately one - third of the observations are larger than the threshold in magnitude . appendix 4 presents the percentages of significant positive δ using model 2 as the benchmark . it shows that only a small percentage of stocks support a switching regression model . as mentioned above , back - testing performance is an important part of the model performance evaluation . all back - testing statistics presented below are computed across all the estimation windows and all stocks in a selected universe . the average across all stocks in a selected universe can be interpreted as the statistics of a market cap - weighted portfolio across the respective universe . appendix 7 contains all the results for selected countries representing different time zones with the most liquid markets , while appendices 5 and 6 contain selected statistics for comparison purposes . the out - of - sample performance was evaluated for all models containing a sector component and the pre - specified economic sector model performed the best . it is generally associated with the smallest mae , the highest hit ratio , and the largest correlation ( cor ). table 6 . 1 of appendix 6 presents the mae , hit , and cor statistics of models with pre - specified sectors for top 10 % stocks . it shows that model 2 performs the best . table 6 . 2 summarizes the arbitrage profit statistics of model 2 for top 10 % stocks in each of the countries . however , it is noted that all the models perform very well in terms of reducing arbitrage profit . table 6 . 2 of appendix 6 also shows that less arbitrage profit can be made by short - term traders for days with small market moves . consequently , fund managers may wish to use a fair value model only when the u . s . market moves dramatically . appendix 8 is included to demonstrate that the naïve model of simply applying the u . s . intra - day market returns to all foreign stocks closing prices does not reflect fair value prices as accurately as using regression - based models . the us exchange traded funds ( etf ) recently have played an increasingly important role on global stock markets . some etfs represent international markets , and since they may reflect a correlation between the us and international markets , it might expected that they may be efficiently used for fair value price calculations instead of ( or even in addition ) to the u . s . market return . in other words , one may consider the back - testing results , however , don &# 39 ; t indicate that model 2 ″ performs visibly better than model 2 . addition of etf return to model 2 in model 2 ′″ does not make a significant incremental improvement either . poor performance of etf - based factors can be explained by the fact that country - specific etfs are not sufficiently liquid . some etfs became very efficient and actively used investment instruments , but country - specific etfs are not that popular yet . for example , ewu ( etf for the united kingdom ) is traded about 50 times a day , ewq ( etf for france )— about 100 times a day , etc . the results of the tests for etfs are included in the appendix 9 . some very liquid international securities are represented by an adr in the u . s . market . accordingly , it may be expected that the u . s . adr market efficiently reflects the latest market changes in the international security valuations . therefore , for liquid adrs , the adr intra - day return may be a more efficient factor than the u . s . market intra - day return . this hypothesis was tested and some results on the most liquid adrs for the uk are included in appendix 10 . they suggest that for liquid securities adr return may be used instead of the u . s . market return in model 2 . as demonstrated above , it is reasonable to expect that different frameworks work differently for different securities . for example , as described above , for international securities represented in the u . s . market by adrs it is more efficient to use the adr &# 39 ; s return than the u . s . market return , since theoretically the adr market efficiently accounts for all specifics of the corresponding stock and its correlation to the u . s . market . some international securities such as foreign oil companies , for example , are expected to be very closely correlated with certain u . s . sector returns , while other international securities may represent businesses that are much less dependent on the u . s . economy . also , for markets which close long before the u . s . market opening , such as the japanese market , the fair value model may need to implement indices other than the u . s . market return in order to reflect information generated during the time between the close of the foreign market and the close of the u . s . market . such considerations suggest that the framework of the fair value model should be both stock - specific and market - specific . all appropriate models described above should be applied for each security and the selection should be based on statistical procedures . the fair value model according to the invention provides estimates on a daily basis , but discretion should be used by fund managers . for instance , if the fvm is used when u . s . intra - day market return is close to zero , adjustment factors are very small and overnight return of international securities reflect mostly stock - specific information . contrarily , high intra - day u . s . market returns establish an overriding direction for international stocks , such that stock - specific information under such circumstances is practically negligible , and the fvm &# 39 ; s performance is expected to be better . another approach is to focus on adjustment factors rather than the us market intra - day return and make decisions based on their absolute values . table 11 . 1 and 11 . 2 from appendix 11 provide results of such test for both approaches . the test was applied to the ftse 100 stock universe for the time period between april 15 and aug . 23 , 2002 . the results demonstrate that fvm is efficient if it is used for all values of returns or adjustment factors . the average was taken across top 10 % stocks by market cap . t - stats on the hypothesis that over - night volatilities for consecutive and non - table 11 . 3 ftse 100 ( no model ). arb mae equally weighted 0 . 00435 0 . 01098 mcap weighted 0 . 00542 0 . 0101 the invention having been thus described , it will be apparent to those skilled in the art that the same may be varied in many ways without departing from the spirit of the invention . any and all such modifications are intended to be encompassed within the scope of the following claims . | 6 |
referring to fig1 the method of making a conductive coated product is shown schematically . metal substrate material in roll form 10 is unwound in a web 12 which passes through an abrading station 15 which produces an abraded substrate 14 , a coating station 20 which adds a layer of uncured hydrogel material onto the abraded substrate 14 , and a curing station 25 which cures the hydrogel material . release liner material in roll form 30 is unwound in a web 32 and is joined with the web with cured coating 16 . the resulting laminate 40 is wound into a roll 42 . the roll 42 is placed into an oven 50 where it is heated to form a finished roll product 60 . the metal substrate material 10 is typically a thin foil of metal laminated on a polymeric backing material . a polyester backing material such as a polyester terephthalate film with a thin coating ( e . g . 0 . 001 inch ) of aluminum or tin on one side can be used . the metal substrate material 10 used is substantially free of rolling oil and other contaminants . the metal substrate material 10 extends as a web 12 to an abrading station 15 where the metal side of the web 12 is mildly abraded to provide a microscopically rough surface . the abrasions are preferably less than 25 μm apart and between about 2 μm and 10 μm in depth and more preferably , between about 2 μm and 20 μm apart and between about 3 μm and 6 μm apart . the abrasions are preferably aligned predominantly in the same direction as the direction of travel for the web 12 . referring now also to fig2 the abrasions can be produced by an abrasion wheel 70 such as an ultra fine silica carbide flap brush ( e . g . 3m company scotch - brite ® finishing flap brush grade ulf ). the metal substrate 12 is drawn between a backup roll 72 and the counter - rotating abrasion wheel 70 . it will be appreciated by those skilled in the art that the degree and uniformity of abrasion is controlled by the combination of the speed of the web 12 , the pressure applied between the abrasion wheel 70 and the backup roll 72 , and the rotational speed of the abrasion wheel 70 . in a preferred embodiment of the invention , the abraded substrate 14 is also cleaned to prevent stray particles from marring the appearance of the finished product 60 . cleaning can be accomplished , for example , by providing a housing 75 enclosing the abrasion wheel 70 and the abraded substrate 14 and attaching a vacuum source 77 to the housing 75 whereby particles released by the abrasion process can be swept away . in yet another method for cleaning a separate cleaning station 80 can be optionally employed in which a web 82 of paper or cloth is pressed against the abraded substrate 14 and moved in a direction opposite to the direction of movement of the abraded substrate 14 . although the abrasion station 15 is shown to be a part of a continuous production system , it has also been found that it is possible to abrade the metal substrate material 10 in a separate operation , store the abraded substrate for a desired period of time and then apply a coating to the pre - abraded material to make the product 60 without again abrading the substrate . the coating station 20 adds a layer of uncured hydrogel material to the abraded surface of the substrate 14 . the uncured hydrogel material is a mixture of 2 - acrylamido - 2 - methylpropanesulfonic acid ( amps ) or one of its salts , copolymers of the acid , copolymers of the salts of the acid and their various mixtures with water and / or an alcohol . such compositions are set forth more fully in u . s . pat . nos . 4 , 391 , 278 and 4 , 581 , 821 issued to cahalan et al . which are incorporated herein by reference . the compositions can include a variety of additives and modifiers including humectants such as glycerol or propylene glycol , thickeners such as polyvinylpyrrolidone or polyvinyl alcohol , monomers such as acrylic acid or acrylamide , crosslinking agents such as methylene - bis - acrylamide , fillers such as silica , ionizable metal salts such as potassium chloride or sodium chloride , ph modifiers such as sodium hydroxide , and various curing agents . a particularly useful curing agent for this process is hydroxycyclohexylphenylketone which can be added to the amps and other ingredients in a solution of isopropanol . it produces a cure of the hydrogel coating when it is exposed to ultraviolet light . the uncured hydrogel material can therefore be premixed and applied to the substrate by conventional coating equipment . preferably , the uncured hydrogel material is handled in an atmosphere that is dry and substantially free of oxygen . the curing station 25 provides the necessary conditions for the hydrogel coating on the abraded substrate 14 to cure . for example , heat or ultraviolet light can be applied depending on the curing agent used curing by application of ultraviolet light is preferred . after the hydrogel coating is cured , the release liner material in roll form 30 is unwound in a web 32 and is joined with the web with cured coating 16 . the resulting laminate 40 is wound into a roll 42 . if the material has been cured by application of ultraviolet light , the roll 42 then undergoes a heat treatment operation whereby it is placed into an oven 50 at a temperature of at least 45 ° c . and preferably in the range of about 50 °- 65 ° c . for at least 10 hours and preferably for more than 24 hours to make a finished product 60 . the time required to accomplish the heat treatment will , of course , depend upon the size of the roll 42 and its heat transfer characteristics . heat treatment could be accomplished in as little as one hour for a small sample . it will be appreciated by those skilled in the art that while the invention has been described above in connection with particular embodiments and examples , the invention is not necessarily so limited and that numerous other embodiments , examples , uses , modifications and departures from the embodiments , examples and uses may be made without departing from the inventive concepts . | 0 |
the standing wave simple math processor is a custom designed base 7 math system built to integrate into 3 standing waves running through a capacitance field . the standing wave ( sw ) is created by transmitting alternating current along a conduction line ( wire ) and then having it reflected upon itself . [ fig1 ] in perfect balance , a sw has no net propagation of energy . standing waves create rising and falling areas at the anti - nodes . utilizing these properties it is the intention to introduce imbalances at these anti - nodes . by having the sw travel through a dielectric it will be possible to to influence the anti - nodes . [ fig2 ] dielectrics are a component of capacitors , indeed the intention of this system is to make a sw inside a dielectric , which will allow a dc interaction with an ac wave . dc current interacting with an ac field is critical to the standing wave simple math processor . by introducing a dc current to the ac field at the anti - node the standing wave will become unstable . in normal conditions an unstable standing wave would deteriorate and lose its energy . by fixing , in this case , re - stabilizing the sw before the reflection point , the sw could be preserved . i propose using a dc source to add or remove dc charges at anti - nodes . dc added or removed at the anti - node would in effect be able to re - balance the sw . the inverse is also true that this method would be able to destabilize the sw as well . this in - out ( i / o ) method would be used to move dc charges to and from the anti - nodes . [ fig3 ] as i will illustrate in the next section these dc charges will represent elements of numerical digits and be instrumental to the processing of math in this system . for the purpose of number creation in this system a few elements need to be explained . in this system i will use base 7 . to express base 7 numbers i need to construct them from 3 anti - nodes , that is to say : any one base 7 digit is comprised of 3 consecutive anti - nodes . the first anti - node represents ‘ 1 ’ and the second ‘ 2 ’ and the third ‘ 3 ’. in this manner , if an anti - node has a dc charge present at the first and third anti - node the number it represents is ‘ 4 ’. see [ fig5 ] for a more complete illustration of digit composition . the minimum number of anti - nodes are dependant on the digit size of the desired math , and / or the physical length of the sw itself . therefore , these strings of anti - nodes will be referred to as anti - node lines ( al ). each al is itself a sw with an i / o at each of its anti - nodes . as will be explained shortly , the standing wave simple math processor requires at least 3 als to process math . al1 and al2 will function as inputs and al3 will function as the output . [ fig6 ] for sake of clarity , these dc charges will be referred to as electron units ( eu ). eus are the lowest possible unit of dc charge that can be used in this system . obviously , as technology gets better and these physical systems are improved upon the actual dc charge will get smaller and more efficient until the smallest possible unit would be 1 electron . for our concerns though the eu is rather arbitrary and is representative of the smallest possible unit of charge in this system . the critical element at this point then , is the relationship between digit values at the anti - nodes and the amount of eu present . at each anti - node in sequence , a corresponding eu must be present . that is in order to represent ‘ 2 ’ 2 eus must be present at that particular anti - node see [ fig7 ]. although it seems redundant to have the number of eus also represent the number itself it is wholly necessary for later stages . basic math requires both operator and operand . in this case the operand is the number defined by eus at the anti - nodes . the operator function is divided between lattice movement and valence movement . for the purposes of simplicity this specification will refer to the various positions of the al . see fig5 , and 6 again . it must be noted that these numbering conventions are completely relative and change to relate to the particular digit being processed . in brief this means that references to position number ( pos .) are accurate only when that digit is being processed . as this system is capable of dealing with any number of digits the position naming convention as supplied is only applicable as that particular digit is being examined . lattice movement in brief is the transfer of any eus along the input als to the output al . [ fig8 ] the lattice is simply an interconnection of al1 and al2 &# 39 ; s individual anti - nodes to al3 pos . 3 , allowing the transfer of eu charges to be deposited at that location . this transfer has a secondary effect of instantly balancing both al1 and al2 . this is done because any eu present on the al will put it into unbalance , therefore removing those eus will return the al into a ‘ 0 ’ charge state or ‘ balance ’. the benefits of this cannot be understated , as a necessary process both al 1 and al2 have achieved a balanced state even before final output is achieved . the second phase of the operator function is valence movement . valence movement , in essence , is a set of 4 logical rules for the redistribution of eus present at al3pos . 3 . after lattice movement has taken place , there is now a deposit of eus at al3pos . 3 this deposit is not necessarily compatible with the base 7 numbering system , as such it must be redistributed . redistribution , or valence movement , is governed by the number of eus present at al3pos . 3 in order from largest to least . this governing can be expressed as 4 logical rules dependent on order ; [ fig9 ] 1 ) if the number of eus at al3pos . 3 number 7 , then 6 eus will be recycled via i / o with the remaining 1 eu moved to the next digit up ( al3pos . 6 ). 2 ) if the number of eu at al3pos . 3 number 3 then that quantity will remain at al3pos . 3 . 3 ) if the number of eu at al3pos . 3 number 2 then that quantity will move entirely to al3pos . 2 . 4 ) if the number of eu at al3pos . 3 number 1 eu then that quantity will move to al3pos . 1 . of important note in this system is that the logical operations are magnitude dependant , as such all four rules must be followed sequentially as to ensure accurate redistribution . also of strict importance is which digit to process first . since these digits process math dependent upon the preceding digit , then logically the first digit to be processed must be the digit of least value . in other words , the operator function can only proceed when the digit represented ‘ beneath ’ it is already completed , or is ‘ 0 ’. in this manner then there is no limit to how many digits can be involved in the math operation , so long as the first digit to have the been processed is the digit of least value . to conclude then , this system uses 3 als to do math . al 1 and 2 are used to create the operands ( input ). al3 serves as the output . an i / o provides both the input of eu values as well as a recycling source for the re - balance of als . by using a lattice interconnection of all the input anti - nodes to al3pos . 3 , al1 and al2 now reach a state of balance after the initial unbalancing of eu input . the lattice movement results in a transfer of eu to a single point on the output sw ( al3 ). using the valence movement rules stated above , these eus can now be sorted into al3 for the purpose of output comprehension ( producing a final output solution ). please see [ fig1 ] for a comprehensive breakdown of this summary . | 6 |
a preferred embodiment of the invention is shown in fig1 to 7 . as fig5 shows , a feed conveyor 45 includes an endless chain 41 powered by a motor 40 to run at a constant speed on which are supported a multiplicity of attachments 42 in equispaced relation . a pair of frames 43 are disposed on both sides of the chain 41 , with a groove 44 formed between top surfaces of the frames 43 . the feed conveyor is adapted to slide an article 46 as pushed by each attachment 42 , within the groove 44 for transfer onto a conveyor 47 located therebehind as shown by the arrow . on both sides of the conveyor are provided a pair of side chains 48 which are each trained around two chain wheels 49 , 50 and a tension wheel 51 . as fig6 shows , the chains 48 are so arranged as to become downwardly inclined in the direction of transport of articles and respectively have a multiplicity of clampers 52 arranged thereon in equispaced relation . the clampers 52 are similar in construction to a known paper clip and are normally allowed to retain their clamping force by a spring force , but only while they are in contact with circular cams ( not shown ) provided on the shafts of the two chain wheels 49 , 50 , the clampers are opened so that they are relieved of their clamping force in order to catch the side edge of the film which is to be described hereinafter . as fig6 shows , a roll - form film 56 is placed on two rod - like rollers 52 , 55 mounted rotatably on a machine frame 53 . as the film is conducted by a roll 58 , powered for rotation by the motor 57 , into the space between the two chaines 48 via a direction changing roll 59 , the belt - like film 60 is obliquely downwardly transported under the rotation force of the chains 48 while being supported at opposite sides thereof by clampers 52 . tension rolls 51 are disposed midway on the chains 48 so that the spacing between the pair of chains 48 is locally enlarged at that location ; therefore , the film 60 is , in effect , placed over each article 46 on the conveyor in such a condition that it is tensioned both sideways . opposite side edges of the film 60 as released from clampers at the rear chain wheels 50 are drawn together toward a center line through the run of a pair of cord - like belts 61 arranged in a v - shaped fashion , being placed one over the other for being welded together in overlapping relation under a clamping force of a pair of heating rolls 62 . as a result , a large number of articles are enclosed in equispaced relation within a tubular film 63 . a pair of seal bars 65 , 66 travelling along an elliptic trajectory 64 as shown by arrow operate to weld the tubular film 63 between adjacent articles which are transported while being aided by side belts 67 for movement on their path of transport . in reality , such a packaging apparatus as described above is not particularly new and is taught in , for example , japanese patent application laid - open publication no . 60 - 183370 . as may be seen from fig5 and 6 , a pipe nozzle 10 is disposed within the tubular film 63 in such a way that its distal end is open adjacent the seal bar 65 . a connecting pipe 11 is connected to the pipe nozzle 10 at an underside open portion thereof adjacent front portions of the pair of cord - like belts 61 arranged in v - shape fashion . as fig3 shows , the pipe nozzle 10 is configured to be laterally flat , being of such a construction as to permit individual articles 46 to slide over the pipe nozzle 10 without any surplus space being produced within the tubular film 63 . as fig1 shows , a vacuum source 14 comprising a vacuum pump 12 and an ancillary tank 13 of a predetermined capacity is connected to the distal end of the connecting pipe 11 . the connecting pipe 11 is provided with a normally - closed type electromagnetic on - off valve 15 in parallel with which a bypass tube 16 is connected to the connecting pipe 11 . the bypass tube is provided with a flow control valve 17 . as fig4 shows , the connecting pipe 11 has a sectional passage area which is about three times as large as that of the pipe nozzle 10 shown in fig3 . the sectional passage area of the bypass tube 16 is substantially smaller than that of the pipe nozzle 10 . as operation of the packaging apparatus is stopped , a valve 19 is closed in response to a signal from a controller 20 . then , the degree of vacuum in the ancillary tank 13 rises as the sucking action of the vacuum pump 12 is still continued . when the valve 19 is opened upon start of operation of the packaging apparatus , a flow of air develops under a differential pressure within the connecting pipe 11 toward the ancillary tank 13 . normally , air flows in the bypass tube 16 at a flow rate regulated by a flow control valve 17 , and the pipe nozzle 10 sucks thereinto the air within the film . the amount of air in the tubular film changes according to the size of the article being packaged , and the flow control valve 17 is operated accordingly . movement of the film causes fresh air to flow successively into the tubular film , but the incoming air is sucked into the pipe nozzle 10 so that the interior of the tubular film is held under negative pressure in such a way that the friction between the pipe nozzle and the film is kept from becoming greater than necessary . the pair of seal bars 65 , 66 press the tubular film from opposite sides so as to cross seal the film and , immediately before the seal bars 65 , 66 move toward each other to press - hold the tubular film therebetween , the electromagnetic on - off valve 15 is opened for about 0 . 2 second upon a signal 18 from the controller 20 . while the valve is so open , an impulsive suction force acts on the pipe nozzle 10 under a vacuum energy accumulated in the ancillary tank 13 , so that the air in the film is momentarily evacuated from a clearance between the pair of seal bars 65 , 66 . immediately thereafter , the seal bars 65 , 66 press and seal that film portion . fig7 shows that inpulsive vacuum suction is effected immediately prior to the sealing action of the seal bars on the film . as may be seen from fig6 an encoder 22 is mounted to a motor 21 which drives the pair of seal bars 65 , 66 to move along the elliptic trajectory 64 , the encoder 22 serving the purposes of detecting the rotation angle of the shaft of the motor and of determining the timing for the pair of seal bars 65 , 66 contacting each other on a predetermined cycle . this encoder 22 and an encoder 23 connected to the motor 40 for driving the feed conveyor 45 rotate in proportional relation with each other . therefore , by connecting one of the encoders to the controller 20 shown in fig1 it is possible to control the electromagnetic on - off valve 15 in corresponding relation to the operation timing for the seal bars . in fig2 in place of such an encoder , a rotary cam 25 and a microswitch 20 are used to constitute a rotation angle detector . in particular , each time when a switch 26 is closed by a cam 25 which is rotated by a motor 21 which drives seal bars 65 , 66 , a timer 27 closes a switch 28 for about 0 . 2 second , and meanwhile the electromagnetic on - off valve 15 of the connecting pipe 11 is opened . in this way , air flowing successively into the tubular film 63 is eliminated by a bypass tube 16 having a smaller sectional passage area , so that a negative pressure is kept within the tubular film 63 in such a way that the friction between the tubular film 63 and the pipe nozzle 10 inserted therein may be kept from becoming greater than necessary . further , immediately before sealing is effected , the connecting pipe 11 which has a greater sectional area of passage is opened to momentarily eliminate air from the tubular film . therefore , it is possible to package articles under high vacuum with little or no stop of film run due to any friction between the pipe nozzle and the tubular film . in fig8 a motor 21 for driving seal bars 65 , 66 , a motor 40 for driving a feed conveyor 45 , and a motor 57 for film transport are respectively provided with encoders 22 , 23 and 24 for converting the number of revolution data on the motors into pulse signals . in response to pulse signals fed back from the encoders to a controller 20 , the controller 20 issues command signals 35 , 36 , 37 to the three motors 21 , 40 , 57 respectively , so that the motors 21 , 40 , 57 are always kept in their normal running speeds . a photoelectric switch 38 provided in a transit zone for articles 46 on the feed conveyor 45 is operative to send pitch data signals 39 successively for entry into the controller 20 , each pitch data signal 39 corresponding to the spacing between adjacent articles 46 passing a zone under the switch . in the process of such signalling , if articles 46 under transport lack one of them , for example , so that the spacing between adjacent articles is increased , two motors 21 and 57 are caused to stop running at abnormality signals 35 , 36 from the controller 20 , and accordingly movement of film 60 , as well as operation of seal bars 65 , 66 , is stopped until the conveyor 45 has made up for such disorder so that a succeeding article overtakes the preceding article . as earlier stated , there is always a flow of air in the bypass tube 16 ; therefore , when film movement is stopped , the interior of the tubular film becomes excessively vacuum . as such , when operation is restarted , considerable friction develops between the pipe nozzle 10 and the film , so that the film is prevented from advancing . therefore , it is arranged that simultaneously upon the film and seal bars 65 , 66 being brought to a halt , a second electromagnetic on - off valve 19 is closed at a signal 30 from the controller 20 , as shown in fig1 . upon the closure of the valve 19 , air naturally flows into the tubular film 63 ; but the controller 20 releases the first and second electromagnetic valves 15 , 19 somewhat earlier than usual . as a consequence , the air in the tubular film is sucked out instantaneously , so that cross sealing can be performed by the seal bars 65 , 66 which have resumed their operation , with any redundant air eliminated . the above described process of operation is shown by a flow chart in fig1 . instead of the above discussed manner of operation in which the on - off valves 15 , 19 are released somewhat earlier than the film and seal bars 65 , 66 are driven for movement again , for the purpose of restarting the tubular film 63 and seal bars 65 , 66 , the film 63 and seal bars 65 , 66 may be so controlled that they go into movement initially at a gradual speed and then at an accelerated speed . that is , the film 63 , once brought to a halt , is allowed to restart movement at a slow speed , whereby it is possible to make time for discharge of the air present therein . subsequently , movement is accelerated for making up for any delay involved . a flow chart for this mode of operation is shown in fig1 . in this way , the on - off valves 15 , 19 are released slightly earlier than usual , or the tubular film 63 , brought to a halt , is allowed to restart movement at a rather slow speed , which makes it possible to make time for discharge of the air which has flowed into the tubular film 63 while at a halt . therefore , when operation is resumed after a short supply of articles being found , for example , it is possible to prevent a first bag of article from being of insufficient vacuum . | 1 |
with reference now to fig1 an automated bond inspection system in accordance with the preferred embodiment of the present invention is schematically illustrated . a wire bonded semiconductor and lead frame assembly 10 is placed upon an electrically grounded supporting carrier or substrate 11 for inspection . these assemblies are typically produced in mass quantities on lead frame strips so that the finished assemblies may be sequentially inspected by simply pulling the strip past the bond inspection system . the supporting carrier 11 is equipped to support and control the positioning of the assemblies during their inspection . the optomechanical system 12 illuminates and images the assembly 10 with a complex illumination and imaging system which effectively captures the three dimensional characteristics of the imaged assembly 10 from a single optical point of view and develops video signals corresponding thereto . the illumination and imaging of system 12 is partially controlled through pneumatically powered instruments within system 12 . pressurized air for the pneumatic instruments is supplied by pneumatic air supply 13 . a video signal digitizer 14 receives the analog output representation of the assembly 10 from system 12 and converts it to a digital signal for input to image analysis computer 16 . computer 16 receives the signals from the digitizer 14 and analyzes the digital information representing the imaged portion of the assembly 10 to determine if any manufacturing defects in the bonding of the die and lead frame have occurred . prior to inspecting assemblies for a particular semiconductor type , a training operation can be performed which sets the specifications for that type of assembly in the memory of the computer 16 . detected signals from the imaged objects are then compared to the master reference created during the training operation . assemblies coming within the specifications of the master assembly pass the inspection . typical manufacturing problems which can cause an inspected assembly to be rejected by the system include bonds which have been misplaced on either the die or the lead frame fingers , bonding wires which have broken , adjacent bonding wires which either touch or are too close to one another , poor quality bonds , bonding wires which are too close to the lead frame island , and bonding wires which are too long or too high . in addition to analyzing the imaged assembly 10 , the computer 16 operates to control the movement of the system 12 , air supply 13 , axis drive 18 and the lead frame feed mechanism 20 . drive 18 controls the positioning of system 12 along the x , y , and z - axes . mechanism 20 controls the positioning of the strip of bonded assemblies to be inspected by the system . a portion of a bonding area of a semiconductor to lead frame connection assembly 10 is illustrated in the partially broken , perspective view depicted in fig2 . the lead frame described above is shown comprised of island 22 and leads or connection fingers 24 , and is depicted as resting upon a support carrier 11 . island 22 creates a mechanical support and heat sink or electrical ground for the semiconductor device or die 26 . metal traces 28 connected to the circuitry portion ( not shown ) of die 26 run to the edges of die 26 and form bonding pads or electrodes 29 . bonding wires 30 provide an electrical connection between the fingers 24 and bonding pads 29 . where the automated wire bonder has attached a bonding wire 30 to a bonding pad 29 by sonic bonding , a ball bond 32 is created . where the automated wire bonder has attached a bonding wire 30 to a finger 24 by sonic bonding , a crescent bond 34 is created . optomechanical system 12 is capable of illuminating and imaging the desired object in a number of manners , the purpose of which will be further illustrated below . system 12 may be moved in the x , y and z - axes directions by drive 18 so that the entire assembly 10 may be imaged either in whole or in part . typically , a large portion of the bonded assembly 10 is imaged at one time , such that only a small number of images are required to completely image each bonded assembly . referring now to fig3 an embodiment of an optomechanical system in accordance with the present invention is depicted in partially broken section at 12 . note that system 12 is disposed immediately above the support 11 ( containing a light source not shown ) and wire bonded assembly 10 , which includes a lead frame to which semiconductor die 26 is attached . the pads 29 of die 26 are electrically connected to the fingers 24 of the lead frame by wires 30 , as is more clearly illustrated in fig2 . an optics case or housing 40 encloses most of the optomechanical components of system 12 . a cover plate 42 , attached with screws 43 to case 40 , is depicted as cutaway to expose the internal components of the system 12 . one means of illuminating the assembly 10 is provided by a bright field illuminator 44 , which casts a narrow angle beam of light rays ( collimated or parallel light rays ) onto assembly 10 . the illuminator 44 is utilized in a number of imaging applications , particularly when a bright field of illumination of the background is required to create a proper optical contrast between the background and the desired object . narrow angle light rays are typically generated by a xenon strobe flash unit ( not shown ) external to the system 12 which is connected to illuminator 44 through fiber optic cable 45 . the diameter of the fiber optic cable 45 must be large enough to fill the desired optical aperture of illumination . light emitted by bright field illuminator 44 passes through a condenser lens 52 which is attached to case 40 by a holder 50 . lens 52 is an aspheric lens , the surface of which has been modified slightly from a spherical surface in order to reduce optical aberrations caused by the greater distance that the narrow angle light rays must travel to reach the bonded assembly 10 . condenser lens 52 preferably has a focal length of 25 mm , although this specification can change depending on the application and the size of the optomechanical system 12 . a pneumatically activated field stop assembly 54 , associated with holder 50 , is utilized to position a field stop aperture 56 in or out of the beam path of illuminator 44 . pressurized air for the pneumatic control of the field stop assembly 54 and various other pneumatic instruments of optomechanical assembly 12 is supplied through a bundle of pneumatic tubing 48 . aperture 56 is primarily used in conjunction with high magnification camera 62 to limit the illumination field of view , as will be further described below . light rays from illuminator 44 then pass through a beam splitter 58 , held in place by a holder 60 , and into an achromatic lens assembly 66 . assembly 66 is a compound lens combination which has the same focal length for at least two different wavelengths and serves to insure that narrow angle light is directed to the bonded assembly 10 lens assembly 66 is attached to the optics case 40 by a holder 68 . light rays passing through lens assembly 66 are reflected downwardly by a beam splitter 80 through the aperture of a telecentric slide stop assembly 84 . the telecentric assembly 84 is basically a telescopic system having an aperture stop at the image side of an object lens 86 . the assembly 84 is telecentric on the image side of the lens 86 . the aperture stop of telecentric assembly 84 is also equipped with an array of selectively actuable light emitting diodes for use in some illumination applications . the telecentric assembly 84 is moved in and out of alignment with the optical axis under the control of a pneumatic actuator 88 . an air diffuser assembly 90 is also provided , and attached to optics case 40 by a screw 91 , to maintain a positive air pressure within optics case 40 , thereby preventing dust and debris from entering optics case 40 . light rays either passing through telecentric slide stop assembly 84 , or generated therefrom , are directed to the object to be imaged by a lens 86 , which is a standard lens ( such as a closed - circuit television lens ) having a focal length of approximately 25 mm , although this can depend upon the application for the lens . lens 86 directs light collected from an object at a working distance , wd , which is the distance from the object side of lens 86 to the point of interest on or above the bonded assembly 10 . since the object within the working distance wd is in the focal plane of the object lens 86 , the light rays after the object lens are collimated . a circular dark field illuminator 92 , having a central aperture 93 with a diameter somewhat larger than the area of the object to be imaged , is positioned beneath the lens 86 and above the die 26 to illuminate the various surfaces of the bonded assembly at a shallow or wide angle . light emitting diodes , or led &# 39 ; s 94 , provide selectively actuable light sources for illuminator 92 as will be further discussed below . regardless of the source of the illumination cast upon the bonded assembly 10 , i . e . from bright field illuminator 44 , telecentric slide stop assembly 84 , or dark field illuminator 92 , some light will normally be reflected from the assembly 10 and be collected and directed by lens 86 into both a high magnification camera 62 via the reflective surfaces of splitters 89 and 58 and a low magnification camera 70 after passage through splitter 80 . camera 62 is secured to case 40 by a bracket 64 . although light is directed to both cameras 62 and 70 , images are only selectively digitized depending on the application . in applications utilizing the low magnification camera 70 , imaged light is directly transmitted through splitter 80 and an imaging lens 78 to camera 70 where an image is then digitized . imaging lens 78 , in this application , preferably has a focal length of 35 mm , and is secured to case 40 by a holder 76 . camera 70 is secured to case 40 by a bracket 72 . each camera is equipped with image sensors comprised of rows and columns of light detectors which develop signals corresponding to each pixel of the illuminated object . optomechanical system 12 operates on a three dimensional coordinate system . the x - axis of the system is parallel to the length of the lead frame strip and the y - axis is directed transverse to the length of the lead frame strip . the z - axis of the coordinate system is perpendicular to the upper surface of the lead frame strip and coincides with the optical axis of system 12 . the origin of coordinate system x , y and z is at the forward focal point of the lens 86 . images reflected to cameras 62 and 70 are recorded in a two dimensional x &# 39 ; y &# 39 ; coordinate system which is in the plane of the image sensors of cameras 62 and 70 . field stop assembly 54 may be better understood through reference to fig4 . assembly 54 is comprised of a field stop aperture 56 , a support bracket 120 and a pneumatic actuator 122 . when high magnification camera 62 is to be utilized , aperture 56 is positioned in line with the optical axis of light transmitted by illuminator 44 so as to limit light projected onto the object to the field of view of camera 62 . a partially exploded , perspective view of telecentric slide stop assembly 84 is depicted in fig5 . the assembly 84 is comprised of a base 128 which is fixed relative to case 40 ( fig3 ), a slide 130 having an aperture 131 formed therein , and an led ring 132 disposed around the perimeter of aperture 131 . the slide 130 , which supports led ring 132 , is positioned &# 34 ; in &# 34 ; and &# 34 ; out &# 34 ; of alignment with the optical axis of system 12 by the pneumatically controlled actuator 88 . when the slide 130 is &# 34 ; out &# 34 ; of alignment with the optical axis of system 12 , the numerical aperture of telecentric slide stop assembly 84 is approximately 0 . 36 . when the slide 130 is &# 34 ; in &# 34 ; alignment with the optical axis of optomechanical assembly 12 , the numerical aperture of telecentric slide stop assembly 84 is approximately 0 . 1 . when it is desired to have a broad field of illumination , but a narrow field of imaging , one or more of the light sources is activated and slide 130 is moved &# 34 ; in .&# 34 ; if the same illumination but a wider field of imaging is desired , slide 130 can be moved &# 34 ; out .&# 34 ; the numerical aperture of slide 130 has no effect on the field of illumination . a broad field of illumination can be obtained at any angle of incidence , since the angle of incidence is not necessarily dependent upon the field of view . fig6 a , 6b and 6c illustrate the different modes , or angles of incidence of illumination that can be created by system 12 depending on the light source utilized . in fig6 a , illuminator 44 is the source of the narrow angled or collimated vertical light rays 140 . in fig6 b , led ring 132 is the source of the slight angled light rays 146 . in fig6 c , led &# 39 ; s 94 are the source of the wide angled ( or low angle to the support 11 ) light rays 150 . depending on the application , each type of illumination , either narrow angle , slight angle , or wide angle illumination , can be utilized independently or in some combination to create the desired illumination effect of the bonded assembly 10 . for example , fingers 24 , pads 29 , bonding wires 30 , ball bonds 32 and crescent bonds 34 as depicted in fig2 are all typically made from materials having similar surface reflectivity . this makes it difficult to distinguish light reflected from the various object surfaces on the basis of reflectivity alone . however , the objects of interest , such as the bonds and wires all have the common characteristics of having surfaces that are more or less rounded , while the background surface areas , such as the pads and lead frame fingers are generally flat . if a rounded object is illuminated by light rays which have an angle of incidence as close to being parallel to the optical axis as possible , such as when illuminated by illuminator 44 , and the telecentric slide 130 is &# 34 ; in &# 34 ; so that there is a small numerical aperture for imaging , only light rays reflected from the background surfaces and from the small portion of the rounded surface object which is perpendicular or nearly perpendicular to the optical axis will be collected by the camera . thus , the camera will see the rounded object surfaces as primarily dark , except for a small area in the middle , while the flat background surfaces will appear light , or as a bright field . how the different illumination modes are utilized to analyze all of the different portions of the bonded assembly 10 can be better illustrated with reference to fig7 a , 7b , and 7c . fig7 a depicts a cross - section representation of how collimated light rays 140 are reflected off the surface of a pad 29 , a ball bond 32 , and a connected bonding wire 30 . the line graph located above the cross - section object represents the intensity of light reflected from the object as collected by the camera 62 or 70 . the mostly flat surface of pad 29 , which has a normal vector approximately parallel to the optical axis , reflects light directly back through object lens 86 to either camera 62 or 70 and as illustrated at 141 produces the highest intensity of reflected light detected by the image sensors of either imaging camera . the line graph depicted in fig7 a illustrates that a unique graphic representation of an imaged object can be created using this technique . the electrical signal equivalent to this graphic representation can be used to determine certain physical characteristics of the ball bond 32 which can then be compared to specifications corresponding to a master of the same ball bond stored in the image analysis computer 16 . as indicated at 143 , the intensity of light reflected from rounded objects and detected by the camera is lower than the intensity of light reflected and detected from flatter object surfaces . thus , the somewhat flattened portion of ball bond 32 reflects more light back to the imaging sensor at a higher intensity , and light reflected off of the edge of ball bond 32 is at a lower intensity . hence , it is possible to produce sufficient information regarding an object from which certain measurements of the object can be taken from a single image of that object , rather than having to recreate an image of the object from a number of different images , either taken from different angles relative to the object or from a single optical point of view with illumination from a number of different angles of incidence . similar unique graphic representations can be created for other aspects of the bonded assembly 10 , such as is depicted in fig7 b for a bonding wire 30 and fig7 c for a crescent bond 34 . graphic representations may also be made for the intensity of light reflected from various other object surfaces versus y - axis or z - axis relative directional displacement . for instance , the intensity of reflected light versus z - axis directional displacement can be utilized to determine the height of a bonding wire 30 with respect to any other surface of the bonded assembly 10 , as will be further discussed below . fig8 a further represents how , through usage of the telecentric slide stop assembly 84 , the same optics can be utilized for various optical measurements . as depicted in part , slide 130 has been cut - away to reveal led ring 132 which is used to control the illumination and imaging of the slightly irregular surface of lead fingers 24 . led ring 132 may be a single row of led &# 39 ; s disposed around the perimeter of aperture 131 as depicted in fig5 or as a number of led &# 39 ; s located on the object side of the slide 130 . in this later configuration , slide 130 and led ring 132 are configured similarly to dark field illuminator 92 and its led &# 39 ; s 94 . as described above , moving the slide 130 &# 34 ; in &# 34 ; or &# 34 ; out &# 34 ; of coaxial alignment with the optical axis of system 12 can vary both the imaging and illuminating numeric apertures of the object lens 86 . the numeric aperture is the quantity of n sin u , where n is the refractive index of the medium between the object and the lens , and u is the angular radius of the lens as seen from a point on the optical axis at the object . by varying the numeric aperture , the depth of field of the optics system can be changed , thereby making it possible to utilize a large imaging numeric aperture in some situations and a small imaging numeric aperture for other applications , while maintaining the same illuminating numeric aperture . fig8 a illustrates that the angle of illumination or the illuminating numeric aperture can be selectively varied without affecting the imaging numeric aperture . the intensity of a point light source within the focal plane of the lens 86 will only be effected by light rays reflected from underlying or adjacent areas . if an adjacent or underlying area is illuminated by the illumination cone 160 in such a way as to direct reflected light rays away from the imaging cone 164 and the imaging camera , a desired object may be differentiated . fig8 a also demonstrates how a small portion , rather than the entire illuminated area , of the total illuminated surface of crescent bond 34 can be imaged by an imaging camera . the surface of lead finger 24 is formed from a number of microscopic planes which are inclined at small angles to the optical axis of system 12 . when this surface is illuminated and imaged through a small aperture , a speckled appearance will result because not all light rays reflected from the entire surface can be collected by the imaging camera . the speckled appearance may be eliminated by illuminating at a larger numerical aperture and imaging at a small numerical aperture , thereby preserving a large depth of focus and causing light from the surface of the lead finger 24 to also be collected by the imaging optics . in addition , fig8 b further demonstrates that the illumination cone 160 need not be circularly symmetrical about the optical axis of system 12 . as long as the approximate orientation of the surface of crescent bond 34 is known , that surface may be selectively illuminated to take advantage of surface variations . by selectively illuminating a portion of the led &# 39 ; s in led ring 132 , light rays reflected from the inclined surface of crescent bond 34 may be projected through aperture 131 . alternatively , the angle of incident light may be selectively varied by backlighting a diffuse surface located in the focal plane of the lens 86 and controlling the light emission by an electrically controlled liquid crystal pattern . by selectively varying the angle of incident illumination , the illuminating and imaging numeric apertures of system 12 , and the position of system 12 and the bonded assembly 10 , the entire bonded assembly 10 can be effectively imaged by system 12 and analyzed for compliance with its specifications by computer 16 . however , before bonded assembly 10 can be analyzed , an optimum or best focus must be established for system 12 at each position over the bonded assembly . the best focus for system 12 is generally calculated through application of a van neumann architecture computer , which is utilized to determine the local maximum for normalized energy density at a selected point on the bonded assembly . much simpler methods , however , may be utilized to determine the best focus , as is shown now with reference to fig9 a . the graphic representation of fig9 a shows that the point spread function for a point of light imaged by system 12 when in focus reaches a sharp peak and then quickly drops off . as an object goes through focus ( as it goes from being out of focus , to in focus , to out of focus ), the point spread function corresponding to the intensity of light reflected by this object ( or if it does not reflect light , from its surrounding background area which does reflect light ) would migrate radially inward and outward . this principle can be illustrated by viewing a point of light in focus and then taking it out of focus . as the point of light moves out of focus , a blurring effect around the periphery of the point of light going out of focus can be detected . likewise , fig9 b illustrates that when system 12 is slightly defocussed , the energy density peak spreads out even more , although the area under the curve remains constant . this implies that the image sensors of the camera , which measure the energy density per unit area , can best detect a maximum energy density when the point light emitter is in perfect focus . to determine the best focus for inspecting the bonded assembly 10 , the system 12 is positioned at a height so that the plane at z = wd , the maximum point of focus within the depth of focus , does not intersect any bonding wires . illumination of the bonded assembly 10 is such that a portion of the surface of bonding wire 30 will appear bright and its background ( also a portion of the bonded assembly 10 ) will be generally dark . this assures that the image sensor will mostly see the contribution from a certain point on a bonding wire rather than the surrounding background . as previously described , when a bonding wire is nearing focus , the slope of the intensity curve versus z - axis relative directional translation is quite sharp while the contribution from the surrounding background , which is out of focus , is small both in energy and in slope . as the system 12 is moved along the z - axis toward or away from the bonded assembly 10 , the light intensity for any of a number of points along the wire can be captured by computer 16 and stored , together with the known information relating to the height of the system 12 at those points . thus , system 12 is typically repeatedly moved by a fixed increment in the direction of the bonded assembly 10 , and for each new height , the intensity of light collected from the imaged object is compared with the previously recorded values . when the new value of intensity is greater than the old value of intensity , the old value is replaced , together with the value of the height of the system 12 at which the replacement occurred . hence , successive information regarding the imaged object is discarded and only information relating to the maximum detected height is retained , since the goal is not to attempt to recreate a three - dimensional image of the object , but just to determine its height . alternatively , a look - up table could be implemented for similarly determining the best focus at every point . also alternatively , the system could be tuned to determine the height of the object or the best focus where there is a dark object and a light background as previously described . the above algorithm , which is utilized to determine best focus , may also be utilized to try to isolate an imaged object when the point light source from that object is surrounded by an area of any degree of brightness , provided that the surrounding area is at a different brightness than the object . because of the radial migration of the point spread function as an object goes through focus , a comparison between intensities at different heights cannot normally be made . however , if slide 130 is positioned &# 34 ; in ,&# 34 ; the change in magnification as a function of z - axis directional translation will be only negligible and the intensity at a point light source in the sensor will always correspond to the same point on the bonding wire , which will allow that point light source to be isolated as the intensity of the surrounding area changes . an alternative to using the slide 130 would be to allow for a change in the magnification ( rather than holding it constant ) while compensating for that change in magnification with the computer 16 through use of standard methods of scan conversion . once best focus for the system 12 has been determined , system 12 and computer 16 can be trained to inspect a particular type of bonded assembly . to train the system and store the specifications of the master assembly in the memory of the computer 16 , an operator generally operates the system to determine the geometry of a master bonded assembly 10 and the proper placement of ball bonds 32 , crescent bonds 34 , and bonding wires 30 . in addition , the position of system 12 and its height at best focus is also determined for each inspection position and digitally stored in computer 16 . alternatively , the system may be trained using a computer aided design system to generate the necessary training information , such as the specifications for the position of the die and bonding wires , and the proper size and placement of bonds . the first operation in inspecting individual bonded assemblies is to determine the alignment of the bonded assembly . alignment is determined by placing the system 12 at the center of the inspection area , at a predetermined height , and focusing the bonded assembly 10 on the image sensor . the bonded assembly 10 is then illuminated from the bottom by the light source located in support 11 . camera 70 is selected to image the bonded assembly 10 and slide 130 is positioned &# 34 ; in &# 34 ;. light rays passing between the lead frame fingers are imaged into camera 70 , converted and stored in computer 16 . this stored image is then cross correlated with the same image ( or specifications for a computer generated equivalent of an image ) of the master assembly stored in the memory of computer 16 . the difference between the two images yields an off - set between the position of the training assembly and the bonded assembly which will later be subject to inspection . the light source within support 11 is then turned off . illuminator 44 is then utilized to project a narrow angle bright field illumination of die 26 . the slide 130 is positioned &# 34 ; in &# 34 ; and low magnification camera 70 is used to determine the off - set between a training die and the die 26 of bonded assembly 10 , which is under inspection . ball bonds are inspected with the slide 130 positioned &# 34 ; in &# 34 ;, narrow angle bright field illumination on , and either the high magnification camera 62 or the low magnification camera 70 . the surface of ball bonds 32 appear dark while the surface background appears light . the image of the ball bond 32 is analyzed by computer 16 and the correct size and position of each ball bond is determined . crescent bonds 34 are typically inspected with slide 130 positioned &# 34 ; in &# 34 ;, narrow angle bright field illumination on , high magnification camera 62 , and field stop 56 positioned &# 34 ; in &# 34 ;. fingers 24 and support 11 will appear light , the crescent bond 34 will appear dark , and the bonding wire 30 , except for the light center , will be dark . the captured image is analyzed by computer 16 . a crescent bond 34 is identified by the large dark area of the image . the bonding wire 30 is identified by its light center and known dimension , and is &# 34 ; cut off &# 34 ; to determine the width , breadth and position of the crescent bond 34 . because of the irregular shape of lead fingers , narrow angle bright field illumination may result in too few light rays reaching camera 62 . in such situations , the slight angle illumination of led ring 132 should be utilized so that the size of the crescent bond 34 may be accurately determined . illumination with led ring 132 may also be required in some situations where the curvature of the surface of the object to be imaged is such that other illumination sources will not reflect light to the imaging camera . alternatively , some combination of illumination sources can be utilized to achieve the proper optical contrast . the path of each bonding wire in the x and y - axis plane , but not in the z - axis direction , can be determined by positioning slide 130 &# 34 ; in &# 34 ;, turning dark field illuminator 92 on , and utilizing camera 62 . bonding wires 30 will appear light and the background will appear dark . the height of each bonding wire 30 can be determined by positioning slide 130 &# 34 ; out &# 34 ;, turning dark field illuminator 92 on , and utilizing camera 70 . system 12 is positioned as close to the surface of bonded assembly 10 as is necessary to focus camera 70 on a bonding wire having the greatest sag . the intensities of all points corresponding to locations on the bonding wire 30 are recorded in computer 16 . system 12 is then raised by about 50 microns and the intensity of each point corresponding to location on the bonding wire are again recorded . utilizing previously described methods , the local energy density maximum can be determined from this information to establish the position of best focus , as well as the height of each bonding wire 30 . it should be noted that the present invention is not limited to usage as an optical inspection system . in general , such a system as is described would be useful in automatically locating or referencing any type of object , or measuring the size of a feature of an object in a number of different applications , such as robotics and medical automation fields . the present invention may also be employed to derive a computer aided database from a pre - existing sample of a part to be manufactured . it should also be noted that the accuracy of z - axis measurement may be increased by replacing the conventional optical system with a confocal microscope . although the present invention has been described in terms of specific embodiments , it is anticipated that alterations and modifications thereof will no doubt become apparent to those skilled in the art . it is therefore intended that the following claims be interpreted as covering all such alterations and modifications as fall within the true spirit and scope of the invention . | 7 |
the preferred embodiments for implementing the present invention will be described with reference to the drawings . fig1 is a perspective view illustrating an example of a flapper 3 . fig2 is an exploded perspective view of the flapper 3 of the present example . fig3 is a perspective view corresponding to fig1 illustrating another example of the flapper 3 of the present invention . fig4 is a cross - sectional view of a fuel filler port closing apparatus using the flapper 3 of the present example . fig5 is a partially enlarged cross - sectional view of the fuel filler port closing apparatus illustrating a normal state in which the flapper 3 closes an opening 211 of a nozzle guide . fig6 is a partially enlarged cross - sectional view corresponding to fig5 of the fuel filler port closing apparatus illustrating a state in which a seal packing 325 is deflected thereby forming a gap δ . fig7 is a partially enlarged cross - sectional view corresponding to fig5 of the fuel filler port closing apparatus illustrating a state in which a seal plate 32 is pushed up thereby filling the gap δ . fig8 is a pattern diagram illustrating the state that a flapper 603 of a prior arts tilts . the fuel filler port closing apparatus of the present invention has a characteristic flapper 3 for opening and closing an opening 211 of a nozzle guide 21 . the flapper 3 of the present example is configured by a rotation plate 31 , which is pushed and biased upwardly by a torsion coil spring 314 and which is rotatable downwardly ; and a seal plate 32 holding the seal packing 325 pressed against the peripheral edge of the opening 211 of the nozzle guide 21 . the seal plate 32 is coupled so as to be freely displaceable in an up and down direction with respect to the rotation plate 31 on the upper surface side of the rotation plate 31 ( see fig4 ). the entire configuration of the flapper 3 is not greatly different from the conventionally known fuel filler port closing apparatus of the same type in size and in positional relationship of a rotation shaft 317 other than that the flapper 3 is divided to the rotation plate 31 and the seal plate 32 . this means that the flapper 3 of the present invention can be easily applied to the conventionally known fuel filler port closing apparatus of the same type . as illustrated in fig1 and 2 , the flapper 3 of the present example is configured by the rotation plate 31 , the seal plate 32 , and a packing holding plate 33 . the rotation plate 31 is a metal plate having a circular shape in the front and square shape in the back , formed with one - through hole 312 of square shape in plane view at the middle , and one connection hole 311 of circular shape in plane view at the front and back of the through - hole 312 . the rotation plate 31 has a pair of left and right arms 318 , 318 projecting out from both sides towards the back side , and the rotation shaft 317 passed through an axial - attachment plate 313 arranged at each arm 318 . the torsion coil spring 314 is freely fitted to the rotation shaft 317 , and is positionally - fixed by pressing a one end 316 against the inner surface of a closure unit 2 ( see fig4 ). other end 315 of the torsion coil spring 314 is pressed against a pushing projection 323 of the seal plate 32 projecting out from the through - hole 312 of the rotation plate 31 to directly push the seal plate 32 upwardly . the seal plate 32 is a resin plate having a circular shape in plan view for mounting the seal packing 325 having an outer diameter corresponding to the peripheral edge ( valve seat ) 212 of the opening 211 of the nozzle guide 21 ( see fig4 ). the seal plate 32 of the present example has the pushing projection 323 , having a square cross - section equal to the planar shape of the through - hole 312 , projecting out at the middle on the lower surface side . the seal plate 32 also has coupling projections 321 of circular cross - section equal to the planar shape of the coupling holes 311 projecting out from the position on the lower surface side corresponding to the coupling holes 311 with the pushing projection 323 in between . furthermore , the seal plate 32 has an assembly flange 326 projecting out on the upper surface side . the pushing projection 323 is used to push up the seal plate 32 by the torsion coil spring 314 . the coupling projections 321 are used to couple the rotation plate 31 and the seal plate 32 . the assembly flange 326 is used to assemble the packing holding plate 33 , a cover plate 331 ( fig1 and 2 ), and a roller 332 ( fig3 ). the seal plate 32 inserts the two coupling projections 321 to the two corresponding coupling holes 311 formed in the rotation plate 31 , respectively , and projects the coupling projections 321 out from the coupling holes 311 with the lower surface of the seal plate 32 surface contacted to the upper surface of the rotation plate 31 . the seal plate 32 can be coupled so as to be freely displaceable in the up and down direction with respect to the rotation plate 31 by arranging an engagement portion 322 at the portion of the coupling projection 321 at the position spaced apart from the lower surface of the rotation plate 31 . the engagement portion 322 is formed by melting and solidifying the distal end of the coupling projection 321 . the coupling projection 321 has the same cross - sectional shape ( circular cross - section ) as the coupling hole 311 , and thus the coupling hole 311 and the coupling projection 321 closely engage other than in the up and down direction with respect to the rotation plate 31 , and do not tilt in an abnormal direction . the seal plate 32 thus displaces only in the up and down direction with respect to the rotation plate 31 within a range in which the engagement portion 322 engages the lower surface of the rotation plate 31 , and fills the gap δ formed between the valve sheet and the seal packing 325 . in the flapper 3 of the present invention , the rotation plate 31 follows a motion of the seal plate 32 by the engagement of the coupling hole 311 the coupling projection 321 pushed up by the torsion coil spring 314 . specifically , the seal plate 32 projects the pushing projection 323 of square cross section out at the middle of the lower surface , and engages one end 315 of the torsion coil spring 314 in an engagement groove 324 extending in the left and right direction formed at the distal end . therefore , the rotation plate 31 functions only as a member for displacing the seal plate 32 that actually opens and closes the opening 211 of the nozzle guide along a circular arc path having the rotation shaft 317 as the center . the seal packing 325 is a circular ring elastic material made of rubber having a protrusion of triangular cross - section on the outer periphery . the seal packing 325 is sandwiched and held by a peripheral edge portion of the upper surface of the seal plate 32 and the lower surface of the packing holding plate 33 to be connected to the seal plate 32 . specifically , the seal packing 325 is mounted on two concentric supporting protrusions formed at the peripheral edge portion of the upper surface of the seal plate 32 . the cylindrical main body of the packing holding plate 33 is then fitted to the inner peripheral edge of the seal packing 325 , and the seal packing 325 is held with the lower surface of the radially and outwardly projecting flange of the holding plate 33 ( see fig5 and subsequent figures ). the holding plate 33 is coupled to the seal plate 32 by projecting the assembly flange 326 of the seal plate 32 out from an assembly hole 336 of the holding plate 33 , communicating an attachment hole 327 of the assembly flange 326 and coupling holes 334 of the holding plate 33 and inserting a coupling pin 333 . the holding plate 33 of the present example includes a metal cover plate 331 having a hill - shaped cross - section at the middle of the upper surface . the cover plate 331 prevents the fuel filling nozzle ( not shown ) from getting caught at the flapper 3 when pulling out the fuel filling nozzle ( not shown ) having the side surface contacted to the push - opened flapper 3 . the cover plate 331 protects the holding plate 33 made of resin . the cover plate 331 of the present example is fixed by communicating the attachment hole 327 of the assembly flange 326 , the coupling holes 334 and the attachment hole 335 of the holding plate 33 and inserting the coupling pin 333 . in order to prevent the fuel filling nozzle being pulled out from being caught at the flapper 3 , a roller 332 may be attached to the holding plate 33 in addition to the cover plate 331 , as illustrated in fig3 . the roller 332 of another example is attached to the holding plate 33 by communicating the assembly hole of the assembly flange 326 , the coupling hole 334 of the holding plate 33 , and a roller shaft hole ( not shown ), and inserting the coupling pin 333 . the cover plate 331 is positionally fixed by inserting the coupling pin 333 to an assembly piece ( not shown ) extended between the assembly flange 326 and the roller 332 . when a finger ( not shown ) is caught at the opening 211 of the nozzle guide by mistake , the roller 332 added to the cover plate 331 allows the finger to be easily removed . the overall configuration of the fuel filler port closing apparatus assembled with the flapper 3 of the present invention will be described hereinafter . as shown in fig4 , the fuel filler port closing apparatus of the present example is configured by a filler neck 1 , a closure unit 2 , and a cover unit 4 . the closure unit 2 is attached with the flapper 3 , which is pushed down by the fuel filling nozzle ( not shown ) inserted from the opening 44 of the filler neck of the cover unit 4 thereby opening the opening 211 of the nozzle guide . an upwardly rotatable cover 5 is attached to the cover unit 4 , where the opening 44 of the filler neck is opened and closed by the cover 5 . the cover unit 4 is also fixed with an attachment plate 56 attached with a rotation shaft 511 of a cover main body 51 . the filler neck 1 is a tubular member made of metal in which an opening at the upper end is wide and a connection port 11 , which is an opening at the lower end , narrows in accordance with a fuel feeding tube main body 8 to be connected . the filler neck 1 of the present example is a separate body from the fuel feeding tube main body 8 , but the end of the fuel feeding tube main body 8 may be enlarged to configure the filler neck 1 . the closure unit 2 is a resin block formed with the nozzle guide 21 for guiding the fuel filling nozzle ( not shown ) inserted from the opening 44 of the filler neck . the flapper 3 for opening and closing the opening 211 is integrally assembled to the closure unit 2 . a ring - shaped fit - in groove 221 is formed at a peripheral surface 22 of the closure unit 2 of the present example . a seal ring 222 is fitted into the ring - shaped fit - in groove 221 to ensure the sealability when the closure unit 2 is fitted into the filler neck 1 . the cover 5 opens and closes the opening 44 of the filler neck positioned at the upper stage of the opening 211 of the nozzle guide to prevent rainwater and dust from accumulating at the opening 211 of the nozzle guide . the cover main body 51 of the cover 5 of the present example is attached to the rotation shaft 511 supported by the attachment plate 56 . the cover main body 51 is biased in an opening direction by the torsion coil spring 512 , and maintains the opening 44 in the closed state by engaging a latch 531 provided on the cover main body 51 to the opening 44 of the filler neck . furthermore , the fuel filler port closing apparatus of the present example has a spacer 6 interposed between the closure unit 2 and the cover unit 4 . the spacer 6 is formed with an opening 61 for fixing the inserted nozzle . the opening 61 is one size smaller than the opening at the upper end of the nozzle guide 21 to engage and hold the inserted fuel filling nozzle . as illustrated in fig5 , according to the flapper 3 of the present invention , the seal plate 32 pushed up by the torsion coil spring 314 closes the opening 211 of the nozzle guide by evenly pressing the seal packing 325 against the peripheral edge ( valve seat ) 212 of the opening 211 in the peripheral direction . the seal packing 325 is pressed against the peripheral edge ( valve seat ) 212 of the opening 211 by the seal plate 32 . the seal plate 32 is directly pushed up by the one end 315 of the torsion coil spring 314 . as long as the seal packing 325 does not deflect , the seal packing 325 is evenly pressed against the peripheral edge ( valve seat ) 212 of the opening 211 in the peripheral direction even if the rotation plate 31 is tilted , whereby reliable sealability is achieved . however , when the seal packing 325 is deflected thereby forming a gap δ at one part , as illustrated in fig6 , the seal plate 32 is pushed up in a range where the engagement portion 322 of the coupling projection 321 engages the lower surface of the rotation plate 31 . as a result , the seal packing 325 is again evenly pressed against the peripheral edge ( valve seat ) 212 of the opening 211 of the nozzle guide , as illustrated in fig7 , whereby reliable sealability is achieved . the flapper 3 of the present invention allows the seal plate 32 holding the seal packing 325 to be displaceable only in the up and down direction with respect to the rotation plate 31 . therefore , even if the gap δ is formed , the sealability is not affected as the seal plate 32 tilts and deforms the seal packing 325 . the flapper 3 of the present invention thus suppresses the formation of the gap δ , and exhibits stable and reliable sealability . in order to assess an effect of the present invention , a sealability of a fuel filler port closing apparatus equipped with the flapper of the present invention and that of a fuel filler port closing apparatus equipped with a conventional flapper ( hereinafter referred to as a “ comparison ”) were measured . as the comparison , the fuel filler port closing apparatus having a flapper made of a single plate and a long bearing hole for a rotation shaft of the flapper was used . configuration of the present invention and the comparison was summarized in table 1 . the connection port 11 of the fuel filler port closing apparatuses of present invention and comparison were connected to a suction pump and were aspirated . the pressure ( kpa ) at which the amount of gas leak ( cc ) per minute reached to 3 cc / min were measured . the measurement was conducted plural times . the results were summarized in the table 2 . according to the present invention the pressure were around − 10 kpa to − 12 kpa and were stable . contrast to this , according to the comparison , the pressure were unstable and gas leaking began around − 3 kpa to − 5 kpa . | 1 |
a method and apparatus are described for tracking ambiguous states in a multi - node shared memory environment . additionally , based on the ambiguous states , requests are routed and nodes are probed to resolve any existing ambiguities and correctly route the request to the proper target node . enclosed is a mechanism for supporting the full mesi protocol so that multiple architectures can simultaneously be implemented in the same shared memory environment without creating problematic bus demand and unnecessary coherence complications resulting from shared status when an exclusive status is preferable . the enclosed mechanism also supports an exclusive state so any member node may make multiple modifications and need not report any modifications to the home node or any other node until another node requests access to the cache line . in the following description , for the purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the present invention . however , the present invention may be practiced without some of the specific detail provided therein . the invention is described herein primarily in terms of a requesting node initiating a request to a cache line in a distributed shared memory environment . the cache line is accessible by the requesting node , a home node that maintains permanent storage of the cache line memory and a responding node that may have a copy of the cache that is being targeted by the requesting node . the request is sent to an intermediate switch that tracks , by using a snoop filter , the status of each cache line accessible in the shared memory environment . the switch determines the status of the cache line of interest by looking at a table maintained in the snoop filter . wherever an ambiguity exists , i . e . the last known state for the cache line at a given node was a state that could have transitioned since last reported , the switch snoops the node to resolve the ambiguity and makes sure the request is properly routed . the invention , however , is not limited to this particular embodiment alone , nor is it limited to use in conjunction with any particular distributed shared memory environment . for example , the claimed method and apparatus may be used in conjunction with various system architectures such as ia32 or ia64 based architectures . it is contemplated that certain embodiments may be utilized wherein a request is received by an intermediate traffic switch , ambiguous states are resolved so as to properly handle the request and the request is properly routed . the present invention includes various operations that will be described below . the operations of the present invention may be performed by hardware components or may be embodied in machine - executable instructions , which may be used to cause a general - purpose or special - purpose processor or logic circuits programmed with the instructions to perform the steps . alternatively , the steps may be performed by a combination of hardware and software . the present invention may be provided as a computer program product , which may include a machine - readable medium having stored thereon instructions , which may be used to program a computer ( or other electronic devices ) to perform a process according to the present invention . the machine - readable medium may include , but is not limited to , floppy diskettes , optical disks , cd - roms , magneto - optical disks , roms , rams , eproms , eeproms , magnetic or optical cards , flash memory , or other type of media / machine - readable medium suitable for storing electronic instructions . moreover , the present invention may also be downloaded as a computer program product , wherein the program may be transferred from a remote computer ( e . g ., a server ) to a requesting computer ( e . g ., a client ) by way of data signals embodied in a carrier wave or other propagation medium via a communication link ( e . g ., a modem or network connection ). accordingly , herein , a carrier wave shall be regarded as comprising a machine - readable medium . brief initial definitions of terms used throughout this application are given below to provide a common reference point . a home node is a node where the contents of a cache line are permanently stored . a responding node is a node that has a copy of the contents of the cache line of question and whose cache line state is ambiguous at the time the switch receives a request concerning the cache line . a requesting node is a node that initiates a request concerning contents of a particular cache line or memory . an ambiguous state is a condition tracked in a snoop filter that identifies the last known state of a cache line at a member node . when the state last identified is one that could have changed at the member node , then the state is determined to be ambiguous . [ 0028 ] fig1 illustrates an exemplary operating environment 100 according to one embodiment of the invention . in this example , multiple nodes 110 and 120 share memory through a cache based coherence system . the nodes supported are processor nodes 110 each having a local memory 130 and input / output ( io ) nodes 120 . the cache based coherence system is collectively designated the scalability port ( sp ). in node environments with more than two nodes , the sp includes a system node controller ( snc ) chip 140 in each of the processor nodes 110 and an io hub ( ioh ) 150 chip in each of the io nodes 120 . the io node implements a cache , such as an l2 cache , so that it may participate in cache coherency . in addition to the snc 140 and the ioh 150 , the sp provides central control for its snoop architecture in a scalability port switch ( sps ) 160 that includes a snoop filter ( sf ) 170 to track the state of cache lines in all the caching nodes . the snc 140 interfaces with the processor bus 180 and the memory 130 on the processor node 110 and communicates cache line information to the sps 160 when the line is snooped for its current status . similarly , the ioh interfaces with the io bus and communicates information to the sps 160 when a line is snooped for its current status . the sp used to exemplify the invention supports various architectures . for instance , the processor nodes 110 could be based on either the ia32 or ia64 architecture . unlike prior snoop based cache coherence architectures , the sp supports the full mesi ( modified , exclusive , shared and invalid ) protocol as uniquely implemented by both architectures , i . e . the ia32 coherence protocol as well as the ia64 coherence protocol . one example of how these coherence protocols differ is when the cache line state is in a modified state when a read request is initiated . in the ia32 coherence protocol , once the read request is processed , the state of the cache line transitions from modified to an invalid state whereas in the ia64 coherence protocol , the cache line , once read , transitions from a modified state to a shared state . the support of multiple architectures allows for scalability and versatility in the future development of architectures and their corresponding protocols by allowing for the resident component of the sp , i . e , the snc for the processor node and the ioh for the io node , to be implemented to handle the new architecture and its corresponding protocol without having to redesign the central snoop controller , the sps . the central snoop controller switch performs coherence in order to resolve existing ambiguities occurring in the snoop filter . this central snoop coherence protocol is an invalidation protocol where any caching node or agent that intends to modify a cache line acquires an exclusive copy in its cache by invalidating copies at all the other caching agents . the coherence protocol assumes that the caching agents support some variant of the mesi protocol , where the possible states for a cache line are modified , exclusive , shared or invalid . the transitions between these states on various local and remote operations may be different for different types of caching agents . the coherence protocol provides flexibility in snoop responses such that the controller switch can support different types of state transitions . for example , a cache line in the modified state can transition to a shared state on a remote snoop or an invalid state on a remote snoop , and the snoop response can indicate this for appropriate state transitions at the switch and the requesting agent or source node . the snoop filter in the sps is organized as a tag cache that keeps information about the state of each cache line and a bit vector indicating the presence of the cache line at the various caching nodes . the bit vector , called the presence vector , has one bit per caching node in the system . if a caching agent at any node has a copy of a cache line , the corresponding bit in the presence vector for the cache line is set . a cache line may be in one of either invalid , shared , or exclusive states in the snoop filter . the snoop filter only tracks the tag and the cache line state at the indicated node and does not maintain a copy of the cache line . the snoop filter at the sps is inclusive of caches at all the caching agents . in other words , a caching agent cannot have a copy of a cache line that is not present in the snoop filter . if a line is evicted from the snoop filter , it must be evicted from the caching agents of all the nodes , i . e . marked in the presence vector . an illustration of the information maintained in the snoop filter 200 is demonstrated abstractly in fig2 . the contents of memory location 210 , maintained exclusively on the home node 220 , are copied and accessible in a cache 230 on the responding node 240 . the responding node snc ( or ioh ) 250 maintains a local presence vector 260 and status 270 for each cache line it utilizes . a snoop to the snc of node 240 may result in the snoop filter &# 39 ; s presence vector and status being updated . if a caching agent at any node has a copy of the cache line , the corresponding bit in the presence vector for that cache line is set . a cache line could be in the invalid , shared , or exclusive state in the snoop filter . in this case , the home node &# 39 ; s cache line is in a shared state ( s ), while the resource node 280 is in an invalid state ( i ) and the remote node &# 39 ; s cache line was last known to be in an exclusive state ( e ). according to the described embodiment , the cache line in the snoop filter will not indicate that a line is in a modified state , because a read to a cache line that has transitioned to a modified state will result in the modified line changing states in response to a snoop or read inquiry . the snoop filter is inclusive in that it does not contain the cache data , but only tracks the tag and the state of caches at all the caching agents . it is possible to divide the snoop filter into multiple scalability port switches or into multiple caches within one sps to provide sufficient snoop filter throughput and capacity to meet the system scalability requirement . in such cases , different snoop filters keep track of mutually exclusive sets of cache lines . a cache line is tracked at all times by only one snoop filter . the state of a cache line in the snoop filter is not always the same as the state in the caching agent &# 39 ; s snc . because of the distributed nature of the system , the state transitions at the caching agents and at the snoop filter are not always synchronized . in fact , some of the state transitions at the caching agents are not externally visible and therefore it is not possible to update the snoop filter with such transactions . for example , transitions from an exclusive state to a modified state may not be visible external to the caching agent . although other ambiguous situations may exist , the usefulness of the invention is illustrated by the scenario described with reference to fig2 where a cache line is in the exclusive state at the snoop filter . in this case , the snoop filter is aware only that the caching agent , i . e . the responding or remote node 240 , has exclusive access to the cache line as indicated by the presence vector in the snoop filter . however , the state of the cache line at the caching agent may have changed to any of the other mesi protocol states ( e . g ., modified , exclusive , shared or invalid ). if a request is made to the sps 290 for a cache line where ambiguity exists ( i . e . the state at the node having ownership may have changed ), the sps snoops the cache line , in this case the responding node &# 39 ; s cache line , indicated by the presence vector to get its current state and most recent corresponding data if necessitated . other snoop filter states exist as follows : an invalid state in the snoop filter is unambiguous , the cache line is not valid in any caching agent and all bits in the presence vector for the line in the snoop filter must be reset . an unset bit in the presence vector in the snoop filter for a cache line is unambiguous , the caching agents at the node indicated by the bit cannot have a valid copy of the cache line . a cache line in a shared state at the snoop filter is ambiguous and reflects that the cache line at the node indicated by the presence vector may be either in a shared or an invalid state . and finally , if a cache line is in an ambiguous exclusive state at the snoop filter , the cache line at the node indicated by the presence vector may be in any of the supported mesi states , specifically modified , exclusive , shared , or invalid . [ 0036 ] fig3 illustrates what happens in the example illustrated in fig2 where an ambiguity exists in the snoop filter . in this example , the requesting node 280 makes a read request for the most current updated contents of memory location 210 . the home node 220 is the node where the data is stored for memory aaaa and the responding node 240 is the node that currently has a modified copy of the data for memory location aaaa 230 . when the responding node 240 originally acquired its copy of the data for memory location aaaa 230 , the snoop filter 200 indicated that the responding node 240 had a copy by asserting its presence bit vector and additionally indicated that the responding node 240 was taking the copy in an exclusive state 291 . once the snoop filter identifies that the data resides on the responding node , it need not monitor the activity at the responding node until another request is made . additionally , the responding node may modify the data and does not need to report the modified data until a request is made by another node to access the data . in this case , the responding node modified the data from x to x + a on the cache line and consequently its local cache line state changed to modified 270 . [ 0037 ] fig3 demonstrates the sequence of events taken by the scalability port switch to resolve an ambiguity . in step 310 , the requesting node 280 submits a read request for the contents associated with memory location aaaa . at step 320 , the sps 290 determines which node last had ownership of the cache line associated with memory location aaaa . the sps makes this determination by accessing its snoop filter and identifying which node last had exclusive ownership of the aaaa cache line . in step 330 , the sps identifies that responding node 240 last had ownership . the sps , in step 340 , then looks at the status of the aaaa cache line last reported and determines that it is in an ambiguous state as the last known state was an exclusive state . because the exclusive state is known to be ambiguous , the sps must snoop the responding node for its current status as it may have changed due to an internal modification to the responding node &# 39 ; s copy contained on its cache line . fig4 - 5 demonstrate a sequence where the responding node 400 has not modified the contents of the cache line since taking control of the cache line in an exclusive state . fig4 demonstrates the status of the nodes while fig5 is a flow diagram showing the steps taken in the shared memory environment . at step 500 , the requesting node 410 submits a read request for the contents of memory aaaa to the sps 420 . in step 510 , the sps 420 looks at its snoop filter &# 39 ; s presence vector 430 and realizes that the responding node last had control of the cache line in question 440 and had access to the line in an ambiguous exclusive state 450 . because the cache line is in an ambiguous state , the sps 420 takes two actions substantially simultaneously . at step 520 , the sps 420 a ) snoops the responding node 400 to determine if the data has been modified while also simultaneously b ) doing a speculative read on the home node 460 . in this case , the responding node 400 has not altered the data ( still in an exclusive state , not modified 470 ) and , as a consequence of the snoop by the sps , the status of the cache line at the responding node changes to a shared state as the cache line data is being accessed by another node . consequently , the responding node 400 , at step 530 responds to the sps that the state has changed to a shared state . at step 540 , because the responding node has not modified the data and has issued a state change to shared without having modified the data , the sps confirms a memory read to the home node so the best source of the data may be retrieved for the requesting node 410 . at step 550 , the data is written from the home node through the sps to the requesting node . in this sample read transaction , when the requesting node has received a copy of the contents , it &# 39 ; s status at the snoop filter changes to a shared state . the requesting node may then determine that it wants the cache line in an exclusive state and may submit commands to invalidate or prevent modification of the contents of the cache line at other nodes . fig6 - 7 demonstrate a sequence where the responding node 400 has modified the contents of the cache line since taking control of the cache line in an exclusive state . fig6 demonstrates the status of the nodes while fig7 is a flow diagram showing the steps taken in the shared memory environment . at step 700 , the requesting node 610 submits a read request for the contents of memory aaaa to the sps 620 . in step 710 , the sps 620 looks at its snoop filter &# 39 ; s presence vector 630 and realizes that the responding node last had control of the cache line in question 640 and had access to the line in an ambiguous exclusive state 650 . because the cache line is in an ambiguous state , the sps 620 takes two actions substantially simultaneously . at step 720 , the sps 620 a ) snoops the responding node 600 to determine if the data has been modified while also simultaneously b ) doing a speculative read on the home node 660 . in this case , the responding node 600 has modified the data and , as a consequence of the snoop by the sps , the status of the cache line at the responding node changes from a modified state to a shared state as the cache line data is being accessed by another node ( in another case , the state may change from modified to invalid based on a different type of architecture ) consequently , the responding node 600 , at step 730 responds to the sps that the state is changing to a shared state and also provides an instruction to the sps to write the modified data to the home node , known as an implicit - writeback , while providing a copy of the modified data . at step 740 , because the responding node has modified the data and has issued a state change to shared with instructions concerning the modified the data , the sps communicates the modified data to the home node while substantially simultaneously copying the data in step 750 to the requesting node node 410 in response to its read request . in this sample read transaction , when the home node has received the updated copy of the contents , it submits in step 750 a completion response to the sps that directs the completion response to the requesting node . the requesting node may then determine that it wants the cache line in an exclusive state and may submit commands to invalidate or prevent modification of the contents of the cache line at other nodes . the invention has been described above primarily in terms of intel &# 39 ; s scalability port architecture . the snoop filter mechanism for supporting the full mesi protocol as embodied by the claims is not limited to use in a distributed shared memory environment , nor is it limited to use in conjunction with intel &# 39 ; s scalability port . for instance , the claimed invention might be utilized in existing or new snoop based architectures . the foregoing description has discussed the snoop filter mechanism as being part of a hardware implemented architecture . it is understood , however , that the invention need not be limited to such a specific application . for example , in certain embodiments the snoop filter mechanism could be implemented as programmable code to cooperate the activities of multiple memories located in a distributed fashion . numerous other embodiments that are limited only by the scope and language of the claims are contemplated as would be obvious to someone possessing ordinary skill in the art and having the benefit of this disclosure . | 6 |
the detailed description and technical content of the present invention with reference to the drawings , which merely provides reference and illustration without having an intention to limit the present invention , illustrates as following . please refer to fig2 . fig2 shows a first embodiment of a resistive device according to the present invention . the resistive device 20 mainly includes a flexible substrate 100 , a resistive layer 110 located on the flexible substrate 100 , an electrode layer 120 located on the resistive layer 110 opposed to the flexible substrate 100 , and an adhesive layer 130 between the resistive layer 110 and the flexible substrate 100 . the resistive layer 110 is made of ni — cu alloy , ni — cr alloy , f — cr alloy , cu — mn alloy , cu — mn — sn alloy , ni — cr — al alloy , ni — cr — fe alloy , and so on . in the embodiment , the resistive layer 110 is a sheet of ni — cu alloy with a thickness of 50 ˜ 300 μm . the resistive layer 110 is a whole rectangular sheet or may form special shape of opening or groove thereon to have a predetermined resistance value . the flexible substrate 100 is plastic material , such as polyimide ( pi ), polyethylene terephthalate ( pet ), bismaleimide - triazine resin ( bt resin ), having preferable chemical stability with a thickness of 12 ˜ 45 μm . the adhesive layer 130 may be material of epoxy and acrylic resin etc . with a thickness of 13 ˜ 102 μm . also , the adhesive layer 130 may be a heat dissipation adhesive with a property of heat dissipation . the electrode layer 120 includes a first electrode part 121 and a second electrode part 122 located at two opposite sides of a lower surface of the resistive layer 110 . the first electrode part 121 and a second electrode part 122 have material of copper or copper alloy . in addition , the resistive device 20 of the embodiment may further include a first outer welding layer 126 covering the first electrode part 121 and a second outer welding layer 127 covering the second electrode part 122 . the first outer welding layer 126 and the second outer welding layer 127 may be used to connect other external components . the first outer welding layer 126 and the second outer welding layer 127 may include a single welding layer or welding multi - layer such as ni layer and sn layer formed by electroplating or sputtering process . in order to prevent the resistive layer 110 from contamination or oxidation , a first protective layer 140 may cover on the lower surface of the resistive layer 110 between the first electrode part 121 and the second electrode part 122 . furthermore , the resistive device 20 of the embodiment may further cover a second protective layer 150 on an upper surface of the flexible substrate 100 . the first protective layer 140 and the second protective layer 150 may have material of epoxy and acrylic resin . in the embodiment , there is not provided a ceramic substrate that is hard to work in the resistive deviceso that the resistive device can be easily further reduced the size . in addition , because both the flexible substrate 100 and the adhesive layer 130 are flexible , the resistive device 20 may have preferable flexibility , and thus the use of the resistive device is wide - spreading . also , the flexible substrate 100 may be easily made thinner because of good workability in such a manner that the resistive device 20 of the present invention has lower thermal impedance . the adhesive layer 130 of the present invention may have preferable heat conductivity due to without using glass fiber . please refer to fig3 . fig3 shows a second embodiment of a resistive device according to the present invention . the difference between the second embodiment and the first embodiment is that the resistive device 30 of the second embodiment may further include a metal layer 160 sandwiched between the flexible substrate 100 and the second protective layer 150 . the effect of heat dissipation of the resistive device 30 can be enhanced by preferable heat conductivity of the metal layer 160 . in this embodiment , the metal layer 160 may preferably have a thickness of 8 ˜ 105 μm , further preferably have a thickness of 8 ˜ 70 μm , and particularly preferably have a thickness of 8 ˜ 35 μm of copper , copper alloy or other metal material with preferable heat dissipation . please refer to fig4 . fig4 shows a third embodiment of a resistive device 40 according to the present invention . the difference between the third embodiment and the second embodiment is that the resistive device 40 of the third embodiment may further include a metal layer 160 having a first metal sheet 162 and a second metal sheet 164 separated with each other , and sandwiched between the flexible substrate 100 and the second protective layer 150 . there is no limitation for the shape of the first metal sheet 162 and the second metal sheet 164 , and the shape may be directed according to the required heat dissipation . in this embodiment , the second protective layer 150 covers the first metal sheet 162 and the second metal sheet 164 , and fills into an area between the first metal sheet 162 and the second metal sheet 164 . in another embodiment , the second protective layer 150 may only fill into the area between the first metal sheet 162 and the second metal sheet 164 without covering the first metal sheet 162 and the second metal sheet 164 . in the embodiment , the first metal sheet 162 and the second metal sheet 164 may have material of copper or copper alloy with a preferable thickness of 8 ˜ 105 μm , a further preferable thickness of 8 ˜ 70 μm and a particular preferable thickness of 8 ˜ 35 μm . please refer to fig5 . fig5 shows the fourth embodiment of a resistive device according to the present invention . the difference between the fourth embodiment and the first embodiment is that the resistive device 50 of the fourth embodiment has no adhesive layer for adhering the resistive layer 110 on the lower surface of the flexible substrate 100 . the resistive layer 110 is directly attached to the flexible substrate 100 . a method for manufacturing a resistive device of the invention is described as following . please refer to fig6 ( a )˜ fig . 6 ( g ). at first , as shown in fig6 ( a ) , a flexible substrate 100 and an adhesive layer 130 are provided , wherein the flexible substrate 100 has a metal layer 160 attached on an upper surface thereof , and the adhesive layer 130 may attach on a release film 170 ; the release film 170 can be removed after the adhesive layer 130 is attached on the flexible substrate 100 . next , as shown in fig6 ( b ) , the flexible substrate 100 is attached on the resistive layer 110 with the adhesive layer 130 , and the flexible substrate 100 and the resistive layer 110 adhere close with the adhesive layer 130 by thermal press to form a plate assembly , as shown in fig6 ( c ) . next , as shown in fig6 ( d ) , the resistive layer 110 is etched to form a recess 111 for adjusting the resistance value of the resistive layer 110 . also , the metal layer 160 is etched to form a groove 161 , and thus a first metal sheet 162 and a second metal sheet 164 separated with each other are formed . next , as shown in fig6 ( e ) , a first electrode part 121 and a second electrode part 122 having electrical conductive function located at two opposite sides of a lower surface of the resistive layer 110 are formed by electroplating , press fitting or welding process . next , as shown in fig6 ( f ) , a first protective layer 140 is formed on the lower surface of the resistive layer 110 between the first electrode part 121 and the second electrode part 122 to prevent the resistive layer 110 from contamination or oxidation . also , a second protective layer 150 is formed on an upper surface of the flexible substrate 100 to provide enough strength for supporting the resistive device . at last , as shown in fig6 ( g ) , a first outer welding layer 126 covering the first electrode part 121 and a second outer welding layer 127 covering the second electrode part 122 are formed to increase the adhesion of the first electrode part 121 and the second electrode part 122 , and to increase the bonding strength between the resistive device and pcb . it should be noted , with the above manufacturing method , the flexible substrate 100 having a metal layer 160 on an upper surface thereof is provided in the beginning . in the another embodiment , the above manufacturing method may proceed by only the remaining flexible substrate 100 . for example , the embodiment of the method may manufacture the resistive device of fig3 or fig4 with the metal layer 160 . the embodiment of the method may manufacture the resistive device of fig2 without the metal layer 160 . as shown in fig7 ( a )˜ fig . 7 ( e ), which illustrate another method for manufacturing a resistive device of the present invention . as shown in fig7 ( a ) , a flexible substrate 100 and a resistive layer 110 directly attached with each other are provided , wherein there is no adhesive layer between the flexible substrate 100 and a resistive layer 110 for adhering them . in one embodiment , the flexible substrate 100 is directly formed on the resistive layer 110 , for example , a liquid soft material is coated or printed on the resistive layer 110 , and then the flexible substrate 100 is formed and attached on the resistive layer 110 by curing the liquid soft material . in another embodiment , the resistive layer 110 may be formed on the flexible substrate 100 by film - forming method , for example , the resistive layer 110 is formed on the flexible substrate 100 by thick film or thin film process . next , as shown in fig7 ( b ) , a first electrode part 121 and a second electrode part 122 having electrical conductive function located at two opposite sides of a lower surface of the resistive layer 110 are formed by electroplating , press fitting or welding process . also , in this embodiment , a metal layer 160 is further formed on the flexible substrate 100 . it should be noted , the metal layer 160 is used for increasing the heat dissipation of the resistive device , and it can be removed if need . as shown in fig7 ( c ) , the resistive layer 110 is etched to form a recess 111 for adjusting the resistance value of the resistive layer 110 . also , the metal layer 160 is etched to form a groove 161 , and thus a first metal sheet 162 and a second metal sheet 164 separated with each other are formed . as shown in fig7 ( d ) , a first protective layer 140 is formed on the lower surface of the resistive layer 110 between the first electrode part 121 and the second electrode part 122 to prevent the resistive layer 110 from contamination or oxidation . also , a second protective layer 150 is formed on an upper surface of the flexible substrate 100 to provide enough strength for supporting the resistive device . as shown in fig7 ( e ) , a first outer welding layer 126 covering the first electrode part 121 and a second outer welding layer 127 covering the second electrode part 122 are formed to increase the adhesion of the first electrode part 121 and the second electrode part 122 , and to increase the bonding strength between the resistive device and pcb . the described embodiments are preferred embodiments of the present invention . however , this is not intended to limit the scope of the invention . the equivalent changes and modifications may be made in accordance with the claims of the invention without departing from the scope of the invention . | 1 |
a progressive forging machine 10 diagrammatically illustrated in fig1 includes a die breast 11 on which are mounted dies and a slide or ram 12 on which are mounted tools or punches . the dies and punches are sometimes referred to as tooling . reference may be made to aforementioned u . s . pat . no . 4 , 898 , 017 for a description of a similar type of forging machine . the die breast 11 and slide 12 each have a plurality of cooperating work stations b1 through b6 and s1 through s6 , respectively , indicated at their centers . the die breast 11 is rigid with respect to the machine frame designated 13 . the slide 12 riding on liners or bearings reciprocates horizontally towards and away from the die breast to progressively forge workpieces that are transferred to successive work stations b1 - b6 on the die breast 11 . fig2 illustrates a typical work station b on the die breast 11 in section . a cradle block 16 is rigidly bolted down on a horizontal surface 15 of the die breast 11 with bolts 17 . an upper surface 18 of the cradle block is a concave cylindrical pocket formed by a precision machined area . the imaginary axis of the surface 18 is coincident with the center of the associated work station b and , consequently , is horizontal and is parallel to the direction of slide movement . the cradle block 16 is adapted to support a die cassette 19 which is formed as a bolted assembly of a main body 21 and a plate 22 . the main body 21 is precision formed with a cylindrical bore 23 and a cylindrical outer surface 24 concentric with the bore . the radius of the cylindrical cassette body surface 24 is equal to the radius of the cradle surface 18 so that the axis of the bore 23 is situated at and represents the true center of the respective work center b . a tool case or a tool can be locked in the bore 23 by a transverse bar 26 bolted to the body 21 . the plate 22 is bolted to a rear face of the body 21 . this plate 22 includes a bore aligned with the body bore 23 . the plate 22 extends below the body 21 and includes a forward facing side with a chamfer surface 27 at its lower end and an undercut surface 28 adjacent the body 21 inclined forwardly and downwardly . at each station b1 - b6 underneath the respective cradle 16 , a rocker arm 36 pivots on a shaft 37 carried in blocks 38 retained on the bolster by bolts 39 . each rocker arm 36 is operated by an associated hydraulic actuator 41 having a rod 42 contacting one end 43 of the arm . an opposite end 44 of the arm 36 has a surface 46 engageable with the undercut surface 28 of the plate 22 . it will be understood that a separate cradle block 16 , rocker arm 36 and actuator 41 is provided for each work station b1 - b6 . a z - shaped bracket 47 is bolted to the top of the plate 22 for enabling the die cassette assembly 19 to be manipulated by an automatic handling device . referring now to fig4 a , b and 6b , a punch holder mounting plate assembly 51 forms a cassette for the tools or punches carried on the slide 12 . the mounting plate assembly or cassette 51 , as is typical for each of the working stations s1 - s6 , has the form of an inverted l in side view and is comprised of a vertical plate 52 and a bracket 53 bolted to the vertical plate . a punch holder 54 is typically bolted to the plate 52 . the lower end of the plate 52 , ( fig5 a at the station s5 ) has a profile of a circular arc 56 and a central vertical slot 57 . the circular end 56 is received in a cradle block 58 bolted to a machined face block 59 carried on the slide 12 . the bracket 53 has a tapered profile at 62 and a central slot 63 on its lower side that includes an internal vertical clamping shoulder 61 revealed at the station s4 in fig5 a where the bracket is shown with the plate 52 removed . the bracket 53 is received between a respective pair of gage blocks 64 mounted by bolts on the top of the face block 59 against dowel pins 66 pressed into the slide mounted block 59 . the mounting plate assembly or cassette 51 is retained on the slide 12 by a pair of clamp bars 68 , 69 disposed in the respective slots 57 and 63 . spring packs 72 bias the bars 68 , 69 to a clamping position , in a direction away from the die breast 11 , and hydraulic pistons 73 in chambers 74 are actuated to override the clamping force of the springs 72 and release the assembly 51 . the l - shaped configuration of the assembly 51 and a recess 76 in an associated component 77 affords a space for a knockout 78 or other instrumentality associated with a tool . a plate 65 suitably attached to the top of the cassette assembly 51 enables the assembly to be handled conveniently for example , by an overhead robotic arm . with reference to fig7 in accordance with the invention , the tool supporting structures on the bolster or die breast 11 and slide 12 in the form of the cassettes 19 , 51 in the disclosed embodiment , at each work station , are mutually precisely located relative to one another so that the axes of their centers are coincident to the extent that measurement and precision adjustment permit . the alignment can be accomplished by positioning a fixture 79 in a die cassette 19 mounted and clamped on the cradle 16 of a particular work station . with the slide 12 in an advanced position and a punch cassette 51 coarsely located on its cradle 58 , measurements can be made between the fixture 79 and a punch holder 54 on the punch cassette to determine any eccentricity existing between the axis of the fixture 79 , and therefore the die cassette bore 23 , and the center on the punch cassette represented by the bore in the punch or tool holder 54 . a gage block 82 is precision ground in its vertical dimension and located under the cradle block 58 to vertically adjust the cradle block so that the axis of its tool holder 54 is at the same vertical location as is the bore 23 of the die cassette . the gage block 82 is bolted to the cradle block 58 and those elements are bolted to the slide mounted face block 59 . the pair of gage blocks 64 that straddle the bracket 53 at the upper end of the tool cassette 51 are precision ground in their horizontal width to adjust and thereby locate the cassette so that the center of its tool holder 54 is horizontally precisely aligned with the center of the die cassette bore 23 . each gage block 64 rests horizontally against dowel pins 66 press fitted into the top of the face plate 59 and are bolted to this top surface . the surfaces 84 of the gage blocks 64 in contact with the cassettes are in vertical planes parallel to the slide motion and opposite surfaces rest against the dowel pins 66 pressed into the block 59 . the actual work station center on the punch holder 51 is roughly midway between the cradle block 58 and the gage blocks 64 . the arcuate shape of the cradle surface , designated 60 , which is cylindrical and has an axis parallel to slide movement allows the cassette to pivot about this surface for horizontal adjustment of the center without significantly affecting the vertical position of the center . to make initial measurements , slightly undersize gage blocks can be used at the top face plate block 59 . the measurement and alignment technique is done manually at each work station s1 - s6 when the machine is originally manufactured . particularly on large machines , this technique produces a degree of alignment between the die and punch work stations b1 - b6 and s1 - s6 that has not been practically achieved in earlier constructions . the cassettes 19 and 51 are adapted to be manipulated automatically with a robotic tool changer similar to that shown in aforementioned u . s . pat . no . 4 , 304 , 041 . an overhead arm of the automatic tool changer can be arranged to grip one or simultaneously both cassettes 19 , 51 at any particular work station . the die cassette 19 is gripped at the z - shaped plate 47 and the punch cassette is gripped at the plate 65 . the automatic tool changer is positioned over such work station and the cassettes 19 , 51 are lowered towards their respective positions on the bolster 11 and slide 12 . at this time , the surface 46 of the rocker arm 36 is retracted by lowering the rod 42 and adjacent end 43 of the arm through control of the actuator 41 by signals from the machine controller . in this position , the gripping surface 46 is nearly vertical and there is sufficient clearance between it and the bolster to allow passage therebetween of the lower end of the plate 22 . the chamfer surface 27 on the lower end of the plate 22 and a chamfer 86 on a bolster plate 87 facilitate registration of the die cassette into the receiving zone formed by the cradle surface 18 in the lateral direction and by the bolster plate 87 and the clamp arm end 43 in the axial or slide direction . the concave surface 18 of the cradle block 16 mating with the convex surface of the main body 21 guides the die cassette 19 as needed in directions lateral of the direction of slide movement . thus , the die cassette 19 and its receiving zone are mutually self - aligning . with the cassette 19 resting on the cradle block 16 , the master controller for the machine causes the actuator 41 to extend the rod 42 upwardly to rock the arm 36 . the arm surface 46 , because it reacts against the inclined or undercut surface 28 which extends in both horizontal and vertical directions , causes the cassette 19 to be tightly drawn against the breast plate 87 and onto the cradle 16 . the cassette 19 is , consequently , accurately located in the same position on the cradle 16 each time it is installed . at the same time as the automatically controlled tool changer is lowering the die cassette 19 into place , it can lower the punch cassette 51 into position on the slide . the lower end of the plate 52 is tapered at 91 , as viewed from the side in fig4 allow self - alignment to the annular grooves 93 , in the respective clamp bar 68 , in both axial directions parallel to the slide motion . at the lower end of the plate 52 , the cassette 51 is self - aligning to the clamp bar 68 by virtue of a rounded throat opening of the slot 57 and the round cross - section of the bar . when fully lowered , the convex surface 56 on the lower end of the plate 52 is self - aligning with the concave surface 60 of the cradle 58 . at the upper end of the punch cassette 51 , the bracket leg 61 is self - aligning to the gage blocks 64 by virtue of its tapered profile 62 enabling this part of the cassette to align itself laterally between the opposed set of gage blocks as it is lowered into position . it will be understood that surfaces 84 of the gage blocks 64 which laterally confine the cassette 51 lie in vertical planes parallel to the axis of slide motion . as previously described , the gage blocks 64 , cooperating with the cradle block 58 , which is vertically gaged by the block 82 , constrain the cassette into a position that is precision aligned with the die cassette 19 . it will be understood by those skilled in the art that ordinarily a die cassette will have its bore 23 supporting a tool holder which in turn will support an actual die . however , there may be occasion in the making of specific parts that it is desirable to make a die larger than would ordinarily be used with a machine of a given center - to - center distance between stations . in such a case , the main body 21 of the die cassette can be used as a tool holder itself . still further , where a part being made is relatively oversize , it is possible to make a special die cassette at a particular station with oversize dimensions in a lateral direction , but keeping the geometry of the cylindrical surface 24 . in such a case , adjacent die cassettes would be correspondingly reduced in size . if necessary , similar techniques can be used on the tool cassettes on the slide . it should be evident that this disclosure is by way of example and that various changes may be made by adding , modifying or eliminating details without departing from the fair scope of the teaching contained in this disclosure . the invention is therefore not limited to particular details of this disclosure except to the extent that the following claims are necessarily so limited . | 1 |
in fig5 , a pump 10 is shown very schematically , which pump is configured as a radial impeller pump . in the pump chamber , said pump comprises an impeller 11 which draws a fluid through a central suction structure and which discharges said fluid in radial direction into the pump chamber . from there , the fluid can exit through an outlet after a few circulations within the pump chamber . that is known from the prior art . the impeller 11 is specifically configured for said pump , as can be seen from the fig1 to 4 . in the oblique view according to fig1 , the impeller 11 comprises an upper cover plate 13 and a lower cover plate 20 . the upper cover plate 13 comprises a central suction opening 14 . concentrically thereto , the lower cover plate 20 comprises an axle seat 21 by means of which the impeller 11 is plugged onto an axle of the pump motor . the axle seat 21 configured as rounded - off elevation also deflects the drawn in fluid radially outwards . as can be seen from fig1 , the upper face of the upper cover plate 13 is flat except for a slightly thicker edge of the suction opening 14 , as can also be seen in particular from fig4 . the same is true also for the bottom face of the lower cover plate 20 , but in both cases this is not obligatory . likewise , however , a bottom face 16 of the upper cover plate 13 is flat or planar , in particular plane - parallel to the upper face . except for a central region with the axle seat 21 , this is also true for an upper face 23 of the lower cover plate 20 . in particular the bottom face 16 and the upper face 23 are again plane - parallel to one another except for the region of the axle seat 21 . the impeller 11 comprises five blades 27 , the shape or course of which can especially be seen from fig2 and 3 . the blades 27 are in each case configured or shaped identically . an outer edge 28 a of the blades 27 corresponds to an outer edge 18 of the upper cover plate 13 and an outer edge 24 of the lower cover plate 20 . the outer edge 28 a of the blades 27 extends significantly inclined or oblique , see in particular fig1 and 4 . here , the initial angle towards the lower cover plate 20 is approximately 20 °, in the upper region towards the upper cover plate 13 the angle is greater , namely approximately 40 °. in the longitudinal course of the blades 27 radially inwards , the inclination decreases more and more , down towards an inner edge 28 b , where said blades extend almost perpendicular relative to the cover plates 13 and 20 and parallel to the central longitudinal axis of the pump or to the rotation axis of the impeller 11 . the inner edge 28 b of the blades 27 is located approximately at the point where the slowly increasing axle seat 21 starts . furthermore , the blades 27 are arranged at an equal distance to one another or are distributed equally , respectively . the side view according to fig4 shows that the inclination steadily increases at the outer edge 28 a of the blades 27 , i . e . strictly monotonously . it can be seen from the plane view according to fig3 that a curvature of the blades 27 also increases from outwards to inwards , although only slightly . per se , such an impeller 11 could be designed from multiple parts during the production in any manner , with blades changing in terms of their inclination in the longitudinal course thereof , since a production by means of synthetic material injection molding is very variable , for example . in particular when a separate upper cover plate is applied to the blades , for example by adhesive bonding , the upper cover plate and the lower cover plate could also be configured in a curved manner , as known from other impellers of similar pumps , see for example u . s . pat . no . 8 , 245 , 718 b2 . however , in order to allow a one - piece configuration and production and to avoid elaborate , expensive and susceptible curved pushers , at least the bottom face 16 of the upper cover plate 13 and the upper face 23 of the lower cover plate 20 have to be plane - parallel to one another or expand from inwards to outwards in a continuous manner , namely in each case in the radial direction . thus , they cannot be curved as known from the aforementioned prior art . in the case of an impeller 11 configured that way , a linear pusher 30 can be used for production as shown in the figures , or five such linear pushers are used , respectively . the push direction s is illustrated . a mold side 31 facing rightwards in the fig3 and 4 is configured exactly the way as to correspond to the side of the blades 27 facing the lower cover plate 20 and in the rotation direction of fig3 . a blade region 33 on the mold side 31 corresponds exactly to said side of the blade 27 . adjacent thereto , there is an inner region 34 which towards the axle seat 21 so to say defines in each case the inner edges 28 b of the blades 27 . the axle seat 21 per se is produced by means of another pusher , which in fig3 is driven into the drawing plane . another blade region 33 ′ on the linear pusher 30 forms , on the blade 27 adjacent in the circumferential direction , the side of the blade 27 facing in the counter - rotation direction , i . e . the side facing the afore described blade . by means of the impeller 11 having the blades differently inclined in the longitudinal course thereof , very good pumping characteristics of the impeller can be achieved . a desired and very advantageous one - piece production is achieved by means of the plane - parallel cover plates or the plane - parallel faces of the cover plates facing to one another , and by means of the illustrated and described linear pushers . even though the molding tool for the impeller is somewhat more elaborate , the production method per se by means of synthetic material injection molding can be controlled in a good manner and results in good properties of the impeller . it is still much more easy to realize than with curved pushers . | 5 |
a prior art electric motor control 20 is illustrated in fig1 . as shown , a pair of redundant stators 22 and 24 are provided to drive a shaft 26 . the stators include three coils associated with three phases of electrical power , and control coils 27 . the buck regulator comprises of a power stage 32 , a controller 30 and inductor 27 . the buck inductor 27 utilizes a control coil of a regulated permanent magnet machine . the buck regulators control the dc bus current to the inverters 28 . in this prior art system , a signal to shut down one of the faulty electric motors 22 or 24 would come from 34 , into the buck regulators . this is undesirable , since the control coil is sized to handle full motor power to achieve full torque control and not just for protection . the electromagnetic decoupling in dual redundant arrangement can be achieved by designing the motor with considerably smaller size control winding . the prior art does not includes a transient suppressor ( a power resistor connected via power switch to the dc bus ) that would be required during fuel pump fast shutdown to keep dc bus voltage within specification limits , when the motor operates in a regenerative mode . this resulted in undesirably heavy components required by the control for the aircraft fuel pump . fig2 is a schematic of an improved system 39 . in system 39 , a prime mover 40 such as a gas turbine engine , is driven to rotate and generates power by an electric power generating system 42 . as known , the power generating system 42 supplies power over a dc bus 43 to customer load 44 . the customer load 44 may be any number of components on an aircraft . in addition , an accessory bus 45 supplies power to a motor controller 46 , which controls a fuel pump 48 . in this basic architecture , the bus 45 may also supply power to a plurality of accessories which are associated with the gas turbine engine , such as a water pump , a fuel pump , and a lubricant pump . a shutdown switch 50 supplies a shutdown signal to the motor controller 46 . when a shutdown signal is received at the motor controller 46 , a signal 52 is sent back to the electric power generating system 42 . fig3 shows the motor controller 46 . as shown , the fuel pump 48 is provided with a rotor 55 . the plurality of stator windings 54 receive voltage through an inverter 56 . a dc power source 58 , which , in a disclosed embodiment , is the accessory bus 45 , supplies the power through the inverter 56 to control the current associated with the three phase coils 54 , to in turn drive the rotor 55 . a control coil 60 is also associated with the stator for the electric motor . a coil control switch 62 , which may be a mosfet , receives a shutdown signal such as shown at 68 . a pulse width modulator 66 receives the shutdown signal from 68 , and sends a signal through a gate drive 64 to control the switch 62 . when the switch 62 is opened , then power no longer flows to the control coil 60 , and the motor is no longer driven . in the dual redundant arrangement the control coil 60 would electromagnetically decouple this motor from the second one sharing the same rotor shaft . the signal at 68 may be a signal of a potential problem , such as an over - current , an over - voltage , or some other type of emergency such as a fire or fuel leak . as is clear from the fig3 schematic , the switch 62 , which functions as a shut off switch , is positioned intermediate the inverter 56 and the control coil 60 , and upstream of the control coil 60 , and downstream of the inverter 56 , relative to power flow . the motor control utilizes a current - mode bidirectional voltage source inverter 56 . a position feedback signal 70 is sent to a speed detector 72 , a coordinate transformation unit 202 and a space vector modulator 88 . the coordinate transformation unit 202 derives direct ( id_fdbk ) and quadrature ( iq - fdbk ) components of stator current from current transducers 201 . a comparator 74 , which also receives a reference speed signal ( spd_ref ), produces a speed error signal that is processed by a proportional - integral regulator ( pi ) 76 to obtain torque producing reference ( iq_ref ). a shutdown signal 78 is provided on this line , and may be driven to open when the signal is provided at 68 . at this point , the desired current iq_ref would become zero at the comparator 80 . a look - up table 84 produces a direct current reference ( id - ref ) as a function of speed . the motor &# 39 ; s d and q current loops are closed using comparators 86 and 80 , and pi regulators 203 and 204 respectively . the outputs of the current loop pi regulators ( vd_ref and vq_ref ) would then go to a space vector modulator 88 , which would in turn control the gate drives 90 to control current in the stator windings 54 . in addition , when there is a zero signal such as a shutdown signal from the switch 78 , a differentiator 82 supplies a feed forward signal 52 back to a voltage regulator for the power generating system . this will be explained with regard to fig4 . an electric power generating system 42 is shown in fig4 . the prime mover 40 , which may be a gas turbine engine , is associated with a generator 213 . generator 213 can be a flux regulated permanent magnet machine with control coil 92 . generator 213 supplies power through a rectifier 43 , dc filter is comprised of a capacitor 206 , and to a dc bus 43 , and the accessory bus 45 . power quality / emi filter 212 is used to ensure that power quality provided to the customer load meets specification requirements . the voltage regulation on dc bus 43 is achieved by controlling current in the control winding 92 in response to the feedback voltage ( vdc_fdbk ) obtained from the voltage transducer 207 , and includes voltage and current loops . the voltage loop includes a comparator 102 and a pi regulator 211 . the comparator 102 derives a voltage error between reference ( vdc_ref ) and a feedback signal ( vdc_fdbk ). in addition , the comparator 102 includes a third input to accommodate a feedforward signal from the motor - pump controller 48 to maintain power quality on dc bus during large transients associated with the motor - pump , such as fast shutdown . the pi regulator 211 produces a current reference signal ( icc_ref ) in response to the output of comparator 102 . the current loop includes an h - bridge 94 , a current transducer 214 , a comparator 100 , a pi regulator 209 , a pwm modulator 210 , and a gate drive 96 a comparator 100 derives a current error signal between current reference ( icc_ref ) and feedback signal ( icc_ref ) obtained form the current transducer 208 . this signal is processed by a pi regulator 209 to derive a duty cycle for the pwm modulator 210 that controls the gate drive 96 . the h - bridge 94 controls current in the control coil 92 in response to the current reference icc_ref . when the fuel pump electric motor is set into regenerative mode to achieve fast shutdown , there could be a spike of voltage supplied downstream through the bus 43 . however , by providing the feedforward signal 52 back upstream , the voltage transients on the dc bus 43 can be significantly improved . in sum , the present invention provides lower weight system to achieve fast shutdown and a fault redundant architecture of an electric motor for a fuel pump . the invention is particularly well suited for use in controlling a fuel pump for a gas turbine engine in an aircraft application . although an example embodiment has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of the claims . for that reason , the following claims should be studied to determine their true scope and content . | 5 |
the compound of formula ( i ) has a uretdione group content of 1 . 5 - 2 mmol / g , a cyclic amidine group ( imidazoline ) content of 0 . 3 - 2 % by weight , and a free nco group content of 0 . 2 - 7 % by weight , preferably 1 - 3 % by weight . the melting point of the compound is within a range of about 80 °- 160 ° c . the present compound further is outstandingly suitable for the preparation of solvent - resistant epoxy resin powder coatings and for bonding metals with enhanced lap shear strength at elevated temperatures . the ipdi uretdione employed in the process according to the invention is described in de - a 30 30 513 and has an nco content of 17 - 18 % by weight with a monomer content of & lt ; 0 . 7 % by weight , after heating at 180 ° c . ( 0 . 5 h ) the nco content is 37 - 37 . 6 % by weight . the reaction between ipdi uretdione and diol or disecondary diamine is carried out in an inert solvent , for example , an aromatic hydrocarbon , an ester or a ketone . acetone has proven to be a particularly advantageous solvent . the compounds which are suitable for the chain extension of the ipdi uretdione are , on the one hand , diols as described , for example , in de - a 27 38 270 , p . 10 , and on the other hand disecondary diamines , as are obtained , for example , in a known manner from the corresponding diprimary diamines by reaction with a carbonyl compound , for example a ketone or aldehyde , followed by hydrogenation . a particularly simple method of preparing the disecondary compounds is the addition reaction of acrylic esters ( ch 2 ═ ch -- coor 2 ) with the primary amino groups of the diprimary diamines ( h 2 n -- r 1 -- nh 2 ). in the chain extension of the ipdi uretdione with diols , the diol , for example ethylene glycol , diethylene glycol , butanediol , 3 - methyl - 1 , 5 - pentanediol , 1 , 6 - hexanediol , decanediol , dodcanediol or 2 , 2 , 4 ( 2 , 4 , 4 )- trimethyl - 1 , 6 - hexanediol , is added at 60 ° c . to the acetone solution of the ipdi uretdione and the mixture is heated further at 60 ° c . until one nco group is reacted per oh group employed . in order to accelerate the reaction it has proven advantageous to add 0 . 01 - 0 . 1 % by weight of dibutyltin dilaurate ( dbtl ). in reacting the ipdi uretdione with disecondary diamines , the diamine is metered at room temperature into the acetone solution of ipdi uretdione at a rate such that the temperature of the reaction mixture does not exceed 40 ° c . after the end of the addition of diamine , the reaction too is also virtually at an end . the addition of a catalyst is not necessary . then , in order to prepare the compound according to the invention , the reaction product from the first stage , which is the acetone solution of the chain - extended ipdi uretdione , is reacted in a 2nd reaction step with the cyclic amidine at 60 ° c . the cyclic amidine is added at about 60 ° c . in portions to the acetone solution of the chain - extended ipdi uretdione . after the end of the addition of amidine , heating is continued for about 1 h in order to complete the reaction . then the acetone is removed by distillation . then a vacuum is applied in order to remove the last residues of acetone . it has been found particularly advantageous to isolate the reaction product by removing the acetone in a film extruder under vacuum . by the process according to the invention , 1 - 2 mol of cyclic amidine are reacted per mol of chain - extended ipdi uretdione ( λ2 nco equivalents ). the cyclic amidines which are appropriate for preparing the compounds according to the invention are described in de - a 22 48 776 and de - a 28 35 029 . particularly suitable amidines are 2 - phenylimidazoline , 2 - phenyl - 4 - methyl - imidazoline and 2 , 4 - dimethylimidazoline . the present invention also provides pulverulent coating compositions of high storage stability and excellent solvent resistance which are based on 1 , 2 - epoxide compounds having more than one 1 , 2 - epoxide group and more than one oh group in the molecule , on curing agents and on customary coatings additives , wherein the coating composition comprises the following compound as a hardener : ## str9 ## in which x , r , r 1 , r 2 , r 3 , n and b are as defined supra , having an oh : nco ratio of from 1 : 0 . 25 to 1 : 1 , preferably 1 : 0 . 5 , the content of cyclic amidine ( in bonded form ) is from 2 to 8 % by weight , preferably from 3 to 6 % by weight , based on the sum of epoxide compound and hardener , and the hardener comprises from 0 . 5 to 1 mol of cyclic amidine per nco equivalent . the hardener ( 1 ) according to the invention is compatible with oh - containing ep resins and at elevated temperatures produces homogeneous melts which are very suitable for preparing pulverulent coating compositions . they are stable on storage at room temperature , with curing times within 30 - 5 minutes in the temperature range 160 °- 200 ° c . epoxide compounds which are suitable for preparing the pulverulent coating compositions according to the invention , which are to be used as powder coatings , are of course only those containing more than one oh group in the molecule . these are ep resins which are obtained by reacting bisphenol a and epichlorohydrin in a molar ratio of n :( n + 1 ) where n is 2 - 7 . particularly suitable epoxy resins are those having a ep equivalent weight of about 900 and an oh equivalent weight of 300 . the powder coatings are prepared , for example , by grinding and mixing the individual components , which are ep resin , chain - extended ipdi uretdione blocked with cyclic amidines , and , if desired , additives such as levelling agents , pigments , fillers , uv stabilizers and antioxidants and extruding the mixture at 80 °- 110 ° c ., preferably 90 °- 100 ° c . after extrusion , the mass is cooled and is ground to a particle size of less than 100 μm . in the preparation of the binder mixture , the components must be matched to each other such that per oh equivalent of the ep resin there is 0 . 25 - 1 , preferably 0 . 5 , blocked nco group of the hardener together with a cyclic amidine content ( in blocked form ) of 2 - 8 % by weight , preferably 3 - 6 % by weight , based on the sum of resin + hardener . the proportion of hardener , therefore , must be chosen such that its cyclic amidine content is sufficient for catalytic curing of the ep resin ( polymerization of the epoxide groups ) without the oh groups reacting , and at the same time achieving crosslinking of the ep resin by reaction of the oh groups of the ep resin with the blocked nco groups of the hardener , the ep groups , however , remaining intact . the application of the powder coatings to the substrates to be coated can be carried out by known methods , for example by electrostatic powder spraying or fluidized - bed sintering . the coated articles are subsequently cured for 5 - 30 minutes in the temperature range 200 °- 160 ° c . substrates suitable for coating with the pulverulent coating compositions according to the invention are all those which withstand the curing conditions indicated , examples being metals , glass and ceramic . the powder coatings thus prepared are notable for very good coatings properties and outstanding resistance to aggressive solvents such as , for example , methyl isobutyl ketone . the present invention also embodies the use of the compounds of the invention in the preparation of pulverulent , one - component metal adhesives . the resin / hardener mixture suitable for bonding metals is identical with the pulverulent coating compositions , i . e . has the same composition , preparation and application , and in the case of the bonding of metals it is even sufficient to apply the powder to the metal panels by sieving . after the clean surface of one metal has been coated with the resin / hardener mixture according to the invention , it is fixed with the other metal to be bonded with the aid of a screw clamp . curing takes place , as in the case of the powder - coated substrates , at 160 °- 200 ° c . within 30 - 5 minutes . the metal bonds thus produced differ markedly from the ep - based one component metal adhesives currently available on the market with respect to their strength ( lap shear strength as determined by the procedure of din 53 283 ) at elevated temperatures . the pulverulent metal adhesives based on ep resins that are currently on the market consist of a ( solid ) ep resin which is cured with dicyandiamide . the metal bonds produced therewith exhibit lap shear strengths which are excellent at room temperature but which decrease sharply with rising temperature and are virtually zero at 150 ° c ., in other words , the bond fails at 150 ° c ., whereas bonds with the resin / hardener mixture according to the invention still have lap shear strengths at 150 ° c . which are about 10 n / mm 2 . the diol is metered in over the course of about 1 hour with intensive stirring to an acetone solution of the ipdi uretdione ( about 50 % acetone based on the sum of ipdi uretdione + chain extender + cyclic amidine ), which contains 0 . 05 % by weight dibutyltin dilaurate , and the mixture is heated further at 60 ° c . until one nco equivalent has reacted per oh equivalent employed . the cyclic amidine is then added in portions . after the addition of amidine has taken place , heating is continued at 60 ° c . for about 1 h . the acetone is then removed by distillation . in order to remove the last residues of acetone , vacuum is applied to the reaction mass . if a disecondary diamine is used instead of the diol for chain extension of the ipdi uretdione , the reaction takes place at room temperature and without dbtl . the ipdi uretdione used for chain extension was prepared in accordance with the reaction conditions described in example 2 of de - a 30 30 513 . the nco content of the ipdi uretdione was 17 . 3 %; on heating at 180 ° c . ( 0 . 5 h ) an nco content of 37 % was found . table 1__________________________________________________________________________compounds according to the invention glass % ncocomposition of the compounds according to the invention transition ( afteripdi point heating atexampleuretdione chain extender cyclic amine m . p . ( dsc ) % nco 180 ° c . nh . sub . 2no . mol ! mol ! mol ! ° c .! ° c .! ( free ) for 1 mmol / g ! __________________________________________________________________________a ) 1 1 -- ## str10 ## 66 - 75 35 - 48 / 42 6 . 6 28 . 4 1 . 6a ) 2 3 2 ho ( ch . sub . 2 ). sub . 6oh 2 b 31 127 - 135 96 - 112 / 100 0 . 1 18 . 7 1 . 0a ) 3 2 1 ho ( ch . sub . 2 ). sub . 6oh 2 b 31 123 - 130 88 - 112 / 93 0 . 2 19 . 8 1 . 4a ) 4 3 2 ho ( ch . sub . 2 ). sub . 12oh 2 b 31 116 - 127 80 - 98 / 84 0 . 1 17 . 2 0 . 9a ) 5 2 1 ho ( ch . sub . 2 ). sub . 12oh 2 b 31 111 - 122 79 - 98 / 82 0 . 1 18 . 8 1 . 3a ) 6 4 3 hoch . sub . 2ch . sub . 2oh ( eg ) 2 b 31 146 - 153 123 - 134 / 126 & lt ; 0 . 1 19 . 3 0 . 8a ) 7 3 2 eg 2 b 31 133 - 141 117 - 128 / 122 & lt ; 0 . 1 19 . 7 1 . 06a ) 8 2 1 eg 2 b 31 128 - 139 108 - 118 / 115 & lt ; 0 . 1 20 . 7 1 . 5a ) 9 5 ## str11 ## ## str12 ## 163 - 175 132 - 145 / 140 1 . 2 15 . 4 0 . 3__________________________________________________________________________ *) r = hc radical of isophoronediamine the ground products each of hardener , epoxy resin and levelling agent masterbatch , were first of all mixed in dry form with the white pigment in an edge runner mill and then homogenized in an extruder at 80 °- 120 ° c . after cooling , the extrudate was crushed and ground in a pinned - disk mill to a particle size of & lt ; 100 μm . the powder thus produced was applied with an electrostatic powder spraying unit at 60 kv to degreased , optionally pretreated iron panels ( 1 mm thick ) and baked in a laboratory convection oven . 10 % by weight of the levelling agent , which is a commercially available acrylate - oligomer , are homogenized in the melt in the epoxy resin and , after solidifying , are comminuted . in the epoxy resin coating examples infra , a solid epoxy resin was used of the diglycidyl ether of bisphenol a prepared by reacting epichlorohydrin with bisphenol a , which , according to the manufacturer , has an epoxide equivalent weight of 900 - 1000 , an epoxide value of 0 . 10 - 0 . 11 , a hydroxyl value of 0 . 34 and a melting point of 96 °- 104 ° c . the powder coatings listed in table 2 contain 40 parts by weight of tio 2 , 0 - 5 part by weight of levelling agent , 59 . 5 parts by weight of binder , with the oh : nco equivalence ratio of resin to hardener being generally 2 : 1 . number of strokes with an mek - soaked cottonwool pad under a load of 1 kg until the surface is attacked ( matt surface ). table 2__________________________________________________________________________composition of the pigmented ( 40 % by weight tio . sub . 2 ) powders and thecoatings data ( after curing ) temp . ° c . ! nco oh 200 180 170exampleequiv . equiv . duration min ! no . hardener ep 10 20 30 15 25 25 30__________________________________________________________________________b ) 1 1 a ) 2 2 hk 138 150 140 154 152 155 153 gg 60 °& lt ;) 29 29 30 26 26 25 28 ch 0 0 1 0 0 1 0 el 3 . 1 3 . 4 6 1 1 . 3 1 . 8 1 . 3 bl rev . 20 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek 120 180 200 & gt ; 200 & gt ; 200 200 200b ) 2 1 a ) 3 2 hk 147 153 154 155 168 163 158 gg 60 °& lt ;) 40 53 56 42 44 38 45 ch 1 1 0 1 1 1 1 el 4 . 5 3 . 8 4 . 1 1 . 8 1 . 8 2 . 6 2 . 8 bl rev . 20 10 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200b ) 3 1 a ) 4 2 hk 185 183 175 192 184 179 180 gg 60 °& lt ;) 78 82 84 85 83 78 88 ch 1 1 1 1 1 0 0 el 7 7 . 8 7 . 4 6 . 7 6 . 4 7 . 1 6 . 7 bl rev . 60 50 50 50 50 40 40 mek & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 150 180b ) 4 1 a ) 5 2 hk 164 169 169 180 177 170 170 gg 60 °& lt ;) 80 76 68 68 69 60 70 ch 4 3 3 0 0 0 0 el 4 . 5 4 . 3 4 . 5 4 . 5 3 . 1 5 . 1 5 . 2 bl rev . 30 20 20 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek 80 120 200 130 180 80 110b ) 5 1 a ) 6 2 hk 101 130 109 133 140 139 128 gg 60 °& lt ;) 11 10 11 13 12 12 12 ch 0 0 0 0 0 0 0 el 1 . 1 1 0 . 8 0 . 9 0 . 8 0 . 6 0 . 7 bl rev . & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek 200 200 200 16 40 20 26b ) 6 1 a ) 7 2 hk 117 110 116 153 141 137 136 gg 60 °& lt ;) 19 18 19 21 20 20 21 ch 1 0 0 0 0 0 0 el 1 . 1 1 . 0 1 . 4 0 . 9 0 . 9 0 . 9 1 bl rev . & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek 200 & gt ; 200 & gt ; 200 26 80 46 60b ) 7a1 a ) 1 2 hk 179 183 186 175 174 179 183 gg 60 °& lt ;) 68 69 70 62 61 60 62 ch 0 0 0 0 1 0 0 el 2 . 5 3 . 0 3 . 1 3 4 2 . 8 3 bl rev . & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200 & gt ; 200b ) 7b1 a ) 1 4 hk 151 151 151 150 146 170 159 gg 60 °& lt ;) 30 32 32 25 20 60 25 ch 0 0 0 0 0 0 0 el 3 . 3 4 . 2 3 . 8 3 3 . 5 5 . 1 2 bl rev . & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 mek 90 100 110 80 100 80 30__________________________________________________________________________ c ) use of the compounds of the invention for the preparation of pulverulent one - component adhesives the hardener of the invention and an ep resin with an ep value of 0 . 1 are subjected to intensive kneading in a plastograph for 5 minutes at 100 ° c . after cooling , the product is ground and applied by sieving to steel panels ( 1 . 5 mm thick ) cleaned with scotch - brite , and bonding is conducted in accordance with the procedure of din 53 283 . the lap shear strengths of these steel bonds ( after curing at 200 ° or 180 ° c .) are listed in the table infra . table 3__________________________________________________________________________metal bonds ( din 53 283 ) with the hardener / ep mixtures according to theinventionadhesive composition curing lap shear strength ( din 53 283 ) n / mm . sup . 2 ! examplenco equiv . oh equiv . temperature time roomno . hardener ep ° c .! min ! temperature 100 ° c . 130 ° c . 150 ° c . __________________________________________________________________________c ) 1 1 a ) 7 2 180 30 20 16 10 9c ) 2 1 a ) 7 1 180 30 21 19 9 9c ) 3 1 a ) 8 2 180 30 20 17 8 7c ) 4 1 a ) 8 1 180 30 18 19 16 15c ) 5 1 a ) 4 2 180 30 21 19 7 6 200 15 20 18 9 7c ) 6 1 a ) 4 1 180 30 17 13 13 12 200 15 18 14 14 15c ) 7 1 a ) 5 2 180 30 21 18 17 14 200 15 20 18 16 16comparison exampleat 1 ( ciba ) 200 30 29 14 3 1__________________________________________________________________________ having now fully described the invention , it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the invention as set forth herein . | 2 |
fig1 shows a processor in accordance with the invention and in which the method of the invention may be performed . the processor comprises a cylinder 1 having an open side or end and a closed side or end . the cylinder may be made of stainless steel , plastics or any other suitable material . the cylinder defines a processing drum chamber 4 . a slot 2 with a water tight cover ( not shown ) is provided through the wall of the cylinder to allow a strip of film 3 to be loaded into the drum chamber 4 . a pair of pinch rollers 8 are provided at the entry to the slot 2 . a drive shaft 11 is provided at the closed side or end of the cylinder 1 for rotation thereof . the open end of the cylinder is provided with a flange 12 . the flange retains solution within the processing chamber . processing solutions may be introduced into and removed from the chamber by any suitable means . a central cylindrical member 6 is located within the processing chamber 4 . in the embodiment shown in fig1 the member 6 is solid . however , the member 6 may have a hollow interior . the gap between the outer wall of the member 6 and the inner circumferential wall 5 of the chamber can be any distance from the film thickness to the radius of the chamber . preferably however the gap will be in the order of 10 to 30 mm . the member 6 provides a film retaining means , preventing the film 3 from falling into the centre of the chamber 4 . in one embodiment of the invention the member 6 is attached to the enclosed end 10 of the processing chamber 1 so that it rotates as the chamber rotates . however , in another embodiment , the member 6 may be mounted such that it rotates independently of the chamber . this could be by means of a concentric drive shaft with a clutch assembly . an agitation roller 7 may be provided in the lower part of the chamber 6 . the roller 7 has a diameter of about 1 cm to 3 cm . in this embodiment it is preferred that the gap is sufficiently large to allow the agitation roller 7 to pass freely between the inner circumferential wall 5 and the central cylindrical member 6 . also in practice it is preferred that the gap is sufficiently small so that it properly prevents the film from falling into the centre . the agitation roller 7 is important as it provides agitation and solution mixing . the roller also prevents the emulsion side of the film 3 sticking to the central cylindrical member 6 when it is wet . the cylindrical member 6 can be made of any material but it is preferable that it is made of a material that will not damage the film surface . this material can be soft plastic or rubber and can have a textured surface such as that found in “ soft touch ” rubber rollers used for the so called “ tendency drive ” method . the inner circumference of the drum chamber 4 may also be made of the same soft material . in operation the film 3 is loaded through the entry slot 2 by the pinch rollers 8 while the drum 1 is stationary . the film is fed into the processing chamber 4 with the emulsion side facing inwards . as the film is fed into the chamber it passes under the agitation roller 7 . the film is passed in until the end of the film 3 is reached when it is held by the pinch rollers 8 . the film may be left attached to the cassette 9 or detached from the cassette and driven in by rotation of the cylindrical member 6 . processing solutions are then added and removed as required in order to process the film . full details of the method of processing can be found in co - pending application no gb 0023091 . 2 , the contents of which are herein incorporated . as can be seen various widths of film can be loaded into a single chamber and processed satisfactorily . although edge guides are not necessary they can still be used even though the chamber has a central cylindrical member filling the centre thereof . if edge guides are used then the widest film is loaded and is retained by both the edge guides . when using narrower film the film can be loaded using the edge guide on one side and the central cylindrical member prevents the other side of the film falling into middle of the chamber . thus it can be beneficial to have the middle of the chamber filled and also to use edge guides as well . fig2 a and 3 b illustrate an embodiment of the invention which allows two widths of film to be loaded into the chamber without the need for the central member 6 preventing the narrower film from falling into the middle of the chamber . in the embodiment of fig2 two slots 20 and 22 are provided in the wall of the cylinder to allow film 3 to be loaded into the drum chamber 4 . both slots are provided with water tight covers ( not shown ). each slot has a pair of pinch rollers 8 provided at the entry thereof . narrow channels or guide means 24 and 26 are defined in the wall of drum chamber 4 . slots 20 and 22 are in connection with narrow channels , 24 and 26 , respectively . the distance of the slots from the pair of pinch rollers to the entrance to the channels is in the region of 15 mm to 50 mm , preferably 15 mm to 25 mm . channel 24 has a width suitable for wide film , such as 35 mm film . channel 26 has a width suitable for narrower film , such as 24 mm film . in operation the film 3 is fed into either slot 20 or 22 , dependent on the width of the film , by the pinch rollers 8 as described above . it will be appreciated that although fig3 b illustrates how both widths of film are retained within the slots in practice only one film will be loaded at a time . as stated above , the central cylindrical member 6 may be fixed to the closed end of the chamber to rotate therewith or it may be mounted such that it rotates independently of the chamber . the latter embodiment has benefits in assisting film loading and unloading and in preventing scuffing of the surface of the film . in a further embodiment the central cylindrical member 6 may be rotated at a different speed to that of the chamber . in such an embodiment the difference in speeds of the member 6 and the drum chamber 4 provides sufficient agitation to process the film satisfactorily . therefore a roller is not required . in yet a further embodiment the member 6 may rotate in the opposite direction to the rotation of the chamber . this provides a very high degree of agitation through solution shear . it is also envisaged that the chamber 4 may remain stationary and only the member 6 rotate . if the inner circumferential wall 5 is made of a soft , flexible material , as described above , the film 3 may be fed into the processing chamber 4 emulsion side out . the cylindrical member 6 rotates to assist in loading the film . the film 3 is loaded completely without holding on to the film trailing end . the back of the film contacts the cylindrical member 6 and the front of the film or emulsion side contacts the inner circumferential wall 5 of the drum chamber . the film can slide easily over both the cylindrical member 6 and the inner circumferential wall 5 of the drum chamber . however , it is arranged that the friction between the rotating cylindrical member 6 and the back of the film is greater than the friction between the stationary inner circumferential wall 5 of the drum chamber . this means that although the film 3 can slide on both surfaces it is normally driven round with the rotating cylindrical member 6 and slides over the stationary inner circumferential wall of the drum chamber . this is the first processing mode . in order to effectively wash the back of the film a second processing mode may be provided . in this case a movable stop section ( not shown ) can be placed in the path of the rotating film . this stop section is adjacent to the entry slot 2 and when the leading end of the film comes up against the stop the film can no longer rotate . this causes the rotating cylindrical member 6 to rotate and thus wash the back of the film 3 . the stop section also serves a second purpose and that is to enable unloading of the film . after the last wash the stop section is in the down position , the rotating cylindrical member 6 is now rotated in the opposite direction so that the trailing end of the film comes up against the other side of the stop section . this side of the stop section is angled so as to be in line with the entry slot 2 and so the trailing end of the film is guided out of the entry slot and into the pair of pinch rollers 8 . thus the film is unloaded . fig4 illustrates a further apparatus and method of loading according to the invention . in this embodiment a slot is provided in the wall of the of the cylinder to allow film 3 to be loaded into the drum chamber 4 as described above . a pair of pinch rollers 8 are provided , also as described above . the drum chamber 4 has a filled central member 6 . a plurality of rollers 30 are provided on the outer perimeter of the central member 6 , projecting out therefrom on arm members 32 . the rollers are on arm members 32 to prevent damage to the film surface . the rollers 30 each have a concave section such that only the outside edge of the film 3 contacts the rollers when the film is loaded in the chamber . the rollers have a diameter between 2 mm and 50 mm , preferably 6 mm . the gap between the rollers 30 and the inner circumference of the drum chamber 4 can be a maximum of 50 mm . however the ideal range is from the thickness of the film to 6 mm . at least one cavity , or nest , 28 is provided within the central member . film is fed into the drum chamber 4 by the pair of pinch rollers 8 . both the drum 4 and central member 6 are held stationary as the film 3 is fed into the chamber . the natural curl of the film 3 means that as the film is fed into the chamber 4 it curls up on itself within the nest 28 provided within the central member 6 . once the film has been loaded the end of the film is held by the pinch rollers 8 . the drum 4 is then rotated in the direction shown by the arrow in fig4 . the central member 6 remains stationary . the film is thus uncurled by the rollers 30 and is drawn out of the nest 28 to lie around the inner circumference of the chamber . at this stage the film is held only by the rollers 30 . as the rollers are concave only the outer edges of the film contact the surface thereof thus minimizing damage to the surface of the film . processing then takes place as described above . as the film gets warm and soft during the processing the strength of its natural curl is lost and eventually the film lies against the inner circumferential wall of the chamber by capillary action . the film does not have to be fed in at the top of the drum chamber . the film can be loaded , and unloaded , with the entry lot at various positions . the chamber may have more than one entry slot and nest for different sizes of film . no edge guide means are required in this embodiment , the inner circumferential wall of the chamber being smooth . it is thus easier and cheaper to manufacture this apparatus . the invention has been described in detail with reference to certain preferred embodiments thereof . it will be understood by those skilled in the art that variations and modifications can be effected within the scope of the invention . | 6 |
