Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Rewrite this program in Python while keeping its functionality equivalent to the Go version. | package main
import (
"fmt"
"rcu"
)
func main() {
primes := rcu.Primes(999)
sum, n, c := 0, 0, 0
fmt.Println("Summing the first n primes (<1,000) where the sum is itself prime:")
fmt.Println(" n cumulative sum")
for _, p := range primes {
n++
sum += p
if rcu.IsPrime(sum) {
c++
fmt.Printf("%3d %6s\n", n, rcu.Commatize(sum))
}
}
fmt.Println()
fmt.Println(c, "such prime sums found")
}
|
from itertools import accumulate, chain, takewhile
def primeSums():
return (
x for x in enumerate(
accumulate(
chain([(0, 0)], primes()),
lambda a, p: (p, p + a[1])
)
) if isPrime(x[1][1])
)
def main():
for x in takewhile(
lambda t: 1000 > t[1][0],
primeSums()
):
print(f'{x[0]} -> {x[1][1]}')
def isPrime(n):
if n in (2, 3):
return True
if 2 > n or 0 == n % 2:
return False
if 9 > n:
return True
if 0 == n % 3:
return False
def p(x):
return 0 == n % x or 0 == n % (2 + x)
return not any(map(p, range(5, 1 + int(n ** 0.5), 6)))
def primes():
n = 2
dct = {}
while True:
if n in dct:
for p in dct[n]:
dct.setdefault(n + p, []).append(p)
del dct[n]
else:
yield n
dct[n * n] = [n]
n = 1 + n
if __name__ == '__main__':
main()
|
Keep all operations the same but rewrite the snippet in Python. | package main
import (
"fmt"
"sort"
)
func distinctSortedUnion(ll [][]int) []int {
var res []int
for _, l := range ll {
res = append(res, l...)
}
set := make(map[int]bool)
for _, e := range res {
set[e] = true
}
res = res[:0]
for key := range set {
res = append(res, key)
}
sort.Ints(res)
return res
}
func main() {
ll := [][]int{{5, 1, 3, 8, 9, 4, 8, 7}, {3, 5, 9, 8, 4}, {1, 3, 7, 9}}
fmt.Println("Distinct sorted union of", ll, "is:")
fmt.Println(distinctSortedUnion(ll))
}
|
from itertools import chain
def main():
print(
sorted(nub(concat([
[5, 1, 3, 8, 9, 4, 8, 7],
[3, 5, 9, 8, 4],
[1, 3, 7, 9]
])))
)
def concat(xs):
return list(chain(*xs))
def nub(xs):
return list(dict.fromkeys(xs))
if __name__ == '__main__':
main()
|
Rewrite the snippet below in Python so it works the same as the original Go code. | package main
import (
"fmt"
"sort"
)
func distinctSortedUnion(ll [][]int) []int {
var res []int
for _, l := range ll {
res = append(res, l...)
}
set := make(map[int]bool)
for _, e := range res {
set[e] = true
}
res = res[:0]
for key := range set {
res = append(res, key)
}
sort.Ints(res)
return res
}
func main() {
ll := [][]int{{5, 1, 3, 8, 9, 4, 8, 7}, {3, 5, 9, 8, 4}, {1, 3, 7, 9}}
fmt.Println("Distinct sorted union of", ll, "is:")
fmt.Println(distinctSortedUnion(ll))
}
|
from itertools import chain
def main():
print(
sorted(nub(concat([
[5, 1, 3, 8, 9, 4, 8, 7],
[3, 5, 9, 8, 4],
[1, 3, 7, 9]
])))
)
def concat(xs):
return list(chain(*xs))
def nub(xs):
return list(dict.fromkeys(xs))
if __name__ == '__main__':
main()
|
Preserve the algorithm and functionality while converting the code from Go to Python. | package main
import (
"fmt"
"sort"
)
func distinctSortedUnion(ll [][]int) []int {
var res []int
for _, l := range ll {
res = append(res, l...)
}
set := make(map[int]bool)
for _, e := range res {
set[e] = true
}
res = res[:0]
for key := range set {
res = append(res, key)
}
sort.Ints(res)
return res
}
func main() {
ll := [][]int{{5, 1, 3, 8, 9, 4, 8, 7}, {3, 5, 9, 8, 4}, {1, 3, 7, 9}}
fmt.Println("Distinct sorted union of", ll, "is:")
fmt.Println(distinctSortedUnion(ll))
}
|
from itertools import chain
def main():
print(
sorted(nub(concat([
[5, 1, 3, 8, 9, 4, 8, 7],
[3, 5, 9, 8, 4],
[1, 3, 7, 9]
])))
)
def concat(xs):
return list(chain(*xs))
def nub(xs):
return list(dict.fromkeys(xs))
if __name__ == '__main__':
main()
|
Maintain the same structure and functionality when rewriting this code in Python. | package main
import "fmt"
const (
m = iota
c
cm
cmc
)
func ncs(s []int) [][]int {
if len(s) < 3 {
return nil
}
return append(n2(nil, s[1:], m), n2([]int{s[0]}, s[1:], c)...)
}
var skip = []int{m, cm, cm, cmc}
var incl = []int{c, c, cmc, cmc}
func n2(ss, tail []int, seq int) [][]int {
if len(tail) == 0 {
if seq != cmc {
return nil
}
return [][]int{ss}
}
return append(n2(append([]int{}, ss...), tail[1:], skip[seq]),
n2(append(ss, tail[0]), tail[1:], incl[seq])...)
}
func main() {
ss := ncs([]int{1, 2, 3, 4})
fmt.Println(len(ss), "non-continuous subsequences:")
for _, s := range ss {
fmt.Println(" ", s)
}
}
| def ncsub(seq, s=0):
if seq:
x = seq[:1]
xs = seq[1:]
p2 = s % 2
p1 = not p2
return [x + ys for ys in ncsub(xs, s + p1)] + ncsub(xs, s + p2)
else:
return [[]] if s >= 3 else []
|
Write the same code in Python as shown below in Go. | package main
import "fmt"
const (
m = iota
c
cm
cmc
)
func ncs(s []int) [][]int {
if len(s) < 3 {
return nil
}
return append(n2(nil, s[1:], m), n2([]int{s[0]}, s[1:], c)...)
}
var skip = []int{m, cm, cm, cmc}
var incl = []int{c, c, cmc, cmc}
func n2(ss, tail []int, seq int) [][]int {
if len(tail) == 0 {
if seq != cmc {
return nil
}
return [][]int{ss}
}
return append(n2(append([]int{}, ss...), tail[1:], skip[seq]),
n2(append(ss, tail[0]), tail[1:], incl[seq])...)
}
func main() {
ss := ncs([]int{1, 2, 3, 4})
fmt.Println(len(ss), "non-continuous subsequences:")
for _, s := range ss {
fmt.Println(" ", s)
}
}
| def ncsub(seq, s=0):
if seq:
x = seq[:1]
xs = seq[1:]
p2 = s % 2
p1 = not p2
return [x + ys for ys in ncsub(xs, s + p1)] + ncsub(xs, s + p2)
else:
return [[]] if s >= 3 else []
|
Generate an equivalent Python version of this Go code. | package main
import (
"github.com/fogleman/gg"
"strings"
)
func wordFractal(i int) string {
if i < 2 {
if i == 1 {
return "1"
}
return ""
}
var f1 strings.Builder
f1.WriteString("1")
var f2 strings.Builder
f2.WriteString("0")
for j := i - 2; j >= 1; j-- {
tmp := f2.String()
f2.WriteString(f1.String())
f1.Reset()
f1.WriteString(tmp)
}
return f2.String()
}
func draw(dc *gg.Context, x, y, dx, dy float64, wf string) {
for i, c := range wf {
dc.DrawLine(x, y, x+dx, y+dy)
x += dx
y += dy
if c == '0' {
tx := dx
dx = dy
if i%2 == 0 {
dx = -dy
}
dy = -tx
if i%2 == 0 {
dy = tx
}
}
}
}
func main() {
dc := gg.NewContext(450, 620)