fig1 shows the circuit arrangement of an image stabilizing device for a camera arranged as an embodiment of this invention . referring to fig1 an angular displacement of a floating element 4 relative to an outer cylinder 2 is arranged to be detected by a psd 5 and an ired 6 . the output of the psd 5 is processed by a position detecting circuit 9 into a voltage output which corresponds to the relative angular displacement mentioned above . the voltage output is inputted to an a / d converter 50 . a winding coil 7 is disposed within a closed magnetic circuit formed by the floating element 4 and a yoke 1 and is arranged to be driven by a coil driving circuit 8 . a photo - taking lens consists of a first lens group 12 , a second lens group 13 , a third lens group 14 , and a fourth lens group 15 . within the photo - taking lens , a zooming lens consists of the second lens group 13 and the third lens group 14 . in the zooming lens , the second lens group 13 is arranged to be movable in the directions of axes x and y within a plane which is perpendicular to the optical axis of the photo - taking lens . the second lens group 13 is thus arranged to serve as a known shifting lens . a camera shake correcting action is performed on the photo - taking lens with the second lens group 13 driven by means of a coil driving circuit 10 and a coil 11 . the absolute position of the second lens group 13 , i . e ., a shifting lens , is detected by a shifting lens position detecting circuit 16 . the result of detection is inputted to the a / d converter 50 . a zoom motor driving circuit 19 and a motor 20 are arranged to drive the second lens group 13 and the third lens group 14 for zooming . the absolute position of the zooming lens is detected by a zoom position detecting circuit 21 . the result of the zoom position detection is inputted to the a / d converter 50 . the first lens group 12 is arranged to be driven for focusing by a focus motor driving circuit 17 and a motor 18 . the absolute position of the focusing lens group 12 is detected by a focus position detecting circuit 22 . the result of detection of focusing position is inputted from the focus position detecting circuit 22 to the a / d converter 50 . as mentioned above , the outputs of the angular - displacement - sensor position detecting circuit 9 , the shifting lens position detecting circuit 16 , the zoom position detecting circuit 21 and the focus position detecting circuit 22 are arranged to be inputted to the a / d converter 50 to be converted into digital data . each digital data thus obtained is supplied to a cpu 51 . the digital data is subjected to an applicable computing operation to be performed within the cpu 51 . the result of the computing operation is supplied via a d / a converter 53 to the coil driving circuit 8 and the other coil driving circuit 10 as driving signals . the operation of the image stabilizing device of the camera arranged as described above is described below with reference to fig2 and 4 which are flowcharts : at steps 200 to 203 , all coefficients to be used in carrying out differentiation by a digital operation are set in internal memories m ( a0h ), m ( a1h ) and m ( b1h ). further , another memory m ( wh ) provided for storing a value which is computed at the time of previous sampling last carrier out and which is necessary for the digital operation is initialized to set its content at &# 34 ; 0 &# 34 ;. the coefficients to be used in a case where a differentiating operation is to be digitally carried out are converted into a formula h ( z ) on a plane z according to a known s - z conversion process ( bilinear conversion in this case ), on the basis of the frequency characteristic of a differentiating circuit shown in fig5 ( a ) and expressed as follows : h ( s )=( sc1 · r1 )/( 1 + sc1 · r1 ). the values of the coefficients of this formula h ( z ) can be expressed by using a sampling time interval t1 as follows : ## equ1 ## at steps 204 to 207 , coefficients to be used in carrying out a low - pass filter computing operation are set in internal memories m ( a0l ), m ( a1l ) and m ( b1l ). further , a memory m ( wl ) for storing a value which is computed at the time of previous sampling last performed and which is necessary for the digital operation is initialized and set at &# 34 ; 0 &# 34 ;. in a case where the low - pass filter data is to be digitally computed , the coefficients are converted to a formula h ( z ) on a plane z according to the s - z conversion process on the basis of the frequency characteristic of a low - pass filter shown in fig5 ( b ) and expressed as follows : h ( s )= 1 /( 1 + sc2 · r2 ). the values of the coefficients of the formula h ( z ) can be expressed by using the sampling time interval t1 as follows : ## equ2 ## at a step 208 , time data t1 is set at a sampling timer 57 which is provided for a digital computing operation on the output value of the angular displacement sensor at intervals of a given period of time t1 . at a step 209 , an interruption by the sampling timer 57 is allowed . at a step 210 , the sampling timer 57 begins to operate . at a step 211 , a sequence timer 52 which is provided for setting a period of time necessary for actually canceling a mechanical offset in the case of this embodiment is reset . at a next step 212 , the sequence timer 52 is allowed to begin to operate . at a step 213 , a flag initl is set within the cpu 51 . at a step 214 , the output of the zoom position detecting circuit 21 is converted into digital data in response to a signal adst coming from the cpu 51 . at a step 215 , a check is made to find if the level of a signal adend has become a high level ( h ). if so , the flow of operation comes to a step 216 . at the step 216 , zoom position data thus obtained is set at a register z which is input or disposed within the cpu 51 . processes after a step 217 are executed for the purpose of obtaining data m ( k ) used for the sequence timer 52 corresponding to the zoom position from among data stored in a rom arranged as shown in fig3 . at the step 217 , the value of the internal register z is first set at a memory address setting register k . at a step 218 : the interruption by the sampling timer 57 is in process during a period before the timer value of the sequence timer 52 reaches the value of the data m ( k ). during this period , digital computing control is executed . this control operation is described below with reference to the flow chart of fig4 : in the main routine of fig2 the flow of operation comes to the interruption process to commence the operation shown in the flowchart of fig4 as soon as the timer value of the sampling timer 57 reaches the given value t1 . at a step 220 of fig4 the level of the output signal adst of the cpu 51 becomes high ( h ) to cause the a / d converter 50 to begin to a / d - convert the output of the angular displacement sensor . at a step 221 , a check is made for the state of the signal adend which indicates the end of the a / d conversion . if the level of the signal adend is found to have become high , the flow of operation comes to a step 222 . at the step 222 , the result of the a / d conversion is set in an internal register a of the cpu . 51 via a bus addata . at a next step 223 , the process of a / d conversion comes to an end with the level of the output signal adst becoming low ( l ). at a step 224 , a check is made for the state of the flag initl within the cpu 51 . if the flag initl is found to have been set at &# 34 ; 1 &# 34 ;, the flow comes to a step 225 to set gain data gkh in a memory m ( gk ). if the flag initl is found to have been reset at &# 34 ; 0 &# 34 ;, the flow comes to a step 226 to set gain data gkl set in the memory m ( gk ). the value of the memory m ( gk ) is arranged to be used for determining the spring constant of the angular displacement sensor with a coil used for the sensor as mentioned in the foregoing . the value of the gain data gkh is arranged to be larger than the value of the other gain data gkl . at a step 227 , the value of the register a and that of the memory m ( gk ) are multiplied by each other . the result of the multiplication is set in a register b . steps 228 to 234 are arranged to carry out a differentiating operation , i . e ., a computing operation process for determining a viscous power of the angular displacement sensor obtained by the coil . at the step 228 , the value of the memory m ( wh ) ( at &# 34 ; 0 &# 34 ; immediately after the memory is reset ) which has already been determined at the time of previous sampling and the value of the memory m ( b1h ) in which a constant value is set at the step 202 of fig2 are multiplied by each other . after that , the result of the multiplication is subtracted from the value of the register a which is set at the output value of the angular displacement sensor . the result of the subtraction is set within a register c . at a next step 229 , a product value obtained from the value of the memory m ( wh ) and the value of the memory m ( a1h ) which is set at a constant value at the step 201 is added to a product value obtained from the value of the register c and the memory m ( a0h ) which is set at a constant value at the step 200 . the result of addition is set in a register d . at this point of time , the result of a differentiating operation digitally carried out on a difference signal of the angular displacement sensor has been set in the register d . next , at a step 230 , a check is made for the state of the flag initl within the cpu 51 in the same manner as at the step 224 . if the flag initl is found to have been set at &# 34 ; 1 &# 34 ;, the flow comes to a step 231 to set gain data ghh in a memory m ( gh ). if the flag initl is found to have been reset at &# 34 ; 0 &# 34 ;, the flow comes to a step 232 to set gain data ghl in the memory m ( gh ). the value of the memory m ( gh ) is to be used for determining the viscosity constant of the angular displacement sensor . the gain data ghh has a larger value than the gain data ghl . at a step 233 , the value of the register d obtained at the step 229 and that of the above - stated memory m ( gh ) are multiplied by each other . the result of multiplication is set again in the register d . at a step 234 , the value of the register c which is necessary for the next sampling is set in the memory m ( wh ). at a next step 235 , the value of the register b in which a spring constant data corresponding to the spring force of the angular displacement sensor is set as mentioned above is added together with the value of the register d in which the viscosity constant data corresponding to the viscous power of the angular displacement sensor is set . the result of the addition is again set in the register b . at a step 236 , the flag initl is checked for its state . if the flag initl is found to have been set at &# 34 ; 1 &# 34 ;, the flow comes to a step 237 . at steps 237 to 239 , low - pass filter data for the register b is computed in the following manner : at the step 237 , the value of the memory m ( wl ) which has its value already set at the time of previous sampling ( the value is &# 34 ; 0 &# 34 ; immediately after resetting ) and the value of the memory m ( b1l ) in which a constant value is set at the step 206 of fig2 are multiplied by each other . after that , the result of multiplication is subtracted from the value of the register b . the result of subtraction is set in a register e . at the step 238 , a value obtained by multiplying by each other the value of the register e and the value of the memory m ( a0l ) which has been set at a constant value at the step 204 is added to a value obtained by multiplying by each other the value of the memory m ( wl ) and the value of the memory m ( a1l ) which has been set at a constant value at the step 205 . the result of addition is set in a register f . at the step 239 , the value of the register e which is necessary for the next sampling is set in the memory m ( wl ). with the low - pass filter computing operation carried out by the steps 237 to 239 in the above - stated manner for spring constant data and viscosity constant data corresponding to the spring force and the viscous power mentioned in the foregoing , any adverse effect of the camera shake caused by the hand of the photographer is removed and dc data for canceling a mechanical unbalance of the angular displacement sensor is computed . while the flag initl is in the state of being set at &# 34 ; 1 &# 34 ;, the level of an output signal dast of the cpu 51 becomes high ( h ) at a step 241 after the low - pass filter computation . then , at a step 242 , the value of the register b is transferred via a bus dadata to the d / a converter 53 , so that a d / a conversion process begins . the output value of the d / a converter 53 becomes the value of a current to be applied to the winding coil 7 via the coil driving circuit 8 . therefore , the floating element 4 of the angular displacement sensor is caused to remain stationary in the neighborhood of its datum position by the strong spring force and the viscous power of the angular displacement sensor . the level of the output signal daend of the d / a converter 53 becomes high ( h ) upon completion of the d / a conversion process . at a step 243 , when this high - level output of the d / a converter 53 is detected , the cpu 51 brings the timer interruption process to an end and the flow of operation comes back to the main process shown in fig2 . the flag initl remains set at &# 34 ; 1 &# 34 ; until the timer value of the sequence timer 52 reaches the data m ( k ). therefore , until then , the actions described above are repeated every time the interruption by the sampling timer 57 takes place . when the sequence timer 52 is found to have counted a given value m ( k ) at the step 218 of fig2 the flag initl is reset at &# 34 ; 0 &# 34 ; at the step 219 . with the flag initl in the state of being reset at &# 34 ; 0 &# 34 ;, a weak spring constant and a weak viscosity constant are selected at the steps 226 and 232 , respectively . then , spring constant data and viscosity constant data obtained in the weak states come to be set in the register b at the step 235 . next , since the flag initl is found to be in the state of being reset at &# 34 ; 0 &# 34 ; at the step 236 , the flow comes to a step 240 . at the step 240 , the value of the register f which stores a dc component for the value obtained by adding together the spring constant data and the viscosity constant data obtained when a strong spring constant and a strong viscosity constant are selected with the flag initl set at &# 34 ; 1 &# 34 ; is added to the value of the register b . the result of addition is then set again at the register b . this value of the register b comes to be outputted from the d / a converter 53 through the steps 241 , 242 and 243 . the output of the d / a converter 53 becomes a current to be applied to the winding coil 7 via the coil driving circuit 8 . in this instance , a dc current corresponding to the value of the above - stated register f is applied . therefore , even if the spring force and the viscous power obtained by the coil are returned to normal values for the angular displacement sensor , the dc current brings about a reaction or a drag against a gravitational component resulting from a mechanical unbalance . in the event of occurrence of an error due to an offset canceling method , the floating element in the angular displacement sensor moves as much as the amount of the error when the spring constant obtained as the spring force of the sensor is brought back to its original value . the adverse effect of this increases accordingly as the focal length of the photo - taking lens increases with the amount of this reduced to an image surface . therefore , if the focal length of a zoom lens is short , a period of stable - state waiting time necessary for carrying out this offset canceling method can be shortened . in view of this , the embodiment is arranged to detect information on zooming of the photo - taking lens of the camera at the beginning of an initial setting action on the angular displacement sensor , and then to vary the period of stable - state waiting time on the basis of the focal length information thus obtained at the time of initial setting ( the actions performed at the steps 216 and 217 of fig2 ). this arrangement enables the embodiment to shorten the build - up time of the angular displacement sensor especially at a short focal length of the photo - taking lens . in other words , a building up action on the angular displacement sensor can be carried out according to the operating state of the camera . the release time lag of the camera thus can be shortened by virtue of this arrangement . as described in the foregoing , this embodiment is provided with varying means for varying a period of stable - state waiting time required before rendering the shake detecting means operable according to information obtained from focal length detecting means . then , since the length of time required in canceling the amount of deflection of the camera body in relation to an absolute space varies with the focal length of the photo - taking lens , the period of table - state waiting time required before the shake detecting means becomes operable is changed according to the information from the focal length detecting means . therefore , with the period of stable - state waiting time of the shake detecting means changed according to the operating state of the camera , the release time lag of the camera can be shortened as much as possible . in the case of this embodiment , displacement amount detecting means for directly detecting angular displacement caused by a shake is employed as the shake detecting means . however , this invention is applicable also to any cases where acceleration or angular acceleration detecting means or speed or angular speed detecting means is employed as the shake detecting means , as long as the lapse of time is required before the detecting means employed becomes capable of stably outputting its detection output after the start of operation thereof . | 6 |
the present capacity maximizing method is best understood by considering a communication channel that is bandlimited to bandwidth b . the frequency range is then divided into n equal width bins , such that the channel , next and fext transfer functions are relatively constant , such as discussed herein before with reference to fig2 . the present capacity maximizing method can be used to determine what signaling scheme to use and the amount of power to place in each of the n bins . one embodiment maximizes the sum of the upstream and downstream capacities subject to a total power constraint p tot . recognizing that the severity of self - next varies with frequency in a typical telephone channel , the present inventors recognized that switching between fds and eqpsd signaling as warranted by the severity of the self - next , would yield maximum channel capacity . a description of the present capacity maximizing method is best understood by considering one embodiment in which s u ( f ) and s d ( f ) denote the psd in a particular bin in the upstream and downstream direction , respectively . [ 0037 ] s u ( f ) = { α 2 p w if 0 ≤ f ≤ w 2 ( 1 - α ) 2 p w if w 2 & lt ; f ≤ w 0 otherwise ( 4 ) s u ( f ) = { ( 1 - α ) 2 p w if 0 ≤ f ≤ w 2 α 2 p w if w 2 & lt ; f ≤ w 0 otherwise ( 5 ) [ 0038 ] fig3 illustrates all possible combinations of signaling schemes in terms of s u ( f ) and s d ( f ) for a typical telephone channel that employs switching between fds and eqpsd as warranted by the severity of self - next . it can be seen , for example , that when α = 0 . 5 , then s u ( f )= s d ( f ) . this situation corresponds to eqpsd signaling , as discussed herein before . alternatively , when α = 1 , s u ( f ) and s d ( f ) are disjoint , corresponding to fds signaling . it can be appreciated that since the upstream and downstream signaling schemes are symmetric , one need only maximize the data rate in one direction of transmission . then , realizing that the residual echo affects performance in a manner similar to next , the total channel capacity in the upstream direction can be written as c u = b 2 ln ( 2 ) { ln [ 1 + α 2 pn b hn nn + ( 1 - α ) 2 pn b xn + α 2 pn b fn + ( 1 - α ) 2 pn b en ] + ln [ 1 + ( 1 - α ) 2 pn b hn nn + α 2 pn b xn + ( 1 - α ) 2 pn b fn + α 2 pn b en ] } ( 6 ) taking the derivative of equation ( 6 ) with respect to cc produces equation ( 7 ) that is written as c u α = g n ( 2 α - 1 ) { 2 ( [ x n + e n ] - f n ) + g n ( [ x n + e n ] 2 - f n 2 ) - h n ( 1 + g n f n ) } l = 0 ( 7 ) since the function c u ( a ) is monotonic in the interval αε [ 0 . 5 , 1 ], a single stationary point at α = 0 . 5 can be scrutinized to determine if it is a maximum . then , if the single stationary point at α = 0 . 5 is a maximum , it is optimal to use eqpsd for the two directions of transmission . it can be shown that for all α & gt ; 0 . 5 , 2 ([ x n + e n ]− f n )+ g n ([ x n + e n ] 2 − f n 2 )− h n ( 1 + g n f n )& lt ; 0 ( 8 ) g n & lt ; h n - 2 [ x n + e n - f n ] ( x n + e n ) 2 - f n 2 - h n f n ( 9 ) g n & gt ; h n - 2 [ x n + e n - f n ] ( x n + e n ) 2 - f n 2 - h n f n ( 10 ) g n = 2 p n n n b & gt ; eqpsd h n - 2 [ x n + e n - f n ] ( x n + e n ) 2 - f n 2 - h n f n ( 11 ) g n = 2 p n n n b & lt ; fds h n - 2 [ x n + e n - f n ] ( x n + e n ) 2 - f n 2 - h n f n ( 12 ) if ( x n + e n ) 2 − f n 2 − h n f n & lt ; 0 , and with the inequalities reversed , if ( x n + e n ) 2 − f n 2 h n f n & lt ; 0 . these test conditions can then be used to find the regions of the spectrum that will surely use eqpsd and fds signaling . it can then be shown that all bins to the left of crossover bin m e use eqpds signaling and that all bins to the right of crossover bin m f use fds signaling . the signaling schemes for the bins in the region ( m e , m f ) cannot be determined using these same test conditions ; and the true optimal crossover point from eqpsd to fds signaling , m e2f , lies somewhere in between . in order to determine the true optimal crossover point m e2f , the present inventors first applied waterfilling techniques described herein below in association with the eqpds and fds regions . since both upstream and downstream spectra are using the same frequency band in this region , echo , next and fext , along with gaussian noise , limit the channel performance . to determine the best possible distribution of power over frequency in this region , the present inventors considered the capacity formula for parallel independent channels written as c = ∑ n = 1 n w 2 n ln ( 1 + p n h n w n + p n f n + p n x n + p n e n ) ( 13 ) where p n is the input power within a particular subchannel , h n is the power transfer gain , x n and f n are the self - next and self - fext transfer functions , and e n is the echo ( as a fraction of the input power . the power distribution importantly must also conform to the power constraint defined by equation ( 14 ) that is written as maximizing the channel capacity can then be determined as an optimization problem wherein the above power constraint can be incorporated with a lagrange multiplier in a fashion familiar to those skilled in the art of optimization theory and techniques . the process begins by writing the functional j as j = ∑ n = 1 n w 2 n ln ( 1 + p n h n w n + p n f n + p n x n + p n e n ) - λ ( ∑ n = 1 n p n - p tot ) ( 15 ) differentiating equation ( 15 ) with respect to p n then produces j p n = w 2 n h n w n [ w n + p n ( f n + x n + e n + h n ) ] [ w n + p n ( f n + x n + e n ) ] - λ = 0 ( 16 ) p n = s n w 2 n ( 17 ) w n = σ 2 w 2 n ( 18 ) b = σ 2 [ 2 ( f n + x n + e n )+ h n ], ( 20 ) c = σ 2 ( σ 2 - h n λ ) ( 22 ) solving the quadratic equation ( 19 ) using equations ( 20 )-( 22 ) is accomplished by first choosing a value for the lagrange multiplier , λ . the power in each bin is then determined according to the quadratic equation ( 19 ). a check is then made to determine if the total power constraint defined by equation ( 14 ) is violated . if the total power constraint is not met , the lagrange multiplier , λ , is readjusted and the process is repeated until the power constraint condition is met . when the power constraint condition is met , the power distribution in the eqpsd region is then also met . this process , however , requires that each s n be positive . it may , therefore , not always be possible to find a solution in the quadratic form . in these cases , the optimization process can be set up to include the inequality constraints set forth herein before , and then using the well - known karush - kuhn - tucker ( kkt ) conditions to verify that each s n is positive . waterfilling in the fds region is done in a similar manner as described above for the eqpsd region . in this case however , since upstream and downstream signals are using disjoint frequency bands , self - next is completely eliminated . echo in this case is also not an issue , since fds signaling is used . determining optimal power distribution in this case can then begin by considering the equation for parallel gaussian channels that is written as c = ∑ n = 1 n w 2 n ln ( 1 + p n h n w n + p n f n ) , ( 23 ) and then proceeding in a manner similar to that described herein before in association with distribution of power in the eqpsd region . with reference now to fig2 , a method is illustrated that employs the psd estimation , sure - region computation and waterfilling techniques discussed herein before in order to determine the true optimal crossover point from eeqpsd to fds signaling such that power can be distributed to achieve optimal channel capacity according to one embodiment of the present invention . the method begins by first setting up equispaced bins w ( hz ) over the transmission bandwidth b of the channel as depicted in step 10 . next , the interference psds associated with noise , dsin - next and dsin - fext are estimated and lumped into a single psd as shown in step 12 . using the test conditions defined by equations ( 11 ) and ( 12 ), the sure - eqpsd region ( all bins to the left of bin m e ) and the sure - fds region are computed as depicted in step 14 . next , an initial estimate of the true optimal crossover point , m e2f is chosen as illustrated in step 16 . subsequent to the estimate of the true optimal crossover point , m e2f , and initial estimate is made regarding the amount of power ( p e ) that goes into the eqpsd region , and how much power ( p f = p tot − p e ) goes into the fds region as seen in step 18 . with the foregoing information , use waterfilling techniques to distribute p e and p f optimally to compute overall channel capacity as depicted in step 20 . following optimal distribution of p e and p f to compute overall channel capacity , p e and p f are re - estimated as shown in step 22 and then used to again perform step 20 . steps 20 and 22 are the repeated for a range of powers in search of the maximum channel capacity as seen in step 24 . once the maximum channel capacity is found , m e2f is re - estimated and used to repeat steps 18 - 26 described herein above as shown by step 28 . the bin number having the overall highest channel capacity as determined via steps 10 - 28 above is then selected as the true optimal crossover point m e2f . [ 0060 ] fig4 simply illustrates a typical downstream psd waveform and a typical upstream psd waveform for a conventional adsl system . as stated herein before , conventional adsl systems use a fixed spectra that do not vary with noise and interference . fig5 - 8 illustrate optimal spectra obtained for various interference combinations . it can be seen that the spectra are not unique . they vary significantly from one another , as the interference combination in each case differ . [ 0062 ] fig9 illustrates the advantage optimal spectra have over fixed ones , as they employ knowledge of the noise environment when distributing power . shown in this figure is the sum of upstream and downstream data rates achieved in the presence of 24 ti next interferers and 24 self - next interferers , when using the fixed spectra of fig4 and the optimal spectra ( for the instant case ) shown in fig6 . it can be seen that a significant performance gain is achieved in terms of data rates using the joint optimization techniques discussed herein before . fig1 - 19 are graphs illustrating the differences in upstream and downstream data rate performance versus loop length between the present optimization method and one known method of spectral optimization in the presence of crosstalk as disclosed by r . gaikwad and r . baraniuk , spectral optimization and joint signaling techniques for communication in the presence of crosstalk , tech . rep . 9806 , rice university , electrical and computer engineering department , houston , tex ., jul . 1998 . the present inventors computed optimal spectra using the present method as well as the method taught by gaikwad et al . the resulting optimal spectra were then tested in a realistic setting , by checking the performance of both systems using various values for the residual echo ( after echo cancellation ). the spectra of adsl modems with 39 interferers was optimized for the first comparison . table 1 illustrates the m e2f crossover point found by the optimization method discussed herein above . the last row of the table shows the values of m e2f that are achieved by the algorithm of gaikwad et al , that does not factor in echo in the optimization process . fig1 - 14 are graphs illustrating the performance of the inventive optimization method discussed herein before as contrasted with the method of gaikwad et al , and when factoring in imperfect equalization . the figures are seen to plot overall datarate ( upstream and downstream ) versus loop length , for values of residual echo ranging from 20 db to 60 db . a second comparison between the two methods was next performed . in this case , the present inventors optimized the spectra of adsl modems with 10 self interferers and 10 hdsl next interferers . shown in table 2 is the m e2f crossover point that the optimization routine discussed herein before yields . again , the last row of the table shows the values of m e2f achieved by the method of gaikwad et al ., and when not factoring in echo in the optimization process . fig1 - 19 illustrates the performance of the optimization scheme discussed herein before versus the scheme of gaikwad et al , when factoring in imperfect equalization . the figures can be seen to plot overall datarate ( upstream and downstream ) versus loop length , for values of residual echo ranging from 20 db to 60 db . in summary explanation , a power distribution scheme for optimization channel capacity significantly outperforms the scheme taught by gaikwad et al ., when the imperfect echo cancellation capabilities of practical xdsl systems are factored into the scheme . the reason for this is straightforward . both optimization techniques choose between eqpsd and fds signaling in a fashion that maximizes overall datarate . in regions where self - next is high , capacity is greater by cutting the bandwidth in half , and using fds signaling , rather by using the full bandwidth and using eqpsd signaling . generally , the shorter the loop length , the smaller the effect of self - next , and hence the less need for fds signaling . the spectra of xdsl environments with shorter loop lengths are characterized by larger eqpsd regions than those with longer loop lengths . this is clearly seen by the data in the last rows of both tables 1 and 2 . it can also be clearly seen that generally , the eeqpsd to fds crossover point occurs at higher tones for shorter loop lengths . finally , it can be seen that when the echo becomes increasingly small , both techniques converge to the same spectra . this is due to the fact that echo has a smaller effect on system performance here , and does not adversely affect performance as much as it normally would in the eqpsd regions . as shown herein before , the residual echo in the system acts in a manner similar to self - next . when considering , for example , a region having low self - next , but in which the echo is high ( relative to signal power ), this is similar to a region in which there is high self - next for the present optimization scheme . as a result , rather than choosing eqpsd signaling ( since there is low self - next ), the present optimization scheme chooses fds signaling . the scheme taught by gaikwad et al ., however , does not factor in echo into the optimization process ; and in the same situation , it sees a region with small self - next and more inaccurately chooses eqpsd signaling . as demonstrated herein before , for shorter loop lengths , the performance of the scheme taught by gaikwad et al . falls far from the scheme discussed herein in association with the present invention . this is because the echo cancelled region is much larger than it should be ( hence the system sees much more echo noise ). looking again at tables 1 and 2 , it can be seen that when the residual echo is less than 40 db smaller than the signal power , the optimal spectra solely consist of an fds region . the examples set forth herein before demonstrate that at 50 db , an eqpsd region becomes noticeable using the present scheme ( in reality , it becomes noticeable somewhere in between the 40 db and 50 db range ). this transition point occurs when the residual echo becomes roughly the same magnitude as the self - next transfer function ( which for adsl , at the frequencies close to zero is roughly 10 − 6 ). when the echo is much larger than this , it swamps out the self - next and forces the system to choose an fds solution . this observation is important since it provides some insight into system design . in situations , for example , when echo canceller performance is poor enough to swamp out the self - next transfer function , an fds solution would almost entirely be seen . in this situation then , it would not make sense to include the extra hardware on the modem for echo cancellation capability ( when it would not provide any increased gain performance to the system ), therefore providing reduced system costs . the optimal solution for this situation is simply the modified waterfilling solution described herein before ( rather than the fixed psd masks used by present systems ). in view of the foregoing discussion of the preferred embodiments of the optimal power distribution methods in the presence of crosstalk and imperfect echo cancellation , it can be seen that knowledge of the optimal solution when factoring echo canceller performance is of great use . when echo canceller performance is poor and the echo swamps out the self - next transfer function , for example , an fds solution results exclusively , and has significantly better performance than a combined eqpsd and fds solution that would result using the scheme taught by gaikwad et al . this knowledge can then be used to implement systems that do not have an echo canceller if it is known that echo rejection would be poor . in situations when echo rejection is moderate ( i . e . the residual echo is roughly the same order of magnitude as self - next ), the present technique provides a solution using both eqpsd and fds signaling . this solution also provides better performance than that provided using the scheme of gaikwad et al ., as it used eqpds signaling more sparingly to keep echo noise limited , while still using eqpsd enough to maximize capacity . the optimization techniques set forth herein before in association with particular embodiments of the present invention , function with excellent echo canceller performance to provide a solution that converges to the same as that provided by the gaikwad et al . scheme , which is expected as the effect of echo becomes increasingly negligible . in view of the above , it can be seen the present invention presents a significant advancement in the art of power distribution methods for communication systems . further , this invention has been described in considerable detail in order to provide those skilled in the xdsl and wireless communication arts with the information needed to apply the novel principles and to construct and use such specialized components as are required . in view of the foregoing descriptions , it should be apparent that the present invention represents a significant departure from the prior art in construction and operation . however , while particular embodiments of the present invention have been described herein in detail , it is to be understood that various alterations , modifications and substitutions can be made therein without departing in any way from the spirit and scope of the present invention , as defined in the claims which follow . | 7 |
in one aspect the invention is directed to the crystalline anhydrous form ii of the compound structural formula a in another aspect , the invention is directed to the crystalline anhydrous form ii of the compound structural formula a characterized by diffraction peaks obtained from the x - ray powder diffraction pattern corresponding to d - spacings of 7 . 7 , 4 . 9 and 3 . 9 angstroms . within this aspect , is the genus wherein the crystalline anhydrous form ii of the compound structural formula a further characterized by diffraction peaks obtained from the x - ray powder diffraction pattern corresponding to d - spacings of 5 . 3 , 4 . 6 and 3 . 9 angstroms . within this aspect is the genus wherein the crystalline anhydrous form ii of the compound structural formula a further characterized by diffraction peaks obtained from the x - ray powder diffraction pattern corresponding to d - spacings of 4 . 2 , 3 . 8 and 2 . 8 angstroms . in another aspect , the invention is directed to the crystalline anhydrous form ii of the compound structural formula a characterized by the x - ray powder diffraction pattern of fig6 . in another aspect , the invention is directed to the crystalline anhydrous form ii of the compound structural formula a characterized by a solid - state fluorine - 19 mas nuclear magnetic resonance spectrum showing signal at − 60 . 4 , − 63 . 4 , and − 115 . 3 ppm , in another aspect the invention is directed to the crystalline anhydrous form ii of the compound structural formula a characterized by the solid - state fluorine - 19 mas nuclear magnetic resonance spectrum of fig8 . in another aspect , the invention is directed to the crystalline anhydrous form ii of the compound structural formula a within this aspect , the invention is further characterized by a peak temperature of 220 . 3 ° c . within this aspect the invention is further characterized by an enthalpy change of 71 . 7 j / g . freebase of compound of structural formula a can exist in two anhydrous crystalline forms , form i and form ii . form i and form ii are enantiotropic with form i thermodynamically more stable at temperatures below 72 ° c . and form ii thermodynamically more stable at temperatures above 72 ° c . fig1 is a characteristic x - ray diffraction pattern of the crystalline anhydrous freebase form i of compound a . fig2 is a carbon - 13 cross - polarization magic - angle spinning ( cpmas ) nuclear magnetic resonance ( nmr ) spectrum of the crystalline anhydrous freebase form i of compound a . fig3 is a fluorine - 19 magic - angle spinning ( mas ) nuclear magnetic resonance ( nmr ) spectrum of the crystalline anhydrous freebase form i of compound a . fig4 is a typical dsc curve of the crystalline anhydrous freebase form i of compound a . fig5 is a typical thermogravimetric ( tg ) curve of the crystalline anhydrous freebase form i of compound a . fig6 is a characteristic x - ray diffraction pattern of the crystalline anhydrous freebase form ii of compound a . fig7 is a carbon - 13 cross - polarization magic - angle spinning ( cpmas ) nuclear magnetic resonance ( nmr ) spectrum of the crystalline anhydrous freebase form ii of compound a . fig8 is a fluorine - 19 magic - angle spinning ( mas ) nuclear magnetic resonance ( nmr ) spectrum of the crystalline anhydrous freebase form ii of compound a . fig9 is a typical dsc curve of the crystalline anhydrous freebase form ii of compound i . fig1 is a typical thermogravimetric ( tg ) curve of the crystalline anhydrous freebase form ii of compound a . table : major peaks for form i from fig1 are as shown below ( wavelength cu kalpha ). major peaks for form ii from fig6 are as shown below ( wavelength cu kalpha ): x - ray powder diffraction studies are widely used to characterize molecular structures , crystallinity , and polymorphism . the x - ray powder diffraction patterns of the crystalline anhydrous freebase of the present invention were generated on a philips analytical x &# 39 ; pert pro x - ray diffraction system with pw3040 / 60 console . a pw3373 / 00 ceramic cu lef x - ray tube k - alpha radiation was used as the source . fig1 shows the x - ray diffraction pattern for the crystalline anhydrous freebase form i of compound ai . the crystalline anhydrous freebase form i exhibited characteristic reflections corresponding to d - spacings of 10 . 4 , 5 . 5 , and 4 . 1 angstroms . the crystalline anhydrous freebase form i was further characterized by reflections corresponding to d - spacings of 9 . 9 , 9 . 2 and 5 . 0 angstroms . the crystalline anhydrous freebase form i was even further characterized by reflections corresponding to d - spacings of 3 . 9 , 3 . 6 , and 3 . 5 angstroms . in addition to the x - ray powder diffraction patterns described above , the crystalline anhydrous freebase of compound a was further characterized by solid - state carbon - 13 nuclear magnetic resonance ( nmr ) spectra . the solid - state carbon - 13 nmr spectra were obtained on a bruker dsx 500wb nmr system using a bruker 4 mm h / x / y cpmas probe . the carbon - 13 nmr spectra utilized proton / carbon - 13 cross - polarization magic - angle spinning with variable - amplitude cross polarization , total sideband suppression , and spinal decoupling at 100 khz . the samples were spun at 10 . 0 khz , and a total of 1500 scans were collected with a recycle delay of 5 seconds . a line broadening of 10 hz was applied to the spectra before ft was performed . chemical shifts are reported on the tms scale using the carbonyl carbon of glycine ( 176 . 03 p . p . m .) as a secondary reference . the crystalline forms were further characterized by solid state fluorine - 19 nmr . the solid - state fluorine - 19 nmr spectra were obtained on a bruker dsx 500wb nmr system using a bruker 4 mm h / f / x cpmas probe . the fluorine - 19 nmr spectra utilized a simple puse - acquire pulse program . the sample was spun at 15 . 0 khz , and a total of 64 scans were collected with a recycle delay of 5 seconds . a line broadening of 10 hz was applied to the spectrum before ft was performed . chemical shifts are reported using poly ( tetrafluoroethylene ) ( teflon ®) as an external secondary reference which was assigned a chemical shift of − 122 ppm . fig2 shows the solid - state carbon - 13 cpmas nmr spectrum for the crystalline anhydrous freebase form i of compound a . the crystalline anhydrous freebase form i exhibited characteristic signals with chemical shift values of 27 . 5 , 44 . 6 , and 147 . 1 p . p . m . further characteristic of the crystalline anhydrous freebase form i are the signals with chemical shift values of 32 . 9 , 83 . 7 , and 161 . 8 p . p . m . the crystalline anhydrous freebase form i is even further characterized by signals with chemical shift values of 53 . 9 , 75 . 0 , and 136 . 2 p . p . m . fig3 shows the solid - state fluorine - 19 mas nmr spectrum for the crystalline anhydrous freebase form i of compound a . the crystalline anhydrous freebase form i exhibited characteristic signal with chemical shift value of − 61 . 3 , − 63 . 1 , and − 112 . 2 p . p . m . dsc data were acquired using ta instruments dsc 2910 or equivalent instrumentation was used . between 1 and 6 mg sample was weighed into an open pan . this pan was then placed at the sample position in the calorimeter cell . an empty pan was placed at the reference position . the calorimeter cell was closed and a flow of nitrogen was passed through the cell . the heating program was set to heat the sample at a heating rate of 10 ° c ./ min to a temperature of approximately 250 ° c . the heating program was started . when the run was completed , the data were analyzed using the dsc analysis program contained in the system software . the melting endotherm was integrated between baseline temperature points that are above and below the temperature range over which the endotherm was observed . the data reported are the onset temperature , peak temperature and enthalpy . thermogravimetric ( tg ) data were acquired using a perkin elmer model tga 7 or equivalent instrumentation . experiments were performed under a flow of nitrogen and using a heating rate of 10 ° c ./ min to a maximum temperature of approximately 300 ° c . after automatically taring the balance , 5 to 20 mg of sample was added to the platinum pan , the furnace was raised , and the heating program started . weight / temperature data were collected automatically by the instrument . analysis of the results was carried out by selecting the delta y function within the instrument software and choosing the temperatures between which the weight loss was to be calculated . weight losses are reported up to the onset of decomposition / evaporation . fig4 shows the differential calorimetry scan for the crystalline anhydrous freebase form i of compound a . the crystalline anhydrous freebase form i exhibited an endotherm due to melting with an onset temperature of 216 . 6 ° c ., a peak temperature of 217 . 8 ° c ., and an enthalpy change of 90 . 9 j / g . fig5 shows a characteristic thermogravimetric analysis ( tga ) curve for the crystalline anhydrous freebase form i of compound a . tga indicated a weight loss of about 0 . 1 % from ambient temperature to about 228 ° c . fig6 shows the x - ray diffraction pattern for the crystalline anhydrous freebase form ii of compound a . the crystalline anhydrous freebase form ii exhibited characteristic reflections corresponding to d - spacings of 7 . 7 , 4 . 9 , and 4 . 8 angstroms . the crystalline anhydrous freebase was further characterized by reflections corresponding to d - spacings of 5 . 3 , 4 . 6 , and 3 . 9 angstroms . the crystalline anhydrous freebase form ii was even further characterized by reflections corresponding to d - spacings of 4 . 2 , 3 . 8 , and 2 . 8 angstroms . fig7 shows the solid - state carbon - 13 cpmas nmr spectrum for the crystalline anhydrous freebase form i of compound a . the crystalline anhydrous freebase form i exhibited characteristic signals with chemical shift values of 28 . 2 , 81 . 6 , and 129 . 8 p . p . m . further characteristic of the crystalline anhydrous freebase form i are the signals with chemical shift values of 74 . 5 , 149 . 1 , and 201 . 0 p . p . m . the crystalline anhydrous freebase form i is even further characterized by signals with chemical shift values of 43 . 7 , 100 . 4 , and 129 . 8 p . p . m . fig8 shows the solid - state fluorine - 19 mas nmr spectrum for the crystalline anhydrous freebase form ii of compound a . the crystalline anhydrous freebase form ii exhibited characteristic signal with chemical shift value of − 60 . 4 , − 63 . 4 , and − 115 . 3 p . p . m . fig9 shows the differential calorimetry scan for the crystalline anhydrous freebase form ii of compound a . the crystalline anhydrous freebase form ii exhibited an endotherm due to melting with an onset temperature of 218 . 0 ° c ., a peak temperature of 220 . 3 ° c ., and an enthalpy change of 71 . 7 j / g . the compounds of the present invention are useful in the prevention and treatment of a wide variety of clinical conditions which are characterized by the presence of an excess of tachykinin , in particular substance p , activity . thus , for example , an excess of tachykinin , and in particular substance p , activity is implicated in a variety of disorders of the central nervous system . such disorders include mood disorders , such as depression or more particularly depressive disorders , for example , single episodic or recurrent major depressive disorders and dysthymic disorders , or bipolar disorders , for example , bipolar i disorder , bipolar ii disorder and cyclothymic disorder ; anxiety disorders , such as panic disorder with or without agoraphobia , agoraphobia without history of panic disorder , specific phobias , for example , specific animal phobias , social phobias , obsessive - compulsive disorder , stress disorders including post - traumatic stress disorder and acute stress disorder , and generalized anxiety disorders ; schizophrenia and other psychotic disorders , for example , schizophreniform disorders , schizoaffective disorders , delusional disorders , brief psychotic disorders , shared psychotic disorders and psychotic disorders with delusions or hallucinations ; delerium , dementia , and amnestic and other cognitive or neurodegenerative disorders , such as alzheimer &# 39 ; s disease , senile dementia , dementia of the alzheimer &# 39 ; s type , vascular dementia , and other dementias , for example , due to hiv disease , head trauma , parkinson &# 39 ; s disease , huntington &# 39 ; s disease , pick &# 39 ; s disease , creutzfeldt - jakob disease , or due to multiple aetiologies ; parkinson &# 39 ; s disease and other extra - pyramidal movement disorders such as medication - induced movement disorders , for example , neuroleptic - induced parkinsonism , neuroleptic malignant syndrome , neuroleptic - induced acute dystonia , neuroleptic - induced acute akathisia , neuroleptic - induced tardive dyskinesia and medication - induced postural tremour ; substance - related disorders arising from the use of alcohol , amphetamines ( or amphetamine - like substances ) caffeine , cannabis , cocaine , hallucinogens , inhalants and aerosol propellants , nicotine , opioids , phenylglycidine derivatives , sedatives , hypnotics , and anxiolytics , which substance - related disorders include dependence and abuse , intoxication , withdrawal , intoxication delerium , withdrawal delerium , persisting dementia , psychotic disorders , mood disorders , anxiety disorders , sexual dysfunction and sleep disorders ; epilepsy ; down &# 39 ; s syndrome ; demyelinating diseases such as ms and als and other neuropathological disorders such as peripheral neuropathy , for example diabetic and chemotherapy - induced neuropathy , and postherpetic neuralgia , trigeminal neuralgia , segmental or intercostal neuralgia and other neuralgias ; and cerebral vascular disorders due to acute or chronic cerebrovascular damage such as cerebral infarction , subarachnoid haemorrhage or cerebral oedema . tachykinin , and in particular substance p , activity is also involved in nociception and pain . the compounds of the present invention will therefore be of use in the prevention or treatment of diseases and conditions in which pain predominates , including soft tissue and peripheral damage , such as acute trauma , osteoarthritis , rheumatoid arthritis , musculo - skeletal pain , particularly after trauma , spinal pain , myofascial pain syndromes , headache , episiotomy pain , and burns ; deep and visceral pain , such as heart pain , muscle pain , eye pain , orofacial pain , for example , odontalgia , abdominal pain , gynaecological pain , for example , dysmenorrhoea , and labour pain ; pain associated with nerve and root damage , such as pain associated with peripheral nerve disorders , for example , nerve entrapment and brachial plexus avulsions , amputation , peripheral neuropathies , tic douloureux , atypical facial pain , nerve root damage , and arachnoiditis ; pain associated with carcinoma , often referred to as cancer pain ; central nervous system pain , such as pain due to spinal cord or brain stem damage ; low back pain ; sciatica ; ankylosing spondylitis , gout ; and scar pain . tachykinin , and in particular substance p , antagonists may also be of use in the treatment of respiratory diseases , particularly those associated with excess mucus secretion , such as chronic obstructive airways disease , bronchopneumonia , chronic bronchitis , cystic fibrosis and asthma , adult respiratory distress syndrome , and bronchospasm ; inflammatory diseases such as inflammatory bowel disease , psoriasis , fibrositis , osteoarthritis , rheumatoid arthritis , pruritis and sunburn ; allergies such as eczema and rhinitis ; hypersensitivity disorders such as poison ivy ; ophthalmic diseases such as conjunctivitis , vernal conjunctivitis , and the like ; ophthalmic conditions associated with cell proliferation such as proliferative vitreoretinopathy ; cutaneous diseases such as contact dermatitis , atopic dermatitis , urticaria , and other eczematoid dermatitis . tachykinin , and in particular substance p , antagonists may also be of use in the treatment of neoplasms , including breast tumours , neuroganglioblastomas and small cell carcinomas such as small cell lung cancer . tachykinin , and in particular substance p , antagonists may also be of use in the treatment of gastrointestinal ( gi ) disorders , including inflammatory disorders and diseases of the gi tract such as gastritis , gastroduodenal ulcers , gastric carcinomas , gastric lymphomas , disorders associated with the neuronal control of viscera , ulcerative colitis , crohn &# 39 ; s disease , irritable bowel syndrome and emesis , including acute , delayed or anticipatory emesis such as emesis induced by chemotherapy , radiation , toxins , viral or bacterial infections , pregnancy , vestibular disorders , for example , motion sickness , vertigo , dizziness and meniere &# 39 ; s disease , surgery , migraine , variations in intercranial pressure , gastro - oesophageal reflux disease , acid indigestion , over indulgence in food or drink , acid stomach , waterbrash or regurgitation , heartburn , for example , episodic , nocturnal or meal - induced heartburn , and dyspepsia . tachykinin , and in particular substance p , antagonists may also be of use in the treatment of a variety of other conditions including stress related somatic disorders ; reflex sympathetic dystrophy such as shoulder / hand syndrome ; adverse immunological reactions such as rejection of transplanted tissues and disorders related to immune enhancement or suppression such as systemic lupus erythematosus ; plasma extravasation resulting from cytokine chemotherapy , disorders of bladder function such as cystitis , bladder detrusor hyper - reflexia , frequent urination and urinary incontinence , including the prevention or treatment of overactive bladder with symptoms of urge urinary incontinence , urgency , and frequency ; fibrosing and collagen diseases such as scleroderma and eosinophilic fascioliasis ; disorders of blood flow caused by vasodilation and vasospastic diseases such as angina , vascular headache , migraine and reynaud &# 39 ; s disease ; and pain or nociception attributable to or associated with any of the foregoing conditions , especially the transmission of pain in migraine . the compounds of the present invention are also of value in the treatment of a combination of the above conditions , in particular in the treatment of combined post - operative pain and post - operative nausea and vomiting . the compounds of the present invention are particularly useful in the prevention or treatment of emesis , including acute , delayed or anticipatory emesis , such as emesis induced by chemotherapy , radiation , toxins , pregnancy , vestibular disorders , motion , surgery , migraine , and variations in intercranial pressure . for example , the compounds of the present invention are of use optionally in combination with other antiemetic agents for the prevention of acute and delayed nausea and vomiting associated with initial and repeat courses of moderate or highly emetogenic cancer chemotherapy , including high - dose cisplatin . most especially , the compounds of the present invention are of use in the treatment of emesis induced by antineoplastic ( cytotoxic ) agents , including those routinely used in cancer chemotherapy , and emesis induced by other pharmacological agents , for example , rolipram . examples of such chemotherapeutic agents include alkylating agents , for example , ethyleneimine compounds , alkyl sulphonates and other compounds with an alkylating action such as nitrosoureas , cisplatin and dacarbazine ; antimetabolites , for example , folic acid , purine or pyrimidine antagonists ; mitotic inhibitors , for example , vinca alkaloids and derivatives of podophyllotoxin ; and cytotoxic antibiotics . particular examples of chemotherapeutic agents are described , for instance , by d . j . stewart in nausea and vomiting : recent research and clinical advances , eds . j . kucharczyk et al , crc press inc ., boca raton , fla ., usa ( 1991 ) pages 177 - 203 , especially page 188 . commonly used chemotherapeutic agents include cisplatin , dacarbazine ( dtic ), dactinomycin , mechlorethamine , streptozocin , cyclophosphamide , carmustine ( bcnu ), lomustine ( ccnu ), doxorubicin ( adriamycin ), daunorubicin , procarbazine , mitomycin , cytarabine , etoposide , methotrexate , 5 - fluorouracil , vinblastine , vincristine , bleomycin and chlorambucil [ r . j . gralla et al in cancer treatment reports ( 1984 ) 68 ( 1 ), 163 - 172 ]. a further aspect of the present invention comprises the use of a compound of the present invention for achieving a chronobiologic ( circadian rhythm phase - shifting ) effect and alleviating circadian rhythm disorders in a mammal . the present invention is further directed to the use of a compound of the present invention for blocking the phase - shifting effects of light in a mammal . this reaction gives consistently high yield and high purity of material . no major side products have been identified . the final product is an oil ( typically clear or slightly yellow ) and is isolated with the above purity profile from the crude work up . a 100 l extractor equipped with a reflux condenser , and a base scrubber was charged with toluene ( 49 . 2 l , kf ≦ 100 ppm ) and 4 - fluorophenylacetic acid ( 1 ) was added ( 5 . 0 kg ). this solution was heated to 70 ° c . once 70 ° c . was reached the dmf ( 48 ml , kf ≦ 150 ppm ) was added and thionyl chloride ( 2 . 8 l ) was slowly added over 3 hours . batch temperature will decrease while thionyl chloride is added . typical temperature changes range from 6 - 10 ° c . when all thionyl chloride has been added and off - gassing has ceased ( typically 30 min . after addition is complete ) an aliquot of the batch was quenched into excess methanol for hplc analysis as the methyl ester . next the reaction was cooled to 5 - 10 ° c . the weinreb amine - hcl ( 4 . 75 kg ) was added to the batch at this point . slow addition of naoh ( 32 . 5 l ) was begun at this point . this base was added at a rate that maintained the batch temperature at or below 10 ° c . with a typical addition time of 3 hours . once this addition was done an aliquot of the batch was quenched into meoh and assayed by hplc to check for complete consumption of the acid chloride . complete consumption of the acid chloride ( in the form of the methyl ester after this quench ) should be seen . additional base can be added if the acid chloride is still present . the biphasic solution was separated at between 5 ° c . and room temperature and the organic phase was washed with 15 wt . % nacl ( aq ) ( 2 × 32 . 5 l ). the organic phase was concentrated to a 50 wt . % solution ( typical kf ≦ 500 ppm ). this reaction is very sensitive to the quality of the grignard reagent and the quench method . major side products have been identified ( a , b , c ), and are shown above . the product is unstable when concentrated to an oil , and has moderate stability in solution . the final toluene solution should be kept cold and used in the next step without delay . a 3 l round bottom flask equipped with an addition funnel was charged with the weinreb amide 2 as a 61 % wt solution in toluene ( 262 g tot mass ; 157 . 2 g 2 , 105 g toluene ). this solution was diluted to a 0 . 5 m solution of amide 2 in toluene by addition of 1 . 32 l of toluene ( kf of solution & lt ; 150 ppm ). this solution was cooled to − 30 ° c ., and vinyl magnesium chloride was slowly added . during the addition of vinyl magnesium chloride the batch temperature is maintained at − 30 ° c . typical addition time is around 60 minutes . after the vinyl grignard addition was complete the reaction was allowed to age at − 30 ° c . for 60 minutes . the reaction was checked by hplc after this 60 minute age . acetic anhydride ( 151 ml ) was then slowly added to the reaction . batch temperature is maintained at − 30 ° c . during this addition to avoid impurities . typical time is 30 minutes . assay of the reaction at the end of this addition typically shows approximately 0 . 5 % lcap of impurity b when compared to product . in a separate 5 l 3 - neck round bottom flask a 2 . 5 wt % solution of nh 4 cl in water ( 1 . 29 l ) was cooled to 10 ° c . the batch at − 30 ° c . was cannulated to this vigorously stirred ammonium chloride solution . the final temperature of the batch is typically around 12 - 13 ° c . when the batch had reached ambient temperature the aqueous and organic layers were cut . the organic layer was then washed with water ( 1 . 3 l ). the organic layer was dried with mgso 4 powder (˜ 100 - 200 g ) until the kf of this solution reached at or below 1000 ppm . the solids were filtered away and washed with dry mecn ( 4 × 50 ml ) to provide a solution of the product in thf / mecn / toluene (˜ 2 . 0 l , kf ˜ 970 ppm , 1 . 80 kg , 7 . 29 wt %, 131 g of 3 , 100 % yield ) which was used directly in the next step . the impurity profile shows 1 . 5 lcap of impurity b and 9 . 1 lcap of impurity c . to 90 . 8 g of the 7 . 29 wt % enone 3 solution in thf / mecn / toluene obtained from step 2 at rt was added more dry mecn ( 18 ml ) and ipr 2 net . tescl was then added slowly while maintaining rt . the solution was stirred at rt until lc revealed complete conversion (˜ 16 h ). the reaction was quenched with 2 wt % aq nh 4 cl ( 70 ml ). the organic layer was separated and washed with water ( 70 ml ). it was then concentrated and flushed with toluene to ˜ 37 wt % with a kf of ˜ 200 ppm . assay yield : 8 . 64 g , 77 %. nmr shows & lt ; 5 % of the e - isomer . to a 3 - neck flask was charged toluene ( 500 ml ) and (−)- menthol ( 157 . 8 g ). the solution was cooled to − 20 ° c . and fumaryl chloride ( 80 . 5 g of 95 %) was charged with 80 ml toluene flush ( no exotherm was observed ). i - pr 2 net ( 191 ml ) was added over 30 min ( fuming ) with 20 ml toluene flush at − 20 ° c . dmap was added immediately afterwards . the dark slurry was then allowed to warm to 21 ° c . over ˜ 60 min to give a dark solution , which showed complete conversion by hplc . at room temperature , a mild exotherm caused the temperature to rise to ˜ 30 ° c . it will be desirable to age at − 20 to 0 ° c . for 1 - 2 h before warming up to rt . 600 ml of aqueous 3 % nacl was added . the aqueous layer (˜ 800 ml ) was cut away and the organic layer was washed with 800 ml aqueous 0 . 15 n hcl containing 5 wt % nacl . the dark organic layer (˜ 800 ml , 710 g ) showed 93 % assay yield ( 182 g , 0 . 464 mol product in 98lcap ) and was concentrated to 378 g ( 48 wt %) for direct use in the diels - alder reaction . 1 h nmr showed non - detectable menthol . the toluene solutions of diene 4 ( 23 . 4 g , 37 wt %) and dimenthylfumarate 5 ( 30 . 4 g , 48 wt %) were combined and cooled to 0 ° c . diethylaluminum chloride solution in toluene ( 1 . 8 m , 29 . 3 ml ) was added over 45 min , keeping the temperature below 5 ° c . ( exothermic addition ). the dark orange solution was aged at 0 ° c . for 18 h (˜ 90 % conversion ), and then at 21 ° c . for 6 h when it reached & gt ; 95 % conversion . if the desired conversion was not achieved , more lewis acid ( and dimenthyl fumarate if necessary ) could be added at any point of the reaction . the reaction mixture was carefully quenched with aqueous 3 n hcl ( 8 ml ) over & gt ; 60 min while keeping the temperature at 15 - 25 ° c . it is important to add this first portion of hcl very slowly without any bursts . although the batch is not very sensitive to heat , rapid off - gassing and foaming upon addition of hcl could result in a disastrous overflow of the batch . the foaming needs to be watched very closely . the remaining hcl ( 3n , 44 . 7 ml ) was added slowly while keeping temperature at 15 - 25 ° c ., and the resulting mixture was aged for 30 min at rt . the aqueous layer was removed , and the organic layer was washed with 1 n aq hcl ( 2 × 50 ml ) and 0 . 5 n aq naoh ( 50 ml ). the toluene solution was used directly in the next step any e - isomer of the diene (& lt ; 5 %) which is present does not react in the diels - alder reaction . a small amount of deprotected products 7 could form in the organic layer during the work - up . the toluene solution from step 5 was concentrated to remove all solvents , flushed with acetonitrile , to give 210 ml slurry in acetonitrile . aqueous 6 n hcl ( 6 . 2 ml ) was added . the slurry was stirred at room temperature for ˜ 2 h , at which point hplc indicated that the reaction was complete . the desilylation initially gave a mixture of 2 , 3 - cis and 2 , 3 - trans ketones , which , driven by crystallization of desired 7 , isomerized to predominantly trans . after aging , filtration followed by 3 × 51 . 4 ml ( 3 . 5 volumes ) acetonitrile slurry washes and drying in vacuo overnight at 60 ° c . yields a white solid ( 15 . 3 g , 98 . 6 wt %, 87 % yield ). add 22 l thf to a 100 l rbf with an inert atmosphere . cool the flask to − 40 ° c . and add li ( o - tbu ) 3 alh . charge ketone 1 as a solid with a thf ( 3 l ) rinse while keeping temp & lt ;− 25 ° c . stir at − 30 to − 35 ° c . until & lt ; 5 % starting material remains ( all solid dissolves ), approximately 2 - 3 hours . the trans / cis ratio is typically ˜ 25 . warm the reaction mixture to ˜− 20 ° c . and add lialh 4 . allow the batch warm up to ˜ 10 ° c . and apply cooling to keep the temperature & lt ; 30 ° c . stir the reaction mixture at room temperature until observing complete reduction to the triol (& lt ; 0 . 5 % desired diol 1 b left ), & gt ; 3 hours . cool the batch to ˜ 0 ° c . and reverse quench slowly into 6 . 0 n hcl ( 23 . 5 l ) while keeping the temperature & lt ; 40 ° c . use 2 l thf to rinse the reaction vessel . caution ! significant h 2 off - gassing and exotherm will occur over the entirety . two clear layers should form if settling occurs . concentrate the quenched solution to ˜ 30 l ( 4 . 3v ) ( water starts to condense at this point ). add heptane ( 35 l ) followed by 6 . 0 l 6 . 0 n hcl and 8 . 9 l 12 . 0n hcl to dissolve a rag layer . cut and keep the aqueous layer (˜ 40 l ) ( org layer ˜ 43 l ), being certain to keep any rag (& lt ; 250 ml ) with the aqueous . assay each layer to ascertain the menthol distribution , which should show & lt ; 2 % remaining in the aqueous . charge the aq layer back to the extractor with 1 l water rinse . titrate to ph ˜ 1 . 5 - 2 with ˜ 14 l 10n naoh while keeping temperature & lt ; 30 ° c . ( charge 12 l first , followed by 0 . 5 l portions ; ph is ˜ 0 after 13 l is charged ; it could take ˜ 10 - 15 min for ph meter to give a stable ph reading .). add 39 l etoac and stir vigorously for 30 min . make sure ph is ˜ 1 . 5 - 2 , otherwise add 10 n naoh or conc hcl in 250 ml portions to adjust the ph . allow 1 - 2 h for the emulsion layer to break up . cut and keep the aqueous ( 50 l ), which should show ˜ 14 % product remaining . drum off the organic ( 41 l ) followed by addition of collidine ( 35 ml ) to adjust to ph ˜ 4 - 4 . 5 . repeat the extraction once more with 39 l etoac ( faster settling this time ). the aqueous layer should show ˜ 2 % product remaining and is discarded . a ph of − 0 . 4 would result in slow decomposition of the triol , possible to acetate at ˜ 0 . 1 %/ h . a higher ph to ˜ 1 . 8 - 2 . 0 reduces the aq solubility of triol , but too high a ph would result in gel formation ( al ( oh ) 3 ?). the triol solution in etoac is stable at ph 1 . 4 - 5 at rt and at ph 4 - 5 at 45 ° ( 8 days ). concentrate the combined organic layers and flush with etoac to ˜ 9 l with a kf & lt ; 1000 ppm . drum off with an inline filter with 3 l mecn rinse . expected yield : 2 . 91 kg of trans - triol ( 91 % y ), 3 . 02 kg total triols ( trans / cis ˜ 25 ). the resulting solution is stable at rt for & gt ; 9 days and at 50 ° c . for & gt ; 4 days . charge the triol solution ( containing 4 . 34 kg active triol + 0 . 23 kg of other triols and ˜ 8 . 7 l etoac + 4 l mecn , kf ˜ 2000 ppm , equiv 10 mol % h 2 o ), mecn ( 14 l ) and n - prso 2 cl to a 100 l extractor . cool the solution to 15 ° c . and add collidine all in one portion . apply cooling to keep the reaction temperature at 18 - 21 ° c . a slurry forms within 30 min . monitor the reaction by lc every hour after 2 h mark until no starting material and & lt ; 2 . 5 % of the mono - sulfonates 2a + b are left ( typically 4 - 6 hours ). leaving the reaction run for longer leads to more tri - sulfonate c formation . after 230 min ( 2a + b : 120 min — 14 . 4 a %, 180 min — 4 . 6 a %, 210 min — 1 . 4 a %, non - sm related peaks - collidine , etoac , n - prso 2 cl — are not integrated ), quench the reaction with 1 n hcl ( 21 . 6 l ) and add 14 l more etoac the quench is slightly endothermic to ˜ 15 ° c . and then back to ˜ 18 ° c . cut away the bottom aqueous layer (˜ 34 l ). wash the organic layer with 10 % nacl ( 38 l ) combined with 50 % v / v hcl ( 6 . 0 n , 0 . 50 l ) to remove any residual collidine . cut away the bottom aq layer (˜ 41 l ) and add naoh ( 1 n , 30 l , removing prso 2 cl ) to the organic layer while keeping temperature & lt ; 27 ° c . stir for 15 min and let the layers settle . cut away the aq layer (˜ 36 l ) and wash the organic layer , which should show & lt ; 2 mol % of n - prso 2 cl left , with 6 % nacl ( 20 l ). cut away the aq layer (˜ 24 l ) and collect the organic layer ( 25 . 6 kg ) with 1 l etoac rinse and assay for yield ( 6 . 80 kg 3 , 85 %). it is then concentrated to an oil , flushed with 20 l cyclohexane to an oil and then with 30 l ch 2 cl 2 to ˜ 10 l ( transfer the solution to a new flask via an inline filter after 15 l ch 2 cl 2 is used and then continue the distillation ), when kf should be & lt ; 250 ppm and etoac & lt ; 8 mol % by lc . to a 100 liter flask containing 27 l of a 4 : 1 mixture of cyclohexane / ch 2 cl 2 was added 8 . 0 kg of ( s )- btba as a solid and the sides of the flask were rinsed with an additional 10 . 3 l of 4 : 1 mixture of cyclohexane / ch 2 cl 2 . to the resulting slurry was added 4 . 92 kg ( 3 . 42 liters ) of trichloroacetonitrile followed by 92 . 2 ml of dbu . the reaction mixture was aged at rt for 5 . 5 h and assayed for completion . the reaction mixture was then transferred to a 100 liter extractor rinsing the reaction flask with cyclohexane . the mixture was washed with 27 liters of water and then with 27 liters of brine . the organic layer was then filtered over a small plug of solka floc and azetropically distilled under reduced pressure ( 24 mmhg , internal temp & lt ; 35 ° c .) and a final volume of ˜ 15 liters and a kf & lt ; 200 . assay yield = 12 . 00 kg ( 96 . 2 %). charge the ch 2 cl 2 solution of the cyclohexanol 3 ( containing 6 . 73 kg active 3 +˜ 0 . 78 kg of related other alcohols and ˜ 6 l ch 2 cl 2 , kf & lt ; 250 ppm , equiv & lt ; 1 . 2 mol % h 2 o ) to a 100 l extractor . charge the imidate solution (˜ 850 g / l in cyclohexane , ˜ 11 l , containing ˜ 2 l cyclohexane ) followed by additional cyclohexane ( 8 . 0 l ). the mixture turns cloudy due to 3 oiling out . add more ch 2 cl 2 ( 2 l ) to dissolve the oil . cool to − 17 ° c . ( oiling out at ˜ 0 ° c .) and add more ch 2 cl 2 ( 1 . 3 l ) to dissolve the oil . the kf at this point should be & lt ; 110 ppm (& lt ; 1 . 5 mol % water ). add 0 . 17 equiv of hbf 4 ( 0 . 339 l ) in one portion , resulting in temperature rising to − 16 ° c . the slightly cloudy mixture is aged at − 16 ° c . it turns clear in ˜ 40 min and a slurry starts to form and thickens as the reaction proceeds to generate poorly soluble trichloroacetamide a . after aging at − 16 ° c . for 18 hours , lc assay reveals ˜ 82 % conv and a 5 / 5a ratio of ˜ 6 . for slightly higher conversion , 0 . 11 equiv more hbf 4 ( 0 . 219 l ) is added following by aging at − 16 ° c . for 4 h . the reaction is then warmed to 5 ° c . and aged for 1 h before being quenched with naoh ( 2 n , 16 l ). the exotherm brings the temperature to 18 ° c . after aging at rt for ˜ 15 min , the layers are allowed to settle . the bottom aqueous layer (˜ 18 l ) is cut away and the organic layer is washed with 18 l of water . the cloudy bottom organic layer is collected ( assay yield of 5 : ˜ 74 %), concentrated to ˜ 20 l , and flushed with ipa ( 90 l ) while keeping batch temperature at ˜ 40 ° c . and volume at ˜ 50 - 60 l to enable stirring as the product crystallizes out . a final volume of ˜ 70 l is reached and the thick slurry is aged at rt until mother liquor shows & lt ; 11 g / l loss ( 5 / 5a & lt ; 0 . 55 ). the product is then filtered , washed with ipa ( 35 l ), and dried . 7 . 07 kg , 98 a %, 96 wt %, 6 . 82 kg corrected , 67 % yield . the reaction vessel was charged with ipa ( 27 l ), allylamine ( 3 . 74 l , 50 . 0 moles ), and bis - propylsulfonate ( 6 . 79 kg , 9 . 61 moles ). at room temperature , the mixture was a very thick ( pasty ) mixture that was difficult to stir . the reaction mixture loosens up upon heating and became completely homogeneous at + 55 - 60 ° c . note that allylamine was boiling at + 53 ° c . the mixture was heated to + 75 - 80 ° c . for 4 h , and was cooled to + 40 ° c . to room temperature . one half volume of water ( 13 . 5 l ) was added and the batch was seeded ( ca . 35 g , 0 . 5 wt %). the batch may crystallize without seed but seeding gave more consistent results . the batch was aged for 30 min and the remainder of water ( 29 . 5 l ) was added over a couple hours . it was filtered , washed with 65 / 35 h2o / ipa ( 12 l ). product was dried at + 40 ° c . for 24 hours under a stream of nitrogen to give 4 . 9 kg of product ( 95 % yield ). the reaction vessel was charged with thf ( 25 . 8 l ), allylamine protected pyrrolidine ( 5 . 16 kg , 10 . 0 moles ), and thiosalicylic acid ( 1 . 62 kg , 10 . 5 moles ). the reaction mixture was degassed and dppb ( 4 . 3 g , 0 . 01 mol ) was added followed by pd 2 ( dba ) 3 ( 4 . 6 g , 0 . 005 mol ) under nitrogen . the mixture was stirred at + 40 ° c . for 4 h , cooled to r . t and was reverse added into a stirred biphasic mixture made of mtbe ( 41 l ) and 1 n aqueous naoh solution ( 25 . 8 l ). layers were separated and the organic was washed with water ( 2 × 23 l ). the organic solution was concentrated under vacuum with feeding of mtbe ( in - line filtration ) with a constant volume of ca . 45 l to lower the kf to less than 5000 ppm . the mixture ( ca . 8 - 10 l mtbe / kg ) is heated to ca . + 50 ° c . and acetic acid ( 10 vol %, 62 . 9 ml ) was added and the batch was seeded ( 0 . 1 wt %, 5 g ) to initiate the crystallization . it was aged at + 50 ° c . for 30 minutes and remaining acetic acid ( 535 . 5 ml ) was added over ca . 1 h at + 50 ° c . the salt crystallizes as a quite thick slurry but remains stirrable . it loosens up upon aging . alternatively , acetic acid can be added as an mtbe solution ( ca . 1 m ). after aging at + 50 ° c . for 2 h the batch was cooled to room temperature and aged for another 2 h , it was filtered , washed with mtbe ( 8 l ) and dried at + 40 ° c . under vacuum for 24 h to give 5 . 14 kg of the product ( 96 % yield ). pd was ca . 25 ppm . a 100 liter flask was charged with ipa ( 26 l ). to this was added the acetic acid salt ( 7 . 5 kg ) followed by 1 , 3 - cyclopentanedione ( 1 . 51 kg ). the sides of the flask were washed with ipa ( 4 l ) and the mixture is heated to + 75 ° c . for 1 h at which point hplc indicated that the reaction was complete . to the reaction mixture was then added ⅓ volume of water ( 10 l ) keeping the temperature at + 60 ° c . the batch was seeded ( 2 . 00 g , 0 . 02 wt %) to initiate crystallization . after aging at 50 - 60 ° c . for 30 min , the mixture was cooled to 40 ° c . the remaining water ( 26 l ) was added over a period of 1 . 25 h and the slurry was aged for 12 hours at rt . the batch was filtered and the wet - cake was washed with 2 bed volumes of 2 : 1 water / ipa and then 1 bed volume of water and dried overnight under vacuum / n 2 sweep . the resulting wet cake was transferred to a vacuum over and further dried at 45 ° c . under vacuum with a sweep of nitrogen for 24 h to give 7 . 45 kg of api ( 98 % yield ). to a solution containing 4 . 11 g ( 8 . 64 mmol ) of crude amine starting material in 65 ml of toluene was added 1 . 02 g ( 10 . 04 mmol ) of 1 , 3 - cyclopentane dione and 164 mg ( 0 . 864 mmol ) of p - toluenesulfonic acid hydrate . the resulting mixture was heated to reflux for 3 h , cooled to rt , and concentrated under reduced pressure . to the residue was 100 ml of etoac and 100 ml of sat . nahco 3 , the layers mixed , and allowed to settle . the organic layer was dried over mgso 4 , filtered over a pad of solka floc , and the solvent removed under reduced pressure . the resulting solid was re - dissolved in 125 ml of etoac and hexane was added to a final volume of 500 ml . the resulting crystalline solid was filtered to give 2 . 84 g ( 59 %) of form ii of compound a which was characterized by physical measurements . | 2 |
referring to the accompanying drawings , certain preferred embodiments of the present invention will be explained in detail . fig3 shows a circuit for the essential portions of a memory according to a first embodiment of the present invention . the numeral 30 denotes a memory cell of the memory . the memory cell 30 includes a pair of nmos transistors 31 and 32 having cross - coupled drain to gate connections and a pair of high resistance resistors 33 and 34 which function as load resistors connected to the drain electrodes of the transistors . the other terminals of resistors 33 and 34 are connected to a suitable biasing source . the memory cell 30 also includes access transistors 35 and 36 which are connected to the drain electrodes of the nmos transistors 31 , 32 respectively , and are selected by means of a word line wl . the drain of nmos transistor 31 is connected to a bit line bl 1 through the nmos transistor 35 , while the drain of nmos transistor 32 is connected to a bit line bl 2 through the nmos transistor 36 . while other memory cells are not shown , it is to be understood that the memory cell 30 is one of a number of such memory cells connected together to form a matrix , such that a plurality of memory cells 30 are provided between a first pair of adjacent bit lines bl 1 and bl 2 in the longitudinal direction . another set of longitudinally arranged memory cells are provided between another pair of bit lines located adjacent to the first pair of bit lines . at the terminal ends of bit lines bl 1 and bl 2 associated with these memory cells 30 are pmos transistor 37 and 38 , respectively . the pmos transistors 37 and 38 serve as the variable resistors . the source sides of the pmos transistors 37 and 38 are each connected to a source voltage v dd while drain sides of the pmos transistors 37 and 38 are connected to the bit lines bl 1 and bl 2 . the gate electrodes of pmos transistors 37 and 38 are connected to a bit line load drive circuit 39 . the same applies for the other columns of the matrix ( not shown ), such that the gate electrodes of the pmos transistors are connected in common to the bit line load drive circuit 39 . a read / write signal r / w is input to the bit line load drive circuit 39 , which outputs a signal switchable between a low ( l ) level and a mid level ( m ). the levels produced depend upon the level of the r / w signal received . the bit line load drive circuit 39 may utilize , for example , a diode drop for realizing the middle or intermediate ( m ) level . referring now to fig4 the operation of the memory of the present embodiment will be explained . during the read - out time , the read / write signal r / w is brought to the low ( l ) level , that is , to the ground ( gnd ) level . the output signal of the bit - line load drive circuit 39 is then brought to the low ( l ) level , and it is applied as the pmos transistors 37 and 38 gate voltage v g , so that the pmos transistors 37 and 38 ( as the variable resistors ) are brought to the low impedance state . with the pmos transistors 37 and 38 in the low impedance state , the potential at the bit lines bl 1 and bl 2 , is raised and sense amplifiers ( not shown ) connected to these bit lines bl 1 and bl 2 are able to sense the state of memory cell 30 . the current flowing , during this time , through the pmos transistors 37 and 38 is determined by the channel conductance of the drive transistors 31 and 32 of the memory cell 30 which determines the state of the cell . during the write time , the read / write signal r / w is brought to a high ( h ) level . the output signal of the bit - line load drive circuit 39 is then set to a mid ( m ) level between the high level ( or source voltage v dd ) and a low level . as a result , the gate voltage v g is at the m level , so that the pmos transistors 37 and 38 are brought to an intermediate impedance state between the low and high impedance states . the currents flowing through pmos transistors 37 and 38 are determined by the values of the channel conductances of transistors 37 and 38 . the middle level of the gate voltage v g may be set to a level which increases the impedance of the pmos transistors 37 and 38 for reducing the power consumption during the write time . on the other hand , when the above impedance is lowered , a so - called rush current at the transition time from writing to read - out may be reduced . since the bit lines bl 1 and bl 2 are connected to the drain sides of the pmos transistors 37 and 38 , no problems will arise in the circuit operation or performance . that is , there is no voltage drop at the bit lines such as is caused with the use of the nmos transistors as in the prior art memory discussed above . it is therefore possible to prevent destruction of the memory cell data caused by a voltage drop at the bit line . fig5 shows a first embodiment of the bit line load drive circuit 39 of the present invention . the gate voltage v g supplied to the gates of the pmos transistors 37 and 38 is determined by the diode configured nmos transistors 51 and 52 which are connected in series to the circuit ground through an nmos transistor 53 . the read / write ( r / w ) signal is applied to the gate of the nmos transistor 53 for turning it on or off in a controlled manner . the second embodiment is shown in fig6 . the memory cell 60 is constructed similar to memory cell 30 . the memory cell 60 is also connected between the bit lines bl 1 and bl 2 . as with the memory illustrated in fig1 it is to be understood that although only one memory cell 60 is illustrated , a number of such memory cells 60 are connected together to form a matrix . a plurality of memory cells 60 are provided between a given pair of adjacent bit lines bl 1 and bl 2 in the longitudinal direction . similarly , other memory cells 60 are also provided in the longitudinal direction between other pairs of bit lines . the drain electrodes of pmos transistors 67 and 68 are each connected to the terminal ends of bit lines bl 1 and bl 2 respectively , associated with memory cells 60 . the source sides of the pmos transistors 67 and 68 are each connected to a source voltage v gg . the gate electrodes of the pmos transistors 67 and 68 are connected to a control circuit 69 . although not shown , the other bit lines are similarly associated with pmos transistors , as the variable resistor means , each pmos transistor having its gate electrode connected to a control circuit 69 . the control circuit 69 is composed of a series circuit of a pmos transistor 61 and a constant current source 62 , which is also a pmos transistor . the pmos transistor 61 has its gate and drain electrodes connected in common and has its gate electrode connected to the gate electrodes of the pmos transistors 67 and 68 , so that a current mirror circuit is formed by the pmos transistors 61 , 67 and 68 . the pmos transistor 62 forming the constant current source 62 has its drain and gate electrodes connected to the ground ( gnd ) level . the constant current source 62 is connected in series with the drain electrode of the pmos transistor 61 for limiting the current flowing in the pmos transistor 61 . the current flowing through the pmos transistor 67 is designated i 67 ( and is equal to the current flowing through transistor 68 ) and the current flowing through the pmos transistor 61 is designated i 61 . the current flowing from the source voltage v dd to the ground voltage gnd in the control circuit 69 is controlled by the constant current source 62 such that the current i 61 ( flowing through the pmos transistor 61 ) has a magnitude which is determined by the constant current source 62 . since the pmos transistor 67 constitutes a current mirror circuit with the pmos transistor 61 , the magnitude of the current i 67 is proportional to i 61 . in particular , the proportion is determined by the ratio of the value of the channel conductance of the pmos transistor 61 to the value of the channel conductance of the pmos transistor 67 . the result is that the d . c . operating current at the time of writing is determined by the current value of the pmos transistor 61 of the current mirror circuit , which in turn is determined by the magnitude of the current of the constant current source 62 . in this manner , the d . c . operating current during writing can be adjusted easily by controlling the value of the constant current of the constant current source 62 and thus the ratio of the values of channel conductance of the transistors 67 and 61 making up the current mirror circuit . in the current mirror circuit arrangement , the gate size of the constant current source ( transistor ) 62 increases and results in a lowered rate of fluctuations in the parameters ascribable to manufacturing tolerances of the constant current source 62 . therefore , even when the pmos transistors 67 and 68 , serving as the variable resistor , are reduced in size , fluctuations in the current values of the pmos transistors 67 and 68 can be suppressed by virtue of the above described relation of proportionality so that a stable circuit operation is assured . the variable resistor transistors 67 and 68 and the transistor 61 are pmos transistors and are produced by the same production process . thus , the transistors 67 , 68 and 61 gate sizes , such as the gate length or width , or the fluctuations in their threshold voltage vth , during the course of the adjustment process , all exhibit the same tendencies . therefore the memory is produced in such a manner that the d . c . operating current is insensitive to manufacturing tolerances . the memory of this embodiment is a more concrete and practical version of the preceding , second embodiment . referring to fig7 the memory includes a memory cell 70 connected to a pair of bit lines bl 1 and bl 2 . as with the memory cells 60 of the preceding second embodiment , a number of the memory cells 70 are connected in a matrix to form a memory cell array . pmos transistors 77 and 78 which serve as the variable resistor means are connected to the terminal ends of bit line bl 1 and bl 2 , respectively . a source voltage v dd is supplied to the source sides of the pmos transistor 77 and 78 , while the drain sides of the pmos transistors 77 and 78 are connected to the bit lines bl 1 and bl 2 . a control circuit 79 includes pmos transistors 71 , 72 and 73 and an nmos transistor 74 . the pmos transistors 71 , 72 , 73 are connected in series between the source voltage v dd and the ground voltage gnd , and the nmos transistor 74 is connected in parallel with the pmos transistor 73 between the drain electrode of transistor 72 and the circuit ground gnd . the pmos transistor 71 constitutes a current mirror circuit with the pmos transistors 77 and 78 . the pmos transistors 77 and 78 have their gate electrodes connected in common , and their source electrodes connected to the source voltage v dd . the pmos transistor 71 has its drain and gate electrodes connected to the source electrode of the pmos transistor 72 . the pmos transistor 72 is a switching element , and its gate is supplied with the read / write signal r / w . the pmos transistor 72 has its drain electrode connected to the gates of the pmos transistors 77 and 78 , the source electrode of the pmos transistor 73 , and the drain electrode of the nmos transistor 74 . the pmos transistor 73 acts as a constant current source . the ground voltage gnd is supplied to both the gate and drain of the pmos transistor 73 . the read / write signal r / w is also supplied to the gate of the nmos transistor 74 . the nmos transistor 74 has its source connected to the ground voltage gnd . the above described memory of the present embodiment operates in the following manner . during the read - out time , the read / write signal r / w is set to a high ( h ) level so that the pmos transistor 72 is turned off while the nmos transistor 74 is turned on . the gate voltage of the pmos transistors 77 and 78 is then about equal to the ground voltage gnd such that the pmos transistors 77 and 78 acting as the loads , are brought to a low impedance state . during writing , the read / write signal r / w is set to the low ( l ) level so that the pmos transistor 72 is turned on and the nmos transistor 74 is turned off . the current then flows from the source voltage v dd to the ground voltage gnd via the pmos transistors 71 to 73 . the current flow causes the pmos transistors 77 and 78 to go to the high impedance state . at this time , the magnitude of the current flowing in the pmos transistor 71 is determined by the pmos transistor 73 acting as a constant current source . similarly , the current flowing in the pmos transistors 77 and 78 is determined by the pmos transistor 71 , since the pmos transistors 77 and 78 and the pmos transistor 71 make up the current mirror circuit . therefore , the impedance values of the pmos transistors 77 and 78 are dependent upon the constant current source formed by transistor 73 so that they are stabilized . also , as was the case with the preceding second embodiment , the d . c . operating current during writing is determined by the ratio of the value of the channel conductance of the pmos transistor 73 to the values of the current conductance of the transistors 71 , 77 , 78 constituting the current mirror circuit . hence the d . c . operating current can be adjusted easily . also , during writing , the pmos transistors 77 and 78 , as the variable resistors , can be brought to an intermediate state between the low and high impedance states . also , by increasing the size of the pmos transistor 73 as compared to the other elements , the rate of fluctuations of the parameters caused by manufacturing tolerances can be lowered so that a stable circuit performance is assured . in addition , the pmos transistors 77 and 78 and the pmos transistor 71 tend to be uniform in manufacturing tolerances , so that it becomes possible to suppress fluctuations in the d . c . operating current . the present fourth circuit embodiment , in which the nmos transistor dependency is increased , is illustrated in fig8 . the fourth circuit , illustrated in fig8 is a modification of the previously described third embodiment illustrated in fig9 . comparing the fourth circuit embodiment with the third circuit embodiment shown in fig7 the fourth circuit embodiment substitutes the pmos transistor 73 with an nmos transistor 83 ; and the nmos transistor is used as the constant current source . the remainder of the circuit elements are unchanged . therefore , they are indicated by the same reference numerals as those used in fig7 and the accompanying corresponding description is omitted here for simplicity . using an nmos transistor 83 , as the current source , allows the manufacturing tolerances of the nmos transistor 83 to be reflected in the current values of the constant current source . in turn , by having the tolerances reflected in the current values results in the memory being insensitive not only to the manufacturing tolerances of the pmos transistor but also to the manufacturing tolerances of the nmos transistor as well . in the memory of the present embodiment , control of the transistors 77 and 78 of the variable resistor means can be accomplished in a stable manner , similar to the memory of the previously described second and third embodiments , while the memory is also insensitive to manufacturing tolerances since the nmos transistor 83 is increased in size . it should be noted that the memory of the present invention is not limited to the above described first through fourth embodiments , but various modifications can be made thereto without departing from the purpose of the invention . | 6 |
fig1 - 22 illustrate an apparatus and methods according to the present invention for photogrammetrically orienting two - dimensional ultrasound image slices of an object into a three - dimensional view of the image slices , thereby enabling three - dimensional visualization of the object . referring first to fig1 and 2 , an apparatus 30 for photogrammetric orientation of ultrasound images according to the present invention may be seen to include an image acquisition apparatus 50 . as shown in fig2 image acquisition apparatus 50 according to the present invention includes a visual imaging device 51 which is capable of recording a sequence of optical images . thus , imaging device 51 may be a still photographic film camera such as a 35 mm camera or film motion picture camera . preferably , however , imaging device 51 is of a type which produces real - time electronic representations of an optical image , rather than one such as a film camera which requires photographic processing of film and subsequent electro optical scanning of film images to obtain electronic images . thus , imaging device 51 is preferably a digital camera or camcorder . alternatively , imaging device 51 may consist of a video camera that outputs an electronic image signal which is recorded on an external electronic memory such as a computer hard disk , floppy disk , or the like . referring still to fig2 it may be seen that imaging device 51 is used to form an image 52 at the focal plane 53 of the device . as shown in fig2 imaging device 51 is fixed with respect to a stationary object , such as a hospital bed ( not shown ), and has a field of view which encompasses an ultrasonic imaging transducer wand 54 located in proximity to a subject such as a patient lying on a hospital bed . wand 54 has affixed thereto a target plate 55 which has contrasting visual features of a predetermined size and shape . in the example embodiment of image acquisition apparatus 50 shown in fig2 ultrasonic imaging transducer wand 54 has a bulbous shape similar to that of an egg cleaved along a vertically disposed medial plane parallel to the long axis of the egg to form a flat front surface 56 . this type of transducer emits an ultrasonic energy beam which is directed in a generally conically - shaped scan pattern having a triangular trace in a plane generally perpendicular to front surface 56 of the transducer , and produces a similarly shaped ultrasound image field pattern , as shown in fig4 and 5 . referring still to fig2 it may be seen that target plate 55 , which is preferably mounted flush with and parallel to front face 56 of ultrasonic transducer wand 54 , has a generally rectangular , preferably square shape , and has a rectangular central area 57 concentric with the perimeter 58 of the target plate . central area 57 of target plate 56 is preferably of a different color or darkness than the remainder of the target plate . thus , as shown in fig2 central area 57 of target plate 55 may be of a light color , such as while , while the remainder of the target plate may be of a darker color , such as black . referring still to fig2 it may be seen that apparatus 30 includes an ultrasonic imaging apparatus 58 which is connected by an electrical cable 59 to ultrasonic imaging transducer wand 54 . ultrasonic imaging apparatus 58 is of a conventional type , such as a general electric brand logi q 500 model number . the construction and function of typical ultrasonic imaging apparatus of this type is described in havlice and taenzer , “ medical ultrasonic imaging : an overview of principles and instrumentation ,” proc . ieee , vol . 67 , pp . 6200 - 641 , april 1979 . ultrasonic imaging apparatus 58 contains electronic circuitry for producing electrical signals of ultrasonic frequency which drive a piezoelectric or magnetostrictive ultrasonic transducer in wand 54 , and cause the transducer to emit a beam of energy directed to an object of interest , such as a fetus or other internal biological feature ( ibf ). typically , the ultrasonic energy beam emitted by the transducer in wand 54 is mechanically or electronically scanned to form a generally fan - shaped pattern , i . e ., in the shape of a truncated isosceles triangle with the vertex located at the transducer , as shown in fig2 and 5 . this type of scan format is referred to as a sector scan . during a period when ultrasonic drive energy to the transducer within transducer wand 54 , is interrupted , the transducer functions in a receive mode , converting ultrasound signals reflected from an ibf into electrical information signals . the latter are used to form an image 60 of a region scanned , the image being displayed on the screen of a lcd , crt or other display device monitor 61 . image 60 appears on monitor 61 within an active display area 60 a shaped similarly to the scan pattern of the ultrasonic energy beam transmitted by transducer wand 54 . in this display , referred to as a b - scan or brightness mode scan , the angular coordinate position of an object feature in the scanned image field 60 a is indicated by the angular position of radial display lines corresponding to the instantaneous directions of an ultrasonic energy beam emitted by the transducer . radial coordinate positions of an object from the common vertex of ultrasound energy beam scan lines , which intersect at the transducer , are determined by measuring the time delay between the emission of an ultrasonic energy pulse , and a return signal reflected from a feature and received by the transducer . the radial coordinates of object features in display area 60 a of monitor 61 are displayed at a proportional distance from the vertex of the display area , and the strength of the reflected signals are indicated by modulating the brightness of display pixels . ultrasound imaging apparatus 58 also includes electronic memory means 62 for storing a sequence of ultrasound images 60 , referred to as monograms . referring now to fig1 it may be seen that apparatus 30 according to the present invention includes components functionally interconnected with visual image acquisition apparatus 50 and ultrasonic imaging apparatus 58 shown in fig2 and described above , to perform a photogrammetric orientation of ultrasound images according to the method of the present invention . as shown in fig1 apparatus 30 includes a computer 64 . as will be described in greater detail below , computer 64 is utilized to precisely determine the instantaneous location and orientation of ultrasonic imaging wand 54 relative to a fixed imaging device 51 for each two - dimensional image slice or sonogram in a sequence of sonograms obtained by changing the orientation and / or location of the wand relative to an internal biological feature ( ibf ) or other feature of interest . this step is performed by forming an oblique view image of target plate 55 with imaging device 51 , and transforming and scaling the oblique image into a correctly scaled normal view image of the target plate using the method described in detail in u . s . pat . no . 5 , 967 , 979 , the entire disclosure of which is hereby incorporated by reference into the present specification . since target plate 55 is fixed to ultrasound scanning wand 54 , precisely determining the orientation and location of target plate 55 precisely determines the orientation and location of the ultrasound scanning wand . therefore , the method described in the &# 39 ; 979 patent enables determination of the precise orientation of the scanned ultrasound energy beam relative to a feature of interest , and therefore the location and orientation of sonogram slices obtained of the feature . according to the present invention , the precise orientation and location of each sonogram slice relative to a fixed coordinate reference frame , e . g ., one in which a patient and imaging device 51 are fixed , is used to construct an assembly of correctly scaled and oriented three - dimensional views of ultrasound image slices of the object , using software such as voxelview , version 1 . 0 , obtainable from vital images , inc ., 3300 penbrook avenue north , plymouth , minn . 55447 , or idl , version 3 , also obtainable direction from vital images . this enables the object to be visualized in three dimensions . referring still to fig1 it may be seen that apparatus 30 according to the present invention includes means for inputting into computer 64 electronic image signals of wand 54 and target plate 55 obtained by imaging device 51 , the computer being used to compute instantaneous normal view images of the target plate and wand . apparatus 30 also includes means for inputting into computer 64 a sequence of electronic image frames , one for each sonogram that represents a two - dimensional image slice of an internal biological features . as shown in fig1 apparatus 30 includes a first , visual image frame grabber 65 which converts each visual image signal 66 obtained by optical imaging device 51 into a separate frame of image data for each of a sequence of images . operation of visual image frame grabber 65 is controlled by a system control electronic module 67 , which issues a command signal , timing signal , and frame identification signal when it is desired to capture and store a particular image frame input to the frame grabber by optical imaging device 51 . each optical image frame thus captured and stored is electronically identified with a sonogram obtained simultaneously with the optical image of transducer wand 54 and target plate 55 , thus recording the precise orientation and location of the wand during the sonogram scan . frame capture command signals may be issued at predetermined times by system control module 67 , or manually by an external command instruction issued by the ultrasonographer . although system control module 67 is shown in fig1 to be separate from computer 64 , functions of the system control module could of course be performed by the computer with appropriate interface electronics and software , as will be understood by those skilled in the art . as shown in dashed lines in fig1 imaging device 51 could optionally be replaced by a photographic still camera 51 a . in this case , a separate photographic film image 52 a is made of ultrasonic wand 54 and target plate 55 for each sonogram obtained using the wand . the exposed film must then be processed in a conventional manner to develop the latent photographic images on the film , the developed film images scanned using an optical scanner 68 and an analog - to - digital ( a / d ) converter 69 used to convert the analog two - dimensional film image into a digital image , which is input into computer 64 in place of electronic images output from frame grabber 65 . however , because of the difficulty of synchronizing real - time sonograms with subsequently processed photographic film image , electronic imaging by video camera 51 is a preferred method . alternatively , camera 51 a could be a digital camera , in which case scanner 68 and a / d converter 69 would be replaced by a digital memory means such as a flash memory card . referring still to fig1 it may be seen that apparatus 30 includes a second , ultrasound image from grabber 75 which converts electronic ultrasound image signals 60 e corresponding to sonograms 60 obtained by ultrasonic imaging apparatus 58 into a separate frame of image data for each of a sequence of sonograms showing separate image slices of an internal biological feature . each ultrasound image frame 60 e corresponding to a separate sonogram 60 is stored electronically along with a timing code and identification code that associates each sonogram with an optical image frame of the transducer wand 54 and target plate obtained simultaneously with the particular sonogram . as described above computer 64 of apparatus 30 performs on each optical image 66 of wand 54 and target plate 55 a coordinate transformation which determines the precise orientation and location of the wand at the time a sonogram 60 associated with the optical image is formed . since the ultrasonic fan beam emitted by transducer wand 54 to form a sonogram image bears a fixed geometric relationship to the transducer , determining the precise location and orientation of the wand determines the exact trajectory of the image - forming beam relative to a fixed reference frame . in a typical example embodiment of the present invention , an ultrasound beam 76 is emitted in a plane perpendicular to front face 56 of the transducer wand , with the vertex of the beam located behind the front face and centered on a longitudinally disposed , vertical medial plane of the wand , as shown in fig2 . construction of a three - dimensional assembly of two - dimensional sonograms taken at different orientations of ultrasound beam 76 is performed by apparatus 30 in the following manner . referring again to fig1 it may be seen that transformed normal view images 77 of ultrasound wand 54 and target plate 55 are input to a computer 78 , which may be part of computer 64 . the transformed normal view images are used to indicate the relative spacing between ultrasound wand 54 and an object of interest , and the orientation of the wand relative to the object , for each sonogram obtained of the object . using this information , computer 78 constructs in a three - dimensional image space 79 three - dimensional images of a sequence of two - dimensional sonogram image slices , in the manner shown in the following example . referring now to fig4 a solid cone a is shown as an example object of interest to be visualized using the method and apparatus 30 according to the present invention . as shown in the example of fig4 cone a , which could as well be a fetus or other internal biological feature of interest to an ultrasonographer , is scanned by a beam 76 emitted by ultrasound wand 54 having a first location and orientation to form a first sonogram . the position and orientation of the want relative to cone a during the first scan are determined by calculating the size and orientation of visual features on target plate 55 , using the coordinate transformation described in u . s . pat . no . 5 , 967 , 979 and cited above . as shown in fig4 the orientation of front face 56 of transducer wand 54 is parallel to the central , vertically orientated axis b of cone a . with this arrangement , ultrasound image beam 76 lies in a horizontal plane which intersects cone a a short distance below the vertex c of the cone . thus , a first sonogram of cone a , as shown in fig5 consists essentially of a circular area having a first diameter , d 1 . using the voxelview reconstruction software described above , a first image slice is therefore reconstructed which is a circle of a first diameter , d 1 , scaled in a ratio k to d 1 , and in a three - dimensional image space 79 , shown in fig6 a perspective view of circle d 1 , is constructed . next , as shown in fig7 of the present example , ultrasonic imaging wand 54 is relocated to a second position , e . g ., a position lower than that shown in fig4 and the wand tilted obliquely upwards with respect to its orientation shown in fig4 . at this second location and orientation , a second sonogram is made of cone a , with fan beam 76 of wand 54 intersecting the cone at an oblique angle . thus , as shown in fig8 a second sonogram of cone a consists essentially of an elliptically shaped area having a major axis e , and a minor axis f . using the voxelview reconstruction software , a reconstruction of the second sonogram image slice in three - dimensional image space 79 , as shown in fig9 is therefore an ellipse having a major axis e , and a minor axis f that are scaled in the same ratio k used to scale each sonogram into three - dimensional image space 79 . [ 0062 ] fig1 of the present example shows ultrasonic imaging want 54 oriented to a third position intermediate in height between positions 1 and 2 shown in fig4 and 7 , but inclined obliquely downward from a horizontal plane . at this third location , a third sonogram is made of cone a , with fan beam 76 of wand 54 intersecting the surface d and base e of the cone at an oblique angle . thus , as shown in fig1 , a third sonogram of cone a consists essentially of a semi - elliptical area having a major axis g , and a truncating chord h . using the voxelview reconstruction software , a reconstruction of the third sonogram slice in three - dimensional image space 79 as shown in fig1 , is therefore a semi - ellipse having a major axis g , and a truncating chord h , that are scaled in the ratio k used to scale each sonogram into three - dimensional space 79 . [ 0063 ] fig1 a shows a three - dimensional image space 79 in which the transforms of sonogram images shown in the example fig4 - 12 have been assembled together in a properly arranged and scaled and oriented relationship . fig1 b shows a surface 80 which is constructed using the rendering portion of the voxelview program , visually , for example , by mentally extending a plurality of directrix lines 81 through the perimeters of a stack of substantially planar image transforms . as shown in fig1 b , surface 80 formed by directrix lines 81 defines a conical transferred image object a , having an altitude b 1 and a base e 1 which is a correctly scaled and proportioned representation of the object cone scanned by ultrasound fan beam 76 . referring now to fig1 - 21 , it may be seen how apparatus 30 according to the present invention is used to form a three - dimensional visualization of an actual object of interest using the method shown in fig4 - 13 and described above . thus , as shown in fig1 , ultrasonic imaging wand 54 is located in a first position and at a first orientation relative to the abdomen j of a patient k . at this first position and orientation of transducer wand 54 , a first sonogram 82 - 1 , shown in fig1 , is obtained of an internal biological feature ( ibf ) such as a fetus l . in an exactly similar manner , additional sonograms 82 - 2 through 82 - 4 are obtained of fetus l , as shown in fig1 - 231 . using the transformation method described above , a three - dimensional representation of fetus 80 l is then visually constructed in image space 79 . three - dimensional images 80 , such as that of fetus 80 l may be displayed on a system monitor 83 , and electronically stored for future access . the process used to position the ultrasound image slices in 3d space to thereby enable three - dimensional visualization of an object scanned by an ultrasound beam is described in somewhat greater detail below : there is understood to be a coordinate system , xyz , based on the camera &# 39 ; s point of view , with the following characteristics : there is also a coordinate system , xyz , for each ultrasound frame based on the target rectangle attached to the ultrasound wand , with the following characteristics ( assuming that the wand is pointing downward as we look at the target plate with its y - axis pointing to : the origin ( o , o , o ) t is the lower left corner of the target rectangle the positive - x axis extends to the right along the bottom edge of the rectangle within a target &# 39 ; s coordinate system , each image pixel &# 39 ; s location can be calculated , knowing the following : xyz position of the top - center point of the acquired image ( given in cm as , for example , ( u . 0 ,− 3 . 0 ,− 1 . 0 )) size of a pixel in x and y direction ( for example , each equal to 0 . 025 cm ) the method of the present invention utilizes placement of the pixel data from each frame into a single 3 - d space based on the camera &# 39 ; s view . this requires transformation from each target &# 39 ; s coordinate system to the camera &# 39 ; s coordinate system . a 4 × 4 transformation matrix may be used to represent any combination of the translation , rotation and scaling of a 3 - dimensional coordinate system . thus , the matrix describes translation of the origin , rotation of xyz axes to another orientation , and optionally , change in scale ( although re - scaling is not required in this application ). any number of separate translation and rotation steps can be combined into a single transformation matrix , which will contain the result of all steps performed in sequence . target rectangle measurement data from vision system ; i . e ., position , aim , rotation the target - to - camera coordinate system transformation matrix is calculated for an ultrasound frame from the position , aim and rotation values for the frame . the image pixel data for this frame is then transformed into the camera &# 39 ; s coordinate system by multiplying each pixel &# 39 ; s xyz location in the target &# 39 ; s coordinate system by this transformation matrix . referring now to fig2 , the 4 × 4 target - to - camera transformation matrix can be determined from these given values : p 3 - element floating - point vector ( xyz ) t giving the position of the camera in the target &# 39 ; s coordinate system . a 3 - element floating - point vector ( xyz ) giving the position of a point directly ahead of the camera in the target &# 39 ; s coordinate system ( this defines the - z - axis of the camera &# 39 ; s coordinate system ). r a floating - point scalar giving the angle between bottom edge of the photograph and the line where the plane of the photograph intersects the plane of the target plate . ( in radians .) to generate the transformation matrix , the camera coordinate system axis vectors xyz c are calculated with respect to the target coordinate system with axes xyz t : z has a direction from point a to point p ( opposite the aim vector ). the direction l is calculated ; i . e ., the direction of the line of intersection of the xy plane and the xy plane ( z ). l is equal to the cross product of the normal to the xy plane ( z ) and the normal to xy plane ( z ). vector l is rotated by r radians on the xy plane : rotations qy and x around y are then calculated to bring vector z to point along z - axis vector l is rotated by r radians on the xy plane . opposite rotations − qy and − qx are applied to bring rotated vector l to point within the xy plane , giving final x vector . x and z are combined together , and rotations iz , iy , ix ( around z , y , x ) needed to bring them to match x and z calculated . point − p is transformed to calculate the target origin point in camera coordinate system the translation of that point is added to the transform to complete the matrix having calculated the transformation matrix , each pixel point is multiplied by this matrix to determine its position in camera space . | 8 |
with reference now to the various figures , one embodiment of the holding assembly 10 is shown in fig1 . here , holding assembly 10 is shown holding a camera 40 . the holding assembly 10 is preferably formed of an adjustable rigid support , which in the preferred embodiment is a telescopic rod 12 , shown in fig1 . the telescopic rod has telescopic units 12 a , 12 b . . . 12 n which may be locked in various positions of length adjustment . the telescopic rod has a first end distal from a second end . as shown in fig1 , the first end has telescoping unit 12 a , which is of the largest diameter , and is connected to a handle 14 . the second end 12 n is provided with removable ball - joint assembly 15 . in the embodiment shown in fig1 a camera 40 is secured to the ball - joint assembly 15 . to attach holding assembly 10 to a generally horizontal support surface , as shown in fig1 , a c - shaped hook 16 , which may be formed from sheet metal , plastic , or the like , may be removably attached to the handle 14 of the support 10 by a screw or attachment means known to one of skill in the art . alternatively , the c - shaped hook 16 may be secured to the ball - joint assembly 15 as shown in fig2 . the c - shaped hook 16 has a first vertically extending section 16 a provided with a lower horizontal tab portion 16 b which may be secured to the first end of the rigid telescoping sections which first end will become the upper end when the support is placed in its normal operating position . a ball - joint b may be used to attach camera mount to telescopic rod 12 . as shown in fig3 , the c - shaped hook 16 is also provided with an upper transverse section 16 c , and a downwardly extending section 16 d secured to the upper transverse section and spaced away from the and generally parallel to the vertically extending section 16 a . the downwardly extending section 16 d is provided with an elongated lower contact surface 16 e which is angled toward the support when in the normal operating position as shown in fig3 . elongated lower contact surface 16 e may be placed on virtually any horizontal structure to hold the support of the device of the present disclosure . the tail of the hook in elongated lower contact surface 16 e is very important ; where narrower shapes are more effective , as elongated lower contact surface 16 e has to grip mortar on brick walls and behind narrow spaces , and thus lower contact surface 16 e may have a chisel shape . in the embodiment show in fig2 the handle 14 is used to grip the holding assembly , pushing the apparatus skyward and unhooking it from the overhead support surface . in the embodiment of fig1 , the camera 40 or the ball - joint assembly 15 is grasped by the user to push the holding assembly 10 upwardly to release the c - shaped hook 16 from the surface to which it is engaged . fig1 shows the holding assembly 10 having a camera 40 secured to a ball - joint assembly 15 which in turn is secured to one end of telescopic rod 12 . the other end of the support may carry a c - shaped hook 16 , which in turn may engage various surfaces , such as the top surface of a board as shown in fig1 . as illustrated in fig2 , telescopic rod 12 is formed of telescoping segments 12 a , 12 b . . . 12 n which may be locked in various length positions . the telescopic rod 12 has first and second ends , each of which is preferably provided with screw threaded apertures which may receive various fasteners , such as a stud carried by the ball - joint assembly 15 . the ball - joint assembly 15 may be of differing designs , particularly one adapted to receive camera 40 as shown in fig1 , or alternatively smartphones as shown in fig2 and 4 . each ball - joint assembly 15 includes a first portion which is secured to an end of the rigid support as for example via a stud which is received in a threaded aperture at the end of the rigid support . the ball - joint assembly is also provided with a second portion which may be locked in various positions of adjustment via knob 22 . the second portion is provided with a mirror 20 so the user can see what the camera or smartphone will capture as an image . fig2 shows the manner in which the support for a picture taking device can be mounted on a relatively flat surface . in this view , elongated lower contact surface 16 e engages to top surface of a brick in a brick wall . while not shown , elongated lower contact surface 16 e may engage a variety of other surfaces , such as tree bark , wall and car moldings , etc . fig4 shows the c - shaped hook 16 engaging the top of a picture frame “ p ” which may above a mantle “ m ” over a fireplace “ f ”. in fig5 , c - shaped hook 16 is shown engaging a gutter “ g ” below a roof “ r ”. fig6 shows a holding assembly where the telescopic rod 12 with telescopic units 12 a , 12 b . . . 12 n has latches “ l ” which are used to secure the telescopic units 12 a , 12 b . . . 12 n from sliding . this variation is desired when using a heavy picture taking device such as a dslr . one embodiment of c - shaped hook 16 , as shown in fig7 and 8 , will have hinges to allow the hook to fold for transport . thus there will be a first hinge 32 between sections 16 a and 16 c , and a second hinge 34 between sections 16 c and 16 d . to fold the c - shaped hook 16 for transport , section 16 a will initially be folded onto section 16 c , and then section 16 d will be folded under section 16 c as shown in fig8 . the holding assembly 10 can further be used to provide near instantaneous mounting , without damage to any surface , of a camera 40 for surveillance and / or monitoring of an area or for personal viewing of a video , such as one might do on a train , by mounting the apparatus on the back of the seat in front of the person using it . this feature is shown in fig9 which , to a certain extent , corresponds to fig2 , except that , in fig9 , there is no requirement for the rigid support to have and adjustable length , nor is there a requirement for the upper ball - joint assembly 15 . fig1 shows an alternative embodiment of the present disclosure , wherein the holding assembly 100 has two sections , a camera attachment section 102 and a support attachment section 104 . from the view in fig1 , camera attachment surface 106 is visible , whereas the support attachment surface 142 ( shown in fig1 ) is facing away from the viewer in fig1 . the support attachment surface 142 is on the opposite side of holding assembly 100 when in the open position , and can be seen in fig1 , where the two panels are separated along hinge 140 . the hinge 140 may allow the two sections to rotate away from each other beyond 180 degrees to allow for attachment to a wide variety of surfaces , while having the camera remain vertically positioned . fig1 shows a post for screw holes 112 and rigid serrated grip 114 . rigid serrated grip 114 provides a significant advantage , in terms of holding power and stability , when combined with the adhesive means of attachment on the support attachment surface 142 . rigid serrated grip 114 , in the preferred embodiment , extends below the camera attachment section 104 and curves toward a support on the support side of camera attachment section 104 , extending beyond the vertical plane of the support side of camera attachment section 104 and gripping the support with teeth 116 , shown in fig1 , at its lower end . the teeth 116 of rigid serrated grip 114 contact the support and may form an angle of approximately 90 degrees with the support , as illustrated in fig2 b , although this angle may vary in some embodiments . the angle formed between the teeth 116 and the region of the support directly above the teeth 116 will generally be between approximately 10 and 90 degrees , such that the teeth 116 may grip the support to provide additional holding power to holding assembly 100 . fig1 shows a front view of holding assembly 100 when in the closed position . a tab 122 is included having an aperture 124 to accept additional means attaching holding assembly 100 to a support , such as tether 110 . teeth 116 are shown attached to the lower portion of camera attachment section 104 for gripping a support . fig1 shows a convex mirror 130 . the mirror 130 may be of various shapes and sizes . fig1 shows a hinge 140 having a hinge rod , which in alternative embodiments may be a ball - joint type hinge , for opening the holding assembly 100 . support attachment surface 142 is shown . the support attachment surface 142 may be an adhesive in the preferred embodiment . the adhesive is preferably washable and will not leave a significant residue on the support or camera . the adhesive may be gk - 22 , produced by northstar polymers . fig1 illustrates a j - hook 150 connected to holding assembly 100 through aperture 124 . fig1 shows cover plate 162 . fig1 shows convex mirror 130 and the j - hook 150 supporting holding assembly 100 through attachment to a tree branch . horizontal camera 170 , which may be a smartphone , is attached to the camera attachment surface 106 . fig1 shows vertical camera 180 and j - hook 150 . fig1 shows a holding assembly 110 combined with telescopic rod 12 attached to a flat support . fig2 a shows an embodiment of the present disclosure having a plurality of magnets 200 in the camera attachment section 104 . the magnets 200 allow attachment of a camera 40 , which may be a smartphone , to the camera attachment surface 106 without the use of adhesives or other means of attachment . alternatively adhesives and other means of attachment may be used in combination with magnets 200 . fig2 b illustrates a side cross - sectional view of holding assembly 100 showing magnets 200 along with cover plate 204 . fig2 b provides a side view of rigid serrated grip 114 , which adds stability to holding assembly 10 when in use . additionally , tab 122 can be seen in fig2 b . fig2 shows holding assembly 100 attached to an uneven surface , such as a mountainside , for support . vertical camera 180 is attached to the holding assembly 100 . while preferred embodiments of this disclosure has been described above and shown in the accompanying drawings , it should be understood that applicant does not intend to be limited to the particular details described above and illustrated in the accompanying drawings , but intends to be limited only to the scope of the disclosure as defined by the following claims . in this regard , the term “ configured ” as used in the claims is intended to include not only the designs illustrated in the drawings of this application and the equivalent designs discussed in the text , but it is also intended to cover other equivalents now known to those skilled in the art , or those equivalents which may become known to those skilled in the art in the future . | 5 |
illustrated in fig1 is a combination schematic circuit diagram and block diagram of a self checking temperature sensor system in accordance with the present invention . thereshown is a temperature sensing circuit 100 having a first electrical circuit terminating means or node 110 and a second node 120 . a first series circuit 112 is connected between the first and second nodes 110 and 120 , and comprises a ptc resistive temperature sensing component identified as zt1 . a second series circuit 114 in parallel with the first series circuit 112 is also connected between the first and second nodes 110 and 120 , and includes the series combination of ntc resistive temperature sensing component zt2 , resistor r1 , and diode d1 . as illustrated in fig1 the anode of diode d1 is electrically connected to node 120 , and the cathode is electrically connected to node 110 through resistor r1 and zt2 . therefore , when node 120 is more positive than node 110 , a current may pass through both the first and second series circuits -- into node 120 and out node 110 . in contrast , when node 110 is more positive than node 120 , current may only pass only through the first series circuit 112 -- into node 110 and out of node 120 . in the preferred embodiment of the invention resistor r1 is intended to be a 1 % precision metal film resistor , and diode d1 may be a 1n4148 manufactured by itt of california , usa , and have a forward voltage of 1 . 0v at 10 ma . temperature sensing component zt1 is intended to have a positive temperature coefficient , and zt2 is intended to have a negative temperature coefficient . an exemplary choice for zt1 is a silicon temperature sensor manufactured by u . s . sensor corp ., of california , usa , having a nominal resistance of 3000 ohms and a positive temperature coefficient in the order of 25 ohms per degree centigrade . an exemplary choice for zt2 is a thermistor manufactured by fenwal electronic inc . having a nominal resistance value 10 , 000 ohms at 25 ° c . and a non linear negative temperature coefficient in the order of - 200 ohms per degree centigrade . exemplary temperature characteristics for zt1 and zt2 are illustrated in fig3 and 2 , respectively . before proceeding , it should be noted that in the preferred embodiment of the invention , for the condition that node 110 has a more positive potential relative to node 120 , current will flow into node 110 substantially only through zt1 , and out of node 120 . therefore , in these circumstances , the effective impedance of the temperature sensing circuit means 100 is the impedance of only zt1 -- i . e ., the positive temperature coefficient resistive temperature sensing component having a nominal value of 3000 ohms . in contrast , for the condition that 120 has a more positive potential relative to node 110 in excess of the forward diode breakover voltage , current will flow into node 120 and out of node 110 . in these circumstances , the temperature sensing circuit means 100 exhibits an effective impedance , herein referred to as r net being substantially the impedance of zt1 in parallel with the sum of the impedances of zt2 and resistor r1 . by proper selection of these latter three components , the effective impedance can be forced to have a somewhat flat temperature characteristic over a selected temperature range as particularly illustrated in fig4 and 5 . fig4 illustrates the temperature characteristic of the aforesaid effective impedance over temperature range of - 40 to + 280 degrees fahrenheit for those nominal values of the components of the temperature sensing circuit as aforesaid . fig5 shows in more detail the temperature characteristic illustrated in fig4 over a temperature range between + 70 and + 250 degrees fahrenheit . as may be seen particularly in fig5 the effective impedance between + 70 and + 250 degrees fahrenheit is at times positive and negative and is approximately 2875 ohms plus or minus 25 ohms . as will be discussed below , it is this &# 34 ; flat &# 34 ; characteristic which provides for the ability of a self checking temperature sensing circuit in accordance with the present invention which may be employed in heating plant high limit control circuits and provide a fail - safe failure mode -- i . e ., all failure modes of either sensor result in a safe failure mode as will be subsequently described . further illustrated in fig1 is an application of a common rc charging circuit employing the temperature sensing circuit in accordance with the present invention . node 110 is electrically connected to pole p of switch sw2 through limit resistor r4 . one electrode of capacitor c1 is electrically coupled to node 120 through a limit resistor r2 , to pole p of switch sw1 through precision resistor r3 , and to input means 22 of comparator 20 . the other electrode of capacitor c1 is electrically coupled to electrical ground . the output of comparator 20 is presented as an input to signal processor 50 . switches sw1 and sw2 are controlled by switch control 40 having outputs for controlling switches sw1 and sw2 respectively . switch control 40 is operative for independently controlling switches sw1 through signal line 44 , and sw2 through signal line 42 to cause either switch pole p of switches sw1 and sw2 to be in an open condition as illustrated , electrically connected to contact a which is electrically connected to the positive polarity of en electric potential v 0 , or electrically connected to contact b which is electrically connected to electrical ground . switch control 40 receives an input signal from signal processor 50 on signal line 52 for determining the state of switches sw1 and sw2 . the operation of the rc circuitry of fig1 will now be described with reference to the following table : __________________________________________________________________________ sw1 sw2 diode d1 capacitor timecondition position position state state constant__________________________________________________________________________a a open inoperative charging t1 = r3 × c1b open b forward discharging t2 = r . sub . net × c1 biasedc open a reversed charging t3 = zt1 × c1 biasedd b open inoperative discharging t4 = r3 × c1__________________________________________________________________________ in accordance with the present invention , consider the application of the temperature sensing circuit means for hot water heating systems employing a boiler . in these circumstances , it is intended to detect the occurrence of a temperature exceeding a high limit value , for example 200 degrees fahrenheit , and where the normal water temperature is in excess of 70 degrees fahrenheit . in these circumstance r net will exhibit the &# 34 ; flat &# 34 ; characteristic over the desired temperature range of interest as illustrated in fig5 -- namely , r net will be in the range between 2850 and 2900 ohms . consider the alternate situations where c1 discharges through switch sw1 in position b , or discharges through switch sw2 in position b . in accordance with the above table , in the just mentioned temperature range , the time constant ratio t2 : t4 will be proportional to the ratio r net : r3 which is designed to be substantially a constant having a variation only dependent upon any variation of the flatness of the empirically determined resistance range -- namely a total variation of 50 ohms . this is so since r3 is substantially a constant and r net is substantially a constant . for a 3 . 3 microfarad capacitor , the time constant range due to variations only in r net would be in the order of 9 . 570 to 9 . 405 msec ( 9 . 4875 ± 0 . 87 % msec ). now consider the alternate situations where c1 is charged through either switch sw2 in position a , or through switch sw1 in position a . then from the above table , in the just mentioned temperature range , the time constant ratio t3 : t1 will be proportional to the ratio zt1 : r3 since r3 is substantially a constant , this ratio will vary directly proportional to the value of the ptc resistance of zt1 , and , corresponding temperature sensed by zt1 as exemplified by the temperature characteristic illustrated in fig3 . the aforementioned time constants particularly depicted in the above table may be easily monitored and measured by a variety of schemes well known in the art . one example , without detail , is illustrated in fig1 . thereshown is the employment of comparator 20 for monitoring the output voltage of capacitor c1 . comparator output signal on signal line 24 is presented to signal processor 50 . comparator 20 compares the capacitor output voltage with a reference voltage and causes the comparator output to indicate that the capacitor output voltage is above or below a reference voltage . in turn , signal processor 50 may be configured to control the action of switches sw1 and sw2 depending upon the timing ratio which is desired to be determine . from the timing ratio information obtained by signal processor 50 , signal processor 50 may provide an output on signal line 58 representative of the temperature sensed by zt1 -- diode d1 reversed biased ; and / or provide a high limit signal on signal line 60 indicative of the temperature of the boiler exceeding a preselected value . it should be noted that a single signal line alternatively could be used , or the like , for subsequent system control . as aforesaid , if all is functioning properly over the desired operating range of the boiler , r net will be substantially a constant thereby self checking the condition of both temperature sensing components zt1 and zt2 . if , on the other hand , the resistance values of either zt1 or zt2 drift away from their nominal values , the ratio t2 : t4 will be observed to fall outside predetermined limits . in turn signal processor may provide a &# 34 ; failure &# 34 ; signal command on output signal line 60 . such a failure signal would also occur if either zt1 or zt2 electrically shorts or opens . at the same time , if the temperature sensing circuit is functioning properly , a high limit temperature sensed by zt2 may be detected by monitoring the ratio t3 : t1 . since this ratio increases with increasing temperature due to zt1 impedance increasing with increasing temperature ( ptc ), a high limit signal may be issued upon the ratio exceeding a pre - selected value . it should be noted , of course , that zt1 failing open would indicate a high temperature -- a fail safe failure . the block diagram of the switch control 40 and signal processor 50 is of course only exemplary . these functional blocks are particularly suitable for being incorporated in a micro - processor based system for achieving the intended control , monitoring and detection functions as should be appreciated by those skilled in the art . it should be appreciated by those skilled in the art that the behavior of the impedance characteristics of temperature sensing circuit 100 may monitored by other means than rc circuitry where charging and discharging time constants are monitored . the principal in accordance with the present invention is the behavior of the effective impedance between nodes 110 and 120 for the two conditions of polarity : ( 1 ) when node 110 is more positive than 120 , and ( 2 ) when node 120 is more positive than node 110 and in excess of the forward breakover voltage drop of diode d1 . the addition of the rectifying means , diode d1 , brings about the polarity sensitive effective impedance r net . that is , as already described , in one polarity the effective impedance of the temperature sensing circuit is the impedance value of zt1 , and in the other polarity is the effective impedance r net . when the intended application of the temperature sensing circuit means in accordance with the present invention is for a limit function , it is intended that r net be characteristically flat over the desired temperature operating range . the characteristic flatness of temperature versus resistance is of course dependent upon the nominal resistance values of zt1 and zt2 , as well as choice of resistor r1 , and as such is either empirically or mathematically determined . there are , of course many combinations , all of which are intended to be within the true spirit and scope of the present invention . the foregoing description of the invention is necessarily detailed so as to provide understanding of the invention &# 39 ; s best mode of practice . it is to be understood , however , that various modifications of detail , rearrangement , addition , and deletion of components may be undertaken without departing from the invention &# 39 ; s spirit , scope , or essence . in particular , the polarity of diode d1 may be reversed thereby affecting the polarity of the operative conditions of the temperature sensing circuit means as described . further , resistor r1 may also be located in a different series order than shown in fig1 . of course , other circuit components may be added or removed , all of which are intended to be within the scope of the present invention . | 6 |
fig1 schematically illustrates an exemplary embodiment of a device for implementing the method according to the invention . the device 1 includes as a heat source a laser 10 , for example a diode - pumped “ nd : yag ” ( neodymium - doped ) laser . its frequency is doubled using a nonlinear ktp ( potassium titanyl phosphate ) crystal , not shown in fig1 . to clarify , in a practical embodiment , the wavelength is 532 nm , with a typical pulse duration of 90 ns . the laser 10 operates at a high firing rate , preferably at a frequency of 10 khz , but can be within a typical range of 1 khz to 30 khz . to this end , conventional electronic circuits 11 generate control pulses i c , which are transmitted to the laser 10 . advantageously the laser beam is injected into a multimode optical fiber 12 , making it possible to homogenize the spatial profile of the optical intensity . via an output , the optical fiber 12 is coupled with one or more optical lenses , only one of which 13 is shown in fig1 . the lens 13 is disposed so as to make it possible to obtain , on the surface of a block of material 14 , an incident beam f li of homogeneous intensity , focused on an area to be heated z th whose surface area typically varies between 0 . 2 and 5 mm 2 , with a fluency of between 0 . 01 and 4 j / cm − 2 . the incident laser beam f li makes it possible to heat the surface of the block of material 14 . this block of material 14 whereof predetermined thermophysical properties need to be known is composed of at least two layers : a superficial layer 140 , of small thickness , and a substrate 141 of large thickness compared to that of the superficial layer 140 . the thickness of the layer 140 is typically within a range of 0 . 1 μm to 900 μm . without going beyond the scope of the invention , the block of material 14 can comprise several superposed superficial layers of small thickness . the temperature measurement is performed using a sensor that is sensitive in a range of thermal radiation wavelengths , thus making it possible to obtain enough signal , yet this range is different enough from the wavelength emitted by the laser 10 so that the latter does not interfere with the measurement . moreover , this sensor 15 has response time that is much shorter than the time between two consecutive shots . this sensor 15 converts the thermal radiation into electrical output signals v s transmitted to a signal acquisition and processing system 18 . the signal acquisition and processing system 18 makes it possible to deduce the temperature using methods known to the person skilled in the art . in the embodiment described in fig1 , the sensor 15 is coupled with an optical fiber 16 , itself coupled via an input to one or more optical lenses , only one of which 17 is shown . the optical lens 17 collects the radiation emitted by the surface of the block 14 . in an additional embodiment ( not illustrated ), the “ sensor 15 — signal acquisition and processing system 18 ” combination can be replaced by a pyrometer . in a practical exemplary embodiment , a kleiber ® c - lwl pyrometer , which is sensitive in a wavelength range of between 1 . 58 and 2 . 2 μm , is used . this measuring device is equipped with a lens for collecting part of the radiation emitted by the material under test . in a preferred embodiment , the signal acquisition and processing system 18 is embodied by means of a computer system with a stored program , comprising specific acquisition cards that receive the signals converted by the sensor 15 and associated with the labview ® (“ laboratory virtual instrument engineering workbench ”) software . this type of operating mode is intrinsically well known to the person skilled in the art and there is no need to describe it further . in a preferred embodiment , the temperature analysis can be performed using specialized software , for example the matlab ® interactive calculation software available on the market , which makes it possible to perform numerical simulations based on numerical analysis algorithms . in the context of the invention , this software makes it possible to solve the heat equation in the medium under test in question , taking into account an internal heat source representing the laser pulse heating . thermophysical parameters such as the thickness of the layer , the thermal resistance between the two layers , the thermal diffusivity , the absorption coefficient and / or the density of the material are variables , and can be adjusted based on experimental results . creating a calculation program using software of this type is an operation that is intrinsically within the capability of the person skilled in the art . here again , there is no need to describe it in further detail . in a preferred embodiment , the heating and the radiation measurement are carried out in a controlled atmosphere , for example in a nitrogen , argon or vacuum atmosphere . in an additional variant of embodiment ( not illustrated ), a gas jet can be sprayed onto the surface of the material ( the superficial layer 140 ) in order to prevent any influence of the ambient atmosphere on the heated surface . in another embodiment , in order to obtain a mapping of the thermophysical properties of the superficial layer , the heating of the material can also be obtained using a laser beam scanned over the surface under the control of a galvanometric scanning device , for example comprising a motor 19 mechanically coupled with an array of optical elements 13 ( mirrors and lenses ) disposed on a rotating shaft . in this embodiment , the optical lens 17 for collecting the thermal radiation must be moved so as to continuously collect the thermal radiation issuing from the area heated by the laser . in another embodiment , in order to obtain a mapping of the thermophysical properties of the superficial layer , the surface of the material 14 is moved past the array of optical lenses 13 . we will now describe a first example of the results obtained using the method of the invention , in reference to fig2 . it is assumed that the high - frequency pulsed laser beam generated by the laser 10 in fig1 is projected onto a block of material 14 comprising two layers , a superficial layer 140 and a substrate 141 . it is also assumed that the superficial layer 140 of small thickness is composed of a material that is highly absorbent of the electromagnetic radiation of the beam generated by the laser 10 and not very thermally diffusive on the surface . the experiment is repeated for superficial layers 140 of various thicknesses , i . e . 2 , 3 and 4 μm in the example described ( curves c 1 through c 3 , respectively ). the material is heated by laser pulses of very short duration ( 90 ns ) emitted at a high firing rate ( 10 khz ). as mentioned above , according to one of the important features of the invention , this choice of frequency makes it possible to accumulate heat , shot after shot , because the superficial material 140 does not have time to cool completely between pulses . it is assumed in the example in fig2 that the salvo of shots comprises ten successive shots ( laser pulses ) tir 1 through tir 10 , repeated after a time interval of 0 . 1 ms ( the horizontal time axis t , graduated from 0 to 1 ms ). the laser pulses , synchronized with the instants 0 through 0 . 9 ms on the time axis t of fig2 , cause sudden temperature increases , with the successively reached temperatures culminating in values tmax i ( typically between 3 , 000 and 3 , 500 ° c . : the vertical axis t of temperatures from 0 to 3500 ° c .) which increase steadily from one shot to the next . when a laser pulse stops , the temperature of the superficial layer of material 140 decreases , but much more slowly than it increased during the temperature increase ( natural cooling ), so as to reach minimum values tmin i ( typically between 250 and 500 ° c .) that increase steadily from one shot to the next . it is easy to see in fig2 that the evolution of the temperature in a single shot ( the first shot , tir 1 ) does not make it possible to distinguish any notable differences in behavior between the various layer thicknesses ; the curves c 1 through c 3 are practically the same . on the other hand , the accumulation of heat , shot after shot , makes it possible to distinguish a clear difference between the various layer thicknesses . in the example described in fig2 , this difference between the curves c 1 through c 3 becomes completely perceptible beginning with the third pulse , tir 3 . an additional series of experiments was conducted , this time no longer varying the thickness of the superficial layer 140 , but choosing a thin layer of material that was highly conductive and not very diffusive on the surface , disposed on a highly thermally diffusive material forming a thick substrate 141 . to conduct these experiments , three different thermal contact values were selected . the thermal contact values were divided into three classes , with two extremes : “ perfect ” thermal contacts and “ no contact ,” respectively . an “ intermediate ” thermal contact value was also chosen . the respective curves c ′ 1 , c ′ 3 and c ′ 3 in fig3 correspond to the three aforementioned classes . as before , the horizontal axis is graduated in time units t ( from 0 to 1 ms ), the vertical axis in temperature units t ( from 0 to 4 , 500 ° c . ), and the salvo of shots comprises ten pulses , t 1 through t 10 , repeating every 0 . 1 ms and having a duration equal to 90 ns . the successively reached temperatures culminate in values t ′ max i ( typically between 2 , 500 and 4 , 500 ° c .) which increase steadily from one shot to the next . in the same way as in the preceding case , when are laser pulsing stops , the temperature decreases , but much more slowly than it increases during the temperature increase , so as to reach minimum values t ′ min i ( typically between 250 and 750 ° c .) that also increase steadily from one shot to the next . here again , it is not possible to see differences between the thermal contacts of different classes with a single shot ( the first pulse tir 1 ). the curves c ′ 1 through c ′ 3 are practically the same . on the other hand , the accumulation of heat , shot after shot , makes it possible to reveal the difference in behavior between the various classes of contacts , here again beginning with the third pulse tir 3 , in the example described in fig3 . moreover , this differentiation becomes greater and greater , again in the example described , between the “ no contact ” class ( curve c ′ 3 ) and the other two classes ( curves c ′ 1 and c ′ 3 ). in the two exemplary experiments described above , it is possible to obtain a set of predetermined information on the superficial layer 140 by analyzing predetermined heating and cooling time regimes of said material ( 140 ). the analysis focuses on all or some of the following regimes : the measurement of the average increase in its temperature , the time evolution of the temperature during the heating in each thermal cycle or selectively for predetermined thermal cycles , the average temperature value reached at saturation , the maximum temperature value ( tmax i ) reached for each thermal cycle or selectively for predetermined thermal cycles , the temperature value reached just before each laser pulse or selectively before predetermined laser pulses , the temperature value in one or more predefined time intervals between two laser pulses as compared to the previous laser pulse , the - time evolution of the temperature between two laser pulses , the time evolution of the temperature after the end of said salvo of laser pulses and / or the temperature value reached in one or more predetermined periods after said salvo of laser pulses ( not illustrated in fig2 and 3 ). the main steps of the method according to the invention will now be described in detail . a first step consists of heating the surface of a block of material 14 comprising at least two different layers , a superficial layer 140 of small thickness , typically on the order of one micrometer , disposed on a thick ( in comparison with the thickness of the superficial layer 140 ) substrate 141 . however , the thickness of the superficial layer 140 can be greater or less than one micrometer without going beyond the scope of the invention . the heating is performed using a laser 10 , pulsed at a high firing rate so the material absorbs the laser radiation , heats up and partially cools between two shots . in essence , the firing rate , i . e . the repetition frequency of the pulses delivered by the laser 10 , is chosen so as to be high enough so that the maximum temperature tmax i reached cannot fall back ( tmin i ) to the initial temperature . the number of shots applied to the block of material 14 can be high enough so that the average temperature increase reaches saturation and remains substantially constant , but it can also be lower , depending on the type of measurement to be performed . the energy of the laser pulses must be high enough so that the thermal signal can be measured with a sufficient signal - to - noise ratio . since the measurement must be non - destructive , it is understood that this energy must also be low enough not to damage the material . a second step consists of collecting all or part of the thermal radiation emitted by the surface of the material . the collection and transport of the radiation can be performed using optical lenses 17 and an optical fiber 16 . a third step consists of measuring at least part of this collected thermal radiation using a sensor 15 whose spectral sensitivity range is adapted to the radiation emitted by the target and converting it into electrical signals . the measurement can be performed , for example , using a pyrometer , advantageously a multi - channel pyrometer in order to eliminate the emissivity specific to the material . in that case , the second and third steps can be combined into a single step , since the pyrometer is normally provided with a lens that collects the radiation emitted by the material under test . a fourth step consists of analyzing predetermined heating time regimes of the material , i . e ., in particular , the average increase in the temperature , the time evolution of the temperature during the heating with each shot ( i . e ., with each laser pulse ) or selectively for predetermined shots , the average maximum temperature value , the maximum temperature value tmax i reached for each shot or selectively for predetermined shots , the temperature value reached just before each shot , t ′ min i , or selectively before predetermined shots , the temperature value in one or more time intervals between two shots as compared to the previous shot , the time evolution of the temperature between two shots , the time evolution of the temperature after the salvo of shots , and / or the temperature value reached in one or more predetermined periods after the salvo of shots . a fifth step consists of comparing the values of the measurements performed and acquired with theoretical values given by the heat equation adapted to the block of material under test , these theoretical values being obtained using a numerical modeling process , and of matching up these two series of values by varying one or more physical parameters of the material , such as the thickness of the superficial layer , the thermal conductivity of the superficial layer , the absorption coefficient of the superficial layer and / or the density of the superficial layer . the numerical modeling can be obtained , as indicated above , using calculation software that is available on the market , such as the aforementioned matlab ® or any similar software . preferably , the theoretical calculation of the heating takes into account the effects of the roughness of the surface of the material , nonhomogeneous heating of the material ( for example , either due to an intrinsic nonhomogeneity of the material or due to a nonhomogeneity of the intensity of the laser beam ), interference with the beam in the superficial layer , the thickness at which the temperature is measured , etc . in light of the description given above , it is easy to see that the invention achieves the objects set forth . it offers a number of advantages , particularly in that it makes it possible both to obtain a very good “ signal - to - noise ” ratio and to heat the material to a sufficient depth for the entire thickness of the thin superficial layer and / or the thermal contact between two layers to actually be involved . it is not , however , limited to the exemplary embodiments explicitly described , particularly in reference to fig1 through 3 . likewise , precise numerical examples have been given only in order to better demonstrate the essential features of the invention and are merely the result of a technological choice that is intrinsically within the capability of the person skilled in the art , in accordance with a specific intended application . they do not limit the scope of the invention in any way whatsoever . | 6 |