dc.SetRGB(0, 0, 0)
dc.Clear()
wf := wordFractal(23)
draw(dc, 20, 20, 1, 0, wf)
dc.SetRGB(0, 1, 0)
dc.SetLineWidth(1)
dc.Stroke()
dc.SavePNG("fib_wordfractal.png")
}
| from functools import wraps
from turtle import *
def memoize(obj):
cache = obj.cache = {}
@wraps(obj)
def memoizer(*args, **kwargs):
key = str(args) + str(kwargs)
if key not in cache:
cache[key] = obj(*args, **kwargs)
return cache[key]
return memoizer
@memoize
def fibonacci_word(n):
assert n > 0
if n == 1:
return "1"
if n == 2:
return "0"
return fibonacci_word(n - 1) + fibonacci_word(n - 2)
def draw_fractal(word, step):
for i, c in enumerate(word, 1):
forward(step)
if c == "0":
if i % 2 == 0:
left(90)
else:
right(90)
def main():
n = 25
step = 1
width = 1050
height = 1050
w = fibonacci_word(n)
setup(width=width, height=height)
speed(0)
setheading(90)
left(90)
penup()
forward(500)
right(90)
backward(500)
pendown()
tracer(10000)
hideturtle()
draw_fractal(w, step)
getscreen().getcanvas().postscript(file="fibonacci_word_fractal.eps")
exitonclick()
if __name__ == '__main__':
main()
|
Generate an equivalent Python version of this Go code. | package main
import "fmt"
func sieve(limit uint64) []bool {
limit++
c := make([]bool, limit)
c[0] = true
c[1] = true
p := uint64(3)
for {
p2 := p * p
if p2 >= limit {
break
}
for i := p2; i < limit; i += 2 * p {
c[i] = true
}
for {
p += 2
if !c[p] {
break
}
}
}
return c
}
func commatize(n int) string {
s := fmt.Sprintf("%d", n)
if n < 0 {
s = s[1:]
}
le := len(s)
for i := le - 3; i >= 1; i -= 3 {
s = s[0:i] + "," + s[i:]
}
if n >= 0 {
return s
}
return "-" + s
}
func main() {
c := sieve(1e10 - 1)
limit := 10
start := 3
twins := 0
for i := 1; i < 11; i++ {
for i := start; i < limit; i += 2 {
if !c[i] && !c[i-2] {
twins++
}
}
fmt.Printf("Under %14s there are %10s pairs of twin primes.\n", commatize(limit), commatize(twins))
start = limit + 1
limit *= 10
}
}
| primes = [2, 3, 5, 7, 11, 13, 17, 19]
def count_twin_primes(limit: int) -> int:
global primes
if limit > primes[-1]:
ram_limit = primes[-1] + 90000000 - len(primes)
reasonable_limit = min(limit, primes[-1] ** 2, ram_limit) - 1
while reasonable_limit < limit:
ram_limit = primes[-1] + 90000000 - len(primes)
if ram_limit > primes[-1]:
reasonable_limit = min(limit, primes[-1] ** 2, ram_limit)
else:
reasonable_limit = min(limit, primes[-1] ** 2)
sieve = list({x for prime in primes for x in
range(primes[-1] + prime - (primes[-1] % prime), reasonable_limit, prime)})
primes += [x - 1 for i, x in enumerate(sieve) if i and x - 1 != sieve[i - 1] and x - 1 < limit]
count = len([(x, y) for (x, y) in zip(primes, primes[1:]) if x + 2 == y])
return count
def test(limit: int):
count = count_twin_primes(limit)
print(f"Number of twin prime pairs less than {limit} is {count}\n")
test(10)
test(100)
test(1000)
test(10000)
test(100000)
test(1000000)
test(10000000)
test(100000000)
|
Please provide an equivalent version of this Go code in Python. | package main
import "fmt"
var (
Nr = [16]int{3, 0, 0, 0, 0, 1, 1, 1, 1, 2, 2, 2, 2, 3, 3, 3}