in a first aspect , the present invention provides a process for preparing a polymer latex comprising polymerizing one or more ethylenically unsaturated aromatic monomers and one or more conjugated diene monomers in the presence of hydroperoxide chain transfer agent and sulfur - containing chain transfer agent , wherein the sulfur - containing chain transfer agent is added after the hydroperoxide chain transfer agent . the hydroperoxide chain transfer agent used in the invention can be hydrogen peroxide or an organic hydroperoxide having the general structure rooh , wherein r is an organic residue . examples of useful organic hydroperoxides are tert - amyl hydroperoxide , tert - butyl hydroperoxide , cumene hydroperoxide , diisopropylbenzene hydroperoxide and pinane hydroperoxide . tert - butyl hydroperoxide is preferably used as the hydroperoxide chain transfer agent in the present invention . in the invention , two or more hydroperoxides may be used in combination as the hydroperoxide chain transfer agent . the hydroperoxide chain transfer agent is typically used in a total amount of 0 . 5 to 10 parts by weight , preferably 0 . 5 to 8 parts by weight , more preferably 0 . 5 to 4 parts by weight , based on 100 parts by weight of the total amount of monomers . the sulfur - containing chain transfer agent used in the invention can be a mercaptan compound , especially an alkyl mercaptan such as methyl mercaptan , ethyl mercaptan , tert - butyl mercaptan , benzyl mercaptan , tert - nonyl mercaptan , n - octyl mercaptan , n - dodecyl mercaptan and tert - dodecyl mercaptan , a thioglycolic acid or thioglycolic acid ester , such as iso - octyl thioglycolate and 2 - ethylhexyl thioglycolate , thiopropionic acid such as iso - octyl mercaptopropionic acid or a dithio compound such as 1 , 8 - dimercapto - 3 , 5 - dioxaoctane . tert - dodecyl mercaptan is preferably used as the sulfur - containing chain transfer agent in the present invention . in the invention , two or more sulfur - containing compounds may be used in combination as the sulfur - containing chain transfer agent . the sulfur - containing chain transfer agent is typically used in a total amount of 0 . 1 to 10 parts by weight , preferably 0 . 1 to 5 parts by weight and more preferably 0 . 1 to 2 parts by weight , based on 100 parts by weight of the total amount of monomers . a combination of tert - butyl hydroperoxide and tert - dodecyl mercaptan is a preferred combination of chain transfer agents used in the present invention . the polymer latex of the present invention is prepared from a monomer mixture which contains one or more ethylenically unsaturated aromatic monomers and one or more conjugated diene monomers , and which may optionally contain further polymerizable monomers ( also referred to as comonomers ) such as monofunctional or multifunctional acrylic and methacrylic acids and corresponding acrylate and methacrylate monomers . the one or more ethylenically unsaturated aromatic monomers are typically used in a total amount of 10 to 90 wt %, more preferably 25 to 75 wt %, even more preferably 30 to 70 wt %, based on the total amount of monomers ( including comonomers ). representative ethylenically unsaturated aromatic monomers include , for example , styrene , α - methyl styrene , p - ethyl styrene , p - methyl styrene , tert - butyl styrene , vinyl toluene and c 1 - 4 alkyl , chloro and bromo derivatives thereof . a particularly preferred ethylenically unsaturated aromatic monomer is styrene . the one or more conjugated diene monomers are typically used in a total amount of 10 to 80 wt %, more preferably 20 to 80 wt %, even more preferably 20 to 70 wt %, even more preferably 25 to 60 wt %, based on the total amount of monomers . representative conjugated diene monomers include , for example , 1 , 3 - butadiene , isoprene , 2 - methyl - 1 , 3 - butadiene , 2 , 3 - dimethyl - 1 , 3 - butadiene and chlorinated butadiene . a particularly preferred conjugated diene monomer is 1 , 3 - butadiene ( also abbreviated as butadiene ). a combination of styrene and butadiene is a preferred combination of monomers in the present invention , preferably used in the respective amounts as indicated to be preferred above . further polymerizable monomers ( comonomers ) may be used as monomers to be polymerized in the preparation of the polymer latex of the present invention . two or more of such further comonomers may be used in combination . examples of such comonomers include acrylate monomers , and two or more acrylate monomers may be used in combination . representative examples of the acrylate monomers include , for example , n -, iso - and tent - alkyl esters of acrylic or methacrylic acid , wherein the alkyl group has from 1 to 20 carbon atoms . additionally , acrylate monomers can include acids , esters , amides of the ( meth ) acrylic acid , and substituted derivatives thereof . generally , preferred acrylate monomers are c 1 - c 20 alkyl ( meth ) acrylates and c 1 - 10 alkoxy c 1 - c 10 alkyl ( meth ) acrylates , more preferably c 1 - c 8 alkyl ( meth ) acrylates and c 1 - c 8 alkoxy c 1 - c 8 alkyl ( meth ) acrylates . examples of such acrylate monomers include n - butyl acrylate , sec - butyl acrylate , ethyl acrylate , hexyl acrylate , cert - butyl acrylate , 2 - ethylhexyl acrylate , iso - octyl acrylate , 4 - methyl - 2 - pentyl acrylate , 2 - methylbutyl acrylate , methyl methacrylate , butyl methacrylate , n - butyl methacrylate , isobutyl methacrylate , ethyl methacrylate , isopropyl methacrylate , hexyl methacrylate , cyclohexyl methacrylate , and cetyl methacrylate , methoxyethyl methacrylate , ethoxyethyl methacrylate , methoxyethyl acrylate , ethoxyethyl acrylate , butoxyethyl methacrylate , methoxybutyl acrylate and methoxyethoxyethyl acrylate . preferred acrylate monomers are n - butyl acrylate , butyl methacrylate , 2 - ethylhexyl acrylate , methyl acrylate and methyl methacrylate , with methyl methacrylate and n - butyl acrylate being especially preferred . typically , the amount of acrylate monomer ( if used ) will be from 0 to 70 wt %, preferably from 0 to 60 wt %, even more preferably from 0 to 50 wt %, based on the total amount of the monomers . further examples of such comonomers include ethylenically unsaturated mono - and di - carboxylic acid monomers such as ( meth ) acrylic acid , fumaric acid , maleic acid and itaconic acid , nitrile monomers such as acrylonitrile , vinyl ester monomers , hydroxyalkyl -( meth ) acrylate monomers , alkoxyalkyl ( meth ) acrylate monomers , and ( meth ) acrylamide monomers . a particularly preferred comonomer is acrylonitrile , preferably used in an amount of at least 2 wt %, more preferably at least 3 wt %, even more preferably at least 4 wt %. in terms of ranges , preferred amounts are 2 to 25 wt %, more preferably 3 to 20 wt %, even more preferably 4 to 12 wt %. it has been found that acrylnonitrile has a particularly profound effect on the effectiveness of the combined , sequential use of the charge transfer agents in the process of the present invention and on the properties of the resulting polymer latex . further comonomers useful in the present invention are crosslinkers and include crosslinkable monomers , such as multi - ethylenically unsaturated monomers . exemplary crosslinkers include n - methylol acrylamide , n - methylol methacrylamide , glycidyl acrylate , glycidyl methacrylate , ethylene glycol dimethacrylate , allyl methacrylate , diallyl maleate , propylene glycol dimethacrylate , divinylbenzene ; and acryloxy alkylsilanes , such as , for example , α - acryloxypropyl trimethoxysilane . preferred crosslinkable monomers for use in the present invention are allyl methacrylate , glycidyl methacrylate , and acryloxy alkylsilanes . these crosslinkable monomers , if used , are typically employed at levels of from 0 . 05 to 10 , preferably 0 . 05 to 5 wt %, more preferably 0 . 05 to 2 wt %, based on the total amount weight of monomers . in one preferred embodiment of the present invention , the polymer latex is prepared from at least styrene , butadiene and acrylonitrile , preferably used in the respective amounts as indicated to be preferred above . initiators useful in the practice of the present invention include water - soluble and / or oil - soluble initiators which are effective for purposes of polymerization . representative initiators are well - known in the art and include , for example , thermal initiators that are oil - soluble , such as higher alkyl peroxides or azo compounds or thermal initiators which are water - soluble such as persulfate ; redox pairs including sodium sulfite , sodium bisulfite , sodium metabisulfite or sodium formaldehyde sulfoxylate and persulfate salt , ferrous ions and a peroxide ( fenton &# 39 ; s reagent ), cuprous ions and peroxide , and ferrous ions and sodium persulfate wherein the peroxides can include benzoyl peroxide , hydrogen peroxide , or t - butyl peroxide . examples of oil - soluble thermal initiators are azobisisobutyronitrile and t - butyl peroctoate . the initiator is employed in an amount sufficient to initiate the polymerization reaction at a desirable rate . in general , the amount of initiator will range from 0 . 05 to 5 , preferably 0 . 1 to 4 wt %, more preferably from 0 . 1 to 3 wt %, based on the total amount of the monomers . in a preferred embodiment , the process of the present invention does not employ a redox pair as an initiator . surfactants or emulsifiers suitable for use in the present invention include those conventional surface active agents typically known in the art for polymerization processes . the surfactant ( s ) can be added to the aqueous phase and / or monomer phase . an effective amount of surfactant in a seeded process is that amount selected to assist in stabilizing the particle as a colloid , minimizing contact between the particles and preventing coagulation . in an unseeded process , an effective amount of surfactant will be that amount selected to influence the particle size . representative surfactants include saturated and ethylenically unsaturated sulfonic acids or salts thereof , including , for example , hydrocarbon sulfonic acids , such as , vinyl sulfonic acid , allyl sulfonic acid , and methallyl sulfonic acid , and salts thereof ; aromatic hydrocarbon - sulfonic acids , such as , for example , p - styrene sulfonic acid , isopropenyl benzene sulfonic acid , and vinyloxybenzene sulfonic acid , and salts thereof ; sulfoalkyl esters of acrylic acid and methacrylic acid , such as , for example , sulfoethyl methacrylate and sulfopropyl methacrylate and salts thereof ; and 2 - acrylamido - 2 - methylpropanesulfonic acid and salts thereof ; alkylated diphenyl oxide disulfonates , sodium dodecyl benzene sulfonates and dihexyl esters of sodium sulfosuccinic acid , ethoxylated alkyl phenols and ethoxylated alcohols ; and sulfosuccinate ester salts , alkylethoxylated sulfate and alkylethoxylated sulfonate salts , alkyl ( poly ) phosphate salts , and alkyl sulfate and alkyl sulfonate salts . the type and concentration of surfactant is typically dependent on the polymer solids level and latex particle size . a higher polymer solids level and a low particle size will generally increase the need for surfactant . typically , surfactants are employed in a total amount of from 0 . 05 to 20 , preferably from 0 . 05 to 10 , more preferably from 0 . 05 to 5 , parts by weight , based on the total weight of the monomers . various protective colloids may also be used in place or in addition to the surfactants described above . suitable colloids include partially acetylated polyvinyl alcohol , casein , hydroxyethyl starch , carboxymethyl cellulose , hydroxyethyl cellulose , hydroxypropyl cellulose and gum arabic . the preferred protective colloids are carboxymethyl cellulose , hydroxyethyl cellulose and hydroxypropyl cellulose . in general , these protective colloids are used at total amounts of 0 to 10 , preferably 0 to 5 , more preferably 0 to 2 parts by weight , based on the total amount of the monomers . various other additives and ingredients known to those skilled in the art can be incorporated to prepare the latex polymer or latex polymer composition of the present invention . such additives include , for example , metal chelating agents , ph buffering agents , anti - foaming agents , wetting agents , thickeners , plasticizers , fillers , pigments and antioxidants . known anti - foaming agents include silicon oils , polysiloxane oils , acetylene glycols , mineral oils and paraffinic oils and formulated compounds . common known wetting agents include alkylphenol ethoxylates , alkali metal dialkyl sulfosuccinates , acetylene glycols and alkali metal alkyl sulfates . typical thickeners include polyacrylates , polyacrylamides , xanthan gums , modified celluloses or particulate thickeners such as silicas and clays . typical plasticizers include mineral oil , liquid polybutenes , liquid polyacrylates and lanolin . zinc oxide , titanium dioxide , aluminum hydrate , calcium carbonate , and clay are typically employed fillers . in the present invention , the polymerization for producing the polymer latex is preferably started in the presence of hydroperoxide chain transfer agent , and sulfur - containing chain transfer agent is added as the polymerization proceeds . for example , the monomer mixture can be added to the hydroperoxide chain transfer agent or combination of hydroperoxide chain transfer agents , or vice versa . alternatively , hydroperoxide chain transfer agent can be added to the polymerizing monomer mixture as the polymerization proceeds , preferably in the period of from 3 to 8 % of the total polymerization time . in such case , hydroperoxide chain transfer agent is preferably added in the form of an aqueous solution . the sulfur - containing chain transfer agent or combination of sulfur - containing chain transfer agents is added after the hydroperoxide chain transfer agent , as the polymerization proceeds . the expression “ added after the hydroperoxide chain transfer agent ” is intended to mean an addition after substantially all of the hydroperoxide chain transfer agent has been introduced in the process , in particular after at least 80 wt %, more particularly at least 90 wt %, even more particularly at least 95 wt %, or at least 99 wt %, or 100 wt % of the hydroperoxide chain transfer agent has been introduced in the process . the sulfur - containing chain transfer agent or combination of sulfur - containing chain transfer agents is preferably added continuously over at least 20 % of the total polymerization time , more preferably over at least 40 % of the total polymerization time , even more preferably over at least 60 % of the total polymerization time , even more preferably over the total polymerization time . the total polymerization time , as referred to in this specification , represents the time from contacting the monomer mixture , or a part thereof , with initiator until the desired degree of polymerization is achieved . for example , in case the monomer mixture is continuously added to the reaction as the polymerization proceeds , the total polymerization time represents the time from beginning of the addition until termination of the addition , including the time of subsequent addition of initiator to achieve the desired degree of polymerization . in general , the polymer latex of the present invention can be prepared by polymerization processes which are known in the art , and particularly by the known latex emulsion polymerization processes , including both seeded and unseeded latex polymerization , provided the addition of the specific chain transfer agents is carried out as described above . representative processes include those described in u . s . pat . no . 4 , 478 , 974 , u . s . pat . no . 4 , 751 , 111 , u . s . pat . no . 4 , 968 , 740 , u . s . pat . no . 3 , 563 , 946 , u . s . pat . no . 3 , 575 , 913 , de 1 905 256 and wo 2011 / 079011 . such processes can be adapted as necessary to polymerize the monomer mixture used in the present invention . the method of introduction of the monomer mixture and other ingredients , such as polymerization aids , is not particularly critical , except for the addition of the chain transfer agents . the polymerization is then carried out under conventional conditions until the desired degree of polymerization is achieved . preferably , the polymerization is carried out at a temperature of from 50 to 95 ° c ., more preferably from 70 to 90 ° c ., crosslinkers and the well - known latex polymerization aids such as initiators , ph buffering agents , surfactants and emulsifiers can be used as needed . the following examples are given to illustrate the invention and should not be construed as limiting it in any way . unless stated otherwise , all parts and percentages are given by weight . a series of latexes is prepared by emulsion polymerizing a monomer composition of styrene , butadiene , itaconic acid , acrylic acid and acrylonitrile , in the additional presence of surfactant and persulfate and varying amounts and types of chain transfer agents . the polymerization is carried out as a seeded radical emulsion polymerization with a particle size range of 120 to 140 nanometers ( nm ) at a temperature of 90 ° c ., similar to the method described in example 1 of wo 2011 / 079011 . gel % test measures gel content and optionally swelling index . the gel content measures the solvent - insoluble fraction of the polymer . the swelling index measures the amount of solvent absorbed by the solvent - insoluble fraction of the polymer . for polymer partly or completely insoluble in solvent ( so that the molecular weight cannot be measured by gel permeation chromatography ), this technique allows a comparative measure of both molecular weight and crosslinking density of the tested polymers . the higher the gel %, the higher the crosslinking density network and corresponding molecular weight . when the polymer is produced by emulsion polymerization reaction in which one or more chain transfer agent types are present and when this is the only parameter modified , a high sell value indicates a low chain transfer efficiency . for the determination of gel content of the polymer latexes of the present invention , toluene is used as the solvent . dry films are made from the latexes adjusted to ph 8 . a dry latex film having a weight ( a ) is swollen for 24 hours with toluene . the toluene - insoluble wet gel is then separated by filtration . after drying the wet gel , the weight of the dry gel is determined as ( c ). gel % is calculated as : elongation at break and force at break reflect polymer film tensile strength . high gel % polymers ( highly crosslinked , with high molecular weight ) show a reduced elongation at break and high force at break when subjected to an elongational force . low sell polymers films ( low crosslinked , with low molecular weight ) have the ability to deform under stress but will break at a lower stress . tensile strength is tested on film samples of 75 mm length , 10 mm width , with a center part width of 5 mm . the punch press is a naef 22 / 028 . tensile tests are performed according to astm d2370 - 92 using a houndfield 5000 extensiometer with a crosshead speed of 100 mm / minute . 4 - phenylcyclohexene ( 4 - pch ) is a by - product formed by diels - alder side reaction competing with emulsion polymerization reaction . the higher the 4 - pch amount , the lower the polymerization reaction conversion and consequently the more diels - alder by - products are likely to be formed . in the present invention , the higher the 4 - pch amount , the more the chain transfer agent acts as a polymerization retarder . a given weight of wet latex is extracted for one hour with isooctane . the isooctane extract is injected in a gas chromatography column previously calibrated with standards . results are given as ppm of impurities based on wet latex . examples 1 to 4 ( comparative ) and 5 to 8 ( in accordance with the invention ): example 1 is prepared in the same manner as described above with 1 . 7 wt % of tert - dodecyl mercaptan being added continuously over the monomer total feed time . example 2 is prepared in the same manner as described above with 4 wt % of tert - butyl hydroperoxide being added continuously over the first 44 . 5 % of the monomer total feed time . example 3 is prepared in the same manner as described above with 0 . 85 wt % of tert - dodecyl mercaptan and 1 . 4 wt % of tert - butyl hydroperoxide both being added continuously over the monomer total feed time . example 4 is prepared in the same manner as described above with 0 . 85 wt % of tert - dodecyl mercaptan being added continuously during the first 50 % of the monomer total feed time and 1 . 4 wt % of tert - butyl hydroperoxide being added continuously over the last 50 % of the monomer total feed time . example 5 is prepared in the same manner as described above with 0 . 85 wt % of tert - dodecyl mercaptan being added continuously during the monomer total feed time and 1 . 4 wt % of tert - butyl hydroperoxide being added at the start of the emulsion polymerization reaction . example 6 is prepared in the same manner as described above with 0 . 85 wt % of tert - dodecyl mercaptan being added continuously during the monomer total feed time and 1 . 87 wt % of tert - butyl hydroperoxide being added at the start of the emulsion polymerization reaction . example 7 is prepared in the same manner as described above with 1 . 13 wt % of tert - dodecyl mercaptan being added continuously during the monomer total feed time and 1 . 4 wt % of tert - butyl hydroperoxide being added at the start of the emulsion polymerization reaction . example 8 is prepared in the same manner as described above with 0 . 85 wt % of tert - dodecyl mercaptan being added continuously during the first 74 % of the monomer total feed time and 1 . 4 wt % of tert - butyl hydroperoxide being added at the start of the emulsion polymerization reaction . * measurement duplicate for example 1 and from a separate measurement series for example 3 and 4 compared to the others the latex polymers of examples 1 to 8 are formulated into an 80 parts of calcium carbonate and 20 parts of clay formulation at 70 wt % solids and ph 8 . 5 . 8 and 10 wt % of binder levels are used . each formulation is coated onto a base paper having a weight of 85 g / m 2 at a coating weight of 12 g / m 2 . the coated papers are evaluated in terms of binding strength as measured by the number of passes to fail in the ink piling test . the ink piling test simulates coated paper surface picking due to ink tack built up from multiple ink splitting events as paper goes through multiple printing station units during industrial offset printing . coated paper surface picking results in particles being transferred back to the blanket and printing cylinder where they agglomerate and disturb the printing process and final visual printing appearance . paper strips of 4 . 5 × 26 centimeters are printed on a prufbau lab printing unit with two printing rolls with a 10 seconds interval between each roll . this allows proper ink deposit on the paper sample . the printing rolls have been previously prepared with a calibrated and controlled standardized huber ink amount which is uniformly applied on each roll . the paper sample is visually inspected for surface picking and further passed through a vulcanized disk every 5 seconds until picking occurs . the number of passes under the vulcanized disk until picking failure is recorded as the number of passes to fail . the evaluation of the coated papers is summarized in fig1 . | 2 |
as best shown in fig8 a vault 20 according to this invention comprises a body 21 , a lid 22 , a clip 23 and a fastener 24 . when the lid is brought down onto the body and the fastener is fastened to the clip , the joinder and assembly are exemplified in fig8 and 9 when the vault is assembled , it forms an enclosed region 25 within which connections ( not shown ) can be placed and accessed through the top end 30 . conventionally the conduits , cables , or valves being connected are brought into the region through the open bottom end 31 of the body . customarily the body is buried in a surrounding region , such as soil , or abutted by gravel or concrete poured around it to stabilize it in place . the upper end of the body will be placed where , when the lid is attached , the upper surface of the lid will be at grade . the peripheral wall 32 of the body is a quadrilateral frustum , sloping upwardly from the bottom end . if preferred , the bottom end could be the larger end , but structural consideration will prefer the illustrated shape over the reverse , or from a prismatic shape ( which could also be used ). circular vaults are also in this scope of this invention , but quadrilaterals are generally preferred . the illustrated shape is well - suited to manufacture by injection molding processes , which is an advantage in the reduction of cost . it is also amenable to rotational molding . the lower end includes an upwardly extending peripheral skirt 33 . attention is called to buttresses 34 which are integral with ( or attached to ) the inside of the skirt and the outside of the peripheral wall . these provide strong support for the skirt , which in turn provides significant rigidity to the lower end so that side forces are less likely to distort the shape of the body . a rim 40 is formed at the top end of the body , where a seat 41 is formed by a re - entrant wall 42 that terminates in an inwardly - extending flange 43 . a lip 44 is formed as an inward extension from flange 43 , with a hole 45 therethrough for a purpose to be described . buttresses 46 fit between the outer surface of wall 42 and the inner surface of the peripheral wall . these buttresses may be molded as part of the body or later cemented or solvent welded in as preferred . however , it will be noted that all elements of the body as shown are suitable for molding in a single operation , perhaps drilling the hole as a second operation . in the event that a positive lock for the lid is not necessary a rise 49 , which may be one or more dimples , or a circumferential band , is formed on the inside of the re - entrant wall . it will frictionally engage to the lid to be described , and require extra force to remove the lid . lid 22 is best shown are fig5 - 7 . it includes a top plate 50 with an upper surface 51 and an optional shoulder 52 that extends around the edge of the lid . the underside of the lid is formed as a plug 53 which is intended to fit in seat 41 , bearing against re - entrant wall 42 and , depending on preference , with shoulder 52 bearing on the rim or the lower end of the plug bearing on flange 43 , or both . to reduce its weight and cost , the bottom is relieved by a honeycombing with intersecting plates 53 forming voids between them . rise 49 will engage the lid , and perhaps slightly indent into it . as best shown in fig9 a recessed opening 55 is formed through the lid near its edge . it has a shoulder 56 around the edge of the opening . a second opening 57 through the opposite edge of the lid is provided to facilitate removal of the lid from the body . lock means 60 comprise clip 23 and fastener 24 . if desired , an e - ring 61 can be placed on the fastener at a spacing from the head . the e - ring can be removed with difficulty . while it is in place it will hold the fastener to the lid , but permit substantive axial movement of the fastener . as best shown in fig9 clip 25 is pressed over lip 44 , where it overhangs hole 45 . fastener 24 , which is a threaded , headed bolt , carries a washer 62 and passes through opening 55 , bearing against the lid as shown . the e - ring can be used if ready separation of the bolt from the lid is not desired . the bolt is threaded into the clip , and the lid is locked in place . the lid can be removed after the - bolt is unthreaded from the clip . as a security measure , the head of the fastener may be coded in shape so as to require a special wrench to engage it . the conventional means for this is to provide an array of curving surfaces which is non - symmetrical . basically this means avoiding parallel driving surfaces , or not providing any array at all , for example a circular head . a pentagonal array is a suitable example . clip 23 is uniquely advantageous to this vault , because it can readily be pushed onto the lip where it will retain itself even when not engaged by the fastener . furthermore it can readily and inexpensively be manufactured from a strip of suitably strong metal , usually a stainless steel . as shown in fig1 - 14 , the clip has a pair of arms 70 , 71 which are joined by a bight 72 . the arms confront one another . installation of the clip is facilitated by oppositely directed bends 73 , 74 at the tips of the arms . upper arm 70 has an opening 75 therethrough with a partial circumference 76 from which a retainer 77 has been punched . the retainer has a complete hole 78 therethrough , and is formed as a catch , angled inwardly from its base area 70 . in side view the retainer has a small bend 80 which enables the retainer to slide over the lip without digging into the plastic as a sharp end would . after installation , the retainer exerts a strong retentive force that may indent into the lip . lower arm 71 has a pair of catches 81 , 82 punched in from the outside , further to retain the lip . a neck 85 is formed on the lower arm , extending outwardly from the clip . it has a tubular wall 86 with an internal thread 87 . the thread and the hole in the upper arm are aligned , and when the clip is installed these will be aligned with hole 45 in the lip , and with the fastener . the assembly with the lid is best shown in fig9 . the neck may be made separately and fastened to the arm if desired . however , it is an advantage of the clip that it can be made from a single strip of metal by successive operations . the neck may readily be formed by impact extrusion , in which metal is deformed from the plane of the strip and extruded to form the neck . the free end of the neck will be squared off , and the inside threaded . the retainer can be formed in a single or double blow , forming the hole in it , and then severing the metal around only part of the retainer while bending it to shape . the folds at the end of the bight are made by a simple folding operation . the organic plastic material for the body and lid may be any suitable for the intended purpose . high density polyethylene or polypropylene family is one suitable example . this invention provides a vault made up from a number of unique and readily manufactured parts . the parts themselves are economically made by routine procedures . this invention is not limited by the embodiment shown in the drawings and described in the description , which is given by way of example and not of limitation , but only in accordance with the scope of the appended claims . | 4 |
to enable the objects , features and advantages of the present invention to be readily understood , the present invention will be described in more detail via the preferred embodiments with reference to the accompanying drawings . referring to fig3 , an lcd having a conducting film according to a first embodiment of the present invention is depicted therein . an lcd panel 20 comprises a first conducting high polymer film 21 formed on an upper surface of the lcd panel 20 and a second conducting high polymer film 22 formed on a lower surface of the lcd panel 20 . the first and the second conducting high polymer films 21 , 22 are each formed by spin - coating a solution of papsa ( poly ( aniline - co - n -( 4 - sulfophenyl ) aniline )) copolymer , having a suitable concentration , with water as a solvent or other organic solvents , wherein the first and the second conducting high polymer films 21 , 22 each have a conductivity of 0 . 0035 s / cm per unit area . then , an upper polarizer 100 and a lower polarizer 100 are then bonded onto the upper and lower conducting high polymer films 21 , 22 respectively . as such , charges produced when the polarizers 100 are bonded to the panel 20 is apt to be rapidly eliminated through the first and the second conducting high polymer films 21 , 22 , and thus ics and tft devices in the panel is exempted from damage . referring to fig4 , an lcd having a conducting film according to a second embodiment of the present invention is depicted therein . an lcd panel 30 comprises a first conducting high polymer film 31 formed on an upper surface of the lcd panel 30 and a second conducting high polymer film 32 formed on a lower surface of the lcd panel 30 . the first and the second conductive high polymers 31 , 32 are each formed by spin - coating a solution of a psa ( poly ( n -( 4 - sulfophenyl ) aniline )), having a suitable concentration , with water as a solvent or other organic solvents , wherein the first and the second conducting high polymer film 31 , 32 each have a conductivity of 0 . 006 s / cm per unit area . then , an upper polarizer 200 and a lower polarizer 200 are bonded onto the first and the second conducting high polymer films 31 , 32 , respectively . as such , charges produced when the polarizers 200 are bonded to the panel 30 is apt to be rapidly eliminated through the first and the second conducting high polymer films 31 , 32 , and thus ics and tft devices in the panel is exempted from damage . referring to fig5 , an lcd having a conducting film according to a third embodiment of the present invention is depicted therein . an lcd 40 comprises a first conducting high polymer film 41 formed on an upper surface of the lcd panel 40 and a second conducting high polymer film 42 formed on a lower surface of the lcd panel 40 . the first and the second conducting high polymer films 41 , 42 are each formed by spin - coating a solution of papsah ( poly ( aniline - co - n - propanesulfonic acid aniline )), having a suitable concentration , with water as a solvent or other organic solvents , wherein the first and the second conductive high polymers 41 , 42 each has a conductivity of 0 . 01 s / cm per unit area . then , an upper polarizer 300 and a lower polarizer 300 are bonded onto the first and second conductive high polymers 41 , 42 , respectively . as such , charges produced when the polarizers 300 are bonded to the panel 40 is apt to be rapidly eliminated through the first and the second conductive high polymers 41 , 42 , and thus ics and tft devices in the panel is exempted from damage . referring to fig6 , a flowchart illustrating a method of manufacturing an lcd panel having a conductive polymer is depicted therein . the method comprises the following steps . at first , an lcd panel is provided ( step 100 ). then , a conductive polymer solution capable of eliminating charges is prepared , the solution being formed by using conductive polymer powder dissolved in water or other organic solvents ( step 200 ). next , the conductive polymer solution is coated on an upper surface as a first conductive polymer and a lower surface as a second conductive polymer of the lcd panel by a spin - coating method ( step 300 ). thereafter , the conductive polymer solution on the lcd panel is to bake at a temperature of 100 ° c . after the water content in the solution is removed , the conductive film in a form of the conductive polymers is obtained ( step 400 ). since the conductive polymer provides a specific conductivity , the accumulated charge on the surface of the polarizer occurred when the polarizer is bonded to the lcd panel may be conducted away or rapidly eliminated through the conductive polymers . as such , the tft devices and ics in the lcd panel may be exempted from damage . further , the conductivity of each of the conductive polymers may be high up to 0 . 01 s / cm , near to those of conductors . in addition , the conductive polymer is slight in weight and easy to be processed . in conclusion , since the accumulated charges produced when the polarizer is bonded onto the panel may be eliminated by the inventive conductive polymer formed on the lcd panel , the pricy discharge polarizer may not be necessary and thus cost of the lcd panel may be reduced . while embodiments and applications of this invention have been shown and described , it would be apparent to those skilled in the art having the benefit of this disclosure that many more modifications than mentioned above are possible without departing from the inventive concepts herein . the invention , therefore , is not to be restricted except in the spirit of the appended claims and their equivalents . | 8 |
fig1 illustrates in flow form the method and steps for utilizing the inventory control system . thus , the inventory control system 10 serves to aid the owner or operator of business 12 while providing complete and continual control of stock inventory . it is now contemplated that business 12 will be any of various types of retail outlet , but the system is applicable at any sales level . first institutions of the inventory control system have been with the automobile parts business and , as may be seen from fig2 certain descriptions will be so oriented . the user or business 12 will first take inventory of his store to enable production of his particularly required store of optical bar code tickets 14 as shown in fig2 . the optical bar code tickets are of an attachable type wherein a central ticket 16 includes the bar code 18 , part description 20 , stock number 22 and , if desired , current price 24 . the central ticket 16 of bar code ticket 14 has no gummed backing as this is only applied on the rear side of perforated tabs 26 and 28 . thus , the user can stick on the code identifier 14 , on the merchandise it applies to , while on the shelf and then tear - off the central ticket 16 upon sale for subsequent accounting procedure , as will be further described . referring again to fig1 once the user has decided to use the system and has listed the pertinent data relative to his inventory , the bar code tickets 14 are printed out at the ticket custom user &# 39 ; s supply 30 , and supplied to the user for marking all of his merchandise with the appropriate tickets 14 . at the same time , the digital data compiled in marking up the optical bar code tickets for user 12 is suitably stored as by magnetic tape recording or the like for introduction via line 32 to the central computer 34 . central computer 34 is a general purpose type having the requisite peripheral recording 36 and user readout devices 38 as required in accordance with volume of data , number of users , etc . thus , inventory data in accordance with digital bar code from business 12 is also in storage relative to central computer 34 once the business 12 is on system and marking merchandise with bar code tickets 14 . in present installation , the central computer 34 is a centurion iv as commercially available from warrex computer corporation of dallas , tex . this computer includes disk drive , central processing unit , video terminals and printer . the processor has a memory capacity which is expandable up to 65 k - bytes , mos random access , memory parity and real time clock . user readout 38 may be effected at the central video terminal of the computer system , or it may be printed out for dispatch to the user location as business operations prefer . moving again to business 12 , the user will tear - off center ticket 16 of each bar code ticket 14 ( fig2 ) upon sale of each item with deposit of the center ticket 16 in a safe place for periodic delivery of all tickets to the processing station as indicated by ticket delivery stage 40 . upon delivery of the tickets they are then sorted and read in ticket processing apparatus 42 , as shown in fig3 et seq ., with output of optically read bar code data from ticket reader 44 via line 46 to the central computer 44 . the optical ticket reader 44 may be any of several commercially available devices , and one presently utilized is known as the scanmark available from markem corporation of keene , n . h . this ticket reader reads out the optical bar code in proper digital format for direct application and acceptance by the central computer 34 . after ticket reading , the center tab 16 operates in a ticket depository 48 wherein used tickets may be saved for reasons peculiar to the business , but record is retained of their existence and purpose in any event . fig3 illustrates the sorting / reading device 42 as it includes a hopper 50 for receiving incoming ticket center tabs 16 for sorting and alignment conveyance along a separating track 52 that leads to an optical reading station 54 and deposit conveyor 56 . the hopper 50 consists of an inclined portion 58 having opposite angular sides 60 and 62 which direct ticket tabs to a central throat portion 64 . also positioned at the throat portion 64 as mounted on frame 66 is a variable speed sorting motor 68 extending rotary shaft 70 and relatively stiff rubber fingers 72 into the sorting area . rubber fingers 72 when rotated tend to move the centered ticket tabs 16 onto the separating conveyor 74 for further separation and movement toward optical reading station 54 . the speed of motor 68 can be varied by the operator in accordance with the volume of input tickets , greasy or sticking conditions and the like . the separator conveyor 74 , as shown in enlargement in fig4 consists of a suitable resilient , rubberized belt 76 having transverse strips 78 bonded thereon in uniform spacing 80 which is slightly larger than the length of a center ticket 16 . thus , as tickets proceed along the separating conveyor 74 they tend to fall individually into one of the spacings 80 between two adjacent overlay strips 78 . also aiding in the ticket separation function along separation conveyor 74 are a plurality of individually adjustable separating finger assemblies 82 , as will be further described . separated tickets then arrive at optical reading station 54 whereupon they pass over optics plate 84 , are digitally read out with data transmission to the central computer , and are then carrier by deposit conveyor 56 to ticket depository 48 . a drive motor 86 operating through a variable gear box 88 provides primary power to the sorter assembly 42 . in present design , a dayton 1 / 2 horespower motor , model 2m145 , is employed and the variable gear box 88 is controllable between 25 and 200 revolutions per minute . rotational output from variable gear box 88 is then applied via rotary linkage 90 to drive deposit conveyor 56 . at the opposite end of conveyor 56 , the same rotational drive is taken off via rotary linkage 92 and applied to a suitable rotary drive transfer 94 for re - application by rotary linkage 96 to drive the separator conveyor 74 . as shown more particularly in fig5 the rotary drive elements are supported by a commercially available self - aligning bearing , borg - warner type lp - 112 , and bearings 98 and 100 support the deposit conveyor 56 for rotation as well as transmission of rotary drive , while bearing 102 and 104 support the separator conveyor 74 . the bearings 98 - 104 are simply secured under the frame apron panel 106 in proper position , and four additional bearings of the same type are similarly located on the other side as supported beneath frame panel 108 ( see fig3 ). referring now to fig6 the two opposite sides of frame 66 ( fig3 ) are formed of right angular structures consisting of top panel 108 and side panel 110 on one side and top panel 106 and vertical side panel 112 opposing . a transverse support plate 114 is then secured as by welding between side panels 110 and 112 along the length of frame 66 in order to support the conveyor belt 74 along the extent . as also shown in fig6 the plurality of separating finger assemblies 82 are each adjustably secured on a support rod 116 as supported between blocks 118 and 120 which are secured as by welding to the respective frame side panels 108 and 106 . the finger assembly 82 is rotationally supported by a block portion 122 supported on rod 116 and which can be rigidly affixed by means of a securing screw 124 . the details of separating finger assembly 82 are also evident in fig7 and 8 where it can be seen that the block portion 122 extends a lever arm 126 to which are affixed a securing pad 128 maintaining a rubber brush 130 in operative alignment with the upper surface of separator conveyor 74 . the rubber fingers 130 are merely made up of a section of rubber as secured between securing pad 128 and the end of finger 126 with the lower extending portion repeatedly slit to provide a brushing action as against center tab tickets 16 passing along separator conveyor 74 . there are included seven such separating finger assemblies 82 in series and this has proven to be a number satisfactory for efficiently separating all center tab tickets 16 entering into separator conveyor 74 . that is , when one , two or more tickets may enter the conveyor in stacked array , their passing through the successive separating finger elements 82 tend to arrange and maintain but a single ticket 16 lying between respective transverse strips 78 with a very high degree of reliability . in this manner , it is extremely reliable that each and every center tab ticket will be read with appropriate digital output to the central computer . in practice the individual separator finger assemblies 82 are adjusted by respective set screws 124 so that securing pads 128 are successively closer to the upper moving surface of separator conveyor 74 as you progress along the conveyance , and such adjustment results in an alignment whereby the last separator finger assembly 82 at position 132 is set so that the securing pad 128 will barely allow clearance of the separator conveyor 74 and transverse strips 78 . also shown in fig7 is the interior pulley arrangement showing transverse pulleys 134 and 136 moving deposit conveyor 56 , the pulley 134 receiving input rotational drive as applied from rotational link 90 ( fig3 ). similarly , drive transfer is affected from pulley 136 with transfer input to a pulley 138 which , in concert with a pulley 140 provides driven support for the separator conveyor 74 . as tickets are moved past the optical reading station 54 across optical plate 84 they are read out by a commercially available form of optical reader . fig9 illustrates one form of ticket reader 44 wherein alternative output is enabled so that no matter which way the center tab 16 progresses across optical plate 84 , it will be read . that is , since digital bar code is only printed on one side of the ticket 16 , the machine has the capability of reading either side as it passes through the optical field of view . the reading station 54 requires merely a standard form of uniform light source 142 and suitable directing optics 144 , to direct the light through the support optics 84 and the printed bar code on ticket 16 to the sensor apparatus 146 within ticket reader 44 . the structure and operation of such optical ticket reading apparatus is well - known in the art and commercially available , as before described , and the equipment utilized in the present invention provides data output on lead 46 which is properly formatted for entry and acceptance at the central computer 34 for processing and storage of pertinent data . in operation , the present invention enables an efficient and economical way for numerous types of small business retail outlets to maintain continual record of inventory and updated accounting of business conditions . a central agency supplying the central computer service can supply the bar code tickets in customized manner to account for all retail sales items of the particular business . after the business user labels his goods and maintains diligent center tab ticket collection for submission to the central agency , the business user has the capability of continually updating his inventory information , and he can also obtain printed readout showing such conditions . initially , the business user need only take inventory of his store merchandise and thereafter attach a bar code inventory control ticket ( fig2 ) to each and every piece of merchandise in accordance with proper identification . when a piece of merchandise is sold , the ticket is removed and dropped in a lock box or other repository subject to periodic removal and dispatch to the central sorting and computing agency . using the ticket 16 data , the central processing agency can enter customer cost , stock numbers and other numerical data in the memory of the computer to enable the business user to receive a printout indicating gross profit on all sales at the end of selected periods of time , e . g ., weekly or monthly . the central agency can control retail sales only , if so desired , and thereafter give the user business an exact list of all merchandise sold by listing manufacturer and stock number ; or the agency can control all inventory in and out by receiving packing slip information . the latter course can be accounted for by either the business user or the central agency by entering the pertinent information on cassette as may be keyed from the computer terminal . the central agency can pick up ticket information and deliver new substitute tickets for like merchandise by courier or mail , and this service can be rendered either daily , weekly or at any period as depends upon the needs of the user . further , after a history of inventory movement and replacement is established , the central computer is able to write orders for the business user and rapidly furnish such written orders within hours . the present system in simplest form is able to control movement by merely having a starting inventory and thereafter recording movement of merchandise . a small business user then has at hand the information needed to dispose of merchandise which is not selling and is therefore able to place his investment in merchandise that sells . in effect , the central computer radout provides a picture of all merchandise , that which is sold as well as that which is not sold . at periodic intervals , for example year end or the like , the central computer can provide a printout of complete inventory , thus obviating the necessity for time consuming manual inventory of the user business . the inventory can be cost extended and priced if so desired , and it will be correct and up to date to the extent that cursory sport check or shelf count will indicate any possible shrinkage figure . additionally , the present inventory control system will apply to either a fifo or lifo procedure and give exact inventory figures . still further , the central computer can offer complete accounting figures with entry of payment or disbursement data on cassette tape as keyed for input to the computer . such information for each individual business user can be periodically entered on disks for that particular user , and such further capability multiplies the capacity of the computer and reduces the cost to individual business users . changes may be made in the combination and arrangement of procedures as heretofore set forth in the specification and shown in the drawings ; it being understood that changes may be made in the embodiment disclosed without departing from the spirit and scope of the invention as defined in the following claims . | 6 |
a machine for producing packaging ( not shown ) processes a material or a flat substrate . in this case , it is a substrate in the form of a continuous web , for example of flat cardboard . as shown in fig1 , the machine comprises a converting unit for a substrate 1 in order to convert the web 2 . the direction of feed or of unwinding ( arrow f in fig1 ) of the web 2 and of the converted web following the longitudinal direction indicates the upstream direction and the downstream direction of the unit 1 . the positions front and rear are defined with regard to the cross direction , as being the driver or operator side and the side opposite the driver or operator side respectively . the machine can have a web unwinder , units such as printing units , means for controlling the quality and the register of the print , a web guiding means and yet other units which are positioned upstream of the unit 1 . the converting unit 1 is a unit for embossing , creasing and cutting . the web 2 arrives in the unit 1 through the upstream transverse side thereof , at a constant speed . an infeed group comprising drive rollers and return rollers for the web 2 is provided at the input to the unit 1 . the unit 1 converts the web 2 , gradually by embossing it , creasing it and cutting it . the unit 1 delivers repeats or converted boxes 3 , being as a result in embossed , creased and cut flat cardboard . the boxes 3 leave the unit 1 through the downstream transverse side thereof , at the same constant speed . the boxes 3 , prepared in the unit 1 , are then separated laterally and longitudinally from one another in a separating station then are received in a receiving station ( not shown ). the unit 1 first comprises a first arrangement for providing the embossing 4 , arranged upstream , i . e . at the input to the unit 1 . the embossing arrangement 4 is provided with the top rotary embossing tool 6 , positioned parallel to a bottom rotary embossing tool 7 . in the exemplary embodiment , an embossing cassette 8 comprises the embossing arrangement 4 . the unit 1 comprises a second arrangement for providing the creasing 9 , disposed downstream of the embossing arrangement 4 . the creasing arrangement 9 is provided with a top rotary creasing tool 11 , positioned parallel to a bottom rotary creasing tool 12 . in the exemplary embodiment , a creasing cassette 13 comprises the creasing arrangement 9 . the unit 1 comprises a third arrangement providing the cutting 14 , disposed downstream of the creasing arrangement 9 , i . e . at the output of the unit 1 . the cutting arrangement 14 is provided with a first top rotary cutting tool 16 , positioned parallel to a second bottom rotary cutting tool 17 . in the exemplary embodiment , a cutting cassette 18 comprises the cutting arrangement 14 . the arrangements 4 , 9 and 14 , and thus the cassettes 8 , 13 and 18 , are placed following one another so that each one realizes its respective conversion , by embossing , creasing and cutting the web 2 . a waste stripping tool in the form of a cylinder provided with stripping needles can also be provided in place of the bottom rotary cutting tool 17 . other combinations are possible such as a top cylinder forming both a cutting tool and a creasing tool . the rotational axis of each of the tools for embossing 6 and 7 , creasing 11 and 12 and cutting 16 and 17 is oriented transversely with respect to the unwinding direction f of the web 2 . the rotational direction ( arrow rs in fig2 ) of the top tools for embossing 6 , creasing 11 and cutting 16 is reversed with respect to the rotational direction ( arrow ri in fig2 ) of the bottom tools for embossing 7 , creasing 12 and cutting 17 . the cassettes for embossing 8 , creasing 13 and cutting 18 are capable of being introduced into a supporting structure 19 of the unit 1 , of being fixed to the supporting structure 19 , of producing , then conversely , are capable of loosened from the positive connection with the supporting structure 19 and of being extracted from the supporting structure 19 . the unit 1 thus comprises three transverse housings provided in the supporting structure 19 for each of the three cassettes 8 , 13 and 18 . the cassettes 8 , 13 and 18 are introduced vertically , from above , with respect to the supporting structure 19 into the transverse housings . conversely , the cassettes 8 , 13 and 18 can be removed vertically with respect to the supporting structure 19 , out of their respective transverse housings . the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises ( see fig2 ) the first top cylindrical rotary tool 16 which is provided with cutter threads ( not shown ) machined or built on its circumference in terms of the configuration of the boxes to be realized . the second bottom cylindrical rotary tool or anvil 17 has a smooth circumference . the web 2 unwinds f in the radial gap 20 between the top tool 16 and the anvil 17 . the top tool 16 is arranged so as to cooperate with the anvil 17 in order to convert , i . e . cut the web 2 . the top tool 16 is provided at its front end with a first front top rolling ring 21 . the top tool 16 is provided at its rear end with a second rear top rolling ring 22 . the anvil 17 is provided at it front end with a third front bottom rolling ring 23 . the anvil 17 is provided at its rear end with a fourth rear bottom rolling ring 24 . all the rings 21 , 22 , 23 and 24 have a truncated form . the top rings 21 and 22 thus have an inside curved surface laid flat against the curved surface of the top tool 16 . the bottom rings 23 and 24 have an inside curved surface laid flat against the curved surface of the anvil 17 . the top rings 21 and 22 of the top tool 16 contact , bear on and roll on the opposite bottom rolling rings 23 and 24 , respectively of the anvil 17 . this results in the front top ring 21 having an outside conical surface which abuts against an outside conical surface of the front bottom ring 23 and the rear top ring 22 having an outside conical surface which abuts against an outside conical surface of the rear bottom ring 24 . in the exemplary embodiment , the two top rings 21 and 22 of the top tool 16 are laterally displaceable ( arrow l in fig2 ). when the operator displaces laterally l a ring 21 and 22 with respect to its opposite ring 23 and 24 , for example by a few tenths of a millimeter , their respective conical surfaces are not positioned in the same place . the overall accumulated thickness of the front ring 21 of the top tool 16 and of the front ring 23 of the anvil 17 , or of the rear ring 22 of the top tool 16 and of the rear ring 24 of the anvil 17 vary compared to one another . this results in a variation in the radial space , i . e . in the radial gap 20 , between the top tool 16 and the anvil 17 . the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises a first top front bearing 26 and a second top rear bearing 27 , which hold the first tool , i . e . the top tool 16 , by its rotational axis 28 for rotation . the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises a third bottom front bearing 29 and a fourth bottom rear bearing 31 which hold the second tool , i . e . the anvil 17 , by it rotational axis 32 for rotation . the base of the two bottom bearings 29 and 31 rests on the supporting structure 19 when the cutting cassette 18 is inserted into the unit 1 . the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises driving means , in the form of a gear wheel arrangement ( not shown in the figures ), intended to rotate the two tools 16 and 17 . when the cassette 18 is inserted into the supporting structure 19 , the gear wheel arrangement meshes with the teeth of a gear wheel combined with an electric motor for rotational movement . the first top front bearing 26 of the top tool 16 is fixed to the third bottom front bearing 29 of the anvil 17 , and the second top rear bearing 27 of the top tool 16 is fixed to the fourth bottom rear bearing 31 of the anvil 17 , so as to constitute the cutting cassette 18 . to hold the cassette 18 all in one unit , tightening elements , in the form of four ties , front upstream and front downstream 33 , and rear upstream and rear downstream 36 , in a vertical manner cross the top front bearing 26 and the top rear bearing 27 , on both sides of the rotational axis 28 of the top tool 16 . the bottom end of each of the four ties , front 33 and rear 36 , is threaded and is screwed into a female thread of the bottom front bearing 29 and of the bottom rear bearing 31 respectively . four nuts , front upstream and front downstream 34 , and rear upstream and rear downstream 37 , are screwed onto the top end of the four ties , front 33 and rear 36 , respectively . the nuts 34 and 37 block the ties 33 and 36 by bearing on a top face of the top front bearing 26 and of the top rear bearing 27 respectively and allowing the bearings to be prestressed in twos . the cutting cassette 18 , as well as the embossing cassette 8 and the creasing cassette 13 , comprise two gripping lugs 38 each provided on the top face of the top front bearing 26 and of the top rear bearing 27 . the two lugs 38 are intended for cooperating with the lifting means in order to raise the cassette 18 , 8 and 13 vertically and transport it outside of the supporting structure 19 . so as to be able to carry out an adjustment of the radial gap 20 between the top tool 16 and the anvil 17 , just one top ring or more often the two top rings 21 and 22 have to be displaced along their tool 16 . to do this , the top tool 16 is moved vertically away from the anvil 17 , and the rings 21 , 22 , 23 and 24 are thus freed from any constraint of support . according to the invention , the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises first translation means 39 in order to move the first bearing 26 vertically away ( arrow u in fig3 and 4 ) from the third bearing 29 , and conversely in order to move the first bearing 26 vertically closer ( arrow d in fig3 and 5 ) to the third bearing 29 . the cutting arrangement 14 , and therefore the cutting cassette 18 , comprises second translation means in order to move the second bearing 27 vertically away from the fourth bearing 31 , and conversely in order to move the second bearing 27 vertically closer to the fourth bearing 31 . the first and second means of translation 39 move the first bearing 26 and the second bearing 27 respectively along a predetermined distance . the means of translation 39 have two positions ( fig4 and 5 ). consequently , the first and second bearings 26 and 27 have the same two positions and , consequently , the top tool 16 and the anvil 17 have the same two positions . in a first position moved closer , the two tools 16 and 17 are arranged with respect to one another with an optimum radial gap 20 , and cooperate to realize the cutting function . in a second position moved away , the two tools 16 and 17 have a space between them and are capable of being modified by displacement of their rings 21 and 22 respectively . the translation means 39 are advantageously disposed between the first lateral bearing 26 and the third lateral bearing 29 so as to lift up the first lateral bearing 26 . the translation means 39 are advantageously disposed between the second lateral bearing 27 and the fourth lateral bearing 31 so as to lift up the second lateral bearing 27 . to do this , the translation means 39 , in a preferred manner , are in the form of a first front device 41 , in order to move the first bearing 26 away from the third bearing 27 by lifting , and conversely in order to move the first bearing 26 closer to the third bearing 27 by lowering . the translation means 39 , in a preferred manner , are in the form of a second rear device , in order to move the second bearing 27 away from the fourth bearing 31 by lifting , and conversely in order to move the second bearing 27 closer to the fourth bearing 31 by lowering . in the embodiment , the device 41 comprises a cylindrical rod 42 which is vertical , approximately parallel to the front ties 33 and centered with respect to the rotational axis 28 of the top tool 16 and with respect to the rotational axis 32 of the anvil 17 . the rod 42 is capable of sliding along a rectilinear vertical movement u and d , between the position moved closer and the position moved away and conversely between the position moved away and the position moved closer . the rod 42 carries out a maximum run ( e in fig4 ) of sliding u . the rod 42 thus reaches a high point which corresponds to the desired and necessary gap between the top tool 16 and the anvil 17 so as to carry out the displacement of the two top rings 21 and 22 . one end or one top face 43 of the rod 42 abuts in an overall manner against a bottom face 44 of the first bearing 26 . a first obstructed , vertical , cylindrical housing 46 is arranged in a bottom part of the first bearing 26 and opens out at the bottom face 44 of said first bearing 26 . the bottom part of the rod 42 with the top end 43 is thus inserted into the first housing 46 . in a preferred manner , the device 41 comprises an eccentric 48 , positioned at the third bearing 29 . in order to obtain the sliding movement u and d , an end or a bottom face 47 of the rod 42 can bear on the eccentric 48 . a second cylindrical housing 49 is arranged in a top part of the third bearing 29 and opens out at the top face 51 of said third bearing 29 . the bottom part of the rod 42 with the bottom end 47 is inserted into the second housing 49 . the eccentric 48 is inserted to the bottom of the second housing 49 . the rod 42 is capable of being actuated manually , by rotating the eccentric 48 . the eccentric 48 is capable of turning ( arrows tu and td in fig4 and 5 ) in a perpendicular manner with respect to the rod 42 and to the third bearing 29 , i . e . in this case horizontally . the device 41 comprises means for manually actuating the rod 42 . said means comprise a shaft which is appreciably horizontal and extends the eccentric 48 and a rotary actuating knob 52 which is provided with a finger 53 , extending out of the outside face 54 of the third bearing 29 , and fixed to the shaft of the eccentric 48 . the rear device comprises the same constituent parts . according to the invention , a method for adjusting a radial gap 20 existing between two converting tools , the top tool 16 and the anvil 17 , in the converting arrangement , i . e . for cutting 14 the web 2 , comprises several successive stages . in a first stage , the operator releases the prestress by loosening the tightening elements , i . e . in this case the nuts 34 and 37 . the operator actuates the actuating knobs 52 by turning them pu clockwise by half a turn and the eccentric 48 turns tu in a corresponding manner ( see fig4 and 6 ). this causes the rod 42 to slide u upward and the first bearing 26 is directly pushed away along the predetermined distance , i . e . the gap e . in said second stage , the first bearing 26 is pushed away u from the third bearing 29 and the second bearing 27 is pushed away from the fourth bearing 31 along a predetermined distance e . the stage consisting in pushing the first bearing 26 away from the third bearing 29 and the second bearing 27 away from the fourth bearing 31 is implemented with two positions , one position moved closer in which the two tools 16 and 17 cooperate for the converting function , and one position moved away in which the lateral position of the ring or rings 21 and 22 is modifiable . the displacement u of the first bearing 26 thus creates the gap e between the top tool 16 and the anvil 17 so as to allow the radial gap 20 to be adjusted by subsequent displacement of one ring or of the rings 21 and 22 . in a third stage , the operator modifies a lateral position of one ring or of the two rings 21 and 22 . the operator actuates the actuating knob 52 by turning it pd anticlockwise by half a turn ( see fig5 and 6 ), and the eccentric 48 turns td in a corresponding manner . this causes the rod 42 to slide d downward , and the first bearing 26 to move closer . in a fourth stage , the first bearing 26 is moved closer to the third bearing 29 and the second bearing 27 is moved closer the fourth bearing 31 . said displacement u of the first bearing 26 thus moves the top tool 16 closer to the anvil 17 , in order to allow the cutting function with the optimum radial gap 20 to be re - established . in a fifth and last stage , the operator re - establishes a prestress by retightening the tightening elements , i . e . the nuts 34 and 37 . the present invention is not limited to the embodiments described and illustrated . numerous modifications can be realized without in any way departing from the framework defined by the scope of the set of claims . | 1 |
in fig1 a plant for producing coverings such as , for example , rubber - based floorings , is generally indicated 1 . the term “ rubber ” as used in the present description and in the following claims , is intended in general to define any elastomer which can be vulcanized / cross - linked and which can be used for the manufacture of coverings such as floorings . a material of this type may adopt the appearance of fragments or particles ( for example , granules ) and can be termed “ cohesible ” in that it can be rendered cohesive so as to form , for example , a sheet or a layer . typical examples of this type are artificial or synthetic rubber ( for example , the synthetic rubbers known by the names sbr ( styrene - butadiene - rubber ), nrje ( nitrile - butadiene - rubber ), and epdm ( ethylene - propylene - diene - monomer )), natural rubber , and mixtures thereof . the invention can thus be applied to the processing of materials which can be vulcanized / cross - linked and hence , in general , which are “ curable ” and , most preferably but not exclusively , materials which are initially in the form of granules . the term “ fragmented material ” used in the claims , however , indicates , in general , any material in pieces and , as such , also includes particular morphologies such as pellets , flattened or rod - shaped granules , threads , strips , etc ., or shavings such as those produced by the scraping or shaving operation described in u . s . pat . no . 5 , 217 , 554 . with further reference to the diagram of fig1 an extruder , generally indicated 2 , has an inlet opening 3 to which the , basic material for producing the covering is supplied . the extruder 2 may be any commercially available extruder which can process materials such as those indicated - above . in the embodiment considered in detail below , which is described by way of example , it will be assumed that the material in question is constituted by synthetic rubber ( typically styrene - butadiene rubber which has not yet been vulcanized ) which is supplied to the opening 3 of the extruder 2 in the form of continuous and / or discontinuous strips , for example with a thickness of a few millimeters and a width of a few centimeters . in particular , when a covering with a non - uniform appearance is to be produced , the strips are taken from an assortment of strips having two or more different colors . however , the invention may also be used to produce coverings of substantially uniform surface appearance . the material supplied to the opening 3 is passed through the barrel of the extruder 2 until it reaches a die 4 having one or more extrusion openings , each of which can produce a thread , for example , of variegated color if the input strips are of different colors . the thread in question may have diametral dimensions of a few millimeters ( for example 4 - 6 mm ). in the region of the die 4 , on the path along which the material is output from the extruder 2 , there is a granulating head 5 ( for example , in the form of a rotary blade ) which divides the material in thread form emerging from the die 4 into individual granules substantially comparable to disk - shaped pellets having , for example , a diameter of 4 - 6 mm and a thickness of the order of 0 . 5 - 1 mm . the granulated material m thus produced , which is usually collected in a container 6 , is supplied , possibly after storage indicated schematically by a block s shown in broken outline in fig1 to the input of a compacting unit 7 . it is pointed out once more that the particular form of fragmentation may vary widely within the scope of the invention . in particular , the scraping / shaving technique described in u . s . pat . no . 5 , 217 , 554 may advantageously be used to produce the fragmented material . the unit 7 is intended basically to compact the material m so as to give rise , precisely owing to the properties of cohesiveness of the fragments thereof , to a substantially continuous laminar layer or sheet l . this avoids giving rise to the stretching phenomena intrinsically connected with a calendering operation . in the embodiment shown , the unit 7 is configured substantially as a so - called continuous or isostatic press . presses of this type are known in the art , for example , from the production of isopress presses by the company hymmen gmbh ( germany ). basically , the unit 7 is composed of two endless , motor - driven belts 8 , 9 of which mutually facing passes 8 a , 9 a define a compacting chamber 10 in which controlled pressure and temperature conditions can be maintained ( in accordance with known criteria ). the fragmented material m is deposited at the input of the unit 7 by means of a metering device 11 ( for example of the hopper type ) so as to define a substantially continuous bed or mat having , for example a thickness of from about 2 to about 10 mm , with currently - preferred values of about 4 - 6 mm . it will be appreciated , in this connection , that the aforementioned deposition may take place either directly onto the lower belt 9 of the press or onto an interposed laminar substrate . this substrate may be constituted by a substrate from which the fragmented material has been produced in accordance with the solution described in u . s . pat . no . 5 , 217 , 554 . limited temperatures , typically of from about 60 ° c . to about 100 ° c . with preferred values of approximately 80 ° c . are maintained in the unit 7 . the pressure values may be between about 2 and about 5 mpa . as it advances through the unit 7 , the bed of fragmented material m is compressed between the two belts 8 and 9 ( possibly with the interposition of the deposition substrate , if one is present ), and is compacted to form a sheet l which is rendered mechanically coherent by the cohesion of the granules of the material m . this sheet , which is compacted but not yet vulcanized , and is hence constituted by “ raw ”, cohesive material may be removed from the unit 7 to go on to other processes , possibly after storage / transportation . the sheet l therefore clearly constitutes , according to the invention , an intermediate product with an independent character . the precision and / or intensity of the compacting are increased by the capability for precise control of the compacting pressure offered by isostatic presses . without wishing in any way to be restricted to any specific theory in this connection , the applicant has reason to believe that the way in which the above - described compacting of the material m is performed avoids the typical longitudinal stretching effect of calendering processes precisely because of the substantially isostatic distribution of the stresses induced locally in the material m . this effect can be attributed , in the embodiment described , to the presence of the belts 8 , 9 , and hence to the fact that the compression effect is distributed over an extensive surface area with a direction of action perpendicular to the surface . this contrasts with what occurs in normal calenders , in which the compression of the calendered material is concentrated in the narrow regions in which the rollers cooperate and , in any case , has components directed along the plane of the calendering product . moreover , it should not be forgotten that , in most calenders , an at least marginal differentiation of the peripheral velocities of the rollers is deliberately aimed for ; clearly , this factor induces significant stretching in the material subjected to calendering . similarly , it will be understood that the desired effect , compacting by compression with a substantial absence of stretching stresses along the sheet l , can be achieved in various ways with the same final result ; a linear press which compresses portions of the bed or mat successively supplied to the press may be mentioned by way of practical example . the sheet or layer of material l may then be supplied to apparatus 12 in which the material l is subjected to a cross - linking treatment by the application of pressure and / or heat . for example , this may be the treatment currently defined by the trade name “ rotocure ”. typical parameters for performing a treatment of this type ( with reference to a starting material constituted by synthetic rubber ) are represented by temperatures of between 150 ° c . and 190 ° c . and pressures of between 0 . 5 and 2 mpa . in accordance with wholly conventional techniques , the rotocure treatment may be implemented in a manner such that the appearance of the opposite flat surfaces of the resulting product f is completely smooth or , particularly in the case of the outer or upper surface of the covering , slightly marbled or rough , for example , with an anti - slip function , when the final product f is intended for use as flooring , in substantially the same manner as is normal for coverings intended for this use . finally , the product emerging from the unit 12 may be subjected to various finishing or grinding operations , to the application of protective layers , to cutting into strips or tiles , etc . these operations , which are performed in accordance with known criteria , are collectively indicate 13 . the final product f may typically have the appearance of a flooring tile p , as shown schematically in fig2 . the most distinctive aspect both of the final product f and of the intermediate product l of the covering produced in accordance with the invention is the intrinsically , non - directional ( isotropic ) nature of its characteristics . this relates both to its physical and mechanical characteristics and to its aesthetic characteristics , at least with regard to the appearance of the outer or upper layer . in particular , the applicant has performed various tests on samples of floorings produced according to the invention from sbr rubber . the flooring in question had a thickness of about 2 mm . samples s 1 , s 2 , s 3 ( see fig2 ) in the form of 27 cm × 7 cm rectangles were cut from the flooring in a longitudinal direction ( s 1 ), in a transverse direction ( s 2 ), and in a diagonal direction at 45 ° to the longitudinal direction ( arrow of fig2 ) ( s 3 ), respectively , from the strip f produced by the continuous process shown in fig1 . visual inspection of the upper face ( the walking surface ), even at short distance , consistently showed that the samples of the three types s 1 , s 2 and s 3 did not differ from one another . this characteristic is important , particularly when the flooring is being laid , since it enables joints which are not perceptible from a normal observation height to be formed between sheets and / or tiles , regardless of the orientation of the sheets and of the tiles . flexibility tests ( en 435 — method a ) and dimensional stability tests ( en 434 ) within the scope of the standard en 1817 ( march 1998 version ) were carried out on longitudinal strips s 1 and transverse strips s 2 of the dimensions given above , produced from a covering according to the invention , with homogeneous structure throughout its thickness . breaking load / extension tests ( din 53504 ) and tear - resistance tests ( din 53515 ) were also carried out . naturally , the principle of the invention remaining the same , the details of construction and forms of embodiment may be varied widely with respect to those described and illustrated , without thereby departing from the scope of the present invention . | 4 |
referring now in detail to the drawings , more specifically fig1 the reference numeral 20 denotes generally a vehicular automatic occupant sensing anti - carjacking system constructed in accordance and embodying theinvention . the automatic occupant sensing anti - carjacking system 20 contains an electronic command control unit 7 , mounted in a hidden location within a motor vehicle 64 , in fig5 . the command control unit 7 is configured for communication with an array of sensors 21 . as will be observed from fig1 the command control unit 7 is operatively connected to a combination keypad - monitor 6 for user programming includingbypass and override functions . such programming may include a selection of available options such as , sensor selections , audible warning devices , timers , light flashers etc . an array of sensors 21 are operatively connected to a command control unit 7 . the sensors may include pressure sensors , infra red sensors , motion detectors , ignition sensors , shift lever position sensor , rpm sensors etc . these are all conventional sensorswhich are used in conjunction with other existing vehicular protection systems and are well known in the market . selected system carjacking responses are actuated by signal from the command control unit 7 to an array of interfaced relays 22 . the relays 22 are strategically positioned at various locations throughout the vehicle 64 and with each adapted to serve a dedicated function . among the relays 22 are an ignition disable relay 10 , starter disable relay 11 , fuel disable relay 12 , audible device relay 14 , lighting relay 13 . internal and external audible devices 19 are operatively connected to the audible device relay 14 within the vehicle 64 for the purposes of providing internal audible functions to drive the carjacker out of the vehicle 64 , as well as , external audible functions to provide an audible alert to draw attention to the vehicle 64 and the carjacker . the combination keypad - monitor 6 may be employed to program the command control unit 7 to recognize only certain of the sensors 21 and which of the relays 22 will be actuated under specific circumstances and in which sequence the relays 22 will be activated . for example , the authorized occupant can program the operator &# 39 ; s seat pressure sensor 61 , referring to fig5 this sensor 61 employs a low cost versatile pressure transducer 43which will allow the authorized occupant to program a specific voltage signal to the command control unit 7 . any of the pressure actuated sensors1 may be variable , sensor 61 was chosen for simplicity . the voltage signal will be relative to the amount of pressure that the authorized occupant exerts on the sensor 61 while sitting in the authorized occupant &# 39 ; s seat 56 . this will allow an authorized operator to program a specific voltage signal from sensor 61 in the memory of the command control unit 7 allowingonly an authorized occupant to operate the vehicle 64 within the parametersstored in the memory of the command control unit 7 . the keypad - monitor 6 may also provide on screen verification of all programming activities through its liquid crystal diode monitor and keypad . additionally , the keypad - monitor 6 may be employed to program the command control unit 7 to appropriately adjust sensitivity of sensors 21 , as well as , appropriately actuating the relays 22 . the automatic occupant sensing anti - carjacking system 20 includes an ignition sensor 2 which determines when ignition is on as an additional input to command control unit 7 . ignition sensor 2 is preferably a wire connected to the vehicle 64 &# 39 ; s ignition circuit ( not shown ) for producing avoltage signal when the ignition is on and no voltage signal when the ignition is off . the automatic occupant sensing anti - carjacking system 20 also includes an engine rpm or revolutions per minute sensor 3 which determines when the engine is running as an additional input to the command control unit 7 . rpm sensor 3 is preferably a wire connected to thevehicle 64 &# 39 ; s ignition circuit ( not shown ) for providing a voltage signal when the engine is running and for providing no voltage signal when the engine is not running . the automatic occupant sensing anti - carjacking system 20 also includes an shift lever position sensor 4 which determines what position the vehicle 64 &# 39 ; s shift lever ( not shown ) is in as an additional input to the command control unit 7 . shift lever position sensor 4 is preferably a wire connected to the vehicle 64 &# 39 ; s neutral safety switch ( not shown ) for providing a voltage signal when the shift lever ( not shown ) is in the reverse or any forward drive selection e . g . first , second , third and overdrive on equipped automatic transmissions and for providing no voltagewhen the shift lever is in the neutral or park position . in vehicle 64 &# 39 ; s with manual transmissions a clutch pedal sensor ( not shown ) is used to signal the command control unit 7 of vehicle 64 movement . however , other sensing devices for determining whether the vehicle 64 is in neutral , drive , or reverse or whether the vehicle 64 is moving or not moving would be realized by one having ordinary skill in the art as providing the same purpose . auxiliary sensors 5 such as , motion sensors , infra red sensors , and pressure sensors may also be used . the automatic occupant sensing anti - carjacking system also includes pressure sensors 1 used to determine if a seat or other monitored area inside vehicle 64 is occupied or unoccupied as an additional input to the command control unit 7 . thus this is what is referred to as the occupant sensing aspect of the present invention . these sensors 1 which are pressure sensitive and are strategically located in the interior seating and floor area of the vehicle 64 . referring to fig5 which is a top viewof a block diagram of vehicle 64 shows one of many possible , strategic installations of pressure sensors . the reference numerals 51 , 55 , 62 and 63 denote fixed signal pressure sensors which detect pressure on the floorarea of the vehicle 64 . sensor 51 is located in the floor of the rear cargoor trunk area . sensor 55 is located in the floor area of the rear seats . sensors 62 and 63 are located in the floor area of the front seats . the reference numeral 52 denotes the rear seat of vehicle 64 . the reference numeral 53 denotes a fixed signal pressure sensor located in the backrest cushion of the rear seat 52 of vehicle 64 . the reference numeral 54 denotes a fixed signal pressure sensor located in the seat cushion of the rear seat 52 of vehicle 64 . the reference numeral 56 denotes the front seat of vehicle 64 . the reference numerals 57 and 58 denote fixed signal pressure sensors located in the backrest cushion of the front seat 56 of vehicle 64 . the reference numerals 59 and 60 denote fixed signal pressure sensors located in the passenger side of the seat cushion of the front seat 56 of vehicle 64 . the reference numeral 61 denotes the authorized operator variable signal pressure sensor , referring to fig5 located in the seat cushion of the operator &# 39 ; s seat 56 of the vehicle 64 . this sensor 61 responds to the seat pressure that the operator exerts on the operator &# 39 ; s seat . the advantage here is that is unlikely that different operators will have the same voltage signal identification . this allows the command control 7 to identify the authorized occupant by monitoring the output signal 45 of the pressure sensor module 48 . the command controlunit 7 continuously monitors the vehicle 64 sensors 21 automatically . the pressure transducer 43 can be easily modified to fit almost any application including the present invention . referring to fig4 the pressure sensor 42 comprises a low cost capacitive type versatile pressuretransducer 43 which is an electrical pressure transducer which is operatively connected to a pressure sensing pad 44 or other sensing apparatus to transmit the pressure signal to the pressure transducer 43 via rubber or plastic tubing . the pressure transducer contains a sensor module 48 providing an output signal 45 indicative of fluid pressure effective thereon to the command control unit 7 which also sends an input signal 46 to the pressure sensor 42 pressure transducer 43 as well as a ground connection at 47 . the flexible plastic or rubber sensing pad 44 andplastic or rubber tubing are readily available on the market . a well known manufacturer and supplier of such products is b . f . goodrich of akron , ohio . although a specific manufacturer and materials for the flexible liquid filled sensing pad 44 have been disclosed there are other well known manufacturers and materials which may be used . a liquid filled pressure sensing pad 44 is operatively connected to a pressure transducer 43 . although fig4 shows the components separately the pressure transducer and pressure sensing pad may be an integral unit . the command control unit 7 is operatively connected to the pressure transducer 43 . thepressure sensing pad 44 contains a liquid that has the properties of any well known ethylene glycol based solution . one such solution is peak antifreeze and coolant manufactured by old world industries inc ., northbrook , ill . although a specific solution has been disclosed it is well understood that numerous other liquid solutions may be used as well . the pressure transducer 43 accordingly reacts quickly to changes in the amount of pressure applied to the pressure sensing pad 44 as the authorized operator or occupant occupies a pressure sensor 42 monitored seat in the vehicle 64 . when a seat is occupied the liquid pressure sensing pad 44 senses the pressure of the occupant as they occupy the seatsurface ( not shown ) this results in a change in pressure of the liquid inside the pressure sensing pad 44 . this change in pressure is received bythe pressure transducer 43 which transmits an output signal 45 of the sensor 42 which is monitored by the command control unit 7 . the output signal 45 is analyzed as a report of an occupied seat . the sensor 42 monitors the input pressure signal 49 while the seat is occupied . these input pressure signals 49 are analyzed and compared with those stored in the memory of the command control unit 7 . the output signal 45 of the sensor 42 therefore will vary depending on the input pressure signal 49 which is relative to how much pressure is applied to the pressure sensing pad 44 . when the seat is vacated the pressure transducer furnishes a constant output signal 45 for example a 0 - value . this output signal 45 is recognized by the command control unit 7 as an unoccupied seat . intentional or unintentional movements of the seated occupant ( s ) on the pressure sensing pad 44 are recognized by the command control unit 7 and would not interfere with the normal system operation . a transducer performing this function is the model number p155 manufactured by kavlico corporation , moorpark , calif . although a specific pressure transducer has been disclosed , it is well understood that numerous other pressure transducers can be used to convert the input pressure signal 49 into an output electrical signal 45 to the command control unit 7 . a pressure switch ( not shown ) may be used to turn on the command control unit 7 when the ignition is not on . this prevents unecessary voltage drainon the system battery 8 and the vehicle battery 9 . thus , when the ignition is not on the pressure activated switch ( not shown ) will provide battery power to the command control unit 7 when any monitored seat in the vehicleis occupied . the pressure switch ( not shown ) may be seperate or incorporated into the pressure sensor 42 . the output signal 45 of the authorized occupant is stored in the memory of the command control unit 7 and is constantly compared with the output signal 45 of the pressure sensor 42 . any unprogrammed or unauthorized signals will activate the disablement sequence at 33 in fig3 . this sensor 42 allows an authorized occupant to easily operate the system 20 while making it virtually impossible for an unauthorized occupant to operate the vehicle 64 . the authorized occupant can , after programming thecommand control unit 7 operate the vehicle 64 without the need for transmitters , buttons or switches or other manual devices to operate its carjacking functions . the command control unit 7 receives inputs from ignition sensor 2 , pressuresensors 1 , shift lever position sensor 4 , engine rpm sensor 3 and auxiliarysensors 5 , as well as , a determination of a connection to vehicle 64 battery 9 and command control unit 7 battery 8 . the command control unit processes these inputs and if necessary , controls system 20 devices , 15 , 16 , 17 , 18 , 19 by controlling corresponding relays 10 , 11 12 , 13 and 14 located in strategic locations in vehicle 64 . command control unit 7 circuitry includes any suitable microprocessor , for example , an intel microcontroller chip such as , 8031 or 8096 , or a motorola microcontroller chip such as a 68332 together with appropriate memory and interfacing . relays 22 are normally open and their operation are described below in conjunction with the operational flow charts shown in fig2 and 3 . otherwell - known signal conditioning circuitry can be used between command control unit 7 and the system devices 23 , including but not limited to , power resistors , as well as appropriate isolation circuitry such as capacitive filters etc . command control unit 7 is designed to operate the automatic occupant sensing anti - carjacking system 20 as shown by the flow chart of fig2 to provide automatically operated anti - carjacking protection . to a vehicle 64operator desiring automatically operable anti - carjacking protection in any carjacking scenario . this system offers anti - carjacking protection regardless whether the authorized occupant is inside or outside of the vehicle 64 , regardless whether the ignition is on or off in vehicle 64 , regardless whether the engine is running or not running in the vehicle 64 , regardless whether the vehicle 64 is attended or unattended , regardless whether the carjacker attempts to take the authorized occupant hostage andforce the authorized occupant to drive the vehicle 64 , regardless whether the carjacker attempts to take the authorized occupant hostage by forcing the authorized occupant into the trunk of the vehicle 64 and other likely scenarios . other than the programming of the command control unit 7 there are no manually operated buttons or switches needed to activate carjacking protection functions . the authorized occupant need not be concerned with turning it on or off as it works automatically requiring no further authorized occupant activation . appropriate indicators such as a chirp speaker or led indicators may be used to indicate system 20 status to the authorized occupant . the command control unit 7 retrieves the stored input , at 25 in fig2 from the array of sensors 21 . the command control unit 7 then begins to compare all signal inputs , at 30 in fig2 with those stored in the memory of the command control unit 7 . if any signals are not within programmed parameters the command control unit 7 activates the anti - carjacking disabling sequence at 33 in fig3 automatically . during the disablement sequence the command control continues to check sensor inputs at 34 , the hazard lights 18 at fig1 flash continuously for a pre - determined amount of time at 35 in fig3 before engine disablement at 36 , 37 and 38 to allow the operator time to safely drive the car out of traffic prior to engine disablement , at 36 , 37 and 38 , by the command control unit 7 . at the expiration of this pre - determined time the hazard lights 18 will continue to flash and the audible devices 19 , infig1 will begin to sound at 39 after disablement at 36 , 37 and 38 . audible devices included for use in the anti - carjacking disablement sequence are interior and exterior audible devices 19 . there are numerous types of well known sirens , speakers , and horns which may be used for thispurpose . the command control unit 7 includes a timing device for controlling both audible devices 19 and hazard flashers 18 so that they operate for a maximum time period and then automatically shut off . unless enabled by an authorized operator the engine will remain disabled at 36 , 37 and 38 and the hazard flasher 18 and audible devices 19 , referring to fig1 will stop after 15 minutes or other pre - determined amount of time . the system 20 will continue to monitor sensors 21 at 40 and continue disabling at 41 until the appropriate input parameters are received by thecommand control unit 7 . if there are no input signals the command control unit 7 will automatically disable vehicle 64 at 27 in fig2 . for increased anti - carjacking protections the command control unit 7 checksfor disablement status at 29 , in fig2 the engine can only be enabled , at28 , once disabled , at 36 , 37 and 38 in fig3 by an authorized occupant sitting and occupying the operator &# 39 ; s seat 56 , in fig5 of the vehicle 64where pressure sensor 61 will send a signal to the command control unit 7 that there is an authorized occupant in the vehicle 64 . the command control unit 7 will then enable the vehicle &# 39 ; s 64 engines at 29 in fig2 and deactivate hazard lights 18 and deactivate audible devices at 19 and return the system 20 to monitor mode at 24 . the vehicle 64 can also be enabled by an authorized operator using the reset and override functions of the monitor - keypad 6 . a carjacker would not be able to prevent disablement at 36 , 37 and 38 as the array of sensors 21 would signal the command control unit 7 of an unauthorized occupancy . the command control unit 7 monitors the system 20 at 24 , it then retrieves the signal at 25 , identifies the signal at 26 , checks the parameters of the signals at 30 and since the carjackers signal would be identified as unauthorized at 31 the command control unit 7 would activate the disabling sequence at 32 . another method the thief may attempt is to disconnect the vehicle 64 battery 9 and the system 20 battery 8 in an attempt to enable the system 20 . since all relays 22 in the system 20 are normally open and must be energized by the command control unit 7 disconnection of the batteries at 8 and 9 will only serve to put the system 20 in the disablement mode at 27in fig2 . it is important that the anti - carjacking prevention features be automatically initiated , prior art devices which utilize remote transmitters and hidden switches are not reliable as the carjacker may force coerce the operator to give up the transmitter , the operator may forget to carry the transmitter , the operator may be coerced prior to entering or shortly after exiting their vehicles the operator may be injured by the carjacker and be unable to use the transmitter or activate any hidden switches . also prior art devices using remote transmitters onlyprotect the vehicle from carjacking while the engine is running and the operator is in the vehicle . they offer no protection if the operator failsto activate the transmitter , forgets the transmitter , the vehicle exceeds transmitter signal range prior to the operation of the transmitter signal or the carjacker obtains the transmitter . the present invention as herein described makes it virtually impossible foran carjacker to obtain the vehicle 64 during an attempted carjacking in anyscenario . to illustrate the capabilities of the present invention , several scenarios are described below which demonstrates the unequalled protection afforded by the automatic occupant sensing anti - carjacking system 20 of the presentinvention : assume the operator drives vehicle 64 to the grocery market and turns the engine off and leaves the vehicle unoccupied . the array of sensors 21 willsend signals to the command control unit 7 that the vehicle 64 is unoccupied . the command control unit will then automatically initiate ignition , fuel and starter disablement at 27 in fig2 until enabled by an authorized occupant . the authorized operator returns to vehicle 64 and occupies the operator &# 39 ; s seat 56 the array of sensors 21 will send a signalto the command control unit 7 that an authorized occupant is in the vehicle64 and the command control unit 7 will automatically enable at 28 the vehicle 64 systems 23 . additionally , if an unauthorized operator enters the unoccupied vehicle 64 the array of sensors 21 will send signals to thecommand control unit 7 that an unauthorized occupant is in the vehicle 64 . the command control unit 7 will then automatically initiate the anti - carjacking disablement sequence at 33 in fig3 . in another scenario , the authorized operator is stopped waiting for a traffic light to change when a carjacker appearing at the window points a gun at the authorized operator and demanding the vehicle 64 . to end this scenario and the possibility of injury , the authorized operator merely complies with the carjacker &# 39 ; s demands knowing that the vehicle 64 will not get more than a pre - determined amount of time away , for example 60 seconds . the pressure sensor 61 , in fig5 sends a signal to the command control unit 7 that an unauthorized operator has entered vehicle 64 . the command control unit 7 will than automatically initiate the anti - carjacking disablement sequence at 33 in fig3 . additionally , the vehicle 64 hazard lights 18 will flash continuously , at 35 notifying the authorized operator that the anti - carjacking disablement sequence has begun and the carjacking attempt will be foiled . at a pre - determined time after the hazard lights 18 began flashing , at 35 , for example , 60 seconds later the carjacker will then decide to abandon the carjacking , compelled by the painful sound of the interior audible device at 39 in fig3 . it is likely that the carjacker will be observed as vehicle 64 is abandoned because the sound of exterior audible device at 39 , in fig3 draws the attention of onlookers or passerbys or others at the scene . in yet another scenario , an operator is approaching their car in a parking lot or pumping gas at a gas station , when a carjacker demands the car threatening the operator with a gun . the operator wisely turns over the keys and lets the carjacker occupy the operator &# 39 ; s seat at 56 in the vehicle 64 . at this times the occupancy sensor at 61 , in fig5 will senda signal to the command control unit 7 that an unauthorized occupant is in the vehicle 64 . the command control unit 7 will then automatically initiate the anti - carjacking sequence at 32 in fig2 and the hazard lights at 18 will began to flash continuously at 35 notifying the operatorthe carjacking attempt will be foiled in the same manner as described above . in a different scenario , the operator is stopped waiting for a traffic light to change when a carjacker forces his way by gunpoint into the passenger seat of the vehicle 64 and demands that the operator drive the vehicle or forces the operator into the trunk of the vehicle 64 the operator merely complies with the carjackers demand knowing that the vehicle 64 will be disabled at 32 , in fig2 as the pressure sensors at 57 , 61 , and 63 in fig5 send a signal to the command control unit 7 that an unauthorized occupant has entered the vehicle 64 . the command control unit 7 will then automatically initiate the anti - carjacking disabling sequence at 33 in fig3 . at this time the hazard lights 18 will begin to flash at 35 , in fig3 and after a pre - determined amount of time , for example , 60 seconds the vehicle 64 will be disabled at 36 , 37 and 38 and audible devices 19 will sound at 39 compelling the carjacker from the vehicle 64 . still another scenario is where the vehicle 64 is occupied by two authorized occupants . one at sensor 59 and one at sensor 61 . both sensors 59 and 61 , in fig5 are of the pressure sensor type illustrated in fig4 . both sensors 59 and 61 are programmed into the memory of the command control unit 7 . the authorized occupants stop at a late night party store at 1 : 30 a . m . the occupant at 59 exits the vehicle 64 to go into the party store . leaving the occupant at 61 in the vehicle . pressure sensor 60 is set to sense an unauthorized occupancy . while the authorized occupant at pressure sensor 59 is in the party store an unauthorized occupant enters the vehicle 64 at sensors 59 and 60 and attempts to make the occupant at sensor 61 drive the vehicle at gunpoint . within seconds after the unauthorized occupant enter the vehicle 64 the pressure sensors at 59 and 60 send signals to the command control unit 7 that an unauthorized occupant is in the vehicle 64 . the command control unit 7 automatically initiates the disabling sequence , at 33 in fig3 which prevents the vehicle 64 from leaving the scene and prevents a possible hostage scenariowhere the authorized occupant may have been forced to drive their own vehicle to some isolated location where the carjacker may do harm to an authorized occupant and go unnoticed . in yet another scenario , a carjacker watches and stalks a potential victim leave their vehicle 64 and go into the supermarket to shop . as the potential victim returns to and is sitting in their vehicle . the carjackerapproaches the vehicle preparing to attempt the carjacking . as the carjacker approaches the vehicle he notices an emblem obviously displayingthe fact the vehicle 64 is equipped with the present invention . the carjacker realizing that he will not be able to drive away with vehicle 64aborts his attempt and seeks another vehicle not so equipped . finally , referring to fig1 the command control unit 7 responds to sensorinputs by controlling actuators or relays 22 according to programmed instructions . the sensors 21 provide input to the command control unit 7 about vehicle occupancy , engine and vehicle conditions and the command control unit 7 initiates the appropriate response . by way of example , if the ignition sensor 2 indicates that the ignition is on and the shift lever position sensor 4 indicates a parked condition , the pressure sensors1 indicate a no occupancy condition and the rpm sensor 3 indicates the engine is running the command control unit 7 will allow an authorized operator to idle the engine for purposes of warming the engine in necessary weather conditions . the authorized operator need not be in the vehicle 64 for the engine to idle . upon initial startup the pressure sensor 61 , in fig5 sends a signal to the command control unit 7 that anauthorized occupant is in the vehicle . thus , after startup the authorized occupant may exit the vehicle 64 and the vehicle 64 will continue to idle . however , if the carjacker attempts to enter the vehicle while it is idling and the authorized occupant is not in the vehicle the pressure sensor 61 will send a signal to the command control unit 7 that an unauthorized occupant is in the vehicle 64 and will automatically initiate the disablement sequence at 33 in fig3 . thus it will be demonstrated that there is a vehicular automatic occupant sensing anti - carjacking system which achieves the various objectives , features and considerations of the present invention and which is well adapted to meet the conditions of mass production and practical usage . as various changes might be made in the exemplary embodiments above described and shown without departing from the spirit of the invention andas various changes might be made in the embodiment set forth , it is to be understood that all matter herein described or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense . the spirit and scope of the present invention are to be limited only by theterms of the appended claims . | 1 |
referring first to fig1 it can be seen that an analog input signal 10 is to be converted into a digital signal in parallel form . to that end , a comparator 12 is provided , with the analog signal 10 being introduced to one input of the comparator 12 . the output of the comparator 12 is connected to the data input of a successive approximation register 14 which is clocked by a clock 16 . the successive approximation register 14 has a plurality of output terminals 16 , of which the output 18 represents the most significant bit ( msb ) and of which output 20 represents the least significant bit ( lsb ). all these output terminals are connected to a digital - to - analog converter 22 , which produces a reference signal 24 that is routed to another input of the comparator 12 . in use , the analog input signal 10 is compared with the then - current reference signal 24 in the comparator 12 . each such comparison takes place every time that the clock 16 produces a clock pulse . initially , the reference signal 24 is set to equal a value equal to one - half the maximum value which can be assumed by the analog input signal 10 . in the event that the analog input signal 10 is equal to or greater than the initial value of the reference signal 24 , output terminal 18 is made logically high , and in the event that the analog input signal 10 is lesser than the value of the reference signal 24 , output terminal 18 is logically low . upon the receipt by the successive approximation register 14 of the next clock pulse generated by clock 16 , the analog input signal 10 is compared to a reference signal 24 which is either three - fourths or one - fourth the above - mentioned maximum value , depending upon the results of the first comparison described above . if , for example , the analog input signal 10 is greater than one - half of this maximum value , it will be next compared with a reference signal 24 which is scaled by the digital - to - analog converter 22 so as to next be compared with a reference signal 24 that is equal to three - fourths the above - mentioned maximum value . in the event that the analog input signal 10 is still greater than this increased reference signal 24 , then the adjacent output terminal 16 will be brought logically high , and will be logically low otherwise . on the other hand , in the event that the analog input signal 10 was originally less than the initial reference signal 24 , it will next be compared with a reference signal 24 which is adjusted to have a value equalling one - fourth of the above - mentioned maximum value , to produce a 37 1 &# 34 ; or a 37 0 &# 34 ; at the immediately adjacent output terminal 16 , depending upon the results of this next comparison . this process is then repeated as many times as there are outputs 16 of the successive approximation register 14 , until output terminal 20 is either brought logically low or logically high depending upon the results of the comparison to which it corresponds . at this point , the logical statuses of all the outputs 16 ( including of course outputs 18 and 20 ) can be described by a binary number in which a &# 34 ; 1 &# 34 ; represents a logically high state and in which a &# 34 ; 0 &# 34 ; represents a logically low state . for example , if all the outputs of the successive approximation register 14 have the logical values shown below , they will correspond to analog input signals 10 having that fraction of the maximum expected value of the analog input signal 10 : ______________________________________digital data word fraction of full scale______________________________________00000000 000000001 1 / 25600000010 1 / 12800000011 1 / 128 + 1 / 256 = 3 / 25600000100 1 / 64 ...... 01000000 1 / 4 ... 01100000 1 / 4 + 1 / 8 = 3 / 8 .... 10000000 1 / 2 ... 11000000 1 / 2 + 1 / 4 = 3 / 4 ... 11111111 255 / 256______________________________________ it may thus be seen that using an analog - to - digital conversion system of this sort , a data output in parallel form can generate a digital data word with as many places as there are output terminals of the successive approximation register 14 . systems of this sort are already known , and therefore this system will not be further described . in fig2 a photocell 26 or other suitable light - responsive semiconductor device ( such as a phototransistor , photodiode and the like ) is located inside a modern photographic camera ( not shown ) so as to measure the intensity of the ambient light in which the camera is being utilized . for the purposes of this discussion , the photocell 26 may view the scene to be photographed either through the lens ( not shown ) of the camera or not . it is only important for the purposes of this discussion to know that the output of photocell 26 will have some correspondence to the intensity of the ambient light in which the camera is to be used . photocell 26 is a photocell or other suitable semiconductor device ( such as a phototransistor , photodiode or other suitable semiconductor element ) which delivers an analog input signal 28 into an analog - to - digital converter 30 such as is disclosed herein . this converter 30 converts the analog input signal 28 to a digital output signal 32 , which is routed to an integrator 34 which operates to provide a time - integral of the intensity of the analog input signal 28 by means of repeated additions . these repeated additions take place as the progressively increasing sum is clocked into and out of clocked memory 36 by a clock 38 . once an accurate time - integral has been produced by this series of repeated additions , the information is routed to an exposure calculated 40 into which information such as film speed can be introduced in order to allow parameters such as lens setting and shutter speed to be adjusted . exposure calculator 40 produces a control signal 42 which , after amplification in amplifier 44 , can be used to drive suitable exposure servos 46 such as the shutter and the elements which control the opening of the lens utilized on the camera . methods which produce time - integrals of signals such as analog input signal 28 are already known . it will be understood by one skilled in the art that the heart of such a system that has just been disclosed resides in the analog - to - digital converter 30 . in order to understand how this invention operates , it is helpful to visualize an eighteen place binary number which can represent the entire dynamic range in which incident light as received by the photocell 26 is represented . such a number takes the form of : in which the x to the far left represents one - half the full - scale light intensity to be expected , the next x to the right represents one - fourth of this full scale number , and the remaining places represent smaller and smaller fractions of this full - scale value in which the denominators increase as successive powers of 2 . modern cameras can operate over such a dynamic range , but differences in light intensity of less than 7 % cannot be detected by such a camera , since such differences correspond to less than 1 / 10 of a photographic stop . a four place binary number is accurate to 1 / 16 , or slightly more than 6 %, which is below this 7 % figure . thus , in the even that 9 four bit group containing 1 &# 39 ; s is detected in such an eighteen place binary number , the number represented by these four bits will be sufficiently accurate in order to allow the exposure of such a camera to be accurately set . as an example , if the number representing the ambient light intensity in which the camera is utilized is it is unnecessary to consider anything after the four 1 &# 39 ; s since the rest of the components of this eighteen place binary number will not amount to a difference of more than 7 %. thus , once such a digital data word is detected , only the first four figures are significant , and the rest can safely be ignored since the other digits will not result in increased exposure accuracy . those skilled in the art will readily understand that the 0 &# 39 ; s to the left of the 1 &# 39 ; s must be considered while the remaining digits are , as before , irrelevant . without considering the left - hand string of 0 &# 39 ; s in this latter number , the significance of the number thus represented cannot be ascertained . hence , it is possible to divide such a number into groups , and to look at the groups thus formed to see if they contain any 1 &# 39 ; s . supposing , for example , that this latter number were divided into groups of five , and each group scanned for the existence of a 1 , a scanner of this latter number would first see a group which was composed of all 0 &# 39 ; s . thus , this would mean that whatever digits were to the right of the first group scanned , the number represented could not exceed 1 / 32 of the full - scale value of the maximum expected light intensity . in the event that the next five digits were all 0 , it would follow that , regardless of the number of digits after the tenth digit in the series , the entire number would have to be less than 1 / 1024 of full scale . hence , by dividing this eighteen digit data word into groups and looking for the first one in any group , it would be possible to assign a weight to the first &# 34 ; 1 &# 34 ; found by keeping track of the groups that had been examined . in this second example given , a &# 34 ; 1 &# 34 ; would be detected within the second group of five digits , or bits , which was scanned . however , it will be immediately apparent to one skilled in the art that in order to achieve the desired level of accuracy , the mere detection of this first &# 34 ; 1 &# 34 ; in the tenth place will not suffice . a productive way in which a string of bits such as the ones illustrated above can be examined to achieve the necessary accuracy is to divide the string of bits into groups of five , to check for the existence of at least one &# 34 ; 1 &# 34 ;. in the event that within any group of five bits , there is at least one &# 34 ; 1 &# 34 ;, only this group of five bits and the following ( three ) bits of the register will be considered or read . the register runs to its last bit . the a / d conversion is then stopped . however , in the event that there is at least one &# 34 ; 1 &# 34 ; in this group of five bits , the possibility exists that the only such &# 34 ; 1 &# 34 ; in existence is the &# 34 ; 1 &# 34 ; in the fifth bit in the group . in this case , more information is necessary since , as in the case listed above , the first four bits in any five bit group must be known and thus the ninth and tenth bit in the second data word shown above does not provide sufficient information . hence , when the third , fourth or fifth bit in any five bit group is a &# 34 ; 1 &# 34 ;, more information is needed . fig3 is a flow chart showing a method that can be used in order to examine data words and to stop such examination when an accuracy of better than 7 % has been achieved . first , a group of five bits is examined . the group is then examined as a whole , to see if any of the bits in the group are 1 &# 39 ; s so as to determine whether or not the analog signal under examination falls within 1 / 16 of full scale . in the event that no such &# 34 ; 1 &# 34 ; is detected , it is known that not only is there a sufficiently small analog quantity so that the analog signal is below 1 / 16 of full scale , but is also less than 1 / 32 of full scale . in the event that no such 1 &# 39 ; s are detected , then it is known that the analog signal corresponds to a portion of the dynamic range which is less intense that the portion under examination . in this case , the previous examination of five bits is noted and a subsequent group of five bits then examined . this process of examination can occur until such time as at least one &# 34 ; 1 &# 34 ; is detected . assuming that a &# 34 ; 1 &# 34 ; is so detected in any five - bit - group , i . e . the third or fourth bit of this group , the register does not stop at the fifth bit . it runs to the last of the following bits of the register , which register then will be stopped . in the event that the third bit is &# 34 ; 1 &# 34 ; the digital word consists of the third bit up to the eighth bit of the register . that means the accuracy of the digital word is six bits . in case that the fifth bit is &# 34 ; 1 &# 34 ; the digital word consists of the fifth up to the eighth bit of the register . that means the accuracy equals four bits which is the lowest possible accuracy for a data word . these digital words form a data word in parallel form , which can be used for subsequent computational purposes . finally , the possibility exists that the analog - to - digital conversion to be performed is taking place at the lowest end of the dynamic range with no illumination at all . in this case , which corresponds to the fourth group of five bits ( because , of course , there are only eighteen bits required in order to express the entire usable dynamic range ), the absence of 1 &# 39 ; s is noted and the next digital data word can be read . the flow chart shown in fig3 has been discussed as if the eighteen bit digital data word already existed in toto prior to this reading process . in fact , this eighteen bit digital data word is actually constructed in a sequential fashion , depending upon the results of comparisons formed by a comparator such as is always used in an analog - to - digital conversion system which uses a successive approximation register . in fact , as can be seen from the schematic diagram shown in fig4 to which reference may now be had , the data word constructed in the analog - to - digital conversion may have as few a eight bits or may have as many as twenty - three bits , depending upon the magnitude of the analog signal to be converted . in fig4 a photocell 48 ( or other suitable semiconductor device such as a phototransistor , a photodiode , or other suitable element ) is connected across the input terminal of comparator 50 . the output of comparator 50 is routed to the digital input of a successive approximation register 52 . a suitable successive approximation register for this application is manufactured by motorola semiconductor products , inc ., under number mc14559 . the successive approximation register 52 has eight parallel data outputs 54 , 56 , 58 , 60 , 62 , 64 , 66 and 68 . parallel data output 54 is that output which corresponds to the most significant bit ( msb ), while parallel data output 68 corresponds to the least significant bit ( lsb ). every time that a clock pulse generated by clock 70 is received at the clock terminal c of the successive approximation register 52 , the analog signal 72 which passes through the photocell 48 is compared with a reference signal 74 . in the event that analog signal 72 is equal to or greater than reference signal 74 , comparator 50 produces a logically high output which is reflected at data input d of the successive approximation register 52 . this comparison can occur because digital - to - analog converter 76 is connected to all of the parallel data outputs 54 - 68 , and generates an appropriate electrical current which , after scaling in scaling network 78 , can be converted into an appropriate reference signal 74 . it will be noted that , except for the scaling network 78 just described , the other elements are connected together in an entirely conventional fashion . the successive approximation register 52 is of a type which can be so connected that unwanted and unnecessary parallel data outputs may remain unused . for this purpose , feed forward terminal ff is provided on the successive approximation register 52 . in the event that it is desired to read only the first five parallel data outputs 54 - 62 , the feed forward terminal ff can be connected directly to parallel data output 64 . in other words , when the successive approximation register 52 is to be used to produce an output of n bits , where n is less than eight , the ( n + 1 ) th parallel data output will be connected to feed forward terminal ff . however , in the event that all eight parallel data outputs 54 - 68 are to be utilized , feed forward terminal ff is simply brought logically low . successive approximation register 52 also has a serial output terminal s out . whenever any of the parallel data outputs 54 - 68 is brought logically high during the operation of the successive approximation register 52 , s out will also be brought momentarily high , with the next clock pulse , so that the data emerging from the successive approximation register 52 in parallel form on parallel data outputs 54 - 68 will also be reflected at terminal s out in serial form . start convert terminal sc of the successive approximation register 52 is pulsed when it is desired to cause the successive approximation register 52 to begin to execute a conversion sequence . finally , the end of convert terminal eoc of successive approximation register 52 will go logically high upon the registration of a logically low or logically high state at the parallel data output to which feed forward terminal ff is connected . when a conversion sequence is to be performed , flip - flop 78 &# 39 ; and counter 80 are initially reset so that flip - flop 78 &# 39 ; has a logically low output and counter 80 begins to count at &# 34 ; 0 &# 34 ;. output 4 of counter 80 is logically low . all parallel data outputs 54 to 68 will be logically low . the nor - gate 88 subsequently brings the input sc of successive approximation register 52 on logically high . when a clock pulse generated by the clock 70 is received at clock terminal c of the successive approximation register 52 its output 54 becomes logically high and the analog signal 72 is compared with a reference signal 74 which at that moment corresponds to one - half of full scale . in the event that the analog signal 72 is less than the reference signal 74 , the comparator 50 will produce a logically low output at data input terminal d of the successive approximation register 52 and parallel data output 54 will be reset to logically low with the following clock pulse . simultaneously the output 56 of the register 52 will be brought logically high so as to produce a reference signal 74 which corresponds to one - fourth of full scale . the reference signal 74 is once again compared with the analog signal 72 . in the event that the analog signal 72 is still less than the reference signal 74 , the comparator 50 once again produces a logically low output and parallel data output 56 is reset to logically low . assuming for the moment that the analog signal 72 is sufficiently low so that the first four comparisons ( which are performed in an entirely conventional manner ) result in the generation of four successive 0 &# 39 ; s , the first four parallel data outputs 54 - 60 will be brought logically low . upon the performance of a fifth comparison by comparator 50 , parallel data output 62 will be brought logically low . parallel data output 64 is connected to one of the inputs of and - gate 82 . the output of and - gate 82 is connected to the feed forward terminal ff of the successive approximation register 52 . as was mentioned above , this connection causes the successive approximation register 52 to recycle back to parallel data output 54 upon the next conversion performed , regardless of the logical status of parallel data output 64 . the reason for such recycling is , of course , that feed forward terminal ff is connected to parallel data output 64 through and - gate 82 and that the second ( inverted ) input of the and - gate 82 is on logically low . when the parallel data output 64 is brought logically low or logically high , end of convert terminal eoc is momentarily brought logically high . this causes counter 80 to count up to 1 . since the contents of counter 80 are transmitted to scaling network 78 via lines 84 , the scaling network 78 can cause an appropriate reference signal 74 to be scaled so that it has the same value it would have had in a normal analog - to - digital conversion process wherein the successive approximation register 52 would bring parallel data output 64 logically low or logically high in conventional fashion . thus , five comparisons have been performed by comparator 50 , and since the results of each such comparison resulted in the generation of a &# 34 ; 0 &# 34 ;, the 0 &# 39 ; s appear on parallel data outputs 54 - 62 and the output of counter 80 registered on line 84 can be used to assign a weight to these 0 &# 39 ; s , so that subsequent apparatus can utilize the data appearing at the parallel data outputs 54 - 62 in connection with an appropriate weighting factor . assuming that the next five comparisons performed by the comparator 50 results in the generation of five 0 &# 39 ; s , these 0 &# 39 ; s will be reflected , as before , on parallel data outputs 54 - 62 , a momentary pulse will appear at end of convert terminal eoc , and the counter 80 will count to 2 . an appropriate weighting factor thus appears on lines 84 , the scaling network 78 is scaled , an appropriate reference signal 74 is generated , and five subsequent comparisons are performed . after the twentieth comparison performed by comparator 50 , the end of convert terminal eoc will be momentarily pulsed once more , and the counter 80 will count to 3 . at this point , it is known that the entire dynamic range of analog signal 72 has been exhausted , and no further comparisons are necessary . in physical terms , this condition corresponds to a situation in which a modern motion picture camera is being utilized in insufficiently bright illumination . because counter 80 has counted to 3 , line 86 is brought logically high . line 86 is connected to one of the inputs of nor - gate 88 , and the output of nor - gate 88 is connected to start convert terminal sc . thus , start convert terminal sc at that time is brought logically low to cause the successive approximation register 52 to run to the last of the three bits of the register 52 . the a / d conversion is stopped until a further reset - pulse will start a new a - d conversion . this reset pulse will be produced by an appropriate reset circuit ( not shown ). however , assume that there is sufficient light available for the camera to be used . in this case , one of the comparisons performed by comparator 50 will produce a logically high output at the output of comparator 50 . this logically high output will be reflected at the data input terminal d of the successive approximation register 52 , and a logically high condition will be registered at one of the parallel data outputs 54 - 62 . at this point , a pulse appears at the serial output terminal s out and the output of flip - flop 78 will be brought logically high . because the output of flip - flop 78 is connected to the second ( inverse ) input of the and - gate 82 , the feed forward terminal ff will be brought logically low . in this situation , the connection between parallel data output 64 and the feed forward terminal ff is severed , so that the successive approximation register 52 can continue to register the results of the next comparison on parallel data output 66 . it will be noted that this will be the case regardless of which of the parallel data outputs 54 - 62 is brought logically high as a result of a logically high output of comparator 50 . for example , if the first comparison performed by comparator 50 results in a logically high state of parallel data output 54 , the flip - flop 78 will have a logically high output , feed forward terminal ff will be locked , and the comparison process will continue to the last ( eighth ) bit of the successive approximation register 52 . as the output of flip - flop 78 is connected with one of the inputs of nor - gate 88 the transition of the output of flip - flop 78 from logically low to logically high brings the input sc of the successive approximation register 52 logically low . as a result no further a / d conversion will start after the eighth bit of the a / d conversion just on run has been reached or read . the successive approximation register 52 remains stopped until a further reset pulse will come from the appropriate reset circuit ( not shown ). for example , if the first comparison performed by comparator 50 results in a logically high state of parallel data output 54 , the data word will appear with sufficient accuracy of eight bit on parallel data outputs . if the fifth comparison performed by comparator 50 results in a logically high state of parallel data output 62 , the data word will appear with a sufficient accuracy of four bits . the high state of parallel data output 62 is the ultimate possible high state of the conversion just on run to have a sufficient accuracy of at least 4 bits . the data weight of these eight or four bits will appear on parallel data outputs 54 to 60 . the digital data word on parallel data outputs 54 to 60 will be transmitted to an integration circuit ( not shown ). this integration circuit produces a reset pulse which is transmitted to flip - flop 78 and to counter 80 . a new a / d conversion begins as described above . the integration circuit is operated or influenced by the parallel data outputs 54 to 68 and by the lines 84 , which characterize the data weight ( weighting data out ). alternatively the integration circuit may be operated or influenced by output s out i . e . serial data output of successive approximation register 52 ( serial data out ). in this case only data output s out is connected to the integration circuit . the number of clock pulses on the input c of the successive approximation register 52 characterizes the data weight of the serial data pulses . the data weight of serial data pulses is characterized by the time sequence of the data pulse on output s out of the successive approximation register 52 beginning with the start of a / d conversion . those skilled in the art will readily appreciate that as the magnitude of the reference signal 74 and the analog signal 72 decreases , longer and longer comparison times are necessary in order to allow the comparator 50 to discriminate between the values of reference signal 74 and analog signal 72 and to produce an appropriate output signal . thus , it is desirable to slow down the comparison rate after the first five comparisons performed by comparator 50 indicate that no 1 &# 39 ; s exist . to that end , a switch 94 and a frequency divider 96 are interposed between the clock 70 and the clock terminal c of the successive approximation register 52 . the switch 94 is connected to the output of counter 80 , and can deliver the clock pulses generated by clock 70 either directly to clock terminal c or indirectly to this terminal , via frequency divider 96 . after the first series of five comparisons are made and no 1 &# 39 ; s have been detected , the switch can route the clock pulse generated by clock 70 through the frequency divider 96 so as to effectively make the successive approximation register 52 receive clock pulses at a lower rate . this will slow down the sampling rate applied to analog signal 72 , giving the comparator 50 a greater time in which to compare the reference signal 74 and the analog signal 72 . as can be seen in fig5 a decoder 98 composed of four and - gates is connected to lines 84 , so as to decode the output of the counter 80 . each of the and - gates can , using suitable switching circuitry known to those skilled in the art , close one of the corresponding switches 100 that are all connected together at one side to the output of the digital - to - analog converter 76 . the switches 100 feed into a resistor network 102 that is connected across the photocell 48 . it will be obvious to those skilled in the art that by suitably closing one of these switches , the output of digital - to - analog converter 76 can be scaled by the resistor network 102 so as to progressively decrease the voltage that appears at the anode of photocell 48 . thus , the scaling network 78 can scale the output signal from the digital - to - analog converter 76 in accordance with the count to which counter 80 has counted . when the clock 70 operates at a frequency of 512 khz and the frequency divider 96 divides by a factor of 4 , it will require approximately 200 microseconds for the successive approximation register as well to register the first five comparisons made by comparator 50 as to accomplish the integration in the integration circuit ( not shown ). thus , for intense levels of light , the system disclosed herein can accomplish its desired task very quickly . at lower - intensity light levels , approximately 1 millisecond may be required in order to accurately accomplish the conversion . the speed of this system results in the main from the absence of capacitors in the system . after each conversion has been accomplished , the data appearing at the parallel data outputs and the logical status of lines 84 can be used in subsequent time integration apparatus ( not shown ) such as was mentioned above . alternatively , the serial data appearing at the serial data output can be used in order to accomplish the same result . thus , it can be seen that by utilizing the system disclosed herein , the successive approximation register 52 is caused to operate in a first mode ( parallel digital words ) and in a second mode ( serial digital words ). when the successive approximation register 52 operates in the first mode , the usable data required for subsequent time integration will appear on parallel data outputs 54 - 60 . however , when the successive approximation register 52 operates in the second mode , the usable data will appear at serial data output s out of the successive approximation register 52 . in both cases the accuracy of the digital data words is at least four bits and at most eight bits . although a successive approximation register having only eight bits is utilized the total dynamic range of the successive approximation register 52 is 23 bits . thus , there is ample capacity to completely cover a dynamic range of as many as twenty - three bits , even though the successive approximation register can hold only eight simultaneously . in this fashion , all the objectives of the invention are achieved . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . | 7 |
exemplary embodiments will be described below with reference to the accompanying drawings . preliminary content as a base will be described prior to the description of the embodiments . fig1 is a cross - sectional view illustrating preliminary content . as shown in fig1 , a core substrate 120 made of a glass epoxy resin or the like is disposed at the middle portion of a wiring substrate 100 according to the preliminary content in a thickness direction of the wiring substrate . through electrodes te , which pass through the core substrate 120 in the thickness direction of the core substrate , are formed in the core substrate 120 . first wiring layers 200 , which are connected to each other by the through electrodes te , are formed on both surfaces of the core substrate 120 . further , interlayer insulation layers 300 in which via holes vh reaching the first wiring layers 200 are formed are formed on both surfaces of the core substrate 120 . second wiring layers 220 , which are connected to the first wiring layers 200 through the via holes vh , are formed on the interlayer insulation layers 300 that are formed on both surfaces of the core substrate 120 . in addition , a solder resist 320 , where opening portions 320 a are formed on connection pads p of the second wiring layer 220 , is formed on the upper interlayer insulation layer 300 . further , the solder resist 320 , where opening portions 320 a are formed on connection portions of the second wiring layer 220 , is formed on the lower interlayer insulation layer 300 . external connection terminals 240 are connected to the lower second wiring layer 220 . furthermore , solder bumps 420 of a semiconductor chip 400 are flip - chip connected to the connection pads p , which are formed on the upper surface of the wiring substrate 100 , by reflow heating . the coefficient of thermal expansion of the wiring substrate 100 ( interlayer insulation layers ( resin )/ wiring layers ( copper ) and the like ) is larger than that of the semiconductor chip 400 ( silicon ). for this reason , the wiring substrate 100 expands or warps more than the semiconductor chip 400 due to the heating that is performed for the flip - chip connection between the semiconductor chip 400 and the wiring substrate 100 . as a result , the positions of the connection pads p are shifted . in particular , if the pitch of the solder bumps 420 of the semiconductor chip 400 is reduced to 100 μm or less , the connection pads p of the wiring substrate 100 are disposed to be shifted from the solder bumps 420 of the semiconductor chip 400 . accordingly , it is difficult to reliably mount the semiconductor chip 400 . further , the second wiring layers 220 ( connection pads p ) are formed on the interlayer insulation layers 300 ( resin ) by a semi - additive method . in detail , after seed layers ( not shown ) are formed on the interlayer insulation layers 300 first , plating resists ( not shown ) including opening portions formed at portions where the second wiring layers 220 are to be disposed are formed . after that , metal plating layers are formed by electrolytic plating where the seed layers are used as plating power - supply paths . furthermore , after the plating resists are removed , the seed layers are etched while the metal plating layers are used as masks . since relatively large irregularities are formed on the surfaces of the interlayer insulation layers 300 ( resin ), considerable over - etching is needed so that residues are not formed during the etching of the seed layers . for this reason , undercut occurs on the seed layers and the patterns of the metal plating layers are apt to become thin . accordingly , when the “ line : space ” of the second wiring layers 220 ( connection pads p ) particularly becomes “ 10 : 10 μm ” or less , the width of a finished line becomes considerably small and deviates from design specifications . eventually , the width of the line becomes small , so that the adhesion between the wiring layer and the interlayer insulation layer is reduced and the second wiring layers 220 are partially detached from the surfaces of the interlayer insulation layers 300 . as described above , it is difficult to form a wiring layer , of which the “ line : space ” is “ 10 : 10 μm ” or less , on a resin layer , which has irregularities , with high yield by a semi - additive method . when it is difficult to reduce the pitch of the wiring layer , it is necessary to cope with this by increasing the number of build - up wiring layers to be laminated . for this reason , the thickness of the wiring substrate is increased , so that it is difficult to cope with the demand for the reduction in size and thickness . further , for the suppression of warpage of the whole core layer 120 of the wiring substrate 100 , the thickness of the core layer 120 of the wiring substrate 100 is set to be relatively large , that is , in the range of 400 to 800 μm . furthermore , the diameter of each of the through electrodes te passing through the core layer 120 is set to about 200 μm . as described above , the through electrodes te , which are considerably thicker and longer than the first and second wiring layers 200 and 220 or the via holes vh ( via conductors ), formed in the core layer 120 . for this reason , since signals are apt to be reflected by the through electrodes te on high - frequency signal transmission lines of the wiring substrate 100 , there is a concern about the degradation of high - frequency characteristics . it is possible to solve the above - mentioned problems by using wiring substrates according to embodiments to be described below . fig2 to 4 are cross - sectional views illustrating a method of manufacturing a wiring substrate according to a first embodiment , and fig5 is a cross - sectional view of the wiring substrate according to the first embodiment . in the method of manufacturing the wiring substrate according to the first embodiment , a glass substrate 10 a having a thickness of 0 . 3 to 1 mm is prepared first as shown in fig2 a . aluminoborosilicate glass , such as e - glass or t - glass , is used as an example of the glass substrate 10 a . t - glass is glass of which component ratios of sio 2 and al 2 o 3 are higher than those of e - glass . after that , first holes h 1 are formed from the upper surface of the glass substrate 10 a so as not to pass through the glass substrate 10 a as shown in fig2 b . the first holes h 1 are formed by laser , a drill , a blast method , etching , or the like . for example , the diameter of an opening end of the first hole h 1 , which is opened to the surface of the glass substrate 10 a , is about 50 μm and the depth of the first hole h 1 is about 100 μm . further , the cross - sectional shape of the first hole h 1 is a tapered shape where the diameter of an upper portion is larger than that of a bottom . after that , as shown in fig2 c , a first wiring layer 20 is formed on the upper surface of the glass substrate 10 a including the first holes h 1 . the first wiring layer 20 is formed so as to fill the first holes h 1 . the first wiring layer 20 is formed by , for example , a semi - additive method . in detail , first , a seed layer ( not shown ) made of copper or the like is formed on the upper surface of the glass substrate 10 a and the inner surfaces of the first holes h 1 by electroless plating or a sputtering method . then , a plating resist ( not shown ), which includes opening portions at a portion where the first wiring layer 20 is disposed , is formed . in addition , a metal plating layer made of copper or the like is formed at the opening portions of the plating resist by electrolytic plating where the seed layer is used as a plating power - supply path . at this time , the first holes h 1 of the glass substrate 10 a are filled with the metal plating layer . after that , after the plating resist is removed , the seed layer is etched while the metal plating layer is used as a mask . accordingly , the seed layer and the metal plating layer form the first wiring layer 20 . subsequently , a first interlayer insulation layer 30 , which covers the first wiring layer 20 , is formed on the glass substrate 10 a as shown in fig3 a . the first interlayer insulation layer 30 is obtained by attaching a resin film , which is made of a thermosetting epoxy resin , a thermosetting polyimide resin or the like , and heating and pressing the resin film with a vacuum press or the like . alternatively , in order to obtain the first interlayer insulation layer 30 , liquid thermosetting resin , such as epoxy or polyimide , may be applied and cured by heating . moreover , first via holes vh 1 reaching the first wiring layer 20 are formed by laser machining that is performed on the first interlayer insulation layer 30 . alternatively , the first interlayer insulation layer 30 may be made of a photosensitive resin and the first via holes vh 1 may be formed by photolithography . after that , as likewise shown in fig3 a , a second wiring layer 22 , which is connected to the first wiring layer 20 through the first via holes vh 1 ( via conductors ), is formed on the first interlayer insulation layer 30 by the same method as the method of forming the first wiring layer 20 . after that , as shown in fig3 b , a second interlayer insulation layer 32 in which second via holes vh 2 reaching the second wiring layer 22 are formed is formed on the first interlayer insulation layer 30 by the same method as the method of forming the first interlayer insulation layer 30 . in addition , as likewise shown in fig3 b , a third wiring layer 24 , which is connected to the second wiring layer 22 through the second via holes vh 2 ( via conductors ), is formed on the second interlayer insulation layer 32 through the repetition of the same machining as described above . subsequently , as shown in fig3 c , a third interlayer insulation layer 34 in which third via holes vh 3 reaching the third wiring layer 24 are formed is formed on the second interlayer insulation layer 32 through the repetition of the same machining as described above . in addition , as likewise shown in fig3 c , a fourth wiring layer 26 , which is connected to the third wiring layer 24 through the third via holes vh 3 ( via conductors ), is formed on the third interlayer insulation layer 34 through the repetition of the same machining as described above . then , a solder resist 36 , where opening portions 36 a are formed on connection portions of the fourth wiring layer 26 , is formed . after that , a contact layer is formed by sequentially forming a nickel plating layer and a gold plating layer on the connection portions of the fourth wiring layer 26 from below as necessary . since the glass substrate 10 a has sufficient rigidity , the glass substrate 10 a functions as a support that prevents warpage in the steps of manufacturing the build - up wiring layers ( the second to fourth wiring layers 22 , 24 , and 26 ). subsequently , as shown in fig4 a , a structure shown in fig3 c is turned over and the thickness of the entire structure is reduced by machining that is performed in the thickness direction on the surface of the glass substrate 10 a opposite to the surface of the glass substrate 10 a on which the first holes h 1 are formed . accordingly , a glass substrate layer 10 of which the thickness is reduced to the range of 100 to 300 μm is obtained . polishing such as cmp , dry etching , wet etching , blasting , or the like may be used as a method of machining the glass substrate 10 a . as described below , in this embodiment , through holes are formed by making the first holes h 1 , which are formed from one surface of the glass substrate layer 10 , communicate with second holes that are formed from the other surface of the glass substrate layer 10 . for this reason , the thickness of the glass substrate 10 a is reduced so that the glass substrate layer 10 remains on the first wiring layer 20 in the first hole h 1 . after that , as shown in fig4 b , second holes h 2 reaching the first wiring layer 20 formed in the first holes h 1 are formed by machining that is performed on portions of the glass substrate layer 10 formed on the first holes h 1 . in an example of fig4 b , the diameter of an opening end of the second hole h 2 , which is opened to the surface of the glass substrate layer 10 , is set to about 50 μm and the depth of the second hole h 2 is set to about 100 μm . in the process shown in fig4 b , after forming the second hole h 2 , an exposed surface of the first wiring layer 20 formed in the first hole h 1 is roughened by laser irradiation . the cross - sectional shape of the second hole h 2 is a tapered shape where the diameter of an upper portion is larger than that of a bottom . in this way , the first and second holes h 1 and h 2 are disposed symmetrically to a middle portion of the glass substrate layer 10 in the thickness direction of the glass substrate layer as the axis of symmetry . subsequently , as shown in fig5 , connection pads p , which are connected to the first wiring layer 20 so as to fill the second holes h 2 , are formed on the upper surface of the glass substrate layer 10 from the inside of the second holes h 2 . the connection pads p may be disposed so as to be isolated in the shape of an island , and may be disposed at end portions of lines that are formed so as to be led from the second holes h 2 to the upper surface of the glass substrate layer 10 . the connection pads p are made of copper or the like , and a contact layer may be formed on the surfaces of the connection pads by sequentially forming a nickel plating layer and a gold plating layer from below as necessary . the connection pads p are formed on the glass substrate layer 10 , of which the surface is smooth , by a semi - additive method that has been described in the step of forming the first wiring layer 20 . for this reason , when the seed layer is etched by a semi - additive method , it is possible to considerably reduce the amount of over - etching as compared to a case where a seed layer is formed on a resin layer having large irregularities . as a result , it is possible to form connection pads p that has a small pitch where the “ line : space ” is “ 10 : 10 μm ” or less . as described above , a wiring substrate 1 according to the first embodiment is obtained . as shown in fig5 , in the wiring substrate 1 according to the first embodiment , the first holes h 1 are formed from the lower surface of the glass substrate layer 10 to the middle portion of the glass substrate layer 10 in the thickness direction and the second holes h 2 are formed from the upper surface of the glass substrate layer 10 to the middle portion of the glass substrate layer 10 in the thickness direction . the cross - sectional shape of the first hole h 1 is an inverted tapered shape where the diameter of a lower portion ( opening end ) is larger than that of an upper portion ( bottom ). further , the cross - sectional shape of the second hole h 2 is a tapered shape where the diameter of an upper portion ( opening end ) is larger than that of a lower portion ( bottom ). the first and second holes h 1 and h 2 communicate with each other at the middle portion of the glass substrate layer 10 in the thickness direction . in this way , the first and second holes h 1 and h 2 are disposed symmetrically to each other in the thickness direction of the glass substrate layer 10 , so that through holes th passing through the glass substrate layer 10 are formed . in addition , the first wiring layer 20 is formed on the lower surface of the glass substrate layer 10 from the first holes h 1 so as to fill the first holes h 1 . further , the connection pads p are formed on the upper surface of the glass substrate layer 10 from the second holes h 2 so as to fill the second holes h 2 . the first wiring layer 20 and the connection pads p form the through electrodes te that pass through the glass substrate layer 10 . as described above , in the first embodiment , the first and second holes h 1 and h 2 are formed from both surfaces of the glass substrate layer 10 , respectively , so that the through holes th are obtained . when through holes having a diameter of 50 μm and a depth of 200 μm are formed from one surface of the glass substrate layer 10 unlike this embodiment , an aspect ratio is large , that is , 4 ( depth / diameter ). accordingly , it is not easy to form the through holes , so that there is a concern about the reduction in production yield . moreover , when the aspect ratio of the through hole is large , voids are formed when the through hole is to be filled with the metal plating layer in the above - mentioned semi - additive method . for this reason , yield is apt to deteriorate . however , in this embodiment , the first and second holes h 1 and h 2 having a diameter of 50 μm are formed from both surfaces of the glass substrate layer 10 with a depth of 100 μm , and the through holes th are formed by making the first and second holes h 1 and h 2 communicate with each other . for this reason , since the aspect ratio ( depth / diameter ) of each of the first and second holes h 1 and h 2 is small , that is , 2 ( depth / diameter ), it is easy to form the through holes . accordingly , it is possible to improve production yield . in addition , even when the first and second holes h 1 and h 2 are to be filled with the metal plating layer , the formation of voids or the like is avoided since the aspect ratio is small . accordingly , it is possible to reliably form the wiring layer or the connection pads . it is preferable that the first and second holes h 1 and h 2 be connected to each other at the middle position of the glass substrate layer 10 in the thickness direction . in this case , the aspect ratios of the first and second holes h 1 and h 2 are reduced . for this reason , since the formation of voids is prevented when the first and second holes h 1 and h 2 are to be filled with the metal plating layer , it is preferable that the first and second holes h 1 and h 2 be connected to each other at the middle position of the glass substrate layer 10 in the thickness direction . however , there is no problem even though the first and second holes h 1 and h 2 are connected to each other while being vertically shifted from the middle position of the glass substrate layer 10 in the thickness direction by a distance corresponding to about ± 20 % of the thickness of the glass substrate layer 10 . further , when the bottom of one hole of the first and second holes h 1 and h 2 and the bottom of the other hole thereof are connected to each other , there is no problem even though the center of the bottom of the other hole is horizontally shifted from the center of the bottom of one hole by a distance corresponding to about ± 20 % of the diameter of one hole . the same applies to the case where a silicon substrate layer is used instead of the glass substrate layer 10 as in a second embodiment to be described below . the first interlayer insulation layer 30 in which the first via holes vh 1 reaching the first wiring layer 20 are formed is formed beneath the first wiring layer 20 that is formed on the lower surface of the glass substrate layer 10 . further , the second wiring layer 22 , which is connected to the first wiring layer 20 through the first via holes vh 1 ( via conductors ), is formed beneath the first interlayer insulation layer 30 . likewise , the second interlayer insulation layer 32 in which the second via holes vh 2 reaching the second wiring layer 22 are formed is formed beneath the second wiring layer 22 . furthermore , the third wiring layer 24 , which is connected to the second wiring layer 22 through the second via holes vh 2 ( via conductors ), is formed beneath the second interlayer insulation layer 32 . likewise , the third interlayer insulation layer 34 in which the third via holes vh 3 reaching the third wiring layer 24 are formed is formed beneath the third wiring layer 24 . moreover , the fourth wiring layer 26 , which is connected to the third wiring layer 24 through the third via holes vh 3 ( via conductors ), is formed beneath the third interlayer insulation layer 34 . in addition , the solder resist 36 , where the opening portions 36 a are formed on the connection portions of the third wiring layer 24 , is formed beneath the third interlayer insulation layer 34 . the connection pads p and the respective wiring layers 20 , 22 , 24 , and 26 include portions that fill the holes h 1 and h 2 or the via holes vh 1 to vh 3 , and wiring pattern portions that are formed on the glass substrate layer 10 or the interlayer insulation layers 30 , 32 , and 34 , respectively . in an example of fig5 , three build - up wiring layers connected to the first wiring layer 20 are laminated beneath the glass substrate layer 10 . however , the number of build - up wiring layers , which are connected to the first wiring layer 20 , may be arbitrarily set to n ( n is an integer of 1 or more ). next , a method of flip - chip connecting a semiconductor chip to the wiring substrate 1 according to this embodiment will be described . as shown in fig6 , solder bumps 42 of a semiconductor chip 40 are disposed on the connection pads p of the wiring substrate 1 of fig5 and are subjected to reflow heating . accordingly , the solder bumps 42 of the semiconductor chip 40 are flip - chip connected to the connection pads p of the wiring substrate 1 . in addition , external connection terminals 28 such as solder balls are formed on the fourth wiring layer 26 . a gap between the semiconductor chip 40 and the wiring substrate 1 may be filled with an underfill resin . as a result , a semiconductor device 5 according to the first embodiment is obtained . in this case , the mounting surface of the wiring substrate 1 on which the semiconductor chip 40 is to be mounted is formed of the glass substrate layer 10 of which the coefficient of thermal expansion is similar to the coefficient of thermal expansion of the semiconductor chip ( silicon ), and the connection pads p are formed on the glass substrate layer 10 . the coefficient of thermal expansion of each of the glass substrate layer 10 and the semiconductor chip 40 is in the range of 3 to 6 ppm /° c . further , the coefficient of thermal expansion of the glass substrate layer 10 is in the range of about ± 30 % of the coefficient of thermal expansion of the semiconductor chip 40 . for this reason , a problem that the wiring substrate 1 expands or warps more than the semiconductor chip 40 due to the heating performed for the flip - chip connection of the semiconductor chip 40 is solved . accordingly , even if the pitch of the solder bumps 42 of the semiconductor chip 40 is reduced to 100 μm or less , it is possible to accurately dispose the solder bumps 42 of the semiconductor chip 40 on the connection pads p of the wiring substrate 1 . further , as described above , the through holes th of the glass substrate layer 10 are obtained by making the first and second holes h 1 and h 2 , which are formed from both surfaces of the glass substrate layer 10 , communicate with each other . the diameter of the through hole th is set to about 50 μm and the depth of the through hole th is set in the range of about 100 to 300 μm . for this reason , it is possible to make the diameter and length of the through electrode te be smaller than those of the through electrode te ( diameter : 200 μm , length : 400 to 800 μm ) that is formed in the core substrate 120 of the wiring substrate 100 described in the preliminary content . accordingly , since signals are not easily reflected by the through electrodes te on high - frequency signal transmission lines of the wiring substrate 1 the degradation of high - frequency characteristics is prevented . moreover , since the glass substrate layer 10 having high rigidity is used as a substrate , it is possible to prevent the occurrence of warpage of the wiring substrate 1 even though thermal stress is generated in the wiring substrate 1 . further , since it is possible to reduce the thickness of the glass substrate layer 10 , which functions as a substrate , to the range of 100 to 300 μm , it is possible to make the entire wiring substrate 1 be thinner than the wiring substrate 100 of the preliminary content . a wiring substrate 1 a according to a modification of the first embodiment is shown in fig7 . as shown in fig7 , when connection pads are formed in second holes h 2 of a glass substrate layer 10 , concave connection pads px may be formed on the inner surfaces of the second holes h 2 so that the second holes h 2 are not filled and holes remain in the second holes h 2 . the concave connection pads px are made of copper ( cu ) or gold ( au ). in a method of forming the concave connection pads px , first , a thin metal layer made of copper or gold is formed on the upper surface of the glass substrate layer 10 and the inner surfaces of the second holes h 2 by a sputtering method or the like . after that , the metal layer is patterned by photolithography and etching so that the concave connection pads px remain on the inner surfaces of the second holes h 2 . accordingly , the concave connection pads px where the metal layer is formed along the inner surfaces of the second holes h 2 are obtained . alternatively , the concave connection pads px may be formed by a semi - additive method or electroless plating . in the wiring substrate 1 a according to the modification , a first wiring layer 20 and the concave connection pads px form through electrodes te . when the wiring substrate 1 a according to the modification is employed , a semiconductor chip 40 including metal bumps 44 made of copper ( cu ) or gold ( au ) is used . further , as shown in fig8 , the metal bumps 44 of the semiconductor chip 40 are fitted and connected to the concave connection pads px of the wiring substrate 1 a . the metal bumps 44 of the semiconductor chip 40 and the concave connection pads px of the wiring substrate 1 a are electrically connected to each other by copper - copper or gold - gold metal bonding . furthermore , external connection terminals 28 are formed by mounting solder balls on the fourth wiring layer 26 . as a result , a semiconductor device 5 a according to the modification of the first embodiment is obtained . fig9 to 12 are cross - sectional views illustrating a method of manufacturing a wiring substrate according to a second embodiment , and fig1 is a cross - sectional view of the wiring substrate according to the second embodiment . the second embodiment is characterized in that a silicon substrate is used instead of the glass substrate of the first embodiment . the detailed description of the same steps and elements as those of the first embodiment will be omitted in the second embodiment . in the method of manufacturing the wiring substrate according to the second embodiment , a silicon substrate 50 a having a thickness of 0 . 3 to 1 mm is prepared first as shown in fig9 a and first holes h 1 are formed from the upper surface of the silicon substrate 50 a by the same method as the method , which is used in the first embodiment , so as not to pass through the silicon substrate 50 a . then , an insulation layer 52 formed of a silicon oxide layer is formed on both surfaces of the silicon substrate 50 a and the inner surfaces of the first holes h 1 as shown in fig9 b by thermally oxidizing the silicon substrate 50 a . alternatively , a silicon oxide layer or silicon nitride layer may be formed on the surface of the silicon substrate 50 a , on which the first holes h 1 are formed , by a cvd method and may be used as the insulation layer 52 . next , as shown in fig9 c , a first wiring layer 20 is formed on portions of the insulation layer 52 , which include the first holes h 1 of the silicon substrate 50 a , by the same method as the method used in the first embodiment . the first wiring layer 20 is formed so as to fill the first holes h 1 . subsequently , as shown in fig1 a , three build - up wiring layers ( second , third , and fourth wiring layers 22 , 24 , and 26 ) connected to the first wiring layer 20 are formed by performing the same steps as the steps of fig3 a to 3c of the first embodiment . subsequently , as shown in fig1 b , a structure shown in fig1 a is turned over and the thickness of the entire silicon substrate 50 a is reduced by machining that is performed on the insulation layer 52 and the silicon substrate 50 a in the thickness direction . accordingly , a silicon substrate layer 50 of which the thickness is reduced to the range of about 100 to 300 μm is obtained . at this time , as in the first embodiment , the silicon substrate 50 a is subjected to machining so that the silicon substrate layer 50 remains on the first wiring layer 20 . after that , as shown in fig1 a , second holes h 2 reaching the first wiring layer 20 are formed by machining that is performed on portions of the silicon substrate layer 50 and the insulation layer 52 formed on the first holes h 1 . moreover , as shown in fig1 b , an insulation layer 54 is obtained by forming a silicon oxide layer or a silicon nitride layer on the upper surface of the silicon substrate layer 50 and the inner surfaces of the second holes h 2 by a cvd method . next , as shown in fig1 a , a resist 56 in which opening portions 56 a are formed at the portions corresponding to the second holes h 2 is patterned by photolithography . for example , a dry film resist is attached to the insulation layer and exposure and development are performed , so that the resist 56 including the opening portions 56 a is obtained . in addition , the insulation layer 54 , which is formed at the bottoms of the second holes h 2 , is etched and removed by anisotropic dry etching that is performed through the opening portions 56 a of the resist 56 . after that , the resist 56 is removed . as a result , as shown in fig1 b , the insulation layer 54 remains on the upper surface of the silicon substrate layer 50 and the side walls of the second holes h 2 and the first wiring layer 20 is exposed to the bottoms of the second holes h 2 . in this way , the through holes th passing through the silicon substrate layer 50 are obtained from the first and second holes h 1 and h 2 . meanwhile , besides the method of patterning the insulation layer 54 by photolithography and etching , the insulation layer 54 may be formed of a photosensitive insulating resin layer . in this case , a liquid or paste photosensitive insulating resin is applied on the silicon substrate layer 50 of fig1 a . then , the insulating resin applied on the bottoms of the second holes h 2 is removed by exposure and development , and the photosensitive insulating resin is cured by heating . accordingly , likewise , it is possible to form the insulation layer 54 so that the first wiring layer 20 is exposed to the bottoms of the second holes h 2 . a phenol photosensitive resin , a polyimide photosensitive resin , a polybenzoxazole photosensitive resin , and the like may be used as the photosensitive insulating resin . the thickness of the insulation layer 54 depends on the diameter or depth of the second hole h 2 , but is set in the range of , for example , 2 to 50 μm . subsequently , as shown in fig1 , as in the first embodiment , connection pads p electrically connected to the first wiring layer 20 are formed on portions of the insulation layer 54 that include the second holes h 2 of the silicon substrate layer 50 . the connection pads p are formed so as to fill the second holes h 2 . as a result , a wiring substrate 2 according to the second embodiment is obtained . as shown in fig1 , in the wiring substrate 2 according to the second embodiment , the silicon substrate layer 50 is used instead of the glass substrate layer 10 of the wiring substrate 1 according to the first embodiment . further , as in the first embodiment , through holes th are formed by making the first and second holes h 1 and h 2 , which are formed from both surfaces of the silicon substrate layer 50 , communicate with each other . the insulation layers 52 and 54 are formed on both surfaces of the silicon substrate layer 50 and the inner surfaces of the through holes th . furthermore , the first wiring layer 20 is formed on the insulation layer 52 of the lower surface of the silicon substrate layer 50 from the first holes h 1 so as to fill the first holes h 1 . moreover , the connection pads p connected to the first wiring layer 20 are formed on the insulation layer 54 of the upper surface of the silicon substrate layer 50 from the second holes h 2 so as to fill the second holes h 2 . the first wiring layer 20 and the connection pads p form the through electrodes te that pass through the silicon substrate layer 50 . in addition , as in the first embodiment , three build - up wiring layers ( second , third , and fourth wiring layers 22 , 24 , and 26 ) connected to the first wiring layer 20 are formed under the silicon substrate layer 50 . the wiring substrate 2 according to the second embodiment has the same advantages as the advantages of the wiring substrate according to the first embodiment . further , as shown in fig1 , as in the first embodiment , solder bumps 42 of a semiconductor chip 40 are flip - chip connected to the connection pads p of the wiring substrate 2 by reflow heating . furthermore , external connection terminals 28 are formed by mounting solder balls on the fourth wiring layer 26 . as a result , a semiconductor device 6 according to the second embodiment is obtained . in this case , the mounting surface of the wiring substrate 2 on which the semiconductor chip 40 is to be mounted is formed of the silicon substrate layer 50 of which the coefficient of thermal expansion is the same as the coefficient of thermal expansion of the semiconductor chip 40 ( silicon ), and the connection pads p are formed on the silicon substrate layer 50 . the coefficient of thermal expansion of each of the silicon substrate layer 50 and the semiconductor chip 40 is in the range of 3 to 6 ppm /° c . further , the coefficient of thermal expansion of the silicon substrate layer 50 is in the range of about ± 30 % of the coefficient of thermal expansion of the semiconductor chip 40 . for this reason , a problem that the wiring substrate 2 expands or warps more than the semiconductor chip 40 due to the heating performed for the flip - chip connection of the semiconductor chip 40 is solved . accordingly , even if the pitch of the solder bumps 42 of the semiconductor chip 40 is reduced to 100 μm or less , it is possible to accurately dispose the solder bumps 42 of the semiconductor chip 40 on the connection pads p of the wiring substrate 2 . further , as in the case where the glass substrate layer 10 of the first embodiment is used , it is possible to form the connection pads p having a small pitch by a semi - additive method since the surface of the silicon substrate layer 50 is smoother than the surface of the insulation layer made of a resin . furthermore , since it is possible to make the diameter and length of the through electrode te , which is formed in the silicon substrate layer 50 , be small as in the case where the glass substrate layer 10 of the first embodiment is used , the degradation of high - frequency characteristics is prevented . even in the wiring substrate 2 according to the second embodiment , concave connection pads may be formed on the inner surfaces of the second holes h 2 and the metal bumps of the semiconductor chip may be fitted to the concave connection pads as in the wiring substrate 1 a according to the modification of the first embodiment . fig1 and 16 are cross - sectional views illustrating a method of manufacturing a wiring substrate according to a third embodiment , and fig1 is a cross - sectional view of the wiring substrate according to the third embodiment . in the first and second embodiments , the first and second holes are formed from both surfaces of the glass substrate layer and the silicon substrate layer , and the through holes are formed by making the first and second holes communicate with each other . accordingly , the formation of the holes and filling the holes with the metal plating layer are facilitated by the reduction of the aspect ratio of each of the holes . a case where holes are formed from only one surface of a substrate layer to form through holes for the reduction in cost when through holes formed in a glass substrate layer or a silicon substrate layer have a relatively large diameter will be described in the third embodiment . the detailed description of the same steps and elements as those of the first embodiment will be omitted in the third embodiment . in the method of manufacturing the wiring substrate according to the third embodiment , a glass substrate 10 a is prepared first as shown in fig1 a as in the first embodiment , and holes h are formed from the upper surface of the glass substrate 10 a by machining so as not to pass through the glass substrate 10 a . in the third embodiment , the diameter of each of the through holes , which are finally formed in a glass substrate layer , is about 100 μm and is set to be considerably larger than the diameter ( 50 μm ) of each of the through holes of the glass substrate layer and the silicon substrate layer of the first and second embodiments . the diameter of the through holes means the diameter of an end of through hole that is opened to the surface of the glass substrate 10 a . accordingly , if the diameter of the hole h is set to 100 μm and the depth of the hole h is set to 200 μm , the aspect ratio ( depth / diameter ) of the hole h becomes 2 . accordingly , even though the holes h are formed from only one surface of the glass substrate 10 a , the formation of the holes h is facilitated . the cross - sectional shape of the hole h is set to a tapered shape where the diameter of an upper portion is larger than that of a bottom . after that , as shown in fig1 b , as in the first embodiment , a first wiring layer 20 is formed on portions of the glass substrate 10 a including the holes h so as to fill the holes h . subsequently , as shown in fig1 a , three build - up wiring layers ( second , third , and fourth wiring layers 22 , 24 , and 26 ) connected to the first wiring layer 20 are formed by performing the same steps as the steps of fig3 a to 3c of the first embodiment . after that , as shown in fig1 b , a structure shown in fig1 a is turned over and the glass substrate 10 a is made thin by machining that is performed on the exposed surface of the glass substrate 10 a until the first wiring layer 20 formed at the bottoms of the holes h is exposed to the outside . accordingly , a thin glass substrate layer 10 is obtained and the first wiring layer 20 is exposed to the upper surface of the glass substrate layer 10 . further , the holes h are changed into through holes th passing through the glass substrate layer 10 , and the first wiring layer 20 functions as through electrodes te that fill the through holes th . after that , as shown in fig1 , connection pads p electrically connected to the first wiring layer 20 are formed on the upper surface of the glass substrate layer 10 from the upper portions of the holes h ( first wiring layer 20 ). as a result , a wiring substrate 3 according to the third embodiment is obtained . as described above , in the third embodiment , first , the tapered holes h are formed from one surface of the glass substrate 10 a by laser or the like so as not to pass through the glass substrate 10 a . in addition , after the first wiring layer 20 is formed in the holes h , the glass substrate 10 a is made thin by machining that is performed on the other surface of the glass substrate 10 a until the first wiring layer 20 is exposed to the outside . as a result , the through holes th are obtained . for this reason , in the wiring substrate 3 according to the third embodiment , the inverted tapered through holes th each of which has the diameter of an upper portion smaller than that of a lower portion are formed in the glass substrate layer 10 . the first wiring layer 20 is formed on the lower surface of the glass substrate layer 10 from the inside of the through holes th so as to fill the through holes th . moreover , the connection pads p connected to the first wiring layer 20 are formed on the upper surface of the glass substrate layer 10 . further , as in the first embodiment , three build - up wiring layers ( second , third , and fourth wiring layers 22 , 24 , and 26 ) connected to the first wiring layer 20 are formed under the glass substrate layer 10 . furthermore , as shown in fig1 , as in the first embodiment , solder bumps 42 of a semiconductor chip 40 are flip - chip connected to the connection pads p of the wiring substrate 3 by reflow heating . in addition , external connection terminals 28 are formed by mounting solder balls on the fourth wiring layer 26 . as a result , a semiconductor device 7 according to the third embodiment is obtained . the wiring substrate 3 according to the third embodiment has the same advantages as the advantages of the wiring substrate according to the first embodiment . moreover , the third embodiment is useful when the through holes th having a relatively large diameter are formed in the glass substrate layer 10 . in this case , since the number of steps is smaller than the number of steps of each of the first and second embodiments , it is possible to reduce cost . fig1 is a cross - sectional view of a wiring substrate according to a fourth embodiment . the fourth embodiment is characterized such that a silicon substrate layer is used instead of the glass substrate layer of the third embodiment . the detailed description of the same steps and elements as those of the first embodiment will be omitted in the fourth embodiment . as shown in fig1 , in a wiring substrate 4 according to the fourth embodiment , the glass substrate layer 10 of the wiring substrate 3 according to the third embodiment shown in fig1 is substituted with a silicon substrate layer 50 . further , as in the third embodiment , inverted tapered through holes th , each of which has the diameter of an upper portion smaller than that of a lower portion , are formed in the silicon substrate layer 50 . in the fourth embodiment , insulation layers 52 and 54 are formed on both surfaces of the silicon substrate layer 50 and the inner surfaces of the through holes th . further , opening portions 54 a are formed in the insulation layer 54 on the first wiring layer 20 that are formed in the through holes th . connection pads p are connected to the first wiring layer 20 through the opening portions 54 a of the insulation layer 54 . when the wiring substrate 4 according to the fourth embodiment is manufactured , a silicon substrate is used in the step of the third embodiment shown in fig1 a and holes h are formed . then , the insulation layer 52 is formed on the upper surface of the silicon substrate and the inner surfaces of the holes h by thermal oxidation or a cvd method . moreover , after the step shown in fig1 b , the insulation layer 54 is formed on the upper surface of the silicon substrate layer 50 by a cvd method . the insulation layer 54 may be patterned to form the opening portions 54 a on the first wiring layer 20 . further , as shown in fig2 , as in the first embodiment , solder bumps 42 of a semiconductor chip 40 are flip - chip connected to the connection pads p of the wiring substrate 4 by reflow heating . furthermore , external connection terminals 28 are formed by mounting solder balls on the fourth wiring layer 26 . as a result , a semiconductor device 8 according to the fourth embodiment is obtained . the wiring substrate 4 according to the fourth embodiment has the same advantages as the advantages of the wiring substrate according to the first embodiment . moreover , like the third embodiment , the fourth embodiment is useful when the through holes th having a relatively large diameter are formed in the silicon substrate layer 50 . in this case , since the number of steps is smaller than the number of steps of each of the first and second embodiments , it is possible to reduce cost . while the present invention has been shown and described with reference to certain exemplary embodiments thereof , other implementations are within the scope of the claims . it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
an invention for chemical mechanical polishing ( cmp ) end - point detection systems and methods for implementing such systems are disclosed . in the following description , numerous specific details are set forth in order to provide a thorough understanding of the present invention . it will be understood , however , to one skilled in the art , that the present invention may be practiced without some or all of these specific details . in other instances , well known process operations have not been described in detail in order not to unnecessarily obscure the present invention . fig3 a shows a cmp system 300 including an end - point detection system , in accordance with one embodiment of the present invention . the end - point detection system is designed to include sensors 310 a and 310 b positioned near a location that is proximate to a carrier 308 . as is well known , the carrier 308 is designed to hold a wafer 301 and apply the wafer 301 to the surface of a pad 304 . the pad 304 is designed to move in a pad motion direction 305 around rollers 302 a and 302 b . the pad 304 is generally provided with slurry 306 that assists in the chemical mechanical polishing of the wafer 301 . in this embodiment , the cmp system 300 also includes a conditioning head 316 that is connected to a track 320 . the conditioning head is designed to scrub the surface of the pad 304 either in an in - situ manner or an ex - situ manner . as is well known , the conditioning of the pad 304 is designed to recondition the surface of the pad 304 to improve the performance of the polishing operations . the sensors 310 a and 310 b are designed to be fixed over a location of the pad 304 , while the carrier 308 rotates the wafer 301 over the surface of the pad 304 . accordingly , the sensors 310 a and 310 b will not rotate with the carrier 308 , but will remain at a same approximate location over the platen 322 . the sensors 310 a and 310 b are preferably temperature sensors which sense the temperature of the pad 304 during a cmp operation . the sensed temperature is then provided to sensing signals 309 a and 309 b which are communicated to an end - point signal processor 312 . as shown , the carrier 308 also has a carrier positioner 308 a which is designed to lower and raise the carrier 308 and associated wafer 301 over the pad 304 in the direction 314 . fig3 b shows a top view of a portion of a pad 304 that is moving in the motion direction 305 . as shown , the carrier 308 is lowered by the carrier positioner 308 a onto the pad 304 . the sensors 310 a and 310 b are also lowered toward the pad 304 as shown in fig3 c and 3d . the sensors 310 a and 310 b , as described above , do not rotate with the carrier 308 , but remain at the same relative position over the pad 304 . accordingly , the sensors 310 a and 310 b are designed to be fixed , however , may move in a vertical direction toward the pad 304 and away from the pad 304 synchronously with the carrier 308 . thus , when the carrier 308 is lowered toward the pad 304 , the sensors 310 a and 310 b will also be lowered toward the surface of the pad 304 . in another embodiment , the carrier 308 can move independently from the sensors 310 a and 310 b . in a preferred embodiment of the present invention , the sensors 310 a and 310 b are designed to sense a temperature emanating from the pad 304 . because the wafer , during polishing , is in constant friction with the pad 304 , the pad 304 will change in temperature from the time the pad 304 moves from the fixed position of sensor 310 a and sensor 310 b . typically , the heat is absorbed by the wafer , the pad material , outgoing slurry and process by - products . this therefore produces differences in temperature that can be sensed . thus , the sensed temperature for sensor 3 a will be a temperature “ in ” ( tin ) and the temperature sensed at sensor 310 b will be a temperature “ out ” ( tout ). a temperature differential ( δt ) will then be measured by subtracting tin from tout . the temperature differential is shown as an equation in box 311 of fig3 b . fig3 c illustrates a side view of the carrier 308 applying the wafer 301 to the pad 304 . as shown , the carrier 308 applies the wafer 301 that is held by a retaining ring 308 b against the pad 304 over the platen 322 . as the pad 304 moves in the motion direction 305 , the sensor 310 a will detect a temperature tin that is communicated as a sensing signal 309 a to the end - point signal processor 312 . the sensor 310 b is also configured to receive a temperature tout and provide the sensed temperature over a sensing signal 309 b to the end - point signal to processor 312 . in one embodiment , the sensors 310 are preferably positioned proximately to the pad 304 such that the temperature can be sensed accurately enough and provided to the end - point signal processor 312 . for example , the sensors are preferably adjusted such that they are between about 1 millimeter and about 250 millimeters from the surface of the pad 304 when the carrier 308 is applying the wafer 301 to the surface of the pad 304 . the sensor 310 a shown in fig3 d , in a preferred embodiment , is positioned such that it is about 5 millimeters from the surface of the pad 304 . in th is preferred embodiment , the sensors 310 are prefer ably infrared sensors that are configured to sense the temperature of the pad 304 as the pad moves linearly in the pad motion direction 305 . one exemplary infrared temperature sensor is model no . 39670 - 10 , which is sold by cole parmer instruments , co . of vernon hills , ill . in another embodiment , the sensors 310 need not necessarily be directly adjacent to the carrier 308 . for instance , the sensors can be spaced apart from the carrier 308 at a distance that is between about ⅛ of an inch and about 5 inches , and most preferably positioned at about ¼ inch from the side of the carrier 308 . preferably , the spacing is configured such that the sensors 310 do not interfere with the rotation of the carrier 308 since the sensors 310 are fixed relatively to the pad while the carrier 308 is configured to rotate the wafer 301 up against the pad surface 304 . fig4 a shows a cross - sectional view of the dielectric layer 102 , the diffusion barrier layer 104 , and the copper layer 106 . the thicknesses of the diffusion barrier layer 104 and the copper layer 106 can vary from wafer - to - wafer and surface zone - to - surface zone throughout a particular wafer being polished . however , during a polishing operation , it will take an approximate amount of time to remove the desired amount of material from over the wafer 301 . for instance , it will take up to about a time t 2 to remove the diffusion barrier layer 104 , up to a time t 1 to remove the copper 104 down to the diffusion barrier layer 104 relative to a time to , which is when the polishing operation begins . for illustration purposes , fig4 b provides a temperature differential versus time plot 400 . the temperature differential versus time plot 400 illustrates a temperature differential change over the pad 304 surface between the sensors 310 a and 310 b . for instance , at a time t 0 , the temperature differential state 402 a will be zero since the polishing operation has not yet begun . once the polishing operation begins on the copper material , the temperature differential 402 b will move up to a temperature differential δt a . this temperature differential is an increase relative to he off position because the temperature of the pad 304 increases as the frictional tresses are received by the application of the wafer 301 to the pad 304 . the temperature differential δt a also increases to a certain level based on the type of material being polished . once the copper layer 106 is removed from over the structure of fig4 a , the cmp operation will continue over the diffusion barrier layer 104 . as the diffusion barrier layer material begins to be polished , the temperature differential will move from 402 b to 402 c . the temperature differential 402 c is shown as δt b . this is an increase in temperature differential due to the fact that the diffusion barrier layer 104 is a harder material than the copper layer 106 . as soon as the diffusion barrier layer 104 is removed from over the dielectric layer 102 , more dielectric material will begin to be polished thus causing another shift in the temperature differential at a time t 2 . at this point , the temperature differential 402 d will be produced at δt c . the shift between δt b and δt c will thus define a target end - point temperature differential change 404 . this target end - point temperature differential change 404 will occur at about a time t 2 . in order to ascertain the appropriate time to stop the polishing operation to ensure that the diffusion barrier layer 104 is adequately removed from over the dielectric layer 102 , an examination of the transition between 402 c and 402 d is preferably made . as shown in fig4 c , the target end - point temperature differential change 404 is shown in magnification wherein tests were made at several points p 1 , p 2 , p 3 , p 4 , p 5 , p 6 , and p 7 . these points span the temperature differential δt b and δt c . as shown , time t 2 actually spans between a time t 2 ( p 1 ), and a time t 2 ( p 7 ). to ensure the best and most accurate end - point , it is necessary to ascertain at what time to stop within time t 2 . the different points p 1 through p 7 are preferably analyzed by polishing several test wafers having the same materials and layer thicknesses . by examining the different layers being polished for different periods of time as well as the thicknesses of the associated layers , it is possible to ascertain a precision time at which to stop the polishing operation . for instance , the polishing operation may be stopped at a point p 5 405 instead of a point p op 407 , which defines an over - polish time . the over - polishing technique is typically used in the prior art when it is uncertain when the diffusion barrier layer or any other layer being polished has , in fact , been removed from over the base layer ( e . g ., dielectric layer ). however , by inspecting the transition between time differential 402 c and time differential 402 d , it is possible to ascertain the proper time to stop the polishing operation ( thus detecting an exact or nearly exact end - point ) within a window that avoids the aforementioned problems of dishing and other over - polishing damage than can occur to sensitive interconnect metallization lines or features . fig5 a illustrates a top view diagram of another embodiment of the present invention in which a plurality of sensors 1 through 10 and a pair of reference sensors r are arrange around and proximate to the carrier 308 . however , it should be understood that any number of pairs of sensors can also be used . in this embodiment , the sensors are divided into five zones over the wafer being polished . as the pad rotates in the direction 305 , temperature differentials are determined between sensors 9 and 10 , 5 and 6 , 1 and 2 , 3 and 4 , and 7 and 8 . each of these temperature differentials δt 1 through δt 5 define zones 1 through 5 , respectively . for each of these zones , there is a determined target temperature differential for ascertaining end - point . by calibrated tests , it may be determined that target temperature differentials or each zone may vary as shown in fig5 b . for instance , zones 1 and 5 may have a target temperature differential of 15 , zones 2 and 4 may have a temperature differential target about 20 , and zone 3 may have a temperature differential of about 35 . by examining the temperature differentials in each of the zones , it is possible to ascertain whether the proper end - point has been reach for the different zones of the wafer being polished in fig5 a . accordingly , the embodiments of fig3 through 4 are equally applicable to the embodiment of fig5 a and 5b . however , by analyzing different zones of the wafer surface , it is possible to ascertain more precise end - point over the different zones of a given wafer . of course , more or less sensors may be implemented depending upon the number of zones desired to be monitored . fig6 illustrates a schematic diagram of the sensors 1 through 10 shown in fig5 a . the sensors 1 through 10 ( e . g ., such as sensors 110 a and 110 b of fig3 are arranged in a position that is proximate to the pad but in a stationary position that does not rotate as does the carrier 308 . by determining the temperature at the different locations over the pad 304 as a polishing operation is in progress , the temperature differentials δt 1 through δt 5 can be ascertained at the different relative locations of the pad 304 . the sensed signals 309 are then communicated to the endpoint signal processor 312 . the end - point signal processor 312 is configured to include a multi - channel digitizing card 462 ( or digitizing circuit ). multi - channel digitizing card 462 is configured to sample each of the signals and provide an appropriate output 463 to a cmp control computer 464 . the cmp control computer 464 can then process the signals received from the multi - channel digitizing card 462 and provide them over a signal 465 to a graphical display 466 . the graphical display 466 may include a graphical user interface ( gui ) that will illustrate pictorially the different zones of the wafer being polished and signify when the appropriate end - point has been reached for each particular zone . if the end - point is being reached for one zone before another zone , it may be possible to apply appropriate back pressure to the wafer or change the polishing pad back pressure in those given locations in which polishing is slow in order to improve the uniformity of the cmp operation and thus enable the reaching of an end - point throughout the wafer in a uniform manner ( i . e ., at about the same time ). as can be appreciated , the end - point monitoring of the present invention has the benefit of allowing more precision cmp operations over a wafer and zeroing on selected regions of the wafer being polished to ascertain whether the desired material has been removed leaving the under surface in a clean , yet unharmed condition . it should also be noted that the monitoring embodiments of the present invention are also configured to be non - destructive to a wafer that may be sensitive to photo - assisted corrosion as described above . additionally , the embodiments of the present invention do not require that a cmp pad be altered by pad slots or the need to drill slots into a platen or a rotary table that is positioned beneath a pad . thus , the monitoring is more of a passive monitoring that does not interfere with the precision polishing of a wafer , yet provides very precise indications of end - point to precisely discontinue polishing . while this invention has been described in terms of several preferred embodiments , it will be appreciated that those skilled in the art upon reading the preceding specification and studying the drawings will realize various alterations , additions , permutations and equivalents thereof . for example , the end - point detection techniques will work for any polishing platform ( e . g . belt , table , rotary , orbital , etc .) and for any size wafer or substrate , such as , 200 mm , 300 mm , and larger , as well as other sizes and shapes . it is therefore intended that the present invention includes all such alterations , additions , permutations , and equivalents that fall within the true spirit and scope of the invention . | 1 |
reference is now made to the drawings wherein like numerals refer to like parts throughout . in fig1 , a child seat cover 10 is preferably fabricated using a one or multi - layer protective cover material 14 of substantially rectangular sheetform configuration . although depicted in fig1 as of woven construction , the present invention is not so limited , and the use of non - woven materials is also contemplated in fabricating the child seat cover 10 . a pair of dorsal slits 18 extend inwardly in a substantially vertical manner from an upper periphery 22 of the cover material 14 , forming a back panel 26 of generally rectangular configuration . in a similar manner a pair of ventral slits 32 extend inwardly from a lower periphery 36 of the cover material 14 , forming a seat panel 42 . the ventral slits 32 are preferably formed on a bias , and in a particularly preferred embodiment , on a substantially 45 - degree bias relative to the lower periphery 36 . while the pair of ventral slits 32 extend inward without intersecting the pair of dorsal slits 18 , the combination of both cooperate to form a first lateral wing panel 46 and a second lateral wing panel 48 within the cover material 14 . in combination , the back panel 26 , the pair of lateral wing panels 46 , 48 , and the seat panel 42 appear to form an angel outline in the cover material 14 , inspiring the trademark for the commercial product : seat angel ™. a plurality of fastening pairs are provided adjacent each of the slits , in fig1 a plurality of pairs of hook and loop fasteners 52 a , 52 b are attached adjacent one - another on opposite sides of both the dorsal slits 18 and the ventral slits 32 . it is to be understood and appreciated that the present invention is not to be interpreted as limited to this one type of paired fasteners . the present child seat cover 10 is intended primarily for use in motor vehicle child seats , and the majority of those offer a 5 - point restraint system . in fig1 a buckle notch 56 is formed at a central location in the seat panel 42 , substantially corresponding to the location of a seatbelt buckle extending through the seat area of child seats utilizing the 5 - point system . the buckle notch 56 permits this centrally - located seatbelt buckle to extend through the cover material 14 . fig2 illustrates a vehicle safety seat 62 that utilizes such a 5 - point harness system . in such systems a common buckle 64 , normally attached to a crotch strap 66 , is used to attach together at a central location a first shoulder strap 68 , a second shoulder strap 72 , a first side strap 74 and a second side strap 76 , which together securely hold the child in proper position within the vehicle safety seat 62 . there are several different manufacturers of vehicle safety seats , some of the more well known might include graco children &# 39 ; s products , inc ., of exton , pa ., dorel juvenile group , inc ., of columbus , ind ., peg - perego , of fort wayne , ind ., and evenflo company , inc ., of piqua , ohio . additionally , most manufacturers have several different models , for example britax child safety , inc ., of charlotte , n . c ., presently offers eleven different seat models , ranging from the companion ® to the vervet ™. the present invention is designed to provide a “ universal fit ” regardless of style and structural peculiarities of these various models . in addition , the present inventive seat cover can be used for three - point harness seats , safety seats anchored to grocery shopping carts , and specialized safety seats for the physically challenged . although the seat structures may vary from model to model and between manufacturers , the vehicle safety seat 62 is believed to be illustrative of the majority of such structures . this “ generic ” seat will be utilized hereinafter to generally illustrate the manner by which child seat cover is securely received by and covers such safety seats . a seat area 82 and a back support surface 84 are located between side wings 86 , forming a protective , padded area for the child . an outer perimeter 88 extends about the vehicle safety seat 62 , separating the seat front from the seat back . in fig3 the child seat cover 10 is shown secured upon the vehicle safety seat 62 ( shown in phantom ); with the cover material 14 extending beyond the outer perimeter 88 thereof ( also see fig4 in this regard ). the first and second lateral wing panels 46 , 48 each extend from a back panel seam of attachment 92 a , 92 b to a seat panel seam of attachment 94 a , 94 b . this manner of attachment permits the various harness belts to extend from the vehicle safety seat 62 yet have the cover material 14 extend over and protect the entire front surface thereof . to assist in this regard , an elastic cord 98 is utilized along the outer seam of the cover material 14 , as is best shown in fig5 . the cover material 14 is also shown as consisting of a three - ply construction , a top layer 104 that may consist of a twill or decorative fabric , a middle layer 106 of armofleece , which adds body and structure without making it stiff , and an inner layer 108 of a polyester material . as mentioned previously , the cover material 14 can consist of multiple layers , including a material providing flame retardant properties , or a single layer without departing from the scope of the present invention . the cover material 14 can also consist of a disposable construction , permitting a user to discard instead of washing when the child seat cover 10 becomes soiled . additionally , although the elastic cord 98 is utilized in a presently preferred embodiment , a drawstring or similar structure can also be used , permitting the periphery of the cover material 14 to be drawn around the outer perimeter 88 helping to secure the child seat cover 10 to the vehicle safety seat 62 . the manner of installing the child seat cover 10 after securely anchoring the vehicle safety seat 62 is depicted in sequential fig6 - 9 . in fig6 the child seat cover 10 is placed over / on top of the vehicle safety seat 62 with the back panel placed over the headrest part of the vehicle safety seat 62 . the common buckle 64 and attached crotch strap 66 are pulled up and through the buckle notch 56 . turning now to fig7 , the first lateral wing panel 46 is next placed under and through the first shoulder strap 68 . the first lateral wing panel 46 is then stretched in the direction of arrow a to overlap and engage with the back panel 26 , utilizing the hook and loop fasteners 52 a , 52 b , forming the back panel seam of attachment 92 a ( see fig8 and 9 ). in a similar manner , the first lateral wing panel 46 is stretched in the direction of arrow b to overlap and engage with the seat panel 42 , forming the seat panel seam of attachment 94 a ( fig8 and 9 ). in fig8 the second lateral wing panel 48 is being drawn under and through the second shoulder strap 72 , with a portion drawn up in the direction of arrow c to overlap and engage with the back panel 26 , forming the second back panel seam of attachment 92 b . another portion of the second lateral wing panel 48 is drawn in the direction of arrow d , to a location of overlap and engagement with the seat panel 42 , forming the second seat panel seam of attachment 94 b . the seat panel 42 is then smoothed to complete its positioning within the seat area 82 . the elastic periphery of the cover material 14 is drawn around the outer perimeter 88 of the vehicle safety seat 62 , completing the installation of the child seat cover 10 . removal of the child seat cover 10 is substantially the reverse of the preceding steps . the child seat cover 10 of the present invention is preferably fabricated out of the three separate materials : the top layer 104 consisting of a twill or decorative fabric ; the middle layer 106 of armofleece ; and the inner layer 108 , a polyester . each of the above materials is cut from a respective supply roll of fabric to measure 1½ yards ( 56 inches ) by 1¼ yards ( 45 inches ). the plies of fabric are placed in the following order as the cover is sewn “ inside out ”: armofleece ; inner layer ; and top layer . the left , top , and right sides are sewn together at 1 inch and 2 inches from the edge of the plies , creating a chamber within the layers to receive the elastic cord or drawstring . the fabric is then repositioned , inside in , with fabric now in the appropriate order . the dorsal and ventral slits are now cut into the 3 plies , with a hem sewn 1½ inches from the edge of the slits . the hook and loop fasteners are now attached , preferably the loop pieces to the top , cotton layer and the hook pieces to the inner , polyester layer , adjacent to the slits to form the fastening pairs . an imaginary crease of the seat is approximately located 22 inches from the bottom edge of the fabric plies , and a 3¼ inch long buckle notch is cut through all layers approximately 14½ inches from the bottom edge of the fabric . a reinforcing seam is stitched around the buckle notch . the elastic cords or drawstrings are then placed within each chamber and sewn in , after first ensuring that the fabric is sufficiently “ bunched ” to secure the cover when received by the vehicle safety seat . my invention has been disclosed in terms of a preferred embodiment thereof , which provides a child seat cover that is of great novelty and utility . various changes , modifications , and alterations in the teachings of the present invention may be contemplated by those skilled in the art without departing from the intended spirit and scope thereof . it is intended that the present invention encompass such changes and modifications . | 1 |
hereinbelow , the embodiments in accordance with the present invention will be described based on the drawings . [ 0063 ] fig1 a and 1b show one embodiment of a resonant element 1 in accordance with the present invention , together with a vibration adjustment system for characterizing the resonant element . in the descriptions of this embodiment , the same components as the above described examples of previous resonant elements are identified by the same reference numerals , and repeated explanations of the common components are omitted . the resonant element 1 shown in fig1 a and 1b can be used as an acceleration sensor , angular velocity sensor , pressure sensor , filter , or the like . the resonant element 1 has substantially the same construction as the proposed resonant element shown in fig6 but this embodiment is characterized in that a detecting electrode 40 which is an excitation deflection detecting means is disposed on the top surface 2 a of the fixed substrate 2 so as to be opposed to and spaced from the vibrator 5 . since the vibrator 5 is formed of polysilicon and has electric conductivity , it is possible , by forming the above - mentioned detecting electrode 40 , to detect , by the detecting electrode 40 , variation in the spacing between the top surface 2 a of the fixed substrate 2 and the vibrator 5 , that is , the vibration ( deflection ) of the vibrator 5 in the z - direction , as a variation in the electrostatic capacity , when the resonant element 1 is used as an angular velocity sensor , for example , the detecting electrode 40 similar to the above - described one , is formed on the top surface 2 a of the fixed substrate 2 as z - direction vibration detecting means , in order to detect the vibration amplitude of the vibrator 5 in the z - direction due to a coriolis force . in such a case , the z - direction vibration detecting means ( detecting electrode 40 ) also serves as excitation deflection detecting means . the characteristic vibration adjusting system in this embodiment shown in fig1 is arranged to perform a vibration adjustment with respect to the resonant element 1 having the above - described excitation deflection detecting means ( detecting electrode 40 ), and comprises a first dc voltage applying means 41 , a second dc voltage applying means 42 , capacity - voltage converting means 43 , an amplifier 44 , and driving means 45 . the first and second dc voltage applying means 41 and 42 are conductively connected to conductive layers 20 and 21 , respectively , and have a capability of applying dc voltages to the respective conductive layers 20 and 21 and of changing the magnitude of the dc voltages to be applied . the capacity - voltage converting means 43 comprises fet 46 and a source resistor 47 . as shown in fig1 the gate - side of the fet 46 is conductively connected to the detecting electrode 40 , one end side of the source resistor 47 is connected to the source - side of the fet 46 , and the other end side of the source resistor 47 is grounded . in the capacity - voltage converting means 43 , the voltage corresponding to the electrostatic capacity between the vibrator 5 and the detecting electrode 40 occurs at the connection point p between the source - side of the fet 46 and the source resistor 47 . in other words , the capacity - voltage converting means 43 converts the electrostatic capacity between the vibrator 5 and the detecting electrode 40 into a voltage and outputs the voltage from connection point p . the amplifier 44 is connected to the connection point p and amplifies and outputs the voltage corresponding to the electrostatic capacity between the vibrator 5 and the detecting electrode 40 . in the vibration adjusting system in this illustrated embodiment , since the capacity - voltage converting means 43 converts the electrostatic capacity detected by the detecting electrode 40 into a voltage , the vibration ( deflection ) of vibrator 5 in the z - direction can be detected as a voltage variation . the driving means 45 comprises an ac power source 48 and a phase inversion portion 49 . one of the fixed - side comb electrodes 11 a and 11 b of the resonant element 1 is conductively connected to the ac power source 48 directly , and the other is conductively connected to the ac power source 48 via the phase inversion portion 49 . by this driving means 45 , ac voltages which are different in phase from each other by 180 ° are applied respectively to the fixed - side comb electrodes 11 a and 11 b of the resonant element 1 , and thereby the vibrator 5 can be subjected to an excitation in the x - direction . a vibration adjusting method for the resonant element 1 may include , for example , conductively connecting an oscilloscope ( not shown ) to the output - side of the amplifier 44 and then subjecting the vibrator 5 to an excitation vibration in the x - direction , while viewing the waveform of the voltage output by the amplifier 44 is viewed on the screen of the oscilloscope . in some cases , even though no angular velocity around the y - axis is applied during the excitation vibration of the vibrator 5 , a voltage waveform as indicated by a solid line a in fig2 is viewed with the oscilloscope , the voltage waveform varying in response to the excitation vibration of the vibrator 5 in the x - direction . in such a case , since deflection in the z - direction arises during the excitation vibration of the vibrator 5 , a vibration adjustment for the vibrator 5 is performed . for example , while viewing the voltage waveforms shown up on the screen of the oscilloscope , the dc voltages to be each applied to the conductive layers 20 and 21 are varied by controlling the first dc voltage applying means 41 or the second dc voltage applying means 42 . the applied voltages for the conductive layers 20 and 21 at the time when the voltage waveform on the screen of the oscilloscope becomes a waveform wherein substantially no vibration amplitude can be seen and wherein the voltage converges into a given voltage , as indicated by the dotted line b in fig2 i . e ., at the time when the variation in the detected electrostatic capacity by the detecting electrode 40 disappears , or is substantially removed , is detected as the voltage optimum for the vibration adjustment for the vibrator 5 . for example , when a voltage waveform indicated by the solid line a in fig2 is viewed on the screen of the oscilloscope , for example , in the state wherein the conductive layer 20 of the resonant element 1 is maintained at a given voltage ( 0 volt for example ), the applied voltage for the conductive layer 21 is varied by variably controlling the second voltage applying means 42 while viewing the voltage waveform on the screen of the oscilloscope . the voltage at the time when the voltage waveform on the screen of the oscilloscope converges into a waveform wherein substantially no vibration amplitude can be seen , as indicated by the dotted line b in fig2 is detected as the optimum voltage for the conductive layer 21 . this detected optimum voltage for the conductive layer 21 , and the fixed voltage ( 0 volt for example ) of the above - described conductive layer 20 are detected as the voltages optimum for the vibrator 5 . conversely , of course , the applied voltage for the conductive layer 20 may be varied in the state wherein the conductive layer 21 is maintained at a given voltage ( 0 volt for example ), and the voltage at the time when the voltage waveform on the screen of the oscilloscope converges into a vibration amplitude wherein substantially no vibration amplitude can be seen , as indicated by the dotted line b in fig2 may be detected as the optimum voltage for the conductive layer 20 , whereby the voltage optimum for the vibration adjustment for the vibrator 5 is detected . or , the voltage optimum for the vibration adjustment for the vibrator 5 may be detected by individually varying the applied voltages for the conductive layers 20 and 21 and thereby obtaining the optimum voltages to the conductive layers 20 and 21 . as described above , by performing the vibration adjustment for the vibrator 5 through controlling the applied voltage to the conductive layers 20 and 21 , the vibrator 5 can be caused to be subjected to an ideal excitation vibration substantially without deflection in the z - direction . the above - described effect has been verified in experiments by the present inventor . in these experiments , the present inventor has built the resonant element 1 having a characteristic construction in this embodiment into the vibration adjusting system shown in fig1 and in the state wherein the conductive layer 20 is fixed at a given voltage ( 0 volt for example ), the inventor has investigated as to how the voltage waveform output by the connection point p of the above - described capacity - voltage converting means varies as the applied voltage v 21 to the above - described conductive layer 21 is varied . [ 0080 ] fig3 is a graph illustrating the experimental results . in fig3 the horizontal axis designates the applied voltage to the conductive layer 21 , and the vertical axis designates the amplitude of the voltage waveform output by the connecting point p of the capacity - voltage converting means 43 . in the above - described experiments , the detecting electrode 40 has dimensions of 0 . 5 × 0 . 5 mm , and the interval between the detecting electrode 40 and the vibrator 5 is 2 mm . the vibrator 5 is caused to be subjected to an excitation vibration in the x - direction under the frequency of 7 . 623 khz . as shown in fig3 as the applied voltage v 21 to the above - described conductive layer 21 is varied , the amplitude of the voltage waveform output by the connection point p of the capacity - voltage converting means 43 varies , and the amplitude of the voltage waveform at the connection point p is minimized at the point q ( at this point , the applied voltage v 21 is 9 . 34 v ). in accordance with the investigated movement of the vibrator 5 in the x - z plane , the vibrator 5 exhibited loci as shown in fig8 b . that is , as illustrated in fig1 c , the vibrator 5 was being subjected to an excitation vibration horizontally in the x - direction along the plane of the fixed substrate in the x - y plane direction , and substantially without deflection in the z - direction . as shown in these experimental results , by performing the vibration adjustment for the vibrator 5 so that the variation in the detected electrostatic capacity by the detecting electrode 40 is canceled , the vibrator 5 can be caused to be subjected to an excitation in the x - direction . [ 0083 ] fig4 shows one example of a main circuit configuration of the sensor device 50 into which a resonant element 1 as an angular velocity sensor has been built . in the sensor device 50 , the vibrator 5 is caused to be subjected to an excitation vibration in the x - direction by applying ac voltages which are different in the phase from each other by 180 ° to the fixed - side comb electrodes 11 a and 11 b , respectively , of the resonant element 1 by driving means 45 . at the same time , a coriolis force is applied to the vibrator 5 due to the angular velocity around the y - axis . variation in the electrostatic capacity with respect to the vibrator 5 resulting from vibration of the vibrator 5 in the z - direction is output by the detecting electrode 40 , and the electrostatic capacity is converted into a voltage by the capacity - voltage converter 43 . the voltage after the conversion is amplified by the amplifier 44 , and is applied to a phase detection portion 53 via a bpf ( band - pass filter ) 51 and a phase shifter 52 . the phase detection portion 53 takes in the ac voltage output by an ac power source 48 as a reference signal , and performs a phase detection with respect to the voltage applied by the phase shifter portion 52 utilizing the reference signal . the signal obtained by this phase detection is output as a detecting signal for angular velocity around the y - axis via a lpf ( low - pass filter ) and the amplifier 55 . as shown in fig4 the angular velocity sensor 50 has the first and second ac voltage applying means 41 and 42 , the capacity - voltage converting means 43 , the amplifier 44 , and the driving means 50 which constitute the vibration adjusting system shown in fig1 . therefore , when performing a vibration adjustment for the resonant element 1 as an angular velocity sensor , it is possible , after building the resonant element 1 into the sensor device 50 , to utilize , for vibration adjustment , the above - described first and second ac voltage applying means 41 and 42 , the capacity - voltage converting means 43 , the amplifier 44 , and the driving means 50 to perform a vibration adjustment for the resonant element 1 . in accordance with this embodiment , since the resonant element 1 is constituted so as to have a detecting electrode 40 , and to detect the deflection of the vibrator 5 in the z - direction by this detecting electrode utilizing the variation in the electrostatic capacity , the vibration adjustment can be performed by the simple vibration adjusting system shown in fig1 without the need to use a large - scale vibration measuring system , such as the system shown in fig7 . since the vibration adjustment for the vibrator 5 can be easily performed , the time required for the vibration adjustment for the vibrator 5 can be reduced , and the adjustment cost can be reduced . also , since this embodiment is constituted so that the deflection of the vibrator 5 in the z - direction is detected utilizing the variation of the electrostatic capacity , the deflection of the vibrator 5 in the z - direction can be detected with a much higher accuracy than the case where the deflection of the vibrator 5 in the z - direction is detected utilizing laser rays as described above . this results in an improvement in the accuracy of the vibration adjustment for the vibrator 5 . furthermore , in addition to having a simple construction , the characteristic vibration adjusting system in this embodiment has features , as described above , such as to detect the deflection of the vibrator 5 in the z - direction utilizing the variation in the electrostatic capacity , to convert the electrostatic capacity into a voltage , and to detect the variation in the electrostatic capacity based on the variation in the voltage . therefore , the automation of the vibration adjustment wherein the optimum value of the applied voltages for the above - described conductive layers 20 and 21 are obtained utilizing the variation in the voltage in response to the deflection of the vibrator 5 in the z - direction , can be easily achieved . moreover , in the case of an angular velocity sensor , since there is provided z - direction vibration detecting means ( detecting electrode 40 ) for detecting the vibration of the vibrator 5 in the z - direction due to a coriolis force , the z - direction vibration detecting means can be caused to do double duty as excitation deflection detecting means for vibration adjustment . thereby , the vibration adjustment can be performed easily and with a high accuracy as describe above without the need to change the design . in addition , since the units constituting the vibration adjusting system shown in fig1 are incorporated in the sensor device 50 into which the resonant element 1 as an angular velocity sensor is to be built , the vibration adjustment of the angular velocity sensor can be performed in the state wherein the angular velocity sensor has been built into the sensor device 50 . this make it possible to prevent the occurrence of the problem that , even though vibration adjustment has been performed , the stresses within the support beams 7 of the vibrator 5 change when the resonant element 1 is built into the sensor device 50 , and the optimum applied voltages to the conductive layers 20 and 21 change with the result that the vibrator 5 of the angular velocity sensor cannot be appropriately caused to be subjected to an excitation vibration without deflection in the z - direction . the present invention is not limited to the above - described embodiment , but various embodiments may be adopted . for example , in the above - described embodiment , the detecting electrode 40 is disposed on the fixed substrate 2 , but , for example , when there is a cover member covering the upper side of the vibrator 5 with an interval interposed , the detecting electrode 40 may be disposed at the area opposed to the vibrator 5 on the cover member . or , the detecting electrodes 40 may be provided on both of the fixed substrate 2 and the cover member . the same goes for the conductive layers 20 and 21 . that is , the conductive layers 20 and 21 may be provided not only on the fixed substrate 2 , but also on the above - mentioned cover member , or may be provided on both of the fixed substrate 2 and the cover member . also , the detecting electrode 40 is disposed so as to be opposed to the central area of the vibrator 5 with a gap interposed . however , the detecting electrodes 40 may be , for example , disposed so as to be opposed to both edge areas of the vibrator 5 with a gap in the x - direction therebetween . also , the configuration of the resonant element 1 is not limited to that of the embodiment illustrated . the present invention can be applied to resonant elements 1 having various configurations . for example , the present invention can be applied to the resonant element 1 as shown in fig5 a and 5b . in fig5 a and 5b , a cavity ( depression ) 57 is formed in the top surface 2 a which is a plane in the x - y plane direction of the fixed substrate 2 which is made of glass . the bottom surface 57 a ofthis cavity 57 , like the top surface 2 a , forms a plane in the x - y plane and a planar vibrating body 6 is disposed so as to be opposed to the bottom surface 57 a with a gap interposed in the z - direction . the planar vibrating body 6 shown in fig5 a and 5b is a combined body wherein a weight 9 is connected to the inside of a frame body 60 by four connection beams ( detecting beams ) 61 . the weight 9 has a square shape , and each of the connection beams has a l - letter shape . the tips of the shorter sides 62 of the l - letter shaped connection beams 61 each communicates with and are connected to the four corners of the weight 9 . the longer sides 63 of the l - shaped connection beams 61 are each extended from the shorter sides 62 along the sides of the frame body 60 via a gap , and the tips of the extension portions thereof each communicates with and are connected to the comers of the frame body 60 . a plurality of fixing portions 8 ( four fixing portions in the figure ) is each fixedly disposed on the fixed substrate 2 with gaps therebetween so as to surround the planar vibrating body 6 , and the planar vibrating body 6 is fixedly supported by hooked - claw shaped support beams ( driving beams ) 7 so as to be vibratable in the x - direction . on both right and left sides ( as viewed in fig5 a ) of the planar vibrating body 6 , movable - side comb electrodes 10 ( 10 a and 10 b ) are formed outwardly in the x - direction , and fixed - side comb electrodes 11 ( 11 a and 11 b ) are each extended from the fixing portion 64 so as to be interdigitated with the above - mentioned movable - side comb electrodes 10 with a gap interposed . these movable - side comb electrodes 10 and fixed - side comb electrodes 11 make up exciting means . the resonant element 1 of fig5 a and 5b , similarly to the embodiment shown in fig1 is provided with conductive layers 20 and 21 , and detecting electrode 40 which is excitation deflection detecting means for detecting the deflection of the weight 9 ( planar vibrating body 6 ) in the z - direction . by performing vibration adjustment in the same manner as vibration adjustment is performed for the embodiment of fig1 the weight 9 ( planar vibrating body 6 ) can be caused to be subjected to an ideal excitation vibration . as explained above , in accordance with the present invention , since the resonant element 1 is provided with excitation deflection inhibiting means , as well as the resonant with excitation deflection detecting means , the deflection of the vibrating body in the z - direction during the excitation vibration thereof in the x - direction can be detected , and the deflection of the vibrating body in the z - direction can be inhibited by the above - described excitation deflection inhibiting means , without the need for large - scale equipment for measuring the vibrating conditions of the vibrating body . thereby , the vibrating body can be caused to be subjected to an ideal excitation vibration in the x - direction without deflection in the z - direction , and hence it is easy to improve characteristics of the resonant element . in the resonant element constituting an angular velocity sensor , since it is possible to make the z - direction vibration detecting means do double - duty as excitation vibration deflection detecting means , a resonant element having superior characteristics can be provided without a large change in design . in the excitation vibration deflection detecting means constituted of detecting means for the variation in the electrostatic capacity with respect to the vibrating body in response to the vibration thereof in the z - direction , since the deflection of the vibrating body in the z - direction can be detected with a high accuracy by a very simple construction , it is possible to inhibit more surely the deflection of the vibrating body in the z - direction during the excitation vibration thereof in the x - direction , which provides a resonant element having more excellent characteristics . the invention is applicable to a vibrating body which is a planar vibrating body disposed so as to be opposed to the plane in the x - y plane direction and supported by a fixed substrate so as to be vibratable in the x - direction . more specifically , since the deflection of the vibrating body in the z - direction during the excitation vibration thereof in the x - direction has a significant adverse effect on characteristics of the resonant element , it is very effective to provide the above - described constructions characterizing the present invention . in accordance with the present invention , it is possible to perform a vibration adjustment for the vibrating body without the need for large - scale equipment , thereby reducing adjustment cost . further , in accordance with the present invention , it is possible to further increase the accuracy of vibration adjustment for the vibrating body , and to easily perform a vibration adjustment for the vibrating body , which leads to a reduction in the time required for the vibration adjustment for the vibrating body . in the resonant element in accordance with the present invention wherein the resonant element constitutes an angular velocity sensor , and wherein the z - direction vibration detecting means and the capacity - voltage converting means incorporated in the sensor device into which the angular velocity is to be built , also serve a function of vibration adjustment , since the vibration adjustment for the vibrator can be performed in the state wherein the vibrator has been built in the sensor device , it is possible to prevent the occurrence of the problem that the deflecting state of the vibrating body in the z - direction after assembly becomes different from that at the time of vibration adjustment , and that the deflection of the vibrating body in the z - direction during the excitation vibration thereof in the x - direction occurs despite the performed vibration adjustment . while preferred embodiments of the invention have been disclosed , various modes of carrying out the principles disclosed herein are contemplated as being within the scope of the following claims . therefore , it is understood that the scope of the invention is not to be limited except as otherwise set forth in the claims . | 6 |
referring to the drawing , the reference numeral 10 refers in general to a fluidized bed combuster of the present invention consisting of a front wall 12 , a rear wall 14 , and two sidewalls , one of which is shown by the reference numeral 16 . the upper portion of the combustor 10 is not shown for the convenience of presentation , it being understood that it consists of a convection section , a roof and an outlet for allowing the combustion gases to discharge , in a conventional manner . a bed of particulate material , shown in general by the reference numeral 18 , is disposed within the combustor 10 and rests on a perforated grate 20 extending horizontally in the lower portion of the boiler . the bed 18 can consist of a mixture of discrete particles of inert material and fuel material such as bituminous coal . an air plenum chamber 22 is provided immediately below the grate 20 and an air inlet 24 is provided through the rear wall 14 in communication with the chamber 22 for distributing air from an external source ( not shown ) to the chamber . a pair of air dampers 26 are provided in the inlet 24 for controlling the flow of air into the chamber 22 . the dampers 26 are suitably mounted in the inlet 24 for pivotal movement about their centers in response to actuation of external controls ( not shown ) to vary the effective openings in the inlet and thus control the flow of air through the inlet and into the chamber 22 . since the dampers 26 are of a conventional design they will not be described in any further detail . a bed light - off burner 28 is mounted through the front wall 12 immediately above the grate 20 for initially lighting off the bed 18 during startup and a bed tap , or drain pipe 29 extends from a corresponding opening formed in the grate 20 to a position below the chamber 22 for discharging the spent materials from the bed 18 . a separator , shown in general by the reference numeral 30 , is located externally of the boiler 10 and is adapted to receive particulate fuel material , such as coal , of a relative large particle size range from an external source ( not shown ), such as coal crusher , via a duct 32 . the separator 30 adapted to separate the fuel material in a conventional manner , such as by the use of a screen or screens , into relatively coarse and relatively fine particles . the relatively coarse particles are passed from the separator 30 via a duct 34 and the relatively fine particles are passed from the separator via a duct 36 . as an example , the separator 30 can be adapted to separate particles greater than 1 / 16 of an inch in diameter from those less than 1 / 16 of an inch and pass the former to the duct 34 and the latter to the duct 36 . an agglomerator , shown in general by the reference numeral 38 , receives the fine particles from the duct 36 and is designed to agglomerate the particles into coarser particles by any conventional technique . for example , if the particles contain any moisture , they can be agglomerated by pelletizing in a disc pelletizer , such as the series 7000 pellet mill manufactured by the california pellet mill co . alternatively , if the fine particles are relatively dry they can be agglomerated on a roll briquetter or an extruder of a conventional type . a duct 39 connects the output of the agglomerator 38 to a distributor , shown in general by the reference numeral 40 , which also receives the coarse particles from the duct 34 . the distributor 40 is mounted relative to the upper portion of the front wall 12 and operates to distribute the mixture of course particles from the duct 34 and the agglomerated particles from the duct 39 onto selected areas across the upper surface of the bed 18 . the distributor 40 includes an inlet pipe 42 for receiving the coarse coal particles from the duct 34 and the agglomerated material from the duct 39 where they are mixed and fed , by gravity , onto a distributor tray 44 which extends immediately below the outlet end of the pipe 42 and into the interior of the combustor 10 . the tray 44 is pivotally mounted relative to an actuating lever 46 for controlling the angular position of the tray relative to the upper surface of the bed as shown , for example , by the one position represented by the solid lines and the two positions represented by the dashed lines . a control unit for the lever 46 is shown in general by the reference numeral 48 and operates in a conventional manner to control the pivotal movement of the tray 44 . the distributor 40 also includes an air distributor unit , shown in general by the reference numeral 50 , for distributing pressurized air at a selected rate through a plurality of vanes , one of which is shown by the reference numeral 52 , located immediately above the tray 44 , to inject the air across the coal particles on the tray . as a result , the coal particles are distributed to selected areas extending across the upper surface of the bed 18 which are determined by the position of the tray 44 under the control of the lever 46 and the unit 48 . for example , in the uppermost position of the free end of the tray 44 as viewed in the drawing , the particles falling onto the tray from the pipe 42 would be propelled by the air from the unit 50 towards the rear wall 14 , and would fall onto the rear portion ( i . e ., the right hand portion as viewed in the drawings ) of the upper surface of the bed 18 . similarly , in the lowermost position of the tray 44 as shown in the drawings , the particles would be distributed onto the front portion ( i . e ., the left hand portion as viewed in the drawing ) of the upper surface of the bed 18 . since the tray 44 can be pivoted to an infinite number of angular positions relative to the upper surface of the bed 18 under control of the lever 46 and the control unit 48 , it can be appreciated that an accurate control of the precise location of the particulate feed across the upper surface of the bed can be achieved . in operation , the bed 18 is started up by opening the dampers 26 associated with the air inlet 24 to distribute air upwardly through the compartment 22 , through the perforations in the grate 20 and into the bed 18 . this loosens the particulate material in the bed 18 and reduces material packing and bridging . the separator 30 and the agglomerator 38 are activated , and operate as discussed above , to feed coarse and agglomerated particulate fuel material , via the ducts 34 and 39 , respectively , to the inlet pipe 42 . the light - off burner 28 is then fired to heat the material in the bed 18 until the temperature of the material reaches a predetermined level , at which time the distributor 40 is activated to distribute the mixture of coarse and agglomerated particulate fuel from the inlet pipe 42 onto selected areas extending across the upper surface of the bed 18 as determined by the position of the tray 44 , to insure a uniform distribution across the upper surface . after the bed 18 has been fluidized and has reached a predetermined elevated temperature , the light - off burner 28 is turned off while the distributor 40 continues to distribute the particulate fuel across the upper surface of the bed 18 in accordance with predetermined feed rates . it is understood that if the combustor is used for the purpose of steam generation , a pluraity of heat exchange tubes carrying the fluid to be heated , such as water , may be routed through the interior of the combustor in a conventional manner , with these tubes being omitted in the drawing for the convenience of presentation . in the event that the combustor is used for other purposes , such as gasification , or the like , the water walls and tubes may be omitted and conventional refractory construction used to contain the fluid bed can be added . a latitude of modification , change and substitution is intended in the foregoing disclosure and in some instances some features of the invention will be employed without a corresponding use of other features . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the spirit and scope of the invention herein . | 5 |
reference is first made to fig1 of the drawings , which illustrates an sst in accordance with one embodiment of the present invention in the form of an atm 10 . in this example , the atm 10 includes many of the features of a conventional atm , namely an interface means in the form of a user panel 12 including a card reader slot 14 ( which is shown having means for identifying the user in the form of an identification card 15 partially inserted therein ), a key pad 16 for entering the user &# 39 ; s personal identification number ( pin ) and transaction details , a cash dispenser slot 18 through which bank notes are dispensed to a user , a display screen 20 for providing information to the user , additional keys 21 disposed at opposite sides of the screen 20 for enabling the user to select preset functions displayed on the screen 20 and aligned with the additional keys 21 , and a receipt printer slot 22 through which a receipt for a transaction may be delivered to a user at the end of a transaction . in addition , the atm 10 of the present invention includes a loudspeaker 30 and a microphone 32 , which allow the atm 10 and the user to communicate primarily or solely using natural speech , as described below . reference is now also made to fig2 of the drawings , which is a block diagram of the atm 10 of fig1 . fig2 shows a user interface module block 40 including the loudspeaker 30 , a speech generation module 31 , the microphone 32 and a speech processing and recognition module 33 . the block 40 also includes the other elements found in a conventional atm user interface , that is a card reader module 42 , the key pad 16 , the display 20 , and a receipt printer module 44 . the card reader module 42 and the receipt printer module 44 are associated with the respective slots 14 and 22 of the user panel 12 of the atm 10 . fig2 also shows a cash dispenser module 46 which is associated with the cash dispenser slot 18 . the atm 10 further comprises processor means in the form of a controller unit 50 which communicates with components of the user interface module block 40 , with an operator panel 52 mounted inside of the atm 10 , and with the cash dispenser module 46 . the operator panel 52 contains circuitry for enabling an authorized operator to interact with the atm 10 . standard operator panels 52 are used on a commercially available atms and are well known in the art . similarly , the cash dispenser module 46 will not be described herein as it is a standard feature of a conventional atm . the controller unit 50 includes a processor unit 54 and a non - volatile memory 56 . the processor unit 54 and memory 56 may be implemented by a micro - computer having non - volatile ram ; suitable computers and memories are readily available commercially . in use , the user inserts their card 15 into the card reader slot , and identification data encoded on the card ( typically in a magnetic strip located on one side of the card ) is read by the card reader module 42 . by doing this the user is claiming an identity . for using this example of an atm 10 , the user will have previously identified a preference for the manner in which the user communicates with atms 10 : in the conventional manner via the screen display 20 and the keypad 16 and keys 21 ; or , where available , by natural speech via the loudspeaker 30 and microphone 32 . in the latter case , the user is requested , by appropriate actuation of the speech generation module 31 and loudspeaker 30 , to state their identification number ( pin ) or a code word to verify the claimed identity , that is to verify that the person in possession of the card 15 is the authorized card owner . the user then speaks into the microphone 32 , the speech recognition module 33 processing the speech sounds . if the user &# 39 ; s identity is verified by recitation of the correct pin or code word , the user is permitted to access the facilities provided by the atm 10 and a menu of the various transactions available to the user is described via the loudspeaker 30 : the speech generation module 31 may be controlled to run through a sequence of options and to prompt a particular response if a particular option is to be selected , for example : atm : “ if you wish to withdraw cash , please say “ one ” into the microphone ; or if you wish to hear your account balance ; please say “ two ”.” this “ conversation ” continues until the transaction has been completed , or is interrupted . it will be apparent to those of skill in the art that the atm 10 described above may be utilized without difficulty by users with reading difficulties and users who are visually impaired . further , it is anticipated that many other users would prefer to converse with a terminal , particularly as the voice generation module 31 may be configured to issue instructions in a particular voice , accent or dialect : for example , the atm 10 may converse with a user with a woman &# 39 ; s voice , with a local accent and in local dialect . other users may choose other voices , or the voice may be selected by the atm operator : a user whose account is overdrawn may be advised , in a stern male voice , to immediately contact the relevant financial institution . also , the voice may be varied during a transaction , for example one voice may be used to issue instructions and prompts , and another voice used to describe other services not related to the transaction in progress . similarly , the speech recognition module 33 may be configured to expect instructions and prompts from the user in different voices , accents and dialects . users may be reluctant to converse with a terminal within earshot of others , particularly where security sensitive information , such as a pin or code word , is being relayed to the terminal . accordingly , terminals in accordance with the invention may be enclosed , partially enclosed , or otherwise arranged to minimize the possibility of the conversation between the terminal and the user from being overheard by third parties . alternatively , or in addition , the terminal may be provided with sensors 58 for determining the location of the user , and directional loudspeakers and microphones , such that the speech volume may be kept at a relatively low level , and to assist in eliminating background noise . to obviate the requirement for the user to state an identification number ( pin ) or the like , terminals in accordance with the invention may utilize biometric sensing means for identifying or verifying the identity of the user . such biometric sensing means are known and may use one or more of a variety of biometric patterns , including iris patterns , fingerprints , palm prints , voice patterns , finger geometry , or other physical traits or characteristics . the embodiment described above incorporates many of the features of a conventional atm , however it is of course possible to provide a terminal in accordance with the invention which may omit , for example , the keypad 16 , display screen 20 and keys 21 , with a corresponding saving in costs , and providing greater flexibility in the design and configuration of the terminal . in other embodiments , the sst may take a different form from that illustrated and described , for example a kiosk for issuing flight tickets . | 6 |
the process of the invention allows active ingredients ( solid or liquid on solid carrier ) to be formed into extrudates with a small quantity of a dissolvable , polymeric lubricant / binder , an amount of solvent that is sufficient to dissolve at least some of the polymeric lubricant / binder , and an optional anti - caking agent . the high lubricity of the dissolved polymeric component reduces frictional forces ( interparticle friction and friction at the edge of the die orifice ) that would conventionally produce heat and expose the active ingredient to detrimentally high temperatures . the high lubricity of the dissolved polymeric component of the present invention allows the solids in the extruder mixture to slide past one another more easily and thereby reduce frictional heating without reducing the desirable compaction effects of an extruder . frequently , the lubricity of the dissolved polymeric component is sufficient to allow extrusion without the need for temperature control or coolant introduction systems at the extrusion die . if desired , the extruded form can be cut to length and used without further processing or shaped into granules . unless otherwise noted , all percentages are by weight and are based on total weight . the active ingredients that can be granulated in accordance with the invention can be selected from a wide variety of materials . preferably , the active ingredients are solid particulates or liquids that are carried by inert or additionally active solid particulates . those active ingredients that are sensitive to heat are well suited for extrusion according to the present invention . exemplary active ingredients are useful as pharmaceutical drugs , biologic agents ( beneficial bacteria , inert viruses , and the like ), and agrochemicals ( agriculturally effective active ingredients with activity as herbicides , plant growth regulators , insecticides , fungicides , and essential plant minerals ), detergents , and similar chemical compounds or formulations . agrochemicals are particularly well suited for granulation according to the present invention . herbicides that can be extruded according to the invention include the triazines ( e . g ., atrazine ), the ureas , glyphosate , sulfosate , glyfosinate , and sethoxydim . plant growth regulators that can be extruded include plant growth hormones such as at least one of the 84 identified gibberillins with ca 3 , ga 4 , ga 5 , ca 7 and ga 9 being preferred ; cytokinins ( e . g ., zeatin , kinetin , benzyladenine , dihydrozeatin , and isopentenyl adenine ); auxins ( e . g ., indolacetic acid ( iaa ), indolebutyric acid ( iba ), and naphthalenacetic acid ( naa )); sodium ortho - nitrophenolate ; sodium para - nitrophenolate ; sodium 5 - nitro - guaicolate ; and polyhydroxycarboxylic acids of 2 , 4 , 5 , and 6 carbon structures ; ethephon ; chlormequat chloride ; mepiquat chloride ; and fertilizers . such plant growth regulators affect and alter plant metabolic processes to enhance or retard plant growth . insecticides that can be extruded according to the present invention include materials and biological agents that control a target insect population through lethal ingestion , sterilization , or other interference with the insect life cycle . exemplary insecticides include solid and liquid forms of the carbamates ( e . g ., carbaryl , aldicarb , methomyl , carbofuran , bendiocarb , oxamyl , thiodicarb , trimethylcarb ); organophosphates ( e . g ., phorate , terbufos , fonophos , isofenphos , ethoprop , fenamiphos , disulfoton , malathion , parathion , demeton , dimethoate , chlorpyrifos , diazinon , and phosmet ); compounds which break down the insect &# 39 ; s digestive tract tissue including fluorine compounds ( cryolite ), zinc , and mercury ; nicotine ; rotenone ; neem oil or azadiractin ; natural or synthetic pyrethrins ; petroleum oils ; the halogenated hydrocarbons ( e . g ., endrin , aldrin and its epoxide , dieldrin , heptachlor , ddt , bhc , lindane , chlordane , methoxychlor , ddd , tde , and the polychlorinated biphenyls ); and microbials ( e . g ., bacillus thuringiensis and entomopathic viruses such as insecticidal viruses such as the bacculo viruses ). fungicides that will benefit from the mixtures of the invention 1 include tridemorph , metalaxyl , iprodione , fosetyl - aluminum , thiophanate , benomyl , triadimefon , carboxin , oxycarboxin , carbendazim , thiabendazole , thiophanate , ethirimol , bupirimate , dimethirimol , captan , any of the ebdcs ( e . g ., mancozeb , maneb , niram , metiram , zineb , and ferbam ), chlorothalonil , iprodione , ziram , copper salts ( e . g ., copper sulfate and copper oxychloride ), and sulfur . the invention is particularly well suited for encapsulating captan in particles having 55 – 80 wt % captan therein . other systemic agents for plants that benefit from the present invention include , inter alia , aldicarb , carbofuran , dimethoate , phorate , and terbufos , and the phosphoroamido ( di ) thioates . the phosphoroamido ( di ) thioates that can be used in the invention include insecticidally active compounds having the general formula : r 1 and r 2 individually are an alkyl , alkenyl or alkynyl group containing up to 6 carbon atoms , r 5 is hydrogen , an alkyl group containing 1 to 18 carbon atoms , a cycloalkyl group containing 3 to 8 carbon atoms , an alkenyl group containing 2 to 18 carbon atoms or an alkynyl group containing 3 to 18 carbon atoms , r 4 is hydrogen or an alkyl group containing 1 to 6 carbon atoms , and y is oxygen or sulfur . acephate is a particularly preferred insecticide for use in the present invention . it is commercially available in a technical grade solid of at least 97 wt % purity and is used in granules of the present invention in an amount of at least 92 wt %, preferably at least 94 wt %, and most preferably in an amount of at least 95 wt % based on total weight of the dried granule . the acephate is preferably milled before granulation . details of the milling process are described in my copending application ser . no . 60 / 279 , 433 . essential plant minerals that can be encapsulated according to the invention include any of the minerals known to the art to effect plant growth in conventional amounts . some examples include elemental and soluble salt forms of boron , nitrates , calcium , potassium , phosphates , iron , magnesium , sulfur , manganese , molybdenum , zinc , and copper . the dissolvable polymers for use with the present invention are soluble in a solvent ( e . g ., water , dimethylsulfoxide , emulsions , alcohol - water azeotropes , or mixtures of these ), solid at ambient temperatures , inert toward the active ingredient , and provide lubricity to the extrusion mixture upon at least partial dissolution in the inert solvent . suitable dissolvable polymers for use in the present invention include one or more of the poly ( alkylene oxides ) ( e . g ., poly ( ethylene oxide ), poly ( propylene oxide ), and poly ( butylene oxide )) with poly ( ethylene oxide ) being particularly preferred . a particularly preferred lubricant / binder component for the present invention is poly ( ethylene oxide ) having an average molecular weight of less than about 50 , 000 . a preferred average molecular weight is within the range from about 15 , 000 to about 35 , 000 . such materials are dry , free - flowing powders , completely soluble in water and certain organic solvents , and have crystalline melting points within the range of 63 ° to 67 ° c . useful amounts of the polymeric lubricant / binder is generally within the range from about 0 . 1 – 5 wt %, preferably 0 . 2 – 3 wt %, and more preferably 0 . 25 – 2 wt % based on total weight of the composition . when used in an amount within the range of 0 . 2 – 0 . 75 wt %, an extrudable mixture is formed that can be readily extruded through a 3 mm opening with a temperature rise of no more than a 4 ° c ., and usually less than about 1 – 2 ° c . an anticaking agent can be added , if desired , in an amount sufficient to prevent clumping and caking of the dried extrudates . generally , anticaking agent is used in an amount within the range of 0 . 01 – 1 . 5 wt % is needed . silica powder in an amount within the range of 0 . 5 – 1 . 25 wt % is particularly useful . an amount of solvent is used that is sufficient to form an extrudable mixture of ingredients . generally , the solvent is used in an amount sufficient to dissolve the polymeric binder and form a lubricious liquid . this lubricious liquid mixture of solvent and dissolved polymer for the active ingredient and any additives used in the formulation . it is believed that the high lubricity of the dissolved polymer acts to reduce the interparticle friction forces and heat that are characteristic of prior extrusion processes . when the solvent is removed , the polymer acts as a structural binder that enhances the structural integrity of the extrudate . use of a polymer that is soluble in water can help to speed release of the active ingredients following application of the dried particles . preferably , the solvent is water , an alcohol - water azeotrope , organic solvents , e . g . : acetonitrile ; ethylene dichloride ; trichloroethylene ; methylene dichloride ; benzene ; dimethylformamide ; tetrahydrofuran ; alcohols that are liquid at temperatures within the range of 10 °– 100 ° c . such as methanol , isopropanol , and butanol ; ketones such as methyl ethyl ketone , toluene , xylene , acetone and methyl isobutyl ketone ; dimethylsulfoxide ( dmso ); mono - and dialkyl ethers of ethylene glycol and their derivatives sold under the name cellosolve ® by union carbide including derivative forms such as cellosolve ® acetate , dimethyl cellosolve ®, butyl cellosolve ®, and diethyl cellosolve ®; anisole ; 1 , 4 - dioxane ; ethyl acetate ; ethylenediamine ; mono - and dialkyl ethers of diethylene glycol and their derivatives sold under the name carbitol ® by union carbide , and butyl acetate ), or a mix of these in an amount of less than 5 wt % based on the total formulation weight . the preferred solvents for use with the preferred polymers , poly ( alkylene oxides ), are nonaqueous ( where the active ingredient is susceptible to hydrolysis ) and selected from the group consisting of dmso , alcohols liquid at 10 °– 100 ° c ., and alcohol - water azeotropic mixtures . the solvent for the polymeric binder can be used in an amount within the range of 0 . 5 – 4 wt % and more preferably within the range of 1 – 3 wt %. some adjustments up or down may be needed to accommodate ambient humidity within the extrusion facility , i . e ., high relative humidity may use added water solvent in the lower ranges ( e . g ., 0 . 25 – 2 wt %) while low relative humidity may find it beneficial to use relatively more added water ( e . g ., 2 – 5 wt %) to account for evaporation during manufacture . it is desirable , however , to use as little added solvent or water as possible . preferably , the polymeric lubricant / binder is dissolved in the solvent at a concentration within the range of 10 – 20 wt % polymeric solids and sprayed onto the surface of the active ingredient and other granule solids . spraying enhances distribution of the polymeric lubricant / binder onto the surface of the solids without incurring the energy costs needed to achieve an equivalent distribution with a mixer blade . in the manufacturing process , an extrudable mixture of active ingredient solids , polymeric lubricant / binder , optional anticaking agent , and a small amount of added solvent is passed through an extrusion die having a suitable diameter , e . g ., within the range from about 1 – 10 mm . the mixture is then extruded into granules . while the present invention reduces the frictional heat thru the die and extrusion can be performed at any desired temperature , the extrusion process is preferably performed at ambient temperatures ( e . g ., 15 ° to 25 ° c .). even more preferably , the extrusion is performed in the absence of controlled cooling or heating of the extrusion die and without the introduction of coolant liquid into the formulation . in the present invention , only so much solvent is added as is needed to render the polymeric component lubricious for the extrusion process and effective as a binder in the final granular product . the extrudate exiting from the extrusion die can be sliced or cut to length before entering a drier to remove excess solvent . suitable driers include convention ovens , fluidized beds , and the like . use of a fluidized bed operating at a temperature less than the melting point of the technical grade of active ingredient is particularly preferred . for example , acephate has a melting point within the range of 63 °– 67 ° c ., so operation of the drier at a temperature of less than 60 ° c . is preferred when granulating acephate . extrudates are often dried to a residual solvent content of less than 1 wt %, preferably to a residual solvent content within the range of 0 . 01 – 0 . 5 wt %, and even more preferably within the range from about 0 . 01 – 0 . 3 wt % based on total weight of the dried extrudate . usually , no more than about 2 – 5 minutes is required for adequate drying . if the extrusion solvent is water and the active ingredient in the granule is sensitive to water or subject to hydrolysis upon storage , it is desirable to dry the extrudate to a residual moisture content of 0 . 5 wt % or less . it may also be preferable to avoid the use of water altogether and employ a nonaqueous solvent for the polymeric binder to provide adequate lubricity in the extrusion process . | 1 |
fig1 shows an embodiment of the method for selecting the focus setting . the steps of the method comprise acquiring a first image with a first focus setting 100 , acquiring a second image with a second focus setting 102 , divide a first image into a first grid of macroblocks 104 , divide a second image into second grid of macroblocks 106 , determine the first zone in a first grid of macroblocks and determine a second zone in second grid of macroblocks 108 , calculate the macroblock shift 110 , calculate first value of figure - of - merit for the first image and calculate the second value of figure - of - merit for the second image 112 , and select the focus setting 114 . typical autofocus support hardware provides a low resolution grid of focus information . each grid location corresponds to a fixed area of the sensor and the stores accumulated focus data relevant to that location . the focus data can be one or more focus metrics resulting from the accumulated magnitude of the focus filter or filters over the neighborhood of the grid element plus an accumulated green sum or average for the same grid location . the image regions covered by each grid location are fixed throughout the focus process and are many pixels on a side . for example , a grid of 16 × 12 or more pixels can be used . thus it is not possible to modify the location of the focus zone , which now corresponds to a contiguous sub - rectangle of grid points , more precisely than the grid size of the hardware . this level of granularity in the placement of the focus zone is not accurate enough to implement in the aforementioned method . referring to the accumulated figure - of - merit and green sum data for each grid location as a macroblock , as it corresponds to a rectangular sub - array of pixels ; a sub - macroblock estimate of the motion 110 is found for a focus zone defined in the macroblock grid between subsequent frames of macroblock data for the focus sequence . the zone is chosen so as not to incorporate edge macroblocks in the grid and can therefore be any size up to ( n − 2 )×( m − 2 ) macroblocks where n is the horizontal dimension of the macroblock grid and m is the vertical dimension . it is possible that a motion signal can be estimated directly in hardware for each element of the macroblock grid . this could then be accumulated over the macroblocks that constitute the focus zone in order to get a best estimate for the motion of the zone itself . however if such a signal is not available then it is possible to estimate the sub - macroblock motion from the green sum data of the macroblock grid . sum squared distance computations followed by quadratic surface fitting produce reasonable estimates of sub - macroblock motion . the quality and robustness of the motion estimate is further improved if the process of macroblock accumulation involves some degree of anti - aliasing ( that is the values accumulated in each macroblock arise from a region substantially larger than the macroblock grid element itself so that macroblock support regions considerably overlap ). this is an important design criteria for hardware solutions . using the sub - macroblock motion estimate it is possible to generate a motion compensated estimate of the changing figure - of - merit for the focus zone between any pair of subsequent frames . this is done by using a modified gaussian windowing function to accumulate the figure - of - merit data from the macroblocks that constitute the zone and a one macroblock border around the zone . this is why we the border macroblocks of the grid was not used to define the zone in the first place . a windowing function is often used to lessen the effects of exact location when accumulating data . rather than having a sharply defined boundary a windowing function transforms smoothly from full accumulation to zero accumulation . a 2d gaussian ( symmetric or asymmetric ) is a popular shape for a windowing function though other possibilities exist . it has the advantage that it is separable and can be composed from a pair of 1d gaussian functions . the window functions can be modified to allow for the measured estimate of the motion of the macroblocks between frames . this is described below . alternatively the embodiment of the method shown in fig1 can be implemented using specialized hardware . the first image 100 is acquired and then the second image 102 is acquired . the division of the first image into grid of macroblocks 104 and the division of the second image into a grid of macroblocks can be determined by the type of image . for instance for a landscape photograph , the most or all of the image can be divided into macroblocks . for a portrait the focus can be determined by dividing only the central portion of the image into macroblocks . the determination of the first zone of macroblocks and the second zone of the macroblock 108 and the calculation of the macroblock shift 110 can be implemented using algorithms used for mpeg image coding . the calculation of the figures - of - merit for the first and second images 112 and the select focus setting 114 can be performed as in the case where the green sum was used to calculate the macroblock shift . fig2 shows an embodiment of a digital imaging acquisition appliance . there is a housing 220 which encloses a ccd array 226 . on the housing there is also mounted actuators 224 which are used for actuating a lens 222 . the lens is adapted for being moved to different focal lengths with respect to the ccd array 226 . the primary goal of the present invention is to determine the proper focus setting or essentially the proper distance between the lens 222 and the ccd array 226 . the actuators 224 move the lens 222 into different positions , and images are acquired with the ccd array 226 . there is a connection between the ccd array 228 and the electronics assembly 230 . the electronics assembly 230 can comprise integrated circuits and it can also comprise micro - controllers or microprocessors adapted for performing calculations . the electronics assembly comprises a ccd array controller 232 , an image division element 234 , a macroblock shift calculation element 236 , a focus metric calculation element 238 , a figure - of - merit calculation element 242 , a focus setting selection element 246 , and a zone determination element 248 . these various elements could be implemented in hardware or they could be implemented as computer executable instructions that are performed by a micro - controller or a microprocessor . there can also be a mix between specialized integrated circuits and between elements that are implemented as machine executable instructions . in this figure the figure - of - merit calculation element 242 and the focus metric calculation element 238 are shown as being integrated into one specialized integrated circuit 244 . other elements that comprise the macroblock shift that comprise the electronics assembly could also be integrated into this or other specialized chips . the focus metric calculation element comprises a window function element 240 . the window of function element is used to average over a spatial group of macroblocks . this allows the measured motion estimate to be compensated accurately . fig3 shows a digital image 350 . the digital image 350 is comprised of individual pixels . a region of the digital image 350 has been divided into a grid of macroblocks 352 . within the grid of macroblocks 352 is located a zone 354 . the zone 354 is the region for which the figure - of - merit is calculated . the zone can be moved within the grid of macroblocks to find the optimal place to determine the figure - of - merit . the task is to choose a zone 354 of macroblocks that can be tracked accurately to give an overall figure - of - merit estimate that is relevant and robust to motion . when choosing a zone 354 , saturated and dark regions of the image should be avoided . each possible zone 354 location is considered , allowing a one macroblock border for tracking . the primary selection criterion for the first zone 354 is the number of saturated macroblocks in the zone 354 and in a one macroblock border around zone 354 . secondary selection criteria for the first zone 354 include : absolute value of the green sum gradient ( horizontal and vertical ), the figure - of - merit divided by the green sum , and selecting the zone with a maximum sum of squares difference ( ssd ) and / or sum of absolute difference ( sad ) over its eight neighbors . fig4 shows a group of macroblocks 452 . these macroblocks are labeled c 0 through c 8 . each of these locations indicates a position where a similarity metric is calculated . a least squares fit can be used to fit a quadratic surface to the similarity metric . c 0 is in the center and corresponds to the unshifted location and each of the surrounding macroblocks c 1 through c 8 correspond to a one macroblock shift . the similarity metric for each of these is calculated in each of the spots . a =(( c 1 + c 2 + c 8 + c 4 + c 5 + c 6 )− 2 *( c 0 + c 3 + c 7 ))/ 6 ; b =(( c 2 + c 3 + c 4 + c 6 + c 7 + c 8 )− 2 *( c 0 + c 1 + c 5 ))/ 6 ; where c 0 through c 8 corresponds to the value of the similarity metric at that position . the macroblock similarity metric is calculated using a sum of squares difference ( ssd ) or using a sum of absolute difference ( sad ) over its nearest neighbors . the metric is accumulated over the set of macroblocks that comprise the selected focus zone . it is computed using the green sum value for the individual macroblocks . fig5 shows an example of a quadratic surface 660 constructed with a lease squares fit for a similarity metric between the first zone and the second zone in the following image . the minimum of this surface is the sub - macroblock shift . the offset of the minima of the quadratic with respect to the centre of the macroblock labeled c 0 is at location dx and dy ( in macroblock sized units ) given by the following formula : however , there is a systematic bias due to the natural shape of the quadratic that fits through the data . this systematic bias can be compensated for by subtracting the offset determined by fitting a quadratic through a similarity metric of the first zone with its self from the estimate derived using the first and the second zones . fig6 shows the plot of a quadratic surface 660 fit to the similarity metric of the first zone with the macroblocks surrounding the first zone . the small systematic offset of the minima of this surface 660 is subtracted from the location of the minima in 560 . fig7 shows a graph demonstrating the correlation between macroblock motion and pixel motion as calculated by an offline simulation using real image data . the comparison of sub - macroblock motion against pixel motion for image zones collected over a 98 frame motion sequence with a mean frame to frame motion of 5 . 9 pixels . the mean euclidian error is 1 . 6 pixels ( rms 1 . 99 pixels ). the macroblocks were 16 × 12 pixels . the line 770 shows the axle macroblock shift in relation to pixel motion . using the method of an embodiment of the invention , the x component 772 and the y component 774 of the calculated macroblock shift are highly correlated as can be seen in fig7 . fig7 demonstrates that the method allows for a reasonable estimate of the macroblock shift in relation to pixel motion . fig8 shows bar chart shows how the relative error of the figure - of - merit is reduced as the quality of motion compensation is improved . four different methods are compared : the first is no compensation 882 , the second is a gaussian window 884 , the third is a gaussian compensation 886 and the fourth is pixel tracking 888 . each of these had been performed for three different situations , one for a fast move which corresponds to an average of 5 . 9 pixels per frame , for a slow motion 894 which corresponds to 2 . 6 pixels and for no motion at all 896 . the no compensation 882 , gaussian window 884 , and gaussian compensation 886 are based on a macroblock figure - of - merit calculation and macroblock tracking while pixel tracking 888 uses pixel tracking and figure - of - merit accumulation . the gaussian window 884 method uses a fixed window and does not utilize macroblock motion estimate , while the gaussian compensation method 886 does . the figure - of - merit relative error is reduced as the quality of the motion compensation is improved . the relative error 890 is shown in comparison to four different methods . fig9 show a one - dimensional illustration of how a windowing function can be modified to compensate for sub - macroblock motion . in the top portion 908 of this figure a standard gaussian windowing function 900 is used to calculate the figure - of - merit for macroblocks 902 beneath it . the gaussian windowing function can be calculated as : g ( x )= exp (− x 2 / σ 2 ), where x is the position coordinate , and σ is the standard deviation of the gaussian function and must be chosen to allow the function to approach zero over the extent of the zone over which the function - of - merit is being calculated . each macro block of the one - dimensional grid is multiplied by the value of the windowing function at its location or the average value of the window over the width of the macroblock . the figure - of - merit can be calculated as : where fom is the value of the function - of - merit , b is the value of the focus metric for a macroblock , i is an index used to reference all macroblocks , and gauss window is the value of the gaussian window function at the macroblock . a representative value of the window function can be chosen , or the gaussian function can be averaged over the macroblock . the final quantized window function gausswindow [ i ] can be normalized so that it sums to 1 . 0 over all possible values of i to make the method more numerically convenient . using a window function in this way has the advantage that edge effects on the function - of - merit are greatly reduced and hence some degree of tolerance to motion is introduced directly . however , the tolerance to motion can be increased further . the bottom portion 910 of fig9 illustrates that the location of the windowing function can be itself be modified to account for the sub - macro block shifts in the data accumulated into the macro - blocks themselves . the original gaussian windowing function 900 and a modified gaussian function 904 shifted by δ 906 are shown . to implement this , a windowing function must be calculated accounting for the sub - macro block shift . the shifted one - dimensional gaussian windowing functions are computed according to the function : where x is the position coordinate , σ is the standard deviation of the gaussian function and must be chosen to allow the function to approach zero over the extent of the zone over which the function - of - merit is being calculated , and δ is the sub - macroblock shift . the figure of merit is calculated as which is identical to gauss window except uses h ( x ) to replace g ( x ) as the windowing function . again gauss windowshifted [ i ] can be normalized so that it sums to 1 . 0 over all possible values of i . the quantized shifted windowing function gauss windowshifted [ i ] can be implemented , by calculating the window function each time it is used with calculated value of δ . however , this would be computationally intensive , and this can be avoided by precalculating the window function for preselected values of δ . the values of δ can be chosen so that the difference between values is determined by a preselected accuracy of the motion estimate . for example , if it is assumed the sub - macro block step up to the ⅛ a macro block is measurable , then we need only store 8 versions of the gaussian function need be computed ( and appropriately normalized ) ahead of time . each of these 8 functions corresponds to a different estimate of the motion shift . the gaussian is symmetrical so motion in the other direction can be computed from the same coefficients for the two - dimensional case . since the 2d gaussian window function is separable we only need store 2 sets of one - dimensional profiles . if the zone is square it would only be necessary to store a single set . | 6 |
referring now to fig1 a to 4 b , an implant system according to a first embodiment of the present invention will be described . the implant system includes a prosthesis support in the form of the combination of an abutment 10 illustrated in fig1 a and 1 b and a collar member 30 illustrated in fig2 a and 2 b ; and an implant 46 illustrated in fig3 a and 3 b . fig4 a and 4 b illustrate the assembly of the prosthesis support and the implant 46 . turning now more specifically to fig1 a and 1 b , the abutment 10 includes an external member defined by an abutment head 12 of a frusto - conical shape , adjacent to a junction segment 14 which is connected to a projection 16 of a substantially polygonal shape . the projection 16 of the abutment 10 is adjacent to an elongated post 18 . the abutment head 12 , the segment 14 , the projection 16 and the post 18 may be integrally made of a single piece of material . the abutment 10 includes a central throughbore 19 which spans the entire length of the abutment 10 starting from a surface 20 of the abutment head 12 and ending at a surface 22 of the post 18 . the abutment head 12 starts from surface 20 and downwardly and outwardly extends until the junction segment 14 is reached . the junction segment 14 is illustrated as having a substantially cylindrical shape ending with a flat surface connected to the projection 16 . the projection 16 is also connected to the post 18 . the abutment head 12 , junction segment 14 , projection 16 and post 18 are coaxial and parallel to the abutment central axis 26 . fig1 b , better illustrates projection 16 which is shown as being generally pentagonal . fig2 a and 2 b illustrate the collar member 30 which has a generally toroidal shape when seen from a top view . the collar member 30 starts with a substantially planar top surface 32 having a downwardly and outwardly extending flange 34 and continues with a downwardly and inwardly curved section 36 . the curved section 36 ends with a shoulder 38 which is connected to a cylindrical section 40 . the collar member 30 is illustrated has having a passage 42 therethrough . as will be clear from the following description , the collar member may take other shapes such that one side may be higher than the opposite side ( a contoured collar member ). fig3 a and 3 b illustrate the implant 46 which is configured and sized to be used with the abutment 10 of fig1 a and 1 b and the collar member 30 of fig2 a and 2 b as will be further described . the implant 46 has a generally elongated tubular body extending about a central longitudinal axis 48 and is defined by a head section 50 , a root section 52 and a generally tapered section 56 . the sections 50 , 52 and 56 are being integrally made of a single piece of material . the head section 50 becomes the elongated root section 52 which is generally tubular as will be described hereinbelow . the elongated root section 52 is shown has having threads 54 on its outer surface ( shown in fig3 b ). the purpose of the threads 54 will be described hereinbelow . the elongated root section 52 ends with an inwardly and downwardly tapered section 56 having a rounded tip 62 defining a closed end of the implant 46 . the open end 64 of implant 46 has two shoulder portions 66 and 67 , having a substantially cylindrical shape and a substantially pentagonal shape , respectively , as can be better seen in fig3 b . these shoulder portions further extend into a central bore 68 . the central bore 68 downwardly extends and ends with a tapered section 70 . the inner surface of the implant 70 includes a threaded portion 72 , the purpose of which will be described hereinbelow . as can be better seen from fig3 b , the shoulder portion 66 is so configured and sized as to receive the cylindrical section 40 of the collar member 30 . similarly the shoulder portion 67 is so configured and sized as to receive the projection 16 of the abutment . fig4 a and 4 b , illustrate the assembled implant system according to a first embodiment of the present invention . the abutment 10 is shown sitting onto the collar member 30 and inserted into the implant 46 . fig4 b is a top view of the implant system of fig4 a , showing the substantially circular shape of each of the component of the implant system , when seen from a top view . as may be glanced from fig4 a , the junction segment 14 of the abutment is so configured and shaped to fit the passage 42 of the collar member 30 . in addition , the projection 16 and post 18 of the abutment 10 are configured and sized to fit the shoulder portion 67 and the central bore 68 of the implant 46 , respectively . furthermore , the cylindrical portion 40 of the collar member is also configured and sized to fit with the shoulder portion 66 of the implant . this type of configuration of each of the component insures stability and easy installation of the implant system of the invention . furthermore , as may be seen from fig4 a , flange 34 of the collar member 30 extends beyond the base of the abutment head 12 . flange 34 thus serves as a base for supporting a dental prosthesis . fig5 a illustrates a cover screw 80 used during one of the installation step of the implant system . the cover screw 80 is shown has having a substantially flat head 82 which is connected to a threaded post 83 . fig5 b illustrates the cover screw secured to the implant 46 of fig3 a and 3 b . as may be seen from fig5 b the head 82 of the cover screw 80 sits on top of the open end 64 of the implant and therefore provides a seal of the central bore 68 . fig6 a illustrates a healing screw 84 which is also used during one of the installation step of the implant system of the invention . the head 86 of the healing screw 84 has a cylindrical section 88 and a curved section 90 and is connected to a threaded post 92 . the curved section 90 of the healing screw mimics the curved section 36 of the collar member 30 of fig2 a and 2 b . fig6 b illustrates the healing screw secured over the implant 46 . the healing screw 84 also provides a seal of the central bore 68 . fig7 a to 7 d , illustrate bottom views of abutments 10 having a projection 16 of varying shape according to other embodiments of the present invention . fig7 a is a bottom view of the abutment of fig1 a . fig7 a better illustrates the pentagonal shape of projection 16 . for purpose of concision , fig7 b to 7 d will be described only with respect to their differences relative to fig7 a . as may be seen , fig7 b illustrates an abutment 10 having a projection 16 of a hexagonal shape . fig7 c illustrates an abutment 10 having a projection 16 of a substantially cylindrical shape and further having an aligning means 92 in the form of a ridge . fig7 d illustrates an abutment 10 having a projection of an irregular shape . the installation of the implant system of fig4 a and 4 b may proceed as follows . first , the oral surgeon access the patient &# 39 ; s jawbone through the patient &# 39 ; s gum tissue and remove any remains of the tooth to be replaced . next , the anchoring site where the implant 46 is to be installed may be widened to accommodate the implant 46 . the implant 46 is inserted into the jawbone , typically by screwing it with the help of the its external threads 54 , although other methods may be used . it is to be noted that it may be useful to install the implant so that one side of the projection 16 ( e . g ., when polygonal ) is parallel with either face ( external or internal ) of the gum . this may facilitate the surgeon &# 39 ; s work as it may provide a point of reference for subsequent alignment of the abutment 10 . the cover screw 80 is secured on top of the implant 46 by screwing the threaded post 83 into the implant 46 using the internally threaded portion 72 of the central bore 68 . the patient &# 39 ; s gum is then sutured over the sealed implant 46 . tissue ingrowth ( i . e ., ossointegration ) is allowed to take place for about 3 to 8 months . the external threads 54 help in stabilizing and anchoring the implant 46 into the bone and / or minimize rotation of the implant 46 with respect to the bone once tissue ingrowth is achieved . once the implant 46 is firmly anchored in the surrounding bone tissue and the bone has healed , the surgeon re - accesses the implant 46 by making an incision through the patient &# 39 ; s gum tissue . the cover screw 80 is removed and a healing screw 84 is installed by screwing its threaded post 92 in to the implant 46 . within the next few days or weeks the gum tissue will heal and will surround the healing screw 84 mainly at the level of its curved section 90 . the cylindrical section 88 of the healing screw 84 extends further from the gum line . the configuration of the healing screw 84 allows the gum to take an appropriate shape for later installation of the collar member 30 and abutment 10 . more particularly , since both the curved section 90 of the healing screw 84 and the curved section 36 of the collar member 30 have a similar configuration the gum will heal leaving an area which will adequately receive the collar member 30 . once the gum has healed , the healing screw 84 is removed and the collar member 30 is installed onto the implant 46 or alternatively assembled with the abutment 10 . the abutment 10 is then aligned with the implant 46 and inserted in a substantially linear translation movement . as will be clear from the description and drawings , the assembly of the implant system may be carried in more than one way . for example , the abutment may first be inserted into the collar member &# 39 ; s passage and second being joined , by a substantially linear translation insertion , with the implant . alternatively , the collar member may be positioned onto the implant and the abutment may then be inserted through the collar member &# 39 ; s passage and into the implant central bore by a substantially linear translation insertion . the assembly of the abutment 10 and collar member 30 is of the tight fit type . once the abutment 10 is shaped to the required configuration , using the direct or indirect technique which will be described hereinbelow , it may be permanently fixed to the implant 46 by the mordancy technique . for example , the post 18 of the abutment 10 may be acid etched . a composite cement may be inserted into the implant &# 39 ; s central bore 68 ( e . g ., before assembling the prosthesis support with the implant ) and both pieces are subsequently joined . the composite cement may thereafter be cured to insure a permanent fixation . as discussed herein , the threaded surface 72 serves to attach the cover screw , the healing screw ( healing cup ) and the impression copying . however , the threaded surface 72 also permits here a mechanical retention of the abutment 10 with the implant 46 during cementation . the central throughbore 19 of the abutment 10 allows the air under pressure and surplus sealing mordancy to escape the bore 68 upon assembly . the collar member 30 may be held between the abutment 10 and implant 46 without additional attachment . therefore , the assembly and fixation mechanism of the implant system does not require the use of a screwing member , e . g ., a separate screw or integral threaded post . a permanent fixation between the two components is thus provided and the use of a discrete fastener , such as a screw is avoided . the dimensions of the junction segment 14 , projection 16 and post 18 may be slightly smaller than the dimensions of the shoulder portions 66 , 67 and central bore 68 . assembly of post 18 and central bore 68 is of the clearance fit type . assembly of the projection 16 and shoulder portion 67 is of the slide fit type . a shock absorbing gap may thus be provided by the empty spaces between the abutment 10 , collar member 30 and implant 46 surfaces . this arrangement may allow the abutment 10 to flex slightly relative to the implant 46 as it is submitted to chewing forces . the materials which are suitable for the implant system of the present invention , include those described hereinbelow . the abutment may be made from a material compatible with the cad / cam milling procedures and system and also compatible with hand operated dentistry tools such as chisels , milling machines , trimmers , etc . cad / cam systems are composed of a data acquisition and analysis unit as well as a machine that is able to shape machinable pieces based on a 3d model . dental material that may be used with the cad / cam system are known in the art . these include for example , ceramics and highly filled composite material such as the following : 3m * paradigm * mz100 block for cerec *; 85 wt % ultrafine zirconia - silica ceramic particles that reinforce a highly crosslinked polymeric matrix . the polymer matrix consists of bisphenol a diglycidyl ether dimethacrylate and triethylene glycol dimethacrylate . vita mark ii vitabloc for cerec *; this product is manufactured from fine particles of dental ceramics with wear characteristics similar to natural tooth enamel . this product has a homogenous microstructure and a flexural strenght of about 160 mpa . lithium disilicate for cad / cam ( jeneric pentron , usa ); this material is similar to opc 3g ( jeneric pentron , usa ) and comprises about 60 % of interlocked needle - shaped lithium disilicate crystals embedded into alumino - borosilicate glass matrix and possesses a resistance to cleavage of about 300 mpa . ips empress * 2 ; leucite - reinforced ceramic pressable containing latent nucleating agents . the leucite - reinforced ceramic powder is pressed into ingots and sintered . * trademark other material which may be used to make the abutment of the implant system include : vita zeta hc composite or vita zeta heat cure composite , vitapress , ivoclar procad blocks ( this material is also reinforced with leucite particles ). a variety of highly filled composite material may be suitable for the abutment of the present invention . such highly filled composite materials may have , for example , the following characteristics : a composition comprising between 50 and 98 % ( w / w ) of solid substrate , e . g ., between 50 and 95 % of solid substrate or for example , between 50 and 90 % of solid substrate ; a density of between 2 . 0 and 3 . 8 g / cm 3 ; a flexural strength of between 100 and 600 mpa , for example between 100 and 450 mpa . generally , the material used for the abutment 10 may be chosen based with a flexural strength which is similar to or slightly lower than the flexural strength of the implant 46 ; a young &# 39 ; s modulus of between 4 and 200 gpa ; a flexural modulus of between 4 and 40 gpa ; a fracture toughness of between 0 . 6 and 1 . 5 gpa ; and / or a compressive strength of between 300 and 900 mpa . when a highly filled composite material is used for the abutment 10 , the aesthetic appearance ( desired color , translucence ) of the tooth prosthesis is improved . for example , the shade or color may be selected according to the color of the surrounding tooth or teeth which is not possible for metallic abutments . in addition , an abutment made from a highly filled composite material may be fixed to the implant by the mordancy technique which may prove difficult when using metallic components . furthermore , fixation of the tooth prosthesis ( e . g . porcelain ) is more easily achieved . according to embodiments of the present invention , the implant 46 may be made from a material allowing ossointegration , more particularly , a material such as titanium , titanium alloy , gold , zirconium oxide , aluminum oxide , ceramics , i . e ., bio - ceramics ( e . g ., zircon ceramics ), or other biocompatible material also according to embodiments of the present invention the collar member 30 may be made , for example , from a material such as titanium , titanium alloy , gold , zirconiumi oxide , or ceramics ( e . g ., zircon ceramics ). since the collar member is in close contact with the gum tissue , the use of zirconium oxide or zircon ceramics has been found to minimize the risk of bacteria growth , decrease tartar formation and increase the esthetic and optical quality of the dental fixture ( shade , translucency ). ceramics used to make the collar member may include , for example , a ceramic made from aluminum oxide , zirconium oxide and the like as well as combination thereof . such ceramics may have , for example , the following characteristics ; a density of between 2 . 4 and 6 . 2 g / cm 3 ( e . g ., 2 . 4 , 3 . 8 , 3 . 9 , 4 , 5 . 8 , 6 . 1 , etc . ); an elastic modulus of between 100 and 380 gpa ( e . g ., 104 ± 4 , 350 ± 20 , 370 ± 20 , 360 ± 20 , 200 ± 20 , etc . ); a poisson &# 39 ; s ratio of between 0 . 22 and 0 . 34 ( e . g ., 0 . 22 , 0 . 23 , 0 . 30 , 0 . 34 , etc . ); a flexural strength of between 200 and 1600 mpa ( e . g ., 300 ± 30 , 400 ± 20 , 700 ± 20 , 900 ± 30 1200 ± 20 , etc . ); a fracture toughness of between 2 and 15 mpa × m ½ ( e . g ., 2 , 3 , 4 , 5 , 6 , 9 , 13 , 15 , etc .) a hardness of between 6 and 15 gpa ( e . g ., 6 , 7 , 12 . 8 , 13 . 2 , 13 . 6 , 14 . 2 , 14 . 6 , 15 , etc .) and / or cte ( coefficient of thermal expansion ) of between 9 and 11 10 − 6 ×° c . − 1 ( e . g ., 10 . 3 ( from 25 ° c . to 1000 ° c . ), 8 ( from 25 ° c . to 1000 ° c . ), etc .). two restorative options are possible using the implant system of the present invention , especially when a highly filled composite material is used to make the abutment ( i . e ., a material having the machinability advantages ( properties ) of a direct restorative material and those of an indirect restorative material ): a direct restorative technique : a dentist may shape the abutment to fit the required configuration directly in the patient &# 39 ; s mouth for subsequent installation of the prosthetic tooth . it is possible to add or remove material from the abutment . this technique does not require impression coping or an impression copying . for example , material may be added or removed from the abutment head 12 depending on the shape , dimension and angularity ( with respect to the implant or post ) needed by the patient and determined by the dentist . the dentist therefore machines the abutment head 12 ( e . g ., using traditional dentistry tools ) of the abutment 10 to fit with the prosthesis . the prosthesis is subsequently installed . an indirect restorative technique : a dentist may take an impression of the patient &# 39 ; s mouth using the impression copying ( analogue system ) described herein and the abutment may be sent to an outside laboratory which will shape the abutment to the required configuration ( e . g ., using a cad / cam system ) based on the impression . the installation of the shaped abutment is thus performed as a separate step . the prosthesis is subsequently installed . the indirect approach requires more chair time . abutments 10 , according to embodiments of the present invention may be provided with different shapes and dimensions such as , for example oval ( e . g ., when seen from a top view ), circular , rectangular , frusto - conical , square or even irregular shapes may be used . the same applies for collar members 30 and implants 46 . for example , the abutment 10 , the collar member 30 and the implant 46 may be provided in a variety of sizes suitable for either lateral , central , cuspid and bicuspid teeth and for molars or suitable for the specific needs of an individual . the dimensions of the curved section 36 of the collar member 30 may vary to accommodate various tissue heights . also , the junction segment 14 of the abutment may be tapering inwardly and downwardly toward the post . therefore , any variation in shape , length , diameter , width , angularity etc . of any component or any individual part of a component of the implant system , impression copying , screws ( cover , screw , healing screw , screw of the impression copying ) of the present invention are encompassed herein . as another example , the projection 16 may take any other shapes than the pentagonal shape illustrated in fig1 b . the projection may have any other suitable polygonal shape ( e . g ., hexagonal , etc . ), oval shape or even an irregular shape . implant system having projection 16 which tapers inwardly and downwardly are also encompassed by the present invention . whatever the shape and size of the projection 16 it would be preferable to provide an implant 46 with a matching shoulder 67 . it may be preferable to have a projection 16 with a low number of sides ( e . g ., a three - sided polygon , a five - sided polygon , a seven - sided polygon ) for allowing alignment of the abutment 10 with the implant 46 in a limited number of positions . it may also be useful to have a projection 16 with an uneven number of sides . as will easily be understood by one skilled in the art , the projection 16 only allows alignment of the abutment 10 with the implant 46 in a limited number of positions , five in the case of fig1 a and fig1 b . alignment is performed by positioning the abutment 10 onto the implant 46 in such a way that the shape of the projection 16 of the abutment 10 is matched and fitted into the shouldered portion 67 of the implant 46 . the projection 16 also prevents rotation of the abutment 10 with respect to the implant 46 . the expression “ limited number of positions ” is to be understood herein as the number of possible positions for inserting the abutment into the implant , this number being , for example preferably below 20 possible positions , more preferably below 10 possible positions . it is also understood herein , that an abutment having a substantially circular shaped projection 16 , may also serve for aligning the abutment with the implant , provided that the projection 16 would have one or more additional aligning means as illustrated by ridge 92 in fig7 c . such additional aligning means may be , for example , selected from the group consisting of a protrusion , a notch , a ridge , a concave structure , a convex structure , a tapered structure , a pin , and combinations thereof . therefore , the aligning means would also partially block or minimize rotation . of course , in the event a projection 16 would have aligning means 92 ( as illustrated in fig7 c ), the shoulder portion 67 would also be configured to match it , e . g ., in a male - female type of structure ( not illustrated ). turning now to fig8 a , 8 b and 8 c , an implant system 100 according to another embodiment of the present invention will be described . it is to be noted that the implant system 100 of these figures is very similar to the implant system illustrated in fig1 a to 6 b . therefore , for concision purposes , only the differences between these implant systems will be described hereinbelow . the main difference between the implant system 100 and the implant system described hereinabove is that the abutment head 112 of the abutment 110 is substantially oval ( when seen from a top view ). in addition , the collar member 130 is also illustrated as having an oval shape . those dimensions may be useful , for example , for an implant installed in place of a cuspid or bicuspid tooth . a position that the implant system may held once installed in the mouth of an individual is suggested in fig8 a and fig8 b where v is the vestibular side , d is the distal side , m is the mouth side and l is the lingual side . other positions may be assumed depending on the need of the patient . fig9 of the appended drawings illustrates an implant system 200 , according to a third embodiment of the present invention . again , only the differences between the implant system 200 and the implant system described hereinabove with reference to fig1 a to 6 b will be described . in fig9 , the collar member 230 is illustrated has having one of its side higher than the opposite side . this type of implant system or collar member 230 is referred as being contoured . accordingly the abutment 210 , more particularly the abutment head 212 and the junction segment 214 , is adapted to fit with the contoured collar member . this type of system may be particularly useful for substantially circular or substantially square teeth , such as a molar , especially when one side of the gum tissue is higher than the opposite side ( e . g ., lingual v mouth ). an implant system 300 , according to a fourth embodiment of the present invention will now be described with reference to fig1 a , 10 b and 10 c . as shown in fig1 b , the collar member 330 is contoured as the collar member 230 of fig9 . in addition , the collar member 330 and the abutment 310 illustrated in fig1 a , 10 b and 10 c have a substantially oval shape . again , the abutment 310 , more particularly the abutment head 312 and the junction segment 314 , is configured to match the collar member 330 . this type of system may be particularly useful for oval teeth , such as a cuspid or bicuspid tooth , especially when one side of the gum tissue is higher than the opposite side ( e . g ., lingual v mouth ). a position that the implant system may held once installed in the mouth of an individual is suggested in fig1 a and fig1 b where v is the vestibular side , d is the distal side , m is the mouth side and l is the lingual side . other positions may be assumed depending on the need of the patient . fig1 a , 11 b and 11 c illustrate implant systems 400 , 500 , and 600 respectively according to additional embodiments of the present invention . in fig1 a , 11 b and 11 c , the collar members 430 , 530 and 630 are of the contoured type . however , the top surface of each abutment is at an angle with respect to the implant central longitudinal axis . the abutment 410 and more particularly the abutment head 412 of fig1 a is shown with an angle of approximately 18 ° with respect to the central longitudinal axis 448 ( as well as with respect to the post 418 ). the abutment 510 and more particularly the abutment head 512 of fig1 b is shown with an angle of approximately 23 ° with respect to the central longitudinal axis 548 ( as well as with respect to the post 518 ). the abutment 610 and more particularly the abutment head 612 of fig1 c is shown with an angle of approximately 30 ° with respect to the central longitudinal axis 648 ( as well as with respect to the post 618 ). more particularly angles of between 15 ° and 35 ° ( or − 15 ° to − 35 °) are encompassed by the present invention . these types of implant system may be required depending on the specific needs of an individual which is easily determined by the dentist . of course , the length , shape ( oval v circular ) size may vary as described herein . turning now to fig1 a and 12 b of the appended drawings , an impression copying 700 , compatible with the implant 46 will be described . the impression copying 700 comprises an elongated section 702 , a curved section 704 and a cylindrical section 706 . the impression copying 700 has a channel 708 passing therethrough . the impression copying 700 possesses , on its external face 710 , substantially horizontal grooves 712 and substantially vertical grooves 713 which are found on the elongated section 708 . the curved section 704 of the impression copying mimics the curved section 36 of the collar member 30 illustrated in fig2 a and 2 b . the cylindrical section 706 of the impression copying 700 mimics the cylindrical section 40 of the collar member 30 as also illustrated in fig2 a and 2 b . the impression copying 700 may therefore be installed onto the implant 46 and may be temporarily held in place with the help of an attaching means such as a screw 714 as the one illustrated in fig1 b . the screw 714 of fig1 b has a substantially elongated cylindrical head 716 , a junction segment 718 and a threaded post 720 . each part of the screw 714 matches the corresponding internal dimensions of the impression copying 700 . in use , the impression copying 700 is installed onto the implant 46 and secured with the help of a screw 714 . an impression is then taken around the impression copying 700 , using for example , a silicone material , such as an addition - curing silicone impression material , a condensation curing silicone impression material , etc . the impression copying 700 may afterward be removed . the laboratory uses the resulting impression to form a prosthetic tooth . the silicone impression will carry impressed threads matching grooves 712 and 713 which will therefore reflect the initial position of the impression copying 700 in the patient &# 39 ; s mouth . it is to be understood herein that an implant system having one or more of the individual characteristics described herein is encompassed by the present invention . for example , an implant system having an oval shaped implant , a contoured and oval shaped collar member and an oval shaped angled abutment is also encompassed by the present invention . similarly , any of the individual characteristics in any implant system &# 39 ; s components or any component &# 39 ; s part may be mixed to provide a desired implant system in accordance with the present invention . it may be advantageous in some instance to manufacture a collar member and abutment in a single piece . however , one main advantage of providing two distinct pieces is that both pieces may be made from distinct material as described herein . the different components of the implant system ( abutment , collar member , implant , which may include a cover screw and a healing screw ) and impression copying ( when required ) may be provided in separate pieces to the dentist or as a standard set of defined dimensions . it may also be useful to have an abutment with the characteristics described herein specifically designed to be used with prior art implant . in addition , a separate implant having the characteristics described herein is also encompassed by the present invention . other variations of the invention encompassed by the present invention include the following . for example , the elongated post 18 of the abutment may be provided with a tapered section at its tip . a tapered section may generally increase the flow of mordancy upon fixation of the abutment 10 to the implant 46 . also , the tip 62 of the implant 46 , illustrated in the appended figures as being rounded may be more pointed as illustrated in fig8 a and 8 b or may have other configuration . in addition , it may be useful to provide a collar member having a threaded passage . this may facilitate assembly of the abutment and collar member when , for example , their assembly is required or preferable prior to their installation onto the implant . a prior assembly of an abutment and a collar member may be useful , for example , to prevent lost of one of the component or may facilitate their distribution to the customer . although the present invention has been described in details herein and illustrated in the accompanying drawings , it is to be understood that the invention is not limited to the embodiments described herein and that various changes and modifications may be effected without departing from the scope or spirit of the present invention . | 0 |
in fig1 a person 10 is shown as having fallen overboard from a vessel 12 into water 14 . in this event , the person is shown as having a portable transmitter unit 16 , embodying the invention , which is attached to a name tag to his shirt . as will be more fully described , the attached unit transmits ultrasonic sound waves 18 through the water to a receiving unit 20 carried by the vessel for actuating a rescue - initiating mechanism 22 . mechanism 22 may comprise any number of alarm devices such as an audible alarm or a remote display . it may also actuate such life - saving devices as a flotation device and a marker buoy including a strobe light . it may additionally operate to turn the engine off or to steer the vessel in a desired path . all such life - saving devices are well - known , and therefore , are not illustrated . as shown in fig2 and 3 , unit 16 includes a transmitter portion 24 carried within a sleeve 26 whose top and bottom portions 28 are curved around to resiliently press against transmitter portion 24 . such a unit may be carried by means of a name tag 25 , which is shown in fig4 with a pin for attachment to the wearer &# 39 ; s outer garment . alternatively , as shown in fig5 unit 16 may be embodied within a buckle 30 to be worn as part of a belt . other means of attachment will be suggested depending on the attachment needs . as shown in fig3 transmitter portion 24 comprises a printed circuitboard 32 having desired circuitry 34 leading from , for example , a hydrostatic switch 36 to a transducer 38 , fittable within an opening 40 in the printed circuitboard . openings 42 are also provided in the circuitboard for reception of batteries 44 . the transmitter portion as well as the receiving apparatus are shown in greater detail in fig6 . briefly , transmitter unit 16 comprises a digital encoder 46 ( if desired ), an oscillator 48 , and a power amplifier 50 , all connected in series and all connected to battery power supply 44 through hydrostatic switch 36 . upon actuation of hydrostatic switch 36 by the pressure of water , as denoted by arrow 52 , transmitter unit 16 is enabled to cause transmission by transducer 38 to produce ultrasonic sound waves 18 which are transmitted through the water to receiver unit 20 . receiver 20 includes a receiving transducer 53 , a narrow bandwidth amplifier 54 , a detector 56 , all coupled in series , for operating an alarm 58 . although shown as an alarm , substitutions or additional equipment may be added thereto , such as the above - mentioned selection of life - saving devices , apparatus to stop the engine of the vessel , and the like . specifically , transducers 38 and 53 may comprise any convenient material , the preferred including a disc of barium titanate , lead titanate , or lead zirconate . such a transducer is obtainable as model channel 5400 made by channel industries , inc ., of santa barbara , calif . such a disc has a preferred frequency constant of 78 kc / in working in a planar or thickness extensional mode . such a device is capable of operating in the preferred frequency range of 60 and 100 khz . this frequency range is chosen because the ambient noise in the sea and moving vessels are at a minimum between these frequencies . other frequencies may be used if desired and may be necessary in order to prevent interference with any frequency already used by the vessel . the selection of the particular transducer geometry is dependent upon various factors . the most important is that the frequency range is selected where the moving ship &# 39 ; s noise is at a minimum . based upon naval studies , such vessel noises fall off above approximately 50 khz . another important factor relates to the radiation pattern of the signal . both the frequency and the radiation pattern in part are determined by the size of the transducer . as the transducer becomes smaller , its frequency of resonance increases but , with an increase in frequency , the radiation pattern becomes correspondingly narrow . in the use of the present invention , it is preferred to have an omnidirectional pattern for the reason that , when a person falls overboard from a vessel , the person &# 39 ; s movement will cause corresponding movement of the transducer . it is not possible under ordinary circumstances for the person to direct the transmitter toward the vessel . therefore , an omnidirectional pattern at a lesser frequency is preferred . based upon these considerations , the size limitations of the transducer involves some tradeoff between frequency and radiation pattern . generally , the upper limit is 100 khz at which point the radiation pattern becomes more directional than preferred . it is to be understood , of course , that if necessity so dictates , higher frequencies may be utilized . accordingly , the preferred frequency range , based upon the above factors , is between 60 and 100 khz . power amplifier 50 is selected to have an impedance which matches that of the transducer and needs only to provide a greater power output than available from oscillator 48 to overcome any interference , noise , or attenuation . oscillator 48 is designed to create a sinusoidal waveform at the chosen frequency . such a frequency could be chosen for use in notifying a group of vessels in the same geographical area as the person having fallen overboard . such a commonly received frequency would also halp other vessels from hitting the person overboard as well as to aid in the rescue operation . digital encoder 46 is used only if there were a need to identify one or more individuals . such identification might be necessary if the identified person had certain health , age and other problems . in addition , if the overboard condition were caused by vandals or pranksters , identification might be of aid in determining who the culprit might be . each battery in power supply 44 should have a long shelf life , a flat discharge characteristic , and a low internal impedance because the aim and requirement of the battery is to be useful after a long - term storage and to provide a rapid , fast discharge in a period of approximately 1 minute to fully expend the charge of the battery . mercury or lithium batteries are suitable for these purposes . the power rating of the battery is , of necessity , associated with the power amplifier , which drives the transducer with approximately 10 - 15 watts of power . switch 36 is preferred to be of a hydrostatic type so that it may be initiated by fresh or salt water pressure and is designed to prevent pranksters and vandals from throwing unit 16 into the water and , therefore , from falsely sounding the alarm . thus , it is required that the unit have a positive buoyancy where the switch will not be closed , but will respond to a specific pressure exerted by a depth of water where the switch can be closed . such buoyancy may be obtained by fabricating the housing or unit enclosure of a high density foam material , e . g ., urethane foam of 7 pounds per cubic foot density . as shown in fig3 the hydrostatic switch includes a diaphragm 60 which is open at one side to water pressure through an orifice 62 . by imparting a buoyancy to unit 16 , it is not possible to develop the required water pressure to be exerted upon diaphragm 60 , unless the transmitter unit were attached to a person . at that point , the unit would be sufficiently submerged to permit a larger pressure to move the diaphragm into a switch - closing position . once the transmitter unit is actuated , it is desired that it latch to remain transmitting so that , when a person is flailing and thrashing around in the water , the transmitter will not switch on and off but will remain on . this may be achieved in several ways such as by permanently deforming the diaphragm by the exerted pressure , or by coating a pair of switch surfaces with electrically conductive adhesive so that , when contact is made therebetween , they adhere together . another desired requirement is that there be delay of about 1 second before the transmitter is activated and latched , again to avoid problems relating to pranksterism and vandalism . this requirement is achieved by restricting the orifice at 62 through which the water enters . a further method of achieving latching and delay is to utilize a silicon controlled recitifier and capacitor which are associated with gate circuitry . as stated above , the ultrasonic sound waves are received by receiver 20 and its transducer 53 whose requirements are the same as transmitting transducer 38 . amplifier 54 is preferably of a narrow band type to exclude noise and signals of other frequencies and to prevent spurious alarms . thus , reception of a weak signal is optimized . detector 56 causes a switch to close upon receipt of a signal from amplifier 54 and causes a relay to close and to actuate alarm 58 , to eject life - saving devices , to stop the engines , etc . it may be desirable to provide a very brief delay , e . g ., 250 milliseconds , in the actuation of the relay by means of an appropriate rc network . such a delay will prevent spurious actuation of the alarm device due to impulse noises normally occurring in the sea . detector 56 , amplifier 54 and transducer 20 may be prepared from a standard semiconductor chip , such as obtained from national semiconductor , chip no . lm1812 . a decoder may be incorporated at the receiving end to decode any digital information developed by encoder 46 to identify the particular party in the water . the signal from detector 56 may also be used to stop the engine of the vessel , especially if it is a one - man boat . it is also possible to use the signal to prevent the boat from moving away from the person having fallen into the water . it is also desirable to have the receiver latch on upon receipt of the signal and to provide a manual reset for the receiver . referring now to fig7 a diver 70 , particularly a scuba diver , is shown to be in need of rescue while underwater . rescue may be initiated by means of a device 72 , which is similar to that previously described . specifically , device 70 differs from portable transmitter unit 16 in that it utilizes a manually actuable switch instead of hydrostatic switch 36 . additionally , a marker buoy exemplified as a balloon 74 is inflated by actuation of the manually operated switch acting on a compressed gas cartridge 76 incorporated in unit 70 . marker buoy 74 may also comprise a flare , smoke or dye . since a cord 78 secures marker 74 to the diver , he can be readily located by his rescuers . as before , notice of his dilemma is transmitted to a vessel , such as vessel 12 of fig1 by ultrasonic waves 80 and , if desired , audible signals 82 may also be initiated for transmission directly to neighboring divers . although the invention has been described with reference to a particular embodiment thereof , it should be realized that various changes and modifications may be made therein without departing from the spirit and scope of the invention . | 7 |