Nc = [16]int{3, 0, 1, 2, 3, 0, 1, 2, 3, 0, 1, 2, 3, 0, 1, 2}
)
var (
n, _n int
N0, N3, N4 [85]int
N2 [85]uint64
)
const (
i = 1
g = 8
e = 2
l = 4
)
func fY() bool {
if N2[n] == 0x123456789abcdef0 {
return true
}
if N4[n] <= _n {
return fN()
}
return false
}
func fZ(w int) bool {
if w&i > 0 {
fI()
if fY() {
return true
}
n--
}
if w&g > 0 {
fG()
if fY() {
return true
}
n--
}
if w&e > 0 {
fE()
if fY() {
return true
}
n--
}
if w&l > 0 {
fL()
if fY() {
return true
}
n--
}
return false
}
func fN() bool {
switch N0[n] {
case 0:
switch N3[n] {
case 'l':
return fZ(i)
case 'u':
return fZ(e)
default:
return fZ(i + e)
}
case 3:
switch N3[n] {
case 'r':
return fZ(i)
case 'u':
return fZ(l)
default:
return fZ(i + l)
}
case 1, 2:
switch N3[n] {
case 'l':
return fZ(i + l)
case 'r':
return fZ(i + e)
case 'u':
return fZ(e + l)
default:
return fZ(l + e + i)
}
case 12:
switch N3[n] {
case 'l':
return fZ(g)
case 'd':
return fZ(e)
default:
return fZ(e + g)
}
case 15:
switch N3[n] {
case 'r':
return fZ(g)
case 'd':
return fZ(l)
default:
return fZ(g + l)
}
case 13, 14:
switch N3[n] {
case 'l':
return fZ(g + l)
case 'r':
return fZ(e + g)
case 'd':
return fZ(e + l)
default:
return fZ(g + e + l)
}
case 4, 8:
switch N3[n] {
case 'l':
return fZ(i + g)
case 'u':
return fZ(g + e)
case 'd':
return fZ(i + e)
default:
return fZ(i + g + e)
}
case 7, 11:
switch N3[n] {
case 'd':
return fZ(i + l)
case 'u':
return fZ(g + l)
case 'r':
return fZ(i + g)
default:
return fZ(i + g + l)
}
default:
switch N3[n] {
case 'd':
return fZ(i + e + l)
case 'l':
return fZ(i + g + l)
case 'r':
return fZ(i + g + e)
case 'u':
return fZ(g + e + l)
default:
return fZ(i + g + e + l)
}
}
}
func fI() {
g := (11 - N0[n]) * 4
a := N2[n] & uint64(15<<uint(g))
N0[n+1] = N0[n] + 4
N2[n+1] = N2[n] - a + (a << 16)
N3[n+1] = 'd'
N4[n+1] = N4[n]
cond := Nr[a>>uint(g)] <= N0[n]/4
if !cond {
N4[n+1]++
}
n++
}
func fG() {
g := (19 - N0[n]) * 4
a := N2[n] & uint64(15<<uint(g))
N0[n+1] = N0[n] - 4
N2[n+1] = N2[n] - a + (a >> 16)
N3[n+1] = 'u'
N4[n+1] = N4[n]
cond := Nr[a>>uint(g)] >= N0[n]/4
if !cond {
N4[n+1]++
}
n++
}
func fE() {
g := (14 - N0[n]) * 4
a := N2[n] & uint64(15<<uint(g))
N0[n+1] = N0[n] + 1
N2[n+1] = N2[n] - a + (a << 4)
N3[n+1] = 'r'
N4[n+1] = N4[n]
cond := Nc[a>>uint(g)] <= N0[n]%4
if !cond {
N4[n+1]++
}
n++
}
func fL() {
g := (16 - N0[n]) * 4
a := N2[n] & uint64(15<<uint(g))
N0[n+1] = N0[n] - 1
N2[n+1] = N2[n] - a + (a >> 4)
N3[n+1] = 'l'
N4[n+1] = N4[n]
cond := Nc[a>>uint(g)] >= N0[n]%4
if !cond {
N4[n+1]++
}
n++
}
func fifteenSolver(n int, g uint64) {
N0[0] = n
N2[0] = g
N4[0] = 0
}
func solve() {
if fN() {
fmt.Print("Solution found in ", n, " moves: ")
for g := 1; g <= n; g++ {
fmt.Printf("%c", N3[g])
}
fmt.Println()
} else {
n = 0
_n++
solve()
}
}
func main() {
fifteenSolver(8, 0xfe169b4c0a73d852)
solve()
}
| import random
class IDAStar:
def __init__(self, h, neighbours):
self.h = h
self.neighbours = neighbours
self.FOUND = object()
def solve(self, root, is_goal, max_cost=None):
self.is_goal = is_goal