now , the present invention will be described in greater detail by referring to the accompanying drawing that illustrates preferred embodiment of the invention . fig2 is a schematic block diagram of the first embodiment of multi - value flash memory according to the invention , illustrating its overall configuration ; referring to fig2 , a plurality of flash memory cells , a plurality of bit lines and a plurality of word lines are arranged in the memory cell array 1 . the flash memory cells are arranged in the form of a matrix . a column control circuit 2 and a row control circuit 3 are arranged adjacently relative to the memory cell array 1 . the column control circuit 2 controls the bit lines in the memory cell array 1 for erasing data from , writing data into and reading data from memory cells . the row control circuit 3 is used for selecting a word line in the memory cell array 1 and supplying a voltage necessary for erasing , writing and reading data . additionally , a source line control circuit 4 for controlling source lines of the memory cell array 1 and a p - well control circuit 5 for controlling the p - type wells for forming the memory cell array 1 are also arranged near the memory cell array 1 . data input / output buffer 6 is connected to a host by way of an external i / o line . the data input / output buffer 6 is adapted to receive data to be written , outputs read out data and receive address data and command data . the data to be written received by the data input / output buffer 6 are forwarded to the column control circuit 2 . the data input / output buffer 6 receives the read out data from the column control circuit 2 . an external address data is sent to the column control circuit 2 and the row control circuit 3 by way of state machine 8 in order to select memory cells in the memory cell array 1 . a command data from the host is sent to command interface 7 . the command interface 7 receives a control signal from the host and determines if the data input to the data input / output buffer 6 is a data to be written , a command data or an address data . if it is a command data , the command interface 7 forwards the command to the state machine 8 as received command signal . the state machine 8 controls the overall operation of the flash memory . it receives a command from the host for controlling the operation of reading data , writing data and erasing data and also controls the data input / output operation . the state machine 8 arranged a write counter pc for counting the number of data writing operations to each of the memory cells . fig3 a is a schematic block diagram illustrating the internal configuration of the memory cell array 1 in fig2 . the memory cells of the memory cell array 1 are divided into a number of blocks block 0 through block 1023 . a block is the smallest unit for an erasing operation . each of the blocks blocki ( i = 0 through 1023 ) includes a total of 8 , 512 nand type memory units as shown in fig3 b . in this embodiment , each of the nand type memory units contains four memory cells m that are connected in series and further to a bit line ble or blo at an end thereof by way of a selection gate s 1 commonly connected to selection gate lines sgd i and to a common source line c - source at the opposite end thereof by way of a selection gate s 2 commonly connected to selection gate lines sgs i . each memory cell m has a control gate , a floating gate , a source and a drain . the control gates of the four memory cell m of each nand type memory unit are commonly connected to the corresponding one of the word lines wl 0 i through wl 3 i . data are independently written into and read out from the even - numbered bit lines ble and the odd - numbered bit lines blo as counted from 0 . data are simultaneously written into or read out from 4 , 256 memory cells connected to the even - numbered bit lines ble out of the 8 , 512 memory cells whose control gates are connected to a single word line wl . when each memory cell stores a 1 - bit data , the 4 , 256 bits data stored in 4 , 256 memory cells constitute a unit of page . thus , when a single memory cell stores a 2 - bit data , the 4 , 256 memory cells store data of two pages . data of other two pages are stored in the 4 , 256 memory cells connected to the odd - numbered bit lines blo . data are written into or read out from the memory cells of a same page simultaneously . fig4 is a schematic cross sectional view of the memory cell array 1 of fig2 taken along the column direction to show the structure of the device . referring to fig4 , an n - type well 11 is formed on a p - type substrate 10 and a p - type well 12 is formed in the n - type well 11 . each memory cell m comprises a source and a drain formed in an n - type diffusion layer 13 , a floating gate fg arranged in a channel region between the source and the drain by way of a tunnel oxide film and a control gate cg arranged on the floating gate fg by way of an insulating film and operating as word line wl . each of the selection gates s 1 , s 2 includes a source and a drain formed in the n - type diffusion layer 13 and a selection gate line sg having a two - layer structure . both the word line wl and the selection gate line sg are connected to the row control circuit 3 in fig2 and controlled by the output signal from the row control circuit 3 . each nand type memory unit including four memory cells m and selection gates s 1 , s 2 is connected at an end thereof to the metal wiring layer m 0 of the first layer by way of a contact hole cb 1 . the metal wiring layer m 0 is connected to the metal wiring layer m 1 of the second layer operating as bit line bl by way of a via hole v 1 . the bit line bl is connected to the column control circuit 2 in fig2 . the nand type memory unit is connected at the other end thereof to the metal wiring layer m 2 of the first layer operating as common source line c - source by way of still another contact hole cb 2 . the common source line c - source is connected to the source line control circuit 4 in fig2 . an n - type diffusion layer 14 is formed on the surface of the n - type well 11 , while a p - type diffusion layer 15 is formed on the surface of the p - type well 12 . both of the n - type diffusion layer 14 and the p - type diffusion layer 15 are connected to the metal wiring layer m 3 of the first layer operating as well line c - p - well by way of respective contact holes cb 3 , cb 4 . the well line c - p - well is connected to the p well control circuit 5 in fig2 . fig5 a and 5b are schematic cross sectional views of the memory cell array 1 taken along the row direction to show the structure of the device . as shown in fig5 a and 5b , each memory cell is isolated from the remaining memory cells by element isolations sti . as shown in fig5 a , in each memory cell , a floating gate fg is laid on a channel region by way of a tunnel oxide film 16 . a word line wl is laid on the floating gate fg by way of an insulating film 17 that is an ono film . as shown in fig5 b , the selection gate line sg has a two - layer structure . the upper layer selection gate line sg and the lower layer selection gate line sg are connected to an end of the memory cell array 1 or a predetermined number of bit lines . fig6 is a schematic block diagram of a principal part of the column control circuit 2 of fig2 , illustrating its configuration . in the column control circuit 2 , a data storage circuit 20 is arranged for every two bit lines including an even - numbered bit line ble and an odd - numbered bit line blo having a same column number . in the column control circuit 2 , a sense amplifier is also arranged for the data storage circuit 20 in order to write data into and read data from memory cells . referring to fig6 , an n - channel mos transistor qn 1 is connected for column selection between the data storage circuit 20 and the even - numbered bit line ble , whereas another n - channel mos transistor qn 2 is connected for column selection between the data storage circuit 20 and the odd - numbered bit line blo . either of the even - numbered bit line ble or the odd - numbered bit line blo connected to each data storage circuit 20 is selected and connected to the data storage circuit 20 to control the operation of writing a data or that of reading a data . more specifically , when signal evenbl is at level h and signal oddbl is at level l , the mos transistor qn 1 is made electrically conductive to select the even - numbered bit line ble , which bit line ble is then connected to the data storage circuit 20 . when , on the other hand , when signal evenbl is at level l and signal oddbl is at level h , the mos transistor qn 2 is made electrically conductive to select the odd - numbered bit line blo , which bit line blo is then connected to the data storage circuit 20 . note that the signal evenbl is supplied to all the n - channel mos transistors for column selection connected to the even - numbered bit lines ble , whereas the signal oddbl is supplied to all the n - channel mos transistors for column selection connected to the odd - numbered bit lines blo . the unselected bit lines bl are controlled by some other circuit ( not shown ). each data storage circuit 20 includes three binary data storage sections ds 1 , ds 2 , ds 3 , of which the data storage section ds 1 is connected to the data input / output buffer 6 by way of an internal data input / output line ( i / o line ) and stores an externally input data to be written or a read out data to be externally output , while the data storage section ds 2 stores the detection outcome of a write verify operation for confirming the threshold value of a memory cell after a write operation and the data storage section ds 3 temporarily stores the data of a memory cell at the time of writing it and at the time of reading it . fig7 is a graph illustrating the relationship between a multi - valued data and the threshold value of a memory cell of the first embodiment of multi - value flash memory according to the invention . now , the operation of the embodiment of multi - valued flash memory according to the invention and having the above described configuration will be described below by referring to fig7 . assume that each memory cell of this embodiment is adapted to store two bits or a four - valued data . it will be appreciated that a 2 - bit data is “ 11 ”, “ 10 ”, “ 01 ” or “ 00 ”. the two bits belong respectively to different row addresses ( different pages ). a four - valued data is stored in a memory cell with different threshold values . referring to fig7 , assume that a data showing the lowest threshold value ( e . g ., the threshold voltage is negative ) represents “ 11 ” and a data , showing the second lowest threshold value ( e . g ., the threshold voltage is positive ) represents “ 10 ”, while a data showing the third lowest threshold value ( e . g ., the threshold voltage is positive ) represents “ 01 ” and a data showing the highest threshold value ( e . g ., the threshold voltage is positive ) represents “ 00 ”. after an erasing operation , the data in the memory cell is “ 11 ”. if the data of the lower order page written into this memory cell is “ 0 ”, the state of the memory cell shifts from “ 11 ” to “ 10 ” as a result of the writing operation . if the data written into this memory cell is “ 1 ”, the state of the memory cell remains to be “ 11 ”. then , the data of the higher order page is written into the memory cell . if the written data is “ 1 ”, the state of the memory cell remain from “ 11 ” or “ 10 ”. if the written data is “ 0 ”, the state of the memory cell shift either from “ 11 ” to “ 01 ” or from “ 10 ” to “ 00 ”. during a write operation , the data written into a memory cell is read out and a so - called write verify operation is conducted to verify if the writing operation is satisfactory . the data read out by the sense amplifier is regarded as “ 11 ” if the threshold value is not higher than 0v and as “ 10 if the threshold value is not lower than 0v and not higher than 1v , whereas the data is regarded as “ 01 ” if the threshold value is not lower than 1v and not higher than 2v and as “ 00 ” if the threshold value is not lower than 2v . thus , four - value threshold values are used for storing a 2 - bit data in a memory cell . in actual devices , the performance of the memory cells can vary from memory cell to memory cell and hence their threshold values can also vary . if they vary to a large extent , it will be no longer possible to identify the data stored in each memory cell and a wrong data may be read out . this embodiment of multi - valued flash memory is adapted to suppress dispersion of threshold value in a manner as indicated by a solid line in fig7 unlike the dispersion of threshold value observed in known flash memories as indicated by broken lines in fig7 . this point will be describe in detail to below . table 1 shows typical voltages of various parts of the first embodiment of multi - valued flash memory in erase , write , read and write verify operations . note that , the values shown in table 1 are obtained when the word line wl 2 and the even - numbered bit lines ble are selected for write and read operations . for an erase operation , 20v and 0v are supplied respectively to the p - type well 12 ( well line c - p - well ) and all the word lines wl 0 of the selected block . electrons are discharged from the floating gates fg of all the memory cells m of the block so that the threshold value becomes negative to show a state of “ 11 ”. while the word lines and the bit lines bl of the unselected blocks are brought to an electrically floating state , they show a voltage level close to 20v as a result of the capacitive coupling with the p - type well 12 . for writing a data , a first step operation , a second step operation and a write inhibiting operation are conducted sequentially . firstly , program voltage ( write voltage ) vpgm of about 14v to 20v is supplied to the selected word line wl 2 . a high voltage such as 10v is supplied to each of the unselected word lines , including , say , the word line wl 3 , of the memory cells located at the bit line side relative to the selected memory cells in order to make the memory cells connected to the word line wl 3 electrically conductive . on the other hand , a low voltage such as 0v is supplied to each of the unselected word lines , including , say the word line wl 1 , of the memory cells located at the side of the well line c - p - well relative to the selected memory cells in order make the memory cells connected to the word line wl 1 electrically non - conductive . the selected bit lines ble is supplies a voltage such as 0v . as a result , the 0v supplied to the selected bit lines ble are transferred to the drains of the selected memory cells and the electric potential of the floating gates fg is raised by the capacitive coupling of the control gates cg and that of the floating gates fg so that electrons are injected into the floating gates fg from the drain by way of the tunnel oxide film ( the tunnel oxide film 16 of fig5 a ) due to the tunneling phenomenon and the threshold value is rapidly raised ( the first step write operation ). the voltage of the bit lines ble is raised to 0 . 4v to suppress the rate at which the threshold value rises in a write operation ( the second step write operation ). the bit lines ble are made to show a sufficiently high voltage , e . g ., the supply voltage vdd ( up to 3v ) for completely blocking the rise of the threshold value ( write inhibition ). a read operation is conducted by sequentially supplying different read voltages ( 0v , 1v , 2v ) to the selected word line wl 2 . a voltage that makes the unselected memory cells electrically conductive , typically 4 . 5v , is supplied to the unselected remaining word lines . if the threshold value of the selected memory cells is lower than the read voltage , the bit lines ble and the common source line c - source are made electrically communicative with each other so that an electric current flows through them to bring the electric potential of the bit lines ble to a relatively low level , or level l . if , on the other hand , the threshold value of the selected memory cells is higher the read voltage , the bit lines ble and the common source line c - source are made electrically non - communicative with each other to bring the electric potential of the bit lines ble to a relatively high level , or level h . the read voltage is typically made equal to 0v and a read operation is conducted ( to read “ 10 ”) for checking if the electric potential of a memory cell is higher than the threshold value corresponding to the state of “ 10 ” or not . the read voltage is typically made equal to 1v and a read operation is conducted ( to read “ 01 ”) for checking if the electric potential of a memory cell is higher than the threshold value corresponding to the state of “ 01 ” or not . the read voltage is typically made equal to 2v and a read operation is conducted ( to read “ 00 ”) for checking if the electric potential of a memory cell is higher than the threshold value corresponding to the state of “ 00 ” or not . a data is written into a memory cell in the state of “ 10 ” so as to make the threshold value not smaller than 0 . 4v in order to provide a read margin of 0 . 4v for the read voltage of 0v . thus , the operation of writing “ 10 ” is inhibited when the threshold value of the memory cell has got to 0 . 4v as a result of a write verify operation . conventional devices comparable to this embodiment are only adapted to check if the threshold value has got to 0 . 4v or not so that the threshold value shows a relatively broad distribution width as shown in fig7 . to the contrary , this embodiment of the present invention is adapted to check if the threshold value has got to a level slightly lower than the target threshold value or not and the rate at which the threshold value rises is suppressed in the second step write operation . therefore , it is now possible to narrow the distribution width of the threshold value as indicated by the solid line in fig7 . the above description also applies to the states of “ 01 ” and “ 00 ”. a write verify operation is conducted by sequentially supplying different verify voltages , e . g ., 0 . 2v , 0 . 4v , 1 . 2v , 1 . 4v , 2 . 2v , 2 . 4v to the selected word line wl 2 . if the threshold value of the selected memory cells is lower than the verify voltage , the bit lines ble and the common source line c - source are made electrically communicative with each other so that an electric current flows through them to bring the electric potential of the bit lines ble to a relatively low level , or level l . if , on the other hand , the threshold value of the selected memory cells is higher than the verify voltage , the bit lines ble and the common source line c - source are made electrically non - communicative with each other to bring the electric potential of the bit lines ble to a relatively high level , or level h . if the target threshold value of the memory cell is 0 . 4v , the verify voltage is reduced typically to 0 . 2v for a write verify operation in order to check if the threshold value of the memory cell is higher than a level slightly lower than the target threshold value , which is 0 . 2v in this embodiment , or not ( the first step operation of write verify “ 10 ”). the verify voltage is made equal to 0 . 4v and a write verify operation is conducted in order to check if the threshold value of the memory cell is higher than 0 . 4 or not ( the second step operation of write verify “ 10 ”). if the target threshold value of the memory cell is 1 . 4v , the verify voltage is reduced typically to 1 . 2v for a write verify operation in order to check if the threshold value of the memory cell is higher than a level slightly lower than the target threshold value , which is 1 . 2v in this embodiment , or not ( the first step operation of write verify “ 01 ”). the verify voltage is made equal to 1 . 4v and a write verify operation is conducted in order to check if the threshold value of the memory cell is higher than 1 . 4v or not ( the second step operation of write verify “ 01 ”). if the target threshold value of the memory cell is 2 . 4v , the verify voltage is reduced to 2 . 2v for a write verify operation in order to check if the threshold value of the memory cell is higher than a level slightly lower than the target threshold value , which is 2 . 2v in this embodiment , or not ( the first step operation of write verify “ 00 ”). the verify voltage is made equal to 2 . 4v and a write verify operation is conducted in order to check if the threshold value of the memory cell is higher than 2 . 4 or not ( the second step operation of write verify “ 00 ”). fig8 is a graph illustrating the changing threshold value of memory cells of a known flash memory and a data writing method adapted to use such a changing threshold value . in fig8 , the small white squares indicate the threshold value and the write control voltage ( the voltage of the bit line bl ) to be supplied to a memory cell where a data can be easily written , whereas the small black squares indicate the threshold value and the write control voltage ( the voltage of the bit line bl ) to be supplied to a memory cell where a data can be hardly written . the two memory cells stores the data of a same page . the data are erased from both of them in the initial state and they show a negative threshold value . the write voltage vpgm is divided into a number of pulses and the pulses are made to rise stepwise typically by 0 . 2v at a time . in other words , the write voltage vpgm increased with a stepwise increment dvpgm of 0 . 2v per pulse . as the voltage of the bit line bl that is the write control voltage is made equal to 0v , the threshold value rises at a rate of 0 . 2v / pulse which is equal to the increment of the write voltage vpgm after several pulses . a write verify operation is conducted after the application of each write pulse and the write operation is inhibited at each memory cell whose threshold value , becomes to a bit line voltage vdd of the memory cell detected to have got to the level of the write verify voltage . thus , the threshold value shows a distribution width of 0 . 2v . fig9 is a graph illustrating the changing threshold value of a memory cell of the first embodiment of multi - value flash memory according to the invention and a data writing method adapted to use such a changing threshold value . as in the case of fig8 , the small white squares indicate the threshold value and the write control voltage ( the voltage of the bit line bl ) to be supplied to a memory cell where a data can be easily written , whereas the small black squares indicate threshold values and a write control voltage ( the voltage of the bit line bl ) to be supplied to a memory cell where a data can be hardly written . the two memory cells stores the data of the respective columns of a same page . the data are erased from both of them in the initial state and they show a negative threshold value . the write voltage vpgm is divided into a number of pulses and the pulses are made to rise stepwise typically by 0 . 2v at a time . in other words , the write voltage vpgm increases with a stepwise increment dvpgm of 0 . 2v per pulse . the voltage of the bit line bl that is the write control voltage is made equal to 0v and a first step write operation is conducted . in the first step write operation , the threshold value rises at a rate of 0 . 2v / pulse which is equal to the increment of the write voltage vpgm after the supplied several pulses . a first step write verify operation or a second step write verify operation is conducted after the application of each write pulse . the voltage of the bit line of the memory cell whose threshold value has got to the first step write verify voltage is subsequently increased to 0 . 4v and the second step write operation is conducted on a memory cell by memory cell basis . the voltage of the bit line of the memory cell whose threshold value has got to the second step write verify voltage is subsequently brought to vdd to inhibit any write operation on a memory cell by memory cell basis . in the second step write operation , the rising rate of the threshold value is held lower than the 0 . 2v / pulse of the first step write operation for several pulses . in other words , while the voltage of the bit lines bl , or the write control voltage , is 0v in the first step write operation , it rises to 0 . 4 in the second step write operation . therefore , it is more difficult to write data in the second step write operation than in the first step write operation . the rising rate of the threshold value in the second step write operation is typically held within a range between 0v / pulse and 0 . 05v / pulse . in other words , the threshold value shows a distribution width of as small as 0 . 05v in the second step write operation . if the write pulse width is 20 μsec . and the time required for a write verify operation is 5 μsec ., the duration of a write operation is conventionally ( 20 μsec .+ 5 μsec . )× 18 pulses = 450 μsec . conventionally , the voltage increment dvpgm of write voltage vpgm needs to be made equal to 0 . 05v , or a quarter of 0 . 2v , in order to realize a threshold value distribution width of 0 . 05v . then , the duration of a write operation is 450 μsec × 4 = 1800 μsec . on the other hand , with this embodiment , as shown in fig9 , it is possible to realize a threshold value distribution width of 0 . 05v by using a voltage increment dvpgm of 0 . 2v / pulse so that the duration of a write time is ( 20 μsec .+ 5 μsec .+ 5 μsec . )× 20 pulses = 600 μsec . thus , the duration of the write operation necessary for realizing a threshold value distribution width of 0 . 05v in this embodiment is reduced to a third of that of the above known device . “ 10 ” is written by using a “ 10 ” first step write verify voltage and a “ 10 ” second step write verify voltage respective for first step write verify voltage and for the second step write verify voltage . fig1 is a graph illustrating the method for writing a higher order page data into a same memory cell and the change with time of the threshold value of the memory of the first embodiment . as in the case of fig8 and 9 , the small white squares indicate the threshold value and the write control voltage ( the voltage of the bit line bl ) to be supplied to a memory cell where a data can be easily written , whereas the small black squares indicate threshold values and a write control voltage ( the voltage of the bit line bl ) to be supplied to a memory cell where a data can be hardly written . the two memory cells stores the data of the respective columns of a same page . the data in the memory cell whose write control voltage is indicated by white squares , where a data can be easily written , is erased in the initial state and the memory cell shows a negative threshold value . assume that a date is written in the memory cell to make it show to show a “ 01 ” state . a data is already written in the memory cell whose write control voltage is indicated by black squares to make it show a “ 10 ” state in the initial state . assume that a data is written to the memory cell to make it show a “ 00 ” state . the write voltage vpgm is divided into a number of pulses and the pulses are made to rise stepwise typically by 0 . 2v at a time . in other words , the write voltage vpgm increases with a stepwise increment dvpgm of 0 . 2v per pulse . the voltage of the bit line bl that is the write control voltage is made equal to 0v and a first step write operation is conducted . in the first step write operation , the threshold value rises at a rate of 0 . 2v / pulse which is equal to the increment of the write voltage vpgm after several pulses . a “ 01 ” first step write verify operation is conducted after the application of each write pulse . after the write operation using a threshold value slightly lower than the target threshold value , a “ 01 ” second step write verify operation is conducted after the application of each write pulse . thereafter , a “ 00 ” first step write verify operation and a “ 00 ” second step write verify operation are conducted . when the threshold value of the memory cell indicated by white squares is detected to have got to the “ 01 ” first step write verify voltage , subsequently the bit line voltage is made equal to 0 . 4v and the process proceeds to the second step write operation . when the threshold value of the memory cell indicated by black squared is detected to have got to the “ 00 ” first step write verify voltage , subsequently the bit line voltage is made equal to 0 . 4v and the process proceeds to the second step write operation . furthermore , when the threshold value of the memory cell indicated by white squares is detected to have got to the “ 01 ” second step write verify voltage , subsequently the bit line voltage is made equal to vdd and the write operation is inhibited . finally , when the threshold value of the memory cell indicated by black squares is detected to have got to the “ 00 ” second step write verify voltage , subsequently the bit line voltage is made equal to vdd and the write operation is inhibited . after the second step write operation starts for both the data “ 01 ” and the data “ 00 ”, the increment of the threshold value is typically held within a range between about 0v / pulse and 0 . 05v / pulse for several pulses of the write voltage . therefore , the threshold value shows only a distribution width of 0 . 05v . fig1 is a graph illustrating the signal waveforms of different parts of the first embodiment of flash memory according to the invention when writing a lower order page data into a single memory cell . referring to fig1 , the write step continues from time tp 0 to time tp 7 . a write pulse is applied during this period . the “ 10 ” first step write verify operation continues from time tfv 0 to time tfv 6 . then , the period of time from time tsv 0 to time tsv 6 is assigned to the “ 10 ” second step write verify operation . in this instance , it is assumed that the word line wl 2 and the even - numbered bit lines ble are selected . in the write step , the voltage of the bit lines ble that is the write control voltage is brought to 0v for the first step write operation and to 0 . 4v for the second step write operation , whereas it is brought to vdd ( e . g ., 2 . 5v ) when any write operation is inhibited . in each write verify period , firstly the bit lines ble is charged typically to 0 . 7v . thereafter , when the selected word line wl 2 has gets to the write verify voltage , the bit lines ble is held to 0 . 7v if the threshold value of the memory cell has got to the write verify voltage but the voltage of the bit lines ble is reduced toward 0v if the threshold value of the memory cell has not got to the write verify voltage . if the threshold value of the memory cell has got to the write verify voltage or not can be detected by observing the voltage of the bit lines ble by means of a sense amplifier at timing of time tfv 4 or tsv 4 . if the threshold value of the memory cell has got to the write verify voltage , the detecting operation is successfully completed . fig1 is a flow chart schematically illustrating the control algorithm of the first embodiment of flash memory according to the invention when writing a lower order page data into a single memory cell . the control operation starts with receiving a data input command from the host and placing the data input command in the state machine 8 ( s 1 ). then , the operation proceeds to receiving an address data from the host and placing the address in the state machine 8 to select the page to be used for a write operation ( s 2 ). thereafter , the operation proceeds to a step of receiving data to be written in a page and storing them correspondingly in the respective data storage sections ds 1 ( s 3 ). subsequently , the operation proceeds to a step of receiving a write command issued from the host and placing the write command in the state machine 8 ( s 4 ). as the write command is placed , the operation of steps s 5 through s 16 is automatically started by the state machine 8 in the inside . the data stored in the data storage sections ds 1 are copied respectively to the corresponding data storage sections ds 2 ( s 5 ). thereafter , 12v is selected for the initial value of the write voltage vpgm and the write counter pc is set to 0 ( s 6 ). if the data in the data storage sections ds 1 are “ 0 ” s and the data in the data storage sections ds 2 are also “ 0 ” s , they indicate a first step write operation and , therefore , the voltage of the bit lines ble that is the write control voltage is reduced to 0v . if , on the other hand , the data in the data storage sections ds 1 are “ 0 ” s and the data in the data storage sections ds 2 are “ 1 ” s , they indicate a second step write operation and , therefore , the voltage of the bit lines ble that is the write control voltage is brought to 0 . 4v . if , finally , the data in the data storage sections ds 1 are “ 1 ” s and the data in the data storage sections ds 2 are also “ 1 ” s , they indicate write inhibition and , therefore , the voltage of the bit lines ble that is the write control voltage is brought to vdd ( s 7 ). then , the operation proceeds to the write step of applying a write pulse to the memory cells for storing the data of a page by using the selected write voltage vpgm and the write control voltage ( s 8 ). in the next step , if all the data stored in the data storage sections ds 2 are “ 1 ” s or not is checked and , if they are all “ 1 ” s , it is determined that the status of the first step is satisfactory whereas , if all the data stored in the data storage sections ds 2 are not “ 1 ” s , it is determined that the status of the first step is not satisfactory ( s 9 ). as will be described hereinafter , if all the data stored in the data storage sections ds 2 are “ 1 ” s , there is no memory cell where the first step write operation is conducted in the preceding write step ( s 8 ). if the status of the first step is satisfactory , a “ 10 ” first step write verify operation is started ( s 10 ) and the data of the data storage sections ds 2 corresponding to only the memory cells where the detection outcome is satisfactory out of the memory cells for storing the data of a page are shifted from “ 0 ” s to “ 1 ” s . the data storage sections ds 2 storing “ 1 ” s are made to keep on storing “ 1 ” s . when the status of the first step is satisfactory or when the “ 10 ” first step write verify operation is completed , a “ 10 ” second step write verify operation is started ( s 11 ). the data of the data storage sections ds 1 corresponding to only the memory cells where the detection outcome is satisfactory out of the memory cells for storing the data of a page are shifted from “ 0 ” s to “ 1 ” s . the data storage sections ds 1 storing “ 1 ” s are made to keep on storing “ 1 ” s . after the “ 10 ” second step write verify operation , if all the data stored in the data storage sections ds 1 are “ 1 ” s or not is checked and , if they are all “ 1 ” s , it is determined that the status of the second step is satisfactory whereas , if all the data stored in the data storage sections ds 2 are not “ 1 ” s , it is determined that the status of the second step is not satisfactory ( s 12 ). if the status of the second step is satisfactory , it is judged that the write operation has completed successfully and the status of the write operation is rated as satisfactory to terminate the write operation ( s 13 ). if , on the other hand , the status of the second step is not satisfactory , the write counter pc is checked ( s 14 ). if the reading of the write counter pc is not less than 20 , it is judged that the status of the write operation is failure and the write operation is terminated unsuccessfully ( s 15 ). if the reading of the write counter pc is not greater than 20 , the reading of the write counter pc is incremented by one and the write voltage vpgm is raised by 0 . 2v ( s 16 ). then , the operation is moved back to step s 7 and then the write operation of step s 8 is retried . it will be appreciated that the norm for the write operation is not necessarily be 20 and some other norm may be selected if appropriate . table 2 shows the relationship between the data of the data storage sections ds 1 and ds 2 before and after the “ 10 ” first step write verify operation and the threshold value ( vt ) of the corresponding memory cells of the write algorithm illustrated in fig1 . immediately before the n - th “ 10 ” first step write verify operation , the data of the data storage sections ds 1 and ds 2 are one of the combinations of 0 / 0 , 0 / 1 and 1 / 1 . the combination of 0 / 0 indicates that the threshold value of the memory cells has not got to the “ 10 ” first step write verify voltage by the n − 1 - th write step . the combination of 0 / 1 indicates that the threshold value of the memory cells has got to the “ 10 ” first step write verify voltage but not to the “ 10 ” second step write verify voltage by the n − 1 - th write step . the combination of 1 / 1 indicates that the threshold value of the memory cells has got to the “ 10 ” second step write verify voltage by the n − 1 - th write step . it is not possible that the threshold value of the memory cells has got to the “ 10 ” second step write verify voltage but not to the “ 10 ” first step write verify voltage by the n − 1 - th write step so that the combination of 1 / 0 does not exists in this embodiment . immediately before the first “ 10 ” first step write verify operation , the data of the data storage sections ds 1 and ds 2 are either of the combinations of 0 / 0 and 1 / 1 . if the threshold value of the memory cells has not got to 0 . 2v which is the “ 10 ” first step write verify voltage by the n - th write step , the detection outcome of the “ 10 ” first step write verify operation is not satisfactory so that the data in the data storage sections ds 2 are not changed . if , on the other hand , the threshold value of the memory cells has got to 0 . 2v , the detection outcome of the “ 10 ” first step write verify operation is satisfactory so that the data in the data storage sections ds 2 are shifted to “ 1 ” s . the data storage sections ds 2 storing “ 1 ” s are made to keep on storing “ 1 ” s . table 3 shows the relationship between the data of the data storage sections ds 1 and ds 2 before and after the “ 10 ” second step write verify operation and the threshold value of the corresponding memory cells of the write algorithm illustrated in fig1 . immediately before the n - th “ 10 ” second step write verify operation , the data of the data storage sections ds 1 and ds 2 are one of the combinations of 0 / 0 , 0 / 1 and 1 / 1 . the combination of 0 / 0 indicates that the threshold value of the memory cells has not got to the “ 10 ” first step write verify voltage after the end of the n - th write step . the combination of 0 / 1 indicates that the threshold value of the memory cells has got to the “ 10 ” first step write verify voltage by the n - th write step but not to the “ 10 ” second step write verify voltage by the n − 1th write step . the combination of 1 / 1 indicates that the threshold value of the memory cells has got to the “ 10 ” second step write verify voltage by the end of the n − 1 - th write step . it is not possible that the threshold value of the memory cells has got to the “ 10 ” second step write verify voltage by the n − 1th write step but not to the “ 10 ” first step write verify voltage by the n - th write step so that the combination of 1 / 0 does not exists in this embodiment . if the threshold value of the memory cells has not got to 0 . 4v which is the “ 10 ” second step write verify voltage by the n - th write step , the detection outcome of the “ 10 ” second step write verify operation is not satisfactory so that the data in the data storage sections ds 1 are not changed . if , on the other hand , the threshold value of the memory cells has got to 0 . 4v , the detection outcome of the “ 10 ” second step write verify operation is satisfactory so that the data in the data storage sections ds 1 are shifted to “ 1 ” s . the data storage sections ds 2 storing “ 1 ” s are made to keep on storing “ 1 ” s . the combination of 0 / 0 will not be changed by the “ 10 ” second write verify operation . fig1 is a flow chart schematically illustrating the control algorithm of the first embodiment of flash memory according to the invention when writing a higher order page data into a memory cell . referring to fig1 , the control operation starts with receiving a data input command from the host and placing the data input command in the state machine 8 ( s 1 ). then , the operation proceeds to receiving an address data from the host and placing the address in the state machine 8 to select the page to be used for a write operation ( s 2 ). thereafter , the operation proceeds to a step of receiving data to be written in a page and storing them correspondingly in the respective data storage sections ds 1 ( s 3 ). subsequently , the operation proceeds to a step of receiving a write command issued from the host and placing the write command in the state machine 8 ( s 4 ). as the write command is placed , the operation of steps s 5 through s 20 is automatically started by the state machine 8 in the inside . firstly , a “ 10 ” write operation is started ( s 5 ) and the operation is satisfactory ( the data of the memory cells are “ 10 ” s , “ 0 ” s are stored in the corresponding data storage sections ds 3 . if the operation is not satisfactory , “ 1 ” are stored in the corresponding data storage sections ds 3 . thereafter , the data stored in the data storage sections ds 1 are copied respectively to the corresponding storage sections ds 2 ( s 6 ). then , 14v is selected for the initial value of the write voltage vpgm and the write counter pc is set to 0 ( s 7 ). if the data in the data storage sections ds 1 are “ 0 ” s and the data in the data storage sections ds 2 are also “ 0 ” s , they indicate a first step write operation and , therefore , the voltage of the bit lines bl that is the write control voltage is set to 0v . if , on the other hand , the data in the data storage sections ds 1 are “ 0 ” s and the data in the data storage sections ds 2 are “ 1 ” s , they indicate a second step write operation and , therefore , the voltage of the bit lines bl that is the write control voltage is set to 0 . 4v . if , finally , the data in the data storage sections ds 1 are “ 1 ” s and the data in the data storage sections ds 2 are also “ 1 ” s , they indicate write inhibition and , therefore , the voltage of the bit lines bl that is the write control voltage is set to vdd ( s 8 ). then , the operation proceeds to the write step of applying a write pulse to the memory cells for storing the data of a page by using the selected write voltage vpgm and the write control voltage ( s 9 ). in the next step , in all the data storage circuits 20 where “ 0 ” s are stored in the data storage sections ds 3 , it is checked if all the data stored in the data storage sections ds 2 are “ 1 ” s or not and , if they are all “ 1 ” s , it is determined that the status of the “ 00 ” first step is satisfactory whereas , if all the data stored in the data storage sections ds 2 are not “ 1 ” s , it is determined that the status of the “ 00 ” first step is not satisfactory ( s 10 ). if all the data stored in the data storage sections ds 2 are “ 1 ” s , there is no memory cell where the “ 00 ” first step write operation is conducted in the preceding write step ( s 9 ). if the status of the “ 00 ” first step is not satisfactory , a “ 00 ” first step write verify operation is started ( s 11 ) and the data of the data storage sections ds 2 corresponding to only the memory cells where the detection outcome is satisfactory out of the memory cells for storing the data of a page are shifted from “ 0 ” s to “ 1 ” s , provided that the data in the data storage sections ds 3 are “ 0 ”. the data storage sections ds 2 storing “ 1 ” s are made to keep on storing “ 1 ” s . when the status of the “ 00 ” first step is satisfactory or when the “ 00 ” first step write verify operation is completed , a “ 00 ” second step write verify operation is started ( s 12 ). the data of the data storage sections ds 1 corresponding to only the memory cells where the detection outcome is satisfactory out of the memory cells for storing the data of a page are shifted from “ 0 ” s to “ 1 ” s , provided that the data in the data storage section ds 3 are “ 0 ” s . the data storage sections ds 1 storing “ 1 ” s are made to keep on storing “ 1 ” s . thereafter , in all the data storage circuits 20 where “ 0 ” s are stored in the data storage sections ds 3 , it is checked if all the data stored in the data storage sections ds 2 are “ 1 ” s or not is checked , if they are all “ 1 ” s , it is determined that the status of the “ 01 ” first step is satisfactory whereas , if all the data stored in the data storage sections ds 2 are not “ 1 ” s , it is determined that the status of that step is not satisfactory ( s 13 ). as will be described hereinafter , if all the data stored in the data storage sections ds 2 are “ 1 ” s , there is no memory cell where the first step write operation is conducted in the preceding write step ( s 9 ). if the status of the “ 01 ” first step is not satisfactory , a “ 01 ” first step write verify operation is started ( s 14 ) and , in all the data storage circuits 20 where “ 0 ” s are stored in the data storage sections ds 3 , the data of the data storage sections ds 2 corresponding to only the memory cells where the detection outcome is satisfactory out of the memory cells for storing the data of a page are shifted from “ 0 ” s to “ 1 ” s , provided that the data in the data storage sections ds 3 are “ 0 ”. the data storage sections ds 2 storing “ 1 ” s are made to keep on storing “ 1 ” s . when the status of the “ 01 ” first step is satisfactory or when the “ 10 ” first step write verify operation is completed , a “ 10 ” second step write verify operation is started ( s 15 ). then , in all the data storage circuits 20 where “ 0 ” s are stored in the data storage sections ds 3 , the data of the data storage sections ds 1 corresponding to only the memory cells where the detection outcome is satisfactory out of the memory cells for storing the data of a page are shifted from “ 0 ” s to “ 1 ” s . the data storage sections ds 1 storing “ 1 ” s are made to keep on storing “ 1 ” s . after the “ 01 ” second step write verify operation , if all the data stored in the data storage sections ds 1 are “ 1 ” s or not is checked and , if they are all “ 1 ” s , it is determined that the status of the second step is satisfactory whereas , if all the data are not “ 1 ” s , it is determined that the status of the second step is not satisfactory ( s 16 ). if the status of the second step is satisfactory , it is judged that the write operation has completed successfully and the status of the write operation is rated as satisfactory to terminate the write operation ( s 17 ). if , on the other hand , the status of the second step is not satisfactory , the write counter pc is checked ( s 18 ). if the reading of the write counter pc is not less than 20 , it is judged that the status of the write operation is failure and the write operation is terminated unsuccessfully ( s 19 ). if the reading of the write counter pc is not greater than 20 , the reading of the write counter pc is incremented by one and the write voltage vpgm is raised by 0 . 2v ( s 20 ). then , the operation is moved back to step s 8 and then the write operation of step s 9 is retried . it will be appreciated that the norm for the write operation is not necessarily be 20 and some other norm may be selected if appropriate . table 4 shows the relationship between the data of the data storage sections ds 1 , ds 2 and ds 3 before and after the “ 10 ” first step write verify operation and the threshold value ( vt ) of the corresponding memory cells of the write algorithm illustrated in fig1 . immediately before the n - th “ 01 ” first step write verify operation , the data of the data storage sections ds 1 , ds 2 and ds 3 are one of the combinations of 0 / 0 / 1 , 0 / 1 / 1 , 1 / 1 / 1 , 0 / 0 / 0 , 0 / 1 / 0 and 1 / 1 / 0 . the combination of 0 / 0 / 1 indicates that the threshold value of the memory cells has not got to the “ 01 ” first step write verify voltage by the n − 1 - th write step . the combination of 0 / 1 / 1 indicates that the threshold value of the memory cells has got to the “ 01 ” first step write verify voltage but not to the “ 01 ” second step write verify voltage by the n − 1 - th write step . the combination of 1 / 1 / 1 indicates that the threshold value of the memory cells has got to the “ 01 ” second step write verify voltage by the n − 1 - th write step . it is not possible that the threshold value of the memory cells has got to the “ 01 ” second step write verify voltage but not to the “ 01 ” first step write verify voltage by the n − 1 - th write step so that the combination of 1 / 0 / 0 does not exists in this embodiment . if the threshold value of the memory cells has not got to 1 . 2v which is the “ 01 ” first step write verify voltage by the n - th write step , the detection outcome of the “ 01 ” second step write verify operation is not satisfactory so that the data in the data storage sections ds 2 are not changed . if , on the other hand , the threshold value of the memory cells has got to 1 . 2v , the detection outcome of the “ 01 ” first step write verify operation is satisfactory so that the data in the data storage sections ds 2 are shifted to “ 1 ” s . the data storage sections ds 2 storing “ 1 ” s are made to keep on storing “ 1 ” s . the combinations of 0 / 0 / 0 , 0 / 1 / 0 and 1 / 1 / 0 do not constitute any objects of the first step write verify operation so that they are not changed . table 5 shows the relationship between the data of the data storage sections ds 1 , ds 2 and ds 3 before and after the “ 01 ” second step write verify operation and the threshold value ( vt ) of the corresponding memory cells of the write algorithm illustrated in fig1 . immediately before the n - th “ 01 ” second step write verify operation , the data of the data storage sections ds 1 , ds 2 and ds 3 are one of the combinations of 0 / 0 / 1 , 0 / 1 / 1 , 1 / 1 / 1 , 0 / 0 / 0 , 0 / 1 / 0 and 1 / 1 / 0 . the combination of 0 / 0 / 1 indicates that the threshold value of the memory cells has not got to the “ 01 ” first step write verify voltage after the n - th write step . the combination of 0 / 1 / 1 indicates that the threshold value of the memory cells has got to the “ 01 ” first step write verify voltage by the n - th write step but not to the “ 01 ” second step write verify voltage by the n − 1 - th write step . the combination of 1 / 1 / 1 indicates that the threshold value of the memory cells has got to the “ 01 ” second step write verify voltage by the n − 1 - th write step . it is not possible that the threshold value of the memory cells has got to the “ 01 ” second step write verify voltage by the n − 1 - th write step but not to the “ 01 ” first step write verify voltage by the n - th write step so that the combination of 1 / 0 / 1 does not exists in this embodiment . if the threshold value of the memory cells has not got to 1 . 4v which is the “ 01 ” second step write verify voltage by the n - th write step , the detection outcome of the “ 01 ” second step write verify operation is not satisfactory so that the data in the data storage sections ds 1 are not changed . if , on the other hand , the threshold value of the memory cells has got to 1 . 4v , the detection outcome of the “ 01 ” second step write verify operation is satisfactory so that the data in the data storage sections ds 1 are shifted to “ 1 ” s . the data storage sections ds 2 storing “ 1 ” s are made to keep on storing “ 1 ” s . the combination of 0 / 0 / 1 will not be changed by the “ 01 ” second write verify operation . the combinations of 0 / 0 / 0 , 0 / 1 / 0 and 1 / 1 / 0 do not constitute any objects of the first step write verify operation so that they are not changed . table 6 shows the relationship between the data of the data storage sections ds 1 , ds 2 and ds 3 before and after the “ 00 ” first step write verify operation and the threshold value ( vt ) of the corresponding memory cells of the write algorithm illustrated in fig1 . immediately before the n - th “ 00 first step write verify operation , the data of the data storage sections ds 1 , ds 2 and ds 3 are one of the combinations of 0 / 0 / 1 , 0 / 1 / 1 , 1 / 1 / 1 , 0 / 0 / 0 , 0 / 1 / 0 and 1 / 1 / 0 . the combination of 0 / 0 / 0 indicates that the threshold value of the memory cells has not got to the “ 00 ” first step write verify voltage by the n − 1 - th write step . the combination of 0 / 1 / 0 indicates that the threshold value of the memory cells has got to the “ 00 ” first step write verify voltage but not to the “ 00 ” second step write verify voltage by the n − 1 - th write step . the combination of 1 / 1 / 0 indicates that the threshold value of the memory cells has got to the “ 00 ” second step write verify voltage . it is not possible that the threshold value of the memory cells has got to the “ 00 ” second step write verify voltage but not to the “ 00 ” first step write verify voltage by the n − 1 - th write step so that the combination of 1 / 0 / 0 does not exists in this embodiment . if the threshold value of the memory cells has not got to 2 . 2v which is the “ 00 ” first step write verify voltage by the n - th write step , the detection outcome of the “ 00 ” first step write verify operation is not satisfactory so that the data in the data storage sections ds 2 are not changed . if , on the other hand , the threshold value of the memory cells has got to 2 . 2v by the n - th writer step , the detection outcome of the “ 00 ” first step write verify operation is satisfactory so that the data in the data storage sections ds 2 are shifted to “ 1 ” s . the data storage sections ds 2 storing “ 1 ” s are made to keep on storing “ 1 ” s . the combinations of 0 / 0 / 1 , 0 / 1 / 1 and 1 / 1 / 1 do not constitute any objects of the first step ; very operation so that they are not changed . table 7 shows the relationship between the data of the data storage sections ds 1 , ds 2 and ds 3 before and after the “ 00 ” second step write verify operation and the threshold value ( vt ) of the corresponding memory cells of the write algorithm illustrated in fig1 . immediately before the n - th “ 00 ” second step write verify operation , the data of the data storage sections ds 1 , ds 2 and ds 3 are one of the combinations of 0 / 0 / 1 , 0 / 1 / 1 , 1 / 1 / 1 , 0 / 0 / 0 , 0 / 1 / 0 and 1 / 1 / 0 . the combination of 0 / 0 / 0 indicates that the threshold value of the memory cells has not got to the “ 00 ” first step write verify voltage after the n - th write step . the combination of 0 / 1 / 0 indicates that the threshold value of the memory cells has got to the “ 00 ” first step write verify voltage by the n - th write step but not to the “ 00 ” second step write verify voltage by the n − 1 - th write step . the combination of 1 / 1 / 0 indicates that the threshold value of the memory cells has got to the “ 00 ” second step write verify voltage by the n − 1 - th write step . it is not possible that the threshold value of the memory cells has got to the “ 00 second step write verify voltage by the n − 1 - th write step but not to the “ 00 first step write verify voltage by the n - th write step so that the combination of i / o / 0 does not exists in this embodiment . if the threshold value of the memory cells has not got to 2 . 4v which is the “ 00 ” second step write verify voltage by the n - th write step , the detection outcome of the “ 00 ” second step write verify operation is not satisfactory so that the data in the data storage sections ds 1 are not changed . if , on the other hand , the threshold value of the memory cells has got to 2 . 4v , the detection outcome of the “ 00 ” second step write verify operation is satisfactory so that the data in the data storage sections ds 1 are shifted to “ 1 ” s . the data storage sections ds 1 storing “ 1 ” s are made to keep on storing “ 1 ” s . the combination of 0 / 0 / 0 will not be changed by the “ 00 ” second write verify operation . the combinations of 0 / 0 / 1 , 0 / 1 / 1 and 1 / 1 / 1 do not constitute any objects of the first step ; very operation so that they are not changed . fig1 is a flow chart schematically illustrating the control algorithm of the first embodiment of flash memory according to the invention for controlling the order of writing data into the blocks . firstly , the word line wl 0 is selected and lower order data are written into a page constituted by a plurality of memory cells connected to even - numbered bit lines . secondly , lower order data are written into a page constituted by a plurality of memory cells connected to odd - numbered bit lines . thirdly , higher order data are written into a page constituted by a plurality of memory cells connected to even - numbered bit lines . finally , higher order data are written into a page constituted by a plurality of memory cells connected to odd - numbered bit lines . then , data are written in a similar manner by sequentially using the remaining word lines wl 1 , wl 2 , wl 3 , . . . , observing the above sequence . with this arrangement , the interference of the floating gates of adjacent memory cells can be minimized . in other words , if a memory cell where a data is written subsequently shifts its state from “ 11 ” to “ 10 ”, from “ 11 ” to “ 01 ” or from “ 10 ” to “ 00 ”, a shift from “ 11 ” to “ 00 ” never takes place . the shift from “ 11 ” to “ 00 ” raises the threshold value of adjacent memory cells most . fig1 is a flow chart schematically illustrating the control algorithm of the first embodiment of flash memory according to the invention when reading the lower order page data stored in a memory cell . the control operation starts with receiving a read command from the host and placing the read command in the state machine 8 ( s 1 ). then , the operation proceeds to receiving an address data from the host and placing the address in the state machine 8 to select the page to be used for a read operation ( s 2 ). as a result of the addressing , the operation of steps s 3 through s 5 is automatically started by the state machine 8 in the inside . firstly , a “ 01 ” read operation is started ( s 3 ). a voltage of 1v is supplied to the word line wl for the “ 01 ” read operation . “ 1 ” is produced by the reading operation of the sense amplifier if the threshold value of the memory cell is lower than the “ 01 ” data , whereas “ 0 ” is produced if the threshold value of the memory cell is higher than “ 01 ” data . the outcome of the read operation is stored in the corresponding data storage section ds 3 . thereafter , a “ 10 ” read operation is started ( s 4 ). a voltage of 0v is supplied to the word line wl for the “ 10 ” read operation . “ 1 ” is produced by the reading operation of the sense amplifier if the threshold value of the memory cell is lower than the “ 10 ” data , whereas “ 0 ” is produced if the threshold value of the memory cell is higher than “ 10 ” data . the outcome of the read operation is stored in the corresponding data storage section ds 2 . lastly , a “ 00 ” read operation is started ( s 5 ). a voltage of 2v is supplied to the word line wl for the “ 00 ” read operation . “ 1 ” is produced by the reading operation of the sense amplifier if the threshold value of the memory cell is lower than the “ 00 ” data , whereas “ 0 ” is produced if the threshold value of the memory cell is higher than “ 00 ” data . the lower order page data is produced by a logical operation using the outcome of the “ 00 ” read operation and the data stored in the corresponding data storage sections ds 2 and ds 3 and stored in the corresponding data storage section ds 1 . the data stored in the data storage section ds 1 is output as lower order page data . for example , if the outcome of the operation of reading “ 01 ” stored in the data storage section ds 3 is “ 1 ” and that of the operation of reading “ 10 ” stored in the data storage section ds 2 is also “ 1 ”, “ 1 ” is produced by the logical operation using the lower order page data . if the outcome of the operation of reading “ 01 ” stored in the data storage section ds 3 is “ 1 ” and that of the operation of reading “ 10 ” stored in the data storage section ds 2 is “ 0 ”, “ 0 ” is produced by the logical operation using the lower order page data . if the outcome of the operation of reading “ 01 ” stored in the data storage section ds 3 is “ 0 ” and that of the operation of reading “ 00 ” is also “ 0 ”, “ 0 ” is produced by the logical operation using the lower order page data . the outcome of the operation of reading “ 01 ” stored in the data storage section ds 3 is “ 0 ” and that of the operation of reading “ 00 ” is “ 1 ”, “ 1 ” is produced by the logical operation using the lower order page data . in short , the logic circuit for carrying out such logical operations needs to be so arranged that the value of the ds 2 is stored in the data storage section ds 1 as lower order page data when ds 3 is “ 1 ” and the outcome of reading “ 01 ” is stored in the data storage section ds 1 as lower order page data when ds 3 is “ 0 ”. fig1 is a flow chart schematically illustrating the control algorithm of the first embodiment of flash memory according to the invention when reading the higher order page data stored in a memory cell . the control operation starts with receiving a read command from the host and placing the read command in the state machine 8 ( s 1 ). then , the operation proceeds to receiving an address data from the host and placing the address in the state machine 8 to select the page to be used for a read operation ( s 2 ). as a result of the addressing , the operation of step s 3 is automatically started by the state machine 8 in the inside . firstly , a “ 01 ” read operation is started in step s 3 . the outcome of the reading operation shows upper order page data , which is stored in the corresponding data storage section ds 1 . in other words , the outcome of the operation of reading “ 01 ” is used as upper order page data . then , the data in the data storage section ds 1 is externally output . in this way , with the multi - value flash memory of the first embodiment , it is now possible to suppress any undesired increase of write time and reduce the distribution width of a threshold value so as to improve the reliability of the device . fig1 a is a graph illustrating the signal waveforms in a write step of the first embodiment of flash memory according to the invention as extracted from the signal waveform of fig1 . note that the voltage of the bit lines ble is made equal to 0 . 4v to carry out a second step write operation . in a write step of the first embodiment , the write operation is conducted while the voltage of the bit lines bl that is the write control voltage is typically held to 0 . 4v during all the period of applying a predetermined write voltage ( e . g ., 18 . 0v as shown in fig1 a ) to the selected word line wl . fig1 b is a graph illustrating the signal waveforms in a write step of the second embodiment of flash memory according to the invention . as shown in fig1 b , the voltage of the bit lines bl that is the write control voltage is held to 0v for only a predetermined period twr out of all the period of applying the write voltage vpgm to the selected word line wl and subsequently brought to vdd in order to inhibit any write operation thereafter . the predetermined period twr for which the voltage of the bit lines bl is held to 0v is determined in such a way that the duration of the second step write operation is shorter that of the first step write operation . then , the increment of the threshold value for the second step write operation can be made smaller than that of the threshold vale for the first step write operation as in the case of the first embodiment . thus , with the second embodiment , the effective value of the write control voltage can be made substantially equal to that of the first embodiment where the voltage of the bit lines bl that is the write control voltage is held to a constant level during the entire write step to consequently bring about the advantages of the first embodiment . fig1 is a graph illustrating the signal waveforms of different parts of the third embodiment of flash memory according to the invention when writing a data into a single memory cell . it will be appreciated that fig1 corresponds to the waveforms of fig1 . as described above by referring to fig1 , with the first embodiment , the voltage of the bit lines is reset to 0v after the end of a first step write verify operation even when it maintains the voltage level observed immediately after a charging operation and then the bit lines are electrically recharged for a second step write verify operation . on the other hand , with the third embodiment a write verify operation is conducted in a manner as described below . the bit lines ble are electrically charged typically to 0 . 7v for a first step write verify operation . as the selected word line wl 2 gets to the first step write verify voltage , the bit lines ble maintain the 0 . 7v if the threshold value of the memory cell has got to the first step write verify voltage . however , the voltage of the bit lines ble falls toward 0v if the threshold value of the memory cell has not got to the first step write verify voltage . if the threshold value of the memory cell has got to the first step write verify voltage or not can be detected by observing the voltage of the bit lines ble by means of a sense amplifier at timing of tfv 4 shown in fig1 . if the threshold value of the memory cell has got to the write verify voltage , the detecting operation is successfully completed . thereafter , at timing of tfv 5 of tfv 3 , the voltage of the selected word line wl 2 is switched from the first step write verify voltage to the second step write verify voltage . for example , the voltage of the selected word line wl 2 may be raised from 0 . 2v to 0 . 4v as shown in fig1 . if the threshold value of the memory cell has got to the second step write verify voltage , the 0 . 7v of the bit lines ble is maintained . if , on the other hand , the threshold value of the memory cell has not got to the second step write verify voltage , the voltage of the bit lines ble falls toward 0v . if the threshold value of the memory cell has got to the second step write verify voltage or not can be checked by detecting the voltage of the bit lines ble at the timing of tsv 4 . if the threshold value of the memory cell has got to the write verify voltage , the outcome of the detection is satisfactory . the third embodiment provides an advantage of eliminating the time necessary for charging the bit lines for a second step write verify operation and achieving a higher data writing rate in addition to the advantages of the first embodiment . it will be appreciated that the above description applies to a first or second step write verify operation with data “ 01 ” or data “ 00 ” by changing the write verify voltage . while the above embodiments are described in terms of storing a 2 - bit data , or a 4 - valued data , in a single memory cell , it will be appreciated that embodiments adapted to store a higher valued data in a single memory can easily be realized . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents . | 6 |
a toy in accordance with the invention is intended herein to broadly embrace any and all suitable structural configurations providing at least two regions , each of which , due to differing physical characteristics of the regions themselves or by virtue of positional placement of other structure of the toy , is accessed to a relatively greater or lesser degree by a dog when picking up the toy in its mouth . it will be understood that such suitable structural configurations are not intended herein to be limited to any precise shape or size , and selection of such parameters in the practice of the invention will often be dictated by design preference , and preferred manner and ease of gripping of the toy by both the user and the dog . the characteristics referred to above which control the respective relative degrees of animal interest in picking up the toy by one region or another may be sensory - based , i . e ., involving such factors as smell , taste , appearance , surface feel , hardness , etc ., and / or may be a structural feature which physically inhibits or discourages access by a dog &# 39 ; s mouth to a given one of the regions designed to be held by a user and therefore intended to be accessed to a lesser relative degree by the dog or other animal . referring now to the figures , fig1 and 2 depict an embodiment of the toy in accordance with the invention , generally designated 10 . in accordance with the illustrated example , toy 10 is structurally of elongated dimension and presents a general shape visually reminiscent of a bone , i . e ., having the appearance of enlarged end portions relative to a narrower central portion extending therebetween . as shown in the figures , toy 10 includes a bar 1 comprising a central region 1 a and opposed end regions defining two handles 1 b . a pair of shields 2 are disposed along the bar 1 in a position adjacent to the opposed ends thereof . shields 2 may be configured in any suitable shape which effectively restricts or inhibits access by the mouth of the animal to the handles 1 b , yet allows grasping thereof by a user inserting a hand 3 into an inner region 4 of shields . conveniently , the shields 2 are , for example as shown , cup - shaped , having open ends arranged to face outwardly in a direction along a longitudinal axis a , and as further shown , advantageously extend past terminal ends of handles 1 b . the openings in the shields 2 are preferably of sufficient size to permit the hand 3 to be inserted and to grasp the handle 1 b disposed therein , and yet advantageously still small enough to discourage a dog from trying to insert its snout in an attempt to bite the handle 1 b or the walls of the shield 2 . the shield can optionally include cutouts 5 , for example , to reduce wind resistence when thrown or just simply to give the toy 10 a more attractive appearance . the elongated central region 1 a , which serves to provide the animal access region , is advantageously appropriately dimensioned to be comfortably receivable between the jaws of a dog and can , if so desired , be textured , patterned , flavored , covered by any suitable material , etc ., to further enhance animal appeal . the handles 1 b , by virtue of being at least partially shrouded by shields 2 , serve to provide animal restricted regions . conveniently , in particular from the standpoint of manufacture and as shown in the example of fig1 and 2 , the handles 1 b are simply axial extensions of the elongated central region 1 a extending between the shields 2 , and having either the same , greater or lesser diameter for comfortable grasping by the user . during use , the user simply grabs either of the shielded handles 1 b and throws the toy 10 as one would throw a stick or the like . when retrieving the toy 10 from the ground after the toy 10 is thrown , the dog is presented with the elongated central region 1 a which is elevated above the ground by the greater diameter shields 2 disposed at opposed ends of the toy 10 which serve to support same on the ground , and the dog is therefore most likely to pick the toy up by the animal access region presented by elongated central region 1 a . it is noted that , although the particular example described above employs two handles 1 b , only one gripping region , conveniently in the form of a suitable handle structure , need be provided at one position of the toy 10 in accordance with an embodiment of the invention . the embodiment shown in fig1 and 2 is conveniently an integral structure , produced as one piece , for example , in practice , by injection molding or other suitable process . however , if so desired , the toy ( including embodiments later described herein or others made in accordance with practice of the invention ) may be comprised of an assembly of parts , for example in instances where injection molding of a unified toy is not a practical option , or where it is desired that the toy have different physical characteristics over different regions to achieve the objectives of the invention ( i . e ., to provide , for example , varying sensory - based stimulus ) or simply to provide a more visually appealing or comfortable feel for consumers at point of purchase and / or during use . fig3 a and 3 b illustrate merely two examples of the virtually limitless possibilities for such assemblies , as will be apparent to one skilled in the art . referring to fig3 a , a toy 10 ′ is comprised of a rod 1 ′ which includes a handle 1 b ′ and a central region 1 a ′ molded as an integral unit . a shield 2 ′ is made of a resilient material stretchable to a degree sufficient to permit assembly by slidable reception of the shield past the handle 1 b ′ thereby to allow a reception portion 2 a ′ of the shield 2 ′ to be captively received in a groove formed in the rod 1 ′ at an axial juncture of the handle 1 b ′ and the central region 1 a ′ when an applied stretching force is relieved . turning now to fig3 b , a toy 10 ″ includes a central member 1 a ″ made , for example , of a moderately rigid or shape - retaining material , and an outer sleeve 1 c ″ of a softer , and optionally , absorbent material , such as a pile , woven fabric , carpet - like material , etc .. referring now to fig4 and 5 , another embodiment of a toy is depicted , generally designated as numeral 20 . toy 20 includes a series of members 21 ( preferably at least three , and in the depicted example of fig4 and 5 , four ) having a longitudinal dimension running co - directionally with a central axis a ′ of the toy , and which are circumferentially spaced - apart about the central axis a ′ ( each equally spaced circumferentially 90 ° apart in the depicted example ) and having at least structural portions located radially outward from the central axis a ′. in a particularly advantageous variant of this embodiment , outermost edges of the members are shaped to collectively describe a generally spherical envelope , as shown in the particular example depicted . at least one hand - grasping region ( preferably two , as shown ) is provided , advantageously , though not necessarily , through which the central axis a ′ passes , and more advantageously in the form of a rod - shaped handle 22 ( preferably two rod - shaped handles 22 , as shown in the example ) longitudinally aligned with the central axis a ′. each of the members 21 and the handles 22 are mutually secured , either by integral molding , fabrication , or assembly . radially outward portions 21 a of the members 21 are extended outward from a center c of the toy 20 in the axial direction such that they extend past an axial position of an inwardmost end of the handle 22 a , thereby at least partially shielding the handles 22 , such that the handles 22 serve to provide the animal restricted regions . in a preferred case , two handles 22 disposed in opposed positions along the central axis a ′ are provided ( as shown in fig4 ), and terminal ends 21 b of the members 21 extend approximately to an axial position p corresponding to outwardly facing terminal ends 22 b of the handles 22 , thereby advantageously shielding handles 22 over a major , or substantially entire , portion of their axial extent . in the presently described embodiment , the circumferentially spaced - apart members 21 each presents an animal access region , particularly accessible by the animal at the radially outward portions 21 a of the members 21 . it should be noted that by virtue of the geometry of this depicted embodiment of fig4 and 5 , the toy 20 is self - righting , i . e ., when tossed onto a relatively horizontal surface , the toy 20 will come to rest with the handles ( and central axis a ′) extending horizontally , and generally parallel with the support surface . this feature provides particular advantage , since when thrown during , for example , fetch play , the toy 20 will right itself in this manner , thereby orienting the circumferentially spaced - apart members 21 , each which presents an animal access region , in a raised position from the ground so as to be particularly accessible by the animal . it is noted that by selecting an appropriate center of gravity , alternative toy designs having other configurations can incorporate this self - righting feature . gripping regions , shown in the depicted example in the form of handles 22 , and which provide the animal restricted regions , need not be in the form of formal handle structure as in the present example , but instead may rather simply be comprised of a hand - retainable region accessible by a hand of a user , which region is at least partially shielded by the terminal end structure of the members 21 providing the animal access regions . an example of such embodiment is depicted in fig6 and 7 , in which an alternate toy embodiment is depicted , generally at 30 . toy 30 includes three members 31 spaced apart circumferentially about a central axis a ″. in the example shown , although not essential to practice of the invention , the members are equally spaced circumferentially by angular intervals of 120 °. the present embodiment is made in general accordance with the above - discussed considerations as the prior - described embodiment , and therefore description of analogous features need not be repeated , and only the notable differences will be addressed . in the embodiment , formal handles are omitted , and hand gripping regions 32 are instead provided at a juncture of the members 31 where they meet at the central axis a ″ in a position axially inward of ( i . e ., recessed back from ) terminal ends 31 b of the members 31 , whereby the extended portions of members 31 proximate to the terminal ends 31 b thereof partially shield access by the animal to the gripping regions 32 which thereby serve to provide the animal restricted regions . it is noted that , alternative to a rod - like handle or a simple gripping region as described above , any number of other suitable configurations can be used in satisfactory manner to satisfy the spirit of the invention . for example , as depicted in fig8 another embodiment of a toy is shown , generally designated 40 . toy 40 is the same in form as the embodiment of fig6 and 7 , and description relating to analogous features , such as the members 41 ( corresponding to members 21 and 31 ) will therefore not be repeated . however , instead of a simple gripping region being provided in a position on the toy recessed back from terminal ends of the members , holes 43 are provided in a location corresponding to the gripping regions 32 in the embodiment of fig6 and 7 through which a rope 42 is passed in general alignment with a central axis a ′″. knots 42 a tied in the rope serve as convenient means for retaining the rope 42 to a remainder of the toy 40 . additional knots 42 b adjacent terminal ends of the rope 42 b optionally facilitate grabbing by a hand of the user . in this embodiment , the free end portions of each of the rope 42 serves as a handle providing the animal restricted regions designed to be accessed by the hand of the user and not the animal . it is noted that in each of the embodiments of fig4 - 8 , the members 21 , 31 , 41 have a cutout portion between the radially outward portions 21 a , 31 a , 41 a thereof and the central axis a ′, a ″, a ′″. however , such structural feature is not deemed essential to the invention , and the members could alternatively be made as solid fin - like structures which radiate from the central axis . additionally , such fin - like structures could optionally thicken in profile as they extend further from the axis to better provide a biting structure for the animal at the radially outermost regions most accessible by the snout of a dog . further examples illustrative of the vast many variations of designs possible which embody the disclosed invention are described with reference to fig9 and 11 . it will be understood in this context that other designs equally diverse in structure , and not shown by example , will fall within the embrace of the invention as contemplated . [ 0038 ] fig9 depicts a toy , generally designated 50 , which includes ropes 51 tensioned between a pair of opposed support members 52 ( retained to the supports by knots or other suitable means ). support members 52 are conveniently identical and are attached to one another end to end such that cup - shaped openings 52 a of the support members face in opposite directions . a handle 52 b is advantageously integrally molded as part of the support member , and serves as the animal restricted region . the ropes 51 , radially spaced from a central axis serve as the animal access regions . [ 0039 ] fig1 depicts a toy , generally designated 60 , which includes a handle 61 ( serving as the animal restricted region ) shrouded by a shielded portion 62 , and a ring portion 63 ( animal access region ), for typical access by a dog as shown . as with the previous embodiments , the toy 60 is made of suitable material of desired resiliency and weight . [ 0040 ] fig1 depicts a toy 70 , particularly suited for tug activities . in this embodiment , unlike the preceding embodiments , a handle 71 serving as the animal restricted region and shrouded by a shield 72 is disposed cross - wise to a central axis a ″″. a tug ring 73 for reception in a dog &# 39 ; s mouth , which serves as the animal access region , is disposed adjacent to the shield 72 , thereby allowing interactive tug play . in yet another embodiment , not depicted , a toy includes two regions each having a characteristic or more than one characteristic which , by virtue of a sensory response by the animal , creates a tendency for the animal to frequent one region more than another . in this regard , the characteristic in one region may be , for example , a taste preferred by the dog , and in the other region , one avoided , for example , a bitter flavor . in the alternative or in addition , smell , color , etc . may be used to discourage the dog to access an animal restricted region , and encourage access to the animal access region . in such dog toy , no particular configuration is important , and the toy may take , for example , the form of a simple rod , in which the animal access region is at one end portion and the animal restricted region on the other . it is noted that the foregoing embodiments described above herein merely represent a few of the myriad possible structural configurations which can embody the principles of the invention . in this regard , rather than being limited to specific structural arrangements and shapes , the intended scope of the invention contemplates design of any number of toys of desired shapes and sizes which take into account any of various parameters ascertained , at present of in the future , as contributing to the likelihood that an animal will frequent one region of toy more than another . in addition , it is further noted that other physical characteristics , in addition to those described specifically herein which exist at present or are discovered in the future as affecting animal behavior without harmful effect , may be suitably incorporated in a toy design practiced in accordance with the invention to influence an animal &# 39 ; s proclivity to access one region ( animal access region ) as opposed to another ( animal restricted region ), and the employment of such physical characteristics in alternative toy designs is contemplated to fall within the intended scope of the claimed invention . having described preferred embodiments of the invention with reference to the accompanying drawings , it is to be understood that the invention is not limited to those precise embodiments , and that various changes and modifications may be effected therein by one skilled in the art without departing from the scope or spirit of the invention as defined in the appended claims . | 0 |
hereinafter , a first preferred embodiment of the present invention will be discussed with reference to accompanying drawings . fig1 is a block diagram of a memory module according to the first preferred embodiment . a host system 1 and a memory module 2 are connected with each other via an interface 31 provided in the memory module 2 . the host system 1 outputs a command which designates an address of data which is expected to be read out (“ readout command ”) to the memory module 2 . also , the host system 1 processes data such as a program which is read out from a memory 4 provided in the memory module 2 . a body of a game machine is cited as an example of the host system 1 , and a game cartridge is cited as an example of the memory module 2 . the memory module 2 includes a memory controller 3 and the memory 4 . the memory controller 3 is able to control access to the memory 4 when the host system 1 reads out data from the memory 4 . also , the memory controller 3 is able to prevent the host system 1 from gaining direct access to the memory 4 when the host system 1 repeatedly reads out data from the memory 4 . because of the inclusion of the memory controller 3 , it is possible to avoid or suppress a “ read disturb ” phenomenon . a concrete method of avoiding or suppressing a “ read disturb ” phenomenon will be later described in detail . the memory 4 is a storage device for storing data which is read out by the host system 1 . in a case where the host system 1 is a body of a game machine , data stored in the memory 4 is a game program processed by the host system 1 . the memory 4 is a non - volatile memory , and further , in the first preferred embodiment , the memory 4 is a nand flash memory of a single - level cell ( slc ) type ( slc nand flash memory ). however , the present invention can be applied to the other types of non - volatile memories such as a nand flash memory of a multi - level cell ( mlc ) type ( mlc nand flash memory ) and a nor flash memory . the memory controller 3 includes the interface 31 , an address decoder 32 , an address comparator 33 , a data selector 34 , a rdy / bsy selector 35 , an access controller 36 , a buffer 37 , and the like . the interface 31 allows the host system 1 and the memory module 2 to exchange a readout command and read data therebetween . the address decoder 32 extracts an address at which data which is expected to be read out is stored (“ readout address ”) from a readout command which is received from the host system 1 . also , the address decoder 32 outputs the thus extracted readout address to the address comparator 33 and the access controller 36 . the address comparator 33 stores a readout address which is received from the address decoder 32 . then , the address comparator 33 compares a current readout address which has most recently been received , with a previous readout address which was received immediately before the current readout address . in a case where a current readout address and a previous readout address match each other , the address comparator 33 outputs a switching signal for switching to a buffer access path , to the data selector 34 and the rdy / bsy selector 35 . also , the address comparator 33 outputs a memory access denial signal to the access controller 36 . as a result , in reading out the same data that was previously read out by the host system 1 , it is impossible to gain access to the memory 4 and access to the buffer 37 is permitted . in a case where a current readout address and a previous readout address do not match each other , the address comparator 33 outputs a switching signal for switching to a memory access path , to the data selector 34 and the rdy / bsy selector 35 . also , the address comparator 33 outputs a memory access request signal to the access controller 36 . as a result of comparison between a current readout address and a previous readout address in the address comparator 33 , the task of reading out the same data that was previously read out by the host system 1 can be achieved by gaining access to the buffer 37 without a need for access to the memory 4 . accordingly , it is possible to avoid or suppress a “ read disturb ” phenomenon . the data selector 34 , in response to a switching signal for switching to a buffer access path which is received from the address comparator 33 , establishes access between the buffer 37 and the host system 1 . also , the data selector 34 , in response to a switching signal for switching to a memory access path which is received from the address comparator 33 , establishes access between the memory 4 and the host system 1 . the rdy / bsy selector 35 , in response to a switching signal for switching to a buffer access path which is received from the address comparator 33 , outputs an always rdy signal which indicates that the buffer 37 is always in a ready mode , to the host system 1 . also , the rdy / bsy selector 35 , in response to a switching signal for switching to a memory access path which is received from the address comparator 33 , outputs a rdy signal which indicates that the memory 4 is in a ready mode and a bsy signal which indicates that the memory 4 is in a busy mode , to the host system 1 . in a case where the host system 1 reads out data from the buffer 37 , by fixing a signal which indicates an operation mode of the buffer 37 to a rdy signal , it is possible to read out data from the buffer 37 at a high speed . the access controller 36 is able to control direct access to the memory 4 . more specifically , the access controller 36 , in response to a memory access denial signal received from the address comparator 33 , does not gain access to a readout address which is provided to the address comparator 33 from the address decoder 32 . also , the access controller 36 , in response to a memory access request signal received from the address comparator 33 , gains access to a readout address which is provided to the address comparator 33 from the address decoder 32 . the buffer 37 stores data which is read out by the host system 1 . when the host system 1 reads out data from the memory 4 , the buffer 37 newly reads out from the memory 4 and stores the same data as is read out by the host system 1 . on the other hand , when the host system 1 reads out data from the buffer 37 , the buffer 37 holds the read data which has already been stored therein without newly reading out from the memory 4 and storing the same data as is read out by the host system 1 . the buffer 37 must be a rewritable memory because the buffer 37 newly stores read data in some cases . in the first preferred embodiment , an sram is employed as the buffer 37 in order to increase a speed of access between the host system 1 and the buffer 37 . however , the present invention can be applied to a case where the buffer 37 is any other type of rewritable memory . below , a flow of processes for avoiding or suppressing a “ read disturb ” phenomenon in an information processor formed of the host system 1 and the memory module 2 as discussed above will be discussed . fig2 is a flow chart showing processes for reading out data by the host system 1 according to the first preferred embodiment . respective reference numerals beginning with “ s ” which indicate respective steps in fig2 correspond to the respective reference numerals beginning with “ s ” in fig1 . in the first preferred embodiment , the host system 1 reads out data on a page - by - page basis , and also , the buffer 37 is able to store a page of data . first , the memory module 2 is mounted onto the host system 1 . in a case where the host system 1 is a body of a game machine and the memory module 2 is a game cartridge , the memory module 2 is inserted into the host system 1 . then , the host system 1 is turned on . the access controller 36 acquires an initial value which is set by the address comparator 33 ( step s 1 ). note that each of an initial value and a current value which will be later described in detail corresponds to a top portion or the like of a page or a block . since the host system 1 reads out data on a page - by - page basis in the first preferred embodiment , each of an initial value and a current value corresponds to a top portion of a page . now , we will describe methods for setting an initial value in the address comparator 33 , giving specific examples . in a first method , a current value which was set by the address comparator 33 when the host system 1 was turned off before is employed as an initial value when the host system 1 is again turned on . in a second method , a specific initial value is set each time the host system 1 is turned on . in setting an initial value in the address comparator 33 , it is desirable that the memory module 2 includes a non - volatile memory which keeps storing an initial value even while the host system 1 is turned off . as a non - volatile memory which stores an initial value , a non - volatile memory provided within the address comparator 33 , a portion of the memory 4 which is a non - volatile memory , a distinct non - volatile memory which is additionally provided , and the like can be cited . alternatively , in the method in which a specific initial value is set each time the host system 1 is turned on , the memory 4 may be configured to store the specific initial value . after the access controller 36 acquires the initial value which is set by the address comparator 33 , the access controller 36 gains access to the memory 4 , to read out data at an address indicated by the initial value . then , the data read out by the access controller 36 is stored in the buffer 37 ( step s 2 ). by performing the above - discussed processes , an initial stage is completed . next , a readout command which is output from the host system 1 is input to the address decoder 32 via the interface 31 ( step s 3 ). the address decoder 32 extracts a readout address from the input readout command , and outputs the extracted readout address to the address comparator 33 and the access controller 36 ( step s 4 ). the address comparator 33 compares the address indicated by the initial value which is set in the step s 1 with the readout address which is received from the address decoder 32 ( step s 5 ). if the address indicated by the initial value and the readout address match each other , it means that data which is expected to be read out by the host system 1 and data which is stored in the buffer 37 in the step s 2 match each other . on the other hand , if the address indicated by the initial value and the readout address do not match each other , it means that data which is expected to be read out by the host system 1 and data which is stored in the buffer 37 in the step s 2 do not match each other . below , respective process flows in cases where the address indicated by the initial value and the readout address match , and do not match , each other will be discussed . first , consider a case where the address indicated by the initial value which is set in the step s 1 and the readout address which is received from the address decoder 32 match each other . in this case , the address comparator 33 outputs a switching signal “ 0 ” for switching to a buffer access path to the data selector 34 and the rdy / bsy selector 35 ( step s 6 ). also , the address comparator 33 outputs a memory access denial signal to the access controller 36 ( step s 7 ). the address comparator 33 updates the address indicated by the initial value which is set in the step s 1 to the readout address which is received from the address decoder 32 ( step s 8 ). a current value which has been described above with respect to the step s 1 represents the latter address . alternatively , since it is assumed that the two addresses match each other in the present case , the address comparator 33 may be controlled not to update the address indicated by the initial value which is set in the step s 1 . the access controller 36 , which receives a memory access denial signal , enters into an inoperative mode ( step s 9 ). also , the rdy / bsy selector 35 , which receives the switching signal “ 0 ” for switching to a buffer access path , outputs a rdy / bsy signal ( having a fixed value , “ 1 ”) to the host system 1 via the interface 31 . the rdy / bsy signal ( having a fixed value , “ 1 ”) is an always rdy signal regardless of an operation mode of the buffer 37 . the host system 1 performs polling of the rdy / bsy signal ( having a fixed value , “ 1 ”), to thereby read out the data which is stored in the buffer 37 in the step s 2 ( step s 10 ). in other words , the host system 1 is able to read out data from the buffer 37 at a high speed regardless of an operation mode of the buffer 37 . the buffer 37 holds the data which has been stored therein in the step s 2 ( step s 11 ). if the host system 1 is not turned off , processes will proceed from the step s 3 thereafter . a flow of the processes which will proceed thereafter will be briefly discussed at later paragraphs . if the host system 1 is turned off , no process is performed . as a result of the above - discussed process flow , in the case where the address indicated by the initial value which is set in the step s 1 and the readout address which is received from the address decoder 32 match each other , the host system 1 gains access to the buffer 37 without a need for access to the memory 4 , to thereby read out data while avoiding or suppressing a “ read disturb ” phenomenon . next , consider a case where the address indicated by the initial value which is set in the step s 1 and the readout address which is received from the address decoder 32 do not match each other . in this case , the address comparator 33 outputs a switching signal “ 1 ” for switching to a memory access path to the data selector 34 and the rdy / bsy selector 35 ( step s 12 ). also , the address comparator 33 outputs a memory access request signal to the access controller 36 ( step s 13 ). the address comparator 33 updates the address indicated by the initial value which is set in the step s 1 to the readout address which is received from the address decoder 32 ( step s 14 ). a current value which has been discussed above with respect to the step s 1 represents the latter address . the access controller 36 , which receives a memory access request signal , gains access to the readout address which is provided to the address comparator 33 from the address decoder 32 ( step s 15 ). on the other hand , the rdy / bsy selector 35 , which receives the switching signal “ 1 ” for switching to a memory access path , outputs a rdy / bsy signal to the host system 1 via the interface 31 . the host system 1 performs polling of the rdy / bsy signal , to confirm that the memory 4 is in a ready mode , and then , reads out data stored in the memory 4 ( step s 16 ). the buffer 37 updates the data which is stored in the step s 2 to the data which is read out by the host system 1 ( step s 17 ). if the host system 1 is not turned off , processes will proceed from the step s 3 thereafter . more specifically , the address comparator 33 compares a new readout address designated by a new readout command which is output from the host system 1 , with the address indicated by the current value ( step s 5 ). if the new readout address and the address indicated by the current value match each other , the host system 1 reads out data from the buffer 37 ( step s 10 ). on the other hand , if the new readout address and the address indicated by the current value do not match each other , the host system 1 reads out data from the memory 4 ( step s 16 ). the same processes will proceed also when the host system 1 outputs a further new readout command . if the host system 1 is turned off , no process is performed . below , how an address indicated by an initial value or a current value which is stored in the address comparator 33 and an object of access for readout ( an object which is expected to be accessed for reading out some information therefrom ) vary while the host system 1 is consecutively outputting readout commands in the above - discussed process flow will be specifically discussed . fig3 is a view showing time series of variations of an address indicated by an initial value or a current value and an object of access for readout according to the first preferred embodiment . in fig3 , it is assumed that time elapses as a position therein moves from an upper portion to a lower portion . items on the first line under double lines in fig3 represent that when an address indicated by an initial value or a current value is a page p 1 , in response to a readout command which tells that the page p 1 is a readout address being output from the host system 1 ( step s 3 ), the address comparator 33 determines that the two addresses match each other ( step s 5 ), so that the buffer 37 becomes an object of access for readout ( step s 10 ). the address comparator 33 updates the address indicated by an initial value or a current value to the readout address ( step s 8 ). if the two addresses match each other , the address comparator 33 may alternatively be configured not to update the address indicated by an initial value or a current value . also , the buffer 37 holds data at the page p 1 which has already been stored therein ( step s 11 ). items on the third line under the double lines in fig3 represent that when an address indicated by a current value is the page p 1 , in response to a readout command which tells that a page p 2 is a readout address being output from the host system 1 ( step s 3 ), the address comparator 33 determines that the two addresses do not match each other ( step s 5 ), so that the memory 4 becomes an object of access for readout ( step s 16 ). the address comparator 33 updates the address indicated by a current value to the readout address ( step s 14 ). also , the buffer 37 updates the data at the page p 1 which has already been stored therein to data at the page p 2 ( step s 17 ). items on the fifth and seventh lines under the double lines in fig3 represent that the same processes as described above with respect to the first and third lines under the double lines in fig3 are performed . according to the first preferred embodiment , the host system 1 gains access to the buffer 37 without a need for access to the memory 4 in order to read out again the same data that was read out before , so that a “ read disturb ” phenomenon can be avoided or suppressed . in this regard , a technique for avoiding or suppressing a “ read disturb ” phenomenon even in a case where a readout command which tells that the page p 1 is a readout address and a readout command which tells that the page p 2 is a readout address are alternately output from the host system 1 , for example , will be discussed with reference to fig4 , 5 , and 6 , respectively in second , third , and fourth preferred embodiments , as follows . it is noted that the structure and function of the memory module 2 in the second , third , and fourth preferred embodiments are the same as shown in fig1 in the first preferred embodiment . fig4 is a view showing time series of variations of an address indicated by an initial value or a current value and an object of access for readout according to the second preferred embodiment . the address indicated by an initial value or a current value includes readout addresses designated by most recent three readout commands which have been output from the host system 1 and is stored in the address comparator 33 . in fig4 , the readout addresses stored in the address comparator 33 are put from the left side to the right side in an order in which the readout addresses are output from the host system 1 . more specifically , an expression “ pages p 1 , p 2 , and p 3 ” represents that the host system 1 outputs the readout addresses in an order “ p 1 , p 2 , and p 3 ”. the host system 1 reads out data on a page - by - page basis . also , the buffer 37 is able to store three pages of data , to correspond to the address comparator 33 which stores three addresses . if the address indicated by an initial value or a current value includes a new readout address , the buffer 37 becomes an object of access for readout . the buffer 37 holds data which has already been stored therein . if the address indicated by an initial value or a current value does not include a new readout address , the memory 4 becomes an object of access for readout . the buffer 37 updates data corresponding to the first readout command out of data corresponding to the above - noted most recent three readout commands , to data corresponding to a new readout command . the address comparator 33 updates the address indicated by an initial value or a current value regardless of whether or not the address indicated by an initial value or a current value includes a new readout address . more specifically , in this updating in the address comparator 33 , the readout address designated by the first readout command out of the readout addresses designated by the above - noted most recent three readout commands is erased , and a readout address designated by the new readout command is added . fig5 is a view showing time series of variations of an address indicated by an initial value or a current value and an object of access for readout according to the third preferred embodiment . the address indicated by an initial value or a current value includes readout addresses designated by two readout commands which have been output from the host system 1 the largest and the second - largest number of times , out of readout addresses designated by most recent five readout commands which have been output from the host system 1 and is stored in the address comparator 33 . the host system 1 reads out data on a page - by - page basis . also , the buffer 37 is able to store two pages of data , to correspond to the address comparator 33 which stores the top two addresses regarding the number of times of output . in the third preferred embodiment , the address comparator 33 needs to store not only the address indicated by an initial value or a current value , but also the readout addresses designated by the most recent five readout commands which have been output from the host system 1 . however , the buffer 37 does not need to store all data corresponding to the most recent five readout commands , and is required only to store date corresponding to the top two readout commands regarding the number of times of output . in one application of the third preferred embodiment , the address comparator 33 stores a histogram of the number of outputs of readout addresses designated by the readout commands which are output from the host system 1 . then , the address comparator 33 refers to the histogram stored therein , to select a readout address which was output many times and compares the selected readout address with a readout address designated by a readout command which has been most recently output from the host system 1 . an example of a process in which the address comparator 33 stores a histogram of the number of outputs is as follows . first , the address comparator 33 stores a histogram of the number of outputs of readout addresses designated by readout commands which are output from the host system 1 from the time of turn - on of the host system 1 to the time of turn - off of the host system 1 . then , a readout address which is output many times can be set as an address indicated by an initial value when the host system 1 is next turned on . in the example of the process in which the address comparator 33 stores a histogram of the number of outputs , next , the address comparator 33 stores a histogram of the number of outputs of readout addresses designated by readout commands which are output from the host system 1 during a period in which the host system 1 provides a predetermined number of outputs . then , a readout address which is output many times and satisfies predetermined requirements is set as a comparison address , and data at the comparison address is stored in the buffer 37 . after the data at the comparison address is stored in the buffer 37 , the address comparator 33 erases the histogram of the number of outputs which has already been stored therein . if one of readout addresses designated by readout commands which are expected to be output during a period in which the host system 1 next provides the predetermined number of new outputs matches the comparison address which has already been set , the host system 1 reads out data at the one readout address from the buffer 37 . the address comparator 33 stores a new histogram of the number of outputs of the readout addresses designated by readout commands which are output during the period in which the host system 1 next provides the predetermined number of the new outputs . a readout address which is output many times and satisfies the predetermined requirements is set as a new comparison address , and data at the new comparison address is stored in the buffer 37 . at that time , in a case where the data at the new comparison address has already been stored in the buffer 37 , it is unnecessary to newly store the data at the new comparison address in the buffer 37 . thereafter , the same process flow as discussed above will proceed . fig6 is a view showing time series of variations of an address indicated by an initial value or a current value and an object of access for readout according to the fourth preferred embodiment . the address indicated by an initial value or a current value includes three addresses indicated by a specific initial value , and is not updated by the address comparator 33 even while the host system 1 is consecutively outputting readout commands . the host system 1 reads out data on a page - by - page basis . also , the buffer 37 is able to store three pages of data , to correspond to the address comparator 33 which stores three addresses . specific examples of the above - noted addresses indicated by the specific initial value are as follows . cited firstly is a readout address designated by a readout command which is estimated to be probably output repeatedly from the host system 1 . in a case where such address is used , the address comparator 33 stores the address without updating it , and the buffer 37 , on the other hand , stores data at the address without updating it . the above firstly - cited address can be conveniently employed at the time of designing data which is expected to be stored in the memory 4 in a situation in which the host system 1 is estimated to probably read out specific data repeatedly . cited secondly as a specific example of the above - noted address indicated by the specific initial value is an address of data which is estimated to probably cause an error when processed by the host system 1 . for an error which occurs while the host system 1 is processing data , there is a case where an error may occur in the data itself while the data is being read out from the memory 4 and a case where an error may occur in other data while the data is being read out from the memory 4 , for example . in the case where an error occurs in other data while the data is being read out from the memory 4 , the likelihood of unintentional rewriting of data stored in a memory cell which is not an object of access for readout is taken into account . even when an error occurs while the host system 1 is processing data , the address comparator 33 stores the above - cited address without updating it , and the buffer 37 stores the data at the above - cited address without updating it . the above - cited address can be conveniently employed in a situation in which data which is estimated to probably cause an error is identified in view of a structure of a memory cell array of the memory 4 . according to the first , second , third , and fourth preferred embodiments , a “ read disturb ” phenomenon can be avoided or suppressed in data which is repeatedly read out by the host system 1 . the present invention can be applied to a case where an error actually occurs in data which is repeatedly read out by the host system 1 . each time an error occurs while the host system 1 is processing data , the address comparator 33 stores an address of data in which an error occurs . also , the buffer 37 stores error - corrected data . when the host system 1 is next turned on , the address comparator 33 keeps storing the address of the data in which the error occurs , which address has been stored therein at the time of previous turn - off of the host system 1 . the host system 1 can repeatedly read out data in which an error has actually occurred and has been corrected by gaining access to the buffer 37 without a need for access to the memory 4 , so that a “ read disturb ” phenomenon can be further avoided or suppressed . while the invention has been shown and described in detail , the foregoing description is in all aspects illustrative and not restrictive . it is therefore understood that numerous modifications and variations can be devised without departing from the scope of the invention . | 6 |
the practice of the present invention will employ , unless otherwise indicated , conventional techniques of chemistry , molecular biology , cell biology , microbiology , recombinant dna and immunology , which are within the capabilities of a person of ordinary skill in the art . such techniques are explained in the literature . see , for example , j . sambrook , e . f . fritsch , and t . maniatis , 1989 , molecular cloning : a laboratory manual , second edition , books 1 - 3 , cold spring harbor laboratory press ; ausubel , f . m . et al . ( 1995 and periodic supplements ; current protocols in molecular biology , ch . 9 , 13 , and 16 , john wiley & amp ; sons , new york , n . y . ); b . roe , j . crabtree , and a . kahn , 1996 , dna isolation and sequencing : essential techniques , john wiley & amp ; sons ; j . m . polak and james o &# 39 ; d . mcgee , 1990 , in situ hybridization : principles and practice ; oxford university press ; m . j . gait ( editor ), 1984 , oligonucleotide synthesis : a practical approach , irl press ; and , d . m . j . lilley and j . e . dahlberg , 1992 , methods of enzymology : dna structure part a : synthesis and physical analysis of dna methods in enzymology , academic press . each of these general texts is herein incorporated by reference . by “ roscovitine activity ” or “ roscovitine - like activity ” is meant an activity exhibited by roscovitine . for example , roscovitine - like means capable of inhibiting cell cycle progression in late g1 / early s or m phase . preferably , said inhibition of cell cycle progression is through inhibiting cdks including cdk1 , cdk2 , cdk5 , cdk7 and cdk9 . a study of roscovitine activity is reported in mcclue et al . int . j . cancer , 2002 , 102 , 463 - 468 . the term “ marker ” or “ biomarker ” of roscovitine activity is used herein to refer to a gene whose expression in a sample derived from a cell or mammal is modulated , for example , up or down regulated , in response to treatment with roscovitine . a sample derived from a treated or untreated cell can be a lysate , extract or nucleic acid sample derived from a group of cells which can be from tissue culture or animal or human . a cell can be isolated from an individual ( e . g . from a blood sample ) or can be part of a tissue sample such as a biopsy . the term “ expression ” refers to the transcription of a gene &# 39 ; s dna template to produce the corresponding mrna and translation of this mrna to produce the corresponding gene product ( i . e ., a peptide , polypeptide , or protein ). by “ polynucleotide ” or “ polypeptide ” is meant the dna and protein sequences disclosed herein whose expression is modified in response to roscovitine . the terms also include close variants of those sequences , where the variant possesses the same biological activity as the reference sequence . such variant sequences include “ alleles ” ( variant sequences found at the same genetic locus in the same or closely - related species ), “ homologs ” ( a gene related to a second gene by descent from a common ancestral dna sequence , and separated by either speciation (“ ortholog ”) or genetic duplication (“ paralog ”)), so long as such variants retain the same biological activity as the reference sequence ( s ) disclosed herein . the invention is also intended to include detection of genes having silent polymorphisms and conservative substitutions in the polynucleotides and polypeptides disclosed herein , so long as such variants retain the same biological activity as the reference sequence ( s ) as disclosed herein . levels of gene expression may be determined using a number of different techniques . gene expression can be detected at the rna level . rna may be extracted from cells using rna extraction techniques including , for example , using acid phenol / guanidine isothiocyanate extraction ( rnazol b ; biogenesis ), or rneasy rna preparation kits ( qiagen ). typical assay formats utilising ribonucleic acid hybridisation include nuclear run - on assays , rt - pcr , rnase protection assays ( melton et al ., nuc . acids res . 12 : 7035 ), northern blotting and in situ hybridization . for northern blotting , rna samples are first separated by size via electrophoresis in an agarose gel under denaturing conditions . the rna is then transferred to a membrane , crosslinked and hybridized with a labeled probe . nonisotopic or high specific activity radiolabeled probes can be used including random - primed , nick - translated , or pcr - generated dna probes , in vitro transcribed rna probes , and oligonucleotides . additionally , sequences with only partial homology ( e . g ., cdna from a different species or genomic dna fragments that might contain an exon ) may be used as probes . nuclease protection assays ( including both ribonuclease protection assays and s1 nuclease assays ) provide an extremely sensitive method for the detection and quantitation of specific mrnas . the basis of the npa is solution hybridization of an antisense probe ( radiolabeled or nonisotopic ) to an rna sample . after hybridization , single - stranded , unhybridized probe and rna are degraded by nucleases . the remaining protected fragments are separated on an acrylamide gel . npas allow the simultaneous detection of several rna species . in situ hybridization ( ish ) is a powerful and versatile tool for the localization of specific mrnas in cells or tissues . hybridization of the probe takes place within the cell or tissue . since cellular structure is maintained throughout the procedure , ish provides information about the location of mrna within the tissue sample . the procedure begins by fixing samples in neutral - buffered formalin , and embedding the tissue in paraffin . the samples are then sliced into thin sections and mounted onto microscope slides . ( alternatively , tissue can be sectioned frozen and post - fixed in paraformaldehyde .) after a series of washes to dewax and rehydrate the sections , a proteinase k digestion is performed to increase probe accessibility , and a labeled probe is then hybridized to the sample sections . radiolabeled probes are visualized with liquid film dried onto the slides , while nonisotopically labeled probes are conveniently detected with calorimetric or fluorescent reagents . this latter method of detection is the basis for fluorescent in situ hybridisation ( fish ). methods for detection which can be employed include radioactive labels , enzyme labels , chemiluminescent labels , fluorescent labels and other suitable labels . typically , rt - pcr is used to amplify rna targets . in this process , the reverse transcriptase enzyme is used to convert rna to complementary dna ( cdna ) which can then be amplified to facilitate detection . relative quantitative rt - pcr involves amplifying an internal control simultaneously with the gene of interest . the internal control is used to normalize the samples . once normalized , direct comparisons of relative abundance of a specific mrna can be made across the samples . commonly used internal controls include , for example , gapdh , hprt , actin and cyclophilin . many dna amplification methods are known , most of which rely on an enzymatic chain reaction ( such as a polymerase chain reaction , a ligase chain reaction , or a self - sustained sequence replication ) or from the replication of all or part of the vector into which it has been cloned . many target and signal amplification methods have been described in the literature , for example , general reviews of these methods in landegren , u . et al ., science 242 : 229 - 237 ( 1988 ) and lewis , r ., genetic engineering news 10 : 1 , 54 - 55 ( 1990 ). pcr is a nucleic acid amplification method described inter alia in u . s . pat . nos . 4 , 683 , 195 and 4 , 683 , 202 . pcr can be used to amplify any known nucleic acid in a diagnostic context ( mok et al ., 1994 , gynaecologic oncology 52 : 247 - 252 ). self - sustained sequence replication ( 3sr ) is a variation of tas , which involves the isothermal amplification of a nucleic acid template via sequential rounds of reverse transcriptase ( rt ), polymerase and nuclease activities that are mediated by an enzyme cocktail and appropriate oligonucleotide primers ( guatelli et al ., 1990 , proc . natl . acad . sci . usa 87 : 1874 ). ligation amplification reaction or ligation amplification system uses dna ligase and four oligonucleotides , two per target strand . this technique is described by wu , d . y . and wallace , r . b ., 1989 , genomics 4 : 560 . in the qβ replicase technique , rna replicase for the bacteriophage qβ , which replicates single - stranded rna , is used to amplify the target dna , as described by lizardi et al ., 1988 , bio / technology 6 : 1197 . quantitative pcr ( q - pcr ) is a technique which allows relative amounts of transcripts within a sample to be determined . alternative amplification technology can be exploited in the present invention . for example , rolling circle amplification ( lizardi et al ., 1998 , nat genet 19 : 225 ) is an amplification technology available commercially ( rcat ™) which is driven by dna polymerase and can replicate circular oligonucleotide probes with either linear or geometric kinetics under isothermal conditions . a further technique , strand displacement amplification ( sda ; walker et al ., 1992 , proc . natl . acad . sci . usa 80 : 392 ) begins with a specifically defined sequence unique to a specific target . suitable probes for detected the markers of roscovitine activity identified herein may conveniently be packaged in the form of a test kit in a suitable container . in such kits the probe may be bound to a solid support where the assay format for which the kit is designed requires such binding . the kit may also contain suitable reagents for treating the sample to be probed , hybridising the probe to nucleic acid in the sample , control reagents , instructions , and the like . suitable kits may comprise , for example , primers for a qpcr reaction or labelled probes for performing fish . gene expression may also be detected by measuring the polypeptides encoded by the gene markers of roscovitine activity . this may be achieved by using molecules which bind to the polypeptides encoded by any one of the genes identified herein as a marker of roscovitine activity . suitable molecules / agents which bind either directly or indirectly to the polypeptides in order to detect the presence of the protein include naturally occurring molecules such as peptides and proteins , for example antibodies , or they may be synthetic molecules . methods for production of antibodies are known by those skilled in the art . if polyclonal antibodies are desired , a selected mammal ( e . g ., mouse , rabbit , goat , horse , etc .) is immunised with an immunogenic polypeptide bearing an epitope ( s ) from a polypeptide . serum from the immunised animal is collected and treated according to known procedures . if serum containing polyclonal antibodies to an epitope from a polypeptide contains antibodies to other antigens , the polyclonal antibodies can be purified by immunoaffinity chromatography . techniques for producing and processing polyclonal antisera are known in the art . in order to generate a larger immunogenic response , polypeptides or fragments thereof maybe haptenised to another polypeptide for use as immunogens in animals or humans . monoclonal antibodies directed against epitopes in polypeptides can also be readily produced by one skilled in the art . the general methodology for making monoclonal antibodies by hybridomas is well known . immortal antibody - producing cell lines can be created by cell fusion , and also by other techniques such as direct transformation of b lymphocytes with oncogenic dna , or transfection with epstein - barr virus . panels of monoclonal antibodies produced against epitopes in the polypeptides of the invention can be screened for various properties ; i . e ., for isotype and epitope affinity . an alternative technique involves screening phage display libraries where , for example the phage express scfv fragments on the surface of their coat with a large variety of complementarity determining regions ( cdrs ). this technique is well known in the art . for the purposes of this invention , the term “ antibody ”, unless specified to the contrary , includes fragments of whole antibodies which retain their binding activity for a target antigen . such fragments include fv , f ( ab ′) and f ( ab ′) 2 fragments , as well as single chain antibodies ( scfv ). furthermore , the antibodies and fragments thereof may be humanised antibodies , for example as described in ep - a - 239400 . standard laboratory techniques such as immunoblotting as described above can be used to detect altered levels of markers of roscovitine activity , as compared with untreated cells in the same cell population . gene expression may also be determined by detecting changes in post - translational processing of polypeptides or post - transcriptional modification of nucleic acids . for example , differential phosphorylation of polypeptides , the cleavage of polypeptides or alternative splicing of rna , and the like may be measured . levels of expression of gene products such as polypeptides , as well as their post - translational modification , may be detected using proprietary protein assays or techniques such as 2d polyacrylamide gel electrophoresis . antibodies may be used in detecting markers of roscovitine activity identified herein in biological samples by a method which comprises : ( a ) providing an antibody of the invention ; ( b ) incubating a biological sample with said antibody under conditions which allow for the formation of an antibody - antigen complex ; and ( c ) determining whether antibody - antigen complex comprising said antibody is formed . suitable samples include extracts tissues such as brain , breast , ovary , lung , colon , pancreas , testes , liver , muscle and bone tissues or from neoplastic growths derived from such tissues . other suitable examples include blood or urine samples . antibodies that specifically bind to protein markers of roscovitine activity can be used in diagnostic methods and kits that are well known to those of ordinary skill in the art to detect or quantify the markers of roscovitine activity proteins in a body fluid or tissue . results from these tests can be used to diagnose or predict the occurrence or recurrence of a cancer and other cell cycle progression - mediated diseases or to assess the effectiveness of drug dosage and treatment . antibodies can be assayed for immunospecific binding by any method known in the art . the immunoassays which can be used include but are not limited to competitive and non - competitive assay systems using techniques such as western blots , immunohistochemistry , radioimmunoassays , elisa , sandwich immunoassays , immunoprecipitation assays , precipitin reactions , gel diffusion precipitin reactions , immunodiffusion assays , agglutination assays , complement - fixation assays , immunoradiometric assays , fluorescent immunoassays and protein a immunoassays . such assays are routine in the art ( see , for example , ausubel et al ., eds , 1994 , current protocols in molecular biology , vol . 1 , john wiley & amp ; sons , inc ., new york , which is incorporated by reference herein in its entirety ). antibodies for use in the invention may be bound to a solid support and / or packaged into kits in a suitable container along with suitable reagents , controls , instructions and the like . array technology and the various techniques and applications associated with it is described generally in numerous textbooks and documents . these include lemieux et al ., 1998 , molecular breeding 4 : 277 - 289 ; schena and davis . parallel analysis with biological chips . in pcr methods manual ( eds . m . innis , d . gelfand , j . sninsky ); schena and davis , 1999 , genes , genomes and chips . in dna microarrays : a practical approach ( ed . m . schena ), oxford university press , oxford , uk , 1999 ); the chipping forecast ( nature genetics special issue ; january 1999 supplement ); mark schena ( ed . ), microarray biochip technology , ( eaton publishing company ); cortes , 2000 , the scientist 14 ( 17 ): 25 ; gwynne and page , microarray analysis : the next revolution in molecular biology , science , 1999 , aug . 6 ; eakins and chu , 1999 , trends in biotechnology , 17 : 217 - 218 , and also at various world wide web sites . array technology overcomes the disadvantages with traditional methods in molecular biology , which generally work on a “ one gene in one experiment ” basis , resulting in low throughput and the inability to appreciate the “ whole picture ” of gene function . currently , the major applications for array technology include the identification of sequence ( gene / gene mutation ) and the determination of expression level ( abundance ) of genes . gene expression profiling may make use of array technology , optionally in combination with proteomics techniques ( celis et al ., 2000 , febs lett , 480 ( 1 ): 2 - 16 ; lockhart and winzeler , 2000 , nature 405 ( 6788 ): 827 - 836 ; khan et al ., 1999 , 20 ( 2 ): 223 - 9 ). other applications of array technology are also known in the art ; for example , gene discovery , cancer research ( marx , 2000 , science 289 : 1670 - 1672 ; scherf et al et al ., 2000 , nat genet 24 ( 3 ): 236 - 44 ; ross et al ., 2000 , nat genet 2000 , 24 ( 3 ): 227 - 35 ), snp analysis ( wang et al ., 1998 , science 280 ( 5366 ): 1077 - 82 ), drug discovery , pharmacogenomics , disease diagnosis ( for example , utilising microfluidics devices : chemical & amp ; engineering news , feb . 22 , 1999 , 77 ( 8 ): 27 - 36 ), toxicology ( rockett and dix ( 2000 ), xenobiotica 30 ( 2 ): 155 - 77 ; afshari et al ., 1999 , cancer res 59 ( 19 ): 4759 - 60 ) and toxicogenomics ( a hybrid of functional genomics and molecular toxicology ). the goal of toxicogenomics is to find correlations between toxic responses to toxicants and changes in the genetic profiles of the objects exposed to such toxicants ( nuwaysir et al ., 1999 , molecular carcinogenesis 24 : 153 - 159 ). in the context of the present invention , array technology can be used , for example , in the analysis of the expression of one or more of the protein markers of roscovitine activity identified herein . in one embodiment , array technology may be used to assay the effect of a candidate compound on a number of the markers of roscovitine activity identified herein simultaneously . accordingly , another aspect of the present invention is to provide microarrays that include at least one , at least two or at least several of the nucleic acids identified in any of fig1 through 8 , or fragments thereof , or protein or antibody arrays . in general , any library or group of samples may be arranged in an orderly manner into an array , by spatially separating the members of the library or group . examples of suitable libraries for arraying include nucleic acid libraries ( including dna , cdna , oligonucleotide , etc . libraries ), peptide , polypeptide and protein libraries , as well as libraries comprising any molecules , such as ligand libraries , among others . accordingly , where reference is made to a “ library ” in this document , unless the context dictates otherwise , such reference should be taken to include reference to a library in the form of an array . in the context of the present invention , a “ library ” may include a sample of markers of roscovitine activity as identified herein . the samples ( e . g ., members of a library ) are generally fixed or immobilised onto a solid phase , preferably a solid substrate , to limit diffusion and admixing of the samples . in a preferred embodiment , libraries of dna binding ligands may be prepared . in particular , the libraries may be immobilised to a substantially planar solid phase , including membranes and non - porous substrates such as plastic and glass . furthermore , the samples are preferably arranged in such a way that indexing ( i . e ., reference or access to a particular sample ) is facilitated . typically the samples are applied as spots in a grid formation . common assay systems may be adapted for this purpose . for example , an array may be immobilised on the surface of a microplate , either with multiple samples in a well , or with a single sample in each well . furthermore , the solid substrate may be a membrane , such as a nitrocellulose or nylon membrane ( for example , membranes used in blotting experiments ). alternative substrates include glass , or silica based substrates . thus , the samples are immobilised by any suitable method known in the art , for example , by charge interactions , or by chemical coupling to the walls or bottom of the wells , or the surface of the membrane . other means of arranging and fixing may be used , for example , pipetting , drop - touch , piezoelectric means , ink - jet and bubblejet technology , electrostatic application , etc . in the case of silicon - based chips , photolithography may be utilised to arrange and fix the samples on the chip . the samples may be arranged by being “ spotted ” onto the solid substrate ; this may be done by hand or by making use of robotics to deposit the sample . in general , arrays may be described as macroarrays or microarrays , the difference being the size of the sample spots . macroarrays typically contain sample spot sizes of about 300 microns or larger and may be easily imaged by existing gel and blot scanners . the sample spot sizes in microarrays are typically less than 200 microns in diameter and these arrays usually contain thousands of spots . thus , microarrays may require specialized robotics and imaging equipment , which may need to be custom made . instrumentation is described generally in a review by cortese , 2000 , the scientist 14 ( 11 ): 26 . techniques for producing immobilised libraries of dna molecules have been described in the art . generally , most prior art methods described how to synthesise single - stranded nucleic acid molecule libraries , using for example masking techniques to build up various permutations of sequences at the various discrete positions on the solid substrate . u . s . pat . no . 5 , 837 , 832 , the contents of which are incorporated herein by reference , describes an improved method for producing dna arrays immobilised to silicon substrates based on very large scale integration technology . in particular , u . s . pat . no . 5 , 837 , 832 describes a strategy called “ tiling ” to synthesize specific sets of probes at spatially - defined locations on a substrate which may be used to produced the immobilised dna libraries of the present invention . u . s . pat . no . 5 , 837 , 832 also provides references for earlier techniques that may also be used . arrays of peptides ( or peptidomimetics ) may also be synthesised on a surface in a manner that places each distinct library member ( e . g ., unique peptide sequence ) at a discrete , predefined location in the array . the identity of each library member is determined by its spatial location in the array . the locations in the array where binding interactions between a predetermined molecule ( e . g ., a target or probe ) and reactive library members occur is determined , thereby identifying the sequences of the reactive library members on the basis of spatial location . these methods are described in u . s . pat . no . 5 , 143 , 854 ; wo 90 / 15070 and wo 92 / 10092 ; fodor et al ., 1991 , science 251 : 767 ; dower and fodor , 1991 , ann . rep . med . chem . 26 : 271 . to aid detection , targets and probes may be labelled with any readily detectable reporter , for example , a fluorescent , bioluminescent , phosphorescent , radioactive , etc reporter . such reporters , their detection , coupling to targets / probes , etc are discussed elsewhere in this document . labelling of probes and targets is also disclosed in shalon et al ., 1996 , genome res 6 ( 7 ): 639 - 45 . format i : probe cdna (˜ 500 -˜ 5 , 000 bases long ) is immobilized to a solid surface such as glass using robot spotting and exposed to a set of targets either separately or in a mixture . this method is widely considered as having been developed at stanford university ( ekins and chu , 1999 , trends in biotechnology , 17 : 217 - 218 ). format ii : an array of oligonucleotide (˜ 20 -˜ 25 - mer oligos ) or peptide nucleic acid ( pna ) probes is synthesized either in situ ( on - chip ) or by conventional synthesis followed by on - chip immobilization . the array is exposed to labeled sample dna , hybridized , and the identity / abundance of complementary sequences are determined . such a dna chip is sold by affymetrix , inc ., under the genechip ® trademark . examples of some commercially available microarray formats are set out , for example , in marshall and hodgson , 1998 , nature biotechnology 16 ( 1 ): 27 - 31 . data analysis is also an important part of an experiment involving arrays . the raw data from a microarray experiment typically are images , which need to be transformed into gene expression matrices — tables where rows represent for example genes , columns represent for example various samples such as tissues or experimental conditions , and numbers in each cell for example characterize the expression level of the particular gene in the particular sample . these matrices have to be analyzed further , if any knowledge about the underlying biological processes is to be extracted . methods of data analysis ( including supervised and unsupervised data analysis as well as bioinformatics approaches ) are disclosed in brazma and vilo j , 2000 , febs lett 480 ( 1 ): 17 - 24 . as disclosed above , proteins , polypeptides , etc may also be immobilised in arrays . for example , antibodies have been used in microarray analysis of the proteome using protein chips ( borrebaeck calif ., 2000 , immunol today 21 ( 8 ): 379 - 82 ). polypeptide arrays are reviewed in , for example , macbeath and schreiber , 2000 , science , 289 ( 5485 ): 1760 - 1763 . the invention also includes use of the markers of roscovitine activity , antibodies to those proteins , and compositions comprising those proteins and / or their antibodies in diagnosis or prognosis of diseases characterized by proliferative activity , particularly in individuals being treated with roscovitine . as used herein , the term “ prognostic method ” means a method that enables a prediction regarding the progression of a disease of a human or animal diagnosed with the disease , in particular , cancer . in particular , cancers of interest with respect to roscovitine treatment include breast , lung , gastric , head and neck , colorectal , renal , pancreatic , uterine , hepatic , bladder , endometrial and prostate cancers and leukemias . in one embodiment , prognostics may include detecting the expression of markers whose expression correlates with roscovitine sensitivity or resistance in a method of predicting the response of a patient to treatment . the term “ diagnostic method ” as used herein means a method that enables a determination of the presence or type of cancer in or on a human or animal . suitably the marker allows success of roscovitine treatment to be assessed . as discussed above , suitable diagnostics include probes directed to any of the genes as identified herein such as , for example , qpcr primers , fish probes and so forth . the present invention will now be described with reference to the following examples . ht29 colon cancer cells were seeded into t175 flasks at 3 × 10 6 cells per flask and allowed to attach for 48 h . cells were then treated with 50 μm cyc202 for either 4 , 12 , 24 or 48 h prior to harvesting by trypsinisation . a cell pellet was made for protein analysis and rna analysis . to harvest cells , the medium was removed and cells were incubated with 5 ml trypsin for 5 min at 37 ° c . to detach them from the plastic . the cells were then pelleted , washed in ice cold pbs and resuspended in ice cold lysis buffer containing 50 mm hepes ph7 . 4 , 250 mm nacl , 0 . 1 % np40 , 1 mm dtt , 1 mm edta , 1 mm naf , 10 mm β - glycerophosphate , 0 . 1 mm sodium orthovanadate and 1 complete protease inhibitor cocktail tablet ( roche , east sussex , uk ) per 10 ml of lysis buffer for 30 minutes on ice . lysates were centrifuged at approx . 18 , 000 × g for 10 minutes at 4 ° c . to remove cellular debris . the supernatant was stored at − 80 ° c . prior to use . the protein concentration of lysates was determined using the bca protein assay ( pierce , rockford , usa ). proteins were separated by sds - page using novex precast tris - glycine gels ( invitrogen , groningen , the netherlands ) and transferred to immobilon - p membranes ( millipore , bedford , usa ). membranes were blocked for 1 hour in tbs ™ 50 mm tris ph7 . 5 , 150 mm nacl , 0 . 1 % tween 20 ( sigma , dorset , uk ) and 3 % milk . immunoblotting with primary antibodies diluted in tbs ™ was performed at 4 ° c . overnight , followed by a 1 hour incubation with hrp - conjugated secondary antibodies at room temperature . membranes were washed with ecl reagents and exposed to hyperfilm ( amersham pharmacia biotech , buckinghamshire , uk ). antibodies used were : phospho - rb ser780 1 : 5000 , phospho - erk1 / 2 1 : 1000 , c - jun 1 : 200 ( cell signalling technologies , beverly , usa ), total rb sc - 50 1 : 2000 , cyclin b2 sc - 5233 1 : 100 , egr - 1 1 : 200 sc - 189 ( santa cruz biotechnology , santa cruz , usa ), total erk2 1 : 10000 ( kindly provided by prof . chris marshall , institute of cancer research , london , uk ), phospho - rb ser608 1 : 2000 ( dr . sibylle mittnacht , institute of cancer research , london , uk ), phospho - rb thr821 1 : 1000 ( biosource , nivelles , belgium ), non - phosphorylated rb 1 : 500 , aurora 1 1 : 250 , mcl - 1 2 μg / ml ( bd biosciences , oxford , uk ), plk - 1 2 μg / ml zymed , san francisco , calif . ), gapdh 1 : 5000 ( chemicon , temecula , calif .) goat anti - rabbit and goat anti - mouse hrp - conjugated secondary antibodies 1 : 5000 ( biorad , hercules , usa ), rabbit anti - sheep hrp - conjugated secondary antibody 1 : 2000 ( upstate biotechnology , lake placid , usa ). total rna was extracted from cell pellets using trizol ( life technologies ) and mrna was purified using the qiagen oligotex system . mrna from control and treated cells was labelled with either cy3 or cy5 ( nen or amersham ) fluorescent dctps respectively , creating cdna probes . cdna microarray slides are made and used as described in eisen , mb and brown po . ( 1999 ) dna arrays for analysis of gene expression . methods in enzymology 303 : 179 - 205 . the cdna probes were then hybridised to the cdna microarray slides overnight and then washed and scanned using an axon labs genepix 4000b scanner . the slides were verified using genepix software and normalised prior to analysis in genespring . fig1 through 8 represent the mrna expression profiles of ht29 cells treated with 50 μm cyc202 for 4 , 12 , 24 and 48 h respectively when compared to asynchronous control cells . a 2 fold cut - off was used to assign significance to a change in mrna expression . therefore , any mrna with a normalised ratio of medians less than 0 . 5 ( fig1 , 5 and 7 ) or greater than 2 ( fig2 , 6 and 8 ) is deemed significant . fig9 a shows the mrna expression over the time course of 50 μm cyc202 in ht29 cells of selected genes of interest . these changes were then validated by western blotting ( fig9 b ). 24 h treatments with olomoucine ( 174 μm ) and purvalanol a ( 12 μm ) were included for comparison . relating the microarray data to the western validation , cyclin b2 , aurora 1 and polo - like kinase 1 are all markedly inhibited in agreement with the microarray data . egr - 1 mrna is induced from as early as 4 h and is maintained above the two fold cut off for the duration of the experiment whereas egr - 1 protein is transiently induced at 12 h after treatment . c - jun mrna is induced to significant levels from 4 h and is maintained at that level for the duration of the experiment , c - jun protein is induced at 4 h and 12 h ( and is in the phosphorylated , active form ) but is lost after 24 h . all publications mentioned in the above specification , and references cited in said publications , are herein incorporated by reference . various modifications and variations of the described methods and system of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to such specific embodiments . indeed , various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims . | 2 |
fig1 shows a motor vehicle roof including a fixed roof structure 10 which has a roof opening 11 which extends from near the front edge 12 of the fixed roof structure 10 to near the rear edge 13 of the fixed roof structure 10 . on the bottom of the fixed roof structure 10 , a frame ( not shown ) is attached which , on each side of the roof opening 11 , has guide rails in which the front cover 14 and the rear cover 15 are movably supported in the longitudinal direction of the motor vehicle . furthermore , the two covers 14 , 15 are each provided with a pivoting - out mechanism ( not shown ) by which the front cover 14 and the rear cover 15 can be raised or lowered into the ventilation positions on the respective rear edge 16 and 17 of the covers with respect to the front edge 18 and 19 of the covers , or alternatively , on the front edge 18 and 19 of the covers with respect to the rear edge 16 and 17 of the covers . moreover , the two covers 14 , 15 can be raised or lowered about their front or rear edges , or one of the covers 14 , 15 can be raised or lowered about its front edge and the other cover can be raised or lowered about its rear edge . for their pivoting motion and their displacement motion along the guide rails , the covers 14 , 15 are each driven by a separate drive which can be made in the known manner as an electric motor with a pinion and compressively - stiff drive cables . as shown in fig2 d , a displacement mechanism ( not shown ) lowers one of the covers 14 , 15 as it is pushed lengthwise to under the other cover . as shown in fig2 a , in the closed position of the motor vehicle roof shown , the front cover 14 closes a front section 20 of the roof opening 11 , when the covers 14 , 15 are the same size , while the rear cover 15 closes the rear section 21 or the rear half . fig2 b shows a position in which the rear edge 16 of the front cover 14 and the rear edge 17 of the rear cover 15 are raised for ventilation purposes by pivoting about the respective front edges 18 and 19 . in fig2 c , the front cover 14 is selectively moved to the rear out of its closed position along its guide rails , and in doing so , is lowered and pushed entirely under the rear cover 15 which is still pivoted into the ventilation position in order to completely clear the front section 20 of the roof opening 11 . in fig2 d , the front cover 14 is lowered out of its closed position and is selectively moved along its guide rails to the rear to under the rear cover 15 which is pushed out of its closed position , forward into the middle of the roof opening 11 . one part of the front section 20 and of the rear section 21 of the roof opening 11 at a time are thus cleared , in a middle arrangement of the covers 14 , 15 , two same - sized openings sections 20 and 21 being formed . in another embodiment , the front cover 14 can be lowered via its raising mechanism on its front edge 18 into a ventilation position . according to fig2 e , a roof position can be set in which the front cover 14 is lowered on its front edge 18 , while the rear edge 17 of the rear cover 15 is raised toward the top . in this way a ventilation opening 22 is formed on the front edge of the roof opening 11 and a ventilation position 23 is formed on the rear edge of the roof opening 11 . as shown in fig2 f , for complete opening of the rear section or of the rear section 21 of the roof opening 11 , the rear cover 15 can be pushed out of its closed position forward to under the front cover 14 . alternatively , the rear cover 15 is pushed forward on its guide rails , after the front cover 14 has been lowered ( not shown ). in the embodiment of the motor vehicle roof shown in fig2 g , the rear cover 15 can be lowered at its front edge into a ventilation position by way of its raising mechanism , while the front cover 14 can be raised at its rear edge 16 . in the position of the two covers 14 , 15 shown in fig2 g , a middle ventilation opening 24 is opened at roughly twice the height obtainable by either cover by itself . finally , as shown in fig2 h , in another embodiment of the motor vehicle roof both the front cover 14 and also the rear cover 15 on their front edges 18 and 19 can be lowered in the ventilation positions . for complete opening of the front and the rear sections 20 , 21 of the roof opening 11 , or for partial opening of at least one of the front section 20 and the rear section 21 of the roof opening 11 , in the described embodiments the front cover 14 is pushed to the rear and the rear cover 15 is pushed to the front by the corresponding path , one cover being pushed horizontally on its guide rails and the other cover being lowered to under the former cover . the control of the drives of the two covers 14 , 15 is made such that the pivoting motions of the covers 14 , 15 and also their displacement motions can be executed independently of one another , collision of the covers 14 , 15 being precluded during the displacement by the arrangement of the guide rails . the embodiments of the motor vehicle roof shown in fig3 a - 3d are formed essentially , like the above described examples , however , they include a wind deflector 25 which is located between the front edge 12 of the fixed roof structure 10 and the front cover 14 , and can be raised at its rear edge 26 by being pivoted up about its front edge 36 . the wind deflector 25 can be made as a louver which is located as a layered part of the fixed roof structure 10 , flush on the latter , and can be pivoted up out of this flush arrangement so that the fixed part of the roof structure 10 which remains underneath the louver preserves its fixed arrangement . as shown in fig3 a , in an alternative embodiment , the wind deflector 25 forms a movable part of the fixed roof structure 10 in its entirety which can be pivoted up as the wind deflector unit of the fixed roof structure 10 and thus can clear an additional ventilation opening 22 between the raised rear edge 26 of the wind deflector 25 and the front edge 18 of the front cover 14 which is located in its closed position . the wind deflector 25 can be used in all the motor vehicle roofs which are shown in fig2 a - 2h . fig3 b shows a position of the covers 14 , 15 in which the front cover 14 is pushed out of its closed position to the rear into the middle of the roof opening 11 and to under the rear cover 15 while the rear cover 15 is raised at its rear edge 17 in the ventilation position . as shown in fig3 c , the rear cover 15 is lowered at its front edge 19 into the ventilation position . while , when the front cover 14 is closed , the front ventilation opening 22 which is formed by the raised wind deflector 25 and the ventilation opening 24 which is partially cleared by the rear cover 15 , yield good , draft - free ventilation , the ventilation action is improved even more when , as shown in the figure , the front cover 14 , 16 is pivoted out at its rear edge into the ventilation position so that the ventilation opening 24 is opened with its greatest height which is twice that obtainable by moving the covers as shown for opening 24 in fig3 b and 3d , for example . the motor vehicle roof shown in fig3 d contains a front cover 14 which can be lowered at its front edge 18 into the ventilation position . with the wind deflector 25 pivoted up , between the rear edge 26 of the wind deflector 25 and the front edge 18 of the front cover 14 lowered relative to the closed position ( on the broken line of the roof ), thus , a much larger front ventilation opening 22 is formed which , in conjunction with the ventilation opening 24 which has been cleared by the rear cover 15 , enables even more improved ventilation by air circulation from the interior through the front ventilation opening 22 to the outside over the front cover 14 and though the middle ventilation opening 24 back into the interior . fig4 a to 4 c show a motor vehicle roof including a headliner 27 having a front headliner unit 28 which is assigned to the front section 20 of the roof opening 11 and the front , especially transparent , cover 14 , and a rear headliner unit 29 which is assigned to the rear section 21 of the roof opening 11 and the rear , especially transparent , cover 15 . the headliner units 28 , 29 are movably located on each side of the roof opening 11 on a respective one of the guide rails 30 , 31 . the rear guide rail 31 extends in the plane near the roof , forward to beyond the rear edge 16 of the front cover 14 . the front guide rail 30 , which runs roughly in the area under the front cover 14 approximately in one plane with the rear guide rail 31 near the motor vehicle roof , is lowered at the beginning of the middle section 32 of the headliner to under the rear guide rail 31 , and extends underneath from it at a distance which is slightly greater than the thickness of the front headliner unit 28 . at least the front headliner unit 28 is divided in the longitudinal direction into a plurality , for example , three headliner elements 33 , 34 , 35 , which are connected flexibly to one another and are connected especially offset relative to one another , or so as to pivot about one or more transverse axes . by dividing the headliner unit 28 into headliner elements 33 , 34 , 35 which are shorter in the longitudinal direction , they can follow , as a result of their greater flexibility , the path of the front guide rail 30 which is curved in an s - shape over a short distance ( thereby reducing headroom in the smallest possible region ) and can be guided into the lower deposition plane under the middle section 32 . as shown in fig4 c , the rear headliner unit 29 is pushed on its guideway 31 over the front headliner unit 28 which is located underneath into the middle section 32 of the headliner so that the two headliner units 28 , 29 clear front and rear sections 20 , 21 of the roof opening 11 . the rear headliner unit 29 can also be divided into two or more headliner elements , this division not being necessary in this embodiment , in which the rear headliner unit 29 is guided roughly on the largely planar path of the guide rail . the plane in which the guide rails 30 , 31 are essentially arranged can be flat or curved according to the shape of the fixed roof structure . it is noted that the displacement mechanisms for the covers and headliners have not been shown or described in specific detail since such forms no part of the invention . those skilled in the sunroof art , given the motions described , will easily be able to apply any of various known drive and linkage techniques to achieve the described effects . | 1 |
examples of a process for manufacturing embodiments of emi shields are illustrated in fig1 . in a first step , the emi shield is manufactured from a thermoformable film , such as general electric &# 39 ; s lexan ®. the thermoformable film may be in small or large sheets or a long continuous reel , depending on the scale of production required . generally , a formable film may be used and , in addition , non - formable films may be used if the required shape is flat . the thermoformable film is coated with a conductive extensible ink , such as acheson colloids company &# 39 ; s electrodag ® sp - 405 ink to form an extensible conductive coating . the extensible ink may be any extensible ink in the case of a 3 - d shape , and any conductive ink ( or paint or plating ) in the case of 2 - d shapes . the extensible ink can be applied to the film by a variety of printing or film coating processes , such as flexographic printing , screen printing , gravure printing , offset printing , letter press printing , pad printing , slot coating , flood coating , spray coating , and jet printing . depending on the configuration of the part used during the forming process , there can be a considerable amount of elongation of the emi shield where geometric features of the shield are concentrated . this in turn may put excessive stress on the extensible ink . if the elongation of the extensible ink is too severe , this will result in fracture of the conductive layer , which in turn leads to loss of conductivity and loss of shielding . ideally , the conductive layer would be one that could be stretched infinitely over the entire part . in practice , this is difficult as most highly conductive materials will tend to fracture . also , materials that are best for stretching are generally not conductive enough to be used as conductive shields . in another embodiment the extensible conductive coating can be formed from a combination of conductive fibers with an extensible film . the extensible film can be selected from materials that , in general , have a lower glass transition temperature than the thermoformable film and , in one embodiment , can be a polymer . the polymer selected for use with the conductive fibers can be very thermoplastic , to the point of almost becoming a liquid , which results in a combined polymer / conductive fiber layer that becomes highly compliant to changes in geometry caused by thermoforming the thermoformable film , while the conductive fibers continue to interact with negligible loss of conductivity . fig2 illustrates an extensible conductive coating 20 on a thermoformable film 30 . in one embodiment the conductive fibers can be placed on the thermoformable film and the extensible film can be placed on top of the conductive fibers . the arrangement of the thermoformable film , the conductive fibers , and the extensible film can be laminated to allow the conductive fibers to integrate with the extensible film . in another embodiment , the extensible film can be processed into fibers which can be mixed with the conductive fibers . the mixture of conductive fibers and the fibers from the extensible film can be deposited on the thermoformable film at a temperature which at least partially melts the extensible film fibers . materials for the conductive fibers include stainless steel fibers from baeckert , naslon — sus316l from nippon seisen co . of osaka - city , japan , panex chopped fiber — px33cf1000 - 01 from zoltex corporation of st . louis , mo ., and x - static silver nylon fiber from instrument specialties of scranton , pa . any fiber which is at least about 3 . 175 mm ( 0 . 125 inches ) long and less than about 0 . 254 mm ( 0 . 01 inches ) in diameter may be used , provided that the outer surface of the fiber is coated with metal sufficient to produce bulk resistivity of the material to less than about 50 milliohm - cm , preferably less than about 25 milliohm - cm , more preferably less than bout 10 milliohm - cm , as determined by mil - g - 83528 paragraph 4 . 6 . 11 / astm 991 . pure component fibers can be used as well , provided the bulk resistivity is below about these values . in addition , some other conductive materials that can be used are silver loaded particles , silver / copper flake , silver / nylon fiber , silver carbon fibers , tin over copper flash , and tin . materials for the extensible film include polypropylene and polyethylene fibers or films , both available from dow chemicals . other suitable polymers for the extensible film include polystyrene , acrylonitrile - butydiene - styrene ( abs ), styrene - acrylonitrile ( san ), polycarbonate , polyester , and polyamide , as long as the thermoplastic polymer has a lower glass transition temperature than the supporting polymer shield , for example at least about 20 degrees c . lower . additionally , a silicone material can also be used for the extensible film . the extensible conductive coating can be made by blending polyethylene and / or polypropylene fibers with the conductive fibers and calendering or laminating the composite with the thermoformable film . other methods for applying the extensible conductive coating to the thermoformable film include wet coating , carding , plating , coating , flocking , dry laid screening , and vacuum metal / ion sputter techniques . various combinations and permutations of the material for the conductive fibers , the material for the extensible film , and the method of applying the extensible conductive coating made from the extensible film and conductive fibers to the thermoformable film can be chosen to result in a desired surface conductivity and shielding effectiveness of the emi shield . in some embodiments the conductive coating may be applied to both sides of the thermoformable film . in other embodiments the conductive coating may be applied to one side of the thermoformable film . the conductive coating may be applied uniformly , or may be applied in a pattern , such as a grid . in still other embodiments the conductive coating may be applied in discrete areas or zones . in a second step , the resulting coated film is then cut to the desired 2 - d shape . any cutting process known to those skilled in the art can be used such as water jet cutting , laser cutting die - cutting , hot wire cutting , etc . the film can be cut to produce a single shape or a plurality of similar or different shapes , which can be held together by sprues . next , in a third step , the cut film is thermoformed into the desired 3 - d shape . any method of thermoforming known to those skilled in the art may be used . the complexity of the 3 - d shape can vary significantly , from a simple box , formed by a single rectangle draw , to a multi - chamber part with different chamber sizes and depths . see fig3 a - 3c for examples . one method of thermoforming , positive forming , is illustrated in fig4 a - 4c . the thermoformable film 30 and the extensible conductive coating 20 are heated by a heater 50 to soften the thermoformable film 30 and the extensible conductive coating 20 . the thermoformable film 30 and extensible conductive coating 20 are then applied to a mold 60 and a vacuum 70 drawn to conform the thermoformable film 30 and the conductive coating 20 to the mold 60 . once cooled sufficiently , the contoured thermoformable film 30 and extensible conductive coating 20 are removed from the mold 60 . lastly , a conductive elastomer gasket is dispensed onto the coated thermoformed film in any desired pattern , using fip dispensing equipment described below and illustrated in fig6 . the fip gasket is typically applied about a perimeter , edge , lip , or other similar structure ; however , in more complex parts , the fip gasket may be applied to internal or external walls , dividers , or other similar surfaces forming with adjoining structure in the final assembled component or housing . the conductive elastomer gasket is then cured , either at ambient temperature or via elevated temperatures , for example , in a continuous oven . in addition to using fip methods for manufacturing the elastomer gasket , other gaskets known to those skilled in the art for shielding emi can be used . for example , the gasket may be other than conductive elastomers including , but not limited to , metallized fabric wrapped foam gaskets , metal fingers , knitted gaskets , a printable foamable ink , etc . in some cases , the finished component may incorporate a separate environmental gasket , for example a polyurethane gasket . the finished shielding element is then shipped to the assembly plant , where the entire shielding function is accomplished by simply placing this single piece into an enclosure . examples of shielding composite cross - sections are shown in fig1 fig3 c , and fig4 . note that the four general process steps do not have to be performed in this particular order and , in fact , may be performed in any order . for example , the fip gasket may be applied either before or after coating , cutting , or forming . similarly , the coating may be applied either before or after cutting , forming , or application of the fip gasket . fig5 is a table which shows a summary of surface resistivity and shield effectiveness test results for various conductive coatings . the table shows the conductive materials , the base extensible films , and the manufacturing methods for applying the conductive coating to the thermoformable film . the table also shows the thickness of the conductive coating and exemplary draw amounts of the conductive coating . the test results of surface resistivity and shielding effectiveness are provided for both an unformed conductive layer , after application of the extensible conductive coating to the thermoformable film and for a formed conductive layer after three - dimensional forming of the emi gasket . the test results generally show the surface resistivity increases after the conductive layer has been three - dimensionally formed . the test results also generally show , with the exception of ag particle ink , that the shielding effectiveness ( se ) remains relatively constant before and after being three - dimensionally formed . there are a number of ways to make a form in place gasket . for example , as illustrated in fig6 is an embodiment of a method 100 for manufacturing an emi shield made of conductive particles and a foamable mixture . in one embodiment , conductive particles 105 , for example , chopped metal fibers or metallized polymer fibers , are added to the components of a foamable mixture . the components of the foamable mixture can be a polyol component 110 and an isocyonate component 115 of a urethane mixture . the polyol component 110 , the isocyonate component 115 , and the conductive particles 105 are mixed in one or more mixing heads 125 to produce a urethane mixture with an integral network of conductive particles 120 . the urethane mixture with the integral network of conductive particles 120 is then processed by available means to produce the desired size and shape of a conductive emi gasket . in one embodiment , the urethane mixture with an integral network of conductive particles 120 , is dispensed through a nozzle 130 directly onto a surface 135 of an electrical enclosure 140 using an xyz positioning system 145 to form the emi gasket in place as the mixture 120 foams and cures . fip emi gaskets may be manufactured of conductive foams , where the conductive elements are introduced into the foam matrix prior to casting by adding organo - metallic compounds to the foam chemical matrix , which are reduced to conductive elements during the foaming process . additionally , various forms of carbon may be added to urethane foam chemical precursors to produce foams with surface resistivities of 100 to 1000 ohms / square . these materials , however , have limited use in emi shielding applications , due to the relatively high resistivity . a new process produces conductive foams which are less than 10 ohms / square by introducing more highly conductive materials into the foam chemical precursors , including silver - plated glass spheres , sintered metal particles which have bulk resistivities below about 10 − 5 ohm - cm ( e . g . cu , al , ni , ag ), and silver - plated copper particles . other conductive materials include the class of non - metallic materials referred to as conductive polymers . this would include such materials as poly - analine . another method of producing conductive foam is to produce the conductive elements in the foaming process by reacting organo - metallic compounds during the foaming process . this is accomplished by introducing reducing agents into one of the two or more chemical precursors of the foam prior to foaming . one example of these compounds is copper acetate , but any metal compound , which is compatible with one of the chemical foam precursors , could be used . examples of chemical foam systems which may be used include the very broad range of urethane foams including polyester and polyether types . chloroprenes , more commonly known as neoprene rubber foams , could also be used . variations , modifications , and other implementations of what is described herein will occur to those of ordinary skill in the art without departing from the spirit and the scope of the invention . | 7 |
the composition of this invention preferably includes between about 1 and about 20 mole % of a polyether monomer and preferably from about 5 to about 15 mole %. most preferably , the polyether monomer is used at a final concentration of about 8 to about 12 mole %. the term “ mole %” as used herein will be determined by the molecular weight of the monomer components . the polyether monomer is preferably of the group of molecules referred to as alkoxy ( poly ) alkyleneglycol ( meth ) acrylates . the alkoxy substituents of this group may be selected from the group consisting of methoxy , ethoxy , propoxy , and butoxy . the ( poly ) alkylene glycol component of the molecule may be selected from the group consisting of ( poly ) propylene glycol and ( poly ) ethylene glycol . the ( poly ) alkylene glycol component preferably has a nominal weight average molecular weight ranging from about 200 g / mole to about 2000 g / mole , and ideally from about 800 g / mole to about 1200 g / mole . examples of preferred polyether monomers include methoxy peg methacrylates , peg methacrylates , and ( poly ) propylene glycol methacrylates . such polyether monomers are commercially available , for instance , from polysciences , inc ., ( warrington , pa .). a composition of this invention preferably includes between about 5 to about 75 mole % of a carboxylic acid - containing monomer , such that the effective ratio of ether groups to carboxylic acid groups in the resultant copolymer is between about 1 to 1 and about 10 to 1 . preferred concentrations of the carboxylic acid - containing monomer are between about 30 to about 50 mole %. most preferably , the carboxylic acid - containing monomer is used at a concentration between about 30 to about 40 mole %. these monomers can be obtained commercially , for instance , from sigma - aldrich , inc . ( st . louis , mo .). preferred carboxylic acid - containing monomers are selected from carboxyl substituted ethylene compounds , also known as alkenoic acids . examples of particularly preferred carboxylic acid - containing monomers include acrylic , methacrylic , maleic , crotonic , itaconic , and citraconic acid . most preferred examples of carboxylic acid - containing monomers include acrylic acid and methacrylic acid . a composition of the present invention preferably includes between about 0 . 1 and about 10 mole % of a photoderivatized monomer , more preferably between about 1 and about 7 mole %, and most preferably between about 3 and about 5 mole %. examples of suitable photoderivatized monomers are ethylenically substituted photoactivatable moieties which include n -[ 3 -( 4 - benzoylbenzoamido ) propyl ] methacrylamide (“ bba - apma ”), 4 ( 2 - acryloxyethoxy )- 2 - hydroxybenzophenone , 4 - methacryloxy - 2 - hydroxybenzophenone , 4 - methacryloxy - 2 - hydroxybenzophenone , 9 - vinyl anthracene , and 9 - anthracenylmethyl methacrylate . an example of a preferred photoderivatized monomer is bba - apma . photoreactive species are defined herein , and preferred species are sufficiently stable to be stored under conditions in which they retain such properties . see , e . g ., u . s . pat . no . 5 , 002 , 582 , the disclosure of which is incorporated herein by reference . latent reactive groups can be chosen that are responsive to various portions of the electromagnetic spectrum , with those responsive to ultraviolet and visible portions of the spectrum ( referred to herein as “ photoreactive ”) being particularly preferred . photoreactive species respond to specific applied external stimuli to undergo active specie generation with resultant covalent bonding to an adjacent chemical structure , e . g ., as provided by the same or a different molecule . photoreactive species are those groups of atoms in a molecule whose covalent bonds remain unchanged under conditions of storage but upon activation by an external energy source , form covalent bonds with other molecules . the photoreactive species generate active species such as free radicals and particularly nitrenes , carbenes , and excited states of ketones upon absorption of electromagnetic energy . photoreactive species can be chosen to be responsive to various portions of the electromagnetic spectrum , and photoreactive species that are responsive to , e . g ., ultraviolet and visible portions of the spectrum , are preferred and can be referred to herein occasionally as “ photochemical group ” or “ photogroup .” the photoreactive species in photoreactive aryl ketones are preferred , such as acetophenone , benzophenone , anthraquinone , anthrone , and anthrone - like heterocycles , i . e ., heterocyclic analogs of anthrone such as those having n , o , or s in the 10 - position , or their substituted , e . g ., ring substituted , derivatives . examples of preferred aryl ketones include heterocyclic derivatives of anthrone , including acridone , xanthone , and thioxanthone , and their ring substituted derivatives . particularly preferred are thioxanthone , and its derivatives , having excitation energies greater than about 360 nm . the functional groups of such ketones are preferred since they are readily capable of undergoing the activation / inactivation / reactivation cycle described herein . benzophenone is a particularly preferred photoreactive moiety , since it is capable of photochemical excitation with the initial formation of an excited singlet state that undergoes intersystem crossing to the triplet state . the excited triplet state can insert into carbon - hydrogen bonds by abstraction of a hydrogen atom ( from a support surface , for example ), thus creating a radical pair . subsequent collapse of the radical pair leads to formation of a new carbon - carbon bond . if a reactive bond ( e . g ., carbon - hydrogen ) is not available for bonding , the ultraviolet light - induced excitation of the benzophenone group is reversible and the molecule returns to ground state energy level upon removal of the energy source . photoactivatible aryl ketones such as benzophenone and acetophenone are of particular importance inasmuch as these groups are subject to multiple reactivation in water and hence provide increased coating efficiency . the azides constitute a preferred class of photoreactive species and include derivatives based on arylazides ( c 6 r 5 n 3 ) such as phenyl azide and particularly 4 - fluoro - 3 - nitrophenyl azide , acyl azides (— co — n 3 ) such as benzoyl azide and p - methylbenzoyl azide , azido formates (— o — co — n 3 ) such as ethyl azidoformate , phenyl azidoformate , sulfonyl azides (— so 2 — n 3 ) such as benzenesulfonyl azide , and phosphoryl azides ( ro ) 2 pon 3 such as diphenyl phosphoryl azide and diethyl phosphoryl azide . diazo compounds constitute another class of photoreactive species and include derivatives of diazoalkanes (— chn 2 ) such as diazomethane and diphenyldiazomethane , diazoketones (— co — chn 2 ) such as diazoacetophenone and 1 - trifluoromethyl - 1 - diazo - 2 - pentanone , diazoacetates (— o — co — chn 2 ) such as t - butyl diazoacetate and phenyl diazoacetate , and beta - keto - alpha - diazoacetates (— co — cn 2 — co — o —) such as t - butyl alpha diazoacetoacetate . other photoreactive species include the diazirines (— chn 2 ) such as 3 - trifluoromethyl - 3 - phenyldiazirine , and ketenes (— ch ═ c ═ o ) such as ketene and diphenylketene . upon activation of the photoreactive species , the coating agents are covalently bound to each other and / or to the material surface by covalent bonds through residues of the photoreactive species . exemplary photoreactive species , and their residues upon activation , are shown as follows . the coating agents of the present invention can be applied to any surface having carbon - hydrogen bonds , with which the photoreactive species can react to immobilize the coating agents to surfaces . examples of suitable surfaces are described in more detail below . a composition of the present invention includes about 0 to about 93 . 9 mole %, preferably from about 30 to about 70 mole %, and most preferably from about 40 to about 60 mole % of a suitable hydrophilic monomer component . suitable hydrophilic monomers provide an optimal combination of such properties as water solubility , biocompatability , and wettability . most preferably , the hydrophilic monomer improves or provides the resultant polymeric complex with improved water solubility , though noting that the carboxylic acid - containing monomer may be hydrophilic as well , and can contribute to this effect . hydrophilic monomers are preferably taken from the group consisting of alkenyl substituted amides . examples of preferred hydrophilic monomers include acrylamide , n - vinylpyrrolidone , methacrylamide , acrylamido propanesulfonic acid ( amps ). acrylamide is an example of a particularly preferred hydrophilic monomer . such monomers are available commercially from a variety of sources , e . g ., sigma - aldrich , inc . ( st . louis , mo .) and polysciences , inc . ( warrington , pa .). the word “ medicament ”, as used herein , will refer to a wide range of biologically active materials or drugs that can be incorporated into a coating composition of the present invention . the substances to be incorporated preferably do not chemically interact with the composition during fabrication , or during the release process . additives such as inorganic salts , bsa ( bovine serum albumin ), and inert organic compounds can be used to alter the profile of substance release , as known to those skilled in the art . the term “ medicament ”, in turn , will refer to a peptide , protein , carbohydrate , nucleic acid , lipid , polysaccharide or combinations thereof , or synthetic inorganic or organic molecule , that causes a biological effect when administered in vivo to an animal , including but not limited to birds and mammals , including humans . nonlimiting examples are antigens , enzymes , hormones , receptors , peptides , and gene therapy agents . examples of suitable gene therapy agents include a ) therapeutic nucleic acids , including antisense dna and antisense rna , and b ) nucleic acids encoding therapeutic gene products , including plasmid dna and viral fragments , along with associated promoters and excipients . examples of other molecules that can be incorporated include nucleosides , nucleotides , antisense , vitamins , minerals , and steroids . coating compositions prepared according to this process can be used to deliver drugs such as nonsteroidal anti - inflammatory compounds , anesthetics , chemotherapeutic agents , immunotoxins , immunosuppressive agents , steroids , antibiotics , antivirals , antifungals , and steroidal antiinflammatories , anticoagulants . for example , hydrophobic drugs such as lidocaine or tetracaine can be included in the coating and are released over several hours . classes of medicaments which can be incorporated into coatings of this invention include , but are not limited to , anti - aids substances , anti - cancer substances , antibiotics , anti - viral substances , enzyme inhibitors , neurotoxins , opioids , hypnotics , antihistamines , immunosuppresents ( e . g ., cyclosporin ), tranquilizers , anti - convulsants , muscle relaxants and anti - parkinson substances , anti - spasmodics and muscle contractants , miotics and anti - cholinergics , immunosuppressants ( e . g . cyclosporine ) anti - glaucoma solutes , anti - parasite and / or anti - protozoal solutes , anti - hypertensives , analgesics , anti - pyretics and anti - inflammatory agents ( such as nsaid &# 39 ; s ), local anesthetics , ophthalmics , prostaglandins , anti - depressants , anti - psychotic substances , anti - emetics , imaging agents , specific targeting agents , neurotransmitters , proteins and cell response modifiers . a more complete listing of classes of medicaments may be found in the pharmazeutische wirkstoffe , ed . a . von kleemann and j . engel , georg thieme verlag , stuttgart / new york , 1987 , incorporated herein by reference . antibiotics are art recognized and are substances which inhibit the growth of or kill microorganisms . antibiotics can be produced synthetically or by microorganisms . examples of antibiotics include penicillin , tetracycline , chloramphenicol , minocycline , doxycycline , vancomycin , bacitracin , kanamycin , neomycin , gentamycin , erythromycin and cephalosporins . examples of cephalosporins include cephalothin , cephapirin , cefazolin , cephalexin , cephradine , cefadroxil , cefamandole , cefoxitin , cefaclor , cefuroxime , cefonicid , ceforanide , cefotaxime , moxalactam , ceftizoxime , ceftriaxone , and cefoperazone . antiseptics are recognized as substances that prevent or arrest the growth or action of microorganisms , generally in a nonspecific fashion , e . g ., either by inhibiting their activity or destroying them . examples of antiseptics include silver sulfadiazine , chlorhexidine , glutaraldehyde , peracetic acid , sodium hypochlorite , phenols , phenolic compounds , iodophor compounds , quaternary ammonium compounds , and chlorine compounds . anti - viral agents are substances capable of destroying or suppressing the replication of viruses . examples of anti - viral agents include α - methyl - p - adamantane methylamine ), hydroxyethoxymethylguanine , adamantanamine , 5 - iodo - 2 ′- deoxyuridine , trifluorothymidine , interferon , and adenine arabinoside . enzyme inhibitors are substances which inhibit an enzymatic reaction . examples of enzyme inhibitors include edrophonium chloride , n - methylphysostigmine , neostigmine bromide , physostigmine sulfate , tacrine hcl , tacrine , 1 - hydroxy maleate , iodotubercidin , p - bromotetramisole , 10 -( a - diethylaminopropionyl )- phenothiazine hydrochloride , calmidazolium chloride , hemicholinium - 3 , 3 , 5 - dinitrocatechol , diacylglycerol kinase inhibitor i , diacylglycerol kinase inhibitor ii , 3 - phenylpropargylaminie , n - monomethyl - l - arginine acetate , carbidopa , 3 - hydroxybenzylhydrazine hcl , hydralazine hcl , clorgyline hcl , deprenyl hcl , l (−), deprenyl hcl , d (+), hydroxylamine hcl , iproniazid phosphate , 6 - meo - tetrahydro - 9h - pyrido - indole , nialamide , pargyline hcl , quinacrine hcl , semicarbazide hcl , tranylcypromine hcl , n , n - diethylaminoethyl - 2 , 2 - diphenylvalerate hydrochloride , 3 - isobutyl - 1 - methylxanthne , papaverine hcl , indomethacind , 2 - cyclooctyl - 2 - hydroxyethylamine hydrochloride , 2 , 3 - dichloro - a - methylbenzylamine ( dcmb ), 8 , 9 - dichloro - 2 , 3 , 4 , 5 - tetrahydro - 1h - 2 - benzazepine hydrochloride , p - aminoglutethimide , p - aminoglutethimide tartrate , r (+), p - aminoglutethimide tartrate , s (−), 3 - iodotyrosine , alpha - methyltyrosine , l (−), alpha - methyltyrosine , d l (−), cetazolamide , dichlorphenamide , 6 - hydroxy - 2 - benzothiazolesulfonamide , and allopurinol . anti - pyretics are substances capable of relieving or reducing fever . anti - inflammatory agents are substances capable of counteracting or suppressing inflammation . examples of such agents include aspirin ( salicylic acid ), indomethacin , sodium indomethacin trihydrate , salicylamide , naproxen , colchicine , fenoprofen , sulindac , diflunisal , diclofenac , indoprofen and sodium salicylamide . local anesthetics are substances which have an anesthetic effect in a localized region . examples of such anesthetics include procaine , lidocaine , tetracaine and dibucaine . imaging agents are agents capable of imaging a desired site , e . g ., tumor , in vivo . examples of imaging agents include substances having a label which is detectable in vivo , e . g ., antibodies attached to fluorescent labels . the term antibody includes whole antibodies or fragments thereof . cell response modifiers are chemotactic factors such as platelet - derived growth factor ( pdgf ). other chemotactic factors include neutrophil - activating protein , monocyte chemoattractant protein , macrophage - inflammatory protein , sis ( small inducible secreted ), platelet factor , platelet basic protein , melanoma growth stimulating activity , epidermal growth factor , transforming growth factor ( alpha ), fibroblast growth factor , platelet - derived endothelial cell growth factor , insulin - like growth factor , nerve growth factor and bone growth / cartilage - inducing factor ( alpha and beta ). other cell response modifiers are the interleukins , interleukin inhibitors or interleukin receptors , including interleukin 1 through interleukin 10 ; interferons , including alpha , beta and gamma ; hematopoietic factors , including erythropoietin , granulocyte colony stimulating factor , macrophage colony stimulating factor and granulocyte - macrophage colony stimulating factor ; tumor necrosis factors , including alpha and beta ; transforming growth factors ( beta ), including beta - 1 , beta - 2 , beta - 3 , inhibin , activin , and dna that encodes for the production of any of these proteins . the coating composition of the present invention can be used in combination with a variety of devices , including those used on a temporary , transient or permanent basis upon and / or within the body . examples of medical devices suitable for the present invention include , but are not limited to catheters , implantable vascular access ports , blood storage bags , vascular stents , blood tubing , central venous catheters , arterial catheters , vascular grafts , intraaortic balloon pumps , heart valves , cardiovascular sutures , total artificial hearts and ventricular assist pumps , extracorporeal devices such as blood oxygenators , blood filters , hemodialysis units , hemoperfusion units , plasmapheresis units , hybrid artificial organs such as pancreas or liver and artificial lungs , as well as filters adapted for deployment in a blood vessel in order to trap emboli ( also known as “ distal protection devices ”). devices which are particularly suitable include vascular stents such as self - expanding stents and balloon expandable stents . examples of self - expanding stents useful in the present invention are illustrated in u . s . pat . nos . 4 , 655 , 771 and 4 , 954 , 126 issued to wallsten and 5 , 061 , 275 issued to wallsten et al . examples of appropriate balloon - expandable stents are shown in u . s . pat . no . 4 , 733 , 665 issued to palmaz , u . s . pat . no . 4 , 800 , 882 issued to gianturco and u . s . pat . no . 4 , 886 , 062 issued to wiktor . similarly , urinary implants such as drainage catheters are also particularly appropriate for the invention . the surfaces of the medical devices may be formed from polymeric , metallic and / or ceramic materials . suitable polymeric materials include , without limitation , polyurethane and its copolymers , silicone and its copolymers , ethylene vinyl - acetate , thermoplastic elastomers , polyvinyl chloride , polyolefins , cellulosics , polyamides , polyesters , polysulfones , polytetrafluorethylenes , polycarbonates , acrylonitrile butadiene styrene copolymers , acrylics , polylactic acid , polyglycolic acid , polycaprolactone , polylactic acid - polyethylene oxide copolymers , cellulose , collagens , and chitins . metallic materials include metals and alloys based on titanium ( such as nitinol , nickel titanium alloys , thermo - memory alloy materials ), stainless steel , tantalum , nickel - chrome , or cobalt - chromium ( such those available under the tradenames elgiloy ™ and phynox ™). metallic materials also include clad composite filaments , such as those disclosed in wo 94 / 16646 . examples of ceramic materials include ceramics of alumina and glass - ceramics such as those available under the tradename macor ™. the substrates that can be coated with a composition of the present invention include materials that are substantially insoluble in body fluids and that are generally designed and constructed to be placed in or onto the body or to contact fluid of the body . the substrates preferably have the physical properties such as strength , elasticity , permeability and flexibility required to function for the intended purpose ; can be purified , fabricated and sterilized easily ; will substantially maintain their physical properties and function during the time that they remain implanted in or in contact with the body . examples of such substrates include : metals such as titanium / titanium alloys , tini ( shape memory / super elastic ), aluminum oxide , platinum / platinum alloys , stainless steels , mp35n , elgiloy , haynes 25 , stellite , pyrolytic carbon , silver or glassy carbon ; polymers such as polyurethanes , polycarbonates , silicone elastomers , polyolefins including polyethylenes or polypropylenes , polyvinyl chlorides , polyethers , polyesters , nylons , polyvinyl pyrrolidones , polyacrylates and polymethacrylates such as polymethylmethacrylate (“ pmma ”), n - butyl cyanoacrylate , polyvinyl alcohols , polyisoprenes , rubber , cellulosics , polyvinylidene fluoride (“ pvdf ”), polytetrafluoroethylene , ethylene tetrafluoroethylene copolymer (“ etfe ”), acrylonitrile butadiene ethylene , polyamide , polyimide , styrene acrylonitrile , and the like ; minerals or ceramics such as hydroxyapatite ; human or animal protein or tissue such as bone , skin , teeth , collagen , laminin , elastin or fibrin ; organic materials such as wood , cellulose , or compressed carbon ; and other materials such as glass , or the like . substrates made using these materials can be coated or remain uncoated , and derivatized or remain underivatized . medical devices upon or into which the composition can be coated include , but are not limited to , surgical implants , prostheses , and any artificial part or device which replaces or augments a part of a living body or comes into contact with bodily fluids , particularly blood . the substrates can be in any shape or form including tubular , sheet , rod and articles of proper shape . various medical devices and equipment usable in accordance with the invention are known in the art . examples of devices include catheters , suture material , tubing , and fiber membranes . examples of catheters include central venous catheters , thoracic drain catheters , angioplasty balloon catheters . examples of tubing include tubing used in extracorporeal circuitry , such as whole blood oxygenators . examples of membranes include polycarbonate membranes , haemodialysis membranes , membranes used in diagnostic or biosensor devices . also included are devices used in diagnosis , as well as polyester yarn suture material such as polyethylene ribbon , and polypropylene hollow fiber membranes . further illustrations of medical devices include the following : autotransfusion devices , blood filters , blood pumps , blood temperature monitors , bone growth stimulators , breathing circuit connectors , bulldog clamps , cannulae , grafts , implantible pumps , impotence and incontinence implants , intra - ocular lenses , leads , lead adapters , lead connectors , nasal buttons , orbital implants , cardiac insulation pads , cardiac jackets , clips , covers , dialators , dialyzers , disposable temperature probes , domes , drainage products , drapes , ear wicks , electrodes , embolic devices , esophageal stethoscopes , fracture fixation devices , gloves , guide wires , hemofiltration devices , hubs , intra - arterial blood gas sensors , intracardiac suction devices , intrauterine pressure devices , nasal spetal splints , nasal tampons , needles , ophthalmic devices , pap brushes , periodontal fiber adhesives , pessary , retention cuffs , sheeting , staples , stomach ports , surgical instruments , transducer protectors , ureteral stents , vaginal contraceptives , valves , vessel loops , water and saline bubbles , acetabular cups , annuloplasty ring , aortic / coronary locators , artificial pancreas , batteries , bone cement , breast implants , cardiac materials , such as fabrics , felts , mesh , patches , cement spacers , cochlear implant , defibrillators , generators , orthopedic implants , pacemakers , patellar buttons , penile implant , pledgets , plugs , ports , prosthetic heart valves , sheeting , shunts , umbilical tape , valved conduits , and vascular access devices . generally , a solution of the copolymer is prepared at a concentration of about 1 % to a concentration of about 10 % in water or an aqueous buffer solution . depending on the surface being coated , an organic solvent such as isopropyl alcohol (“ ipa ”) can be included in the solution at concentrations varying from about 1 to about 40 %. the medical device or surface to be coated can be dipped into the copolymer solution , or , alternatively , the copolymer solution can be applied to the surface of the device by spraying or the like . at this point , the device can be air - dried to evaporate the solvent or can proceed to the illumination step without drying . the devices can be rotated and illuminated with uv light for 5 - 10 minutes to insure an even coat of the coating . this process can be repeated multiple times to attain the desired coating thickness . coating thicknesses can be evaluated using scanning electron microscopy ( sem ) in both the dry and hydrated forms . the difference in thickness between the dry and the hydrated condition is not generally significant . the thickness of the coating ranges from about 0 . 5 microns to about 20 microns and preferably from about 2 microns to about 10 microns . if a significant amount of surface area is to be coated , it may be preferable to place the device in a rotating fixture to facilitate the coverage of the device &# 39 ; s surface . for example , to coat the entire surface of a vascular stent , the ends of the device are fastened to a rotating fixture by resilient retainers , such as alligator clips . the stent is rotated in a substantially horizontal plane around its axis . the spray nozzle of the airbrush is typically placed 2 - 4 inches from the device . the thickness of the coating can be adjusted by the speed of rotation and the flow rate of the spray nozzle . medicament is typically incorporated into the matrix after the matrix itself has been coated onto a medical device . generally a solution of medicament or medicaments is prepared and the matrix - coated device is soaked in the solution . medicament is absorbed into the matrix from the solution . various solvents can be used to form the medicament solution as the amount of medicament absorbed by the matrix can be controlled by the solvent solution . likewise , the ph and / or the ionic strength of the medicament solution can be adjusted to control the degree of medicament absorption by the matrix . after soaking in medicament solution for a period of time , the medical device is removed and air dried . a coating of the present invention is preferably sufficiently durable and tenacious to permit the coating to remain on the device surface , in vivo , for a period of time sufficient for its intended use , including the delivery of medicaments . the durability and / or tenacity of various coatings , on various surfaces , can be assessed using conventional techniques . applicants , for instance , have constructed a device that includes the use of an adjustable o - ring connected to a high - end torque screw - driver . using this device it is possible to place a constant and replicable force on a coated medical device , e . g ., a catheter . the coated medical device to be tested is inserted into the o - ring and the torque applied to a desired level . the coated device is pulled through the device a predetermined number of times . the coated device is then removed from the o - ring and the device evaluated to determine the amount of matrix remaining on the surface . the matrix remaining on the surface can be detected either directly , e . g ., by staining , and / or indirectly , e . g ., using a drug loading and release assay . after 5 cycles through the device described above , a medical device coated with a formulation of the present invention , preferably retains the ability to absorb and release at least 75 % of its initial capacity . other suitable biomaterials include those substances that do not possess abstractable hydrogens to which the photogroups can form covalent bonds . such biomaterials can be used in a variety of ways . for instance , biomaterials can be made suitable for coating via photochemistry by applying a suitable primer coating which bonds to the biomaterial surface and provides a suitable substrate for binding by the photogroups . for instance , metals and ceramics having oxide groups on their surfaces can be made suitable for coupling via photochemistry by adding a primer coating that binds to the oxide groups and provides abstractable hydrogens . such metals include , but are not limited to , titanium , stainless steel , and cobalt chromium , while such ceramics can include , but are not limited to , silicon nitride , silicon carbide , zirconia , and alumina , as well as glass , silica , and sapphire . one suitable class of primers for metals and ceramics are organosilane reagents , which bond to the oxide surface and provide hydrocarbon groups ( brzoska , j . b ., et . al ., langmuir 10 : 4367 - 4373 , 1994 ). this reference teaches that — sih groups are suitable alternatives for bonding of photogroups . similarly , various tie layers can be applied to various metals , glass , and ceramics , which can in turn serve as sources of abstractable hydrogens for photochemical coupling to the surface . various polymeric materials such as nylon , polystyrene , polyurethane , polyethylene terepthalate , and various monomeric analogs used to prepare such polymers could be used for such tie layers . see , for instance , u . s . pat . nos . 5 , 443 , 455 ; 5 , 749 , 837 ; 5 , 769 , 796 ; 5 , 997 , 517 . the present invention further includes the optional use of additional , e . g ., “ clad ”, layers covering and / or between layers of the composition in either a continuous or discontinuous fashion . for instance , one or more outer layers of one or more other materials , e . g ., a hydrophilic or protective outer coating , can be photoimmobilized or otherwise bound , absorbed or attached on or to a coating prepared as described herein . if desired , for instance , such an additional coating can be applied on top of a medicament absorbing layer , either before and / or after medicament has been absorbed into the matrix . it is preferable to add the additional layer before medicament has been absorbed . for instance , a solution of the same or of a different copolymer can be prepared and the coated device dipped , sprayed or otherwise contacted with the solution and illuminated as described previously . the coated device can then be contacted with , e . g ., soaked in , the medicament solution as described previously . medicament will pass through the top coat and be absorbed by the underlying matrix . when placed in the body , the medicament will be released as described herein . using such a method , a coating with enhanced lubricity , hemocompatibility , or other desired property can be incorporated into the medical device surface , thus forming a device coating that provides multiple desired properties . the invention will be further described with reference to the following non - limiting examples . 4 - benzoylbenzoic acid ( bba ), 1 . 0 kg ( 4 . 42 moles ), was added to a dry 5 liter morton flask equipped with reflux condenser and overhead stirrer , followed by the addition of 645 ml ( 8 . 84 moles ) of thionyl chloride and 725 ml of toluene . dimethylformamide , 3 . 5 ml , was then added and the mixture was heated at reflux for 4 hours . after cooling , the solvents were removed under reduced pressure and the residual thionyl chloride was removed by three evaporations using 3 × 500 ml of toluene . the product was recrystallized from 1 : 4 toluene : hexane to give 988 g ( 91 % yield ) after drying in a vacuum oven . product melting point was 92 - 94 ° c . nuclear magnetic resonance (“ nmr ”) analysis at 80 mhz ( 1 h nmr ( cdcl 3 )) was consistent with the desired product : aromatic protons 7 . 20 - 8 . 25 ( m , 9h ). all chemical shift values are in ppm downfield from a tetramethylsilane internal standard . the final compound ( compound i shown below ) was stored for use in the preparation of a monomer used in the synthesis of photoactivatable polymers as described , for instance , in example 3 . a solution of 1 , 3 - diaminopropane , 1910 g ( 25 . 77 moles ), in 1000 ml of ch 2 cl 2 was added to a 12 liter morton flask and cooled on an ice bath . a solution of t - butyl phenyl carbonate , 1000 g ( 5 . 15 moles ), in 250 ml of ch 2 cl 2 was then added dropwise at a rate which kept the reaction temperature below 15 ° c . following the addition , the mixture was warmed to room temperature and stirred 2 hours . the reaction mixture was diluted with 900 ml of ch 2 cl 2 and 500 g of ice , followed by the slow addition of 2500 ml of 2 . 2 n naoh . after testing to insure the solution was basic , the product was transferred to a separatory funnel and the organic layer was removed and set aside as extract # 1 . the aqueous was then extracted with 3 × 1250 ml of ch 2 cl 2 , keeping each extraction as a separate fraction . the four organic extracts were then washed successively with a single 1250 ml portion of 0 . 6 n naoh beginning with fraction # 1 and proceeding through fraction # 4 . this wash procedure was repeated a second time with a fresh 1250 ml portion of 0 . 6 n naoh . the organic extracts were then combined and dried over na 2 so 4 . filtration and evaporation of solvent to a constant weight gave 825 g of n - mono - t - boc - 1 , 3 - diaminopropane which was used without further purification . a solution of methacrylic anhydride , 806 g ( 5 . 23 moles ), in 1020 ml of chcl 3 was placed in a 12 liter morton flask equipped with overhead stirrer and cooled on an ice bath . phenothiazine , 60 mg , was added as an inhibitor , followed by the dropwise addition of n - mono - t - boc - 1 , 3 - diaminopropane , 825 g ( 4 . 73 moles ), in 825 ml of chcl 3 . the rate of addition was controlled to keep the reaction temperature below 10 ° c . at all times . after the addition was complete , the ice bath was removed and the mixture was left to stir overnight . the product was diluted with 2400 ml of water and transferred to a separatory funnel . after thorough mixing , the aqueous layer was removed and the organic layer was washed with 2400 ml of 2 n naoh , insuring that the aqueous layer was basic . the organic layer was then dried over na 2 so 4 and filtered to remove drying agent . a portion of the chcl 3 solvent was removed under reduced pressure until the combined weight of the product and solvent was approximately 3000 g . the desired product was then precipitated by slow addition of 11 . 0 liters of hexane to the stirred chcl 3 solution , followed by overnight storage at 4 ° c . the product was isolated by filtration and the solid was rinsed twice with a solvent combination of 900 ml of hexane and 150 ml of chcl 3 . thorough drying of the solid gave 900 g of n -[ n ′-( t - butyloxycarbonyl )- 3 - aminopropyl ]- methacrylamide , m . p . 85 . 8 ° c . by differential scanning calorimetry (“ dsc ”). analysis on an nmr spectrometer was consistent with the desired product : 1 h nmr ( cdcl 3 ) amide nh &# 39 ; s 6 . 30 - 6 . 80 , 4 . 55 - 5 . 10 ( m , 2h ), vinyl protons 5 . 65 , 5 . 20 ( m , 2h ), methylenes adjacent to n 2 . 90 - 3 . 45 ( m , 4h ), methyl 1 . 95 ( m , 3h ), remaining methylene 1 . 50 - 1 . 90 ( m , 2h ), and t - butyl 1 . 40 ( s , 9h ). a 3 - neck , 2 liter round bottom flask was equipped with an overhead stirrer and gas sparge tube . methanol , 700 ml , was added to the flask and cooled on an ice bath . while stirring , hcl gas was bubbled into the solvent at a rate of approximately 5 liters / minute for a total of 40 minutes . the molarity of the final hcl / meoh solution was determined to be 8 . 5 m by titration with 1 n naoh using phenolphthalein as an indicator . the n -[ n ′-( t - butyloxycarbonyl )- 3 - aminopropyl ] methacrylamide , 900 g ( 3 . 71 moles ), was added to a 5 liter morton flask equipped with an overhead stirrer and gas outlet adapter , followed by the addition of 1150 ml of methanol solvent . some solids remained in the flask with this solvent volume . phenothiazine , 30 mg , was added as an inhibitor , followed by the addition of 655 ml ( 5 . 57 moles ) of the 8 . 5 m hcl / meoh solution . the solids slowly dissolved with the evolution of gas but the reaction was not exothermic . the mixture was stirred overnight at room temperature to insure complete reaction . any solids were then removed by filtration and an additional 30 mg of phenothiazine were added . the solvent was then stripped under reduced pressure and the resulting solid residue was azeotroped with 3 × 1000 ml of isopropanol with evaporation under reduced pressure . finally , the product was dissolved in 2000 ml of refluxing isopropanol and 4000 ml of ethyl acetate were added slowly with stirring . the mixture was allowed to cool slowly and was stored at 4 ° c . overnight . compound ii was isolated by filtration and was dried to constant weight , giving a yield of 630 g with a melting point of 124 . 7 ° c . by dsc . analysis on an nmr spectrometer was consistent with the desired product : 1 h nmr ( d 2 o ) vinyl protons 5 . 60 , 5 . 30 ( m , 2h ), methylene adjacent to amide n 3 . 30 ( t , 2h ), methylene adjacent to amine n 2 . 95 ( t , 2h ), methyl 1 . 90 ( m , 3h ), and remaining methylene 1 . 65 - 2 . 10 ( m , 2h ). the final compound ( compound ii shown below ) was stored for use in the preparation of a monomer used in the synthesis of photoactivatable polymers as described , for instance , in example 3 . compound ii 120 g ( 0 . 672 moles ), prepared according to the general method described in example 2 , was added to a dry 2 liter , three - neck round bottom flask equipped with an overhead stirrer . phenothiazine , 23 - 25 mg , was added as an inhibitor , followed by 800 ml of chloroform . the suspension was cooled below 10 ° c . on an ice bath and 172 . 5 g ( 0 . 705 moles ) of compound i , prepared according to the general method described in example 1 , were added as a solid . triethylamine , 207 ml ( 1 . 485 moles ), in 50 ml of chloroform was then added dropwise over a 1 - 1 . 5 hour time period . the ice bath was removed and stirring at ambient temperature was continued for 2 . 5 hours . the product was then washed with 600 ml of 0 . 3 n hcl and 2 × 300 ml of 0 . 07 n hcl . after drying over sodium sulfate , the chloroform was removed under reduced pressure and the product was recrystallized twice from 4 : 1 toluene : chloroform using 23 - 25 mg of phenothiazine in each recrystallization to prevent polymerization . typical yields of compound iii were 90 % with a melting point of 147 - 151 ° c . analysis on an nmr spectrometer was consistent with the desired product : 1 h nmr ( cdcl 3 ) aromatic protons 7 . 20 - 7 . 95 ( m , 9h ), amide nh 6 . 55 ( broad t , 1h ), vinyl protons 5 . 65 , 5 . 25 ( m , 2h ), methylenes adjacent to amide n &# 39 ; s 3 . 20 - 3 . 60 ( m , 4h ), methyl 1 . 95 ( s , 3h ), and remaining methylene 1 . 50 - 2 . 00 ( m , 2h ). the final compound ( compound iii shown below ) was stored for use in the synthesis of photoactivatable polymers as described in examples 4 and 5 . acrylamide , 39 . 3 g ( 0 . 55 mole ), and bba - apma ( compound iii ), 15 . 5 g ( 0 . 04 mole ), were dissolved in dimethylsulfoxide (“ dmso ”), followed by methoxypolyethyleneglycol 1000 monomethacrylate ( methoxy peg 1000 ma ), 110 . 8 g ( 0 . 11 mole ), methacrylic acid , 33 . 8 ml ( 0 . 4 mole ), 2 , 2 ′- azobisisobutyronitrile (“ aibn ”), 2 . 3 g ( 0 . 01 mole ), and n , n , n ′, n ′,- tetramethylethylenediamine (“ temed ”), 2 . 2 ml ( 0 . 02 mole ). the solution was deoxygenated with a helium sparge for 60 minutes at 60 ° c ., then sealed under argon and heated overnight at 60 ° c . the resulting product was dialyzed against deionized water using 12 , 000 - 14 , 000 molecular weight cutoff tubing for 66 to 96 hours , then filtered through whatman # 1 filter paper before being lyophilized to give 190 g of polymer . the resultant polymer was identified as methacrylic acid - co - methoxy peg1000 - ma - co - bba - apma having the following general structure ( compound iv ). a series of polymers of the general formula of compound iv were synthesized as generally described in example 4 . the mole percent of acrylamide and methoxy peg1000 monomethacrylate were varied while the mole percent of the bba - apma ( compound iii ) was constant at four mole percent . the ratios of the other groups to carbonyl groups in the various polymers were calculated assuming each mole of the methoxy peg1000 monomethacrylate contained 23 ether groups . a list of the various polymers prepared and the composition of the various polymers are listed below . the following compounds were synthesized in a manner analogous to that described above with respect to compound iv . 2 . 4 % bba - apma , 10 % methoxy peg1000 monomethacrylate , 86 % methacrylic acid ( polymer # 8 in table below ) 3 . 4 % bba - apma , 2 % methoxy peg1000 monomethacrylate , 66 % acrylamide , 28 % methacrylic acid ( polymer # 1 in table below ) 4 . 4 % bba - apma , 2 % methoxy peg1000 monomethacrylate , 42 % acrylamide , 52 % methacrylic acid ( polymer # 2 in table below ) 5 . 4 % bba - apma , 26 % methoxy peg1000 monomethacrylate , 42 % acrylamide , 28 % methacrylic acid ( polymer # 3 in table below ) 6 . 4 % bba - apma , 2 % methoxy peg1000 monomethacrylate , 54 % acrylamide , 40 % methacrylic acid ( polymer # 4 in table below ) 7 . 4 % bba - apma , 14 % methoxy peg1000 monomethacrylate , 54 % acrylamide , 28 % methacrylic acid ( polymer # 5 in table below ) 8 . 4 % bba - apma , 14 % methoxy peg1000 monomethacrylate , 42 % acrylamide , 40 % methacrylic acid ( polymer # 6 in table below ) 9 . 4 % bba - apma , 2 % methoxy peg1000 monomethacrylate , 42 % acrylamide , 52 % methacrylic acid 10 . 4 % bba - apma , 60 % acrylamide , 36 % methacrylic acid 11 . 4 % bba - apma , 50 % acrylamide , 46 % methacrylic acid 12 . 4 % bba - apma , 40 % acrylamide , 56 % methacrylic acid the mole % bba - apma was constant at 4 mole %. the ratios of ether groups to carboxyl groups in the various polymers were calculated assuming each mole of methoxy peg1000 monomethacrylate contained 100 / 44 = 23 ether groups . the composition of the various polymers were : ** polymers # 3 , # 5 , and # 6 were poorly soluble in water and difficult to coat . release of chlorhexidine diacetate and hexachlorophene on stainless steel rods tested against staphylococcus epidermidis stainless steel ( ss , 304 ) rods ( 0 . 75 in ., 2 cm ) were initially pretreated with parylene c as follows : first , the rods were cleaned with enprep 160se detergent ( ethone - omi inc ., bridgeview , ill .) followed by silylation with γ - methacryoxypropyltrimethoxysilane ( sigma chemical co ., st . louis , mo .). five grams of parylene c ( specialty coating systems , indianapolis , ind .) was loaded into the vaporizer of a labcoter 1 , parylene deposition unit , model pds 2010 ( specialty coating systems , indianapolis , ind .) and the parylene was deposited onto the rods in order to achieve a uniform and durable coating of the desired thickness . after precoating , the rods were wiped clean with a cloth soaked in isopropyl alcohol ( ipa ). a solution of compound iv was prepared at a concentration of 50 mg / ml in 20 % ipa . the rods were dipped at 1 . 0 cm ( 0 . 4 in . )/ sec into and 0 . 5 cm ( 0 . 2 in . )/ sec out of solution ( with no dwell period for the first application and a 30 sec dwell period for the second application ). after air - drying for approximately 20 minutes , the coated rods were suspended midway between opposed elc 4000 lamps ( 40 cm ( 15 . 7 in ) apart ) containing 400 watt mercury vapor bulbs which put out 1 . 5 mw / sq . cm from 330 - 340 nm at the point of illumination . the rods were rotated and illuminated for five minutes to insure an even coat of the coating . two coats were applied . two separate solutions of chlorhexidine and hexachlorophene were prepared . chlorhexidine diacetate (“ cda ”) ( 100 mg / ml ) was dissolved in 70 % ethanol ( etoh ) and hexachlorophene (“ hcp ”) was also dissolved in 70 % etoh by heating . the ss rods coated with compound iv were incubated with either the cha or hcp solution for 30 minutes at room temperature . the parts were air - dried overnight . the longevity of the antiseptic release was evaluated by transferring the rods from one agar surface to a fresh agar surface for zone of inhibition analysis . basically , the 2 cm ( 0 . 8 in .) ss rods were laid parallel on to a mueller - hinton agar surface that was incubated with approximately a 1 × 10 6 cfu / ml of staphylococcus epidermidis ( atcc 35984 ). the agar plates containing the parts were incubated overnight at 37 ° c . the zones of inhibition or areas of no bacterial growth were measured across the diameter of the part . samples were transferred daily to new agar plates with fresh lawns of s . epidermidis until no zones of inhibition were present . the cda containing rods produced zones starting at approximately 34 mm and leveling off to 15 - 18 mm by day 4 and continued at that size through day 14 while the hcp containing parts produced zones starting at approximately 33 mm and leveling off to 30 mm by day 3 and continued at that size through day 14 ( end of experiment ). release of chlorhexidine digluconate (“ chg ”) on stainless steel rods tested against staphylococcus epidermidis , staphylococcus aureus , escherichia coli , and candida albicans stainless steel ( ss , 304 ) rods ( 0 . 75 in ., 2 cm ) were pretreated and a solution of compound iv was prepared as described in example 6 . a portion of the rods ( 0 . 6 in ., 1 . 6 cm ) was dip - coated into the coating solution by dipping into the solution at 0 . 5 cm ( 0 . 2 in . )/ sec , swelling for 30 seconds and withdrawing at a rate of 0 . 2 cm ( 0 . 08 in . )/ sec for the first 1 . 2 cm ( 0 . 5 in .) of the rod , the reduced to 0 . 05 cm ( 0 . 02 in .) for the last 0 . 4 cm ( 0 . 16 in .) of the rod . the rods were air - dried for 15 minutes and uv illuminated for 5 minutes with rotation as described in example 6 . two coats were applied . chlorhexidine digluconate ( chg ) ( 100 mg / ml ) was diluted further in deionized ( di ) water . compound iv - coated parylene treated and uncoated rods were sterilized for 20 minutes in 70 % ipa and air - dried . all of the rods were soaked for one hour at room temperature in the chg solution . the parts were then air - dried overnight . the chg - incorporated parts as well as uncoated and compound - iv coated without chg were tested in the zone of inhibition assay agent s . epidermidis ( atcc 35984 ), s . aureus ( atcc 25923 ) e . coli ( atcc 25922 ) and c . albicans ( atcc 10231 ) as described in example 6 . the following results were obtained . s . epidermidis : the controls for both the uncoated and compound iv - coated did not produce zones . the uncoated parts with chg produced zones starting at 22 mm on day 1 and dropped off to no zones by day 4 . the parylene - only coated samples with drug gave zones starting at 25 mm and dropped off to zero zones by day 5 . the compound iv - coated samples with chg incorporated had zones starting at 25 mm , which leveled off to 15 - 20 mm by day 2 through day 14 , and decreasing to 5 mm by day 21 . e . coli : the controls with no drug for both uncoated and compound iv - coated did not produce zones . the uncoated parts with chg produced zones starting at 15 mm and dropped off with no zones by 4 days . the parylene - only sample with drug gave zones starting at 22 mm and dropped off to no zones by 5 days . the compound iv - coated samples with drug had zones starting at 20 mm and gradually decreased to no zones by day 21 . c . albicans : the controls with no drug for both uncoated and compound iv - coated produced no zones . the uncoated parts with chg produced zones starting at 17 mm for day one only . the parylene - only samples with drug gave zones starting at 19 mm and lasted only 2 days . the compound iv - coated samples with drug gave zones that started at 28 mm and gradually decreased to zero zones by day 18 . s . aureus : the controls with no drug for both uncoated and compound iv - coated did not produce zones . the uncoated parts with chg produced zones starting at 23 and dropped off to no zones by day 4 . the parylene - only samples with drug gave zones starting at 25 mm and dropped off to no zones by day 3 . the compound iv - coated samples with drug had zones starting at 23 mm and gradually decreased to 13 mm through day 12 . on day 13 the study was discontinued due to contamination . release of chlorhexidine digluconate ( chg ) on titanium rods tested against s . epidermidis , s . aureus , e . coli , and c . albicans titanium ( 90 ti / 6 al / 4v ) rods ( 0 . 75 in ., 2 cm ) were pretreated with parylene and a compound iv solution was prepared as described in example 6 . the rods were dip coated as described in example 7 , except that the entire rod was coated . the rods were air - dried and uv cured as described in example 6 . two coats were applied . the uncoated , parylene treated , and compound iv - coated rods were sterilized in 70 % ipa for 20 minutes and air - dried . the samples were then incorporated with chg at 100 mg / ml in di water for one hour at room temperature with agitation . the rods were rinsed by dipping three times into tubes containing di water and air - dried overnight . the quantity of chg eluted from the rods was also determined . the individual rods were placed into test tubes containing 2 ml of phosphate buffer saline (“ pbs ”) and were incubated at 37 ° c . overnight with agitation . the rods were transferred to fresh pbs daily , and the eluates were diluted into the high pressure liquid chromatography ( hplc ) mobile phase to solubilize the chg . the amount of chg eluted was measured by hplc and was determined to be 12 . 3 μg / rod for uncoated , 10 . 1 μg / rod for parylene - only , and 275 μg / rod for compound iv - coated . also the chg incorporated parts , as well as uncoated and compound iv - coated without chg were tested in the zone of inhibition assay against s . epidermidis ( atcc 35984 ), s . aureus ( atcc 25923 ) e . coli ( atcc 25922 ) and c . albicans ( atcc 10231 ) as described in example 6 . the results were as follows : s . epidermidis : the uncoated and parylene - only gave zone of 15 - 18 mm on day 1 and died off by day 3 . the compound iv - coated rods with drug gave zones starting at 24 mm , leveling at 15 - 19 mm from day 2 - 21 and then gradually decreasing to no zone on day 27 . s . aureus : the uncoated and parylene - only gave zone of 14 - 16 mm on day 1 and dropped off to no zones by day 3 . the compound iv samples with drug gave zones starting at 20 mm and gradually decreasing to 12 mm on day 16 . they were discontinued on day 20 due to contamination . e . coli : uncoated and parylene - only gave zones of 13 - 14 mm on day 1 and dropped off to no zones by day 3 . the compound iv sample with drug gave zones starting at 20 mm and gradually decreased to no zones on day 20 . c . albicans : uncoated and parylene - only gave zone of 7 - 10 mm on day 1 and dropped off to no zone by day 2 . the compound iv samples with drug had zones starting at 19 mm and gradually decreased to no zones on day 21 . release of benzalkonuim chloride (“ bak ”) and chg from pebax ™ rods tested against s . epidermidis and e . coli pebax ™ rods ( 0 . 75 in ., 2 cm ) were wiped clean with an ipa soaked cloth and a compound iv solution was prepared as described in example 6 . the rods were dipped at 3 . 0 cm ( 1 . 2 in . )/ sec into , 30 sec dwell , and a 3 . 0 cm ( 1 . 2 in . )/ sec out of solution . the rods were air - dried for approximately ten minutes and uv illuminated for 3 minutes with rotation as described in example 6 . two coats were applied and a portion of the pebax ™ rods were cut into 1 cm ( 0 . 4 in .) pieces for the zone of inhibition testing . bak and chg were prepared at 100 mg / ml in di water and the samples were incorporated for one hour at room temperature with agitation . the rods were rinsed three times in di water and air - dried overnight . the samples were tested in the zone of inhibition assay against s . epidermidis ( atcc 35984 ) and e . coli ( atcc 25922 ) as described in example 6 except the rods were placed perpendicular into the agar . s . epidermidis results : the compound iv coatings containing bak gave zones starting at 26 mm and gradually decreasing to no zones by day 16 . the chg coated rods gave zones that started at 22 mm and gradually decreased to 12 mm on day 16 when the study was discontinued . e . coli : the bak coated rods gave zones that started at 11 mm but lasted only 2 days . the chg coated rods gave zones that started at 15 mm and gradually decreased to 9 mm on day 16 when the study was discontinued . release of chg form polyurethane ( pellethane ) catheter material tested against s . epidermidis the polyurethane ( pu ) catheter material was wiped clean with ipa and a solution of compound iv for coating was prepared as described in example 6 . the rods were dip coated in the coating solution by dipping into the solution at 1 . 0 cm ( 0 . 4 in . )/ sec , dwelling for 30 seconds , and withdrawing at a rate of 0 . 5 cm ( 0 . 2 in . )/ sec . the rods were air - dried for 15 minutes and uv illuminated for three minutes with rotation as described in example 6 . two coats of the compound iv coating were applied . the compound iv coated rods were wiped with 70 % ipa and dried for one hour . the rods were cut into 2 cm lengths and the chg was incorporated by dipping the rods into a 200 mg / ml solution of chg for one hour at room temperature and then rinsed three times in di water . the samples were air - dried overnight and tested in the zone of inhibition assay against s . epidermidis ( atcc25984 ) as described in example 6 . all of the uncoated samples and coated samples containing no drug produced no zones of inhibition . the compound iv - coated zones with drug started at 28 mm at day zero and gradually decreased to no zones on day 23 . release of alexidine dihydrochloride (“ adc ”) from polyurethane rods tested against s . epidermidis polyurethane rods ( 6 in ., 15 cm ) were wiped clean as described in example 9 and a compound iv solution was prepared as in example 6 . the rods were dip - coated by dipping into the solution at a rate of 2 . 0 cm ( 0 . 8 in . )/ sec , dwelling for 30 seconds and withdrawing at 3 . 0 ( 1 . 2 in . )/ sec . the samples were air - dried for 10 minutes and uv illuminated for two minutes with rotation as described in example 6 . two coats were applied . a solution of alexidine dihydrochloride ( adc ) ( 100 mg / ml ) in 50 % methanol was prepared with heat . the pu rods were cut into 1 cm lengths and incorporated with the alexidine in the adc solution in a warm water bath . the rods were incorporated for one hour , rinsed three times in di water , and air - dried over night . the samples were tested in the zone of inhibition against s . epidermidis ( atcc 35984 ) as described in example 6 . all of the uncoated samples and coated samples containing no drug produced no zones of inhibition . the compound iv - coated zones with alexidine started at 12 mm and leveled off at 6 - 9 mm form day 2 through the duration of the test period of 21 days . release of vancomycin (“ va ”) on coated pu rods tested against s . epidermidis polyurethane rods ( 6 in ., 15 cm ) were wiped clean as described in example 9 and a compound iv solution was prepared as in example 6 . the rods were dip coated in the coating solution by dipping into the solution at 2 . 0 cm ( 0 . 8 in . )/ sec , dwelling for 30 seconds , and withdrawing at 2 . 0 ( 0 . 8 in . )/ sec . the rods were air - dried for 15 minutes and uv illuminated for four minutes with rotation as described in example 6 . two coats were applied . a solution of vancomycin ( va ) was prepared at 50 mg / ml in di water . the rods were incorporated with va in the va solution for one hour at room temperature , rinsed three times in di water , air - dried , and cut into 1 cm pieces . the samples were tested against s . epidermidis ( atcc35984 ) as described in example 6 . all of the uncoated samples and coated samples containing no drug produced no zones of inhibition . the compound iv coated zones with va started at 20 mm and dropped off to no zones by day 6 . | 8 |
the structure of methoxatin with ring numbering may be depicted as the following formula : the present invention relates to hydroxamic acid derivatives at the 7 - position of methoxatin . the preparation and use of these compounds is described in more detail below and in the examples . a general synthetic route for preparing compounds of formula i is set forth above in scheme 1 . the quinone functionality of methoxatin trimethyl ester ( i ) ( which may be prepared according to martin et al ., helv . chim . acta , 76 , 1667 - 73 ( 1993 )) may be protected by reaction with ethylene glycol ( or similarly with propane - 1 , 3 - diol ) and a catalytic amount of an acid such as p - toluenesulfonic acid , benzenesulfonic acid , or camphorsulfonic acid in refluxing benzene or toluene , utilizing a dean - stark trap to remove water produced by the reaction . the resulting ketal - protected compound ( ii ) may then be dissolved in pyridine - water and allowed to stir at about room temperature for several days ( e . g ., 4 - 10 days ). these very mild conditions result in saponification of the methyl ester at the 7 - position with extraordinarily high regioselectivity . coupling of ( iii ) with o - substituted - hydroxylamines ( i . e ., r 3 - t - o — nh 2 ) using reagents such as edac . hcl , dcc or dic in combination with hobt or hoat , or pybop in combination with a tertiary amine base such as triethylamine or diisopropylethylamine affords compound ( iv ). after purification of ( iv ) by chromatography only a single regioisomer is typically observed by 1 h - nmr . the ketal protecting group may then be removed by acid hydrolysis ( e . g ., dilute hcl ) to liberate the quinone functionality . saponification of the remaining two methyl esters may then be accomplished by treatment with a hydroxide base , such as , for example , lioh , naoh , or koh , to provide ( v ). the synthesis outlined in scheme 1 provides a generally applicable strategy for the regiospecific introduction of hydroxamic acid modifications to methoxatin at the 7 - position , leaving the 2 and 9 positions of methoxatin as free carboxylic acids or their base addition salts . in certain embodiments , the compounds of the present invention , e . g ., compounds of formulas i and ii may be capable of forming salts . acceptable base addition salts may be formed with metals or amines , such as alkali and alkaline earth metal hydroxides , or of organic amines examples of metals used as cations are aluminum , calcium , magnesium , potassium , sodium , lithium , and the like . examples of suitable amines include tertiary amines , such as triethylamine , n , n - di ( isopropyl )- ethylamine , n - methylmorpholine , n - methylpiperidine , n - methylpyrrolidine , and the like , and aromatic amines , such as pyridine , 2 , 6 - dimethylpyridine , 2 , 4 , 6 - trimethylpyridine , 4 -( dimethylamino ) pyridine , and the like . in a particular embodiment , a compound of formula ii may form a pyridine salt . in certain embodiments , the compounds of formula i retain the natural co - enzyme activity of methoxatin , indicating that the compound is still recognized as methoxatin by the enzymes for which it is a co - factor . in certain embodiments , the compounds of formula i retain from 1 % to 100 of the activity of native methoxatin using the gdh assay of example 14 . in certain embodiments , the compounds of formula i retain greater than 5 % activity of native methoxatin , 10 % activity of native methoxatin , greater than 15 % activity of native methoxatin , greater than 20 % activity of native methoxatin , greater than 25 % activity of native methoxatin , greater than 30 % activity of native methoxatin , greater than 35 % activity of native methoxatin , or greater than 40 % activity of native methoxatin using the gdh assay of example 14 . in certain embodiments , the compound of formula i retain between about 40 % to about 100 % of the activity of native methoxatin using the gdh assay of example 14 . compounds of formula i may be used to prepare antibodies against pqq which can be used to isolate and or assay for quinoproteins . for example , a compound of formula i may be reacted with an antigenic carrier protein ( e . g ., keyhole limpet hemocyanin ( klh ), serum albumin , bovine thyroglobulin , or soybean trypsin inhibitor ). in certain embodiments , the compound of formula i that may be employed is a compound of formula i with a free thiol group , which may react with a free thiol group on the carrier protein to form a disulfide bond . the resulting compound - carrier protein conjugate may then be used to induce polyclonal antibodies against the compound of formula i in an animal . the immunization of the animals can be by any method known in the art . see , e . g ., harlow and lane , antibodies : a laboratory manual , new york : cold spring harbor press , 1990 . methods for immunizing non - human animals such as mice , rabbits , rats , sheep , goats , pigs , cattle and horses are well known in the art . see , e . g ., harlow and lane , supra . subsequently , antibodies to methoxatin may be isolated from the mammal &# 39 ; s blood . methoxatin antibodies would be useful in biochemical assays that employ methoxatin as an enzyme cofactor . for example , the methoxatin antibodies could be immobilized on a solid support and used to scavenge methoxatin from an assay solution . in certain embodiments , the compound of formula i that may be employed is a compound of formula i with a terminal — n 3 group as r 3 or r 4 . compounds of formula i may also be used to purify methoxatin antibodies and quinoproteins ( e . g ., gdh from a biological source such as aspergillus niger or acinetobactercalcoaceticus ). a wide variety of chemistries may be employed to couple compounds of formula i to solid supports and chromatographic media that can be employed in affinity purification methods to isolate , identify , or assay quinoproteins . for example , a compound of formula i may be reacted with solid cross - linked dextran gel particles . or agarose particles . the resulting ( formula i )- dextran gel or ( formula i )- agarose materials may then be used in column chromatography to identify and purify quinoproteins , such as glucose dehydrogenase . the purified glucose dehydrogenase can be used to assay for glucose , which has applications in the diagnosis and treatment of diseases such as diabetes . for example , an affinity column may be prepared using a compound of formula i . for example , an azide - containing compound of formula i may be reacted with phosphine - modified solid agarose beads . the resulting agarose - compound conjugate may then be used to purify a quinoprotein or methoxatin antibody . in addition , an affinity purification of methoxatin antibodies or a quinoprotein may be carried out by incubating a compound of formula i containing a cf 3 ( cf 2 ) f ( ch 2 ) g — group at r 3 , where f is an integer from 1 to 11 , g is 0 or an is an integer from 1 to 3 ( e . g ., a cf 3 ( ch 2 ) 7 — group ) with an impure source of methoxatin antibodies or quinoprotein . the resulting mixture may be then adsorbed onto silica gel containing fluorohydrocarbon side chains ( e . g ., cf 3 ( ch 2 ) 7 —) ( e . g ., fluorous spe ( f - spe ) cartridge (“ fluorous solid - phase extraction ), fluorous technologies , inc ., pittsburgh , pa .) and rinsed with water . the methoxatin antibodies or quinoprotein may then be eluted with a solution of methoxatin ( alternatively a compound of formula i could be used ) to elute purified methoxatin antibodies or quinoprotein . a suspension of trimethyl 4 , 5 - dioxo - 4 , 5 - dihydro - 1h - pyrrolo [ 2 , 3 - f ] quinoline - 2 , 7 , 9 - tricarboxylate , 1 ( 1 . 2 g , 3 . 22 mmol ) in benzene ( 200 ml ) was treated with ethylene glycol ( 10 ml ) and p - toluensulfonic acid ( 60 mg , 0 . 32 mmol ). the resulting mixture was heated at reflux under a dean - stark trap and reflux condenser for 14 hours . the orange suspension became a yellow solution . the heat was turned off , the trap was removed , and the condenser was replaced . to the hot solution , a mixture of benzene ( 75 ml ) and dcm ( 75 ml ) was cautiously added . the resulting solution was allowed to cool to room temperature , and then washed with 5 % aqueous nahco 3 ( 100 ml ). the organic layer was separated and washed with water ( 100 ml ). the organic layer was separated , dried over na 2 so 4 , and filtered . evaporation of solvent at reduced pressure gave a yellow solid . flash chromatography on silica gel ( 40 g ), eluting with etoac - dcm - hexane ( 50 : 25 : 25 ) gave purified 2 ( 1 / 02 g , 74 . 4 %) as a yellow solid upon evaporation of solvent . 1 h - nmr ( cdcl 3 , δ ) 12 . 31 ( s , 1h , nh ), 8 . 77 ( s , 1h , h - 8 ), 7 . 15 ( d , 1h , h - 3 ), 4 . 35 ( m , 2h , och 2 ), 4 . 30 ( m , 2h , och 2 ), 4 . 11 ( s , 1h , co 2 ch 3 ), 4 . 07 ( s , 1h , co 2 ch 3 ), 3 . 93 ( s , 1h , co 2 ch 3 ). a solution of the product from example 1 ( 2 , 1 . 0 g , 2 . 4 mmol ) in a mixture of pyridine ( 75 ml ) and water ( 25 ml ) was stirred in a capped flask at room temperature for 5 days . the reaction mixture was concentrated at reduced pressure to give an oil that begins to crystallize . trituration with etoac ( 40 ml ) gave a slurry of yellow solid , which was collected by filtration . after drying to constant weight , 3 ( 0 . 91 g , 78 . 8 %) was isolated . nmr ( dmso - d 6 , δ ), 13 . 82 ( br , 1h , nh ), 8 . 68 ( d , 2h , 2 , 6 - pyridine - h ), 8 . 58 ( s , 1h , h - 8 ), 8 . 02 ( m , 1h , 4 - pyridine - h ), 7 . 58 ( m , 2h , 3 , 5 - pyridine - h ) 7 . 01 ( d , 1h , h - 3 ), 4 . 25 ( m , 2h , och 2 ), 4 . 14 ( m , 2h , och 2 ), 3 . 93 ( s , 3h , co 2 ch 3 ), 3 . 83 ( s , 3h , co 2 ch 3 ). a mixture of the product from example 2 ( 3 , 95 mg , 0 . 2 mmol ), edac . hcl ( 1 - ethyl - 3 -( 3 - dimethylaminopropyl ) carbodiimide hydrochloride ) ( 104 mg , 0 . 54 mmol ) and hobt ( 1 - hydroxy - benzotriazole ) ( 73 mg , 0 . 54 mmol ) was placed under a n 2 atmosphere . anhydrous dcm ( dichloromethane ) ( 2 . 5 ml ) was added and the resulting mixture was stirred for 2 minutes until a solution was obtained . a solution of 4 - penten - 1 - yl - oxyamine ( 70 μl , 0 . 59 mmol ) in dcm ( 1 ml ) was added and stirring continued at room temperature for 3 hours . the reaction mixture was diluted with dcm ( 30 ml ), washed with 0 . 5m hcl ( 30 ml ), and then washed with water ( 30 ml ). the cloudy organic layer was separated and allowed to stand at room temperature for 15 minutes . the organic layer was decanted from some water droplets , dried over na 2 so 4 , filtered , and evaporated to a yellow solid . flash chromatography on silica gel ( 5 g ), eluting with dcm - meoh ( gradient 99 . 5 : 5 to 98 : 2 ) gave a yellow oil upon evaporation of solvents . trituration with etoac and evaporation of the resulting slurry gave 4 ( 67 mg , 69 %) as a yellow solid after drying in vacuo . ms ( ap −) 484 ( m − 1 ). a solution of the product from example 3 ( 4 , 32 mg , 64 μmol ) in thf ( 6 ml ) was treated with 1n hcl ( 0 . 6 ml ) was kept at 45 - 47 ° c . for 24 hours . the reaction mixture was cooled to room temperature . tlc ( dcm - meoh 95 : 5 ) shows no 4 ( r f = 0 . 75 ) and one major product ( r f = 0 . 4 ). the solution was concentrated on a rotary evaporator to remove thf . the resulting mixture was partitioned between etoac ( 25 ml ) and saturated aqueous nacl ( 25 ml ). the organic layer was separated and allowed to stand for 15 minutes . the organic solution was decanted from some aqueous droplets . it was then evaporated at reduced pressure to give an orange solid . the solid was dissolved in 0 . 25 m lioh ( 1 ml , 0 . 25 mmol ). the resulting black solution was stirred at room temperature for 24 hours . the reaction mixture was then acidified by dropwise addition of concentrated hcl ( 3 drops from a pasteur pipet ) to give a slurry of an orange solid . the slurry was cooled on an ice bath for 10 minutes then the solid was collected by filtration , rinsing with ice - cold water ( 2 × 2 ml ) and et 2 o ( 2 × 2 ml ). the solid was then dried under vacuum for 6 hours to afford 5 ( 13 . 5 mg , 51 %). ms ( ap − taken from a meoh solution ) 444 ( m + meoh − 1 ), 412 ( m − 1 ). nmr ( dmso - d 6 , δ ), 13 . 55 ( br , 1h , co 2 h ), 12 . 65 ( br , 1h , co 2 h ), 12 . 02 ( br , 1h , conh ), 11 . 83 ( br , 1h , nh ), 8 . 24 ( s , 1h , h - 8 ), 7 . 20 ( s , 1h , h - 3 ), 5 . 87 ( m , 1h , vinyl - h ), 5 . 05 ( dd , 1h , vinyl - h ), 4 . 99 ( dd , 1h , vinyl - h ), 4 . 03 ( t , 2h , och 2 ), 2 . 18 ( q , 2h , allyl - ch 2 ), 1 . 75 ( m , 2h , ch 2 ). a mixture of the product from example 2 ( 3 , 390 mg , 0 . 81 mmol ), edac . hcl ( 427 mg , 2 . 23 mmol ) and hobt ( 301 mg , 0 . 2 . 23 mmol ) was placed under a n 2 atmosphere . anhydrous dcm ( 10 ml ) was added and the resulting mixture was stirred for 2 minutes until a solution was obtained . a solution of o -( 11 - azido - 3 , 6 , 9 - trioxa - undecyl ) hydroxylamine ( 569 mg , 2 . 43 mmol ) in dcm ( 5 ml ) was added and stirring continued at room temperature for 2 hours . the reaction mixture was diluted with dcm ( 85 ml ), washed with 0 . 5m hcl ( 100 ml ), and then washed with water ( 100 ml ). the cloudy organic layer was separated and allowed to stand at room temperature for 10 minutes . the organic layer was decanted from some water droplets . the previous two steps ( standing and decanting ) was repeated twice more . then the solution was dried over na 2 so 4 , filtered , and evaporated to a yellow gum . flash chromatography on silica gel ( 25 g ), eluting with dcm - etoac ( gradient 97 : 3 to 85 : 15 ), followed by dcm - etoac - meoh ( 85 : 13 : 2 ) gave a yellow oil upon evaporation of solvents that begins to crystallize on standing . refrigeration for two days gives a crystalline mass that was pulverized and dried in vacuo to afford 6b ( 406 mg , 81 %). ms ( ap − taken from a solution in meoh ) 649 ( m + meoh - 1 ), 617 ( m − 1 ). a solution of the product from example 5 ( 6 , 250 mg , 0 . 4 mmol ) in thf ( 36 ml ) was treated with 1n hcl ( 0 . 4 ml ) was kept at 45 - 47 ° c . in for 24 hours . the reaction mixture was cooled to room temperature . tlc ( dcm - meoh 95 : 5 ) shows no 4 ( r f = 0 . 75 ) and one major product ( r f = 0 . 45 ). the solution was concentrated on a rotary evaporator to remove thf . the resulting mixture was partitioned between etoac ( 100 ml ) and saturated aqueous nacl ( 50 ml ). the organic layer was separated and allowed to stand for 15 minutes . the organic solution was decanted from some aqueous droplets . the last two steps ( standing and decanting ) were repeated . the resulting etoac solution was then evaporated at reduced pressure to give an orange gum . the gum was dissolved in dcm ( 20 ml ) and evaporated at reduced pressure twice to give an orange foam which was further dried in vacuo for 4 hours . the foam was dissolved in 0 . 5 m lioh ( 3 . 4 ml , 1 . 7 mmol ). the resulting black solution was stirred at room temperature for 24 hours . the reaction mixture was then acidified by dropwise addition of concentrated hcl ( 0 . 25 ml , 3 mmol ) to give red solution . the solution was partitioned between etoac ( 50 ml ), water ( 5 ml ) and saturated aqueous nacl ( 5 ml ). the organic layer was separated and allowed to stand for 15 minutes . the organic solution was decanted from some aqueous droplets . evaporation of solvent at reduced pressure gave a red gum . the gum was triturated with dcm and the resulting slurry was evaporated at reduced pressure . the resulting solid was triturated with dcm - hexanes ( 1 : 1 ), the solvent was decanted from the red - brown solid , and the solid was dried in vacuo to afford 7 ( 94 mg 43 %). ms ( ap − taken from a meoh solution ) 577 ( m + meoh - 1 ), 545 ( m − 1 ). a mixture of the product from example 2 ( 3 , 400 mg , 0 . 83 mmol ), edac . hcl ( 440 mg , 2 . 28 mmol ) and hobt ( 310 mg , 0 . 2 . 28 mmol ) was placed under a n 2 atmosphere . anhydrous dcm ( 10 ml ) was added and the resulting mixture was stirred for 2 minutes until a solution was obtained . a solution of o -( 6 -( tritylthio ) hexyl ) hydroxylamine ( 980 mg , 2 . 49 mmol ) in dcm ( 5 ml ) was added and stirring continued at room temperature for 90 minutes . the reaction mixture was diluted with dcm ( 85 ml ), washed with a mixture of water ( 100 ml ) and saturated aqueous nahco 3 ( 100 ml ). the organic layer was separated and washed with a mixture of 0 . 2n hcl ( 100 ml ) and saturated aqueous nacl ( 50 ml ). the organic layer was dried over na 2 so 4 , filtered , and evaporated to a yellow oil . flash chromatography on silica gel ( 30 g ), eluting with dcm - etoac ( gradient 98 : 2 to 85 : 15 ), followed by dcm - etoac - iproh ( 85 : 13 : 2 ) gave a yellow oil upon evaporation of solvents that begins to crystallize on standing . etoac ( 10 ml ) was added and the resulting suspension was stirred with a glass rod to pulverize the solid . the solid was collected by filtration , using additional etoac ( 12 ml ) to complete the transfer and rinse the solid . further drying in vacuo at room temperature afforded 8 ( 420 mg , 65 %) as a yellow solid . ms ( ap − taken from a solution in meoh ) 806 ( m + meoh - 1 ), 774 ( m − 1 ). ms ( ap + taken from a solution in meoh ) 806 ( m + meoh + na ), 798 ( m + na ). a solution of the product from example 7 ( 8 , 100 mg , 129 μmol ) in a mixture of anhydrous dcm ( 2 ml ) and anhydrous meoh ( 1 ml ) was treated with a solution of i 2 in meoh ( 15 . 8 mm , 4 . 4 ml , 69 μmol ). the resulting solution was stirred 40 minutes at room temperature then anhydrous pyridine ( 21 μl , 260 μmol ) was added and stirring was continued for another 40 minutes at room temperature . the reaction mixture was concentrated at reduced pressure . the residue was partitioned between etoac ( 30 ml ) and water ( 30 ml ). the organic layer was washed with saturated aqueous nacl ( 10 ml ), dried over na 2 so 4 , filtered , and evaporated at reduced pressure . flash chromatography on silica gel , eluting with dcm - etoac ( 75 : 25 ), followed by dcm - meoh ( 97 : 3 ) afforded purified 9 ( 46 mg , 65 %). ms ( ap − taken from a solution in meoh ) 1128 ( m + 2meoh - 1 ), 1096 ( m + meoh - 1 ). ms ( ap + taken from a solution in meoh ) 1151 ( m + 2meoh + na ), 1119 ( m + meoh + na ), 1088 ( m + na ), 1066 ( m + 1 ). using the method of example 5 , n -( 11 - aminooxy - 3 , 6 , 9 - trioxadodecyl )- 4 , 4 , 5 , 5 , 6 , 6 , 7 , 7 , 8 , 8 , 9 , 9 , 10 , 10 , 11 , 11 , 11 - heptadecafluoroundecanamide is acylated by 3 to afford 10 . using the method of example 6 , the product from example 9 ( compound 10 ) is deprotected and saponified to afford 11 . colorless , low density aminoethyl - agarose beads ( 1 ml ) may be suspended in mecn - pyridine ( 9 : 1 , 10 ml ) and treated with 4 -( 2 , 5 - dioxo - 1 - pyrrolidinyl )- 2 -( diphenylphosphino )- 1 , 4 - benzenedicarboxylic acid - 1 - methyl ester ( 9 , 150 mg ). the mixture may then be shaken in a sealed flask for 24 hours . the derivatized beads may then be collected by filtration and washed with mecn ( 4 × 10 ml ). the derivatized beads would be ninhydrin negative ( no color ) as compared to the starting aminoethyl - agarose which would be ninhydrin positive ( blue color ). the azido - methoxatin derivative from example 6 ( 7 , 4 . 0 mg , 7 . 3 μmol ) may be mixed with distilled water ( 0 . 4 ml ), treated with 0 . 5 m lioh ( 29 μl , 14 . 5 μmol ), and diluted with mecn ( 0 . 6 ml ) to afford a red solution . this solution may be added to the derivatized beads . the mixture may then be shaken in a capped vial for 24 hours . the solid may be collected by filtration and rinsed with mecn — h 2 o ( 1 : 1 ) until the rinse is colorless . the red color of the solid would indicate the successful conjugation of the azido - methoxatin ( 7 ) to the agarose beads . solid 5 -[ n -( 6 - aminohexyl )- 3 -( e )- acrylamido ]- 5 ′- o -( dimethoxytrityl )- 2 ′- deoxyuridine ( 12 , 0 . 5 g , 0 . 72 mmol )) and solid 4 -( 2 , 5 - dioxo - 1 - pyrrolidinyl )- 2 -( diphenylphosphino )- 1 , 4 - benzenedicarboxylic acid - 1 - methyl ester ( 13 , 0 . 33 g , 0 . 72 mmol ) were placed in a flask under n 2 atmosphere . anhydrous dcm ( 10 ml ) and anhydrous pyridine ( 1 ml ) were added and the mixture was stirred at room temperature for 18 hours . the reaction mixture was partitioned between dcm ( 25 ml ), water ( 25 ml ) and saturated aqueous nahco 3 ( 50 ml ). the organic layer was separated , dried over na 2 so 4 and filtered . evaporation of solvent at reduced pressure gave a yellow oil . flash chromatography on silica gel ( 25 g ), eluting with dcm - meoh ( gradient of 99 : 1 to 96 : 4 ) afforded purified product upon evaporation of solvents at reduced pressure . further drying in vacuo for 18 hours gave 59 mg of an off - white solid . a portion of this intermediate solid ( the dmt protected form of 14 , 157 mg , 0 . 15 mmol ) was dissolved a mixture of anhydrous thf ( 0 . 5 ml ), 1 , 1 , 1 , 3 , 3 , 3 - hexafluoro - propan - 2 - ol ( 1 . 5 ml ) and triethylsilane ( 0 . 1 ml , 0 . 63 mmol ) and stirred at room temperature for 24 hours . the reaction mixture was concentrated at reduced pressure to afford a wet paste . flash chromatography on silica gel ( 4 g ), eluting with dcm - meoh ( a gradient of 100 : 0 to 90 : 10 ) afforded purified product upon evaporation of solvent . further drying in vacuo at room temperature for 18 hours gave 14 ( 68 mg , 61 %). ms ( ap +) 743 ( m + 1 ), 765 ( m + na ). the product from example 6 ( 7 , 4 . 0 mg , 7 . 3 μmol ) was mixed with distilled water ( 0 . 4 ml ) and treated with 0 . 5 m lioh ( 29 μl , 14 . 5 μmol ). the resulting red solution was diluted with mecn ( 0 . 6 ml ). the product from example 12 ( 14 , 25 mg , 33 . 7 nmol ) was added in solid form , then the reaction mixture was placed under an atmosphere of n 2 and stirred at room temperature for 48 hours . the reaction mixture was diluted with distilled water ( 0 . 4 ml ) and the resulting solution was concentrated under a stream of n 2 gas for approximately 30 minutes until most of the mecn had evaporated which resulted in a heterogeneous mixture of solid in a red solution . the solid was removed by filtration through a plug of glass wool in a pasteur pipet , rinsing with distilled water ( 0 . 1 ml ). the combined filtrate and rinse was extracted with etoac ( 3 × 0 . 5 ml ). the red aqueous fraction was treated with a stream of n 2 gas for approximately 15 minutes , then trace solids were removed by filtration through a plug of glass wool in a pasteur pipet . the resulting red solution was acidified by addition of 1n hcl ( 30 μl , 30 nmol ) which caused a dark tar to precipitate and stick to the glass . the liquor was withdrawn with a pipet and the tar was rinsed with distilled water ( 0 . 5 ml ), which was also withdrawn with a pipet . the tar was further dissolved in mecn — h 2 o ( 1 : 1 , 1 ml ) and the solution was evaporated in vacuo at room temperature to afford 15 as a dark orange solid ( 4 mg , 44 %). ms ( ap − taken from a meoh solution ) 1278 ( m + meoh - 1 ), 1246 ( m − 1 ). the coenzyme activity of several compounds relative to native methoxatin was determined with a published assay that utilizes soluble glucose dehydrogenase ( gdh ) from acinetobactercalcoaceticus . ( misset - smits et al ., methods in enzymol ., 280 , 89 - 98 ( 1997 )). table 1 shows illustrative results for methoxatin and methoxatin derivatives with gdh assay expressed as a percentage of the methoxatin sample . compounds j and k which modify the 2 position of the methoxatin core displayed less than 0 . 1 % of the activity of the native methoxatin sample . compounds 5 and 7 displayed 40 and 45 %, respectively , of the activity of the native methoxatin sample . | 2 |
with reference to fig1 and 2 , a computer main unit 10 is shown according to an embodiment of the present invention . the computer main unit 10 includes a panel 4 . in one embodiment , the panel 4 is disposed at an operational end of the computer main unit 10 , which is typically a front end from which disk drives and buttons are accessed . in one embodiment , the size and the shape of the panel 4 correspond to the end of the computer main unit 10 to which it is engaged . an embodiment of the invention includes an inner shield 1 , an outer shield 2 , and at least one display board 3 . fig1 shows an assembly view of an embodiment of the invention . the front panel display system can be assembled to , e . g ., the operation end of a computer main unit 10 . the inner shield 1 has a size and a shape corresponding to the operational end of the computer main unit 10 . at the upper portion of the inner shield 1 is an opening 11 for accommodating internal devices of the computer main unit , such as removable media devices . further , a lower portion of the inner shield 1 has an opening 12 for accommodating connections from external devices outside the computer main unit 10 to internal devices or other circuitry within the computer main unit 10 . the outer shield 2 can cover and join with the inner shield 1 to secure the panel 4 . preferably , the outer shield 2 is made of transparent material or otherwise configured to allow viewing of the panel 4 . further , the outer shield 2 has a size and a shape corresponding to the operation end of the main unit 10 as the inner shield does . an access port 21 can be provided to accommodate buttons 13 and other controls . in addition , the outer shield 2 is provided with a connecting hole 22 corresponding to the connecting opening 12 . the panel further includes a display board 3 . the display board 3 is configured to sit against and be secured in part by the inner shield 1 . as the assembly drawing of fig1 shows , the display board 3 is disposed between the inner shield 1 and an outer shield 2 . the display board 3 further corresponds to the shield opening 11 ; however , additional display boards 3 may be provided to cover areas corresponding to the shield opening 11 . preferably , the outer shield 2 is transparent or otherwise allows the display board 3 to be visible , either partially or entirely , when the panel is assembled . in one embodiment , the display board 3 comprises one or more a cold light plates . using a plurality of cold light plates enables two or more different color illumination layers to be provided , where each illumination layer is made from electricity excited light film material . by layering a number of cold light plates and selectively illuminating one of the plates , the colors displayed by the display board 3 can be controlled . using technology presently available , a number of different colors can be implemented , including white , orange , red , pink , green , yellow , and blue . these are achieved by selecting from rare earth elements such as prf 3 , naf 3 , smf 3 , euf 3 , tbf 3 , dyf 3 , hof 3 , erf 3 , tmf 3 , ybf 3 , and mnf 2 . the display board 3 is electrically coupled to a circuit 5 for receiving electrical energy therefrom . in the case where the display board 3 comprises one or more cold light plates , the display board uses electrical energy to generate excited cold light . in one embodiment , the circuit 5 is operatively coupled to the computer and receives electrical energy from the computer &# 39 ; s power supply . however , the circuit 5 may be separately implemented and include its own power source . the control of color selection can be set via press button or software . the circuit 5 may be attached to the main unit 10 . in another embodiment , the display board 3 comprises a liquid crystal display ( lcd ). other display devices may also be used , alone or in combination with others . with a liquid crystal display , a circuit 5 is coupled to the lcd and controls the display thereon . the display board 3 can be configured to display a solid color or any among an unlimited selection of characters , numbers , or pictures , in addition to a background . accordingly , the display board 3 can be configured to display functional information , such as the time , temperature , or characteristics of the computer , for example . with reference to fig2 again , an assembled perspective view of the panel is illustrated . due to the panel being provided with the display board 3 , colors can be shown via display and changeability of displayed colors can be achieved by way of different display materials in company with hardware design . in this way , it is possible to enhance the appearance of the computer , and to provide information to the user . in addition , as the foregoing , the background and the pictures can be operated with change between colors and the display of information can be executed accordingly . furthermore , the user can select the operation of the panel , allowing the user to customize the appearance and function of the computer main unit 10 . the foregoing description of the embodiments of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . persons skilled in the relevant art can appreciate that many modifications and variations are possible in light of the above teaching . it is therefore intended that the scope of the invention be limited not by this detailed description , but rather by the claims appended hereto . | 6 |
the following is a detailed explanation , with reference to the attached drawings , of the apparatus for rf level stabilization of an optical link over temperature variations , and a method for using the apparatus for rf level stabilization of an optical link over temperature variations , in embodiments of the present invention . it should be noted that the same reference numbers are assigned to components having approximately the same functions and structural features in the following explanation and the attached drawings to preclude the necessity for repeated explanation thereof . [ 0029 ] fig1 shows a block diagram representation of a current stabilization system 100 for an optical link according to an embodiment of the related art . current stabilization system 100 includes a transmitter section 102 , an optical link 150 , and a receiver section 105 . transmitter section 102 includes an rf path comprising rf in amplifier circuit 110 and rf in attenuator circuit 120 , which are coupled to a laser transmitter 140 . laser transmitter 140 is powered by supply voltage v cc , and includes a laser device ( e . g ., a laser diode ) 142 , a bias input circuit 141 , and a back facet ( bf ) monitor circuit 143 . a first transmitter feedback loop 135 provides a bias current feedback signal 130 from bf monitor circuit 143 signal to the bias input circuit 141 . the bias current feedback bias signal 130 derived from the back facet monitor circuit 143 represents the dc current range of the laser device 142 . the output signal from the laser device 142 is carried over optical link 150 , and is received by receiver section 105 . receiver section 105 includes photo diode circuit 160 , which is controlled by optical modulation voltage ( omv ) control circuit 161 , and powered by supply voltage v cc . the output of photo diode circuit 160 is coupled to an rf path comprising rf out amplifier circuit 170 and rf out attenuator circuit 180 . optical link 150 may be comprised of , inter alia , erbium doped fiber amplifiers ( edfas ), semiconductor optical amplifiers ( soa &# 39 ; s ), and various kinds of optical fiber , such as , inter alia , single mode fiber ( smf ) or dispersion compensating fiber ( dcf ). an inherent drawback in the related art current stabilization system 100 , is that this current stabilization system 100 cannot compensate for two well known phenomenon , namely that the efficiency of a laser drops as temperature rises , and that tracking errors exist which prevent an exact tracking of the output level of the laser as the temperature varies . referring now to fig2 a block diagram representation of a basic rf in level stabilization system 200 according to an embodiment of the present invention . basic rf in level stabilization system 200 includes a transmitter section 202 , an optical link 150 , and a receiver section 205 . transmitter section 202 is similar to transmitter section 102 of the current stabilization system 100 of fig1 . receiver section 205 is similar to receiver section 105 of the current stabilization system 100 of fig1 except that receiver section 205 includes an added first receiver feedback loop 266 . first receiver feedback loop 266 provides a feedback signal from the optical modulation voltage ( omv ) control circuit 161 to the rf out attenuator circuit 180 . the optical modulation voltage ( omv ) control circuit 161 produces an feedback signal which is proportional to changes in the optical level of the photo diode 160 . first receiver feedback loop 266 includes a feedback attenuation circuit 265 to scale the feedback signal to a level compatible with rf out attenuator circuit 180 . this embodiment ( fig2 ) compensates for changes in the optical power , including the tracking error . however , this embodiment cannot accommodate changes in the optical modulation index caused by changes in laser efficiency . [ 0036 ] fig3 is a block diagram representation of an enhanced rf level stabilization system according to an embodiment of the present invention . enhanced rf level stabilization system 300 includes a transmitter section 302 , an optical link 150 , and a receiver section 305 . transmitter section 302 is similar to transmitter section 102 of the basic rf level stabilization system 200 of fig2 except that transmitter section 302 includes an added second transmitter feedback loop 336 . receiver section 305 is similar to receiver section 205 of the basic rf level stabilization system 200 of fig2 . second transmitter feedback loop 336 provides a feedback attenuation circuit 332 from the back facet monitor 143 to the rf in attenuator circuit 120 . the feedback attenuation circuit 332 produces an attenuated feedback signal which is proportional to the bias current from the laser . second transmitter feedback loop 336 includes a feedback attenuation circuit 332 to scale the feedback signal to a level compatible with rf out attenuator circuit 180 . feedback attenuation circuit 332 may include a diode , transistor , or other attenuation circuit ( e . g ., a pin transistor circuit ). [ 0038 ] fig4 is a block diagram representation of a full rf level stabilization system according to an embodiment of the present invention . full rf level stabilization system 400 includes a transmitter section 402 , an optical link 150 , and a receiver section 405 . transmitter section 402 is similar to transmitter section 302 of the enhanced rf level stabilization system 300 of fig3 except that two additions have been made . first , an oscillator circuit 445 has been added to the output of the rf attenuator 120 . oscillator circuit 445 introduces a signal tone of e . g ., 100 khz or thereabouts . second , a third transmitter feedback circuit 430 has been added which provides a feedback loop from the back facet monitor 430 to the rf attenuator 120 . third transmitter feedback loop 455 provides a feedback signal from the back facet monitor 143 to the rf in attenuator 120 . third transmitter feedback loop 455 includes a filter oscillator circuit , an rf detector circuit , and a feedback attenuator circuit . the rf in the transmitted signal is sensed by the rf detector circuit of feedback circuit 430 and is then fed to the feedback attenuator circuit which reduces or increases attenuation as needed . receiver section 405 is similar to receiver section 305 of the enhanced rf level stabilization system 300 of fig3 except that receiver section 405 includes an added second receiver feedback circuit 440 which provides a feedback loop from the photo diode 160 to the rf out attenuator 180 . a signal from photo diode circuit 160 is fed to second receiver feedback circuit 440 which includes a filter oscillator circuit , an rf in sensor circuit , and a feedback attenuator circuit . the rf in the received signal is sensed by the rf detector circuit of second receiver feedback circuit 440 and is then fed to the feedback attenuator circuit which reduces or increases attenuation as needed . [ 0041 ] fig5 is a block diagram representation of a functional rf level stabilization system according to an embodiment of the present invention . functional rf level stabilization system 500 includes a transmitter section 502 , an optical link 150 , and a receiver section 505 . transmitter section 502 is similar to transmitter section 402 of the full rf level stabilization system 400 of fig4 except that modulation and demodulation circuits have been added to the transmitter section 502 and the receiver section 505 , respectively . the modulation circuit 520 coupled to the oscillator circuit 445 of the transmitter section 502 enables the output signal from oscillator circuit 445 to be selectively varied , which in turn will selectively vary the output at node 410 of the rf in attenuator circuit 120 . this operation effectively tunes the output of the rf in attenuator circuit 120 , and hence the laser device 142 . similarly , the demodulation circuit 540 in receiver section 505 provides demodulation of the feedback circuit 440 . embodiments of the present invention have been disclosed . a person of ordinary skill in the art would realize , however , that certain modifications would come within the teachings of this invention . therefore , the following claims should be studied to determine the true scope and content of the invention . | 7 |
the following description provides specific details in order to provide a thorough understanding of the present invention . the skilled artisan , however , would understand that the present invention can be practiced without employing these specific details . indeed , the present invention can be practiced by modifying the illustrated apparatus and method and can be used in conjunction with apparatus and techniques conventionally used in the industry . the chain tightening ( ct ) apparatus of the invention comprises at least three parts or components . the first part is an attachment for attaching the apparatus to the tire chain . the second part of the invention is a connector for connecting the attachment . the third part of the invention is a slack take - up for drawing up or tightening the connector . reference is now made to fig1 fig2 and fig3 . the chain tightening apparatus 5 of the invention comprises an attachment 20 , a connector 25 , and a slack take - up 30 . in use , as shown in fig1 the chain tightening apparatus 5 is connected to the chains 10 on tire 15 . the apparatus of the invention can be employed on any type of chains 10 known in the art , such as chains for use in mud , ice and snow . indeed , the apparatus of the invention can be used on any chains used to increase the traction of tires on any type of surface . the only requirement for the chains 10 is that , as described below , the attachment 20 of the chain tightening apparatus 5 is able to attach to the chains . tire chains typically comprise two closed loops connected by cross - chains . when attached to the tire , the closed loops extend around the inside and outside sidewalls spaced from the tread with the cross - chains extending over the tread . the apparatus of the present invention is usually connected at spaced intervals on the loop on the outside sidewall . accordingly the attachments 20 are spaced generally around a circumference of a circle defined by the loop . however , any chain construction that allows such radial spacing of the attachments is contemplated . such construction includes “ chains ” or antiskid devices that are not constructed of linked chain structures , but can still provide the attachments as described herein and can be held and tightened on the tire by the tightening force of the invention . any tire 15 known in the art can be employed in the invention . the apparatus of the invention 5 can be modified for any size and shape of tire by increasing ( or decreasing ) the number of attachments 20 and increasing ( or decreasing ) the length of the connection 25 described below . as well , the apparatus of the invention can be used with tires on self - propelled equipment and on motorized vehicles as well as on other wheeled apparatus pulled by motorized vehicles . for example , the chain tightening apparatus of the invention can be used with tires on cars , trucks , busses , semi - trucks and trailers , farm equipment , commercial equipment , lawn and garden tractors , and self - propelled snowblowers . to illustrate the invention , a tire with a width of about nine inches and a diameter of about 22 . 5 inches is depicted in fig1 . as illustrated in fig1 the ct apparatus 5 contains attachments 20 , connector 25 for connecting the attachments and slack take - up 30 . the function of an attachment 20 is to attach the ct apparatus to the chains 10 . the connector 25 connects the various attachments 20 together . the slack take - up 30 pulls on or tensions the connector 25 to draw up or tighten the connector . as mentioned above , the attachments 20 attach the ct apparatus 5 to the chains 10 . the attachments 20 can be attached to the desired portions of the chains 10 preferably after the chains are attached to the tire . the attachments 20 are removably attached to the chains so that the ct apparatus 5 can be used together with the chains or so that the chains can be used as - is without the ct apparatus . once attached and the connector is tensioned , however , the attachments 20 should securely attach the ct apparatus 5 to the chains 10 . any suitable attachments 20 known in the art accomplishing these functions can be employed in the invention . examples of such attachments 20 include clips , hooks such as retractable hooks and s - hooks , latches and clasps . preferably , s - hooks 20 are employed , as illustrated in the figures , as these securely attach to the chains while being removable . as depicted particularly in fig3 the larger loop of an individual s - hook is connected to an individual link 40 of the chain 10 . when used in combination with the rest of the ct apparatus 5 , an attachment 20 pulls on link 40 which in turn pulls on other connecting links until the links are tight against tire 15 . the attachments 20 are connected to a plurality of locations on the chains 10 . the number of the attachments ( and the corresponding number of attachment locations on the chains 10 ) depends on the circumference of the tire , the type ( and size ) of chains used , the type of attachment and the type of tire used . the number of attachments can typically range from 6 to 10 but a greater number of attachments could be used . in one aspect of the invention illustrated in fig1 s - hooks are employed in the ct apparatus of the invention . the attachments 20 are also connected to the connector 25 . while the attachments 20 and connector 25 can be removably connected , the attachments are preferably permanently connected in a secure fashion to the connector that allows the connector to easily slide through each attachment 20 . any suitable connection system known in the art can be used between the attachment and the connector . the type of connection will depend in part on the attachment used in the ct apparatus . for example , when s - hooks are employed as the attachment , the smaller loop of the s - hook can enclose a cable - type connector as more fully described below . the connector 25 of the ct apparatus connects through all of the multiple attachments 20 . as described in more detail below , the connector 25 is movably connected to the attachments 20 . this is required so that when the connector 25 is tightened , the force from the tightening is more or less distributed evenly among the connector . while , an attachment may be fixed to the connector , preferably , no single portion of the connector is immovably attached to any given attachment 20 . an example is show in fig2 and 5 , which show a cable connector slidably attached to s - hook attachments . thus , the connector 25 exhibits the ability to move ( or slide ) with respect to any given attachment and corresponding chains 10 to which the attachments are connected . any connector known in the art functioning in the above manner can be employed in the present invention . examples of connectors that can be employed in the present invention include wires , straps , cording and cable . preferably , a cable in the form of a loop is employed as the connector . as illustrated particularly in fig2 and 5 ( showing s - hook attachments together ), the cable - type connector 45 connects to all the s - hooks by passing through the s - hooks in a manner that allows the s - hooks to slide along the cable . the connector 25 is made of any suitable material known in the art that is sufficiently strong , e . g ., not breakable when the ct apparatus is used in the manner described herein . further , the material used for the connector should allow the attachments 20 to easily move along its length . it should be flexible so that it can have various configurations and can be transported easily . as well , the material for the connector should be lightweight . any materials satisfying these criteria can be employed in the invention as the material for the connector . exemplary materials for the connector include high - strength polymers , composite materials , metals , and twisted multiple - strand cable . ⅛ inch diameter galvanized aircraft cable employed as the material for the connector has been found suitable . the length of the connector is such that when attached through the attachments , and the connector is tightened , the combination functions to tighten the chains upon the tire . the size is generally determined by the projected size of the tires for which the chain tightening apparatus of the invention will be used . when cable is used as the connector , the length of the loop of the cable will typically be slightly smaller than the circumference of the tire . in one aspect of the invention , the circumference of the loop is about 5 feet to accommodate standard tire sizes for pick - ups , passenger cars , and sport utility vehicles . in another aspect of the invention , the circumference is about 8 feet to accommodate commercial vehicles , such as semi - trucks and trailers . the connector 25 of the ct apparatus 5 may be a permanently closed - end loop on which the slack take - up 30 is non - detachable by virtue of the connector running through a hole in the slack take - up , which in the illustrated slack take - up passes through the inner cylinder 55 . such is the configuration for a standard 5 foot or 8 foot diameter permanently closed - end loop connector in the aspect of the invention illustrated in fig2 . in another aspect of the invention , as illustrated in fig5 the connector consists of an open - ended length of a suitable material for the connector 25 ( such as a cable ) which separately attaches to the slack take - up 30 using , for example , a slotted coupling device on one side of an outer cylinder walls 65 or through a slot 105 in the inner cylinder of the slack take - up 30 . the third component of the ct apparatus is the slack take - up 30 . by applying a rotational force to the slack take - up 30 , the slack take - up pulls on or tensions the connector 25 to draw up or tighten the connector and then retains the connector 25 in the tightened position while the ct apparatus remains installed on the chains and tire . any device which accomplishes these functions can be employed as the slack take - up 30 in the invention . see , for example , the device described in u . s . pat . nos . 4 , 173 , 244 , 4185 , 674 , 4 , 237 , 951 , 4 , 266 , 593 , 4 , 392 , 521 , 4 , 679 , 608 , 4 , 799 , 522 , 5 , 284 , 196 , 5 , 785 , 783 , 5 , 804 , 001 , 6 , 026 , 876 , and 6 , 085 , 816 , the disclosures of which are incorporated herein by reference . in one aspect of the invention , the device depicted in the figures and shown particularly in fig4 and fig6 is employed as the slack take - up . this device comprises a take - up reel 50 containing an inner cylinder 55 enclosed by two outer circular walls 60 and 65 of a larger diameter . the inner cylinder contains a hole 70 running through its diameter through which a cable - type connector 25 passes . the inner cylinder can be any diameter but is preferably about 1 ¼ to 1 ½ inches in diameter . the diameter of hole 70 is sufficient to allow the cable loop to slide easily through the hole . the diameter of the outer cylinder walls can vary , but should be of sufficient diameter to take up and retain the slack in the connector . in the aspect of the invention illustrated in fig4 the diameter of the outer cylinder walls is about 3 inches . an indentation 75 is located on the outer side of one of the outer cylinder walls at its center . this indentation is designed to operably connect with a tool , or the like , to rotate the slack take - up as described in more detail below . thus , the indentation 75 can take on any number of shapes and sizes depending on the tool or mechanism used to rotate the slack take - up 30 . in one aspect of the invention , the indentation has a rectangular shape as depicted in fig4 . reference is now also made to fig6 . an indented slot 105 extends on the outer side of one of the outer cylinder walls 65 to receive and retain the two ends of an open - ended connector 25 . this convention is used to allow any variable length of a connector 25 to be utilized by the ct apparatus in order to accommodate any non - standard tire sizes , such as tires on a large commercial farming tractor . any closing structure for closing or securing the ends of an open loop cable to form a closed loop is contemplated by the present invention . in the aspect of the invention shown in fig6 each of the open - ended cable ends of a connector are crimped with a stop 110 and cable ends with the stops are each inserted into the indented slot 105 to complete a secured loop of the connector . the connector slack is then drawn up on the reel 50 of the slack take up 30 . the stop 110 can be any suitable structure formed by crimping , molding , or bolting , or by any other way of attaching a stop to the cable end . in one aspect of the invention , the inner cylinder also contains a narrow slot 115 , extending along a major portion of the width of the inner cylinder through which the open ends of an open - ended connector consisting of a web or woven strapping material can be inserted in opposing directions to complete a secured loop of the connector . reference is now made to fig6 a . an end of the cable 45 is passed through the cylinder hole 70 and a stop 110 attached to the end to prevent it from passing back through the cylinder hole 70 . the other end of the cable is wrapped around the inner cylinder 55 of the take - up reel 50 a enough times to resist unwrapping of the cable ( e . g ., two or three times ) and the free end passed through slot 105 . this secures the cable into a closed loop . the connector slack is then drawn up on the reel 50 of the slack take up 30 . referring again to fig6 the outer cylinder walls 60 and 65 contain a plurality of holes 80 around their outer circumference , with holes on one outer cylinder wall matching corresponding holes on the other cylinder wall to make sets of paired opposing holes 85 . any number and location of holes 80 ( and sets of paired holes 85 ) can be employed consistent with their purpose as described below . located on opposing sides of any given outer cylinder wall are retaining pins 90 . the retaining pins have a straight side 95 that slides into any given set of paired holes 85 . the retaining pins 90 also contain an opposing side 100 that locks the retaining pin 90 into the set of holes 85 . accordingly the pins are locked through the slack take - up 30 during a time the ct apparatus is installed on the tire , but can be manually inserted and removed by hand or by a tool when the tire is not rotating . the opposing side 100 can have any configuration - i . e ., shape or size - accomplishing this locking function . in one aspect of the invention , the configuration of the opposing side is depicted in fig6 . in this configuration , the opposing side has at least one narrow part in close proximity to the straight side 95 such that when inserted into the set of paired holes 85 , the narrow part abuts the edge of at least one outer cylinder . when forced past the edge , the retaining pin 90 thereby locks the take - up reel in that position until manually removed . the ct apparatus of the invention is used in the following manner . a tire is equipped with a chain as known in the art . a ct apparatus for the given size of the tire and the configuration of the chain is then attached by first attaching multiple attachments 20 on the connector 25 . for example , this is performed by providing the s - hooks on a connector 25 in the form of a cable 45 , which is shown in fig2 , 5 and 6 . next , the connector 25 is already attached to the slack take - up through the cylinder hole 70 if , for example , a closed - end connector 25 is used ; or if an open - end connector securing the connector into a closed loop by any suitable method , such as by attaching the open ends to the indented slot 105 or passing the ends through the slot 115 in the inner cylinder in opposite directions . in each case , the cable is secured to form a completed loop . the assembled ct apparatus is then placed on chains 10 using the following procedure . the attachments 20 are first attached to the chain approximately equidistant around the circumference of the connector 25 . for example , the s - hooks an be attached to individual links of the chain at selected locations . the locations are selected for a uniform spacing between successive s - hooks . the slack take - up 30 is then used to draw up or tighten the connector 25 until the desired tension is reached . in the aspect illustrated in fig4 and 6 , the take - up reel 50 is rotated , usually by means of a tool operably connected at indentation 75 , to tighten the connector until the attachments 20 pull the chains 10 into a tight position . because of the sliding relationship of connector 25 to the attachments 20 , a uniform tension will result . when tightened in this manner , the take - up reel 50 is not at the center of the tire . rather , the take - up reel is on the circumference of the connector similar to that depicted in fig1 . the take - up reel 50 is then locked in the tightened position where uniform tension is distributed throughout the chain by reinserting the previously removed retaining pins 90 while holding the take - up reel with a tool that fits within indentation 75 to wind or draw the excess cable of the loop onto the inner cylinder of the take - up reel . the tool may be any suitable structure that provides the suitable leverage and fits in indentation , such as , for example , a ratchet . the reinserted retaining pins prevent the connector 25 from unwinding . when the tire rotates , the locked take - up reel retains the connector in its tightened position 30 , maintaining the uniform tension obtained when the take - up reel was tightened . when the user wishes to remove the tire chains , the ct apparatus is easily removed by removing the retaining pins , which allows the cable to loosen , permitting the s - hooks to be removed . the chain may then be removed from the tire . in an alternate aspect of the invention , the ct apparatus has a ratcheting mechanism built into the ct apparatus . in this instance removable pins would not be required . instead , the mechanism would involve a take - up reel rotating on a second shaft that holds the ratcheting mechanism , with one end of a cable connector attached to an outer wall and the other end connected to the take up reel . the reel is rotated around the ratchet mechanism to take up the slack and would have a release device to allow the ratchet mechanism to release the cable so that the ct apparatus can be removed . other suitable ratchet , winch , lever or other mechanisms that can take up slack and maintain the tension on the connector as described herein , are contemplated in the present invention . unlike apparatus known in the prior - art , the ct apparatus of the invention achieves a uniform tension on the chains . the uniform tension is obtained since the connector is drawn linearly along its circumference creating a corresponding uniform pull of the tire chains in a radial direction through the attachments toward the center of the tire , like pulling the drawstring on a knapsack . the chain links not directly connected to attachments are likewise drawn tight via their linked interconnection to the attached links . none of the apparatus in the prior - art provide this same uniform radial pull by circumferentially tightening the connector . if desired , any metal parts comprising the ct apparatus can be plastic - coated to inhibit rust formation and other corrosion . the slack take - up can be made from high - impact plastic , metal , or any other suitable material . the size and strength of the individual components will depend upon the size of the tire and the weight of the chains that are installed on the tire . having described the preferred embodiments of the present invention , it is understood that the invention defined by the appended claims is not to be limited by particular details set forth in the above description , as many apparent variations thereof are possible without departing from the spirit or scope thereof . | 8 |
a child restraint 10 in accordance with the present disclosure includes a juvenile seat 12 and belt - guide clip 14 a , 14 b as shown in fig1 - 4 . belt - guide clip 114 a is coupled to juvenile seat 12 to engage a lap belt 16 and is configured provide means for establishing a modified axis of rotation 20 about which child restraint 10 rotates about toward a vehicle passenger seat 18 during a rebound portion of an impact event as shown in fig5 - 7 . a second embodiment of a belt - guide clip 114 in accordance with the present disclosure is shown in fig8 - 11 . a third embodiment of a belt - guide clip 214 in accordance with the present disclosure is shown in fig1 - 15 . child restraint 10 is support by vehicle passenger seat 18 in a rear - facing orientation as shown in fig1 . a child ( not shown ) restrained by child restraint 10 faces toward a seat back 18 a included in vehicle passenger seat 18 when child restraint 10 is in the rear - facing orientation . lap belt 16 included in vehicle passenger seat 18 interconnects child restraint 10 to a seat bottom 18 b included in vehicle passenger seat 18 as shown in fig1 . during an impact event ( e . g ., a front impact to the vehicle ), child restraint 10 in the rear - facing orientation first moves away from seat back 18 a and shown in fig5 and 6 and then rebounds and moves in a direction back toward seat back 18 b as shown in fig7 . belt - guide clips 14 a , 14 b of child restraint 10 cooperate with lap belt 16 to limit rebounding movement of child restraint 10 back toward seat back 18 b . child restraint 10 includes juvenile seat 12 and first and second belt - guide clips 14 a , 14 b as shown in fig4 . one belt - guide clip 14 a is coupled to a first side of a seat bottom 22 included in juvenile seat 12 and the other belt - guide clip 14 b is coupled to an opposite second side of seat bottom 22 as suggested in fig4 . lap belt 16 is routed upwardly from vehicle passenger seat 18 , through first belt - guide clip 14 a , through seat bottom 22 , through second belt - guide clip 14 b , and back to vehicle passenger seat 18 . while only lap belt 16 is shown , any other suitable passenger belt or belts may be used . during the impact event , an external force f 1 is applied to the vehicle and transferred to child restraint 10 as suggested in fig5 . belt - guide clips 14 a , 14 b engage lap belt 16 and cooperate with lap belt 16 to modify movement of child restraint 10 in response to application of external force f 1 . movement is modified as a result of belt - guide clips 14 a , 14 b engaging lap belt 16 to cause rotation of child restraint 10 about modified axis of rotation 20 to be minimized during a rear - facing rebound portion of the impact . second belt - guide clip 14 b is substantially the same as first belt - guide clip 14 a and the description of first belt - guide clip 14 a applicable to second belt - guide clip 14 b . first belt - guide clip 14 a includes first and second retainer tabs 23 , 24 , fasteners 25 , 26 , first and second support rails 27 , 28 , and a cantilevered belt - retainer arm 30 as shown in fig3 . first and second retainer tabs 23 , 24 are arranged to receive associated fasteners 25 , 26 therein to couple belt - guide clip 14 a to seat bottom 22 of juvenile vehicle seat 12 . first and second support rails 27 , 28 are arranged to extend between first and second retainer tabs 23 , 24 to form a guide slot 32 therebetween as shown in fig3 . cantilevered belt - retainer arm 30 is arranged to extend from first retainer tab 23 toward second retainer tab 24 . belt - guide clip 14 a is configured to receive lap belt 16 between belt - retainer arm 30 and first and second support rails 27 , 28 to retain lap belt 16 relative to juvenile vehicle seat 12 so that modified axis of rotation 20 is established during the impact event . juvenile seat 12 includes seat bottom 22 , a seat back 34 , a seat support 36 , and a seat lock 38 as shown in fig4 . seat back 34 is arranged to extend upwardly from seat bottom 22 . first and second belt - guide clips 14 a , 14 b are coupled to opposite sides of seat bottom 22 . seat support 36 is arranged to underlie seat bottom 22 . seat lock 38 is configured to vary a tilt angle of juvenile seat 12 relative to seat support 36 . child restraint 10 moves as suggested in fig5 - 7 in response to application of external force f 1 from an impact event . belt - clip guides 14 a , 14 b are configured to minimize rebounding movement of the child restraint 10 as shown in fig7 . child restraint 10 is installed on vehicle passenger seat 18 in the rear - facing position in which a child ( not shown ) seated in child restraint 10 faces toward seat back 18 b of vehicle passenger seat 18 . application of external force f 1 to vehicle passenger seat 18 and child restraint 10 causes child restraint 10 to first pivot in a first direction 40 ( double phantom arrow ) away from seat back 18 b of vehicle passenger seat 18 as shown in fig5 . after child restraint 10 has rotated in first direction 40 away from seat back 18 b of vehicle passenger seat 18 in response to application of external force f 1 , child restraint 10 rebounds by rotating about modified axis of rotation 20 in a second direction 42 ( double phantom arrow ) toward seat back 18 b as shown in fig6 and 7 . rotation of child restraint 10 in second direction 42 is limited by belt - guide clips 14 a , 14 b establishing modified axis of rotation 20 . a child restraint 110 in accordance with another embodiment of the present disclosure includes juvenile seat 12 and first and second belt - guide clips 114 a , 114 b as shown in fig8 . one belt - guide clip 114 a is coupled to a first side of a seat bottom 22 included in juvenile seat 12 and the other belt - guide clip 114 b is coupled to an opposite second side of seat bottom 22 as suggested in fig8 . lap belt 16 is routed upwardly from vehicle passenger seat 18 , through first belt - guide clip 114 a , through seat bottom 22 , through second belt - guide clip 114 b , and back to vehicle passenger seat 18 . during the impact event , an external force f 1 is applied to the vehicle and transferred to child restraint 110 . belt - guide clips 114 a , 114 b engage lap belt 16 and cooperate with lap belt 16 to modify movement of child restraint 110 in response to application of external force f 1 . movement is modified as a result of belt - guide clips 114 a , 114 b engaging lap belt 16 to cause rotation of child restraint 110 about modified axis of rotation 20 to be minimized during a rear - facing rebound portion of the impact . second belt - guide clip 114 b is substantially the same as first belt - guide clip 114 a and the description of first belt - guide clip 114 a is applicable to second belt - guide clip 114 b . first belt - guide clip 114 a includes a back clamp 124 , a front clamp 126 , and a latch 128 as shown in fig9 - 11 . back clamp 124 is arranged to couple belt - guide clip 114 b to seat bottom 22 of juvenile seat 12 and includes teeth 124 t configured to engage a back side of lap belt 16 . front clamp 126 is coupled to a first end of back clamp 124 to pivot relative to the back clamp 124 and includes teeth 126 t configured to engage a front side of the lap belt 16 . latch 128 is coupled to a second end of back clamp 124 to pivot relative to back clamp 124 and configured to engage front clamp 126 to block relative movement between front and back clamps 124 , 126 when belt - guide clip 114 a is in a closed position so that lap belt 16 remains engaged with belt - guide clip 114 a . belt - guide clip 114 a is movable between an opened position as shown in fig9 and 11 and a closed position as shown in fig8 and 10 . lap belt 16 may be installed in belt - guide clip 114 a between front and back clamps 124 , 126 when belt - guide clip 114 a is in the opened position . when belt - guide clip 114 a is in the closed position , lap belt 16 remains engaged with belt - guide clip 114 a between front and back clamps 124 , 126 . belt - guide clip 114 a is configured to receive lap belt 16 between front and back clamps 124 , 126 to retain lap belt 16 relative to juvenile vehicle seat 12 so that modified axis of rotation 20 is established during the impact event . a child restraint 210 in accordance with another embodiment of the present disclosure includes juvenile seat 12 and first and second belt - guide clips 214 a , 214 b as shown in fig1 . one belt - guide clip 214 a is coupled to a first side of a seat bottom 22 included in juvenile seat 12 and the other belt - guide clip 214 b is coupled to an opposite second side of seat bottom 22 as suggested in fig1 . lap belt 16 is routed upwardly from vehicle passenger seat 18 , through first belt - guide clip 214 a , through seat bottom 22 , through second belt - guide clip 214 b , and back to vehicle passenger seat 18 . during the impact event , an external force f 1 is applied to the vehicle and transferred to child restraint 210 . belt - guide clips 214 a , 214 b engage lap belt 16 and cooperate with lap belt 16 to modify movement of child restraint 210 in response to application of external force f 1 . movement is modified as a result of belt - guide clips 214 a , 214 b engaging lap belt 16 to cause rotation of child restraint 210 about modified axis of rotation 20 to be minimized during a rear - facing rebound portion of the impact . second belt - guide clip 214 b is substantially the same as first belt - guide clip 214 a and the description of first belt - guide clip 214 a is applicable to second belt - guide clip 214 b . first belt - guide clip 214 a includes a back clamp 224 , a front clamp 226 , and a latch 228 as shown in fig1 - 15 . back clamp 224 is arranged to couple belt - guide clip 214 b to seat bottom 22 of juvenile seat 12 . front clamp 226 is coupled to a first end of back clamp 224 to pivot relative to the back clamp 224 and includes teeth 226 t configured to engage a front side of the lap belt 16 . latch 228 is coupled to a second end of back clamp 224 to pivot relative to back clamp 224 and configured to engage front clamp 226 to block relative movement between front and back clamps 224 , 226 when belt - guide clip 214 a is in a closed position so that lap belt 16 remains engaged with belt - guide clip 214 a . belt - guide clip 214 a is movable between an opened position as shown in fig1 and 15 and a closed position as shown in fig1 and 14 . lap belt 216 may be installed in belt - guide clip 214 a between front and back clamps 224 , 226 when belt - guide clip 214 a is in the opened position . when belt - guide clip 214 a is in the closed position , lap belt 16 remains engaged with belt - guide clip 214 a between front and back clamps 224 , 226 . belt - guide clip 214 a is configured to receive lap belt 16 between front and back clamps 224 , 226 to retain lap belt 16 relative to juvenile vehicle seat 12 so that modified axis of rotation 20 is established during the impact event . | 1 |
an embodiment of the present invention will now be described in detail with reference to the accompanying drawings . bombyx mori cocoon was degummed with 0 . 5 % marseilles soap at a cocoon - soap solution ratio of 1 : 200 for 30 min at a temperature of 100 ° c . after this was performed twice , the result was washed with distilled water to obtain degummed cocoon . the degummed cocoon was dissolved at a temperature of 40 ° c . in a 9 m aqueous solution of lithium bromide ( libr ), and dialyzed after which approximately 4w / w % of a bombyx mori regenerated silk fibroin solution was obtained . the solution of bombyx mori regenerated silk fibroin was mixed with 0 . 2 wt % of the dried fibroin glucose oxidase ( god ). the liquid was cast on an acrylic sheet and dried at 4 ° c ., thereby providing a god - fixed regenerated silk fibroin membrane having a membrane thickness of 27 um . the biocatalyst - fixed membranes prepared as described above were subjected to a methanol treatment , which entailed dipping the membranes in an 80 % aqueous solution for 30 sec ( hereinafter referred to as &# 34 ; me30 &# 34 ;), 3 min ( hereinafter referred to as &# 34 ; me3 &# 34 ;) and 24 hrs ( hereinafter referred to as &# 34 ; me24 &# 34 ;), respectively , followed by washing with water . the biocatalyst - fixed membranes prepared as described above were subjected to a stretching treatment , which entailed attaching each membrane to a stretcher , placing the stretcher together with the attached membrane in a sealed box for 30 min in which the environment was held at a temperature of 20 ° c . and a relative humidity of 90 %, thereafter stretching the membranes in the box at a tensioning rate of 0 . 2 mm / sec , and structurally stabilizing the membranes at given degree of stretching of 1 . 25x , 1 . 5x , 2 . 0x and 3 . 0x ( hereinafter represented by dr1 . 25 , dr1 . 5 , dr2 . 0 and dr3 . 0 ) for 10 min and at a relatively humidity of 40 % for 10 min . the biocatalyst - fixed membranes prepared as described above were preserved in a dry state at a temperature of 4 ° c . until biocatalyst stability was measured . prior to measurement of biocatalyst stability , each biocatalyst - fixed membrane was dipped in a 0 . 1 m phosphate buffer solution ( ph 7 . 0 ). the biocatalyst activities of the god - fixed bombyx mori regenerated silk fibroin membranes were measured quantitatively by colorimetry and a dissolved oxygen electrode . the spectrophotometer used was a model u - 3200 ( manufactured by hitachi , ltd . ), and the oxygen electrode was a model bo ( manufactured by ishikawa seisakusho , k . k .). for comparison purposes , free god was also measured . the amount of eluted protein was determined by the lowry method . the permeabilities of the membranes were measured by a differential birefringencemeter ( manufactured by nippon bunseki kogyo k . k .) using a 0 . 1 m aqueous glucose solution . a 13 c nmr measurement was carried out using an fx - 90q ( manufactured by jeol ) at a frequency of 22 . 49 mhz and a temperature of 25 ° c . an ir measurement ( infra - red analysis ) was performed using an ir - 435 ( manufactured by shimazu seisakusho k . k .). the ir spectra of the stretched god - fixed regenerated silk fibroin membranes are illustrated in fig1 . peak intensity at 700cm - 1 of the amide band v increased owing to the stretching treatment , and it was verified that silk fibroin membrane took partially β - form . immediately after membrane formation ( i . e . prior to stretching ), there were many random coil regions in the silk fibroin membranes , and these would redissolve if the membranes were immersed in water as is . however , insoluble membranes could be fabricated by increasing the crystallization between the molecular chains of the silk fibroin , this being accomplished by mere stretching of the membranes . the β - form mentioned above refers to achieving hydrogen bonds between the molecular chains to provide a dense structure , thereby realizing structural stabilization to prevent elution of the fixed biocatalyst . the random coil regions refer to regions in which the biocatalyst readily dissolves in water because of comparatively little interaction between molecular chains . even when stretched bombyx mori regenerated silk fibroin membranes not containing god were immersed in a phosphate buffer solution ( ph 7 . 0 ), the amount of eluted protein bombyx mori silk fibroin after 10 days was less than 0 . 02 ± 0 . 01 w / w % in all cases . fig2 illustrates 13 c nmr ( nuclear magnetic resonance ) spectra of the insolubilized god - fixed bombyx mori regenerated silk fibroin membranes . though considerable mobile components which give a high - resolution peak rem in in methanol - treated membranes b , these components are reduced in stretched membranes c . this indicates there is a highly non - homogeneous structure between the β - form regions near the surface and the internal mobile regions in the case of the methanol treatment , and that β - form tends to proceed through the entirety of the membrane when the stretching treatment is applied . table 1 shows the results of determining , by colorimetry , the rate of hydrogen peroxide formation which accompanies the biocatalyst reaction of god - fixed bombyx mori regenerated silk fibroin membranes . table 1______________________________________rate of hydrogen peroxide formationaccompanying biocatalyst reaction of god - fixedbombyx mori regenerated silk fibroin membranes reaction rate × 10 . sup . 4 reaction rate × 10 . sup . 2stretching ( absorbance / min cm . sup . 2 ) ( absorbance / min mg ) ______________________________________dr 1 . 25 7 . 22 5 . 26dr 1 . 5 6 . 12 5 . 23dr 2 . 0 4 . 50 4 . 90dr 3 . 0 4 . 06 6 . 01methanoltreatmentme 30 ( 30 sec ) 6 . 5 3 . 87me 3 ( 3 min ) 5 . 6 3 . 33me 24 ( 24 hr ) 5 . 1 3 . 04______________________________________ a comparison of the methanol - treated membranes and stretched membranes shows no great difference in reaction rate per unit surface area . however , in terms of reaction rate per unit weight of the biocatalyst , the comparison reveals that the stretched membranes tend to have higher reaction rates than the methanol - treated membranes in all cases . as for the effect of degree of stretching on biocatalyst stability , reaction rate per unit surface area gradually declines with an increase in the percent of stretch . however , there is no significant change in reaction rate per unit amount of biocatalyst with a change in degree of stretch . in many cases , the rate of reaction of fixed biocatalyst is influenced by the diffusion rate of the substrate in the carrier . upon measuring the glucose permeability of the silk fibroin membrane , it was found that the permeability constant declined markedly with an increase in stretching , as shown in fig3 . this indicates that the biocatalyst reaction of a stretch - treated bombyx mori regenerated silk filbrin membrane has a correlation with the permeability of glucose , which is the substrate . fig4 ( a ), ( b ) are views illustrating the results of determining the biocatalyst activities of god - fixed bombyx mori regenerated silk fibroin membranes by a dissolved oxygen electrode , and fig5 is a table showing michaelis constants km and maximum reaction rates vm obtained from fig4 ( a ), ( b ), in which [ s ] represents the substrate concentration . these results show that the biocatalyst activities of the stretched god - fixed bombyx mori regenerated silk fibroin membranes are higher overall than those of the methanol - treated membranes , and that the higher the stretching , the higher the biocatalyst stability . the stability of biocatalyst stability with respect to a change in ph is shown in fig6 . it was found that the god - fixed bombyx mori regenerated silk fibroin membranes have stability that is more stable than free god with respect to a change in ph , and that the ph range indicating relative actitivies of 80 % or more is a broad ph 5 - 8 . fig9 ( a ), ( b ) are schematic views of a glucose sensor fabricated by coating an oxygen electrode with a god - fixed bombyx mori regenerated silk fibroin membrane embodying the present invention . numeral 91 denotes a well - known oxygen electrode , 92 a god - fixed bombyx mori regenerated silk fibroin membrane , 93 a voltage measuring device , 94 a stirrer for stirring a glucose solution 96 , and 95 a vessel through which thermostated water is passed to hold the glucose solution 96 at a constant temperature . fig9 ( b ) is an enlarged view of the tip of the glucose sensor . numeral 91a denotes a platinum electrode , 91b an internal liquid chamber , and 97 a teflon membrane having gas permeability . the teflon membrane 97 is coated with the god - fixed bombyx mori regenerated silk fibroin membrane 92 . the characteristics of this glucose sensor were measured voltometrically by the voltage measuring device 93 . fig7 and 10 are graphs in which the glucose sensor output voltage is plotted against glucose concentration , and fig8 is a graph illustrating the stability of the glucose sensor output with respect to a change in ph . these graphs demonstrate that the god - fixed bombyx mori regenerated silk fibroin membrane of the present embodiment can be used satisfactorily as the biocatalyst membrane of a glucose sensor , and that stability is high over a ph range of 5 - 8 . an ion sensor in accordance with the invention has excellent performance , as will now be illustrated . performance of a glucose sensor using a stretched bombyx mori regenerated silk fibroin membrane as a biocatalyst - fixed carrier : repetitive measurement error : less 0 . 9 % ( 30 runs ) where god : aspergillus niger thus , in accordance with the invention , there is provided an biocatalyst sensor using an biocatalyst - fixed membrane in which , by exploiting the structural characteristics of silk fibroin to employ the same as an biocatalyst bombyx mori regenerated fixed material , the stability of the biocatalyst - containing membrane is raised , the leakage of biocatalyst is minimized and biocatalyst stability is prolonged . in the biocatalyst sensor of the invention , the structural change of the biocatalyst - containing regenerated silk fibroin membrane is manifested solely by a stretching treatment without any chemical processing . as a result , the following advantages are obtained : ( 3 ) the stability of the biocatalyst in the membrane does not change for more than four months . though glucose is selected to typify the biocatalyst in the illustrated embodiment , it is obvious that other biocatalysts can be used . in addition , the technical concept of the invention is not limited to bombyx mori but can also be applied to other biocatalyst - fixed membranes such as wild silkworm regenerated silk fibroin membranes , microbial membranes and membranes made of animal and vegetable cells . bombyx mori cocoon was degummed with 0 . 5 % marseilles soap at a cocoon - soap ratio of 1 : 200 for 30 min at a temperature of 100 ° c . after this was performed twice , the result was washed with distilled water to obtain degummed cocoon . the degummed cocoon was dissolved at a temperature of 40 ° c . in a 9 m aqueous solution of lithium bromide ( libr ), and dialyzed after which approximately 4w / w % of a bombyx mori regenerated silk fibroin solution was obtained . a glucose oxidase solution in an amount of 0 . 2 wt % of the weight of fibroin was mixed gently with the regenerated fibroin solution . the concentration of glucose oxidase is preferably 0 . 002 % to 6 %, and , if it is less than 0 . 002 %, the response becomes deteriorated when glucose oxidase is applied to a biocatalyst sensor . if the concentration of glucose oxidase exceeds 6 %, glucose is likely to elute from the biocatalyst - fixed membrane . the liquid was cast on an acrylic sheet and air - dried at 20 ° c ., thereby providing a glucose oxidase - fixed silk fibroin membrane 1 . a compression treatment was performed by placing the membrane in a shield box in an atmosphere at 20 ° c . and a relative humidity of 90 %. the temperature is preferably - 10 ° c . to 60 ° c . if the temperature is below - 10 ° c ., freezing is likely to occur , and , if it exceeds 60 ° c ., the biocatalyst is likely to become deactivated . in addition , the relative humidity is preferably 70 % or above , and , if it is less than 70 %, the β - form region is not produced . the membrane was then removed and placed in a charta 2 , and a predetermined pressure ( at 560 kgf / cm 2 for two min . in this case ) was applied thereto . subsequently , the pressurized membrane was held for 10 min in an atmosphere at a humidity of 40 % to achieve structural stabilization . the pressurizing force is preferably 140 to 700 kgf / cm 2 , while the pressurizing time is preferably 1 min or more . if the pressurizing force is low and the time is short , both the biocatalyst and the silk fibroin elute from a preserving solution ( phosphate buffer solution ). a methanol treatment for comparison was effected by immersing the membrane in a 80 % aqueous solution for 30 sec followed by washing . the treated membrane was preserved in a 0 . 1 m phosphate buffer solution ( ph 7 . 0 ) until the biocatalyst stability was measured . a glucose oxidase solution in an amount of 0 . 002wt % of the weight of fibroin was fixed by a compression treatment in the same way as example 2 - 1 , therely preparing a god - fixed membrane . pseudomonas fluorescens which exhibits a god stability was fixed as microorganism with a fixing amount of 1 . 2 wt % by a compression treatment in the same way as the god - fixed membrane of example 2 - 1 , thereby preparing a microorganism - fixed membrane . glucose and oxygen undergo biocatalyst reaction due to glucose oxydase . by using a circuit similar to the one shown in fig9 ( a ) in the same way as in example 1 , measurement was made of the amount of oxygen consumed in this biocatalyst reaction by means of a commercially available biocatalyst electode 5 ( a model bo manufactured by ishikawa seisakusho , k . k .) so as to evaluate the stability . incidentally , measurement was similarly conducted with respect to free glucose oxidase - and methanol - treated fixed membranes to provide comparative examples . measurement was made of the relative stability with respect to membranes subjected to heat treatment at 30 min at a given temperature with room temperature ( 25 ° c .) set as 100 . as a result , it was found that the compression - treated membranes displayed more excellent thermal stability than the free biocatalysts , as shown in fig1 . measurement was made of the stability relative to the ion concentration by setting as 100 the stability at the time when ions were absent , so as to determine the effect of the presence of ions as impurities on the stability . as a result , it was found that the relative stability was stable , as shown in fig1 . the strength and degree of stretching were measured with respect to the compression - treated membranes in swollen as well as methanol - treated membranes and cellulose membranes of the prior art . the results are shown in table 2 , which reveals that the compression - treated membranes display greater values in both strength and degree of stretching than the other two types of membrane . incidentally , as for the cellulose membranes , those that are commercially available were used . although the numerical values of the strength and the standard deviation of the strength are measured values , those in the parentheses are comparative values in which the membrane thickness was uniformly set to the 10 . 3 um of the methanol - treated membrane . measurement was made of the activity yield of the compression - treated membranes and methanol - treated membranes of the prior art , and a comparison was made . the results are shown in table 3 . this table reveals that the activity yield is greater in the case of the compression - treated membranes . table 2__________________________________________________________________________strength and degree of stretching of methanol -, compression - treated fibroin films andcellulose films in swollen standard standard deviation degree of deviation membrane strength of stretching of ( um ) ( kg / mm . sup . 2 ) strength (%) stretching__________________________________________________________________________methanol - 10 . 3 6 . 07 1 . 12 189 . 1 49 . 9treated ( 30 min ) compression - 2 . 00 5 . 57 1 . 29 197 . 2 45 . 6treated ( 28 . 7 ) ( 6 . 65 ) cellulose 35 . 5 27 . 5 1 . 30 85 . 1 0 ( 8 . 10 ) ( 0 . 38 ) __________________________________________________________________________ table 3______________________________________activity yield of fixed biocatalysts obtained bymethanol and compression treatments activity activity average activ - ( u / mg ) yield (%) ity yield______________________________________free glucose 107 . 00 -- -- oxidasemethanol - 5 . 38 5 . 00 4 . 77treated 4 . 88 4 . 56 5 . 07 4 . 74compression - 6 . 21 5 . 80 6 . 01treated 6 . 21 5 . 80 6 . 88 6 . 43______________________________________ above three membranes of example 2 after a lapse of two months upon the compression treatment were respectively installed on a commercially available oxygen electrode ( a model bo manufactured by ishikawa seisakujo k . k .) by means of an o - ring in the same way as in fig9 ( a ), and measurements were made of the response of the sensor when glucose was added gradually by predetermined amounts ( 0 . 27mg ). the amount of glucose added was plotted as the absissas , and the amount of a reduced output was plotted as the ordinates . the results are shown in fig1 ( a ), ( b ), in which an extremely accurate calibration curve was obtained despite the fact that two months had elapsed after the compression treatment . after each membrane was dipped in an aqueous solution ( 0 . 1 m phosphate buffer solution ) of various ph for two hours at 25 ° c ., the stability was measured using a glucose solution of 7 . 0 ph . the results are shown in fig1 ( c ). the compression - treated membrane displayed a remarkably improved level of ph stability in the vicinity of neutrality as compared to the free god membrane . an infra - red analysis ( an ir measurement ) was performed using an ir - 435 ( manufactured by shimazu seisakusho k . k .). the measured results are shown in fig1 . peak intensity at 700cm - 1 of the amide v band increased owing to the compression treatment , and the occurrence of some β - regions was verified . the occurrence of β - regions mentioned above refers to achieving hydrogen bonds between the molecular chains to provide a dense structure , thereby making it difficult for the fixed biocatalyst to flow out . immediately after membrane formation , there were many random coil regions in the domestic regenerated silk fibroin membranes , and these would redissolve if the membranes were immersed in water as is . however , insoluble membranes could be fabricated by increasing crystallization between the molecular chains of the silk fibroin , this being accomplished by mere compressing of the membranes . it should be noted that the biocatalyst is not restricted to glucose oxidase alone , and it is apparent that the present invention can be applied to other biocatalysts as well . it should be noted that the biocatalyst is not restricted to glucose oxidase or pseudomonas fluorescens , and it is apparent that the present invention can be applied to other biocatalysts as well . as many apparently widely different embodiments of the present invention can be made without departing from the spirit and scope thereof , it is to be understood that the invention is not limited to the specific embodiments thereof except as defined in the appended claims . | 8 |
referring to the drawings , in which like reference numerals identify identical or similar elements . fig1 - 31 illustrate preferred embodiments of a needle transport assembly 10 . the needle transport assembly includes a holding apparatus 12 , a calibrating apparatus 14 , and a loading apparatus 16 . referring to fig1 - 7 , a needle transporting apparatus 10 is shown comprising a holding apparatus 12 which includes an upper portion 20 and a lower portion 22 in overlapping relation . the holding apparatus further includes jaw structure 18 adapted for holding up to a multiplicity of needles 13 for transporting . the jaw structure 18 defines the front of the holding apparatus , and the opposite end of the holding apparatus from the front defines the back of the holding apparatus . both the front and back of the holding apparatus 12 are referred to herein for reference . the jaw structure 18 includes an upper section 24 which is integral with the upper portion 20 , and further includes a lower section 26 which is integral with the lower portion 22 . the upper and lower sections 24 , 26 of the jaw structure 18 are movable between open and closed positions . the upper and lower jaw sections 24 , 26 work in concert to hold needles 13 therebetween when in the closed position . once the needles 13 are positioned between the jaws , transport of the needles 13 held in the jaw structure 18 is possible . it also contemplated that the upper and lower jaw sections 24 , 26 may be of a different material than the rest of the holding apparatus . preferably , the upper and lower jaw sections 24 , 26 include needle contacting material 28 where the jaws are intended to contact needles 13 . a needle 13 positioned between the jaw material 28 will remain substantially unchanged or undamaged . the contacting material 28 preferably is an elastomeric material such as , for example , neoprene , rubber or urethanes . the holding apparatus upper portion 20 and the lower portion 22 are spring biased in overlapping relation to each other by springs 30 . the springs 30 are positioned on both sides of the holding apparatus 12 and are attached thereto by pins 32 . the springs 30 normally bias the upper and lower jaw sections 24 , 26 in a closed position ( fig3 ). the holding apparatus 12 further includes an actuation lever 34 for opening the jaw structure 18 by separating the upper and lower jaw sections 24 , 26 . the actuation lever 34 is positioned along a central longitudinal axis extending through the holding apparatus 12 . the lever 34 provides a remote actuating means for moving the jaw section 24 , 26 into open and closed positions . the jaw actuation lever 34 is pivotably mounted on a pivot rod 46 which extends through the upper portion of the holding apparatus . the actuation lever 34 includes a camming portion 36 , shown in fig4 . the camming portion 36 contacts the camming surface 38 , shown in fig6 when the actuation lever 34 is moved towards the front of the holding apparatus 12 . this movement of the actuation lever 34 causes contact between the camming portion 36 and the camming surface 38 to separate the first and second portions 20 , 22 , opening the jaw structure 18 . a locking plate 40 is positioned on the outer side of the upper portion 20 . the locking plate 40 is fastened to the upper portion by fasteners 42 . the locking plate 40 partially overhangs the back end of the upper portion 20 . preferably a cylinder ( not shown ) may be applied to the underside of the overhanging portion of the locking plate 40 to insure that the upper section 24 and the lower section of the jaw structure 18 are in the closed position , as shown in fig3 . a groove 48 extends across the bottom 50 of the lower portion 22 of the holding apparatus 12 . the groove 48 mates with a positioning bar 54 on a mounting structure 56 , shown in fig1 and 10 . a mount 41 is positioned on the upper portion 20 of the holding apparatus 12 . the mount is used for moving the upper portion 20 when calibrating the lateral movement of the upper portion 20 with respect to the lower portions 22 , as described below . a notch 52 is positioned in the bottom 50 of the lower portion of the holding apparatus 12 . notch 52 is matable with a member on a mounting structure , such as , for example , the mounting structure 56 shown in fig1 . the notch 52 and mating member encourage positive and fixed positioning of the holding apparatus 12 to a mounting structure . referring to fig6 the upper jaw section 24 of the upper portion 20 mates with an &# 34 ; l &# 34 ; shaped receiving groove 88 towards the front of the upper portion 20 . the lower jaw section 26 of the lower portion 22 mates with an &# 34 ; l &# 34 ; shaped receiving groove 90 towards the front of the lower portion 90 . pins 92 connect the upper and lower jaw sections 24 , 26 within the &# 34 ; l &# 34 ; shaped receiving grooves 88 , 90 . the upper portion 20 further includes an upper axle holding section 58 toward the back of the holding apparatus 12 . the upper axle holding section 58 includes an aperture 60 extending therethrough . the lower portion 22 of the holding apparatus 12 includes an aperture 62 extending through a lower axle holding section 64 which is in axial communication with the aperture 60 of the upper axle holding section 58 . an axle 66 is positioned through the apertures 60 and 62 of the upper and lower axle holding sections 58 , 64 . the axle 66 includes a middle indented portion 68 and an elongated longitudinal slot 70 . on each side of axle 66 are lateral biasing springs 72 and bushings 74 fixedly placed within the aperture 60 of the upper axle holding section 58 . the axle 66 is positioned between the springs 72 and bushings 74 . thus , the upper portion 20 may be moved laterally with respect to the lower portion 22 while being biased in a central location by the lateral biasing springs 72 . a threaded hole 76 is positioned toward the back of the upper portion 20 and receives a tension adjustment pin 78 having a mating threaded portion 79 . the tension adjustment pin 78 includes a ball bearing 80 at its lower end which contacts the indented middle portion 68 of axle 66 . the indented middle portion 68 accommodates the ball bearing 80 to affirmatively bias the upper portion 20 to a central location with respect to lower portion 22 . a set screw 81 locks the tension adjustment pin 78 positioned along the longitudinal slot 70 . the set screw 81 locks the tension adjustment pin 78 in position after the pin 78 is screwed up or down to adjust the tension on the axle 66 . further , axle set screws 86 are positioned in the back of the lower portion 22 for holding the axle 66 in place by contacting the longitudinal slots 70 in the axle 66 . an abutment pin 79 is positioned in a hole 82 in the lower portion 22 . the abutment pin 79 is positioned such that adjustment screws 84 contact the abutment pin 79 when the upper portion 20 is moved laterally in relation to the lower portion 22 . more specifically , since the adjustment screws 84 are connected to the upper portion 20 , each adjustment screw 84 can be positioned to contact the abutment pin 79 at selectable locations of the upper portion 20 . thus , the upper portion 20 can be laterally moved to selectable positions defined by the adjustment screws 84 . thus , needles held between the jaw sections 24 , 26 can be rotated by laterally moving the upper portion 20 relative to the lower portion 22 . the desired angular rotation of the needles 13 is regulated by altering the adjustment screws 84 to arrange the magnitude of lateral motion of the upper portion 20 . referring to fig8 and 9 , the needle transporting apparatus 10 also includes a calibrating apparatus 14 . the calibrating apparatus 14 is dimensioned and configured to accommodate the needle holding apparatus 12 for calibration . specifically , the calibrating apparatus 14 includes a frame 94 having legs 96 such that the calibrating apparatus 14 can be positioned on a work surface 11 or the like . the frame 94 of the calibrating apparatus 14 includes a mounting surface 98 configured and dimensioned for receiving the holding apparatus 12 in a predetermined manner . a calibrating meter 100 is mounted on the frame 94 . the calibrating meter 100 includes a contacting member 102 positioned proximate the mounting surface for contacting the holding apparatus 12 placed thereupon . a calibrating knob 103 is positioned opposite the contacting member 102 for selectively approximating the contacting member 102 towards and away from the holding apparatus 12 positioned on the mounting surface 98 . the calibrating meter 100 visually indicates the relative motion of the contacting member 102 , and thereby , the relative motion of , for example , the upper portion 20 of the holding apparatus 12 communicating with the contacting member 102 . the relative motion is preferably measured by the calibrating meter 100 in increments of mils . a curved portion 101 is positioned between the mounting structure 111 and the calibrating meter 100 . an adjustment tool , such as a screw driver or allen key , is guided by the curved portion 101 to meet with the adjustment screws 84 of the holding apparatus 12 . the adjustment screws 84 can then be arranged to set the lateral motion of the upper portion 20 of the holding apparatus 12 , as described above . stabilizers 104 , functioning as retaining means , are positioned through a side wall 106 of the frame 94 opposite the calibrating meter 100 . the stabilizers include knobs 105 , threaded portion 107 , and contacting portions 108 opposite the knobs 108 . the contacting portions 108 are positioned against the holding apparatus 12 placed on the mounting surface 98 to secure the holding apparatus 12 in position . a calibrating mechanism 110 is positioned on the frame 94 proximate the calibrating meter 100 . the calibrating mechanism 110 includes a rotatable actuation knob 112 positioned on a mounting structure 111 . a slide member 114 is positioned at least partially within the mounting structure 111 . the actuation knob 112 selectively moves the slide member 114 laterally , that is , towards and away from the side wall 106 . a fastening structure 116 , also functioning as a retaining means or grasping member , includes a knob 118 and a body portion 120 having first and second apertures 122 , 124 . the first aperture 122 is pivotally positioned on pivot mount 126 . the second aperture 124 is removably positioned on mount 41 of the needle holding apparatus 12 . the knob 118 is used to rotate the fastening structure 116 about the pivot mount 126 such that the body portion 120 of the fastening structure 116 can be connected to the mount 41 on the holding apparatus 12 . in operation , the calibrating apparatus 14 may first be used to calibrate the holding apparatus 12 for appropriately rotating needles held in its jaw structure 18 . the calibrating apparatus 14 accommodates the holding apparatus 12 on its mounting surface 98 , as shown in fig9 . the fastening structure 116 is pivoted about the pivot mount 126 to attach the second aperture 124 to the mount 41 on the holding apparatus 12 . the stabilizing knobs 105 are rotated to position the contacting portions 108 against the holding apparatus 12 , thereby , securing the holding apparatus 12 in position on the mounting surface 98 . the calibrating actuation knob 112 may then be turned to move the upper portion 20 of the holding apparatus 12 connected to the slide member 114 . the upper portion 20 may be moved laterally in both directions by changing the direction of rotation of the knob 112 . as the upper portion 20 is moved by the slide member 114 , the calibrating knob 103 may be actuated to position the calibrating contacting portion 102 against the upper portion 20 of the holding apparatus 12 . the calibrating meter 100 visually displays the incremental movement of the upper portion 20 of the holding apparatus via the placement of the calibrating contacting member 102 . the adjustment screws 84 can then be accessed using a screw driver or the like , guided by the curved portion 101 to access one adjustment screw 84 . the other adjustment screw 84 is accessed for adjustment over the side wall 106 . after the calibration of the holding apparatus 12 is completed by positioning the adjustment screws 84 of the holding apparatus 12 , the stabilizing knobs 104 and the fastening structure 116 can be released by reversing the procedure described above . the holding apparatus 12 can then be removed from the mounting surface 98 of the calibrating apparatus 14 . referring to fig1 - 15 , the needle transporting apparatus includes a loading apparatus 16 for loading needles into the holding apparatus 12 . the loading apparatus 16 includes a frame 130 positioned on the work surface 11 , as shown in fig1 and 11 . the loading apparatus 16 includes a needle receptacle 132 positioned towards one end of the frame 130 , and a loading station 155 positioned distal to the needle receptacle 132 . further , the frame 130 includes a longitudinally extending slot 157 which slidably accomondates the track 134 . the track 134 can be moved in the slot 157 , and removed after being extended through the end of the slot 157 proximate the loading station 155 . the track 134 can then be loaded into the opposite end of the slot 157 to be reloaded with needles 13 . the needle receptacle 132 is dimensioned and configured for accommedating a multiplicity of needles 13 . it is envisioned that the needle receptacle 132 is a preferred embodiment of a storing member or accommodating means for holding needles . the receptacle 132 includes a sloped portion 133 for encouraging the needles 13 through an opening 135 in the receptacle 132 . the receptacle 132 thereby deposits the needles 13 onto the track 134 in a predetermined fashion , as shown in fig1 . referring now to fig1 , the track 134 functions as a movable member for advancing the needles 13 along a predetermined track path from the needle receptacle 132 . the track 134 extends along the frame 130 about a longitudinal axis extending through the frame 130 . the track 134 includes a plurality of equidistant spaced grooves 136 . the grooves 136 are have a generally &# 34 ; v &# 34 ; shaped configuration such that a triangular portion of a needle will mate with the groove 136 . it is also contemplated that grooves having other shapes may be acceptable for mating with alternatively shaped needles or needle stock , such as , a generally &# 34 ; u &# 34 ; shaped groove . the needle receptacle 132 includes a positioning member 138 , which is envisioned as a preferred embodiment of a positioning means , for rotating the needles 13 to the appropriate position to mate with the grooves 136 . the positioning member 138 includes a contacting clement 140 for communicating with needles 13 that are not positioned with the grooves 136 in the appropriate manner . the contacting element 140 contacts the needles 13 and , rotates them until they fit into grooves 136 in the track 134 . an adjustment member 142 includes a rotatable knob 144 and a threaded portion 146 . the adjustment member 142 is connected to the positioning member 138 to elevate and descend the contacting element 140 to an appropriate height above the track 134 . referring back to fig1 , a track actuation mechanism 148 includes a rotatable knob 150 communicating with the track 134 . rotation of the knob 150 moves the track 134 toward the loading station 155 . the actuation mechanism , and track 134 , may both be considered part of an advancing structure for moving the needles 13 in an orderly and predictable fashion to the loading station . an aligning block 152 is positioned along side of the track 134 and has a frontally inclined surface 154 . the inclined surface 154 contacts the needles 13 as they are advanced toward the loading station 155 on the track 134 . the inclined surface substantially insures that the needles 13 are aligned evenly with respect to each other on the track 134 . the needles 13 positioned in the grooves 136 on the track 134 are advanced until situated at the loading station 155 . the loading station 155 includes a retaining structure 156 having a needle contacting portion 158 , shown in fig1 and 15 . the needle contacting portion 158 is substantially non - abrasive and may be composed of , for example , an elastomeric material . the loading station 155 further includes a sloped portion 162 . ( see fig1 and 12 ) the sloped portion 162 allows the holding apparatus 12 positioned on the mounting surface 56 to approach the needles 13 held by the retaining structure 156 . the retaining structure 156 includes an actuation lever 160 which approximates the needle contacting portion 158 onto the needles 13 on the track 134 . the contacting portion 158 thereby holds the needles 13 on the track in their predetermined position in the grooves 136 . referring to fig1 , the loading apparatus includes a mounting structure 56 dimensioned and configured for accommodating the holding apparatus 12 . the mounting structure 56 includes a frame 164 having the mounting structure slidably positioned therein . the mounting structure 56 further includes the positioning bar 54 which mates with the groove 48 in the holding apparatus 12 . the mounting structure 56 is movably positioned on the work surface 11 . the mounting structure 56 slides in a generally orthogonal direction with respect to the loading station 155 . the mounting structure 56 thus is positioned such that the needle holding apparatus 12 , when positioned on the mounting structure 56 , can slide towards the loading station 155 . the needles 13 positioned at the loading station 155 can be placed between the open jaw structure 18 of the holding apparatus 12 . as illustrated in fig1 and 14 , to ensure proper positioning of the holding apparatus 12 when positioning needles 13 in the jaw structure 18 , the mounting structure 56 includes a cylindrical alignment projection 57 . the projection 57 mates with a cylindrical hole 59 in the frame 130 of the loading apparatus 16 . referring to fig1 - 15 , in operation , the loading apparatus 16 and the holding apparatus 12 of the needle transporting apparatus 10 are shown . referring to fig1 , the loading apparatus 16 is shown positioning needles 13 from the needle receptacle 132 into the grooves 136 in the track 134 as the track is moved toward the loading station 155 by the rotation of knob 150 . referring to fig1 , the needles 13 are in position at the loading station 155 . the needle holding apparatus 12 is also in position on the mounting structure 56 . the lever 34 , and thereby the camming portion 36 , are in position to open jaw structure 18 against the biasing nature of the spring 30 . the jaws structure is opened by separating the upper and lower sections 20 and 22 of the holding apparatus 12 . more specifically , the jaw structure 18 is opened by lifting the actuation lever 34 upwardly as shown in fig1 , rotating the lever 34 about pivot rod 46 . the camming portion 36 of actuation lever 34 abuts the camming surface 38 of the lower portion 22 of the holding apparatus 12 , separating the upper and lower portions 20 , 22 in relation to each other . this separation opens the upper and lower jaw sections 24 , 26 against the biasing tension of the spring 30 . referring to fig1 , the needle contacting portion 158 of the retaining structure 156 has been positioned on the needles 13 by moving actuating lever 160 . the needles 13 are thereby retained in their desired position in the grooves 136 of the track 134 . the holding apparatus 12 is then ready to be moved to position the needles 13 between the jaw structure 18 . the needle holding apparatus 12 moves toward the needles 13 in the loading station 155 by sliding the holding apparatus 12 mounted on the slidable mounting structure 56 . the needles 13 are thus positioned between the open jaw structure 18 . when the needles 13 are positioned between the jaw structure 18 the cylinder projection 57 is positioned in the hole 59 ensuring proper alignment of the jaw structure 18 with the needles 13 . referring to fig1 , the jaw structure 18 is closed on the needles 13 by lowering lever 34 . the camming portion 36 thereby ceases to contact the camming surface 38 and the jaws are closed by the tensioning of the springs 30 . the needles 13 are thereby held in the holding apparatus 12 and ready for removal from the loading apparatus 16 . the needles 13 are then released from the retaining structure 156 by actuating lever 160 ( see fig1 and 11 ) to release the needle contacting portion 158 from the needles 13 in the grooves 136 on the track 134 . the needle holding apparatus 12 may then be removed from the mounting structure 56 , and the needles 13 held in the holding apparatus 13 are ready for transporting , for example , to a work or processing station . another embodiment of a needle loading apparatus 166 for use with a needle transporting apparatus is shown in fig1 - 22 . referring to fig1 , a needle loading apparatus is shown which is similar to the previous embodiment of a needle loading apparatus 16 shown in fig1 and 10 - 15 . however , the embodiment of the needle loading apparatus 166 shown in fig1 is substantially automated and includes a rotatable positioning wheel 168 mounted to a wall 169 at axis 171 . the wheel 168 includes a needle contacting portion 170 consisting of a suitable material , such as , the elastomeric materials previously mentioned . the proximity of the wheel 168 to the needles 13 positioned on the track 134 is adjusted by rotatable knob 172 . the wheel 168 is preferably rotated in a counterclockwise direction at a predetermined speed by a motor 174 connected to the wall 169 . the wheel 168 speed is preferably between about 2 and about 20 rpm &# 39 ; s . needle receptacle 176 is essentially identical to the needle receptacle 132 shown in fig1 , however , the needle receptacle 176 shown in fig1 and 17 includes a curved wall 178 for encouraging needles toward opening 180 . referring to fig1 , a first positioning member 182 includes a needle contacting portion 184 . the first positioning member 182 defines part of the opening 180 and is positioned in relation to track 134 such that the needles 13 are located in grooves 136 in the track 134 in a similar manner as with the positioning member 138 shown in fig1 . the proximity of the positioning member 182 contacting portion 184 to the needles 13 is adjusted by knob 186 . knob 186 secures a shaft within a selectable position in slot 188 . an aligning wall 190 is curved for aligning the needles on the track 134 as the needles 13 are moved towards the loading station 192 . the curved aligning wall 190 substantially insures that the needles 13 are aligned evenly with respect to each other on the track 134 , as with the aligning block 152 shown in fig1 . a second positioning member 194 includes a first element 196 having a needle contacting portion 198 and a second element 197 also having a needle contacting portion 198 . the needle contacting portion 198 is preferably of similar material as the contacting portion 184 of the first positioning member 182 . the first and second elements 196 , 197 are biased in an initial position by spring 202 . the spring is connected to pin 200 of pivotably mounted element 203 and post 204 . the first and second elements 196 , 197 are resiliently deflectable such that needles 13 are contacted and moved into the grooves 136 in the track 134 . the height of the contacting portions 198 is adjusted by knob 201 . referring to fig1 , a retaining mechanism 206 includes a body portion 208 having a needle contacting portion 210 and accommodating an actuation pin 212 . the pin 212 is part of a pneumatic cylinder 214 having a shaft 213 . the pneumatic cylinder 214 is preferably controlled by pneumatic interface 215 for selectively extending the shaft 213 and the pin 212 to move the lever 34 on the holding apparatus 12 , shown in fig2 . more specifically , as shown in fig1 , the body portion 208 is pivotably connected at pivot point 216 to the frame 130 of the loading apparatus 166 . the body portion is further pivotably connected at pivot point 218 to pneumatic cylinder 220 . cylinder 220 selectively pivots the body portion 208 about pivot point 216 to lower the contacting portion 210 onto needles 13 . the loading apparatus further includes movable mounting surface 222 which functions essentially the same as mounting surface 56 shown in fig1 . however , the mounting surface 222 shown in fig1 is slidably positioned on guide rods 224 . the mounting surface 222 can be pneumatically actuated to move towards and away from the loading station 192 . the needle track 134 is subdivided into links 226 connected in a continuous loop 227 of links 226 . the track links 226 are rotated about the work surface 11 by motor 228 at a predetermined speed . in operation , referring to fig1 - 21 , the retaining mechanism 206 is in an open position having the needle contacting portion 210 of the body portion 208 out of contact with the needles 13 , and the pneumatic cylinder 220 in a first position . further , the needle holding apparatus 12 is oriented with the jaw structure 18 in an open position . the holding apparatus is positioned on the movable mounting surface 222 in a first position which is removed from the work station 192 . referring to fig1 , the needle contacting portion 210 of the body portion 208 is positioned in engagement with the needles 13 . the body portion 208 is activated by a shaft 221 of the pneumatic cylinder 220 moving to a second position pivoting the body portion about pivot point 216 to position the contacting portion 210 on the needles 13 . the needle holding apparatus 12 is identical to the holding apparatus 12 shown in fig1 - 9 , and 13 - 15 . the jaw structure 18 of the holding apparatus 12 is in an open position . the holding apparatus 12 has been moved towards the needles held in the loading station 192 , until the needles 13 are disposed between the open jaw structure 18 . the holding apparatus has been moved forward via mounting surface 222 advancing on the rods 224 . referring to fig2 , the shaft 213 is fully extended and pin 212 is moved into contact with lever 34 . the contact between the pin 212 and lever 34 pushes the lever 34 downwardly closing the jaw structure 18 on the needles 13 . as shown in fig2 , the needle contacting portion 210 of the retaining mechanism 206 is returned to it initial position by moving shaft 221 of the pneumatic cylinder 220 to its first position . the body portion 208 is thus pivoted about pivot point 216 to release contact between the contacting portion 210 and the needles 13 . the needle holding apparatus 12 can then be returned to its initial position on the mounting surface 222 via rods 224 . the needle holding apparatus 12 may then be lifted off the mounting surface 222 having the needles 13 positioned in its jaw structure 18 and transported , for example , to a work or processing station . referring to fig2 , another embodiment of a positioning means is shown as positioning mechanism 230 . the positioning mechanism 230 is incorporated in the loading apparatus 166 shown in fig1 - 21 . the positioning mechanism 230 includes a rotating cylindrical wheel 232 having a needle contacting surface 234 being of a suitable material , such as , the elastomeric material previously mentioned . the wheel 232 is rotated by shaft 236 which is connected to pulley system 238 including pulley 239 . the belt 240 of the pulley system 238 is driven by a motor ( not shown ) for rotating the shaft 236 and wheel 232 at a predetermined speed . the wheel 232 is rotated in a clock - wise direction to encourage needles not properly positioned for mating with the grooves 136 of the track 134 to reenter the needle receptacle 132 . the rotating speed of the wheel 232 is preferably between about 20 and about 100 . another embodiment of a needle holding apparatus of a needle transporting apparatus is shown in fig2 - 31 . the holding apparatus 244 , in some respects , is similar to the holding apparatus 12 shown in fig1 - 7 . referring to fig2 and 24 , the holding apparatus 244 includes an upper portion 246 , middle portion 247 , and a lower portion 248 in overlapping relation . the upper portion 246 includes a lever 252 having a camming surface 254 . the camming surface 254 selectively communicates with a sleeve portion 256 for actuating the lower section 262 of the first jaw structure 258 . the first jaw structure 258 is positioned on the distal end of the holding apparatus 244 and between the upper and middle portions 246 , 247 . a needle contacting material 264 is positioned on the upper section 266 of the first jaw structure 258 for working in concert with needle grooves 268 of the lower section 262 . the second jaw structure 260 is connected to the middle portion 247 of the holding apparatus 244 . the second jaw structure 260 includes a frame 280 defining an upper jaw section 281 having needle contacting material 282 . the second jaw structure further includes lower jaw section 284 having grooves 285 in a needle contacting portion 286 . as shown in fig2 , the middle portion 247 is dimensioned and configured to accommodate the upper portion 246 . the middle portion 247 includes an aperture 270 for accepting a camming shaft 272 . the camming shaft 272 includes a camming end 274 having first and second cams 276 , 278 . the frame 280 and the lower jaw section 284 are mounted on the middle portion 247 such that the camming end 274 of the camming shaft 272 is positioned in a hole 288 in the lower section 284 and a corresponding hole 290 in the frame 280 . the second jaw structure 260 is positioned between the middle portion 247 and a lock plate 292 thereby securing the second jaw section 260 in place . as shown in fig2 , the middle and upper portions 247 and 246 are positioned on the lower portion 248 . the lower portion includes a hole 294 for accommodating a gear shaft 296 having gear teeth 298 . the lower portion 248 further includes a hole 300 for rotatably accommodating a gear 302 . the gear 302 is connected to the opposite end of the camming shaft 272 with respect to the camming end 274 . the gear teeth 298 of the gear shaft 296 and the gear 302 are in mating relation for laterally moving frame 280 downwardly , and the lower section 284 upwardly . the interaction of the upper section 281 of the frame 280 and the contacting portion 286 of the lower section 284 provides selectable opening and closing of the second jaw structure 260 . spring 306 is mounted in hole 308 in the middle portion 247 . the spring 306 contacts the lower section 262 of the first jaw structure 258 thereby biasing the lower jaw section 262 in a closed relation with the upper jaw section 266 . camming surface 254 of lever 252 is rotatable about pivot pin 253 and opens the first jaw structure 258 against the biasing of the spring 306 when the camming surface 254 in positioned against the sleeve portion 256 . referring to fig2 and 26 , upper portion 246 includes a rectangular notch 304 . the notch mates with an approximating member to shift the upper portion 246 laterally with respect to middle portion 247 and lower portion 248 . this lateral shifting rolls the needles 13 a predetermined amount while being held in the grooves 268 of the first jaw structure 258 . two mounting indentations 303 are positioned on the bottom of the holding apparatus 244 , as shown in fig2 . the indentations 303 provide positive positioning of the holding apparatus 244 on a mounting surface . referring to fig2 , an enlarged view is shown of the first and second jaw structures 258 , 260 and their corresponding grooves 268 and 285 . the grooves 268 , 285 are aligned to position needles 13 continuously between the first and second jaw structures 258 , 260 . the first jaw structure 258 includes generally rectangular shaped grooves 268 permitting uniform rotation of the needles 13 having a circular shank 15 . the second jaw structure 260 includes generally &# 34 ; v &# 34 ; shaped grooves 285 . the &# 34 ; v &# 34 ; shaped grooves 285 securely mate with triangularly shaped needles 13 to insure correct orientation of the needle 13 . referring to fig2 and 29 , the needle holding apparatus 244 is in an initial position having both first and second jaw structures 258 and 260 in an open position , as shown in fig2 . the camming surface 254 is positioned against the sleeve portion 256 to open the first jaw structure 258 . further , as best seen in fig2 , the camming end 274 of the camming shaft is positioned in the holes 288 and 290 such that the frame 280 and contacting portion 286 are distal from one another . rotation of the camming shaft 272 manipulates the second jaw structure 260 as indicated by arrows 267 . in operation , referring to fig3 and 31 , the first jaw structure 258 is in a closed position since lower section 262 is in contact with upper jaw section 266 and holding a needle 13 therebetween . the second jaw structure 260 is in an open position . the needles 13 held in the first jaw structure 258 are rotated by laterally moving the upper portion 246 . a moving beam 310 is positioned in the rectangular notch 304 and is used as an approximating member . the moving beam 310 selectively moves the upper portion 246 laterally to rotate the needles 13 in the grooves 285 , 268 a specified amount . the needle 13 rotation is caused by the frictional contact of the upper jaw section 266 contacting material 264 on the needles 13 held in the grooves 268 . after the needles 13 have been angularly rotated the desired amount , the second jaw structure 260 may be closed on the needles 13 further securing of the needles 13 in their specified position in the holding apparatus 244 . the first and second camming sections 276 , 278 interact with the respective lower jaw 284 and the frame 280 to move the frame down , and the lower jaw up . this action closes the second jaw structure 260 when the needles 13 are held securely between the upper jaw section 266 contacting material 282 and the grooves 285 in the contacting portion 286 . the camming end 274 is activated by moving gear shaft 296 laterally to engage gear 302 , thereby , rotating camming shaft 272 . the gear shaft 296 is moved by actuation rods 312 positioned on both sides of the holding apparatus ( only one is shown in fig3 ). the actuation rods 312 rotate camming shaft 272 in either direction by actuating the corresponding side of the gear shaft 296 to achieve the desired rotational movement of camming shaft 272 . once both the first and second jaw structures 258 , 260 are in a closed position , the needles 13 are thereby secured in the holding apparatus 244 . the needles may be then be securely transported to a work or processing station using the holding apparatus 244 . while the present invention is described herein with respect to needles , it should be understood that the devices of this invention may be employed to hold and / or transport any elongated workpiece , including , but not limited to , needle blanks . while the invention has been particularly shown , and described with reference to the preferred embodiments , it will be understood by those skilled in the art that various modifications and changes in form and detail may be made therein without departing from the scope and spirit of the invention . accordingly , modifications such as those suggested above , but not limited thereto , are to be considered within the scope of the invention . | 1 |
the present invention is a therapeutic method for treating angina in mammals . the method utilizes a class of antagonists which have been previously prepared and evaluated as effective aii receptor antagonists . examples of suitable angiotensin ii receptor antagonists include , but are not limited to , the following : substituted imidazoles of the formula ( i ), which are described in u . s . application ser . no . 07 / 746 , 262 , filed aug . 14 , 1991 : r 1 is adamantyl , phenyl , biphenyl , or naphthyl , with each aryl group being unsubstituted or substituted by one to three substituents selected from cl , br , f , i , c 1 — c 6 alkyl , nitro , a - co 2 r 7 , tetrazol - 5 - yl , c 1 — c 6 alkoxy , hydroxy , sc 1 — c 6 alkyl , . so 2 nhr 7 , nhso 2 r 7 so 3 h , conr 7 r 7 , cn , so 2 c 1 — c 6 alkyl , nhso 2 r 7 , po ( or 7 ) 2 , nr 7 r 7 , nr 7 coh , nr 7 coc 1 — c 6 alkyl , nr 7 con ( r 7 ) 2 , nr 7 cow , w wo 2 w ; r 2 is c 2 — c 10 alkyl , c 3 — c 10 alkenyl , c 3 — c 10 alkynyl , c 3 — c 6 cycloalkyl , or ( ch 2 ) 0 - 8 phenyl unsubstituted or substituted by one to three substituents selected from c 1 — c 6 alkyl , nitro , cl , br , f , i , hydroxy , c 1 — c 6 alkoxy , nr 7 r 7 , co 2 r 7 , cn , conr 7 r 7 , w , tetrazol - 5 - yl , nr 7 coc 1 — c 6 alkyl , nr 7 cow , sc 1 — c 6 alkyl , so 2 w , or so 2 c 1 — c 6 alkyl ; x is a single bond , s , nr 7 , or o ; r 3 is hydrogen , cl , br , f , i , cho , hydroxymethyl , coor 7 , conr 7 r 7 , no 2 , w , cn , nr 7 r 7 , or phenyl ; r 4 and rs are independently hydrogen , c 1 — c 6 alkyl , thienyl - y -, furyl - y -, pyrazolyl - y -, imidazolyl - y -, pyrrolyl - y -, triazolyl - y -, oxazolyl - y -, isoxazolyl - y -, thiazolyl - y -, pyridyl - y -, or tetrazolyl - y -, except that r 4 and r 5 are not both selected from hydrogen and c 1 — c 6 alkyl and each heterocyclic ring is unsubstituted or substituted by c 1 — c 6 alkyl , c 1 — c 6 alkoxy , cl , br , f , i , nr 7 r 7 , co 2 r 7 , so 2 nhr 7 , so 3 h , or conr 7 r 7 , oh , no 2 , w , so 2 w , sc 1 — c 6 alkyl , so 2 c 1 — c 6 alkyl , nr 7 coh , nr 7 cow , or nr 7 coc 1 — c 6 alkyl ; y is a single bond , o , s , or c 1 — c 6 alkyl which is straight or branched or optionally substituted by phenyl or benzyl , wherein each of the aryl groups is unsubstituted or substituted by halo , no 2 , cf 3 , c 1 — c 6 alkyl , c 1 — c 6 alkoxy , cn , or co 2 r 7 ; z is a single bond , vinyl , — ch 2 — o — ch 2 —, methylene optionally substituted by c 1 — c 6 alkyl , one or two benzyl groups , thienylmethyl , or furylmethyl , or — c ( o ) nhchr 9 -, wherein r 9 is h , c 1 — c 6 alkyl , phenyl , benzyl , thienylmethyl , or furylmethyl ; a is —( ch 2 ) m —, — ch ═ ch —, — o ( ch 2 ) n —, or — s ( ch 2 ) n —; each r 7 independently is hydrogen , c 1 — c 6 alkyl , or ( ch 2 ) m - phenyl , wherein m is 0 - 4 ; and r 8 is hydrogen , c 1 — c 6 alkyl , or 2 - di ( c 1 — c 6 alkyl )- amino - 2 - oxoethyl ; or a pharmaceutically acceptable salt thereof . particularly preferred compounds are ( e )- 3 -[ 2 - n - butyl - 1 -{( 4 - carboxyphenyl ) methyl }- 1h - imidazol - 5 - yl ]- 2 -( 2 - thienyl ) methyl - 2 - propenoic acid and ( e )- 3 -[ 2 - n - butyl - 1 -{ 4 - carboxynaphth - 1 - yl ) methyl }- 1h - imidazol - 5 - yl ]- 2 -( 2 - thienyl ) methyl - 2 - propenoic acid ; or a pharmaceutically acceptable salt thereof . the most preferred compound of this invention is ( e )- 3 -[ 2 - n - butyl - 1 -{( 4 - carboxyphenyl ) methyl }- 1 - h - imidazolyl - 5 - yl ]- 2 -( 2 - thienyl ) methyl - 2 - propenoic acid methanesulfonate . the compounds of formula ( i ) are prepared following the methods described in european patent publication number ep 0 403 159 , published on dec . 19 , 1990 . substituted imidazoles , which are described in u . s . application ser . no . 07 / 746 , 024 , filed aug . 14 , 1991 , are prepared following the methods described in european publication number ep 0 403 158 , published on dec . 19 , 1990 . preferred compounds included within the scope of this class of aii receptor antagonists are : substituted imidazoles , which are described in u . s . application ser . no . 07 / 590 , 207 , filed sep . 28 , 1990 , are prepared following the methods described in european publication number ep 0 425 211 , published on may 2 , 1991 . preferred compounds included within the scope of this class of aii receptor antagonists are : substituted imidazoles , which are described in u . s . ser . no . 07 / 590 , 206 filed , sep . 28 , 1990 , are prepared following the methods described in european publication number ep 0 427 463 , published on may 15 , 1991 . substituted imidazoles , which are described in u . s . ser . no . 07 , 621 , 491 , filed nov . 30 , 1990 , are prepared following the methods described in european publication number ep 0 437 103 , published jul . 17 , 1991 . preferred compounds included within the scope of the class of aii receptor antagonist are n -[{ 2 - n - butyl - 1 -( 2 - chlorophenyl ) methyl - 1h - imidazol - 5 - yl } methyl - carbonyl ]- l - phenylalanine and n -[( 2 - n - butyl - 1 -( 2 - chlorophenyl ) methyl - 1h - imidazol - 5 - yl } methylcarbonyl ]- l -( 2 - thienyl ) alanine ; or a pharmaceutically acceptable salt thereof . r 1 is adamantyl , or phenyl , biphenyl , or naphthyl , with each aryl group being unsubstituted or substituted by one of three substituents selected from cl , br , f , i , c 1 — c 6 alkyl , nitro , co 2 r 7 , tetrazol - 5 - yl , c 1 — c 6 alkoxy , hydroxy , sc 1 — c 6 alkyl , so 2 nr 7 r 7 , nhso 2 r 7 , so 3 h , conr 7 r 7 , cn , so 2 c 1 — c 6 alkyl , or c n f 2n + 1 ; r 2 is c 2 — c 10 alkyl unsubstituted or substituted by co 2 h , oh , or nr 7 r 7 , c 3 — c 10 alkenyl , c 3 — c 10 alkynyl , c 3 — c 6 cycloalkyl , or ( ch 2 ) 0 - 8 phenyl unsubstituted or substituted by one to three substituents selected from c 1 — c 6 alkyl , nitro , cl , br , f , i , hydroxy , c 1 — c 6 alkoxy , nr 7 r 7 , co 2 r 7 , cn , or conr 7 r 7 ; r 3 is hydrogen , cl , br , f , i , cho , hydroxymethyl , coor 7 , conr 7 r 7 no 2 , or c n f 2n + 1 ; r 4 is co 2 r 7 , conr 7 r 7 , or tetrazol - 5 - yl ; r 5 is hydrogen , c 1 — c 8 alkyl , c 3 — c 6 cycloalkyl , ( ch 2 ) 0 - 4 phenyl , or ( ch 2 ) 0 - 3 ch - diphenyl wherein each phenyl group independently is unsubstituted or substituted by one to three substituents selected from c 1 — c 6 alkyl , nitro , cl , br , f , i , hydroxy , c 1 — c 6 alkyl , nr 7 r 7 , co 2 r 7 , or conr 7 r 7 ; each r 7 independently is hydrogen , c 1 — c 4 alkyl , or ( ch 2 ) 0 - 4 phenyl ; or a pharmaceutically acceptable salt thereof . preferred compounds included within the scope of formula ( vi ) are 3 -[( 2 - chlorophenyl ) methyl - 2 - propylthio - n - butyrylhistidine and 3 -[( 2 - chlorophenyl )- methyl ]- 2 - n - butyl - n - butyrylhistidine ; or a pharmaceutically acceptable salt thereof . compounds of formula ( ii ) are prepared as illustrated by example 1 . r 1 is adamanthylmethyl , or phenyl , biphenyl , or naphthyl , with each aryl group being unsubstituted or substituted by one to three substituents selected from cl , br , f , i , c 1 - 6 alkyl , nitro , co 2 r 8 , tetrazol - 5 - yl , c 1 - 6 alkoxy , hydroxy , sc 1 - 4 alkyl , so 2 nhr 8 , nhso 2 r 8 , so 3 h , conr 8 r 8 , cn , so 2 c 1 - 4 alkyl , or c n f 2n + 1 , wherein n is 1 - 3 ; r 2 is c 2 - 10 alkyl , c 3 - 10 alkenyl , c 3 - 10 alkynyl , c 3 - 6 cycloalkyl , or ( ch 2 ) 0 - 8 phenyl unsubstituted or substituted by one to three substituents selected from c 1 - 6 alkyl , nitro , cl , br , f , i , hydroxy , c 1 - 6 alkoxy , nr 8 r 8 , co 2 r 8 , cn or conr 8 r 8 ; r 3 is hydrogen , cl , br , f , i , cho , hydroxymethyl , co 2 r 8 , no 2 , or c n f 2n + 1 , wherein n is 1 - 3 ; r 5 is c 3 - 6 alkyl , c 3 - 6 alkenyl , phenyl - y -, 2 - or 3 - thienyl - y -, 2 - or 3 - furyl - y -, 2 -, 3 -, or 4 - pyridyl - y -, tetrazolyl - y -, triazolyl - y -, imidazolyl - y -, pyrazolyl - y -, thiazolyl - y -, or oxazolyl - y -, with each aryl ring being unsubstituted or substituted by c 1 - 6 alkyl , cl , br , f , i , c 1 - 6 alkoxy , nr 8 r 8 , co 2 r 8 , or conr 8 r 8 ; y is a single bone or c 1 - 6 alkyl which is branch or unbranched ; r 6 is co 2 r 8 , conr 8 r 8 , or tetrazol - 5 - yl ; r 7 is h , co 2 r 8 , or c 1 - 6 alkyl ; and each r 8 independently is hydrogen , c 1 - 6 alkyl , or ( ch 3 ) 0 - 4 phenyl ; or a pharmaceutically acceptable salt thereof a preferred compound included within the scope of formula ( vii ) is 3 -[ 2 - n - butyl - 1 -{( 2 - chlorophenyl )- methyl }- 1h - imidazol - 5 - yl ]- 2 - benzylpropanoic acid or a pharmaceutically acceptable salt thereof . compounds of formula ( iii ) are prepared as illustrated by example 2 . substituted imidazoles of the formula ( iv ) which are described in u . s . application ser . no . 07 / 621 , 188 , filed nov . 30 , 1990 : r 1 is adamanthylmethyl , or phenyl , biphenyl , or naphthyl , with each aryl group being unsubstituted or substituted by one to three substituents selected from cl , br , f , i , c 1 — c 6 alkyl , nitro , co 2 r 5 , c 1 — c 6 alkoxy , hydroxy , sc 1 — c 6 alkyl , so 2 c 1 — c 6 alkyl , tetrazol - 5 - yl , so 2 nhr 5 , nhso 2 r 5 , so 3 h , po ( or 5 ) 2 , conr 5 r 5 , cn , nr 5 r 5 , nr 5 coh , nr 5 coc 1 — c 6 alkyl , nr 5 con ( r 5 ) 2 , nr 5 cow , so 2 w , or w ; r 2 is c 2 — c 10 alkyl , c 3 — c 10 alkenyl , ( ch 2 ) 0 - 8 — c 3 - 6 cycloalkyl , or ( ch 2 ) 0 - 8 phenyl unsubstituted or substituted by one to three substituents selected from c 1 — c 6 alkyl , nitro , cl , br , f , i , hydroxy , c 1 — c 6 alkoxy , tetrazol - 5 - yl , nr 5 r 5 , co 2 r 5 , cn , conr 5 r 5 , w , nr 5 coh , nr 5 coc 1 — c 6 - alkyl , nr 5 cow , so 2 w , so 2 c 1 — c 6 alkyl , or sc 1 — c 6 alkyl ; x is a single bond , s , nr 5 , or o ; r 3 is hydrogen , cl , br , f , i , cho , hydroxymethyl , c 1 — c 6 alkyl , nr 5 r 5 , co 2 r 5 , conr 5 r 5 no 2 , cn , phenyl , or w ; r 4 is co 2 r 5 , conr 5 r 5 , or tetrazol - 5 - yl ; z is hydrogen , cl , br , f , i , c 1 — c 6 alkyl , c 1 — c 6 alkoxy , hydroxy , cn , no 2 , co 2 r 5 , cor 5 r 5 , w , phenyl - y -, naphthyl - y -, thienyl - y -, furyl - y -, pyrazolyl - y -, imidazolyl - y -, thiazolyl - y -, tetrazolyl - y -, pyrrolyl - y -, triazolyl - y -, oxazolyl - y -, or isoxazolyl - y -, with each aryl or heteroaryl group being unsubstituted or substituted by c 1 — c 6 alkyl , c 1 — c 6 alkoxy , cl , br , f , i , co 2 r 5 , hydroxy , no 2 , cn , conr 5 r 5 , or w ; y is a single bond or c 1 — c 6 alkyl , which is straight or branched ; each r 5 independently is h or c 1 — c 6 alkyl ; or a pharmaceutically acceptable salt thereof . a preferred compound included within the scope of formula ( iv ) is 3 -[ 2 - n - butyl - 1 -( ( 2 - chlorophenyl )- methyl }- 1h - imidazol - 5 - yl ] benzoic acid or a pharmaceutically acceptable salt thereof . compounds of formula ( iv ) are prepared as illustrated by example 3 . r 1 is — c ( o ) nh — ch ( y )—( ch 2 ) n - aryl , — c ( o ) nh — ch ( y )— ch 2 ) n - heteroaryl , or phenyl unsubstituted or substituted by one to three substituents selected from cl , br , f , i , c 1 - 6 alkyl , c 1 - 6 alkoxy , oh , cn , no 2 , co 2 r 4 , tetrazol - 5 - yl , conr 4 r 4 , so 3 h , c m f 2m + 1 , sc 1 - 6 alkyl , or so 2 c 1 - 6 alkyl ; r 2 is hydrogen , c 2 - 10 alkyl , c 3 - 10 alkenyl , c 3 - 6 - cycloalkyl , c m f 2m + 1 , or ( ch 2 ) 0 - 8 phenyl unsubstituted or substituted by one to three substituents selected from c 1 - 6 alkyl , c 1 - 6 alkoxy , cl , br , f , i , oh , no 2 , c m f 2m + 1 , co 2 r 4 , or nr 4 r 4 ; r 3 is —( ch 2 ) n — y , — ch ═ cy —( ch 2 ) n - aryl , — ch ═ cy —( ch 2 ) n - heteroaryl , —( ch 2 ) n — c ( o )— nh — ch ( y )—( ch 2 ) n - aryl , —( ch 2 ) n — c ( o )— nh — ch ( y )—( ch 2 ) n heteroaryl , —( ch 2 ) n heteroaryl , —( ch 2 ) m — nh — ch ( y )—( ch 2 ) n - aryl or —( ch 2 ) m — nh — ch ( y )—( ch 2 ) n - heteroaryl , when r 1 is an optionally substituted phenyl group ; or h when r 1 is — c ( o ) nh — ch ( y )—( ch 2 ) n - aryl or — c ( o ) nh — ch ( y )—( ch 2 ) n - heteroaryl ; x is cl , br , f . i , c m f 2m + 1 , c 1 - 6 alkyl , c 1 - 6 alkoxy , oh , o - phenyl , co 2 r 4 , tetrazol - 5 - yl , cn , or ( ch 2 ) 0 - 4 phenyl unsubstituted or substituted by cl , br , f , i , c 1 - 6 alkyl , c 1 - 6 alkoxy , oh , c m f 2m + 1 , cn , co 2 r 4 , no 2 , or nr 4 r 4 ; aryl is phenyl , biphenyl , or naphthyl wherein each aryl group is unsubstituted or substituted by c 1 - 6 alkyl , c 1 - 6 alkoxy , cl , br , f , i , oh , no 2 , cf 3 , co 2 r 4 , or nr 4 r 4 ; heteroaryl is 2 - or 3 - thienyl , 2 -, or 3 - furanyl , 2 -, 3 -, or 4 - pyridyl , pyrimidyl , imidazolyl , thiazolyl , triazolyl , or tetrazolyl wherein each heteroaryl group is unsubstituted or substituted by c 1 - 6 alkyl , c 1 - 6 alkoxy , cl , br , f , i , oh , no 2 , cf 3 , co 2 r 4 , or nr 4 r 4 ; each r 4 independently is h or c 1 - 6 alkyl ; or a pharmaceutically acceptable salt thereof . a preferred compound included within the scope of formula ( v ) is 2 - n - butyl - 1 -( 4 - carboxyphenyl ) methyl - 5 - chloro - 1h - benzimidazole - 7 - carboxylic acid or a pharmaceutically acceptable salt thereof . compounds of formula ( v ) are prepared following the methods described in patent cooperation treaty publication number wo 91 / 16313 , published oct . 31 , 1991 . formula ( v ) compounds are prepared as illustrated by example 4 . the above descriptions on pages 2 - 11 of classes of aii receptor antagonists for use in the present invention were taken from the noted patent applications and publications . reference should be made to such patent applications and publications for their full disclosure , the entire disclosure of each of which is incorporated herein by reference . the following angiotensin ii receptor antagonists are also included within the scope of the instant invention . since it is contemplated that any aii receptor antagonist will possess the novel utility herein described , the list below does not limit the scope of the present invention . reference citing aii receptor aii analog * blocking activity sar 1 ala 8 clin . sci . 57 : 71 , 1979 sar 1 ile 8 endocrinology 107 ( 5 ): 1365 , 1980 succ 1 val 5 phenylgly 8 clin . sci . mol . med . 51 : 4305 , 1976 desasp 1 ile 8 am . j . physiol . 236 ( 3 ): f252 , 1976 sar 1 thr 8 clin . sci . mol . med . 51 : 3855 , 1976 sar 1 cys - me 8 j . cardiovasc . pharm . 5 : 1025 , 1983 sar 1 tyr - me 4 life sci . 34 : 317 , 1983 gly 8 can j . physiol pharm . 57 : 121 , 1979 ile 8 can j . physiol pharm . 57 : 121 , 1979 leu 8 can j . physiol pharm . 57 : 121 , 1979 sar 1 leu 8 can j . physiol pharm . 57 : 121 , 1979 desasp 1 leu 8 can j . physiol pharm . 57 : 121 , 1979 sar 1 me - ala 7 ile 8 can j . physiol pharm . 57 : 763 , 1979 sar 1 dl - nipecotamide 7 can j . physiol pharm . 57 : 763 , 1979 ile 8 sar 1 sar 7 ile 8 can j . physiol pharm . 57 : 763 , 1979 8 - l - ala j . pharm . pharmacol . 32 : 232 , 1980 met 8 j . med . chem . 22 ( 9 ): 1147 , 1979 thr 8 j . med . chem . 22 ( 9 ): 1147 , 1979 o - me thr 8 j . med . chem . 22 ( 9 ): 1147 , 1979 n - me ile 8 j . med . chem . 22 ( 9 ): 1147 , 1979 n - me phe 8 j . med . chem . 22 ( 9 ): 1147 , 1979 sar 1 sar 7 leu 8 j . med . chem . 22 ( 9 ): 1147 , 1979 sar 1 sar 7 thr ( me ) r j . med . chem . 22 ( 9 ): 1147 , 1979 sar 1 sar 7 dlaile 8 j . med . chem . 22 ( 9 ): 1147 , 1979 meile 1 thr 8 j . med . chem . 20 ( 2 ): 253 , 1977 me 2 gly 1 thr 8 j . med . chem . 20 ( 2 ): 253 , 1977 gdnac 1 thr 8 j . med . chem . 20 ( 2 ): 253 , 1977 desasp 1 thr 8 j . med . chem . 20 ( 2 ): 253 , 1977 sar 1 ser ( me ) 8 j . med . chem . 20 ( 2 ): 253 , 1977 sar 1 thr 8 j . med . chem . 20 ( 2 ): 253 , 1977 sar 1 thr ( me ) 8 j . med . chem . 19 ( 2 ): 244 , 1976 measpnh 2 1 ile 8 j . med . chem . 19 ( 2 ): 244 , 1976 sar 1 metyr 4 ile 8 j . med . chem . 19 ( 2 ): 244 , 1976 sar 1 meile 5 ile 8 j . med . chem . 19 ( 2 ): 244 , 1976 sar 1 meile 8 j . med . chem . 19 ( 2 ): 244 , 1976 sar 1 meile 5 meile 8 j . med . chem . 19 ( 2 ): 244 , 1976 sar 1 thr ( o —/— me ) 8 j . med . chem . 19 ( 2 ): 244 , 1976 sar 1 met 8 j . med . chem . 19 ( 2 ): 244 , 1976 sar 1 ser 8 j . med . chem . 19 ( 2 ): 244 , 1976 ile 5 ala 8 j . med . chem . 13 : 181 , 1970 ile 5 , 8 -( 3 - amino - 4 - j . med . chem . 13 : 181 , 1970 phenyl ) butyric acid asn 1 ala 8 circ . res . 29 : 664 , 1971 sar 1 cys ( me ) 8 circ . res . 46 : 720 , 1980 phe 4 tyr 8 proc . nat acad . sci . 67 : 1624 , 1970 octanoylleu 8 j . med . chem . 20 : 898 , 1977 cys 8 cir . res . 31 : 862 , 1972 phe 4 tyr 8 cir . res . 31 : 862 , 1972 desasp 1 phe 4 tyr 8 cir . res . 31 : 862 , 1972 para - flourophe 4 cir . res . 31 : 862 , 1972 para - fluorophe 8 cir . res . 31 : 862 , 1972 other classes of aii receptor antagonists are disclosed in the following : sipos et al ., u . s . pat . no . 3 , 751 , 404 , issued aug . 7 , 1973 . a particularly preferred compound in this class of aii receptor antagonists is sar - arg - val - tyr - val - his - pro - β - ala - oh which is also referred to as saralasin . regoli et al ., u . s . pat . no . 3 , 907 , 762 , issued sep . 23 , 1975 . examples of suitable compounds within this class are asp - arg - val - tyr - ile - his - pro - val - oh and asp - arg - val - tyr - ile - his - pro - α - amino - n - butyric acid . nyeki et al ., u . s . pat . no . 4 , 388 , 304 , issued jun . 14 , 1983 . compounds disclosed in this patent include sar - arg - val - tyr - ile - his - pro - ile - methyl ester and hydroxyacetyl - arg - val - tyr - ile - his - pro - thr - methyl ester . the same or similar compounds are also disclosed in european patent no . 34 , 259 . sipos et al ., u . s . pat . no . 3 , 886 , 134 issued may 27 , 1975 . examples of compounds of this class are sar - arg - val - tyr - val - his - pro - ala - oh , ser - arg - val - tyr - val - his - pro - ala - oh , and asn - arg - val - tyr - val - his - pro - d - leu - oh . kisfaludy et al ., u . s . pat . no . 4 , 179 , 433 , issued dec . 18 , 1979 . examples of this class of compounds include aminooxyacetyl - arg - val - tyr - ile - his - pro - leu - oh and d - α - aminooxypropionyl - arg - val - tyr - ile - his - pro - leu - oh . hallinan et al ., u . s . pat . no . 4 , 204 , 991 , issued may 27 , 1980 . see also west german offenlegungschrift no . 2846200 ( chemical abstracts , vol . 91 , abstract no . 74989d ). kisfaludy et al ., u . s . pat . no . 4 , 209 , 442 , issued jun . 24 , 1980 . examples include hydroxyacetyl - arg - val - tyr - ile - his - pro - leu - oh , hydroxyacetyl - arg - val - tyr - ile - his - pro - ala - oh , and α - hydroxypropionyl - arg - val - tyr - ile - his - pro - ile - oh . nyeki et al ., u . s . pat . no . 4 , 330 , 532 , issued may 18 , 1982 . exemplary compounds of this class are sar - arg - val - tyr - ile - his - pro - lac , sar - arg - val - tyr - ile - his - pro - lac ( oh 2 h 5 ), and sar - arg - val - tyr - ile - his - pro - 2 - hydroxy - 3 - methylvaleric acid . furukawa et al ., u . s . pat . no . 4 , 340 , 598 issued jun . 20 , 1982 . examples include 1 - benzyl - 4 - chloro - 2 - phenylimidazole - 5 - acetamide , 1 - benzyl - 2 - n - butyl - 4 - chloroimidazole - 5 - acetamide , and 1 - benzyl - 2 - n - butyl - 5 - chloroimadazole - 4 - acetic acid . furukawa et al ., u . s . pat . no . 4 , 355 , 040 , issued oct . 19 , 1982 . examples include 1 -( 2 - chlorobenzyl )- 2 - n - butyl - 4 - chloroimidazole - 5 - acetic acid and 1 - benzyl - 4 - chloro - 2 -( 4 - chloro - 3 , 5 - dinitrophenyl ) imidazole - 5 - acetic acid . furukawa , et al ., in european patent publications no . 103 , 647 , published mar . 28 , 1984 . a preferred compound included within the scope of this class of aii receptor antagonists is 4 - chloro - 1 -( 4 - hydroxy - 3 - methylbenzyl )- 2 - phenylimidazole - 5 - acetic acid or a pharmaceutically acceptable salt thereof . carini et al ., in european patent publication no . 252 , 310 , published jan . 20 , 1998 and u . s . application ser . no . 50341 filed may 22 , 1987 . preferred compounds included within this class of aii receptor antagonists are 2 - n - butyl - 4 - chloro - 1 -[( 2 ′-( 1h - tetrazol - 5 - yl ) biphenyl - 4 - yl ) methyl ]- 5 -( hydroxymethyl ) imidazole and 2 - n - butyl - 4 - chloro - 1 -[ 2 ′-( carboxybiphenyl - 4 - yl ) methyl ]- 5 -( hydroxymethyl )- imidazole ; or a pharmaceutically acceptable salt thereof . blankley et al ., in european patent publication no . 243 , 637 , published nov . 19 , 1987 and u . s . application ser . no . 847067 , filed apr . 1 , 1986 . preferred compounds included within the scope of this class of aii receptor antagonists are 1 -( 2 - phenylethyl )- 5 - phenylacetyl - 4 , 5 , 6 , 7 - tetrahydro - 1h - imidazo [ 4 , 5 - c ] pyridine - 6 - carboxylic acid and 1 -( 4 - amino - 3 - methylphenyl ) methyl - 5 - diphenylacetyl - 4 , 5 , 6 , 7 - tetrahydro - 1h - imidazo [ 4 , 5 - c ] pyridine - 6 - carboxylic acid ; or a pharmaceutically acceptable salt thereof . carini et al ., in european patent publication no . 323 , 841 , published jul . 12 , 1989 and u . s . application ser . no . 07 / 279 , 1983 , filed dec . 6 , 1988 . preferred compounds included in this class of aii receptor antagonists are 5 - n - propyl - 1 -[( 2 ′- carboxybiphenyl - 4 - yl ) methyl ] pyrrole - 2 - carboxylic acid , 3 - methoxymethyl - 5 - n - propyl - 4 -[( 2 ′-( 1h - tetrazol - 5 - yl ) biphenyl - 4 - yl ) methyl ]- 1 , 2 , 4 - triazole , and 3 - methoxymethyl - 5 - n - butyl - 1 -[ 2 ′- carboxybiphenyl - 4 - yl ) methyl ] pyrazole ; or a pharmaceutically acceptable salt thereof . carini , et al ., u . s . pat . no . 4 , 880 , 804 , issued nov . 14 , 1989 . preferred compounds included within this class of aii receptor antagonists are 2 - n - butyl - 1 -[( 2 ′- carboxybiphenyl - 4 - yl ) methyl ]- 5 - hydroxymethylbenzimidazole and 2 - n - butyl - 1 -[( 2 ′- carboxybiphenyl - 4 - yl ) methyl ]- 6 - hydroxymethylbenzimidazole ; or a pharmaceutically acceptable salt thereof . carini , et al ., u . s . pat . no . 4 , 916 , 129 , issued apr . 10 , 1990 . a preferred compound included within this class of aii receptor antagonists if 5 -[ 4 -( 3 -( n - iso - propylamino ) hydroxypropoxy ) indole - 2 - carboxamidomethyl ]- 2 - n - butyl - 1 -[( 2 ′- carboxybiphenyl - 4 - yl ) methyl ]- 4 - chloroimidazole or a pharmaceutically acceptable salt thereof . rosenberg , et al ., u . s . pat . no . 4 , 857 , 507 , issued aug . 15 , 1989 . examples include boc - phe - leu amide of ( 45 )- 3 - oxo - 4 - amino - 2 , 2 - difluoro - 1 - isopropyl - mercapto - 5 - cyclohexylpentane and boc - phe - leu amide of ( 3r , 4s , ez )- 3 - hydroxy - 4 - amino - 2 - fluoro - 1 - isopropyl - sulfonyl - 5 - cyclohexyl - 1 - pentene ; or a pharmaceutically acceptable salt thereof . wissmann et al . u . s . pat . no . 4 , 013 , 791 , issued mar . 22 , 1977 . an example of such compounds is succinamoyl - arg - val - tyr - val - his - pro - phegly - oh where phegly - oh is a l - c - phenylglycine residue . bumpus et al ., u . s . pat . no . 3 , 923 , 769 , issued dec . 2 , 1975 . bumpus et al ., u . s . pat . no . 3 , 923 , 770 , issued dec . 2 , 1975 . bumpus et al . u . s . pat . no . 3 , 923 , 771 , issued dec . 2 , 1975 . bumpus et al ., u . s . pat . no . 3 , 925 , 345 , issued dec . 9 , 1975 . bumpus et al ., u . s . pat . no . 3 , 976 , 770 , issued aug . 24 , 1976 . wille u . s . pat . no . 3 , 915 , 948 , issued oct . 28 , 1975 . an example of an aii receptor included in this reference is sar - arg - val - tyr - val - his - pro - oh lifer , et al , european patent publication number ep 0 438 869 , published jul . 31 , 1991 and u . s . application ser . no . 07 / 044 , 456 , filed nov . 30 , 1989 . a preferred compound of this class of aii receptor antagonists is α - hexyl - 4 -[( 2 - carboxy - 3 - hydroxybenzoyl ) amino ]- 1h - imidazole - 1 - acetic acid ethyl ester or a pharmaceutically acceptable salt or solvate thereof . chakravarty , et al ., european patent publication number ep 0 401 030 , published dec . 5 , 1990 and u . s . application ser . no . 07 / 522 , 662 , filed may 16 , 1990 . a preferred embodiment of this class of aii receptor antagonists includes 2 - n - butyl - 3 -( 2 ′- tetrazol - 5 - yl ) biphenyl - 4 - yl ) methyl06 , 7 - dihydroimidazo [ 4 , 5 - e ][ 1 , 4 ] diazepine - 8 ( 3h )- one or a pharmaceutically acceptable salt thereof . chakravarty , et al , european patent publication number ep 0 400 974 , published dec . 5 , 1990 and u . s . application ser . no . 07 / 516 , 286 , filed may 4 , 1990 . an example included within the scope of this class of aii receptor antagonists is 5 , 7 - dimethyl - 2 - ethyl - 3 -( 2 ′-( tetrazol - 5 - yl ) biphenyl - 4 - yl ) methyl - 3h - imidazo [ 4 , 5 - b ] pyridine or a pharmaceutically acceptable salt thereof . chakravarty , et al ., european patent publication number ep 0 400 835 , published dec . 5 , 1990 and u . s . application ser . no . 07 / 504 , 441 , filed apr . 4 , 1990 . a preferred embodiment of this class of aii receptor antagonists includes 4 , 6 - dimethyl - 2 - ethyl - 1 -[ 2 -( tetrazol - 5 - yl ) biphenyl - 4 - yl ] methylbenzimidazole or a pharmaceutically acceptable salt thereof . ashton , et al ., european patent publication number ep 0 409 332 , published jan . 23 , 1991 and u . s . application ser . no . 07 / 503 , 352 , filed apr . 2 , 1990 . a preferred embodiment of this class of aii receptor antagonists includes 3 - n - butyl - 4 -[ 4 -( 2 - carboxy - benzamido ) benyl ]- 5 -( 2 - methylbenzylthio )- 4 - 1 , 2 , 4 - triazole or a pharmaceutically acceptable salt thereof . greenlee , at al ., european patent publication number ep 0 407 102 , published jan . 9 , 1991 and u . s . application ser . no . 07 / 516 , 502 , filed apr . 25 , 1990 . a preferred embodiment of this class of aii receptor antagonists includes 2 - n - butyl - 1 , 5 - dihydro - 4 , 5 - dimethyl - 1 -[( 2 ′-( 1h - tetrazol - 5 - yl }( 1 , 1 - biphenyl }- 4 - yl ) methyl ]- pyrrolo [ 3 , 4d ] imidazole or a pharmaceutically acceptable salt thereof . carini , et al ., european patent publication number ep 0 324 377 , published jul . 19 , 1989 and u . s . application ser . no . 07 / 279 , 194 , filed dec . 6 , 1988 . a preferred embodiment of this class of aii receptor antagonists includes 2 - n - propyl - 4 - pentafluoroethyl - 1 -[ 2 ′-( 1h - tetrazol - 5 - yl ) biphenyl - 4 - yl ) methyl ] imidazole - 5 - carboxylic acid or a pharmaceutically acceptable salt thereof . oku , et al , european patent publication number ep 0 3426 021 , published may 8 , 1991 . a preferred embodiment of this class of aii receptor antagonists includes 2 - n - butyl - 7 - methyl - 3 -[( 2 -( 1h - tetrazol - 5 - yl ) biphenyl - 4 - yl ] methyl ]- 3h - imidazo [ 4 , 5 - b ] pyridine or a pharmaceutically acceptable salt thereof . roberts , et al ., european patent publication number ep 0 412 848 , published feb . 13 , 1991 . a preferred embodiment of this class of aii receptor antagonists includes 2 - methyl - 4 -( 2 ′-( 1h - tetrazol - 5 - yl ) biphenyl - 4 - yl ) methoxy ] quinoline or a pharmaceutically acceptable salt thereof . roberts , et al ., patent cooperation treaty application publication number wo 91 / 07404 , published may 30 , 1991 . a preferred embodiment of this class of aii receptor antagonists included 2 - ethyl - 4 -[( 2 -′-( 1h - tetrazol - 5 - yl ) biphenyl - 4 - yl ) methoxy - 1 , 5 - naphthyridine or a pharmaceutically acceptable salt thereof . roberts , et al ., european patent publication number ep 0 399 732 , published nov . 28 , 1990 . a preferred embodiment of this class of aii receptor antagonists includes 4 -[( 2 - n - butyl - 1h - benzimidazol - 1 - yl ) methyl - n - phenylsulphonlybenazmide or a pharmaceutically acceptable salt thereof . miyake , et al ., european patent publication number ep 0 420 237 , published mar . 3 , 1991 . a preferred embodiment of this class of aii receptor antagonists includes 7 - methyl - 2 - n - propyl - 3 -[( 2 ′( 1h - tetrazol - 5 - yl ) biphenyl - 4 - yl ) methyl ]- 3 - h - imidazo [ 4 , 5 - b ] or a pharmaceutically acceptable salt thereof . narr , et al ., european patent publication number ep 0 392 317 , published nov . 17 , 1990 . a preferred embodiment of this class of aii receptor antagonists includes 4 ′[( 6 - n - butanoylamino - 2 - n - butyl - benzimidazol - 1 - yl ) methyl ] biphenyl - 2 - carboxylic acid or a pharmaceutically acceptable salt thereof . the above descriptions of classes of aii antagonists for use in the present invention were taken from pending patent applications , noted patents , and publications or from abstracts thereof . reference should be made to such patents and publications themselves for their full disclosures of such classes and specific compounds within such classes , the entire disclosure of such patents and publications being incorporated herein by reference . furthermore , examples 1 - 4 teach how to make compounds encompassed by the generic formulae of ( ii )-( v ). many aii antagonist are known in the art and may be prepared by known methods or by variations thereof . certain aii antagonists employed in the invention may exists in isomeric form . this invention includes all such isomers both in pure form and admixture , including racemic mixtures and their pharmaceutically acceptable salts . angiotensin ii antagonist activity is assessed by in vitro methods . in vitro antagonist activity is determined by the ability of the compounds to compete with 125 i - angiotensin ii for binding to vascular angiotensin ii receptors and by their ability to antagonize the contractile response to angiotensin ii in the isolated rabid aorta . for the purposes of the present invention the preferred aii antagonists are compounds which are capable of inhibiting the action of aii by at least 50 % at a concentration of 1 mm or less , and especially preferred aii antagonists are compounds which are capable of inhibiting the action of aii by at least 50 % at a concentration of 25 nm or less when tested by the following standard methods . the radioligand binding assay is a modification of a method previously described in detail ( gunther et al ., circ . res . 47 : 278 , 1980 ). a particular fraction from rat mesenteric arteries is incubated in tris buffer with 80 pm of 125 i - angiotensin ii with or without angiotensin ii antagonists for 1 hour at 25 ° c . the incubation is terminated by rapid filtration and receptor bound 125 i - angiotensin ii trapped on the filter is quantitated with a gamma counter . the potency of angiotensin ii antagonists is expressed as the ic 50 which is the concentration of antagonists needed to displace 50 % of the total specifically bound angiotensin ii . the ability of the compounds to antagonize angiotensin ii induced vasoconstriction is examined in the rabbit aorta . ring segments are cut from the rabbit thoracic aorta and suspended in organ baths containing physiological salt solution . the ring segments are mounted over metal supports and attached to force displacement transducers which are connected to a recorder . cumulative concentration response curves to angiotensin ii are performed in the absence of antagonist or following a 30 - minute incubation with antagonist . antagonist dissociation constants ( k b ) are calculated by the dose ratio method using the mean effective concentrations . in the therapeutic use for the treatment of angina the aii receptor antagonizing compounds of this invention are incorporated into standard pharmaceutical compositions . they can be administered orally , parenterally , rectally , topically or transdermally . the compounds of the instant invention and their pharmaceutically acceptable salts which are active when given orally can be formulated as liquids , for example syrups , suspensions or emulsions , tablets , capsules and lozenges . a liquid formulation will generally consist of a suspension or solution of the compound or pharmaceutically acceptable salt in a suitable liquid carrier ( s ) for example , ethanol , glycerine , non - aqueous solvent , for example , polyethylene glycol , oils , or water with a suspending agent , preservative , flavouring or colouring agent . a composition in the form of a tablet can be prepared using any suitable pharmaceutical carrier ( s ) routinely used for preparing solid formulations . examples of such carriers include magnesium stearate , starch , lactose , sucrose and cellulose . a composition in the form of a capsule can be prepared using routine encapsulation procedures . for example , pellets containing the active ingredient can be prepared using standard carriers and then filled into a hard gelatin capsule ; alternatively , a dispersion or suspension can be prepared using any suitable pharmaceutical carrier ( s ), for example aqueious gums , celluloses , silicates or oils and the dispersion or suspension then filled into a soft gelatin capsule . the compounds of the instant invention and their pharmaceutically acceptable salts which are active when administered parenterally ( i . e . by injection of infusion ) can be formulated as solutions or suspensions . a composition for parenteral administration will generally consist of a solution or suspension of the active ingredient in a sterile aqueous carrier or parenterally acceptable oil , for example polyethlene glycol , polyvinyl pyrrolidone , lecithin , arachis oil or sesame oil . alternatively , the solution can be lyophilised and then reconstituted with a suitable solvent just prior to administration . a typical suppository composition comprises a compound of the instant invention or a pharmaceutically acceptable salt thereof which is active when administered in this way , with a binding and / or lubricating agent such as polymeric glycols , gelatins or coca butter or other low melting vegetable or synthetic waxes or fats . a typical transdermal formulation comprises a conventional aqueous or non - aqueous vehicle , for example , a cream , ointment lotion or paste or in the form of a medicated plaster , patch or membrane . for topical administration , the pharmaceutical compositions adapted include solutions , suspensions , ointments , and solid inserts . typical pharmaceutically acceptable carriers are , for example , water , mixtures of water and water - miscible solvents such as lower alkanois or vegetable oils , and water soluble ophthalmologically acceptable non - toxic polymers , for example , cellulose derivatives such as methyl cellulose . the pharmaceutical preparation may also contain non - toxic auxiliary substances such as emulsifying , preserving , wetting , and bodying agents , as for example , polyethylene glycols ; antibacterial components such as quaternary ammonium compounds ; buffering ingredients such as alkali metal chloride ; antioxidants such as sodium metabisulfite ; and other conventional ingredients such as sorbitan monolaurate . preferably the composition is in unit dose form . doses of the compounds of the instant invention in a pharmaceutical dosage unit will be a efficacious , non - toxic quantity selected from the range of 0 . 01 - 200 mg / kg of active compound , preferably 0 . 1 - 100 mg / kg . the selected dose is administered to a human patient in need of treatment of angina induced by angiotensin ii from 1 - 6 times daily , orally , rectally , topically , by injection , or continuously by infusion . oral dosage units for human administration preferably contain from 10 to 500 mg of active compound . lower dosages are used generally for parenteral administration . oral administration is used when safe , effective , and convenient for the patient . no unacceptable toxicological effects are expected when compounds of the invention are administered in accordance with the present invention . the following examples are intended to illustrate , but not to limit , the present invention . examples 1 - 4 describe how to make certain compounds encompassed by the generic formulae of ( ii )-( v ). the remaining examples are directed to pharmaceutical compositions of this invention . the compounds included in these disclosed compositions are representative of the aii receptor antagonists included within the scope of the instant invention , but therapeutically effective amounts of other aii antagonists as discussed hereinabove may be substituted . the procedures of examples 1 - 4 are illustrative of the synthesis of compounds encompassed by generic formulae ( ii )-( v ). substitution of starting materials by the appropriate known reagents yields additional compounds within the scope of formulae ( ii )-( v ). reagents , protecting groups , and functionality on the imidazole and other fragments of the molecule must be consistent with the proposed chemical transformations . the procedure of example 1 is illustrative of the synthesis of compounds encompassed by generic formula ( ii ). a solution of 2 - chlorobenzylamine ( 14 . 2 g , 0 . 1 mol ) and triethylamine ( 13 . 9 ml , 0 . 1 mol ) in dimethyl - formamide ( 100 ml ) was treated with methyl chloroacetate ( 10 . 9 g , 0 . 1 mol ). the mixture was heated at 50 ° c . for 3 . 5 hours . the cooled reaction mixture was diluted with diethyl ether , the solids filtered and the concentrated filtrate was flash chromatographed over silica gel with 6 : 4 hexane in ethyl acetate to provide 15 . 3 g ( 71 %) of homogenous methyl 2 -[ n -( 2 - chloro - phenyl ) methyl ] amino - acetate . this product ( 15 . 2 g , 0 . 071 mol ) in xylene ( 100 ml ) was treated with 98 % formic acid ( 2 . 74 ml , 0 . 0711 mol ) and the mixture was refluxed for 2 . 5 hours with a dean - stark water separator . evaporation gave 17 . 1 g ( 99 %) of methyl 2 -[ n -( 2 - chlorophenyl ) methyl - n - formyl ] aminoacetate . this formylated product ( 17 . 0 g , 0 . 071 mol ) was dissolved in methyl formate ( 13 . 3 ml , 0 . 216 mol ) and added dropwise to a sodium methoxide mixture prepared by adding sodium metal ( 1 . 79 g , 0 . 0778 g - atom ) to tetrahydrofuran ( 325 ml ) followed by slow addition of methanol ( 3 . 15 ml , 0 . 0778 mol ). the combined mixture was stirred at room temperature for 18 hours , then evaporated to dryness . this crude product was dissolved in 50 % aqueous methanol ( 200 ml ), treated with charcoal , filtered and the solution was cooled in ice . concentrated hydrochloric acid ( 14 . 3 ml of 12 n , 0 . 171 mol ) was added slowly to this solution followed by a solution of potassium thiocyanate ( 8 . 6 g , 0 . 0885 mol ) in water ( 20 ml ). the mixture was heated in an oil bath held at 90 ° c . for 2 . 5 hours , then cooled to − 10 ° c . the precipitated solid was filtered , washed with cold ethanol - water and dried at 60 ° c . to provide 14 . 7 g ( 74 %) of 5 - carboxymethyl - 1 -( 2 - chlorophenyl ) methyl - 2 - thio - 1h - imidazole ; m . p . 72 - 74 ° c . a mixture of 5 - carboxymethyl - 1 -( 2 - chlorophenyl )- methyl - 2 - thio - 1h - imidazole ( 2 g , 7 . 08 mmol ), ethyl acetate ( 20 ml ), 5 % sodium carbonate solution ( 40 ml ) and propylbromide ( 4 ml , 44 mmol ) was heated at 60 ° c . for 18 hours . the organic layer was separated , dried over magnesium sulfate and concentrated to 2 . 23 g of crude product . trituration with diethyl ether provided 1 . 63 g ( 71 %) of 5 - carboxymethyl - 1 -( 2 - chlorophenyl ) methyl - 2 - propylthio - 1h - imidazole ; m . p . 68 - 71 ° c . ( from hexane ). the ester was hydrolyzed with aqueous sodium hydroxide solution to give 1 -( 2 - chlorophenyl ) methyl - 2 - thiopropyl - 1h - imidazole - 5 - carboxylic acid ; m . p . 158 - 159 . 5 ° c . ( from ethanol ). a solution of 5 - carboxymethyl - 1 - 1 -( 2 - chloro - phenyl ) methyl - 2 - propylthio - 1h - imidazole ( 3 . 74 g , 11 . 5 mmol ) in dry tetrahydrofuran ( 50 ml ) was cooled to − 78 ° c . under argon , and a solution of diisobutyl aluminum hydride in toluene ( 30 ml of 1 m ) was added dropwise . the mixture was stirred at − 78 ° c . for 1 . 5 hours , then allowed to slowly warm to room temperature . the reaction was quenched by pouring onto iced dilute acetic acid , the product was extracted into methylene chloride and the organic extracts were washed with water , 5 % sodium carbonate solution and brine . the dried , concentrated product was a light tan solid ( 3 . 32 g ). crystallization from ethanol / water gave 1 -( 2 - chlorophenyl ) methyl - 5 - hydroxymethyl - 2 - propylthio - 1h - imidazole ; m . p . 98 - 101 ° c . a mixture of 1 -( 2 - chlorophenyl ) methyl - 5 - hydroxymethyl - 2 - propylthio - 1h - imidazole ( 0 . 117 g , 0 . 393 mmol ) in thionyl chloride ( 1 ml ) was refluxed for 2 hours , evaporated in vacuo to an amorphous solid and triturated with ether to provide 1 ( 2 - chlorophenyl )- methyl - 5 - chloromethyl - 2 - propylthio - 1h - imidazole hydrochloride ( 0 . 13 g , 94 %). a solution of diisopropylamine ( 8 . 4 ml ) in tetrahydrofuran ( 100 ml ) was cooled to − 78 ° c . under argon and a solution of n - butyl lithium ( 30 ml of 2 . 5 m in hexane ) was added . the mixture was stirred at − 78 ° c . for 30 minutes and at 0 ° c . for 10 minutes . after being recooled at − 78 ° c ., a solution of n -( diphenylmethylene )- glycine ethyl ester ( tetra . lett ., ( 1978 ), 2541 , 4625 ) ( 15 . 4 g ) in tetrahydrofuran ( 50 ml ) was added , the mixture was stirred for 1 hour at − 78 ° c . and a solution of 1 -( 2 - chlorophenyl ) methyl - 5 - chloromethyl - 2 - propylthio - 1h - imidazole hydrochloride ( 9 . 4 g ) in dry dimethylformamide ( 20 ml ) was added . the mixture was then stirred at ambient temperature for 18 hours , poured into saturated ammonium chloride solution and the aqueous layer was extracted with methylene chloride . the organic extracts were washed with water , dried with magnesium sulfate concentrated and chromatographed over silica gel with 1 % methanol in methylene chloride to afford 6 . 88 g of 3 -[( 2 - chlorophenyl ) methyl ]- 2 - propylthio - n -( diphenylmethylene ) histidine ethyl ester . this product ( 2 . 59 g ) was dissolved in methylene chloride ( 52 ml ), aqueous 1n hydrochloric acid solution ( 52 ml ) was added and the mixture was stirred at 25 ° c . for 18 hours . the aqueous layer was separated , neutralized to ph 10 . 5 with sodium carbonate and the product was extracted into methylene chloride . the organic extract was dried with magnesium sulfate and concentrated to give 1 . 29 g ( 71 %) of 3 -[( 2 - chlorophenyl ) methyl ]- 2 - propylthio - histidine ethyl ester as an oil . a solution of 3 -( 2 - chlorophenyl ) methyl - 2 - propylthiohistidine ethyl ester ( 0 . 4 g , 1 . 05 mmol ) in methylene chloride ( 20 ml ) was treated with triethylamine ( 0 . 17 ml ) and butyryl chloride ( 0 . 12 ml ). the mixture was stirred at 25 ° c . for 18 hours . the reaction was partitioned between ethyl acetate and water , and the organic layer was washed with water , dried , concentrated an chromatographed over silica gel with 1 to 3 % of methanol in methylene chloride to give 0 . 367 g ( 77 %) of 3 -[( 2 - chlorophenyl ) methyl ]- 2 - propylthio - n - butyrylhistidine ethyl ester as an oil . a mixture of 3 -[( 2 - chlorophenyl ) methyl - 2 - propylthio - n - butyrylhistidine ethyl ester ( 0 . 37 g , 0 . 819 mmole ), ethanol ( 4 ml ), water ( 4 ml ) and potassium hydroxide pellets ( 0 . 098 g , 1 . 75 mmole ) was stirred at 25 ° c . for 1 hours . the reaction was then diluted with water and the ph was adjusted to 4 with 1n aqueous hydrochloric acid solution . the product was extracted into methylene chloride , washed with water , dried and concentrated to an orange solid . two crystallizations from chloroform provided 0 . 22 g of 3 -[( 2 - chlorophenyl ) methyl ]- 2 - propylthio - n - butyrylhistidine ; m . p . 178 °- 181 ° c . the procedure of example 2 is illustrative of the synthesis of compounds encompassed by generic formula ( iii ). imidazole was converted to the 1 - diethoxyortho - amide derivative by the method of curtis and brown , j . org . chem . , ( 1980 ), 45 , 20 . imidazole ( 12 . 8 g , 0 . 19 mol ) and 118 . 4 g ( 0 . 8 mol ) of triethylorthoformate were reacted in the presence of 1 g of p - toluenesulfonic acid to give 20 . 6 ( 61 %), bp 65 - 70 ° c . ( 0 . 1 mm ) of 1 - diethoxyorthoamide imidazole . this product ( 24 . 0 g , 0 . 14 mol ) was dissolved in dry tetrahydrofuran ( 250 ml ), cooled at − 40 ° c . and n - butyl lithium ( 0 . 14 mol , 56 . 4 ml of 2 . 5 m in hexane ) was added to − 40 ° c . to − 35 ° c . after 15 minutes n - butyl iodide ( 31 . 1 g , 0 . 169 mol ) was added at − 40 ° c ., and the reaction was stirred overnight at ambient temperature . the reaction was partitioned between ether an 0 . 3 n hydrochloric acid , and the organic layer was repeatedly extracted with dilute hydrochloric acid . the combined aqueous extracts were neutralized with sodium bicarbonate solution , extracted with methylene chloride , dried over magnesium sulfate and concentrated . a flash distillation on a kugelrohr apparatus provided 14 . 8 g ( 85 %) of 2 - n - butylimidazole . 2 - n - butylimidazole ( 9 . 7 g , 0 . 078 mol ) was dissolved in methanol ( 50 ml ) and added dropwise to a solution of sodium methoxide ( from sodium hydride ( 2 . 31 g , 0 . 0934 mol ) in methanol ( 250 ml )). after one hour the solution was evaporated to dryness , and the sodium salt was taken up in dry dimethylformamide ( 150 ml ) and 2 - chlorobenzyl bromide ( 16 . 3 g , 0 . 079 mol ) was added . the mixture was heated at 50 ° c . for 17 hours under argon , poured onto ice water and the product was extracted into ethyl acetate . the extract was washed , dried , and concentrated to give 18 . 5 g of crude product which was chromatographed over silica gel with 2 : 1 ethyl acetate / hexane to provide 11 . 9 g ( 61 %) of 2 - n - butyl - 1 -( 2 - chlorophenyl ) methyl - 1h - imidazole as an oil . thin layer chromatography on silica gel with 4 : 1 ethyl acetate / hexane gave an r f value of 0 . 59 . a mixture of 2 - n - butyl - 1 -( 2 - chlorophenyl ) methyl - 1h - imidazole ( 95 . 5 g , 0 . 384 mol ), 37 % formaldehyde ( 500 ml ), sodium acetate ( 80 g ) and acetic acid ( 60 ml ) was heated to reflux for 40 hours under argon . the reaction was concentrated in vacuo , and the residue was stirred with 500 ml of 20 % sodium hydroxide solution for 4 hours , diluted with water and extracted with methylene chloride . the extract was washed , dried , and concentrated . the crude product ( 117 g ) was flash chromatographed over 600 g of silica gel with a gradient of ethyl acetate of 10 % of methanol in ethyl acetate to give 8 . 3 g of starting material , 24 . 5 g of a mixture of starting material and product , and 44 g ( 41 %) of 2 - n - butyl - 1 -( 2 - chlorophenyl ) methyl - 5 - hydroxymethyl - 1h - imidazole ; mp 86 - 88 ° c . ( from ethyl acetate ). further elution provided the bis ( 4 , 5 - hydroxymethyl ) derivative ; mp 138 - 140 ° c . ( from ethyl acetate ). a mixture of valeramidine methyl ether hydrochloride ( 250 g , 1 . 66 mol ) and dihydroxyacetone ( 150 g , 0 . 83 mol ) dissolved in liquid ammonia was allowed to stand overnight at room temperature in a pressure vessel , and then heated at 65 ° c . for 4 hours at 375 psi . the ammonia was allowed to evaporate , and the residue was dissolved in methanol ( 3l ). the resulting slurry was refluxed with added acetonitrile ( 1l ). the solution was decanted from the solid ammonium chloride while hot . this procedure was repeated , and the combined acetonitrile extracts were treated with charcoal , filtered hot and the filtrate was concentrated in vacuum to give the dark oil , 2 - n - butyl - 5 - hydroxymethylimidazole ( 253 g , 163 mol , 98 %). this crude alcohol ( 253 g ) was treated with acetic anhydride ( 400 ml ) at − 15 ° c . and then allowed to warm to ambient temperature with stirring , and then stirred an additional 19 hours . the acetic anhydride was evaporated at reduced pressure , the residue taken up in methylene chloride , and the organic phase was washed with 5 % sodium bicarbonate solution and water . the extract was dried over sodium sulfate and concentrated to give 323 g ( 83 %) of 1 - acetyl - 4 - acetoxymethyl - 2 - n - butylimidazole . this diacetate was n - alkylated by the following procedure . to a solution of triflic anhydride ( 120 ml , 0 . 71 mol ) in methylene chloride ( 200 ml ) at − 78 ° c . under argon was added a solution of diisopropyl ethylamine ( 128 ml , 0 . 73 mol ) and 2 - chlorobenzyl alcohol ( 104 g , 0 . 72 mol ) in methylene chloride ( 350 ml ) over a period of 20 minutes . after being stirred an additional 20 minutes at − 78 ° c ., this solution was then treated with 1 - acetyl - 4 - acetoxymethyl - 2 - n - butylimidazole ( 146 g , 0 . 61 mol ) dissolved in methylene chloride ( 300 ml ) over a 20 - minute interval . the mixture was then stirred at ambient temperature for 18 hours and the solvents were evaporated , the residual 2 - n - butyl - 5 - acetoxymethyl - 1 -( 2 - chlorophenyl ) methyl - 1h - imidazole was used without purification for the hydrolysis of the acetate group . a solution of crude 2 - n - butyl - 5 - acetoxymethyl - 1 -( 2 - chlorophenyl ) methyl - 1h - imidazole ( 250 g ) in methanol ( 200 ml ) was treated with 10 % sodium hydroxide solution ( 700 ml ) and the mixture was heated on a steam bath for 4 hours . after cooling , methylene chloride was added , the organic phase was separated , washed with water , dried and concentrated . the residue was dissolved in ether , cooled , and seeded to give the crude product . recrystallization from ethyl acetate gave 176 g of 2 - n - butyl - 1 -( 2 - chlorophenyl ) methyl - 5 - hydroxymethyl - 1h - imidazole ; mp 86 - 88 ° c . this material was identical in all respects to the product prepared in method 1 . a mixture of 2 - n - butyl - 1 -( 2 - chlorophenyl ) methyl - 5 - hydroxymethyl - 1h - imidazole , prepared in example 1 ( ii ), ( 10 g , 0 . 0337 mol ) in thionyl chloride ( 75 ml ) was refluxed for one hour , evaporated in vacuo and the residue azeotroped three times with toluene . the solid was triturated with ethyl ether and collected to provide 10 . 4 g ( 88 %) of the hydrochloride salt of 2 - n - butyl - 1 -( 2 - chlorophenyl ) methyl - 5 - chloromethyl - 1h - imidazole . to dry dimethylformamide ( 50 ml ) under argon was added sodium hydride ( 0 . 53 g , 0 . 022 mol ) followed by diethyl benzyl malonate ( 5 . 51 g , 0 . 022 mol ) in dimethylformamide ( 10 ml ) at 0 ° c . the mixture was stirred at ambient temperature for one hour . a solution of 2 - n - butyl - 1 -( 2 - chlorophenyl ) methyl - 5 - chloromethyl - 1h - imidazole hydrochloride ( 3 . 5 g , 0 . 0105 mol ) in dimethylformamide ( 40 ml ) was added over 5 minutes . the reaction mixture was stirred at 25 ° c . for 18 hours ; then partitioned between water and methylene chloride . the organic layer was washed with water , dried , and concentrated . the crude product was flash chromatographed over silica gel to give 4 . 54 g ( 85 %) of the title compound as an oil . a mixture of diethyl [ 2 - n - butyl - 1 -{( 2 - chloro - phenyl ) methyl }- 1h - imidazol - 5 - yl ] methyl - 2 - benzylmalonate ( 0 . 72 g , 1 . 36 mmol ), potassium hydroxide ( 0 . 83 g , 14 . 7 mmol ), water ( 15 ml ) and ethanol ( 25 ml ) was refluxed for 4 hours . the ethanol was evaporated , the residual aqueous layer was extracted with diethyl ether , and the basic solution was adjusted to ph 3 . 75 with concentrated hydrochloric acid . the precipitated product was extracted into methylene chloride , dried , and concentrated . this crude product was flash chromatographed on silica gel with 10 % methanol in methylene chloride to give 0 . 51 g ( 86 %) of 3 -[ 2 - n - butyl - 1 -{( 2 - chlorophenyl ) methyl }- 1h - imidazol - 5 - yl ]- 2 - benzylpropanoic acid ; mp 118 - 120 ° c . ( from acetone / diethyl ether as the hydrochloride salt ). the procedure of example 3 is illustrative of the synthesis of compound encompassed by generic formula ( iv ). hexane - washed 80 % sodium hydride ( 1 . 45 g , 0 . 0483 mol ) in dimethylformamide ( 80 ml ) under argon was treated with a solution of 2 - n - butylimidazole ( 5 . 45 g , 0 . 0439 mol ) in dimethylformamide ( 14 ml ) dropwise at 25 ° c . and the reaction was stirred an additional hour . then 2 -( trimethylsilyl ) ethoxymethyl chloride ( sem - cl ) ( 7 . 68 g , 0 . 0461 mol ) was added , the mixture was stirred for 18 hours at ambient temperature and then partitioned between ice water and ethyl acetate . the washed , dried , concentrated organic solution was chromatographed over silica gel with 1 : 1 hexane in ethyl acetate to yield 10 . 8 g ( 96 %) of 2 - n - butyl - 1 -( trimethylsilyl )- ethoxymethyl - imidazole . a solution of 2 - n - butyl - 1 - sem imidazole ( prepared above ) ( 6 . 37 g , 0 . 025 mol ) in ethyl ether ( 125 ml ) was treated dropwise with n - butyl lithium ( 0 . 0255 mol , 10 . 2 ml of 2 . 5 m in hexane ) under argon at room temperature . after being stirred for an additional 45 minutes , tributyltin chloride ( 8 . 83 g , 7 . 4 ml , 0 . 026 mol ) was added dropwise . the suspension was stirred overnight , saturated ammonium chloride solution was added and the ether layer was separated , washed with brine , dried over sodium sulfate , concentrated and flash chromatographed over silica gel with 3 : 1 hexane / ethyl acetate to provide 11 . 3 g ( 83 %) of 2 - n - butyl - 5 - tributyltin - 1 -( trimethyl - silyl ) ethoxymethylimidazole . to a solution of methyl 3 - hydroxybenzoate ( 1 . 73 g , 11 . 3 mmol ), 4 - dimethylaminopryridine ( 215 mg , 1 . 74 mmol ), and 2 , 6 - lutidine ( 2 . 0 ml , 16 . 6 mmol ) in 60 ml of methylene chloride at − 30 ° c . was added trifluoromethane - sulfonic anhydride ( 2 . 8 ml , 16 . 6 mmol ). after stirring the reaction mixture for 10 min at − 30 ° c ., the cooling bath was removed and the reaction was stirred at ambient temperature for 4 hours . saturated aqueous ammonium chloride solution was then added , the layers were separated and the aqueous layer was back extracted twice with methylene chloride . the combined organic extracts were dried with sodium sulfate and the methylene chloride was removed in vacuo . the residue was dissolved in ethyl acetate and washed with water , 10 % aqueous hydrochloric acid solution , saturated sodium bicarbonate solution and brine . the organic extract was dried with magnesium sulfate and the solvent was removed in vacuo . the crude product was flash chromatographed over silica gel eluting with 1 : 1 diethyl ether / hexane to give 3 . 13 ( 98 %) of methyl 3 - trifluoromethane - sulfonyloxybenzoate . to a solution of 2 - n - butyl - 5 - tributytin - 1 -( trimethylsilyl ) ethoxymethylimidazole ( 6 . 06 g , 11 . 1 mmol ), methyl 3 - trifluoromethanesulfonyloxybenzoate ( 3 . 13 g , 11 . 0 mmol ) in 53 ml of 1 , 4 - dioxane at room temperature was added tetrakis ( triphenyl - phosphine ) palladium ( 0 ) ( 256 mg , 0 . 22 mmol ). the reaction mixture was stirred under argon at room temperature for 10 minutes and then 2 , 6 - di - t - butyl - 4 - methylphenol ( 10 mg ) was added . the reaction was heated at 100 ° c . for 3 . 5 hours , cooled to room temperature and treated with 70 ml of diethyl ether and 65 ml of aqueous potassium fluoride solution . the reaction mixture was left stirring at room temperature for 17 hours and then filtered through celite ®. the organic layer was washed with water and brine , dried over magnesium sulfate and concentrated in vacuo . the crude product was flash chromoatgraphed over silica gel eluting with 3 : 1 ethyl aetate / hexane to give 2 . 88 g ( 67 %) of methyl 3 -[ 2 - n - butyl - 1 -{( trimethylsilyl ) ethoxymethyl }- 1h - imidazol - 5 - yl ] benzoate . to a solution of methyl 3 -[ 2 - n - butyl - 1 -{( trimethyl - silyl ) ethoxymethyl }- 1h - imidazol - 5 - yl ] benzoate ( 2 . 88 g , 7 . 41 mmol ) in 35 ml of ethanol was added 35 ml of 5n aqueous hydrochloric acid solution . the reaction mixture was heated at 55 ° c . for 25 hours and then an additional 20 ml of 5n aqueous hydrochloric acid solution was added . the reaction mixture was heated at 70 ° c . for one hour and then stirred at room temperature for 66 hours . the ethanol was removed in vacuo and the resulting aqueous layer was neutralized with saturated aqueous sodium bicarbonate solution and extracted with ethyl acetate . the organic extract was dried with sodium sulfate and the solvent was removed in vacuo . the residue ( 1 . 46 g , 5 . 65 mmol ) was dissolved in methanol ( 40 ml ) and was treated with triethylamine ( 5 . 2 ml , 37 . 3 mmol ) and di - t - butyl dicarbonate ( 8 . 4 ml , 35 . 4 mmol ) at room temperature for 42 . 5 hours . the mixture was concentrated in vacuo and the crude product was flash chromatographed over silica gel with a gradient of ethyl acetate in hexane ( 1 : 8 to 4 : 1 ) to give 800 mg ( 30 %) of methyl 3 -[ 2 - n - butyl - 1 - t - butoxycarbonyl - 1h - imidazol - 5 - yl ] benzoate . to a stirred solution of trifluoromethanesulfonic anyhydride ( 0 . 72 ml , 5 . 1 mmol ) in methylene chloride ( 20 ml ) held at − 78 ° c . under argon was added a solution of 2 - chlorobenzyl alcohol ( 748 mg , 5 . 25 mmol ) and diisopropylethylamine ( 810 mg , 6 . 26 mmol ) in methylene chloride ( 25 ml ). after stirring for 15 minutes at − 78 ° c ., a solution of methyl ( 3 -[ 2 - n - butyl - 1 - t - butoxycarbonyl - 1h - imidazol - 5 - yl ] benzoate ( 1 . 53 g , 4 . 26 mmol ) in methylene chloride ( 10 ml ) was added dropwise over 10 minutes and the mixture was stirred overnight at room temperature . a solution of 5 % sodium bicarbonate solution was added with stirring and the layers were separated , washed and dried . the reaction mixture was evaporated to dryness , the residue triturated with 1 : 1 hexane / ethyl acetate , the solid filtered off and the filtrate was concentrated and flash chromatographed over silica gel with 1 : 1 hexane / ethyl acetate to provide 600 mg ( 38 %) of methyl ( 3 -[ 2 - n - butyl - 1 -[( 2 - chlorophenyl )- methyl }- 1h - imidazol - 5 - yl ] benzoate . methyl 3 -[ 2 - n - butyl - 1 -{( 2 - chlorophenyl ) methyl }- 1h - imidazol - 5 - yl ] benzoic ( 600 mg , 1 . 63 mmol ) was dissolved in 6 ml of ethanol and then 2 ml of 10 % aqueous sodium hydroxide solution was added . the reaction mixture was stirred at room temperature overnight , 10 % aqueous hydrochloric acid solution was added to ph 3 . 5 and the resulting solid was filtered , washed with water and dried to give 125 mg ( 21 %) of 3 -[ 2 - n - butyl - 1 -{( 2 - chlorophenyl ) methyl }- 1h - imidazol - 5 - yl ] benzoic acid as the hydrochloride salt ; mp 200 - 202 ° c . the procedures of example 4 is illustrative of the synthesis of compounds encompassed by generic formula ( v ). the procedure described in r . k . bentley and f . g . holliman , j . chem . soc . ( c ) , 2447 ( 1990 ) was used . a mixture of 2 , 5 - dibromobenzoic acid ( 50 g , 0 . 18 mol ) in concentrated sulfuric acid was vigorously stirred as fuming nitric acid ( 62 . 5 ml ) was added dropwise at a rate to keep the temperature below 70 ° c . the reaction mixture was vigorously stirred , heated to 100 ° c . and then kept at 100 ° c . for 5 hours . the cooled reaction was cautiously poured into 2 liters of ice and vigorously stirred , the precipitate was filtered through a sintered glass funnel and the solid was washed well with water . crystallization was achieved by dissolving the solid in acetic acid ( 150 ml ) and after concentration to a half of the volume , crystals separated ( 16 . 72 g ); mp 225 - 229 ° c . an additional crop of 7 . 52 g was obtained to give a total yield of 24 . 24 g ( 41 %). a suspension of 2 , 5 - dibromo - 3 - nitrobenzoic acid ( 10 . 76 g , 0 . 0331 mol ) in toluene ( 100 ml ) was placed under argon , treated with 2 - chlorobenzylamine ( 14 . 06 g , 0 . 0993 mol ) and the mixture was brought to reflux . a clear , red solution resulted and the solution was refluxed for 24 hours , cooled , poured into 5 % sodium hydroxide solution ( 600 ml ) and ether ( 100 ml ). the insoluble material was filtered off , the layers separated and the aqueous phase was added to the insoluble material and acidified with 10 % hydrochloric acid solution . the separated crystalline produce was collected , washed with water and the solid was crystallized from a large volume of methanol to provide 7 . 85 g ( 61 . 5 %) of the yellow crystalline 5 - bromo - 2 -[( 2 - chlorophenyl ) methyl ] amino - 3 - nitrobenzoic acid ; mp 159 - 161 ° c . a solution of 5 - bromo - 2 -[( 2 - chlorophenyl ) methyl ]- amino - 3 - nitrobenzoic acid ( 8 g , 0 . 021 mmol ) in pyridine ( 100 ml ) was cooled in ice under argon and valeryl chloride ( 5 . 5 g , 0 . 046 mol ) was added . the mixture was heated at 45 ° c . for 18 hours , poured into water , acidified with hydrochloric acid and the oily product was extracted into ethyl acetate . the organic extracts were washed with 10 % hydrochloric acid solution and brine , and the dried , concentrated product afforded about 100 % yield of the crude oil , 5 - bromo - 2 -[( 2 - chlorophenyl ) methyl - n - valeryl ]- amino - 3 - nitrobenzoic acid , which was used without further purification . a solution of 5 - bromo - 2 -[( 2 - chlorophenyl ) methyl - n - valeryl ] amino - 3 - nitrobenzoic acid ( 9 . 72 g , 0 . 0207 mol ) in tetrahydrofuran ( 75 ml ) was diluted with 5 % sodium bicarbonate solution ( 75 ml ), and then treated portionwise with sodium hydrosulfite ( 12 g ) over 2 hours . the ph was adjusted to 7 . 1 with additional solid sodium bicarbonate . after an hour of stirring , 6 g of additional sodium hydrosulfite was added , and , after another hour of stirring , the mixture was filtered , diluted with ether , and the layers were separated . the organic phase was concentrated to a solid that was dissolved in acetic acid ( 15 ml ) and concentrated hydrochloric acid ( 5 ml ) and heated on a steam bath for 2 hours . the residual slurry was concentrated in vacuo , diluted with water and the solid was collected . the solid was dissolved in hot methanol , some insolubles filtered off , and the filtrate was concentrated to incipient crytallization . after chilling , there was obtained 4 . 26 g ( 37 %) of 5 - bromo - 2 - n - butyl - 1 -( 2 - chlorophenyl ) methyl - 1h - benzimidazole - 7 - carboxylic acid ; mp 254 - 255 ° c . an oral dosage form for administering orally active formula ( i ) compounds is produced by screening , mixing and filling into hard gelatin capsules the ingredients in proportions , for example , as shown below . ingredients amounts ( e )- 3 -[ 2 - n - butyl - 1 -{( 4 - carboxy - 100 mg phenyl ) methyl }- 1h - imidazol - 5 - yl ]- 2 - ( 2 - thienyl ) methyl - 2 - propenoic acid magnesium stearate 10 mg lactose 100 mg the sucrose calcium sulfate dihydrate and orally active formula ( i ) compounds are mixed and granulated with 10 % gelatin solution . the wet granules are screened , dried , mixed with the starch , talc and stearic acid , screened and compressed into a tablet . ingredients amounts ( e )- 3 -[( 2 - n - propyl - 1 -{( 4 - carboxynaphth - 75 mg 1 - yl ) methyl }- 1h - imidazol - 5 - yl ]- 2 -( 2 - thienyl ) methyl - 2 - propenoic acid calcium sulfate dihydrate 100 mg sucrose 15 mg starch 8 mg talc 4 mg stearic acid 2 mg ( e )- 3 -[ 2 - n - butyl - 1 -{( 4 - carboxyphenyl ) methyl }- 1h - imidazol - 5 - yl ]- 2 -( 2 - thienyl ) methyl - 2 - propenoic acid , 50 mg , is dispersed in 25 ml of normal saline to prepare an injectable preparation . it is to be understood that the invention is not limited to the embodiments illustrated hereabove and the right to the illustrated embodiments and all modifications coming within the scope of the following claims is reserved . | 0 |
in the present invention , it has been determined that using an glucocorticoid pharmacologic agent in combination with a gene of interest provides a distinct improvement in the efficiency of gene delivery to cells which express glucocorticoid receptors as well as increasing the number of cells receiving the gene . in particular , dexamethasone , one of the most potent synthetic glucocorticoid , at mole ratios up to 3 compared to the cationic lipid , has been shown to facilitate the non - viral gene delivery of a variety of genetic constructs capable of performing their function ( including apoptotic cell death ) in human cancer cells . therefore the present invention provides an aqueous formulation useful for selective targeting and delivery of genes to cancer cells , comprising : ( a ) a cationic lipid , ( b ) a steroid and ( c ) a neutral co - lipid characterized in enhancing the transfection efficiency and stability of the formulation , wherein the said cationic lipid , steroid and neutral co - lipid are mixed in the ratio in the range of 0 . 75 : 0 . 5 : 1 to 1 : 2 : 1 preferably 0 . 75 : 1 : 1 to 1 : 2 : 1 . in a preferred embodiment of the invention , genes which can induce cell death are delivered via a non - viral route in combination with glucocorticoid pharmacological compounds in order to provide more complete tumor remission and more effective prevention of tumor recurrence , thus leading to improved patient survival . the glucocorticoid pharmacological agent ( e . g ., dexamethasone ) is to be administered via the same route of gene delivery , by incorporating it with the non - viral gene carrier ( e . g ., cationic lipid coat ). in this embodiment , four classes of genes may be used . first , cytotoxic genes such a tumor necrosis factor alpha or the tumor suppressor gene p53 , which promotes apoptosis , can be provided . second , genes which sensitize cells by enzymatically activating pro - drugs can be provided . for example , thymidine kinase or cytosine deaminase which respectively activates the cytotoxic pro - drugs gancylclovir and 5 - fluorocytosine could be provided . third , genes which promote immune surveillance could be provided . for example , tumor growth factor - beta 1 could be provided in combination with interleukin - 2 and interferon - gamma . fourth , antimetastatic genes , such as 5 e1a , could be provided . the idea of making this formulation stems from the fact that dexamethasone , a glucocorticoid , has close structural resemblance with cholesterol , a commonly used co - lipid present in many of the cationic lipids used for non - viral based gene delivery . the present invention provides a method for delivering genetic constructs via a non - viral mode with enhanced efficiency by co - formulating cationic lipid based gene delivery formulation carrying a glucocorticoid based pharmacologic agent along with common co - lipids cholesterol . cholesterol as a co - lipid has long been used in liposomal formulations . it is known that cholesterol - containing liposomes have greater stability and lower ion - permeability than when cholesterol is not used [ straubinger et al 1983 , cell , 32 , 1069 - 1079 ]. in the event of lysosomal entrapment during cellular delivery the liposomal cargo is expected to be chewed up by the lysosomal degradative enzymes , such as nucleases , that work at ph & lt ; 6 . it is very much conceivable from the above known facts that cholesterol - associated liposomes not only provide a concrete integrity to the lipid - dna complex in cytosol but also prevent diffusion of lower ph solution containing lysosomal nucleases inside the lipid - dna core . the use of cholesterol increasing the stability of the genetic cargo and transfection efficiency is documented previously [ templeton et al . 1997 , nature biotechnology , 15 , 647 - 652 ; xu and szoka 1996 , biochemistry , 35 , 5616 - 5623 ]. in the context the present invention stands with complete patentability because the formulation uses our own patented cationic lipid along side a secondary co - lipid in the name of dexamethasone , a common , generic , glucocorticoid . the dexamethasone is not modified at all and is used as such . the concentration at which the dexamethasone is used did not induce any toxicity to non - cancer cells . the use of dexamethasone for the targeted gene delivery to cancer is not documented in any of these papers . moreover , we for the first time showed that upon associating dexamethasone into cationic lipid formulation , the cancer cells are alone targeted leaving non - cancer cells untouched , even though the glucocorticoid receptors , through which dexamethasone works in cells , are ubiquitously present in all cells . the following examples are given by the way of illustration of the present invention and should not be construed to limit the scope of the present invention . glucocorticoid receptor expressing cell - specific gene delivery properties of the dexamethasone - cationic liposomal formulation : the in vitro transfection efficacies of dx liposome containing dexamethasone in combination with dodeac as cationic lipid and cholesterol as co - lipid at a mole ratio of 0 . 75 : 1 : 1 were evaluated by reporter gene expression assay using pcmv - sport - β - gal plasmid as the reporter gene in a549 , mcf - 7 and cho cells across the cationic lipid to dna having charge ratios 8 : 1 to 1 : 1 . dexamethasone containing liposome dx has been found to be nearly 2 - 30 folds more efficient in transfecting a549 and mcf - 7 cells ( human cancer cells expressing glucocorticoid receptor ) ( fig1 and 3 ) than cho cell line . dx was most efficient in transfecting lung cancer cells a549 at cationic lipid : dna charge ratios of 8 : 1 and 4 : 1 ( fig1 ). transfection efficiency of dx in a549 at 2 : 1 and 1 : 1 was at least 10 - 20 fold less than that of other charge ratios . however , dx was most efficient in transfecting breast cancer cells mcf - 7 at cationic lipid : dna charge ratios of 4 : 1 , 2 : 1 and 1 : 1 ( fig3 ). both in a549 and mcf - 7 cells , lipofectamine ™ mediate comparatively much less transfection in comparison to dx ( fig1 & amp ; 3 ). significantly low levels of reporter gene expression were observed for dx in the otherwise highly transfectable , non - cancerous , transformed cell cho across all the charge ratios studied with 8 : 1 and 4 : 1 gave highest transfection efficiencies ( fig5 ). transfection efficiencies of other charge ratios are not shown . lipofectamine ™ as expected did show up very high transfection efficiency in cho with respect to dx ( fig5 ). the contrastingly enhanced β - galactosidase reporter gene expression level observed in both a549 and mcf - 7 cells ( fig1 and 3 ) strongly indicate that transfection of glucocorticoid receptor expressing cancer cells , a549 and mcf - 7 by dx is likely to be mediated by the glucocorticoid receptor - binding dexamethasone as present in formulation dx . the transfection efficiencies of the dx formulation in transfecting glucocorticoid receptor expressing lung and breast cancer cells were significantly reduced when the gene transfer experiments were carried out by pretreating the cells with the ru - 38486 , the commercially available glucocorticoid receptor antagonists ( fig2 and 4 ) ( p & lt ; 0 . 01 ). similar ru - 38486 pretreatment studies in cho cells yielded no significant change in transfection efficiencies ( fig6 ) ( p & gt ; 0 . 1 ). thus , the results summarized in fig1 - 6 provided strong evidence for the involvement of glucocorticoid receptors expression in breast and lung cancer cells for the present class of dexamethasone associated gene delivery reagents . materials used — dulbecco &# 39 ; s modified eagle medium ( dmem ), fetal bovine serum was obtained from sigma - aldrich . lipofectamine ™ was obtained from invitrogen . p - cmv -. beta .- galactosidase was a generous gift from dr n . m . rao , ccmb , india . dexamethasone , ru - 38486 were purchased from ( sigma chemical co ., st . louis , mo .) cell - culture — mcf - 7 , cho , a549 cells were purchased from national center for cell sciences ( pune , india ) and were mycoplasma free . cells were cultured in dmem medium ( sigma chemical co ., st . louis , mo .) containing 10 % fetal bovine serum ( sigma chemical co ., st . louis , mo .) and 1 % penicillin - streptomycin at 370 c in a humidified atmosphere of 5 % co2 in air . cultures of 85 - 90 % confluency were used for all of the experiments . the cells were trypsinized , counted , subcultured in 96 - well plates for transfection and viability studies . the cells were allowed to adhere overnight before they were used for experiments . all the necessary compounds ( for e . g . dodeac , cholesterol , dope , dexamethasone ) were taken as stock solutions and mixed in a sample vial in appropriate amounts . it was dried as a thin film in gentle nitrogen flow and further dried in high vacuum for 6 hrs . then it was hydrated for overnight . after that it was subjected to bath sonication for 10 - 15 min and then probe sonicated at room temperature using a ti - probe sonicator for 3 - 4 min to get suv liposome . the liposomes were kept at 4 ° c . plasmid complexation & amp ; gene transfection — for a typical gene transfection study in vitro , cells were first seeded at a density of 12 , 000 - 15 , 000 cells / well in a 96 well plate usually 18 - 24 h before transfection . plasmid dna was complexed with cationic liposome typically in the following manner : 0 . 30 μg of pcmv - sport - β - gal dna , a negatively charged entity ( diluted to 50 μl with plain dmem ) was electrostatically complexed with varying amount of cationic liposomes ( a positively charged entity , diluted to 50 μl with plain dmem ) for 30 min . the molar ratios ( lipid : dna ) were 8 : 1 , 4 : 1 , 2 : 1 and 1 : 1 . after the complexation of plasmid dna and cationic liposome was completed , 200 μl of dmem containing 10 % fbs ( cm1 ×) were added to the resulting lipoplexes for triplicate experiments . thus the final concentration of serum became 6 . 7 %. cells were washed with phosphate - buffered saline ( pbs ), ph 7 . 4 ( 1 × 200 μl ) and then with lipoplex ( 100 μl ). after incubation of the cell plates at a humidified atmosphere containing 5 % co 2 at 37 ° c . for 4 hr , 100 μl of dmem containing 10 % fbs ( cm1 ×) were added to cells . the reporter gene activity was assayed after 48 hr . the media were removed completely from the wells and cells were lysed with 50 μl of 1 × lysis buffer ( np - 40 ) for 30 min . the beta - galactosidase activity per well was estimated by adding 50 μl of 2 × substrate ( 1 . 33 mg / ml of onpg , 0 . 2 m sodium phosphate , ph 7 . 3 and 2 mm magnesium chloride ) to the cell - lysate in the 96 well plate . absorption of the product ortho - nitrophenol at 405 nm was converted to absolute μ - galactosidase units using a calibration curve constructed with commercial μ - galactosidase enzyme . ru 38486 was dissolved in dmso at a concentration of 10 mm . 1 μl of it were added to each well plate where cells were plated previously in 100 μl of dmem + 10 % fbs . after 2 hr media were removed and cells were washed with pbs ( 1 × 100 μl ) and treated with lipoplexes . statistical analysis — all experiments were repeated at least once . data were expressed as mean ± standard derivation and statistically analyzed by the two - tailed unpaired student t - test using the microsoft excel software program ( microsoft , seattle , wash .). data were primarily considered significant if p & lt ; 0 . 01 . an experiment has been conducted to prove that indeed the cholesterol inclusion increases the stability of the liposomal formulation . the optimal formulation concentration that we used in our examples was 1 : 0 . 75 : 1 for dodeac : dex : chol . we made a formulation devoid of cholesterol but having the same ratio of cationic lipid and dexamethasone . the new formulation is hence dodeac : dex , 1 : 0 . 75 . the formulations were made 1 mm in concentration with respect to cationic lipid . 50 μl of each formulation was dispersed in 2 ml of phosphate buffer saline ( pbs ). pbs contains similar ionic strength and ph that prevails in a cellular environment . then we proceeded to measure the size in zetasizer ( malvern instruments , u . k .) over the period of time as indicated in fig7 . the data here indeed proves that the absence of cholesterol in cationic lipid formulation is detrimental for the size - stability of the liposome . the cholesterol - less formulation tends to increase in its size which might render it precipitate out in due course . in fact after 20 h it is noticed that the dodeac : dex ( 1 : 0 . 75 ) formulation indeed precipitated out , while the cholesterol containing formulation [ dodeac : dex : cholesterol : 1 : 0 . 75 : 1 ] remained intact and showed no signs of precipitation . the wide range of literature related with cationic lipid mediated gene transfection shows that the optimal size of the liposome showing efficient transfection should be in submicron level primarily because the lipid formulations with more than micron sizes will tend to precipitate out in long run rendering them incapable of carrying any bioactive molecules such as dna in a near - soluble form . moreover , a very big particulate matter will not be compatible in fusing with cellular membrane and hence will not be able to penetrate the membrane . in the same scenario , our cholesterol - formulated liposome does not change its size showing tremendous amount of stability and structural integrity of the formulation . two dexamethasone ( dex ) associated cationic liposome formulations comprising with or without cholesterol ( chol ) were made and proceeded to check their gene transfection efficiencies . the formulations were dodeac : dex : chol ( 1 : 0 . 75 : 1 ) and dodeac : dex ( 1 : 0 . 75 ). the said formulations were respectively complexed with plasmid encoding β - galactosidase gene and fed to the cells . following 4 h of lipid / dna complex treatment the cells were washed and kept at normal cell culture conditions for 48 h , on completion of which the cells were washed , lysed and assayed for the β - galactosidase gene using o - nitrophenol - b - d - galactopyrano side ( onpg ) substrate . the formation of o - nitrophenol is measured by measuring absorbance at 405 nm . the efficiency of transfection is directly proportional to the expression of transgene ( here , β - galactosidase enzyme ) that produces o - nitrophenol upon exposure with onpg substrate . the results are shown in fig8 . as the result shows that the cholesterol formulated cationic liposome could induce more transfection ( 2 - 4 folds ) than cholesterol - less formulation . the process of the present invention can be exploited for preparing cationic lipid based gene transfer reagents containing glucocorticoid receptor binding dexamethasone in the formulation . the invention of this dexamethsone associated cationic lipid based gene delivery vehicle is useful for delivering polyanions , polypeptides or nucleopolymers into cells via glucocorticoid receptors . the formulation disclosed herein can be used to deliver an expression vector into a cell for manufacturing or therapeutic use . the expression vectors can be used in gene therapy protocols to deliver a therapeutically useful protein to a cell or for delivering nucleic acids encoding therapeutically useful protein molecules . the dexamethasone associated lipid based formulation can be formulated with anionic , zwitterionic and lipophilic therapeutic agents including anticancer agents such as doxorubicin hydrochloride , a hydrophilic compound , or taxol ™, a lipophilic compound to obtain complexes comprising the invented dexamethasone - associated formulation and a therapeutic agent ( s ). in the invented dexamethasone - associated cationic lipid based formulation , two classes of genes may be used . first , cytotoxic genes such a tumor necrosis factor alpha or the tumor suppressor gene p53 , which promotes apoptosis , can be provided . second , those genes can be provided which sensitize cells by enzymatically activating pro - drugs . for example , thymidine kinase or cytosine deaminase , which respectively activates the cytotoxic pro - drugs gancylclovir and 5 - fluorocytosine . third , genes that promote immune surveillance could also be provided . for example , tumor growth factor - beta 1 could be provided in combination with interleukin - 2 and interferon - gamma . fourth , antimetastatic genes , such as 5 e1a , could also be provided for killing metastatic cells . | 0 |
in accordance with this invention , silicon carbide ceramic composites are coated with an aqueous suspension of monoaluminum phosphate ( al ( h 2 po 4 ) 3 , flakes or chopped fibers of aluminoborosilicate , and silicon carbide powder . the coating is most easily applied by brushing it onto the composite surface , although other application methods , such as dip coating or spraying , could be used . once the coating is applied to the composite , it is allowed to air dry , and then fired to about 1000 ° c . to form a hard and durable ceramic coating . there are many silicon carbide ceramic composites which could be used in conjunction with the coating compositions of the present invention . one brand of composite is the afore - mentioned siconex ™ fiber - reinforced ceramic , commercially - available from minnesota mining and manufacturing company , st . paul , minn . these composites are formed by first braiding , weaving , or filament - winding fibers of aluminoborosilicate ( sold under the trade designation nextel ™ 312 , having an alumina : boria mole ratio of from 9 : 2 to 3 : 1 . 5 and containing up to 65 weight percent silica , as described in u . s . pat . no . 3 , 795 , 524 , assigned to minnesota mining and manufacturing company ) to form a desired shape , such as a tube . the tube is coated with a phenolic resin in an organic solvent to rigidize it and thereafter coated with silicon carbide via chemical vapor deposition . the coating of the present invention is comprised of silicon carbide , aluminum phosphate and aluminoborosilicate . an available source of silicon carbide is available as fine abrasive powder , commercially available from fujimi kenzamaki kogyo co ., inc ., nagoya , japan . other forms of silicon carbide include flakes or fibers . in the preferred embodiment , 1 - 50 micrometer diameter silicon carbide powder is used . the precursor aluminum phosphate present in the coating is prepared by dissolving aluminum metal in phosphoric acid . a solution , 50 weight percent of al ( h 2 po 4 ) 3 in water , is available from stouffer chemical company , westport , conn . as the coating is fired , water and a portion of phosphate are released from the aluminum phosphate solution . thus , aluminum phosphate is left after firing . the mole ratio of silicon carbide to aluminum phosphate ( sic : alpo 4 ) in the fired coating is preferably in the range of about 1 : 1 to 50 : 1 . most preferably , the mole ratio of sic : alpo 4 in a fired coating is in the range of about 5 : 1 to 30 : 1 . aluminoborosilicate is also added to the coating composition . this may be in the form of powder , flakes or fibers . preferably , aluminoborosilicate , in the form of fibers , is used and is available under the trade designation nextel ™ ceramic fiber , commercially available from minnesota mining and manufacturing company . the ceramic fiber yarn ranges in diameter from 11 to 15 micrometers and is chopped by passing the yarn between two steel rollers with knurled surfaces . other methods of chopping include ball milling or other methods known in the art . the yarn is chopped to an average fiber length of about 0 . 02 to 0 . 05 mm . the weight percent of the aluminoborosilicate of the total coating composition is in the range of about 0 . 5 to 70 % and , preferably , in the range of about 30 to 70 %. to fashion the ceramic composites for testing the different coating compositions of the present invention , nextel ™ ceramic fiber braid was fit onto a 5 cm diameter aluminum mandrel , and a solution of 10 ml of phenolic resin ( durite ™ sc - 1008 phenolic resin , 60 - 64 % solids , commercially available from borden chemical , columbus , ohio ) in 90 ml of methanol was prepared . a small amount of the resin solution was poured over the ceramic fiber tube while rotating the mandrel , to assure uniform coverage by the resin . the tube was then dried in air until solvent odor could no longer be detected , and then cured in air at 200 ° c . for 20 minutes . this process resulted in a rigid tube having a golden color due to the cured polymer layer . the rigid preform was placed in a chemical vapor deposition chamber , as is well known in the art , wherein vacuum is applied and the chamber is heated . hydrogen gas was bubbled through dimethyldichlorosilane ( dds ) and passed through the cvd furnace chamber , thermally decomposing the dds which thereby deposited a layer of silicon carbide on the preform . by - product and unreacted gases exited the opposite end of the tube to the vacuum pumping and scrubbing system . typical process conditions for these samples were pressures of 5 to 50 torr , flow rates of 0 . 15 liters per minute ( lpm ) of dds , and 1 . 0 lpm of hydrogen gas at temperatures of 900 ° to 1000 ° c . coating times ranged from 4 to 8 hours . under these process conditions and times , the samples received from about 100 to about 200 weight percent increase due to silicon carbide deposition . in this process , sic coats and infiltrates the fibers and the resin coat is also decomposed to form a carbonaceous layer on the surface of the preform . it is useful to examine the fractured surfaces of broken composites made in the above manner . the fractured surfaces resulted in a &# 34 ; brushy &# 34 ; fracture surface which indicates that the coated material has composite rather than monolithic properties , and that heating and processing steps have not destroyed the desired composite properties . coupons of siconex ™ fiber - reinforced ceramic were prepared in a manner similar to the tubes , using woven ceramic fiber ( nextel ™, 312 ) fabric . coupons were convenient for carrying out initial studies of coating feasibility and were more convenient to use in order to examine the adhesion and hardness of the coating . adhesion of the coating on an exposed edge and the performance of the coated edge are also important indicators of the coating performance . many sizes of tubes of the ceramic - ceramic composite were coated and tested . permeability of the final fired tubes was tested by a differential flow test using a flow meter . though not being bound by theory , it is believed that the coating works to maintain the composite characteristics of its composite substrate as well as to match the thermal expansion coefficient of the substrate ( which is important in furnace and high temperature applications ) because the coating itself is a composite material , being comprised of flakes or fibers and particles in a matrix . the flakes , fibers , and particles act to fill the porous sites in the matrix , thereby blocking the flow of gas through the porous sites . further , this discontinuous phase also deflects cracks that may initiate in the coating from mechanical or thermal stresses . aluminoborosilicate ( nextel ™ 312 ceramic fiber commercially - available from minnesota mining and manufacturing company , st . paul , minn .) ranging in diameter from 11 to 15 micrometers was chopped by passing the ceramic fiber yarn between two steel rollers with knurled surfaces . this resulted in chopped fibers with an average length of about 50 micrometers . to a 50 percent by weight solution of monoaluminum phosphate , ( al ( h 2 po 4 ) 3 , commercially available from stauffer , westport , conn .) was added silicon carbide powder (# 1500 , 8 micron , commercially available from fujimi kenmazai kogyo co ., ltd ., nagoya , japan ) and chopped nextel ™ 312 ceramic fiber . deionized water was added to some mixtures to adjust the consistency for coatability . table i shows compositions representing approximately 40 - 70 % fired solids and mole ratios of sic to alpo 4 in the fired product of from about 5 to about 20 : 1 . table i______________________________________coating compositionscomponent mass , g moles sic : alpo . sub . 4 % fired solids______________________________________a . al ( h . sub . 2 po . sub . 4 ). sub . 3 2 . 9 6 40 sic powder 1 . 1 nextel ™ fiber 1 . 3 deionized 2 . 0 waterb . al ( h . sub . 2 po . sub . 4 ). sub . 3 45 . 0 6 50 sic powder 16 . 3 nextel ™ fiber 11 . 4 deionized -- waterc . al ( h . sub . 2 po . sub . 4 ). sub . 3 50 . 0 6 55 sic powder 18 . 1 nextel ™ fiber 21 . 7 deionized -- waterd . al ( h . sub . 2 po . sub . 4 ). sub . 3 5 . 0 16 69 sic powder 5 . 0 nextel ™ fiber 5 . 0 deionized 1 . 0 watere . al ( h . sub . 2 po . sub . 4 ). sub . 3 1 . 5 20 47 sic powder 1 . 9 nextel ™ fiber 1 . 9 deionized 4 . 0 water______________________________________ tube - shaped siconex ™ fiber - reinforced ceramic samples were dipped in , or painted with , each coating formulation , typically in only one pass . coated parts typically weighed 10 to 20 % more than the weight of the original part and had a coating thickness of about 1 mm . the coated parts were allowed to dry at ambient temperature and humidity for 24 hours and then were fired in air by ramping the temperature at 250 ° c . per hour to 1000 ° c ., and holding for 1 hour . the coatings were hard and durable as indicated by attempting to remove or crack the coating by scratching the surface with a steel needle . intact ceramic fibers and particles of sic could be seen by examination under a microscope at 50 × magnification . x - ray diffraction powder patterns of the fired coatings showed beta - sic , mullite , and alpo 4 as crystalline phases . in order to test the permeability of a sample before and after coating , tube - shaped samples were used . through - wall permeability of two tubes ( 5 . 0 cm outer diameter × 20 . 0 cm long ) was measured by closing each end of the tube with a one - hole stopper , and flowing air through the tube . air at a regulated pressure of 1 atmosphere ( 1 . 03 kg / cm 2 ) was admitted through a needle valve and monitored by a flow meter at the inlet end of the tube . a manometer at the exit end of the tube measured the difference in pressure between the inside of the tube ( pressurized air flowing through it ) and the outside of the tube ( room pressure ). for a particular pressure drop , the air flow in cm 3 / min is read from the flow meter . this flow rate , divided by the surface area of the tube , is permeability ( cubic centimeters per minute per square centimeter ). a coating of 55 weight percent fired solids and a 6 : 1 sic : alpo 4 mole ratio ( as per example 1c ) was applied to the outside surface of the tubes . the wet coating was 12 to 15 % of the original part weight . after air drying , the tubes were fired to 1000 ° c . the tubes were weighed and permeability checked again . table ii shows weight and permeability changes : table ii______________________________________permeability data permeabilityweight ( gm ) ( cm . sup . 3 min . sup .- 1 cm . sup .- 2 ) coated coatedtube uncoated & amp ; fired % wt . gain uncoated & amp ; fired______________________________________1 77 . 62 85 . 19 9 . 8 % 132 . 0 1 . 22 95 . 80 103 . 86 8 . 6 10 . 2 & lt ;. 02______________________________________ gas permeability was reduced by a factor of approximately 100 for tube 1 and a factor of 500 for tube 2 . two 5 . 0 × 20 . 3 cm siconex ™ fiber - reinforced ceramic composite tubes were coated as described in example 1 with the coating formulation of example 1c ( designated a in table iii , below ), and two tubes with no coating ( designated b in table iii ) were fired together to 1000 ° c . for 1 hour . all tubes were cut into 2 . 5 cm long rings in order to do strength testing . additional samples were prepared to evaluate the coating as an edge protector for siconex ™ fiber - reinforced ceramic . three 15 . 2 cm ( 6 &# 34 ;) samples were cut from one 5 . 1 by 45 . 7 cm ( 2 &# 34 ;× 18 &# 34 ;) tube and treated as follows sample c ( ends of 15 . 2 cm piece coated , heat treated to 1250 ° c . for 10 hours ), sample d ( cut into 1 &# 34 ; samples , cut edge coated , heat treated at 1250 ° c . for 10 hours ), and sample e ( cut into 1 &# 34 ; samples , heat treated at 1250 ° c . for 10 hours ). burst strength was measured on 1 &# 34 ; rings from all tubes by internal pressurization to failure ( burst test ); average results of the samples are shown in table iii . table iii______________________________________strength datatreatment burst strength1000 ° c ., 1 hr . average st . dev . ______________________________________a coated 9420 psi 540b uncoated 9230 1470 1250 ° c ., 10 hr . c ht . as piece , cut 8000 920d cut , edge coated , ht . 6840 1080e cut , no coating , ht . 5420 670______________________________________ in comparing samples a and b , the burst strength of the samples shows some improvement after coating . in the data for sample c ( 15 cm - long sample , heated , sectioned , and tested ) and e ( six 2 . 5 cm ring samples , heated , and tested ), it appeared that cutting samples before heat treating resulted in a loss of strength of about 33 % with uncut samples . cut samples which were also edge - coated ( sample d ) suffered only about a 15 % strength loss . fracture surfaces of samples c and d are &# 34 ; brushy &# 34 ; ( meaning individual fibers are visible and have not fused together during heat treatment ) and composite - like , while fractured samples of e were quite brittle with less evidence of fiber pull - out . although not intending to be held to any theory , it is speculated that unprotected edges allow oxygen to penetrate into the interface between fibers and the matrix . oxidation within the matrix is suspected to result in bonding between the fibers and the matrix and , thus , brittle fracture behavior results . three coating formulations were prepared as described in example 1 with the formulation of example 1d , except that the particle size of the sic was varied . the particle sizes were one micron , 8 micron , and 50 micron sic powders , commercially available from fujimi kenmazai kogyo co . ltd ., nagoya , japan . small siconex ™ fiber - reinforced ceramic composite samples were painted with the coatings and fired first to 1000 ° c . for a period of one hour at a heat - up rate of 250 ° c ./ hour and then to 1200 ° c . for a period of one hour . each sample was hard and durable as indicated by visual inspection after attempting to remove or crack the coating by scratching the surface with a steel needle . thus , a wide range of silicon carbide particle sizes and a wide firing temperature range produce acceptable coatings . this example shows how the coating compositions can be used as adhesives to join two samples together . to test for shear strength of the coating when used as a bonding agent , 2 . 5 cm - long siconex ™ fiber - reinforced ceramic tubes of two different diameters were used ( 5 cm and 4 . 4 cm in outer diameter ). the tubes were joined together by fitting the smaller diameter tube part - way into the larger tube , such that the smaller diameter tube projected 1 . 25 cm out of the larger diameter tube . a 1 . 25 cm band of coating ( 70 weight % solids ) was placed on the outer surface of the smaller tube , and then a 1 . 25 cm wide piece of nextel ™ 312 ceramic fiber tape was placed on the coating . additional coating was added to the tape , and then the tube with the coating and the ceramic fiber tape was fitted into the larger tube . additional coating was added to fill the gap between the two tubes . this bonded piece was dried for 24 hours at ambient temperature and humidity , heated for 10 hours at 110 ° c ., and fired for 2 hours at 1000 ° c . an axial compression test of the joined tubes was carried out . in this test , pressure was applied to the long axis of the joined tubes to try to break the adhesive bond formed by the dried and fired coating between the two tubes . axial compression tests of fired tubes were carried out at 0 . 051 cm / min ( 0 . 02 &# 34 ;/ min ) crosshead speed with an instron model 1125 load frame . joints tested in this way did not fail under a 1000 lb . ( 455 kg ) load at room temperature . this indicates that the coating can be used effectively to join siconex ™ fiber - reinforced ceramic composite tubes together . this is useful for making t - or u - shaped tubes , or for cases in which the tube diameter must change in order to fit another piece . a further test of the bonding strength of the coating was to rapidly cycle joined pieces through a heating and cooling sequence . two 5 - cm long by 4 . 4 cm diameter siconex ™ fiber - reinforced ceramic composite tubes were butt - joined using the coating composition prepared as described above . an outer sleeve of 5 cm diameter and 2 . 5 cm long was added at the joint to further reinforce the butt - joint . the assembled tube was dried and fired as described above . the joined tubes were flame - cycle tested by heating the inside of the joined tubes with the gas flame of a meeker burner to a temperature of approximately 800 ° c . while cooling the outside of the tube with a flow of compressed air . these heat cycles did not cause failure of the bonds . further heating of this heat - cycled joint for 100 hours at 1000 ° c . in air caused no detectable strength change . in order to show utility of the coating formulations as an adhesive for patching siconex ™ composite parts together , a coating with 70 weight % solids was applied by brushing it onto a siconex ™ composite tube , drying in air for several hours , and firing with a gas - air torch of the kind typically used for glass working . components of the coating melted slightly , lightened in color , and then hardened . the coating is , thus , effective in attaching a patch to a siconix ™ fiber - reinforced ceramic composite tube with a hole in it or in bridging small gaps or cracks in siconix ™ fiber - reinforced ceramic composite tubes in situations where the tubes are in need of repair and require spot heat - treating . as will be apparent to those skilled in the art , various other modifications can be carried out for the above disclosure without departing from the spirit and scope of the invention . | 8 |
fig1 shows a conventional shell - and - tube heat exchanger 10 that is configured to exchange heat between a first fluid and a second fluid in a single - pass , primarily counter - flow ( the two fluids flow primarily in opposite directions ) arrangement . the heat exchanger 10 has tubes 12 , a tube sheet 14 at each end of the tubes , baffles 16 , an input plenum 18 for a first fluid , an output plenum 20 for the first fluid , a shell 22 , an inlet 24 to the input plenum for the first fluid , and an outlet 26 from the output plenum for the first fluid . in addition , the shell 22 includes an inlet 28 for a second fluid and an outlet 30 for the second fluid . the first fluid and the second fluid are at different temperatures . for example , the first fluid can be at a lower temperature than the second fluid so that the second fluid is cooled by the first fluid . during operation , the first fluid enters through the inlet 24 and is distributed by the manifold or plenum 18 to the tubes 12 whose ends are in communication with the plenum 18 . the first fluid flows through the tubes 12 to the second end of the tubes and into the output plenum 20 and then through the outlet 26 . at the same time , the second fluid is introduced into the shell 22 through the inlet 28 . the second fluid flows around and past the tubes 12 in contact with the outer surfaces thereof , exchanging heat with the first fluid flowing through the tubes 12 . the baffles 16 help increase the flow path length of the second fluid , thereby increasing the interaction and residence time between the second fluid in the shell - side and the walls of tubes . the second fluid ultimately exits through the outlet 30 . turning to fig2 - 4 , an improved shell - and - tube heat exchanger 50 is illustrated . the heat exchanger is illustrated as a single - pass , primarily counter - flow ( the two fluids flow primarily in opposite directions ) arrangement . however , it is to be realized that the heat exchanger 50 could also be configured as a multi - pass system , as well as for cross - flow ( the two fluids flow primarily generally perpendicular to one another ), co - current flow ( the fluids primarily flow in the same directions ), or the two fluids flow can flow at any angle therebetween . the heat exchanger 50 includes a shell 52 and a tube bundle 54 that is configured to be disposable in the shell 52 . in the illustrated embodiment , the shell 52 includes an axial inlet 56 at a first end for introducing a first fluid and an axial outlet 58 at the opposite second end for the first fluid . in addition , the shell includes a radial inlet 60 near the first end for introducing a second fluid and a radial outlet 62 near the second end for the second fluid . the shell 52 is configured to enclose the tube bundle 54 and constrain the second fluid to flow along the surfaces of tubes in the tube bundle . the shell 52 can be made of any material that is suitably resistant to corrosion or other effects from contact with the type of second fluid being used , as well as be suitable for the environment in which the heat exchanger 50 is used . for example , the shell can be made of a metal including , but not limited to , steel or aluminum , or from a non - metal material including , but not limited to , a plastic or fiber - reinforced plastic . the tube bundle 54 extends substantially the length of the shell and includes a plurality of hollow tubes 64 for conveying the first fluid through the heat exchanger 50 . the tubes 64 are fixed at a first end 66 to a first tube sheet 68 and fixed at a second end 70 to a second tube sheet 72 . as would be understood by a person of ordinary skill in the art , the tube sheets 68 , 72 are sized to fit within the ends of the shell 52 with a relatively close fit between the outer surfaces of the tube sheets and the inner surface of the shell . when the tube bundle 54 is installed inside the shell 52 , the tube sheets of the tube bundle and the shell collectively define an interior chamber that contains the tubes 64 of the tube bundle . the radial inlet 60 and radial outlet 62 for the second fluid are in fluid communication with the interior chamber . due to the closeness of the fit and / or through additional sealing , leakage of the second fluid from the interior chamber of the shell past the interface between the outer surfaces of the tube sheets 68 , 72 and the inner surface of the shell is prevented . as shown in fig3 , the ends of the tubes 64 penetrate through the tube sheets 68 , 72 via holes in the tube sheets so that inlets / outlets of the tubes are provided on the sides of the tube sheets facing away from the interior chamber of the shell . the ends of the tubes 64 may be attached to the tube sheets in any manner to prevent fluid leakage between the tubes 64 and the holes through the tube sheets . in one example , the ends of the tubes are attached to the tube sheets by fsw . the use of fsw is particularly beneficial where the heat exchanger is used in an environment where it is subject to corrosion , since the fsw process eliminates seams , no dissimilar metals are used and , in the case of saltwater environments , no galvanic cell is created . fsw is a known method for joining elements of the same material . immense friction is provided to the elements such that the immediate vicinity of the joining area is heated to temperatures below the melting point . this softens the adjoining sections , but because the material remains in a solid state , the original material properties are retained . movement or stirring along the weld line forces the softened material from the elements towards the trailing edge , causing the adjacent regions to fuse , thereby forming a weld . fsw reduces or eliminates galvanic corrosion due to contact between dissimilar metals at end joints . furthermore , the resultant weld retains the material properties of the material of the joined sections . further information on fsw is disclosed in u . s . patent application publication number 2009 / 0308582 , titled heat exchanger , filed on jun . 15 , 2009 , which is incorporated herein by reference . the tubes 64 and the tube sheets 68 , 72 are preferably made of the same material , such as , for example , aluminum , aluminum alloy , or marine - grade aluminum alloy . aluminum and most of its alloys , as well as high alloy stainless steels and titanium , are amenable to the use of the fsw joining technique . the tubes and tube sheets can also be made from other materials such as metals including , but not limited to , high alloy stainless steels , carbon steels , titanium , copper , and bronze , and non - metal materials including , but not limited to , thermally enhanced polymers or thermoset plastics . other joining techniques can be used to secure the tubes and the tube sheets , such as expansion , press - fit , brazing , bonding , and welding ( such as fusion welding and lap welding ), depending upon the application and needs of the heat exchanger and the user . in the example illustrated in fig2 - 4 , the tubes 64 are substantially round when viewed in cross - section and substantially linear from the end 66 to the end 70 . however , the shape of the tubes , when viewed in cross - section , can be square or rectangular , triangular , oval shaped , or any other shape , and combinations thereof . in addition , the tubes need not be linear from end to end , but can instead be curved , helical , and other shape deviating from linear . a total of seven tubes 64 are illustrated in this example . however , it is to be realized that a smaller or larger number of tubes can be provided . it is preferred that the tubes be made of a material , such as a metal like aluminum , that permits extrusion or other seamless formation of the tubes . by eliminating seams from the tubes , corrosion is minimized . the tube bundle 54 also includes a baffle assembly 80 integrated therewith . in the illustrated embodiment , the baffle assembly 80 is formed by a plurality of discrete ( i . e . separate ) heat transfer units 82 that are connected to each other so that the baffle assembly 80 has a substantially helix - shape that extends along the majority of the length of the tube bundle 54 around the longitudinal axis of the tube bundle . more preferably the helix - shaped baffle assembly 80 formed by the heat transfer units 82 extends substantially the entire axial length of the tube bundle . the baffle assembly 80 increases the interaction time between the second fluid in the interior chamber of the shell and the walls of the tubes 64 . further , as described further below , the heat transfer units 82 forming the baffle assembly are made of material that is thermally conductive , so that the baffle assembly 80 effectively increases the amount of surface area for thermal contact between the tubes and the second fluid . in addition , the substantially helix - shaped baffle assembly 80 substantially reduces or even eliminates dead spots in the interior chamber of the shell . the helix - shaped baffle assembly 80 can reduce pressure drop , reduce flow restriction of the fluid , and reduce the required force of pumping , yet at the same time provide directional changes of the second fluid to increase interaction between the second fluid and the tubes . thus , the baffle assembly 80 provides the heat exchanger 50 with greater overall heat transfer efficiency between the second fluid and the tubes . in an embodiment , the heat transfer units 82 can be strengthened by the use of solid or perforated plates , made from a thermally conductive material such as aluminum , affixed to the heat transfer units 82 . the plates can be affixed to the units 82 in a periodic pattern along the helix , or they can be affixed to the units in any arrangement one finds provides a suitable strengthening function . the plates can be used to assist in the assembly of the tube bundle and the heat exchanger , and can assist with minimizing the pressure drop on the shell - side flow . fig1 shows an example of such a plate . referring to fig5 together with fig2 - 4 , each heat transfer unit 82 comprises a generally wedge - shaped , planar body 84 having a generally triangular or pie - shape that has radiused inner surfaces to fit the curvature of the outer surfaces of the tubes . as described further below , the unit 82 includes a foam material such as graphite foam or metal foam . preferably , the unit 82 consists essentially of the foam material , and more preferably consists of the foam material . the body 84 includes a first major surface 86 and a second major surface 88 opposite the first major surface . in the illustrated embodiment , the major surfaces 86 , 88 are substantially planar . however , one or more of the major surfaces 86 , 88 need not be planar and could have contours or be shaped in a manner to facilitate fluid flow across or past the unit 82 . fin patterns shown in fig1 a - 17f could be used to enhance flow and heat transfer over the major surfaces 86 , 88 . the fins could extend substantially perpendicular to the surfaces 86 , 88 . alternatively , certain edges of the body 84 could have fin patterns shown in fig1 a thru 17 f to enhance flow and heat transfer from the edges of the heat transfer unit . a support rod hole 90 extends through the body 84 from the first major surface 86 to the second major surface 88 for receipt of a support rod described below . in another embodiment , an open - ended slot is used instead of the hole 90 to receive the support rod . therefore , any opening , such as a hole or slot , could be used to receive the support rod . the perimeter of the body 84 is defined by an arcuate radially outer edge 92 connected to linear side edges 94 , 96 at opposite ends of the outer edge . the side edges 94 , 96 converge toward a common center 98 which is removed during formation of the unit 82 . the side edges 94 , 96 terminate at radiused tube contact surfaces 100 , 102 , respectively , that are positioned on the body 84 opposite the radially outer edge 92 . each of the contact surfaces 100 , 102 is configured to connect to an outer surface of one of the tubes 64 for establishing thermal contact between the heat transfer unit 82 and the tubes . to maximize thermal contact , the contact surfaces 100 , 102 are configured to match the outer surface of the tubes 64 . in the illustrated embodiment , the contact surfaces 100 , 102 are curved , arcuate , or radiused to generally match a portion of the outer surface of the tubes 64 . however , the contact surfaces 100 , 102 can have any shape that corresponds to the shape of the tubes , for example square or rectangular , triangular , oval , or any other shape , and combinations thereof . the body 84 also includes a finger section 104 that in use extends between the two tubes 64 engaged with the contact surfaces 100 , 102 . the finger section 104 includes linear edges 106 , 108 that extend from the contact surfaces 100 , 102 and that terminate at a third tube contact surface 110 that is configured to contact an outer surface of a third tube 64 for establishing thermal contact with the third tube . the contact surface 110 is configured to match the outer surface of the third tube . in the illustrated embodiment , the contact surface is slightly curved or arcuate to generally match a portion of the outer surface of the third tube . however , the contact surface 110 can have any shape that corresponds to the shape of the third tube , for example square or rectangular , triangular , oval , or any other shape , and combinations thereof . in certain embodiments , for example where contact between the body 84 and a third tube is not desired or where there is insufficient space between the tubes for the finger section to extend through , the finger section 104 can be eliminated . fig3 and 4 show the heat transfer units 82 mounted in position on the tube bundle 54 . as shown in fig3 , a plurality of support rods 120 are mounted at one end thereof to the tube sheet 72 and extend substantially parallel to the tubes 64 . the opposite ends of the support rods 120 are unsupported and not fixed to the tube sheet 68 . in another embodiment , the opposite ends of the support rods are also fixed to the tube sheet 68 . in the illustrated embodiment , four support rods 120 are provided and are evenly spaced around the tube bundle 54 . however , a larger or smaller number of support rods 10 can be used based in part on the size of the heat transfer units 82 that are used . the heat transfer units 82 are mounted on the tube bundle 54 with the outer edges 92 thereof facing radially outward . a support rod 120 extends through the hole 90 or other opening and the tube contact surfaces 100 , 102 , 110 are in thermal contact with outer surfaces of three separate tubes 64 . when in thermal contact with the tubes , the major surfaces 86 , 88 form heat transfer surfaces that extend substantially radially from the outer surfaces of the tubes . as used herein , “ in thermal contact ” includes direct or indirect contact between the tube contact surfaces and the tubes to permit transfer of thermal energy between the tube contact surfaces and the tubes . indirect contact between the tube contact surfaces and the tubes could result from the presence of , for example , an adhesive or other material between the tube contact surfaces and the surfaces of the tubes . when a hole is used , the hole 90 is preferably sized such that a relatively tight friction fit is provided with the support rod 120 to prevent axial movement of the heat transfer unit on the rod . if desired , fixation of the heat transfer unit 82 on the rod 120 can be supplemented by fixation means , for example an adhesive between the hole 90 and the rod . instead of the hole , a slot can be formed that receives the support rod which can be secured via a friction fit or bonded using an adhesive . if adhesive bonding is used , the adhesive can be thermally conductive . the thermal conductivity of the adhesive can be increased by incorporating ligaments of highly conductive graphite foam , with the ligaments in contact with the surfaces heat transfer unit ( s ) and the tubes , and the adhesive forming a matrix around the ligaments to keep the ligaments in intimate contact with the tubes and heat transfer units . the ligaments will also enhance bonding strength by increasing resistance to shear , peel and tensile loads . as best seen in fig4 , the heat transfer units 82 are arranged in a helical manner to form the baffle assembly 80 . each heat transfer unit is axially and rotationally offset from an adjacent heat transfer unit with a small overlap region 122 between each pair of adjacent heat transfer units . because of the overlap regions 122 , the baffle assembly formed by the heat transfer units is substantially continuous along the length of the tube bundle 54 . the amount of overlap provided in the region 122 can vary based on the size and depth or thickness of the heat transfer units . in the overlap regions 122 the adjacent heat transfer units can be secured together . for example , the heat transfer units 82 can be frictionally engaged in the overlap regions so that friction maintains the relative rotational positions of the heat transfer units . alternatively , an adhesive or other fixation technique can be provided at the overlap regions to fix the relative rotational positions of the heat transfer units . the periodicity of the helix can be changed by altering the angle of rotation of the heat transfer units . for example , the helix can have an angle of 30 degrees , 60 degrees , 90 degrees , 120 degrees , 150 degrees , 180 degrees and other angles . a person having ordinary skill in the art can determine the desired angles of rotation depending upon , for example , the desired performance of the heat exchanger . in addition , as discussed above , a metal plate ( fig1 ) can be used to strengthen the foam heat transfer units 82 and assist in fabrication of the tube bundle . the support plate can also be embedded within the foam heat transfer unit 82 during formation of the heat transfer units 82 . the metal plate secures the positioning of the tubes in a fixed pattern as an alternating baffle that travels in a helical pattern down the tube axes . the metal plate can be used to overlap two or more foam pieces to provide strength of the graphite core assembly . when the tube bundle is installed in the shell 52 , the heat transfer units 82 are also sized such that the radially outer edges 92 thereof are positioned closely adjacent to , or in contact with , the interior surface of the shell to minimize or prevent the second fluid flowing in the shell from flowing between the radially outer edges 92 and the interior surface . this forces the majority of the fluid to flow past the tubes 64 in a generally spiral flow path defined by the heat transfer units 82 . in some embodiments , the heat transfer units 82 need not overlap , but can instead be sized and mounted so as to have gaps between adjacent heat transfer units to permit some of the fluid to flow axially between the adjacent heat transfer units . the unit 82 ( as well as the heat transfer units described below ) includes , consists essentially of , or consists entirely of , a foam material such as graphite foam or metal foam . the term foam material is used herein to describe a material having closed cells , open cells , coarse porous reticulated structure , and / or combinations thereof . examples of metal foam include , but are not limited to , aluminum foam , titanium foam , bronze foam or copper foam . in an embodiment , the foam material does not include metal such as aluminum , titanium , bronze or copper . in one embodiment , the foam material is preferably graphite foam having an open porous structure . graphite foam is advantageous because graphite foam has high thermal conductivity , a mass that is significantly less than metal foam materials , and has advantageous physical properties , such as being able to absorb vibrations ( e . g . sound ). graphite foam can be configured in a wide range of geometries based on application needs and / or heat transfer requirements . graphite foam can be used in exemplary applications such as power electronics cooling , transpiration , evaporative cooling , radiators , space radiators , emi shielding , thermal and acoustic signature management , and battery cooling . fig6 a - e depict an exemplary process of how the heat transfer units 82 can be made . it is to be realized that this process is exemplary only and that other processes can be used . the heat transfer units 82 can be made by a process that stamps a foam material into a plurality of the wedge - shaped bodies 84 . fig6 a shows a die 128 for simultaneously punching a plurality of the bodies 84 from a circular foam substrate 130 ( fig6 d ). in fig6 b , the foam substrate is shown as stamped by the die . fig6 c shows the stamped material being pulled up and transitioned with the press to force the foam from the die . fig6 d and 6e show the foam pressed out of the die 128 , creating a plurality of the wedge - shaped bodies 84 . in the illustrated example , five wedge - shaped bodies 84 are formed with each stamping sequence . however , a smaller or larger number of bodies 84 can be formed if desired . a clover - leaf shaped remainder 132 is left at the center of the substrate 130 which can be discarded . fig6 d and 6e show the bodies 84 without the holes 90 . the holes 90 could be formed directly by the die 128 . alternatively , if the die does not form the holes , the holes can be created in the bodies 84 after the stamping process through a separate machining process . fig7 shows another embodiment of a foam heat transfer unit 150 disposed on a tube 64 of a tube bundle of a shell - and - tube heat exchanger . the heat transfer unit 150 comprises a generally cylindrical body with a central passage through which the tube 64 extends . the heat transfer unit 150 is in thermal contact with , directly or indirectly , the outer surface of the tube 64 . the body of the heat transfer unit 150 includes opposite end surfaces 152 that form heat transfer surfaces extending substantially radially from the outer surface of the tube . the heat transfer unit 150 can be fixed on the tube to maintain the axial position thereof in any suitable manner , for example by a friction fit or by using an adhesive . axially extending channels 154 are formed in the body that extend between the end surfaces 152 . the channels 154 are evenly circumferentially spaced from one another around the body . in the illustrated embodiment , four channels 154 are shown , although a smaller or larger number of channels 154 can be used . in fig7 , a pair of the heat transfer units 150 are shown disposed on the tube 64 , spaced from each other with an axial gap between the heat transfer units . the two heat transfer units are rotated , for example , approximately 45 degrees relative to each other . however , the rotational angle between the heat transfer units can be more or less than 45 degrees , with the angle chosen based on , for example , the number of grooves and the spacing of the heat transfer units on the tube 64 . as shown by the arrows in fig7 representing the flow of fluid , a fluid flowing through the channel 154 impacts the surface of the adjacent heat transfer unit between the channels 154 causing the fluid to change direction in order to flow into the channels 154 of the adjacent heat transfer unit 150 . additional heat transfer units 150 can be disposed along the entire length of the tube 64 , spaced from each other and rotated relative to a preceding heat transfer unit , similar to that shown in fig7 . fig8 shows an embodiment of a foam heat transfer unit 160 disposed around the tube 64 of a tube bundle of a shell - and - tube heat exchanger . the heat transfer unit 160 is configured as a cylindrical sleeve with at least one end surface 162 that forms a heat transfer surface extending substantially radially from the outer surface of the tube . the heat transfer unit 160 can extend along any length of the tube , and preferably extends along substantially the entire length of the tube . the heat transfer unit 160 can be fixed on the tube to maintain the axial position thereof in any suitable manner , for example by a friction fit or by using an adhesive . in another embodiment , the heat transfer unit 160 is formed by two or more semi - circular sections that are fixed to the outer surface of the tube to form a sleeve . in addition , the sections can be spaced from one another to form one or more grooves between the sections that extend along the axis of the tube 64 . with each of the heat transfer units 150 , 160 , they can be used by themselves , with each other , or with the heat transfer units 82 . in addition , when the heat transfer units 150 , 160 are mounted on the tubes 64 , the outer surfaces of the heat transfer units 150 , 160 preferably are in thermal contact with , directly or indirectly , the outer surfaces of the heat transfer units 150 , 160 of one or more adjacent tubes 64 . fig9 shows an embodiment of a portion of a tube bundle 170 of a shell - and - tube heat exchanger with a plurality of tubes 172 similar in function to the tubes 64 . a plurality of identical foam heat transfer units 174 are illustrated as being engaged with the tubes 172 and spaced along the length of the tubes . the heat transfer units 174 have bodies that are constructed as cradles or frames so that each heat transfer unit 174 is configured to engage with a plurality of the tubes 172 . in particular , the body of each heat transfer unit 174 is formed with a pair of outer tube contact surfaces 176 a , 176 b and three inner tube contact surfaces 178 a , 178 b , 178 c . however , the heat transfer units 174 can be configured to engage with more or less tubes as well . each heat transfer unit 174 also includes generally planar end surfaces that form heat transfer surfaces extending substantially radially from the outer surface of the tubes . fig9 shows a first set of the heat transfer units on one side of the tubes 172 with the outer contact surfaces 176 a , 176 b facing upward , and a second set of the heat transfer units on the opposite side of the tubes 172 with the outer contact surfaces 176 a , 176 b facing downward . the first set of heat transfer units is axially or longitudinally offset from the heat transfer units of the second set . in the embodiment illustrated in fig9 , seven tubes 172 can be engaged with the heat transfer units 174 , including two tubes engaged with the tube contact surfaces 176 a , 176 b of the upper set , two tubes engaged with the tube contact surfaces 176 a , 176 b of the lower set , and three tubes engaged with the inner tube contact surfaces 178 a , 178 b , 178 c of the upper and lower set . it is to be realized that the heat transfer units 174 can be configured to engage with a larger or smaller number of tubes . depending upon the layout of the heat transfer units 174 , the heat transfer units can create offsets , spirals or other flow patterns , in either counter , co - current or cross - flow arrangements . fig1 a - f illustrate examples of patterns formed by different configurations of the foam heat transfer units 174 from fig9 . for example , as shown in fig1 a , the heat transfer units can be arranged into a baffled “ offset ” configuration . fig1 b shows the heat transfer units arranged disposed in an offset configuration . when viewed from the top , each of the heat transfer units may have the shape of , but not limited to , square , rectangular , circular , elliptical , triangular , diamond , or any combination thereof . fig1 c shows the heat transfer units arranged into a triangular - wave configuration . other types of wave configurations , such as for example , square waves , sinusoidal waves , sawtooth waves , and / or combinations thereof are also possible . fig1 d shows the heat transfer units arranged into an offset chevron configuration . fig1 e shows the heat transfer units arranged into a large helical spiral . fig1 f shows the heat transfer units arranged into a wavy arrangement or individual helical spirals . fig1 a shows another embodiment of a tube bundle that has a plurality of tubes 190 arranged with an equilateral triangular pitch ( i . e . the space between the tubes is generally an equilateral triangle ). fig1 b shows tubes 190 of a tube bundle arranged with a square pitch , while fig1 c shows tubes 190 of a tube bundle arranged with a staggered square pitch . in fig1 a - c , foam heat transfer units 192 are shaped to fit in the pitch space between the tubes . for example , as shown in fig1 a , foam heat transfer units 192 are disposed between the tubes 190 and have surfaces that are in thermal contact with the tubes . each of the heat transfer units 192 comprises a generally triangular body , that can be radiused to the curvature of the tubes , with a generally triangular cross - section , and with the three surfaces of the triangular body in thermal contact with , directly or indirectly , three separate tubes 190 . the heat transfer units 192 may be arranged as required for heat transfer efficiency and / or providing directional flow of the fluid outside the tubes 190 . for example , the heat transfer units 192 can be arranged in any configuration to mimic a helix , multiple helix , offset baffle , offset blocks , or other patterns as shown in fig1 a - f . a person of ordinary skill in the art would realize that the tubes can be arranged with other pitch shapes between the tubes , and that the foam heat transfer units can have other corresponding shapes as well . with reference to fig1 and 12 , another embodiment of a shell - and - tube heat exchanger 200 is illustrated that employs a tube bundle that includes twisted tubes 202 together with a foam heat transfer unit 204 . this embodiment has a number of advantages , including strengthening the tube core , eliminating the need for baffles , minimizing vibrations , and enhancing heat transfer on both the tube side ( i . e . on the helical tubes ) and on the shell side ( the foam heat transfer unit ). the heat exchanger 200 includes a shell 206 that has axial inlets and outlets at each end for a first fluid to flow into and out of the tubes 202 . tubes sheets , similar to the tube sheets 68 , 72 would be provided at each end of the tube bundle , would be attached to each tube 202 , and would fit within and close off the ends of the shell 206 . the shell also includes a radial inlet 208 and a radial outlet 210 for a second fluid . in this embodiment , the tubes 202 are twisted helically around the foam heat transfer unit 204 along the length of the heat transfer unit 204 . the heat transfer unit 204 comprises a central , solid body of foam such that at any cross - section of the tube bundle , the foam body forms a heat transfer surface extending substantially radially from the outer surface of the tube ( s ). in fig1 , the heat transfer unit 204 is represented by the dashed line extending the length of the shell 206 . the dashed line is not intended to imply that the heat transfer unit 204 is broken into sections or is discontinuous ( although it is possible that the heat transfer unit 204 could be broken into separate section or made discontinuous if desired ). the helical arrangement of tubes 202 enhances heat flow between the fluid flowing in the tubes and the fluid flowing in the shell outside of the tubes , by breaking up boundary layers inside and / or outside the tubes and combining axial and radial flow of the fluid along and around the outer surface of the tubes . in addition , the use of a baffle can be eliminated if desired . further , the tubes 202 could be twisted about their own axes as well . although fig1 and 12 show six tubes 202 , a smaller or larger number of tubes can be used . for example , as discussed further below with respect to fig1 - 15 , three tubes can be helically wound around a central , solid heat transfer unit . fig1 is a cross - sectional view of another embodiment of a tube bundle that contains many axial tubes 222 disposed in a shell 224 . two different implementations of the twisted or helical tube concept are illustrated . the triangle 226 in fig1 illustrates three tubes 228 helically twisted about a central , solid body foam heat transfer unit 230 . this is illustrated more fully in fig1 which additionally shows an optional sleeve 232 disposed around the assembly formed by the tubes 228 and the heat transfer unit 230 to form a tube - within - a - tube construction . the heat transfer unit 230 comprises a central , solid body of foam such that at any cross - section , the foam body forms a heat transfer surface extending substantially radially from the outer surface of the tube ( s ). in fig1 , the heat transfer unit 230 is represented by the dashed line extending the length of the sleeve 232 . the dashed line is not intended to imply that the heat transfer unit 230 is broken into sections or is discontinuous ( although it is possible that the heat transfer unit 230 could be broken into separate section or made discontinuous if desired ). returning to fig1 , a hexagonal arrangement 240 of the twisted tube concept is illustrated and shown more fully in fig1 . in the hexagonal arrangement 240 , a tube within a tube concept is provided similar to the single arrangement shown in fig1 , wherein a hexagonal pattern of six tubes - within - tubes assemblies 242 are used . each assembly 242 includes a plurality of tubes 244 , for example three tubes , helically twisted about a central , solid body foam heat transfer unit 246 , with the tubes 244 and the heat transfer unit 246 disposed within a larger fluid carrying tube 248 . so the first fluid flows within the tubes 244 as well as within the tubes 248 in contact with the outside surfaces of the tubes 244 . this twisted tube concept can be used by itself or in combination with any of the embodiments previously described herein . for example , fig9 shows an arrangement similar to fig1 , with a plurality of the tubes 228 twisted helically around the heat transfer unit 230 , and the tubes 228 and unit 230 disposed inside one of the tubes 172 to function together with the heat transfer units 174 at increasing the effectiveness of the heat exchanger . the heat transfer units 204 , 230 have been described above as being solid bodies . however , the heat transfer units 204 , 230 need not be solid . instead , the heat transfer units 204 , 230 can function as fluid carrying fluid distribution tubes which would be useful for creating a baffle - less design in a spray evaporator . for example , with reference to fig1 , the heat transfer unit 204 can carry a fluid and be configured to spray the fluid outward as shown by the arrows onto the surfaces of the tubes 202 . the sprayed fluid exchanges heat with the tube surfaces , causing some or all of the sprayed fluid to change phase into a vapor . likewise , as illustrated by the arrows in fig1 and 14 , the heat transfer unit 230 can be configured to spray fluid outward onto the tubes . one can also alternate foam and spray tubes too in various configurations . fig1 illustrates another embodiment of a shell - and - tube heat exchanger that uses rectangular blocks of foam heat transfer units 300 that are in thermal contact with , directly or indirectly , a plurality of axial tubes 302 . the blocks would extend some or all of the axial length of the tubes 302 . the blocks form a staggered diagonal baffle arrangement which is useful in applications where the second fluid flows in a cross - flow direction relative to the flow of the first fluid through the tubes 302 . however , other heat transfer unit configurations and arrangements , as well as other flow patterns , are possible . all of the shell - and - tube heat exchangers described herein operate as follows . a first fluid is introduced into one axial end of the tubes of the tube bundles , with the fluid flowing through the tubes to an outlet end where the first fluid exits the heat exchanger . the tubes can be single pass or multi - pass . simultaneously , a second fluid is introduced into the shell . the second fluid can flow counter to the first fluid , in the same direction as the first fluid , or in a cross - flow direction relative to the flow direction of the first fluid . as the second fluid flows through the shell , it contacts the outer surfaces of the tubes and / or the surfaces of the heat transfer units . because the first fluid flows within the tubes , separated from the second fluid , heat is exchanged between the first and second fluids . depending upon the application , the first fluid can be at a higher temperature than the second fluid , in which case heat is transferred from the first fluid to the second fluid via the tubes and the heat transfer units . alternatively , the second fluid can be at a higher temperature than the first fluid , in which case heat is transferred from the second fluid to the first fluid via the tubes and the heat transfer units . the first and second fluids can be either liquids , gases / vapor or a binary mixture thereof . one example of a first fluid is water , such as sea water , and one example of a second fluid is ammonia in liquid or vapor form , which can be used in an ocean thermal energy conversion system . the examples disclosed in this application are to be considered in all respects as illustrative and not limitative . the scope of the invention is indicated by the appended claims rather than by the foregoing description ; and all changes which come within the meaning and range of equivalency of the claims are intended to be embraced therein . | 5 |
with reference to fig1 , the knotting element and suture anchor applicator device disclosed herein generally includes a proximal handle 500 that provides a surgeon with means to manipulate the endoscopic portion of the device at the site of repair ; a flexible shaft 510 that includes multiple actuators that provide means for communicating such manipulation to the endoscopic portion of the device ; and a distal tip 520 that carries suture anchors , knotting elements , and the like to the site of repair . flexible shaft 510 may be adapted for insertion into the working channel of a flexible endoscope ( not shown ) such as a gastroscope or a colonoscope by being flexible , having an outer diameter in a range of about 2 . 0 to about 3 . 8 millimeters , and having a length of approximately 1 . 5 meters . distal tip 520 may be similarly adapted for insertion into the working channel of a flexible endoscope by having a maximum outer diameter in a range of about 2 . 0 to about 3 . 8 millimeters . the reader will appreciate that devices having various diameters and / or lengths may be inserted through other endoscopic instruments , such as laparoscopes , depending on the requirements of the surgical procedure to be performed . with reference to fig2 and 3 , in one aspect of the device the distal tip 520 of the knotting element and suture anchor applicator device may include a cannulated needle 530 , an anchor deployment actuator 540 , a knotting element deployment actuator 550 , a first knotting element portion 560 , and a second knotting element portion 570 . cannulated needle 530 may be manufactured from 19 gage stainless steel hypodermic tubing having an outer diameter of approximately 0 . 043 inches ( 1 . 09 millimeters ) and a wall thickness of approximately 0 . 003 inches ( 0 . 076 millimeters ). the hypodermic tubing may extend through flexible shaft 510 to proximal handle 500 , or alternately may be joined to a second length of metal or extruded plastic polymer tubing extending through flexile shaft 510 to proximal handle 500 . cannulated needle 530 may be joined to such a second length of tubing by welding , gluing , or other methods known in the art . the distal end of cannulated needle 530 may optionally be ground to form a penetrating tip . cannulated needle 530 may include a central channel 532 , one or more shear ports 534 , a suture slot 536 extending proximally from the distal end of the needle , and a detent 538 . central channel 532 is open to the environment at the distal end of cannulated needle 530 and may extend proximally to handle 500 . shear ports 534 in cannulated needle 530 may be disposed around a portion of the needle to provide a means for attaching first knotting element portion 560 to the needle . suture slot 536 may be provided as a means for routing sutures 582 extending from suture anchors 580 out of central channel 532 and away from the distal tip of cannulated needle 530 . such routing may advantageously reduce interference between cannulated needle 530 , suture 582 , and suture anchor 580 during the deployment of an anchor , and may advantageously reduce the potential for the distal tip of the needle to sever sutures 582 that would otherwise be routed around that tip . optionally , the edges of suture slot 536 may be coated with a protective material 539 such as an epoxy resin or a plastic polymer to reduce any potential for the edges of suture slot 536 to sever a suture 582 during operation of the device . detent 538 may be disposed around a portion of cannulated needle 530 to provide a means for attaching and retaining second knotting element portion 570 . detent 538 may be formed as an integral portion of cannulated needle 530 , or alternately may be an annular ring of material affixed to the needle by gluing , welding , or other methods known in the art . suture anchors 580 may be loaded into central channel 532 and each associated suture 582 may be routed to pass through first knotting element portion 560 and extend outward from second knotting element portion 570 at a location between first knotting element portion 560 and second knotting element portion 570 . if cannulated needle 530 includes a suture slot , sutures 582 may additionally be routed to pass through suture slot 536 between first knotting element portion 560 and second knotting element portion 570 and extend outward from second knotting element portion 570 . the remainder of each suture 582 may extend alongside knotting element actuator 550 and flexible shaft 510 within the working channel of the endoscope , exiting the instrument adjacent to the proximal handle 500 of the knotting element and suture anchor applicator device . anchor deployment actuator 540 may be manufactured from 19 gage stainless steel wire having an outer diameter of approximately 0 . 036 inches ( 0 . 912 millimeters ). the actuator 540 may slide within central channel 532 , and may extend from approximately the distal end of cannulated needle 530 , through central channel 532 and flexible shaft 510 , to proximal handle 500 . the actuator 540 should have a length sufficient to permit suture anchors 580 to be fully ejected from cannulated needle 530 during a surgical procedure . the actuator 540 may be advanced within central channel 532 in a stepwise manner through the manipulation of a plunger or trigger control on proximal handle 500 , or by other control means known in the art . as anchor deployment actuator 540 is advanced , the distal end of the actuator abuts a suture anchor 580 , and sufficient advancement will cause the most distally disposed anchor 580 within cannulated needle 530 to be ejected from central channel 532 . knotting element deployment actuator 550 may be manufactured from a helically wound stainless steel wire or other suitable materials known in the art . the actuator 550 may slide over cannulated needle 530 , and may extend from distal tip 520 , abutting second knotting element portion 570 , to proximal handle 500 . the knotting element deployment actuator 550 , anchor deployment actuator 540 , and cannulated needle 530 may be held in a coaxial relationship along flexible shaft 510 between distal tip 520 and proximal handle 500 . the actuator 550 should have a length sufficient to permit first knotting element portion 560 and second knotting element portion 570 to be deployed off the distal end of cannulated needle 530 at the completion of a knotting step in a surgical procedure . the actuator 550 may be advanced over cannulated needle 530 through the manipulation of a control on proximal handle 500 such as a slider or a ratcheting trigger , or by other control means known in the art . with reference to fig3 and 4 , first knotting element portion 560 may be configured as a partially hollow cylinder having an outer wall 562 and one or more shear posts 564 which may extend inward from outer wall 562 to engage with shear ports 534 of cannulated needle 530 . first knotting element portion 560 may provide an interior suture path 566 which contributes to a knotting action described later . first knotting element portion 560 may be constructed from various plastic polymers approved for medical use . the width and number of shear posts 564 may be varied along with other factors , such as the elasticity of the material used to construct the element , to vary the shear force necessary to overcome the engagement of shear posts 564 with shear ports 534 . the reader will appreciate that the configuration of this element as a partially hollow cylinder is merely a matter of convenience , and that a variety of shapes may be adapted to define an interior suture path 566 and achieve similar functional results . second knotting element portion 570 may also be configured as a generally hollow cylinder having an outer wall 572 and one or more retention posts 574 which may extend inward and engage with detent 538 of cannulated needle 530 . optionally , a single retention post 574 may extend inward from the periphery of outer wall 572 towards cannulated needle 530 , forming a retention post similar in structure to a proximal wall . second knotting element portion 570 may be constructed from various plastic polymers approved for medical use . the width and number of retention posts may be varied along with other factors , such as the degree to which detent 538 projects outward from cannulated needle 530 and the elasticity of the material used to construct the element , to vary the force necessary to overcome the engagement of retention posts 574 with detent 538 . the reader will appreciate that the configuration of this element as a generally hollow cylinder is again merely a matter of convenience , and that a variety of shapes may be selected to complement the shape of first knotting element portion 560 and achieve similar functional results . typically , outer wall 572 of second knotting element portion 570 has an inner diameter approximately equal to the outer diameter of outer wall 562 of first knotting element portion 560 with the addition of a gap , d . preferably , outer wall 572 has an inner diameter in the range of about the outer diameter of outer wall 562 to about the sum of the outer diameter of outer wall 562 and the diameter of a suture line . the knotting element may be engaged by slidingly joining first knotting element portion 560 and second knotting element portion 570 , such that first knotting element portion 560 nests within second knotting element portion 570 , leaving a suture gap 576 having a width approximately equal to gap d defined between the outer surface of outer wall 562 of first knotting element portion 560 and the inner surface of outer wall 572 of second knotting element portion 570 . sutures 582 extending through interior suture path 566 of first knotting element portion 560 are bent by the joining of the knotting element portions to conform to an “ s ”- shaped path that runs through interior suture path 566 , around the proximal end of first knotting element portion 560 , through suture gap 576 , around the distal end of second knotting element portion 570 , and along flexible shaft 510 towards proximal handle 500 . sutures 582 are retained or “ knotted ” within the joined knotting element portions by frictional engagement with the outer surface of outer wall 562 of first knotting element portion 560 and the inner surface of outer wall 572 of second knotting element portion 570 , and optionally by engagement between the proximal end of first knotting element portion 560 and the distal surface of retention posts 574 . similarly , first knotting element portion 560 and second knotting element portion 570 are retained in a joined relation by frictional engagement with each other and sutures 582 . optionally , the outer surface of outer wall 562 of first knotting element portion 560 and the inner surface of outer wall 572 of second knotting element portion 570 may be textured , coated , or otherwise modified to increase the apparent coefficient of friction between the two surfaces , and between the surfaces and sutures 582 . a plurality of suture anchors 580 may be loaded into central channel 532 of cannulated needle 530 . with reference to fig5 , such suture anchors may include conventional t - tags having a hollow cylindrical body 584 including a longitudinal slot 586 extending along approximately one half of the length of the body . suture 582 may be attached to suture anchor 580 by passing the suture through body 584 and forming a knot 588 in suture 582 larger than the diameter of body 584 , or alternately by crimping , gluing , or otherwise affixing suture 582 within body 584 adjacent to slot 586 . the reader will appreciate that a variety of different suture anchors may be deployed from the knotting element and suture anchor applicator device disclosed herein , including but not limited to the expandable suture anchors disclosed in my copending application , u . s . patent application ser . no . 11 / 274 , 358 , entitled “ expandable suture anchor ” and filed on nov . 15 , 2005 , the entire contents of which are incorporated herein by reference . with reference to fig6 and 7 , in an additional aspect of the device the distal tip 520 of the knotting element and suture anchor applicator device may include a cannulated needle 630 , an anchor deployment actuator 640 , a knotting element deployment actuator 650 , a first knotting element portion 660 , and a second knotting element portion 670 . cannulated needle 630 may be manufactured from 19 gage stainless steel hypodermic tubing having an outer diameter of approximately 0 . 043 inches ( 1 . 09 millimeters ) and a wall thickness of approximately 0 . 003 inches ( 0 . 076 millimeters ). the hypodermic tubing may extend through flexible shaft 510 to proximal handle 500 , or alternately may be joined to a second length of metal or extruded plastic polymer tubing extending through flexile shaft 510 to proximal handle 500 . cannulated needle 630 may be joined to such a second length of tubing by welding , gluing , or other methods known in the art . the distal end of cannulated needle 630 may optionally be ground to form a penetrating tip . cannulated needle 630 may include a central channel 632 and a suture slot 636 extending proximally from the distal end of the needle . central channel 632 is open to the environment at the distal end of cannulated needle 630 and may extend proximally to handle 500 . suture slot 636 may be provided as a means for routing sutures 582 extending from suture anchors 580 out of central channel 632 and away from the distal tip of cannulated needle 630 . such routing may advantageously reduce interference between cannulated needle 630 , suture 582 , and suture anchor 580 during the deployment of an anchor , and may advantageously reduce the potential for the distal tip of the needle to sever sutures 582 that would otherwise be routed around that tip . optionally , the edges of suture slot 636 may be coated with a protective material 639 such as an epoxy resin or a plastic polymer to reduce any potential for the edges of suture slot 536 to sever a suture 582 during operation of the device . suture anchors 580 may be loaded into central channel 632 and each associated suture 582 may be routed to pass through first knotting element portion 660 and extend outward from second knotting element portion 670 at a location between first knotting element portion 660 and second knotting element portion 670 . if cannulated needle 630 includes a suture slot , sutures 582 may additionally be routed to pass through suture slot 636 between first knotting element portion 660 and second knotting element portion 670 and extend outward from second knotting element portion 670 . the remainder of each suture 582 may extend alongside knotting element actuator 650 and flexible shaft 510 within the working channel of the endoscope , exiting the instrument adjacent to the proximal handle 500 of the knotting element and suture anchor applicator device . anchor deployment actuator 640 may be manufactured from 19 gage stainless steel wire having an outer diameter of approximately 0 . 036 inches ( 0 . 912 millimeters ). the actuator 640 may slide within central channel 632 , and may extend from approximately the distal end of cannulated needle 630 , through central channel 632 and flexible shaft 510 , to proximal handle 500 . the actuator 640 should have a length sufficient to permit suture anchors 580 to be fully ejected from cannulated needle 630 during a surgical procedure . the actuator 640 may be advanced within central channel 632 in a stepwise manner through the manipulation of a plunger or trigger control on proximal handle 500 , or by other control means known in the art . as anchor deployment actuator 640 is advanced , the distal end of the actuator abuts a suture anchor 580 , and sufficient advancement will cause the most distally disposed anchor 580 within cannulated needle 630 to be ejected from central channel 632 . knotting element deployment actuator 650 may be manufactured from a helically wound stainless steel wire or other suitable materials known in the art . the actuator 650 may slide over cannulated needle 630 , and may extend from distal tip 520 , abutting second knotting element portion 670 , to proximal handle 500 . the knotting element deployment actuator 650 , anchor deployment actuator 640 , and cannulated needle 630 may be held in a coaxial relationship along flexible shaft 510 between distal tip 520 and proximal handle 500 . the actuator 650 should have a length sufficient to permit first knotting element portion 660 and second knotting element portion 670 to be deployed off the distal end of cannulated needle 630 at the completion of a knotting step in a surgical procedure . the actuator 650 may be advanced over cannulated needle 630 through the manipulation of a control on proximal handle 500 such as a slider or a ratcheting trigger , or by other control means known in the art . with reference to fig3 and 4 , first knotting element portion 660 may be configured as a partially hollow cylinder having an outer wall 662 and one or more retention posts 664 which may extend inward from outer wall 662 to abut cannulated needle 630 . first knotting element portion 660 may be engaged with cannulated needle 630 by affixing one or more retention posts 664 to cannulated needle 630 at the point where the posts abut the needle with a frangible layer of adhesive 634 . first knotting element portion 660 may provide an interior suture path 666 which contributes to a knotting action described later . first knotting element portion 660 may be constructed from various plastic polymers approved for medical use . the width and number of retention posts 664 may be varied along with other factors , such as the strength of the frangible adhesive 634 binding the posts to cannulated needle 630 , to vary the shear force necessary to overcome the engagement of retention posts 664 and cannulated needle 630 . the reader will appreciate that the configuration of this element as a partially hollow cylinder is merely a matter of convenience , and that a variety of shapes may be adapted to define an interior suture path 666 and achieve similar functional results . second knotting element portion 670 may also be configured as a generally hollow cylinder having an outer wall 672 and one or more retention posts 674 which may extend inward and abut cannulated needle 630 . optionally , a single retention post 674 may extend inward from the periphery of outer wall 672 towards cannulated needle 630 , forming a retention post similar in structure to a proximal wall . second knotting element portion 670 may be engaged with cannulated needle 630 by affixing one or more retention posts 674 to cannulated needle 630 at the point where the posts abut the needle with a frangible layer of adhesive 638 . second knotting element portion 670 may be constructed from various plastic polymers approved for medical use . the width and number of retention posts 674 may be varied along with other factors , such as the strength of the frangible adhesive 638 binding the posts to cannulated needle 630 , to vary the force necessary to overcome the engagement of the retention posts 674 with cannulated needle 630 . the reader will appreciate that the configuration of this element as a generally hollow cylinder is again merely a matter of convenience , and that a variety of shapes may be selected to complement the shape of first knotting element portion 660 and achieve similar functional results . typically , outer wall 672 of second knotting element portion 670 has an inner diameter approximately equal to the outer diameter of outer wall 662 of first knotting element portion 660 with the addition of a gap , d . preferably , outer wall 672 has an inner diameter in the range of about the outer diameter of outer wall 662 to about the sum of the outer diameter of outer wall 662 and the diameter of a suture line . the knotting element may be engaged by slidingly joining first knotting element portion 660 and second knotting element portion 670 , such that first knotting element portion 660 nests within second knotting element portion 670 , leaving a suture gap 676 having a width approximately equal to gap d defined between the outer surface of outer wall 662 of first knotting element portion 660 and the inner surface of outer wall 672 of second knotting element portion 670 . sutures 582 extending through interior suture path 666 of first knotting element portion 660 are bent by the joining of the knotting element portions to conform to an “ s ”- shaped path that runs through interior suture path 666 , around the proximal end of first knotting element portion 660 , through suture gap 676 , around the distal end of second knotting element portion 670 , and along flexible shaft 510 towards proximal handle 500 . sutures 582 are retained or “ knotted ” within the joined knotting element portions by frictional engagement with the outer surface of outer wall 662 of first knotting element portion 660 and the inner surface of outer wall 672 of second knotting element portion 670 , and optionally by engagement between the proximal end of first knotting element portion 660 and the distal surface of retention posts 674 . similarly , first knotting element portion 660 and second knotting element portion 670 are retained in a joined relation by frictional engagement with each other and sutures 582 . optionally , the outer surface of outer wall 662 of first knotting element portion 660 and the inner surface of outer wall 672 of second knotting element portion 670 may be textured , coated , or otherwise modified to increase the apparent coefficient of friction between the two surfaces , and between the surfaces and sutures 582 . the knotting element and suture anchor applicator device disclosed herein may be used to endoscopically appose tissues in the following illustrative , but not limiting manner . a surgeon may guide an endoscopic instrument , such as a gastroscope and examination tube , through the gastrointestinal tract of a patient . the surgeon may then use the endoscopic instrument to survey the patent &# 39 ; s internal tissues , such as a stomach , and to visualize damaged tissue , such as an ulcerated region . to effect a repair , the surgeon may obtain a knotting element and suture anchor applicator loaded with a plurality of suture anchors 580 and associated sutures 582 , such as the t - tags described previously , and insert distal tip 520 and flexible shaft 510 of the device into the working channel of the instrument , guiding distal tip 520 to the site of repair . the surgeon may then manipulate distal tip 520 to cause cannulated needle 530 to penetrate the tissues adjacent to the damaged tissue , and manipulate suture anchor actuator 540 to deploy a first suture anchor 580 onto a distal surface of , or optionally within , a first portion of the tissue to be apposed . the surgeon may then manipulate distal tip 520 to cause cannulated needle 530 to penetrate other tissues adjacent to the damaged tissue , and manipulate suture anchor actuator 540 to deploy a second suture anchor 580 onto a distal surface of , or optionally within , a second portion of the tissue to be apposed without withdrawing distal tip 520 from the endoscopic instrument to swap in a second device or to reload a suture anchor 580 into cannulated needle 530 . thus , the surgeon may emplace a plurality of suture anchors 580 without withdrawing the device . preferably , the knotting element and suture anchor applicator is loaded with 2 , 3 , or 4 suture anchors 580 and associated sutures 582 . after deploying the last suture anchor 580 , the surgeon may manipulate the proximal ends of the sutures 582 to appose the tissues at the site of repair . when the tissues have been properly apposed , the surgeon may “ fire ” the knotting element by manipulating knotting element actuator 550 and applying force to second knotting element portion 570 , which is in engagement with cannulated needle 530 as described previously . if sufficient force is applied , retention posts 574 of second knotting element portion 570 may distort and become released from engagement with detent 538 of cannulated needle 530 , permitting second knotting element portion 570 to slide towards the distal end of the needle until it abuts first knotting element portion 560 , which is in engagement with cannulated needle 530 as described previously . the joining of first knotting element portion 560 and second knotting element portion 570 will “ knot ” sutures 582 as described previously . continued manipulation of knotting element actuator 550 will transmit force through second knotting element portion 570 to first knotting element portion 560 , transforming the applied force into a shear force acting across shear posts 564 . if sufficient force is transmitted , shear posts 564 may shear and become released from engagement with shear ports 534 of cannulated needle 530 , permitting first knotting element portion 560 and joined second knotting element portion 570 to slide towards the distal end of the needle until the joined knotting element portions are deployed off the distal end of cannulated needle 530 . the surgeon may withdraw distal tip 520 and flexible shaft 510 from the endoscopic instrument to clear the working channel of the instrument in preparation for additional procedures or in preparation for the withdrawal of the instrument . although various aspects of the disclosed device have been shown and described herein , modifications may occur to those skilled in the art upon reading this specification . the present application includes such modifications as are within the spirit of the invention , and is to be limited only by the scope of the appended claims . | 0 |
the present invention provides the capability to capture and store data object definitions in a database in a less costly and less time - consuming manner than previous techniques . using the present invention , after an initial set of metadata definitions has been captured , only those definitions that have changed since the last time the definitions were captured are again captured and stored . the present invention provides a way to store only changed definitions , which allows efficient retrieval of the complete set of definitions as they existed at each point of capture , and algorithms for efficiently determining which definitions have changed since the last point of capture . this present invention provides an efficient technique for capturing and storing the definitions of a set of data items , then repeating the process later to create a new set of definitions , and so on . the technique provides advantages in both execution time and storage space over the obvious approach of capturing and storing all the definitions , each time . an example of a system 100 in which the present invention may be implemented is shown in fig1 . system 100 includes one or more data items 102 , characteristics 104 , delta values 106 , and baselines 108 . a data item 102 is a collection of related information stored in a computer . the individual pieces of information are the data item &# 39 ; s characteristics 104 . these characteristics may change over time . data items may be created and destroyed over time . for example , the definition of a metadata object such as a table or index is a data item . its characteristics may include its name , owner , columns , constraints and so on . key characteristics are a subset of a data item &# 39 ; s characteristics that uniquely identify this data item among all others . for a given data item , the values of the key characteristics may not change during its lifetime . ( if the value of a key characteristic does change , this is equivalent to destroying the data item and creating a new data item identified by the new key characteristic values .) it must be possible to efficiently and unambiguously sort a collection of data items based on their key values . for example , key characteristics may include a metadata object &# 39 ; s type , owner , and name , such as table scott . tiger or user scott . a delta value 106 is a single , easily obtained value that is uniquely associated with a particular set of data item characteristic values . for a given data item , the delta value 106 is guaranteed to change each time one or more characteristic values changes . ( if the set of characteristic values later returns to a previous configuration , the delta value 106 may or may not be the same as its previous value ; the technique works in either case .) for example , a delta value 106 may be formed using a last - ddl timestamp indicating the last time that a metadata object &# 39 ; s definition was modified , or a hash key calculated from the object &# 39 ; s definition . a last - ddl timestamp distinguishes one version of a data item from other versions of the same data item that were modified at an earlier or later time . other data items may have the same last - ddl timestamp . a hash key delta value , on the other hand , is uniquely associated with a single version of a single data item . a baseline 108 is specification for capturing data items from a computer , including a source 110 of data items , such as a database , and a filter 112 , which data item key values must pass in order to be included . for example , the filter 112 may specify inclusion of indexes and tables owned by user scott . a baseline &# 39 ; s source 110 and filter 112 may not be changed after the baseline 108 has been created . a baseline may also contain zero or more baseline versions 114 that have been captured using the specification . it is to be noted that the filter part 112 of the specification is optional ( that is , not a necessary component of the technique ). a baseline may capture all data items that are available from the source . a baseline version 114 is a set of data items captured at a point in time . the baseline version 114 includes those data items that were present in the source , and that passed the filter , at the time of capture . the baseline version 114 preserves the characteristics of each data item as they existed at the time of capture . a baseline version 114 has a version number that distinguishes it from other versions of the same baseline . once captured , a baseline version 114 may be deleted , but it may not be modified . a data item version includes the values of a data item &# 39 ; s characteristics at a particular point in time . a data item version may appear in one or more consecutive baseline versions ; this indicates that the data item &# 39 ; s characteristics have not changed during the time those baseline versions were captured . capture process 116 creates a baseline version 114 by determining which data items currently pass the filter , and storing the identities and characteristics of those data items . in the prior art , each baseline version physically contains all the data items that match the filter at the time of capture . it may take a great deal of time and space to store all the data items . the present invention , however , takes advantage of the likelihood that , from one baseline version to the next , only a small percentage of the data items will change ( or be created , or be deleted ). the present invention captures and stores only those data items that have changed since the last baseline version . this is invisible to the user . each baseline version appears to be complete . the technique described here makes this possible . a versioning scheme . the versioning scheme allows a single data item definition to appear in more than one baseline version . for example , if a data item is first seen in baseline version 2 , is unchanged through versions 3 and 4 , then changes before version 5 is captured , the definition captured with version 2 also appears in versions 3 and 4 . the versioning scheme permits efficient retrieval of all the data items included in a particular baseline version . capture algorithms . the capture algorithms use the delta value associated with each data item to quickly determine if a data item has changed since the last baseline version . for baseline versions after the first , the capture algorithm stores only those data items that have changed , or have been added , since the last baseline version . if a data item has been deleted since the last baseline version , the capture algorithm does not include it in the current version . data items that have not changed since the previous version are not stored , and are allowed to appear in the current version . the versioning scheme has two main components , storage and operations . regarding the storage component , each captured data item definition is stored in one or more database tables . there is one table in particular ( the “ data item versions table ”) that contains a single row for each data item definition . an example of such a table is shown in fig2 . this table preferably contains at least the following columns : a column containing an identifier used to group all data items that belong to a particular baseline . one or more columns that contain the data item &# 39 ; s key characteristics values . one column that contains the delta value for this version of the data item . a numeric column , first_version , which identifies the first baseline version in which a data item version appears . a numeric column , last_version , which identifies the last baseline version in which a data item version appears . this column contains an arbitrarily high value ( e . g ., 99999 ) if the data item version appears in the most recent baseline version . one or more additional columns may be used to store the data item &# 39 ; s remaining ( non - key ) characteristics , or these characteristics may be stored in other tables that are linked to the data item versions table by some means . an example of a data item versions table 200 after the initial capture ( baseline ) is shown in fig2 . in this example , the baseline selects tables in schema scott . in this example , table 200 includes columns such as type column 202 , indicating the type of the object included in the baseline , schema column 204 , indicating the schema of the object , name column 206 , indicating the name of the object , first capture version column 208 , indicating the version number of the capture in which the item first appears , and last capture version column 210 , indicating the version number of the capture in which the item last appears . columns 202 , 204 , and 206 together contain the data item &# 39 ; s key characteristics . table 200 is a baseline , so all items present in the baseline at this point first appeared in capture version 1 . in the example shown in fig3 , table salgrade has been added to the schema scott , and capture version 2 is captured . table 300 includes the entries from table 200 , plus the entry for table salgrade , which first appeared in capture version 2 . in the example shown in fig4 , table emp has been modified , and capture version 3 is captured as shown in table 400 . the original version of table emp first appeared in capture version 1 and last appeared in capture version 2 , while the modified version of table emp first appeared in capture version 3 . in the example shown in fig5 , table dept is dropped , and version 4 is captured as shown in table 500 . table dept now has a last version of capture version 3 . regarding the operations component of the versioning scheme , how fundamental operations are carried out on the data item versions table is described below . add a new data item version to a baseline version : while capturing a new version n of baseline b , it is determined that a data item with key characteristic values ( k1 = x , k2 = y ) has been added since the last baseline version . add a row to the data item versions table with values : baseline identifier column : baseline id b key characteristic columns : k1 = x , k2 = y delta value column : delta value for this data item version first_version : n last_version : 99999 store the data item &# 39 ; s characteristics in additional data item versions table columns or in other tables , as appropriate . remove a data item version from a baseline version : while capturing a new version n of baseline version b , it is determined that a data item with key characteristic values ( k1 = q , k2 = r ) has been deleted since the last baseline version . determine the number of the previous version ( before n ) pv . find a row in the data item versions table having values : baseline identifier column : baseline id b key characteristic columns : k1 = q , k2 = r last_version : 99999 update a data item version in a baseline version : while capturing a new version n of baseline version b , it is determined that a data item with key characteristic values ( k1 = s , k2 = t ) has changed since the last baseline version . carry out the “ remove a data item version ” operation , followed by the “ add a data item version ” operation , for data item ( k1 = s , k2 = t ). retrieve data items that constitute a baseline version : to retrieve all the data items that constitute version n of baseline b , find the data item versions table rows that meet the following criteria : baseline identifier column : baseline id b first_version : & lt ;= n last_version : & gt ;= n retrieve all versions of a data item : to retrieve all the versions from baseline b of a data item with key characteristic values ( k1 = x , k2 = y ), find the data item versions table rows that meet the following criteria : baseline identifier column : baseline id b key characteristic columns : k1 = x , k2 = y an example of an initial ( first version ) capture process 600 is shown in fig6 . in order to capture version 1 ( the first version ) of baseline b , the process begins with step 602 , in which a list of the data items meeting the baseline specification is obtained . the list need not be sorted . each entry in the list includes at least the following information : a ) the key characteristic values for the data item b ) the delta value for the data item &# 39 ; s current set of characteristics in step 604 , for each entry in the list , carry out the “ add a data item to a baseline version ” operation described above . after the initial ( baseline ) capture , the state of the database configuration may be recaptured as desired — periodically , based on the occurrence or non - occurrence of some event , or at will . there are two different techniques that may used to perform the recapture process . depending on the types of objects included in the baseline , either or both may be used during recapture : the “ lockstep technique ” is used when an ordered list of data items with their delta values can efficiently be obtained from the baseline source . the “ hash table technique ” is used when an ordered list of data items with their delta values cannot efficiently be obtained from the baseline source , but an unordered list can be . an example of a process 700 for performing the lockstep recapture technique is shown in fig7 . process 700 captures a version n ( where n & gt ; 1 ) of baseline b . process 700 begins with step 702 , in which a list ( the “ source list ”) of the data items in the baseline source that meet the baseline specification is obtained . each entry in the list includes at least the following information : the key characteristic values for the data item the delta value for the data item &# 39 ; s current set of characteristics in step 704 , a list ( the “ baseline list ”) of the data items in the baseline version preceding version n , is obtained using the technique described in “ retrieve data items that constitute a baseline version ” above . each entry in the list includes the following information : the key characteristic values for the data item as stored in the first version the stored delta value for the data item &# 39 ; s set of characteristics at the time the first version was captured in step 706 , the two lists are compared as follows : in step 708 , it is determined whether the data item is present in the source list but not the baseline list . if so , the process continues with step 710 , in which the “ add a new data item version to a baseline version ” operation is performed . the process then continues with step 712 , in which the process advances the source list to the next data item , then loops back to repeat step 706 for the next data item . if the condition in step 708 is not met , then the process continues with step 714 , in which it is determined whether the data item is present in the baseline list but not the source list . if so , the process continues with step 716 , in which the “ remove a data item from a baseline version ” operation is performed . the process then continues with step 712 , in which the process advances the baseline list to the next data item , then loops back to repeat step 706 for the next data item . if the condition in step 714 is not met , then the data item is present in both the baseline list and the source list . the process continues with step 720 , in which it is determined whether the delta values from the baseline data item and the source data items are not equal . if it is the case that the delta values are not equal , then the process continues with step 722 , in which the “ update a data item version in a baseline version ” operation is performed . the process then continues with step 712 , in which the process advances both the source and baseline lists to their next data items , then loops back to repeat step 706 for the next data item . if the condition in step 720 is not met , the process then continues with step 712 , in which the process advances both the source and baseline lists to their next data items , then loops back to repeat step 706 for the next data item . an example of a process 800 for performing the hash table recapture technique is shown in fig8 . process 800 captures version n ( where n & gt ; 1 ) of baseline b . process 800 begins with step 802 , in which a list ( the “ source list ”) of the data items in the baseline source that meet the baseline specification is obtained . each entry in the list includes at least the following information : the key characteristic values for the data item the delta value for the data item &# 39 ; s current set of characteristics in step 804 , a list ( the “ baseline list ”) of the data items in the baseline version preceding version n , is obtained using the technique described in “ retrieve data items that constitute a baseline version ” above . each entry in the list includes the following information : the stored delta value for the data item &# 39 ; s current set of characteristics in step 806 , each delta value included the baseline list is stored , preferably in an in - memory data structure ( such as a hash table ) that permits efficient access to an object by specifying a key value . it is only necessary to insert the delta value in the data structure , using the delta value as the key value . in step 807 , it is determined if there are more entries in the source list . if so , the process continues with step 808 , in which the process attempts to find the entry &# 39 ; s delta value in the data structure created in 806 . in step 810 , it is determined , based on the attempt to find the entry &# 39 ; s delta value in the data structure in step 808 , whether the delta value is present in the data structure . if so , this means that the current version of the data item is already present in the previous baseline version and the process continues with step 812 , in which the delta value is removed from the data structure , so that the data item version will not be removed from the baseline in a later step . the process then returns to step 807 to determine if there are more entries in the source list . if , in step 810 , it is determined that the delta value is not present in the data structure , then the process continues with step 814 , in which it is determined whether the data item corresponding to that delta value entry is present in the previous baseline version . if the data item is present in the previous baseline version , then the process continues with step 816 , in which it is determined whether the data item has been modified in the baseline source , in which case , the “ update a data item version in a baseline version ” operation is performed . the process then returns to step 807 to determine if there are more entries in the source list . if , in step 814 , it is determined that the data item is not present in the previous baseline version , the process continues with step 818 , in which the “ add a new data item version to a baseline version ” operation is performed . the process then returns to step 807 to determine if there are more entries in the source list . when , in step 807 , it is determined that no entries remain in the source list , each remaining entry in the data structure represents a data item that was present in the previous baseline version , but is not present in the baseline source . thus , upon completion of steps 812 , 816 , or 818 for each entry in the baseline source list , the process continues with step 820 , in which a variant of the “ remove a data item from a baseline version ” operation is performed . in this variant of the operation , the data item to be removed is identified by its delta value rather than by its key characteristics . it is to be noted that , in practice , the “ update a data item version in a baseline version ” operation will work for both steps 816 and 818 , since “ update ” is simply a “ remove ” followed by an “ add ,” and “ remove ” does not report an error if there is nothing to remove . an exemplary block diagram of a database system 900 , in which the present invention may be implemented , is shown in fig9 . system 900 is typically a programmed general - purpose computer system , such as a personal computer , workstation , server system , and minicomputer or mainframe computer . system 900 includes one or more processors ( cpus ) 902 a - 902 n , input / output circuitry 904 , network adapter 906 , and memory 908 . cpus 902 a - 902 n execute program instructions in order to carry out the functions of the present invention . typically , cpus 902 a - 902 n are one or more microprocessors , such as an intel pentium ® processor . fig9 illustrates an embodiment in which system 900 is implemented as a single multi - processor computer system , in which multiple processors 902 a - 902 n share system resources , such as memory 908 , input / output circuitry 904 , and network adapter 906 . however , the present invention also contemplates embodiments in which system 900 is implemented as a plurality of networked computer systems , which may be single - processor computer systems , multi - processor computer systems , or a mix thereof . input / output circuitry 904 provides the capability to input data to , or output data from , database system 900 . for example , input / output circuitry may include input devices , such as keyboards , mice , touchpads , trackballs , scanners , etc ., output devices , such as video adapters , monitors , printers , etc ., and input / output devices , such as , modems , etc . network adapter 906 interfaces database system 900 with internet / intranet 910 . internet / intranet 910 may include one or more standard local area network ( lan ) or wide area network ( wan ), such as ethernet , token ring , the internet , or a private or proprietary lan / wan . memory 908 stores program instructions that are executed by , and data that are used and processed by , cpu 902 to perform the functions of system 900 . memory 908 may include electronic memory devices , such as random - access memory ( ram ), read - only memory ( rom ), programmable read - only memory ( prom ), electrically erasable programmable read - only memory ( eeprom ), flash memory , etc ., and electro - mechanical memory , such as magnetic disk drives , tape drives , optical disk drives , etc ., which may use an integrated drive electronics ( ide ) interface , or a variation or enhancement thereof , such as enhanced ide ( eide ) or ultra direct memory access ( udma ), or a small computer system interface ( scsi ) based interface , or a variation or enhancement thereof , such as fast - scsi , wide - scsi , fast and wide - scsi , etc , or a fiber channel - arbitrated loop ( fc - al ) interface . the contents of memory 908 varies depending upon the function that system 900 is programmed to perform . in the example shown in fig9 , memory 908 includes database 912 , database routines 918 , data item capture routines 920 , and operating system 928 . database 912 includes a collection of information and other objects organized in such a way that computer software can select and retrieve desired pieces of data . database routines 918 are software routines that provide the capability to store , organize , modify , and extract information from database 912 . database 912 includes a plurality of data items 914 a - n , which may be organized in one or more schemas 916 a - m . data item capture routines 920 are software routines that provide the capability to capture and recapture data item versions . operating system 922 provides overall system functionality . as shown in fig9 , the present invention contemplates implementation on a system or systems that provide multi - processor , multi - tasking , multi - process , and / or multi - thread computing , as well as implementation on systems that provide only single processor , single thread computing . multi - processor computing involves performing computing using more than one processor . multi - tasking computing involves performing computing using more than one operating system task . a task is an operating system concept that refers to the combination of a program being executed and bookkeeping information used by the operating system . whenever a program is executed , the operating system creates a new task for it . the task is like an envelope for the program in that it identifies the program with a task number and attaches other bookkeeping information to it . many operating systems , including uni ®, os / 2 ®, and windows ®, are capable of running many tasks at the same time and are called multitasking operating systems . multi - tasking is the ability of an operating system to execute more than one executable at the same time . each executable is running in its own address space , meaning that the executables have no way to share any of their memory . this has advantages , because it is impossible for any program to damage the execution of any of the other programs running on the system . however , the programs have no way to exchange any information except through the operating system ( or by reading files stored on the file system ). multi - process computing is similar to multi - tasking computing , as the terms task and process are often used interchangeably , although some operating systems make a distinction between the two . it is important to note that while the present invention has been described in the context of a fully functioning data processing system , those of ordinary skill in the art will appreciate that the processes of the present invention are capable of being distributed in the form of a computer readable medium of instructions and a variety of forms and that the present invention applies equally regardless of the particular type of signal bearing media actually used to carry out the distribution . examples of computer readable media include recordable - type media such as floppy disc , a hard disk drive , ram , and cd - rom &# 39 ; s , as well as transmission - type media , such as digital and analog communications links . although specific embodiments of the present invention have been described , it will be understood by those of skill in the art that there are other embodiments that are equivalent to the described embodiments . accordingly , it is to be understood that the invention is not to be limited by the specific illustrated embodiments , but only by the scope of the appended claims . | 6 |
according to various embodiments of the present invention , a simplified version of kubelka - monk in conjunction with a non - continuous version of bier &# 39 ; s law for converting device independent data into device dependent data , such as rgb data , are used to provide a reasonable estimate for measured device independent data , such as cielab or ciexyz values , of mixed colorants on a substrate . according to embodiments of this invention , a reasonable baseline of original information is assumed , such as the information one normally finds in an icc profile , combined with measurements that indicate shifts from the baseline , such as a change in paper color . for those situations where there is no baseline information indicating the overprinting of different colors , such as for example a list of l * a * b * values for spot colors , the described techniques at least can provide a reasonably valid estimate for the mixing of solid colors , far better than current results in drawing applications . additionally , for packaging applications , the described techniques can give reasonable estimates for overprint colors based on accurate data for the individual colorants in conjunction with a baseline example for a particular printing press . such reasonable estimates are useful because packaging customers often have difficulty performing color management for their work due to the fact that each job often has a different set of colorants . the techniques described herein assist in predicting color profiles on a per job basis with changing inks based on a baseline characterization . this can be very useful to packaging customers or anyone that needs very accurate color in print jobs . turning now to fig3 , various embodiments of the present invention , described below , involve inventive data processing techniques that may be executed by a system 300 . the system 300 includes a computer system 301 , that itself may include one or more computers communicatively connected . the data required to execute the below - described data processing techniques may be provided to the computer system 301 from an input source 302 communicatively connected to the computer system 301 . although one skilled in the art will appreciate that the invention is not limited to any particular input source 302 , such input source may include one or more user - interfaces , such as keyboards , mice , etc ., other computers , or computer accessible memories that may have data stored therein or thereon . to facilitate executing the data processing techniques described below , the computer system 301 may have a data storage system 304 communicatively connected to it . the data storage system 304 may include one or more computer accessible memories . the output ( s ) generated by the computer system 301 as a result of executing the data processing techniques described below may be transmitted to an output source 303 communicatively connected to the computer system 301 . although one skilled in the art will appreciate that the invention is not limited to any particular output source 303 , such output source 303 may include one or more display devices , other computers , or computer accessible memories that may have data stored therein or thereon . accordingly , the output source 303 may be included , completely or partially , within the data - storage system 304 . in this regard , the input source 302 may also be included , completely or partially , within the data - storage system 304 . the data - storage system 304 may be a distributed data - storage system including multiple computer - accessible memories communicatively connected via a plurality of computers and / or devices . on the other hand , the data storage system 304 need not be a distributed data - storage system and , consequently , may include one or more computer - accessible memories located within a single computer or device . the phrase “ computer - accessible memory ” is intended to include any computer - accessible data storage device , whether volatile or nonvolatile , electronic , magnetic , optical , or otherwise , including but not limited to , floppy disks , hard disks , compact discs , dvds , flash memories , roms , and rams . the term “ computer ” is intended to include any data processing device , such as a desktop computer , a laptop computer , a mainframe computer , a personal digital assistant , a blackberry , and / or any other device for processing data , and / or managing data , and / or handling data , whether implemented with electrical and / or magnetic and / or optical and / or biological components , and / or otherwise . the phrase “ communicatively connected ” is intended to include any type of connection , whether wired , wireless , or both , between devices , and / or computers , and / or programs in which data may be communicated . further , the phrase “ communicatively connected ” is intended to include a connection between devices and / or programs within a single computer , a connection between devices and / or programs located in different computers , and a connection between devices not located in computers at all . in this regard , although the data storage system 304 is shown separately from the computer system 301 , one skilled in the art will appreciate that the data storage system 304 may be stored completely or partially within the computer system 301 . the data processing techniques , according to various embodiments of the present invention , begin with a simplified version of kubelka - munk , in which it is assumed that the scattering approaches 0 . this implies that for a first order approximation , the colorants only absorb light , meaning that they are perfectly transparent ( i . e . not opaque ). this assumption implies that the ratio of absorption to scattering k ( λ )/ s ( λ ) is nearly infinite , resulting in the following expression ( also known as bier &# 39 ; s law ): r q ( λ , z )= r g ( λ ) e − k ( λ ) z eq . 1 if multiple colorants of thickness z i are combined , this may be extended to : r q ( λ , z 0 , z 1 , z 2 , . . . )= r g ( λ ) e − σk i ( λ ) z i eq . 2 where , for example , i denotes 0 , 1 , 2 , 3 identifying cyan , magenta , yellow , and black . since the icc based standards used in the graphic arts are generally based on cie systems which are inherently based on red , green , blue ( or ρ , β , γ in cie terminology ), the single continuous function of λ , r q ( λ ), which is based on an infinite set of possible values of λ , is replaced with a function of dimension 3 that predicts reflection for the red , green , blue areas of the visible spectrum : r j ( z 0 , z 1 , z 2 , . . . )= r gi e − σk ij z i eq . 3 where j = 0 , 1 , 2 denotes red , green , and blue portions of the spectrum . this reflectance 3 - d vector may be denoted as r ( z 0 , z 1 , z 2 , . . . ). although this embodiment of the present invention converts device independent coordinates into a discrete 3 - dimensional rgb approximation of the visible spectrum , one skilled in the art will appreciate that other discrete approximations of the visible spectrum may be used . now , in actual printing there are complex interactions that occur : as one colorant prints over another colorant , the adhesion may be higher or lower than that of printing on the paper substrate . this phenomenon may be difficult to separate from effects such as scattering unless experimental data has been obtained to precisely determine and separate out these effects . assuming that such data may not be available , an embodiment of this invention proposes to combine the effects of all interactions into a simple correction factor . this correction factor may be for example in the form of an effective colorant thickness z i ′ which may be slightly different from the original value z i . hence value z i in the expression above is replaced with where , as before , i denotes colorant and j denotes red , green , or blue part of the spectrum . the correction factor may account for colorant bonding differences of colorants deposited upon other colorants relative to colorants deposited directly on a paper base , as indicated above . moreover , the same or similar correction factor may also be used to account for colorant impurities . the term “ paper base ” is generally used herein to refer to any substrate or surface on which colorants may be deposited . note that the exponential expression in equation 3 above may be regarded as the transmittance property of each colorant as a function of its thickness z i : t ij ( z i )= e − k ij z i eq . 5 t ij ( z i , δ i )= e − k ij ( z i + δ i ) t ij ( z i , δ i )= t ij ( z i ) t ij ( δ i ) eq . 6 if it is assumed that baseline data contains cielab data for paper base , colorants , and overprints , the expression above may be rewritten in terms of a product of the reflectance of the baseline paper substrate and the negative exponentials of the colorant absorptions , modified by corrections caused by δz above : for simplicity , all of the tij ( δi ) corrections for a particular combination of colorants may be combined into a single correction factor ( 1 + δj ). this correction is valid only for that particular combination of individual colorants : assuming that the value of transmission for a particular colorant will always be determined via measurement of paper and individual colorant printing on that paper , the above may further be simplified as functions purely of the change in paper and the empirically determined transmissions of each of the colorants , corrected by the overall delta for that particular combination of colorants : the last mathematical conversion may be used to derive rgb from cielab values . this conversion may be performed using a simple matrix transformation — no tone curves are required since all the above calculations have been performed in linear rgb space , which may be converted directly from xyz via matrix transformation : the matrix used to convert between xyz and rgb may be any reasonable space that contains the gamut of colorants : for cmyk inks for example , adobergb with white point set to d50 illumination may be used . note that the rgb transmittance for any individual colorant may be derived from its measured cielab value by the expression : where r gj is the rgb vector converted from xyz of the paper base converted directly to rgb according to the above and r jmeas is the rgb value converted from the measured xyz of the colorant + paper together . likewise , the delta correction which combines all the interactions between colorants for a particular overprinted group of colorants , may be derived as follows : for measured colors that are a combination of paper base and more than one colorant , it is noted that if a particular colorant is missing ( i . e . is 0 %), that colorant will have no absorption k which means that t ij = 1 for that colorant “ i ”— i . e . it has no impact on the resulting final reflection . note that the determined values of t ij refer to individual colorants and r gj refers to the value of paper converted directly from the value of xyz for the paper base . if it is now assumed that new values of paper and / or colorant are measured and converted to r ′ gi for the paper and t ′ ij for the individual colorant according to eq . 14 above , a new estimated value may be calculated for r ′ jmeas . thus the procedure for predicting colors in this manner may be summarized as follows : 1 ) convert all cielab values to ciexyz and from ciexyz to rgb using equation 11 above 2 ) note that the rgb vector for the paper base r g is now determined directly from step 1 3 ) determine the transmittance vectors t i from equation 13 for the remaining i colorants by normalizing out the values of the paper base vector r g as indicated by equation 13 4 ) determine the overprint delta corrections δ j for each combination of overprints , ( i . e . red , green , blue , 3 / color , etc . according to equation 14 above ). having determined values of δ j for each overprint color , it is noted that if all values of xyz for paper and colorants remain unchanged , there will be no change to the calculated values r jmeas . if a shift is detected for either paper or colorants or both , new values of r ′ gi for the paper and t ′ ij may be empirically determined and new values of r ′ jmeas may be calculated for each solid and overprint color . these estimated values of r ′ jmeas may be converted back to xyz according to eq . 10 above . if there is no measured data available for a paper base or for any colorant , it is assumed that no change has occurred . in other words , the value of r ′ gi for the paper and t ′ ij for the colorants remains unchanged for any component for which there is no data . thus , if the only data offered for recalculating the solids and overprints is that of paper , the new values of first paper reflectance are calculated and new values of colorants may be calculated . this is particularly important for colors , such as a yellow , that tend to shift with a similar direction and magnitude as the shifts in paper due to its low degree of absorption for all colors other than blue . for situations where no original overprint data exists , such as an illustration application painting with pantone ™ colors , equation 16 may be used with the value of δ j be set to 0 , implying a perfect overprint and transparent mixing of the two colors . the overprinting of similar colors using transparency enabled will result in a darker , more saturated composite color relative to the original colors . thus , the expected darker appearance of the cyan intersection in the original example would indeed occur . the approach described above is a good first order approximation which assumes that the change in effective thickness of each colorant is a fixed value . if a more realistic adjustment is assumed , namely that the proportional change in thickness for each colorant is constant rather than the absolute magnitude of change in thickness , a slightly more complex calculation may be performed to estimate how the resulting overprint colors varies with changes in individual colorant , in the manner shown below . equation 4 is rewritten to indicate proportional change in thickness rather than absolute change in thickness : t ij ( z i , δ i )= e − k ij z i ( 1 + δ i ) t ij ( z i , δ i )= t ij ( z i ) ( 1 + δ i ) eq . 17 if it is assumed that baseline data contains cielab data for paper base , colorants , and overprints , the expression above may be rewritten in terms of a product of the reflectance of the baseline paper substrate and the negative exponentials of the colorant absorptions , modified by corrections caused by δz above : assuming that the value of transmission for a particular colorant will always be determined via measurement of paper and individual colorant printing on that paper , the above may further be simplified as functions purely of the reflection of paper and the empirically determined transmissions of each of the colorants , corrected by the overall delta for that particular combination of colorants : this calculation is now reduced to a set of 3 linear equations with 4 unknowns . if the case of 4 color black overprint is ignored , which has little impact on color due to its high density and low chroma , the values of all the other overprint colors may uniquely be calculated since at least one of the 4 colors in each overprint is not present , which equates to t = 1 , and log [ t ]= 0 , δi = 0 for that non - present colorant or colorants . the vector δi may hence be calculated from standard solutions to 3 linear equations with 3 unknowns ( similar for 2 colorant overprints — 2 equations with 2 unknowns ): ( δ 0 δ 1 δ 2 ) = m - 1 ( α 0 α 1 α 2 ) eq . 21 where 0 , 1 , 2 each temporarily denote cyan , magenta , yellow , or black and represent three out of the four colorants present in the overprint color . the 4 color overprint may be handled in an approximate manner using the value δ as described earlier in this document . the values of α j are given by : having determined these more complex and more accurate values of the deltas , the user may recalculate the vectors r j for new values of paper and colorants by measuring paper and colorant xyz and converting to rgb in order to determine r gi and t ij . having recalculated the r j vector , one may convert back to predicted xyz . it is to be understood that the exemplary embodiments are merely illustrative of the present invention and that many variations of the above - described embodiments can be devised by one skilled in the art without departing from the scope of the invention . it is therefore intended that all such variations be included within the scope of the following claims and their equivalents . | 7 |
korean patent application no . 2001 - 71144 , filed nov . 15 , 2001 , and entitled : “ semiconductor memory device and bit line sensing method thereof ,” is hereby incorporated by reference in its entirety . reference will now be made in detail to preferred embodiments of the present invention , an example of which is illustrated in the accompanying drawings . [ 0044 ] fig5 illustrates a circuit diagram of a semiconductor memory device according to the present invention . the semiconductor memory device of fig5 preferably includes a cell bit line pre - charge circuit 40 connected between cell bit line pair blcelli and blbcelli , a sense amplifier bit line pre - charge circuit 44 , a pmos sense amplifier 46 and an nmos sense amplifier 48 , which are connected between sense amplifier bit line pair blsa and blbsa , and charge transfer circuits or bit line isolation circuits 42 and 50 connected between the sense amplifier bit line pair blsa - blbsa and the cell bit line pairs blcelli - blbcelli and blcellj - blbcellj , respectively . memory cells mci and mcj represent representative memory cells among memory cells arranged in memory cell array blocks blk 1 and blk 2 , respectively , among n - number of memory cell array blocks blk 1 to blkn . a capacitor cb 1 represents a cell bit line load capacitor , and a capacitor csa represents a sense amplifier bit line load capacitor . the cell bit line pre - charge circuit 40 includes nmos transistors n 22 , n 23 and n 24 . the nmos transistor n 22 is connected between the cell bit line pair blcelli and blbcelli and has a gate receiving a control signal blpre . the nmos transistors n 23 and n 24 are serially connected between the cell bit line pair blcelli and blbcelli and have a gate receiving the control signal blpre and a common source receiving a pre - charge voltage vcca / 2 . the sense amplifier bit line pre - charge circuit 44 has pmos transistors p 5 and p 6 . the pmos transistors p 5 and p 6 are serially connected between the sense amplifier bit line pair blsa and blbsa and have a gate receiving a control signal sapre and a common source receiving a first voltage vcca . the pmos sense amplifier 46 has pmos transistors p 7 and p 8 serially connected between the sense amplifier bit line pair blsa and blbsa . the pmos transistors p 7 and p 8 have a common source receiving the voltage from sapre , or an external power voltage , but preferably the first voltage vcca . a gate of the pmos transistor p 7 is connected to the sense amplifier bit line blbsa , and a gate of the pmos transistor p 8 is connected to the sense amplifier bit line blsa . the nmos sense amplifier 48 has nmos transistors n 27 and n 28 serially connected between the sense amplifier bit line pair blsa and blbsa . the nmos transistors n 27 and n 28 have a common source receiving a signal san . a gate of the nmos transistor n 27 is connected to the sense amplifier bit line blbsa , and a gate of the nmos transistor n 28 is connected to the sense amplifier bit line blsa . the bit line isolation circuit 42 includes nmos transistors n 25 and n 26 connected between the cell bit line pair blcelli and blbcelli and the sense amplifier bit line pair blsa and blbsa , respectively . the bit line isolation circuit 50 includes nmos transistors n 29 and n 30 connected between cell bit line pair blcellj and blbcellj and the sense amplifier bit line pair blsa and blbsa , respectively . each of the memory cells mci and mcj includes an nmos transistor nm having a gate connected to the word lines wli and wlj and a drain connected to the cell bit line blcelli and blcellj , respectively , and a capacitor c connected between a source of the nmos transistor nm and a ground voltage . the nmos transistors n 22 , n 23 , and n 24 of the cell bit line pre - charge circuit 40 are turned on in response to the control signal blpre having a logic “ high ” level to pre - charge the cell bit line pair blcelli and blbcelli to a voltage vcca / 2 . the nmos transistors n 25 and n 26 of the bit line isolation circuit 42 are turned on in response to a control signal isoi to transfer charges to , and electrically connect , the cell bit line pair blcelli and blbcelli to the sense amplifier bit line pair blsa and blbsa . the pmos transistors p 5 and p 6 of the sense amplifier bit line pre - charge circuit 44 are turned on in response to the control signal sapre having a logic “ low ” level to pre - charge the sense amplifier bit line pair blsa and blbsa to a first voltage vcca . the pmos transistors p 7 and p 8 of the pmos sense amplifier 46 are turned on in response to a signal of the sense amplifier bit line pair blsa and blbsa having a logic “ low ” level to amplify a signal of the cell bit line pair blcelli and blbcelli and the sense amplifier bit line pair blsa and blbsa having a logic “ high ” level to a first voltage vcca . when a sense amplifier enable signal san of 0 volts is applied , the nmos transistors n 27 and n 28 of the nmos sense amplifier 48 are turned on in response to a signal of the sense amplifier bit line pair blsa and blbsa to amplify a signal of the cell bit line pair blcellj and blbcelij and the sense amplifier bit line pair blsa and blbsa having a logic “ low ” level to a second voltage of 0 volts . the nmos transistors n 29 and n 30 of the bit line isolation circuit 50 are turned on in response to a control signal isoj to transfer charges to , and electrically connect the cell bit line pair blcellj and blbcellj to the sense amplifier bit line pair blsa and blbsa . in fig5 the pmos sense amplifier 46 is preferably configured to be directly connected to a first voltage vcca . but , like the nmos sense amplifier 48 , the pmos sense amplifier 46 may be configured such that a first voltage vcca is applied to the common source of the pmos transistors p 7 and p 8 . in this case , when a sense amplifier enable signal having a first voltage level vcca is applied , the pmos transistors p 7 and p 8 are turned on in response to a signal of the sense amplifier bit line pair blsa and blbsa having a logic “ low ” level to amplify a signal of the cell bit line pair blcelli and blbcelli and the sense amplifier bit line pair blsa and blbsa having a logic “ high ” level to a first voltage vcca . [ 0049 ] fig6 illustrates a circuit diagram of a control signal generating circuit for generating the control signal isoi shown in fig5 according to the present invention . the circuit of fig6 preferably includes inverters 11 to 13 , an nmos transistor n 31 , and a pmos transistor p 9 . the inverters 11 and 12 buffer a control signal p 1 having a logic “ high ” level to generate a high third voltage vpp . the inverter 13 inverts a control signal p 2 having a logic “ high ” level to generate a second voltage 0v . the nmos transistor n 31 receives a first voltage vcca to generate the control signal isoi in response to an output signal of the inverter 12 having the high third voltage level vpp . the pmos transistor p 9 receives a high third voltage vpp to generate the control signal isoi in response to an output signal of the inverter 13 having a ground voltage level ( second voltage 0v ). [ 0050 ] fig7 illustrates a circuit diagram of a signal generating circuit for generating the signals p 1 and p 2 shown in fig6 according to the present invention . the signal generating circuit of fig7 preferably includes a word line enable signal generating circuit 60 , and first , second and third delay circuits 62 , 64 and 66 , respectively . the first delay circuit 62 is designed to have the same line load as the word line enable signal generating circuit 60 . the word line enable signal generating circuit 60 incorporates a predetermined time delay after reception and decoding of a row address ra in response to an inverted row address strobe signal rasb before generating a word line enable signal wl . the first delay circuit 62 generates a signal rwl in response to the inverted row address strobe signal rasb at the same time that the word line enable signal wl is generated . the second delay circuit 64 delays the signal rwl by a first predetermined time to generate the signal p 1 . the third delay circuit 66 delays the signal rwl by a second predetermined time to generate the signal p 2 . since the first delay circuit 62 preferably has a same configuration as the word line enable signal generating circuit 60 , the signals rwl , p 1 and p 2 may be generated with accurate timing . operation of the semiconductor memory device of fig5 is described below with reference to fig8 which illustrates timing diagrams ( a ) and ( b ), illustrating an operation of the semiconductor memory device of fig5 . in particular , ( a ) is a timing diagram to describe an operation of a cell bit line pair portion , and ( b ) is a timing diagram to describe an operation of a sense amplifier bit line pair . in fig8 data is read from the memory cell array block blk 1 . during a time period t 1 , when the control signal isoi is maintained at the second voltage of 0 volts , the control signal blpre having a logic “ high ” level , and the control signal sapre having a logic “ low ” level are applied , the nmos transistors n 25 and n 26 are turned off . the nmos transistors n 22 , n 23 and n 24 are turned on to pre - charge the cell bit line pair blcelli and blbcelli to a voltage vcca / 2 . the pmos transistors p 5 and p 6 are turned on to pre - charge the sense amplifier bit line pair blsa and blbsa to a first voltage vcca . during a time period t 2 , when a high voltage vpp is applied to the word line wli , the nmos transistor nm of the memory cell mci is turned on to perform a charge sharing operation between the capacitor c and the cell bit line pair blcelli and blbcelli . thus , a voltage difference occurs between the cell bit line pair blcelli and blbcelli . during a time period t 3 , when the control signal isoi of a first voltage vcca is applied , the nmos transistors n 25 and n 26 are turned on , so that a charge transfer occurs between the cell bit line pair blcelli and blbcelli and the sense amplifier bit line pair blsa and blbsa , and a voltage of the cell bit line pair blcelli and blbcelli is steadily raised to cause a voltage difference δvblcelli , and a voltage of the sense amplifier bit line pair blsa and blbsa is steadily lowered to cause δvblsa . during a time period t 4 , when a voltage difference between the cell bit line pair blcelli and blbcelli and the sense amplifier bit line pair blsa and blbsa is lower than a threshold voltage of the nmos transistors n 25 and n 26 , the nmos transistors n 25 and n 26 are turned off . as a result , a connection between the cell bit line pair blcelli and blbcelli and the sense amplifier bit line pair blsa and blbsa is cut off , and charge transfer therebetween ceases . consequently , the cell bit line pair blcelli and blbcelli and the sense amplifier bit line pair blsa and blbsa are maintained at a certain level . during a time period t 5 , when the sense amplifier enable signal san of 0 volts is applied , the nmos sense amplifier 46 and the pmos sense amplifier 48 operate to amplify a voltage of the sense amplifier bit line pair blsa and blbsa to a voltage of 0 volts and a voltage vcca , respectively . at this time , when the control signal isoi is transited to a high third voltage level vpp , the nmos transistors n 25 and n 26 are turned on so that an amplified level of the sense amplifier bit line pair blsa and blbsa is transferred to the cell bit line pair blcelli and blbcelli . that is , during this time period , the cell bit line pair blcelli and blbcelli as well as the sense amplifier bit line pair blsa and blbsa is amplified . the semiconductor memory device of the present invention is preferably configured to apply a voltage vcca , which corresponds to an intermediate voltage level of the control signal isoi , as a voltage for pre - charging the cell bit line pair blcelli and blbcelli and the sense amplifier bit line pair blsa and blbsa . however , the semiconductor memory device of the present invention may be configured to apply an external power voltage instead of the voltage vcca . as described above , the semiconductor memory device according to the present invention shares the pmos sense amplifier and the nmos sense amplifier between the memory cell array blocks to perform a charge transfer pre - sensing operation , and thus a layout area size can be significantly reduced . in addition , using the semiconductor memory device and the bit line sensing method according to the present invention , it is easier to control a level of the control signal applied to the bit line isolation circuit than by using conventional implementations . a preferred embodiment of the present invention has been disclosed herein and , although specific terms are employed , they are used in a generic and descriptive sense only and not for purpose of limitation . accordingly , it will be understood by those of ordinary skill in the art that various changes in form and details may be made without departing from the spirit and scope of the invention as set forth in the following claims . | 6 |
generally , as shown in fig1 the invention herein is a computerized telecommunications lottery wagering system . the system automatically handles telephone calls from subscribers with an automatic call director ( acd ). a voice responsive unit ( vru ) welcomes the subscriber to the lottery wagering system and places a wager for the subscriber based on information elicited from them over the telephone including and account number , personal id number , the particular state lottery of interest , the particular lottery format of interest , such as 6 - digit lotto , &# 34 ; keno &# 34 ;, 3 - digit lotto , the type of wager , &# 34 ; quick - pick &# 34 ; or &# 34 ; personal numbers &# 34 ;, and a betting amount . the host computer ( hereinafter &# 34 ; host &# 34 ;) stores the information in a mainframe computer and confirms the wager back to the subscriber via the vru . the link between the telephone handset and the acd may be through the telephone company equipment by landline , satellite communications or fiber optic connections . where the subscriber has computer facilities , voice and touch - tone is not required and the subscriber may access the system directly from the computer . the host is more completely described in an ibm brochure entitled , ibm system / 88 digest , first edition ( december 1988 ), publication no . g520 6518 - 00 , which is hereby incorporated by reference . the acd is more fully described in an at & amp ; t brochure entitled , an introduction to definity 75 / 85 communications system , generic 2 , which is hereby incorporated by reference . the vru is more fully described in a perception technology brochure entitled , bt - 111 the perception advantage , which is hereby incorporated by reference . if required , a multi - lingual vru may be employed . in one embodiment , the system provides subscribers with two 800 numbers , one for the purpose of enrolling as a subscriber and the other for the purpose of placing wagers . when the subscriber dials either of the 800 numbers they will be connected to their local telephone company , and then ultimately into the network of the watts carrier that are selected to provide the service . all calls are connected to the acd from the watts network and routed to the appropriate vru . the acd routes enrollment calls to enrollment vrus and wagering calls to wagering vrus . to determine the subscriber &# 39 ; s originating location the system utilizes a feature of the network called automatic number identification ( ani ). the ani feature allows the system to determine , at a minimum , the area code and 3 - digit exchange of the caller and in many instances the entire 10 - digit telephone number . in one embodiment , the system uses the area code to limit the caller to placing wagers only with the state lottery within the state from which they are calling . in another embodiment the system allows the subscriber to place lottery wagers on an interstate or interstate basis , so that a lottery wager can be placed from anywhere to any state , or even international , lottery through the use of a touch - tone telephone . both the intrastate and interstate wagering are discussed in more detail below . fig2 shows a flow chart of the subscriber enrollment process of the vru , and fig2 a and 2b respectively show the associated subscriber enrollment vru scripts . in this case , for example , the subscriber would have dialed 1 - 800 - enroll and been connected to an enrollment vru by the acd . the system is adaptable to any actual enrollment / customer service 800 number assigned by the telephone company . utilizing the ani feature , the vru will store the telephone number of the subscriber and play the subscriber enrollment script as depicted in fig2 a . first the vru plays a welcome message to the subscriber , welcoming them to the automated subscriber enrollment process , and then asks them to respond to a number of questions by pressing the appropriate number on their touch tone telephone . as shown in fig2 a , the first question to be asked is &# 34 ; please select the credit card you wish to use &# 34 ;. for example , in the process of selecting the caller will be asked to press &# 34 ; 1 for visa &# 34 ;, &# 34 ; 2 for mastercard &# 34 ;, &# 34 ; 3 for discover &# 34 ;, &# 34 ; 4 for american express &# 34 ;, and &# 34 ; 5 for diners card &# 34 ;. in the example , the caller responded with a ` 1 ` and the vru played back a message , &# 34 ; you have selected visa , enter your card number &# 34 ;. after the subscriber enters their card number , the vru plays back the numbers entered and requests confirmation of the account number or re - entry . for example , the vru plays back , &# 34 ; you have entered 123 , 456 , 789 , 012 , 345 , 6 , press 1 to confirm , 2 to re - enter &# 34 ;. if the number played back is incorrect the caller would press 2 and re - enter their account number . if the number was correct the caller would press 1 and the vru would store the number and immediately send a transaction to the host to initiate the host credit card authorization process as indicated by the off page connector 11 . 0 ( shown as an inverted pyramid ), see fig1 described herein . the vru sends a transaction code , credit card type code , and credit card account number to the host . this authorization process is described later in this document . concurrently with that authorization by the host , the vru continues the automated enrollment process by playing subscriber enrollment script 2 ( fig2 b ). the vru plays a message requesting the subscriber to enter the four - digit expiration month and year of their credit card . in our example , the caller entered &# 34 ; 11 89 &# 34 ;, and the vru responded with the message &# 34 ; you have entered 11 89 , press 1 to confirm , 2 to re - enter &# 34 ;. if the caller confirms the date by pressing 1 then the vru will respond with the message &# 34 ; enter your two - digit weekly wager amount &# 34 ;, else the vru will again request the expiration month and year . when the caller then - enters &# 34 ; 10 &# 34 ; signifying that on a weekly basis they wager ten dollars ($ 10 . 00 ) on lottery games , the vru confirms the weekly wager amount by responding with a message &# 34 ; you have entered 10 dollars , press 1 to confirm , 2 to re - enter &# 34 ;. in our example , since the caller pressed ` 1 ` to confirm , the vru then plays the message , &# 34 ; the system will now charge your credit card with 50 dollars , providing you with an open balance to wager . we will also obtain your credit information from the credit card company you have selected . press 1 to authorize the withdrawal and obtaining of credit information &# 34 ;. to minimize the number of credit card transactions , in a preferred embodiment , the system software multiplies the wager amount entered by five and rounds upwards to the nearest ten dollars . if the subscriber entered five dollars , the system would multiply five by five giving twenty - five and round upwards to thirty dollars . this amount is withdrawn from the credit card creating an open balance to wager in the subscribers account . the caller confirms the withdrawal amount by pressing &# 34 ; 1 &# 34 ; and the vru responds with a message , &# 34 ; you will now be transferred to a customer service agent .&# 34 ; as indicated earlier , the vru can send a transaction to the host which initiated the host credit card authorization process ( fig1 ). the host may for instance , be linked on - line to the credit card company &# 39 ; s database to validate the subscriber &# 39 ; s credit card number . in addition , the system obtains the caller &# 39 ; s name , address , city , state , zip code , home and business telephone numbers , and their social security number . the host then stores the subscriber &# 39 ; s credit card information in the subscriber master file , which is made available to the customer service agent when the caller is transferred to complete the enrollment . subsequently , the customer service agent repeats all information entered by the subscriber and obtained from the credit card company . once the caller verbally confirms all the information they will be provided with a subscriber id , a personal id number ( pin ), and the 800 number to be used for wagering . the system will also request the preparation of an information packet which will be mailed to the subscriber . the entire conversation is recorded via a tape recorder that is connected to the acd customer service agent &# 39 ; s extension . the system will record all conversations using this equipment and since the system also records the date and time of each call , the recorded information is readily available . this concludes the automated subscriber enrollment process . the subscriber is now able to place lottery wagers utilizing the system . the customer service agent can transfer the subscriber to a wagering vru and the subscriber can start placing wagers . fig3 shows a flow chart of the subscriber identification and game selection process of the vru , and fig3 a , 3b , and 3c respectively show the associated wagering vru scripts played to the subscriber . in one embodiment , for example , the subscriber would dial 1 - 800 - wager to be connected to a wagering vru by the acd . the system is adaptable to any number assigned by the telephone company . utilizing the ani feature , the wagering vru will store the telephone number of the caller and play the subscriber identification script as depicted in fig3 a . note that in the description of this embodiment the interstate wagering feature of the system is highlighted , but where appropriate , the differences related to intrastate wagering are mentioned . but generally , on an intrastate basis the subscriber would be blocked from wagering by the vru if their call was not initiated from within a state that had a lottery . the subscriber would only be allowed to place wagers with that lottery . as shown in fig3 in the subscriber identification and game selection process , the vru plays a welcome message to the subscriber and requests their account number as depicted in fig3 a . in our example , the subscriber entered ` 123456789098 `, and the vru responded with , &# 34 ; you entered 123 , 456 , 789 , 098 , press 1 to confirm , 2 to re - enter &# 34 ;. the subscriber responded with a 1 and the vru then played the message , &# 34 ; enter your personal id &# 34 ;. the subscriber entered ` 12345 ` and the vru responded with &# 34 ; you entered 123 , 45 , press 1 to confirm , 2 to re - enter &# 34 ;. the subscriber responded by pressing ` 1 ` to confirm that the number was correct . the vru stores the subscriber id and pin and immediately sends a transaction to the host to validate the subscriber . the vru sends a transaction code , subscriber id , and pin to the host which would immediately initiate the host validate subscriber process , see fig4 described herein . the vru then requests the entry of the amount to be wagered during this call . the host compares this amount to the subscriber &# 39 ; s open balance to wager to insure that sufficient funds are available for wagering . the system only reduces the open balance to wager as wagers are placed and not by the entry of this wager amount . the vru plays the message , &# 34 ; enter 2 - digit wager amount &# 34 ;. in our example , the subscriber entered ` 10 `, and the vru then responds with , &# 34 ; you entered 10 dollars , press 1 to confirm , 2 to re - enter &# 34 ;. as shown the subscriber responded by pressing ` 1 `. in response to the subscriber input , the vru plays either the script in fig3 b or 3c . the determining factor is whether interstate wagering is allowed . for interstate wagering , the vru plays the script in fig3 b , lottery selection , to the subscriber . this script gives the subscriber the option to select one of five options . the first four options will be the lotteries in close proximity to their state . the fifth option &# 34 ; other states &# 34 ;, will cause the vru to play another script which will allow the subscriber to select from another group of lotteries . this will continue until the subscriber is given the option to select from any state with a lottery that utilizes the service . once the subscriber makes their lottery selection the vru plays the script in fig3 c , game selection . in the game selection script shown fig3 c , the vru presents the subscriber with the various lottery games available within the selected lottery . on an intrastate basis it presents the games available within the state from which the call initiated . for instance , the vru plays a message and welcomes the subscriber to the lottery then plays a message , &# 34 ; press 3 for 3 - digit numbers , press 4 for 4 - digit numbers , press 6 for lotto , press 7 for keno &# 34 ;. in our example , the subscriber pressed ` 6 ` for lotto . now the subscriber can place a wager . they will now be transferred to the 6 - digit lotto process as described in fig5 a and 5b . as described above , when the subscriber entered their id and pin , the vru requested that the host validate the subscriber id ( see fig4 ). at this point the host should have completed that process and has sent a signal to the vru to allow the wager to proceed or to transfer the subscriber to customer service in the event of a problem . ( the vru also can be programmed to determine , that a subscriber is having difficulty in using the system .) if the subscriber cannot place a wager for any reason at this point , the vru will transfer the caller to a customer service agent for assistance in completing the wager . if the host subscriber validation process was successful , the host returns an appropriate message to the vru allowing the wagering to proceed . this concludes the discussion of fig3 a , 3b , and 3c , known as subscriber identification and game selection process . fig4 shows a flow chart of the host validate subscriber process , which validates the subscriber identification to the system and determines whether they have sufficient funds to place a wager . for instance , in response to voice commands from the vru , the subscriber enters their subscriber id and their pin . the host receives this information from the vru and calls the validation process which searches a subscriber master file for a match . if a match does not exist , then the host sends an invalid subscriber message signal to the vru , which plays an invalid subscriber message back to the subscriber . if a match is found , then the host compares the subscriber &# 39 ; s open balance to wager against the amount which they indicated they would be wagering . if there are sufficient funds , then the host sends a sufficient funds signal to the vru and the subscriber would then be allowed to proceed . the system then returns to off page connector 3 . 2 ( shown as an inverted pyramid and also known as an off page connector ), see fig3 . in our example , since funds are available the host sends a message signal back to the vru to proceed with the wager . if funds are not available , the host calls the host additional funds process , indicated by the off page connector 12 . 0 , see fig1 described herein . in response to a withdrawal approval from the host additional funds process , the host sends a sufficient funds signal to the vru and the subscriber would then be allowed to proceed . in response to a withdrawal nonapproval , the host sends a bad card signal to the vru which plays a bad card message back to the subscriber . the system then returns to off page connectors 3 . 2 , see fig3 described above . fig5 shows a flow chart of the 6 - digit lotto process of the vru , and fig5 a and 5b show the scripts for the messages played by the vru back to the subscriber . all of the game types described herein in fig5 to 8 from an overall systems perspective operate the same way . the essential difference between the games is the combination of numbers played , including both the amount and the range of numbers allowed . for example , 6 - digit lotto , requires 6 two - digit numbers . different state lotteries have variations on the range of number which can be selected . for example , in new jersey the lotto game range is presently from 1 to 48 , and subscribers can select any 6 numbers that are not repeated within that range . in new york &# 39 ; s lotto game the range is presently from 1 to 54 . in the flow chart shown in fig5 after the subscriber picks 6 - digit lotto ( see fig3 ), the vru requests a wagering type from the subscriber . in the script shown in fig5 a , the vru plays a message &# 34 ; you have chosen pick 6 lotto &# 34 ; to inform the subscriber of their choice , and also requests in the message that they either &# 34 ; press 1 for quick pick &# 34 ; or &# 34 ; 2 to enter your numbers &# 34 ;. if the subscriber chooses quick pick by responding with a &# 34 ; 1 &# 34 ;, then the vru plays a message &# 34 ; you have selected quick pick press 2 digit dollar amount &# 34 ; ( again see fig5 a ). in the case of a quick pick wager , the vru requests the entry of a quickpick wager amount then confirms it . for example , if the subscriber responds with &# 34 ; 10 &# 34 ;, then the vru plays a message &# 34 ; you have entered 10 dollars , press ` 1 ` to confirm , press ` 2 ` to re - enter &# 34 ; to confirm or re - enter the subscriber &# 39 ; s wagering amount . if the subscriber presses ` 2 ` to reenter , enter the vru again requests a quick pick amount . presently , in the state of new jersey a $ 10 . 00 wager results in 10 plays since every game cost $ 1 . 00 , while in new york state the $ 10 . 00 results in 20 plays since every game costs 50 cents , although the minimum in new york is a $ 1 . 00 wager which gives the subscriber two games . after the subscriber confirms the $ 10 . 00 wager amount , the vru sends to the host the subscriber id , the lotto selected , and 6 - digit lotto wager for $ 10 . 00 . the host then calls the host quick pick process as indicated by off page connector 9 . 0 , see fig9 described herein . in summary , in the host quick pick process the host firsts determines the lottery &# 39 ; s profile from a master state lottery file , and if the state lottery was in new jersey , for example , where the range of numbers is from 1 to 48 , then it would utilize a random number generating routine to generate 6 unique numbers between 1 and 48 for each game . again for new jersey , the quick pick process would generate 6 unique numbers for all 10 games . in comparison , if the call had been placed from new york , the host would , have generated 20 games . after the host quick pick process returns with the quick pick numbers , the vru plays a message &# 34 ; please hold for confirmation &# 34 ; and plays each of the wagers generated back to the subscriber , see fig5 a . note that the system only does so if the subscriber chooses to listen and record the numbers , if they hang up no message is played . the vru also plays a confirmation or ticket number assigned by the host to that wager . as far as the overall system is concerned , once the subscriber confirms the wager amount , if the subscriber at that time choose to hang up the phone , it would still generate all of the wagers , place them in the lottery , and store all the wagers within for billing , inquiry and auditing purposes . on a monthly basis the system will produce a statement which will tell the subscriber every wager that was placed , every draw down that was made from their credit card , all service charges , an opening balance from the last statement , and a closing balance as a result of this statement . at this point the system returns to the state lottery script as indicated by the off page connector 3 . 1 and go to fig3 . once again the system gives the subscriber the options : to place another wager , to select another game within this lottery , to select another lottery to place wagers , or finally to terminate the call . in the alternative , the other option in the 6 - digit lotto process was to allow the subscriber to enter their own numbers . if the subscriber chose to enter their own numbers by responding with ` 2 ` ( i . e . no quick pick ), the vru plays the script in fig5 b . first , the vru requests , based on the lottery profile , that the subscriber enters their 6 two - digit numbers within the range of 1 to 48 for n . j ., or 1 to 54 for n . y . the subscriber will utilize their touch tone phone to enter their 6 two - digit numbers . the vru plays a message &# 34 ; enter your six two digit numbers from 1 to 54 .&# 34 ; in the example in fig5 b if the subscriber enters their numbers , then the vru plays a message &# 34 ; you entered 5 10 16 18 29 37 press 1 to confirm or 2 to re - enter &# 34 ;. if the subscriber does not confirm then the vru again requests the subscribers numbers . else if the subscriber confirms then the vru sends the wager to the host , which calls the host wager process , see off page connector 10 . 0 and go to fig1 described herein . the vru sends the subscriber &# 39 ; s wager to the host to be processed , by passing to the host the subscriber id , the lottery and game selected , the 6 two - digit numbers entered , and that the subscriber chose their own numbers . the vru then requests the subscriber to enter another wager . at this point , if they choose to enter another series of numbers , they would be transferred back up to the point where the vru requests the entry of their numbers , and they would stay in this loop until such time as they choose to do something else . similar to that described above for the quick pick option , at the conclusion of wagering or selecting their own numbers , the vru will tell the subscriber to please hold on for confirmation , the host would have then come back to the vru with a confirmation or ticket number which will be played back to the subscriber . the vru , as in the quick - pick option , would now requests what they would like to do next , and based on the response , they will be transferred to the appropriate process or the call will be terminated . this concludes the discussion on the 6 - digit lotto process . fig6 shows a flow chart of the 3 - digit number game process of the vru . as earlier described , the processes are essentially the same except for the number of numbers being entered and the range . in the case of 3 - digit numbers , the range of numbers allowed is from 1 to 999 . again , the subscriber has the quickpick option and the option to enter their own numbers . as seen from the flow chart , the process works substantially the same way as the 6 - digit lotto process described above . fig7 shows a flow chart of the four - digit number process of the vru . again , this game is processed by the system essentially the same way as the 6 - digit lotto option by choosing the quickpick option or the entry of enter their own numbers . in contrast , the subscriber can select from a range from 1 to 9 , 999 . fig8 shows a flow chart of the keno process of the vru . the keno game typically works so that in order for the subscriber to win , they must choose 7 of the 11 numbers drawn by the lottery to win a prize , from a range of unique 2 - digit numbers between 1 and 84 . lotteries describe this in many ways , talk about it and , in particular , in pennsylvania , the keno game is 7 out of 11 from 184 . once again , the subscriber can select a quickpick or enter their own numbers . if they select a quickpick , the randomizing routine would generate the numbers . if they choose to enter and confirm their own numbers , they will be asked to enter their 7 two - digit numbers . that concludes the keno game process . fig9 show a flow chart of the quickpick process , called by the host whenever the subscriber chooses that option in any of the aforementioned games selected . in the quickpick process , first the host obtains from the vru the subscriber id , the lottery , the game ( such as lotto 3 - digit , 4 - digit , or keno ), a quickpick option signal to indicate that the subscriber chose quickpick , and the amount of the quickpick option . in our example , we spoke about $ 10 . 00 , which in n . j . means that 10 games or 10 wagers will be placed . after the host process receives this information , it examines the state lottery profile for the game in question to obtain the allowable number range , and passes that information on to the random number generator which would generate the appropriate numbers for the game . it will do this until the wager amount is exhausted . the host will send each wager back to the vru . it will also call the host wager process to actually place the wagers with the state lottery and ultimately return to the vru with the quickpick selected . that concludes the quickpick process . fig1 shows a flow chart of the host wager process . the system calls this process from various points in the overall systems software . for instance , the system calls this process from the quickpick process , or from the process when the subscriber chooses to enter their own numbers . in either case , the host wager process needs the information such as the subscriber id , the lottery , the game , the type of wager -- be it quickpick or individual personal numbers -- and the actual numbers being entered . the numbers obviously vary depending on the game , but the process is the same regardless of the game . so this information is passed from the vru . the wager will be recorded in the subscriber &# 39 ; s wager file for the purpose of audit and monthly statements . it will also be recorded in the state lottery wager file so that both the system and the lottery can keep track of the wagers for that particular day that were placed with the lottery . for each wager the system updates the subscriber master file , specifically the open balance to wager field based on the amount of the wager . it reduces that amount by the size of the wager and the service charge . there are situations where the system may need to be connected directly to the lottery computer . the system sends the wager or wagers down to the lottery computer and receives back the ticket number or confirmation number . that ticket number or confirmation number will be utilized to update the subscriber wager file and at the same time will be utilized to update the lottery file . it is this same number which goes back to the vru and played to the subscriber . where the system is not connected to the lottery &# 39 ; s computer , the ticket number or confirmation number will be a number which is generated by the system . all information will be transferred back to the routines which called the host wager process , be it the quickpick process or be it the subscriber &# 39 ; s entry of their own numbers for a particular game . that concludes the description on the host wager process ( see fig1 ). fig1 shows a flow chart of the host credit card authorization process . the vru calls this process only during enrollment to elicit various information about the subscriber , specifically , name , address , city , state , zip , home phone , business phone , social security number , credit rating , etc . the aforementioned enrollment process , shown in fig2 calls this host authorization process , the vru provides it with the subscriber &# 39 ; s credit card number and expiration date . the host , which is directly connected to the credit card company computer , from which the subscriber would have authorized the system to obtain the necessary information to complete their enrollment . the system will have access to the information and retrieve it back into the host computer . if there is no information to be obtained because the credit card number provided by the subscriber is invalid , an error message would go back to the vru and the vru would transfer the caller to the customer service agent . if the information we requested was retrievable , the host updates the subscriber master file with that information , looks at the available subscriber id and pin file for the next available subscriber numbers , and adds them to the master file . a message would go back to the vru indicating that the credit card is valid , allowing the enrollment process to continue . the vru then transfers the subscriber to a customer service agent for verbal verification of all information entered . fig1 shows a flow chart of the host additional funds process . the host calls the process when additional drawdowns of funds from the credit card are needed for the subscriber . the host checks a bad credit card file , and if the subscriber &# 39 ; s credit card number does not appear in that file , the credit card will allow a draw down of funds up to the limit allowed without a direct communication for authorization . the system has a database with a list of the latest bad cards provided by the credit card company , so the host compares the subscriber &# 39 ; s credit card number to the bad credit card database to verify it . if the subscriber &# 39 ; s card is not on the list , then the host can draw down funds to whatever limit is allowed by the credit card to the system . ( for example , most credit card companies establish a limit of say $ 50 . 00 to a particular retails , as long as , the draw down is $ 50 . 00 or less , there is no need for direct communication with the credit card company to obtain authorization , and thereby the credit card company will pre - approve that limit without the direct communication .) the advantage to this approach is that the system minimizes the interaction with the credit card company because these transactions typically take 10 to 15 seconds to accomplish , perhaps even longer , thus avoiding lengthening the time of the call as there are costs that are associated with that . and assuming that the subscriber &# 39 ; s card was not on the bad card list , the host can draw down the appropriate amount of funds and essentially return a signal to the vru saying that funds are now available . in addition , a transaction is sent to that credit card company &# 39 ; s daily charge file , transferred to the credit card company overnight , to assure that funds are received from the credit card company . if the subscriber &# 39 ; s credit card is on the bad card list , the host sends a signal back to the vru and the system returns to off - page connection 2 . 2 to indicate that a credit problem exists . the subscriber is then transferred to a customer service agent who knows that a credit problem exists , and would request a different credit card from the caller or would request some direction from the caller as to what we should do in order to allow them to wager . that concludes page 3 , the validate process . some of the other features that the system is designed to accommodate include : 1 ) determine winning numbers in other states ; 2 ) determine if a ticket which they hold , regardless of the lottery was a winner ; 3 ) determine what wagers were made over a period of time ; 4 ) place sports wagers ; and 5 ) place horse racing wagers . while the invention has been described in its preferred embodiment , it is to be understood that the words which have been used are words of description rather than limitation and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the invention in its broader aspects . | 6 |
preferred embodiments of the present invention are hereinafter described in conjunction with the drawings . an experiment was conducted on an exposure apparatus for image formation according to one embodiment of the present invention , using an image formation process unit 10 shown in fig1 . an exposure apparatus 1 is provided between a charger 12 and a development unit 13 along the perimeter of a photoreceptor drum 11 that rotates in direction a represented by the arrow in fig1 and a charging process , an exposure process and a development process are successively carried out on the surface of photoreceptor drum 11 by image formation process unit 10 . photoreceptor drum 11 includes a photosensitive layer formed of an undercoat layer ( ucl ), a charge generation layer ( cgl ) and a charge transport layer ( ctl ) deposited in this order on a cylindrical base made of a conductive material such as aluminum . the photoreceptor drum is a laminated type organic photoreceptor having a photosensitive layer with its surface negatively charged . charger 12 includes a casing 12 a , a wire 12 b and a grid 12 c each connected to a high - voltage power supply . grid 12 c is arranged with a distance of approximately 1 to 2 mm from the surface of photoreceptor drum 11 . the amount of charges generated by corona discharge , released from wire 12 b and subsequently arriving at the surface of photoreceptor drum 11 is controlled by a bias voltage applied to grid 12 c in order to charge the surface of photoreceptor drum 11 to a desired surface potential . referring to fig2 exposure apparatus 1 includes an infrared semiconductor laser 2 ( hereinafter ld 2 ) with a wavelength of 780 nm as a light source , a collimator lens 3 , an aperture 4 and an objective lens 5 . a laser beam emitted from ld 2 is converted into a parallel beam by collimator lens 3 and shaped by aperture 4 to generate a spot with a desired exposure spot diameter so as to form an image on the surface of photoreceptor drum 11 by objective lens 5 . ld 2 is driven with a predetermined power by a well - known laser driver 6 ( manufactured by kino melles griot corporation for example ) and its on / off is controlled with a predetermined pulse width . the laser beam emitted from exposure apparatus 1 irradiates the surface of photoreceptor drum 11 charged to a predetermined surface potential , and accordingly a latent electrostatic image is formed on the surface of photoreceptor drum 11 through photoconduction in the photosensitive layer . referring to fig3 development unit 13 includes a container 31 holding one - component developer 36 therein and further includes a development roller 32 , a supply roller 33 , a doctor roller 34 and a collection roller 35 each supported rotatably on an axis . developer 36 in container 31 is conveyed by supply roller 33 onto the surface of development roller 32 to be held by doctor roller 34 on the surface of development roller 32 with a predetermined layer thickness . the surface of development roller 32 passing the position opposing doctor roller 34 then faces the surface of photoreceptor drum 11 . developer 36 held on the surface of development roller 32 thus electrostatically adheres to the electrostatic latent image on photoreceptor drum 11 . consequently , a developer image is formed . developer 36 held on the surface of development roller 32 is charged with the same polarity as that of the charge potential on the surface of photoreceptor drum 11 . a bias voltage is applied to development roller 32 that is controlled to allow , when the potential of the latent electrostatic image formed on the surface of photoreceptor drum 11 ranges from a half of the charge potential of the photoreceptor drum 11 to 0 , developer 36 held on development roller 32 to electrostatically adhere to the surface of photoreceptor drum 11 . the surface of development roller 32 passing the position facing the surface of photoreceptor drum 11 then faces the surface of collection roller 35 , and accordingly developer 36 remaining on the surface of development roller 32 is collected into container 31 . image formation process unit 10 having the structure as discussed above was used for an experiment to observe image reproducibility with respect to image patterns formed as shown in fig4 i . e ., a periodic - line pattern 40 , an isolated - dot pattern 41 and an isolated - line pattern 42 . these patterns were formed with a margin of 6 p between patterns for avoiding cross talk between exposure spots of respective image patterns , and periodic line pattern 40 was formed with lines each having width p that are arranged at intervals of 2 p . a developer image of each image pattern formed on the surface of photoreceptor drum 11 was stripped therefrom by means of an adhesive tape , transferred , and enlarged by a microscope for evaluation . respective proper sizes of the diameter of an isolated dot and the line width were both 2 times dot pitch p . results of the experiment are described below . fig5 a to 5 c correspond respectively to exposure spot diameters d of 60 μm , 40 μm and 30 μm . photoreceptor drum 11 having its photosensitive layer of 20 μm in thickness was used to form an image with a resolution of 1200 dpi by using a varied exposure energy density ( μj / cm 2 ). resultant images have respective states as shown in fig5 a to 5 c . normal values indicated on the axis of abscissas shown in fig5 a to 5 c were determined , relative to the periodic line pattern , by defining a normal value as “ 1 ” with respect to the ratio of 50 % of line width b to interval a of lines ( duty ratio ) as shown in fig6 and relative to the isolated - dot pattern and the isolated - line pattern , by defining a normal value as “ 1 ” with respect to the dot diameter and the line width equal to pixel pitch p . as shown in fig5 a , when exposure spot diameter d is 60 μm and equal to 2 . 8 p , normal value of only “ 0 ” or “ 2 ” ( duty ratio is 0 % or 100 %) occurs regarding the periodic line pattern . it is thus impossible to produce a periodic line pattern having an intermediate duty ratio . namely , no image is formed or a resultant image is solid black . more specifically , exposure energy has a distribution as shown in fig7 a in the direction orthogonal to the line direction of a periodic line pattern formed under the above - described conditions . it is understood from fig7 a that , supposing that the potential of a latent electrostatic image varies in accordance with change of the exposure energy value , the latent image potential contrast of the periodic line pattern ( difference between a value of a white line of the periodic line pattern and a peak value of the periodic line pattern ) is merely 28 % relative to the latent image potential contrast of 100 % obtained when exposure spots do not overlap each other . a reason for this is that the latent image potential in the direction orthogonal to the line direction is rendered uniform by being significantly affected by cross talk between exposure spots of adjacent lines in the periodic line pattern . on the other hand , the isolated - dot and isolated - line patterns can be formed with respective proper sizes ( 12 times pixel pitch p ). however , when an isolated - line pattern formed of isolated - dot patterns continuing in one direction is formed , influence of cross talk between adjacent dots causes a considerable difference in the latent image potential between the isolated - line pattern and the isolated - dot pattern as shown in fig7 b . resultant phenomena are that an exposure energy forming an isolated - line pattern of a desired size could not form an isolated - dot pattern of a desired size and that an exposure energy forming an isolated - dot pattern of a desired size could produce an isolated - line pattern with an increased line width . these isolated - line and isolated - dot patterns are basic image patterns constituting various images . therefore , such phenomena could be a chief cause of image - quality deterioration . in order to prevent these phenomena and maintain a high image quality , a high image reproducibility is required with respect to both of the isolated - line pattern and the isolated - dot pattern and thus an appropriate exposure energy must be applied to each image pattern . as clearly seen from fig5 a , when exposure spot diameter d is 2 . 8 times dot pitch p , the exposure energy density for producing an isolated - line pattern of a proper size is approximately 0 . 1 μj / cm 2 and that for producing an isolated - dot pattern of a proper size is approximately 0 . 3 μj / cm 2 . in view of this , it would be possible to achieve a high image reproducibility for both of the isolated - line pattern and the isolated - dot pattern by applying an exposure energy to the isolated - dot pattern that is three times an exposure energy density applied to isolated - line pattern . then , as shown in fig8 a , the pulse height ( drive power ) of a drive pulse for each dot was changed depending on the image patterns by using power control means provided to laser driver 6 . in this way , drive energy supplied from laser driver 6 to ld 2 was controlled according to an image pattern so as to form an image . consequently , reproducibility could be enhanced for an isolated - dot pattern with a resolution of 1200 dpi having a dot diameter of approximately 30 μm and an enhanced reproducibility is also achieved for an isolated - line pattern . the power control means controlling the pulse height of a drive pulse per dot could be employed to accomplish image reproducibility for both of the isolated - dot pattern and the isolated - line pattern simultaneously . the discussion above refers to photoreceptor drum 11 having its photosensitive layer of 20 μm in thickness for forming an image with a resolution of 1200 dpi . a superior image reproducibility could also be achieved for both of the isolated - dot pattern and the isolated - line pattern by using photoreceptor drum 11 having its photosensitive layer of 15 μm or 25 μm in thickness and applying the same exposure energy ratio as employed for the photosensitive layer of 20 μm in thickness . when exposure spot diameter d is 3 . 8 p , i . e ., 80 μm , there was an increased difference in the latent image potential between the isolated - dot pattern and the isolated - line pattern as shown in fig9 compared with that when exposure spot diameter d is 2 . 8 p . then , for spot diameter d of 3 . 8 p , exposure energy supplied to ld 2 for forming an image of the isolated - dot pattern was defined as an energy three times or higher the exposure energy supplied for forming an image of the isolated - line pattern . accordingly , a high image reproducibility could be achieved for both of the isolated - dot and isolated - line patterns . it is accordingly understood that when d is greater than 2 . 8 p , exposure energy ed applied to the isolated - dot pattern and exposure energy es applied to the isolated - line pattern should be defined as ed / es & gt ; 3 . 0 . when exposure spot diameter d is 1 . 9 p , i . e ., 40 μm as shown in fig5 b , an exposure energy of 0 . 3 μj / cm 2 and that of 0 . 2 μj / cm 2 can be supplied respectively for the isolated - dot pattern and the isolated - line pattern to form images of respective proper sizes . data obtained regarding exposure spot diameter d equal to 2 . 8 p can be taken into consideration to achieve a high image reproducibility for both of the isolated - dot and isolated - line patterns , when exposure spot diameter d is in a range expressed by 1 . 9 p & lt ; d ≦ 2 . 8 p , by employing ed / es in a range expressed by 1 . 5 & lt ; ed / es ≦ 3 . 0 . when exposure spot diameter d is 1 . 4 p , i . e ., 30 μm , as shown in fig5 c , exposure energy of 0 . 4 μj / cm 2 can be supplied for both of the isolated - dot and isolated - line patterns to form images of respective proper sizes , which means that no change is necessary of exposure energy depending on the image patterns . data obtained regarding exposure spot diameter d of 1 . 9 p can be taken into consideration to achieve an excellent image reproducibility for both of the isolated - dot and isolated - line patterns , when d is in a range expressed by 1 . 4 p & lt ; d ≦ 1 . 9 p by setting ed / es in a range expressed by 1 . 0 & lt ; ed / s ≦ 1 . 5 . fig1 shows a resultant relation between exposure energy ed to be applied to the isolated - dot pattern and exposure energy es to be applied to the isolated - line pattern with respect to spot diameter d which is varied . fig1 a to 11 c show a relation , which is determined through analytical simulation , between an exposure energy density and an image size ( dot diameter , line width ) when the exposure spot diameter is changed . referring to fig1 a , when an image pattern with a resolution of 1200 dpi is formed by using exposure spot diameter d equal to 60 μm ( 2 . 8 p ), an exposure energy density for achieving a proper image size 30 μm for the isolated - dot pattern is 0 . 12 μj / cm 2 and that for the isolated - line pattern is 0 . 22 μj / cm 2 . the exposure energy must be controlled by setting ed / es to approximately 1 . 8 in order to produce both of the isolated - dot and isolated - line patterns with respective proper sizes . referring to fig1 b , when an image pattern of a resolution 1200 dpi is formed by using exposure spot diameter d equal to 40 μm ( 1 . 9 p ), an exposure energy density for achieving a proper image size 30 μm is 0 . 17 μj / cm 2 for the isolated - dot pattern and that for the isolated - line pattern is 0 . 22 μj / cm 2 . therefore , the exposure energy must be controlled for generating the isolated - dot pattern and the isolated - line pattern both with proper image sizes respectively by setting ed / es to approximately 1 . 3 . further , referring to fig1 c , when an image pattern of a resolution 1200 dpi is formed by using exposure spot diameter d equal to 30 μm ( 1 . 4 p ), an exposure energy density for accomplishing a proper image size 30 μm is 0 . 2 μj / cm 2 for both of the isolated - dot and isolated - line patterns . then no exposure energy control is required for producing both of the isolated - dot and isolated - line patterns with proper image sizes respectively . it is clearly seen from the results shown in fig1 a to 11 c that , when exposure spot diameter d is in a range exceeding 1 . 4 p , an exposure energy fixed at a certain value cannot produce a high image reproducibility for both of the isolated - dot and isolated - line patterns . the exposure energy should thus be changed depending on image patterns . however , the exposure energy ratio ( ed / es ) with respect to the isolated - dot pattern and the isolated - line pattern determined through the experiment does not necessarily coincide with an exposure energy ratio for an actual image formation . a possible reason is that no consideration is taken for the thickness of the ctl of photoreceptor drum 11 in the present experiment . therefore , if a photoreceptor drum having a thinner ctl is employed in the experiment , a latent electrostatic image can more accurately be formed through an exposure process with less diffusion of carriers . consequently , an experimental result would match the exposure energy ratio in an actual image formation . in the experiment herein discussed , the exposure energy is controlled by keeping constant the exposure time ( pulse width of a drive pulse supplied to ld 2 ) and varying the exposure power ( pulse height of the drive pulse ) ( power control method ). alternatively , the exposure power may be fixed while the exposure time may be varied , i . e ., pulse - width control method may be employed , or another control method by which both of the exposure time and exposure power are varied may also be used . fig8 b shows a waveform of a drive pulse applied to ld 2 for setting exposure energy ratio to 3 by means of pulse modulation method with a constant exposure power . the experiment discussed above is conducted by employing an image formation process through which a latent electrostatic image is made visible by means of one - component development method . however , a similar result would be accomplished when a two - component development method or jumping development method is applied to a development process to form an image . although the present invention has been described and illustrated in detail , it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation , the spirit and scope of the present invention being limited only by the terms of the appended claims . | 7 |
fig1 is a perspective view of a use - monitoring closure according to the invention , shown attached to the open end of a tennis ball can . fig2 is a partial vertical sectional view , taken along 2 -- 2 of fig1 of the fig1 closure and can . fig3 is a vertical sectional view of the two parts of the fig1 closure , shown before their assembly . referring to the drawings , there is shown in fig1 use - monitoring closure 10 attached to the top end of conventional , cylindrical tennis ball can 12 . as illustrated in fig3 use - monitoring closure 10 is assembled from two parts , snap - on cap 14 and rotatable pointer 16 . cap 14 has flat , circular central panel 18 around the periphery of which are imprinted use indicia 20 ( fig1 ), consisting of the digits 0 through 9 , equidistantly spaced in a complete circle . at the center of panel 18 is small circular hole 22 ( approximately 0 . 020 &# 34 ; in diameter before assembly , fig3 ). surrounding panel 18 is a raised annular ledge 24 . projecting upwardly along the top surface of ledge 24 is narrow rib 26 , displaced inwardly from the outer edge approximately one - third of the width of ledge 24 . the outer edge of ledge 24 merges into a downwardly projecting peripheral skirt 28 . on the inner surface of skirt 28 is annular bead 30 , forming annular pocket 32 ( having a diameter of about 2 . 96 &# 34 ;) into which the top end seam 34 of the tennis ball can 12 fits when closure 10 is snapped onto it , as shown in fig2 . the lower portion of annular bead 30 is beveled slightly outwardly and downwardly to cause skirt 28 to flex outwardly during the snapping operation so bead 30 easily passes over end seam 34 . cap 14 is preferably molded as a unitary structure out of a soft plastic material such as polyethylene or polypropylene , with a thickness of approximately 25 mils across panel 18 , ledge 24 , and the upper portion of skirt 28 and a thickness of about twice this amount across the width of bead 30 . this choice of material and thickness provides cap 14 with sufficient flexibility , as well as durability , to be readily and repeatedly snapped on and snapped off tennis ball can 12 . pointer 16 has thin ( 1 / 32 &# 34 ; thick ), rectangular - shaped bar 36 , of length approximately one - half of the diameter of cap 14 , cylindrically - shaped hub 38 dependent from the bottom surface of one end of bar 36 , and , projecting downwardly from hub 38 , short vertical post 40 ( approximately 0 . 063 &# 34 ; long and 0 . 093 &# 34 ; in diameter ), with an enlarged , somewhat pointed , head 42 ( approximately 0 . 078 &# 34 ; long and 0 . 105 &# 34 ; in diameter ). pointer 16 is assembled to cap 14 by forcing head 42 and post 40 through hole 22 so that one end rests on the inner portion of ledge 24 and the other end is rotatably pivoted at the center of panel 18 . head 42 and post 40 are of a much larger diameter than hole 22 . as a consequence , when head 42 and post 40 are forced through hole 22 , that portion of panel 18 immediately surrounding central hole 22 is stretched downward and outward and forms annular skirt 44 around post 40 and base of head 42 , as shown in fig2 . the forces of reaction of the plastic of this annular skirt 44 against its stretched deformation serve to pull head 42 , post 40 , and hub 38 into tight contact with annular skirt 44 . this contact provides frictional resistance to rotation which , while large enough to secure pointer 16 against unintentional movement from its set position , is small enough to allow the force of a single finger tip to reset pointer position when required . the diameter of hub 38 is more than twice that of head 42 , and is sufficient to completely seal off the top surface of annular skirt 44 and so prevent the entry of dirt and moisture into can 12 of tennis balls 46 . however , if for some reason leakage at this seam should occur , the tight fit of annular skirt 44 around post 40 and the base of head 42 provides an additional seal against moisture and dirt contamination of tennis balls 46 within can 12 . pointer 16 is preferably molded as a unitary structure from a plastic material which is harder than the plastic of cap 14 , for example nylon or polystyrene . the choice of harder plastic for pointer 16 facilitates the effective formation of the pivot structure described above ; yet it allows pointer 16 to be flexed easily when closure 10 is snapped on , or snapped off , a tennis ball can 12 , because pointer bar 36 of pointer 16 10 is relatively thin ( 1 / 32 &# 34 ;). in spite of the thinness of pointer bar 36 , however , the tip of a person &# 39 ; s finger can effect substantial engagement with the edge of pointer bar 36 in order to reset the latter &# 39 ; s position , because bar 36 is supported some distance ( approximately 50 mils ) above the surface of panel 18 by ledge 24 at one end and by hub 38 at its other end . rib 26 , which runs around the top surface of ledge 24 , is preferably about 35 mils high , and because it is somewhat higher than the thickness of bar 36 , it serves to prevent the adjacent end of bar 36 from being caught or snagged on objects during handling and storage of tennis ball can 12 . additional functions of both ledge 24 and rib 26 are to provide structural rigidity to cap 14 , to help maintain the resilient biasing of peripheral skirt 28 against the side of tennis ball can 12 , and to provide a hinge point to facilitate snapping cap 14 on and off can 12 . as described above , use - monitoring closure 10 is preferably fabricated by the molding of two relatively uncomplicated plastic parts which are then assembled in a single step , i . e ., pushing them together . this simple design allows closure 10 to be manufactured at very low cost . another advantage of both the simplicity and the flexibility of this plastic structure is that it imparts exceptional durability to use - monitoring closure 10 . this durability is especially important because tennis ball cans tend to receive a fair amount of abuse : they get kicked and stepped on on the tennis court , and they get stuffed or thrown into equipment bags , lockers , trunks of cars , and closets . in employing the present invention to monitor the amount of use of his tennis balls , a tennis player can let the numerals on closure 10 represent any unit of measure of use that he finds convenient , such as number of matches , sets , hours , or games played . each time he plays with a particular can of tennis balls , the player would simply increment the setting of pointer 16 by the additional amount of use that the balls have had . because of the analog nature of the use - indication provided by the circularly - disposed indicia 20 on closure 10 , a player can keep track of fractional units of use as well as whole units , where this is appropriate ; e . g . if one is accumulating hours of use , and one plays with the balls for an hour and a half , a pointer setting exactly midway between two digits can represent the half hour . although use indicia 20 consist of just the numerals 0 - 9 , few if any tennis players would find this limiting . the reason is that for almost all tennis players -- with the possible exception of beginners -- tennis balls are completely spent within ten hours or sets of play , and most players are likely to choose one of these units of use ( or the generally larger unit of matches played ) to monitor the condition of their tennis balls , rather than a smaller unit such as games played . in any case , for those rare cases when a can of balls does accumulate more than ten units of play , one can let the pointer begin a new revolution of the dial , and then one must simply recall that the new settings are actually ten more than they read . there will probably be little difficulty in doing this , because a visual inspection should make it obvious whether a ball has for example two hours of play on it or twelve . e . g ., instead of the numerals 0 - 9 , one could have more numerals , e . g ., 0 - 16 , to record larger amounts of usage . also , although in our preferred embodiment the digits 0 through 9 are imprinted around the periphery of central panel 18 , these digits could be imprinted elsewhere on cap 14 , for instance on ledge 24 or on the outside surface of skirt 28 , so long as the registration of pointer 16 with the digits can be clearly ascertained . also , instead of a rotating pointer , one could have a rotatable disk with numbers around its periphery and a registering index mark at the edge of the cap , the disk being either centrally pivoted on the cap or slidably mounted in a circumferential groove or guide ; or an annular ring , similarly numbered and slidably mounted at the periphery of the cap . other alternatives to the rotating pointer of our preferred embodiment could be a marker that , e . g ., slides along a track ( e . g ., circular or linear ) secured to cap 14 , adjacent to indicia ; or a small token that is held to the cap by magnetism and can be moved around to cover up or point to numerals on the cap ; or a movable cover on the cap that covers all except one digit ; or an electronic display device that increments the displayed value when a button is pushed . | 8 |
according to this disclosure a system 10 includes hospital beds 12 of different types as indicated diagrammatically in fig1 . each of beds 12 communicates , either via a wired connection or a wireless connection , with a respective system interface 14 . system interfaces 14 also may be of different types , although the number of types of interfaces 14 will typically not correspond to the number of bed types . accordingly , fig1 suggests that there may be “ n ” bed types and “ m ” system interface types . for example , system interfaces 14 that are able to communicate with multiple different types of hospital beds 12 are contemplated by this disclosure . thus , n may be greater than , less than , or equal to m according to different embodiments contemplated by this disclosure . system interfaces 14 are communicatively coupled via information technology ( it ) infrastructure 16 with a bed data manager 18 . bed data manager 18 is sometimes referred to herein as bed data manager server 18 or simply as server 18 . server 18 receives bed data sent from beds 12 of the various types and normalizes the bed data into a common format for storage in a database that is either included in server 18 or associated with server 18 . end user computer devices 20 access the normalized bed data via the it infrastructure 16 . according to this disclosure , server 18 has software that permits end users of computer devices 20 to select a particular communication protocol from among a plurality of available communication protocols that the normalized data is to be provided to each respective end user computer device 20 . as suggested in fig1 , there may be up to “ x ” end user computer devices 20 that receive normalized bed data according to a selected communication protocol from server 18 . the number x of end user computer devices 20 may be greater than , less than , or equal to m and / or n according to different embodiments contemplated by this disclosure . in some embodiments , server 18 is configured to receive bed data from up to five hundred ( 500 ) beds 12 . as also shown diagrammatically in fig1 , server 18 is configured to transmit bed data to computer devices 22 in a raw data format . that is , the bed data is transmitted to computer devices 22 in the same format as it is received from the various beds 12 . server 18 communicates with one or more of computer devices 22 via it infrastructure 16 in some embodiments . alternatively or additionally , server 18 communicates with one or more computer devices 22 via a dedicated communication link 24 which may be a wired datalink or wireless datalink according to this disclosure . just to be clear , in some embodiments , one group of computer devices 22 may communicate with server 18 via it infrastructure 16 and another group of computer devices 22 may communicate with server 18 via respective dedicated communication links 24 . similarly , some or all of end user computer devices 20 may communicate with server 18 via dedicated communication links ( not shown ) in lieu of it infrastructure 16 . the computer devices 20 , 22 communicating via dedicated communication links are co - located with server 18 , in some instances , thereby enabling a direct wired connection to server 18 . it infrastructure 16 , as illustrated diagrammatically in fig1 , is intended to encompass the various other hardware and software that exists in a facility , such as a healthcare facility , or across multiple facilities , that permits computer devices , such as beds 12 , system interfaces 14 , computer devices 20 , 22 , and so forth to communicate with at least one other computer device . it infrastructure typically includes things such as gateways , routers , servers , transmitters , receivers , transceivers , wiring , connection ports , and so on . the hardware and software of the it infrastructure is typically acquired and installed in a facility at a time different than the time at which a facility may acquire and install beds 12 , interfaces 14 , server 18 , and computer devices 20 , 22 . in some embodiments , server 18 transmits raw bed data to computer devices 22 at the same frequency with which it is received from the various beds 12 . thus , if beds 12 are transmitting bed data at a time interval of , say , every 100 milliseconds , then server 18 , in turn , transmits the bed data to computer devices 22 about every 100 milliseconds . accordingly , it is contemplated that users who wish to receive bed data in its raw format at such high frequency must subscribe to server 18 for this purpose . in contrast and as will be discussed in further detail below , users of computer devices 20 typically will not wish to receive bed data as frequently as it is received by server 18 . according to this disclosure , therefore , users of computer devices 20 are able to select the frequency at which server 18 transmits bed data to their respective computer devices 20 . the time interval or frequency at which server 18 transmits bed data to computers 20 can vary from computer 20 to computer 20 according to this disclosure . system interfaces 14 may sometimes include bed interface units ( biu &# 39 ; s ), network interface units ( niu &# 39 ; s ), or wireless interface units ( wiu &# 39 ; s ) of the type available from hill - rom company , inc . discussion of the functionality and details of biu &# 39 ; s , niu &# 39 ; s and wiu &# 39 ; s may be found in u . s . pat . nos . 7 , 868 , 740 ; 7 , 852 , 208 ; 7 , 746 , 218 ; 7 , 538 , 659 and 7 , 319 , 386 and in u . s . patent application publication nos . 2009 / 0217080 ; 2009 / 0214009 ; 2009 / 0212956 ; and 2009 / 0212925 , for example , each of which is hereby incorporated herein by reference . other types of system interfaces 14 include ethernet ports such as rj - 45 connector ports as well as rs - 232 ports or the like . wireless access points ( wap &# 39 ; s ) are also considered to be system interfaces 14 according to this disclosure . hospital beds 12 are of different types as previously mentioned . the term hospital bed as used herein , including in the claims , is intended to cover beds of all types and in all environments , not just those found in hospitals . of course , the beds 12 contemplated herein have the ability to communicate bed data to remote computer devices . in some instances , the beds 12 are also able to receive data or commands from remote computer devices . it will be appreciated that each different type of bed 12 typically will communicate different types of data and the data may be formatted in different ways . table 1 below is an example of the type of bed data that is available from six different types of hospital beds 12 . in the example of table 1 , bed type 1 is the totalcare ® bed , bed type 2 is the versacare ® bed , bed type 3 is the careassist ® es bed , bed type 4 is the advanta ™ 2 bed , bed type 5 is the advance ™ bed , and bed type 6 is the advanta ™ bed , each of which is or was marketed by hill - rom company , inc . beds 12 of other types which have other types of bed data are , of course , within scope of this disclosure . based on table 1 , it will be appreciated that the number of bits being transmitted from beds 12 of different types may vary widely depending upon the amount of information to be conveyed . according to one embodiment of system 10 contemplated by this disclosure , server 18 is capable of receiving data from up to five hundred ( 500 ) beds 12 . referring now to fig2 a and 2b , various software modules are shown diagrammatically as being included in bed data manager server 18 . the various modules comprise software code having the associated functions as herein described and as further explained in one or more of the attached appendices , which are considered to be part of the written description of this provisional patent application . in some embodiments , the modules may be included in separate software packages that are installed in the memory of server 18 via copying from associated disks or uploaded separately to server 18 from one or more other computer devices . in other embodiments , the modules are included in a single software package or software routine such that each module is a sub - portion or subroutine of the overall routine . regardless of whether the modules described below are provided to server 18 in a piecemeal fashion or as a single , large software routine , the modules work together to perform the functions described herein . server 18 executes the instructions included in the software modules stored in memory of server 18 . as shown in fig2 b , the software stored in memory of server 18 includes an application server 2 module 26 which , in turn , includes an operating system services host environment module 28 and a cross - cutting module 30 . cross - cutting module 30 includes a system coordination service module 32 . operating system services host environment module 28 includes a data services layer module 34 , a business logic layer module 36 and a data access layer module 38 . the data access layer module 38 includes a bed interface services module 40 which includes interface service 1 through m modules 42 . modules 42 include the software that allows server 18 to receive bed data from the various system interfaces 14 . in fig2 a and 2b , the it infrastructure 16 is omitted . business logic layer module 36 includes a data normalization service module 44 and a command arbitration service module 46 . the data normalization service module 44 includes the software instructions that , when executed , normalizes the incoming bed data from the various bed types 12 into a common format . such software instructions for normalizing the bed data , therefore , rearranges and modifies the incoming bits and bytes of data into a single , common format . the command arbitration service module 46 includes software instructions that when executed , passes the bed data in its raw format ( i . e ., the format in which it is received from each bed 12 ) to a data distribution service ( publish / subscribe ) module 48 of a data services layer module 34 which , in turn , publishes or sends the raw bed data to one or more computer devices 22 that have subscribed to receive such raw bed data . command arbitration service module 46 also includes software instructions that , when executed , passes bed command messages received from computer devices 22 to the bed 12 for which the bed command message is designated . module 46 sends each bed command message to module 40 which , in turn , sends the bed command message through the appropriate module 42 and system interface 14 to the appropriate bed 12 . as indicated diagrammatically in fig2 b , the illustrative computer device 22 includes a bed command provider module 49 which includes the software that , when executed , sends the bed command messages to module 48 of server 18 . in some embodiments , the programming of module 49 is done by the same party that manufactures one or more of the various bed types 12 and is installed specifically on computer device 22 as its own software package or as part of a larger software package . in other embodiments , module 49 is uploaded to computer device 22 from server 18 . an example of a bed command that is sent from computer devices 22 to beds 12 include commands to arm or disarm a patient position monitoring system of the bed 12 . computer devices 22 that do not contain module 49 are within in the scope of this disclosure . that is , systems 10 in which some , all , or none of computer devices 22 include module 49 are contemplated by this disclosure . data services layer module 34 also includes a data persistence service module 50 . server 18 includes a database server module 52 which includes , for example , an sql server module 54 which has an sql database 56 . data persistence service module 50 passes normalized bed data to the sql database 56 for storage . in some embodiments , as bed data from a particular bed 12 changes , the sql database 56 is updated only with the changing data and the other , unchanged data remains . in other embodiments , the sql database 56 is updated with all of the bed data received from each of the beds 12 regardless of whether some of the data has not changed from the prior data transmission from a particular bed . server 18 also includes an application server 1 module 58 which includes a web server module 60 as shown in fig2 a . module 60 , in turn , includes a services layer module 62 , a business logic layer module 64 and a data access layer module 66 . module 66 includes an ado . net entity framework data model module 68 which further includes an ado . net entity framework database connection module 70 that interfaces with sql server module 54 to obtain normalized bed data . module 66 also includes an entity relationships module 72 to maintain entity relationships , an entity contexts module 74 to maintain entity contexts , and a data access entities module 76 . business logic layer module 64 includes a domain services module 78 , a server - side data validation logic module 80 , a server - side business rules module 82 , a business entities module 84 , and an entity metadata module 86 . the domain services module 78 interfaces with the ado . net entity framework data model module 68 as shown in fig2 a . services layer module 62 include a wcf ria services server module 88 and communication service 1 through y modules 90 . module 88 interfaces with module 78 . modules 90 communicate with each computer device 20 that desires to receive normalized bed data according to a respective data communication protocol associated with each of communication service 1 through y modules 90 . according to this disclosure , the number “ x ” of computer devices 20 in system 10 may be greater than , equal to , or less than the number “ y ” of communication service modules 90 . in the illustrative example , communication service 1 module 90 communicates with computer 20 . it should be understood , based on this disclosure , that each of modules 90 may be in communication with a multitude of computer devices 20 even though fig2 a illustrates only one module 90 communicating with one computer device 20 . in some embodiments , modules 90 of server 18 include two modules 90 that communicate normalized bed data according to two different communication protocols . in some such embodiments , the communication protocols include an odata atom protocol and a json endpoint protocol . computer devices 20 may be included as part of an electronic medical records ( emr ) system , an admission / discharge / transfer ( adt ) system , a workflow system , a nurse call system , or any other computer system for which there is a reason to consume , have access to , or store bed data from beds 12 . as also shown in fig2 a computer device 20 includes a web browser module 92 with a plugin container module 94 . according to this disclosure , modules 90 of server 18 upload software plug - ins to each plugin container module 94 of computer devices 20 . in the illustrative example , the software plug - ins uploaded via the associated communication service 1 module 90 includes a presentation layer [ views ] module 96 , a business logic layer [ viewmodels ] module 98 , and a data access layer [ models ] module 100 . module 100 includes a domain context module 102 and a wcf ria services client module 104 which , in the illustrative example , is communicatively coupled to communication service 1 module 90 . module 98 includes a viewmodels module 106 , a client - side business rules module 108 , a shared code ( from server ) module 110 , and a client - side data validation logic module 112 . module 106 and module 102 exchange data as indicated in fig2 a . module 96 includes an xaml module 114 and an xaml code - behind module 116 . modules 114 , 116 each exchange data with module 106 . modules 96 , 98 , 100 , 102 , 104 , 106 , 108 , 110 , 112 , 114 , 116 cooperate to access and display bed data on the display screen of computer device 20 . as indicated above , computer device 20 is used to select the communication protocol which is desired from among the various available communication protocols associated with communication service 1 through y modules 90 . referring now to fig3 , an example of a screen shot of a bed data screen 120 having bed data displayed on a display screen of one of the end user devices 20 is shown . screen 120 includes a view selector box 122 having an arrow 124 that can be selected for a drop down menu of additional types of views . in the example of fig3 , a “ bed view ” is shown which has bed data shown in table 126 . a refresh button 128 is provided on screen 120 next to box 124 . selection of button 128 results in the data of table 126 being updated with the most current data . screen 120 also has a manage settings button 130 that is selected to customize the type of data to be displayed in table 126 . it will be appreciated that any of the various types of data listed above in table 1 is selectable for inclusion in table 126 of screen 120 . in the illustrative example of fig3 , table 126 includes a bed id column 132 in which the bed type is indicated in text ( e . g ., “ totalcare ”) and in which the assigned bed identification number for the particular bed is indicated after a hyphen , an assigned location column 134 which indicates the bed &# 39 ; s location in the healthcare facility , an assigned patient column 136 which indicates the patient assigned to the particular bed , a bed connector id column 138 in which the type of system interface 14 is indicated in text ( e . g ., niu ) and in which the associated identification number for the system interface 14 is indicated after a hyphen , a connection state column 140 which includes icons 141 that indicate whether or not each bed is properly connected to server 18 via interface 14 , a bed position column 142 which indicates whether or not an upper frame of each bed 12 is in its lowest position , and a head rails position column 144 which has text indicative of the position of the siderails of the associated bed 12 . left and right scroll arrows 146 , 148 are provided to scroll on table 126 to see additional columns that are hidden from view . up and down scroll arrows 150 , 152 are provided to scroll up and down table 126 to see additional rows that are hidden from view . alternatively , a paging control box 154 is provided with numbers ( e . g ., 1 - 5 ) which are selectable to jump to additional pages of table 126 and with arrows that are selectable to go forward or back by one page or to jump to the last page or first page of table 126 . finally , screen 120 includes a history window 156 beneath table 126 which shows the date and time at which table 126 was populated with bed data . in the illustrative example of window 156 of screen 120 , it is indicated that bed data was retrieved from server 18 by the computer device 20 displaying screen 120 on mar . 7 , 2011 at 2 : 19 : 42 pm and then again on mar . 7 , 2011 at 2 : 19 : 47 pm . thus , in the illustrative example , computer device 20 is configured to receive and / or retrieve the bed data every five ( 5 ) seconds . according to this disclosure , the frequency at which each computer device is able to retrieve or receive bed data is selectable . when a user is first setting up and configuring the software of an associated computer 20 , after a successful initial login , a manage application settings screen 160 appears on the display of computer device 20 as shown , for example , in fig4 . 100571 a text block 162 is provided in a manage application settings window 164 of screen 160 . the end user types in block 162 a polling interval , in milliseconds ( ms ), at which bed data is communicated to or retrieved by the respective end user device 20 . in the illustrative example of fig4 , one thousand ( 1 , 000 ) ms has been entered in box 162 . window 164 further includes a service root uri text block 166 in which the universal resource identifier ( uri ) of server 18 with which the associated computer device 20 will interact is indicated . if server 18 comprises multiple server devices ( e . g ., the application server 1 module 58 is on one server , the database server module 52 is on another server , and the application server 2 module 26 is on yet another server , with the three servers communicatively coupled ), then the uri entered into block 166 should be the server that includes the selected communication service 1 through y module 90 . in block 166 , the text string preceding the “. svc ” is what determines which of communication service 1 through y modules 90 has been selected by the end user . in window 164 , text boxes 162 , 166 appear when a user selects a service settings menu bar 168 . window 164 also includes a version information window bar 170 and a general user settings menu bar 172 . if the user selects bar 170 , information about the software version uploaded to the user &# 39 ; s computer device 20 in modules 96 , 98 , 100 , for example , is shown . if the user selects bar 172 , the user is able to toggle history window 156 on and off via selection of check boxes or radio buttons or the like that appear in an associated drop down window . after the user finishes making the selections and entering the relevant information in boxes 162 , 166 , the user selects an ok button 174 to close window 164 . in the illustrative example of fig4 , the text “ location view ” appears in the view selector box 122 . details of the location view are discussed below in connection with fig6 and 7 . referring now to fig5 , a screen which is similar to fig3 , but which illustrates a couple additional features available on the bed data screen 120 , is shown . one additional feature allows a user to right click on the table header row 176 which results in a bed column chooser box 178 to appear on table 126 . the term “ right click ” means that a user has placed a cursor over row 176 using a computer mouse and then clicked on a mouse button that is on the right hand side of the mouse as is generally understood by those familiar with a computer mouse . by selecting the bed column chooser box 178 , a pop up window ( not shown ) appears with the list of all of the available bed column names that may be displayed in the bed view . the user then selects or deselects the various bed columns names using a check box or radio button or the like . based on the description above , it will be understood that if a user selects more columns than can be seen in table 126 at the same time , then the left and right scroll arrows 146 , 148 appear to permit a user to scroll to the unseen columns as desired . another feature of the bed data screen 120 shown in fig5 is a polling window 180 . polling window 180 appears in table 126 when a user selects a particular row of bed data on table 126 via a left mouse click , for example , or by using up and down arrow keys of a tab key to highlight a particular row of bed data then hitting the enter key of a keyboard of the respective computer device 20 . when the polling window 180 appears , the selected row is now live in the sense that it will get bed data updates in near real - time . that is , the data for the particular bed will be updated at the frequency that the data is transmitted from the respective bed 12 rather than being updated at the frequency selected using box 162 on screen 160 . by “ near real - time ” it is intended to mean in approximately real - time taking into account the data processing delays that inherently exist as server 18 and computer 20 process the bed data through the various software modules . this is a practical feature when monitoring a single bed 12 for data updates because it eliminates the need to continuously or repeatedly select the refresh button 128 . referring now to fig6 , when a user selects the location view from the drop down menu that appears near box 122 in response to icon 124 being selected , an association screen 190 appears on the display screen of the respective computer device 20 . association screen 190 includes an association table 192 which , in turn , includes an assigned location id column 194 , an assigned location name column 196 , an assigned bed connector column 198 , an assigned bed column 200 , and an assigned patient column 202 . according to this disclosure , an authorized user of computer device 20 is able to add , update , and delete data appearing in table 192 . thus , table 192 is used to create the associations between location id &# 39 ; s , location names , the id &# 39 ; s of system interfaces 14 , the id &# 39 ; s of beds 12 , and the patients assigned to beds 12 . if table 192 has more rows of information than can be seen at one time , a paging control box 199 is provided to navigate to the additional rows of information by selecting the forward or back arrows or by selecting the page number appearing in box 199 . in the illustrative example of table 192 in fig6 , the location names appearing in column 196 match the location id &# 39 ; s appearing in column 194 . however , this need not be the case such that a particular healthcare facility may have location names that are different than the location id &# 39 ; s . also , the manner in which the assigned patient is indicated in column 202 may be in any number of formats not just one the shown . thus , rather than pat - 001 for the assigned patient , a common alternative is “ sm . . . jo ” which has the first two letters of the patient &# 39 ; s last name and first two letters of the patient &# 39 ; s first name separated by ellipses . of course , some other manner of indicating an assigned patient , such as a patient &# 39 ; s full name , could be used , if desired , in column 202 . screen 190 includes an add location button 204 that is selected to add a new location to the list in table 192 . screen 190 also includes an edit icon or button 206 and a delete icon or button 208 in each row of column 194 . if delete button 208 is selected , the information appearing in the associated row of table 192 is deleted . if button 204 or button 206 is selected , then a pop - up window 210 appears on screen 190 as shown , for example , in fig7 . however , if button 204 is selected to add a location to table 192 , then the various text boxes of window 210 are blank , whereas if button 206 is selected to edit the information of a location already appearing in table 192 , then the various text boxes are filled with the current data from table 192 from the associated row of table 190 for which icon 206 was selected . window 210 includes a location id text box 212 , a location name text box 214 , a bed connector id text box 216 and a patient id text box 218 as shown in fig7 . the user of computer device 20 types into boxes 212 , 214 whatever location id and location name , respectively , the user wishes to type in those boxes . it will be appreciated that different healthcare facilities will have their own conventions for designating location id &# 39 ; s and location names . boxes 216 , 218 each have a respective menu drop down arrow 220 that can be selected to retrieve a list of the bed connector id &# 39 ; s ( e . g ., the type and serial number of the system interfaces 14 that are in communication with computer device 20 via server 18 ) and a list of patient &# 39 ; s that are available for associating with the room location . selection of one the bed connector id &# 39 ; s corresponding to one of the system interfaces 14 in window 210 will automatically cause the associated bed id to appear in column 200 of table 192 and in column 132 of table 126 since each system interface 14 is coupled to a corresponding bed 12 . window 210 has a save button 222 and a cancel button 224 as shown in fig7 . after the user of computer device 20 has filled in boxes 212 , 214 , 216 , 218 with the desired information , the user selects button 222 to save the entered information . if the user had selected add location button 204 then the saved information appears as a new row in table 198 , otherwise if the user was editing an existing row of table 198 , then the saved information appears in the edited row . alternatively , if the user does not wish to save the information entered into boxes 212 , 214 , 216 , 218 , the user selects button 224 and the user will close out of window 210 without the information in boxes 212 , 214 , 216 , 218 being added or modified on table 198 . additional details of system 10 , server 18 and the various software modules of server 18 , including those uploaded to computer devices 20 , can be found in the seven ( 7 ) appendices of u . s . provisional application no . 61 / 494 , 569 which appendices have already been incorporated by reference herein by virtue of the incorporation by reference of u . s . provisional application no . 61 / 494 , 569 . although certain embodiments have been described in detail above , variations and modifications exist within the scope and spirit of this disclosure as described and as defined in the following claims . | 7 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.