self.path = [root]
self.is_in_path = {root}
self.path_descrs = []
self.nodes_evaluated = 0
bound = self.h(root)
while True:
t = self._search(0, bound)
if t is self.FOUND: return self.path, self.path_descrs, bound, self.nodes_evaluated
if t is None: return None
bound = t
def _search(self, g, bound):
self.nodes_evaluated += 1
node = self.path[-1]
f = g + self.h(node)
if f > bound: return f
if self.is_goal(node): return self.FOUND
m = None
for cost, n, descr in self.neighbours(node):
if n in self.is_in_path: continue
self.path.append(n)
self.is_in_path.add(n)
self.path_descrs.append(descr)
t = self._search(g + cost, bound)
if t == self.FOUND: return self.FOUND
if m is None or (t is not None and t < m): m = t
self.path.pop()
self.path_descrs.pop()
self.is_in_path.remove(n)
return m
def slide_solved_state(n):
return tuple(i % (n*n) for i in range(1, n*n+1))
def slide_randomize(p, neighbours):
for _ in range(len(p) ** 2):
_, p, _ = random.choice(list(neighbours(p)))
return p
def slide_neighbours(n):
movelist = []
for gap in range(n*n):
x, y = gap % n, gap // n
moves = []
if x > 0: moves.append(-1)
if x < n-1: moves.append(+1)
if y > 0: moves.append(-n)
if y < n-1: moves.append(+n)
movelist.append(moves)
def neighbours(p):
gap = p.index(0)
l = list(p)
for m in movelist[gap]:
l[gap] = l[gap + m]
l[gap + m] = 0
yield (1, tuple(l), (l[gap], m))
l[gap + m] = l[gap]
l[gap] = 0
return neighbours
def slide_print(p):
n = int(round(len(p) ** 0.5))
l = len(str(n*n))
for i in range(0, len(p), n):
print(" ".join("{:>{}}".format(x, l) for x in p[i:i+n]))
def encode_cfg(cfg, n):
r = 0
b = n.bit_length()
for i in range(len(cfg)):
r |= cfg[i] << (b*i)
return r
def gen_wd_table(n):
goal = [[0] * i + [n] + [0] * (n - 1 - i) for i in range(n)]
goal[-1][-1] = n - 1
goal = tuple(sum(goal, []))
table = {}
to_visit = [(goal, 0, n-1)]
while to_visit:
cfg, cost, e = to_visit.pop(0)
enccfg = encode_cfg(cfg, n)
if enccfg in table: continue
table[enccfg] = cost
for d in [-1, 1]:
if 0 <= e + d < n:
for c in range(n):
if cfg[n*(e+d) + c] > 0:
ncfg = list(cfg)
ncfg[n*(e+d) + c] -= 1
ncfg[n*e + c] += 1
to_visit.append((tuple(ncfg), cost + 1, e+d))
return table
def slide_wd(n, goal):
wd = gen_wd_table(n)
goals = {i : goal.index(i) for i in goal}
b = n.bit_length()
def h(p):
ht = 0
vt = 0
d = 0
for i, c in enumerate(p):
if c == 0: continue
g = goals[c]
xi, yi = i % n, i // n
xg, yg = g % n, g // n
ht += 1 << (b*(n*yi+yg))
vt += 1 << (b*(n*xi+xg))
if yg == yi:
for k in range(i + 1, i - i%n + n):
if p[k] and goals[p[k]] // n == yi and goals[p[k]] < g:
d += 2
if xg == xi:
for k in range(i + n, n * n, n):
if p[k] and goals[p[k]] % n == xi and goals[p[k]] < g:
d += 2
d += wd[ht] + wd[vt]
return d
return h
if __name__ == "__main__":
solved_state = slide_solved_state(4)
neighbours = slide_neighbours(4)
is_goal = lambda p: p == solved_state
tests = [
(15, 14, 1, 6, 9, 11, 4, 12, 0, 10, 7, 3, 13, 8, 5, 2),
]
slide_solver = IDAStar(slide_wd(4, solved_state), neighbours)
for p in tests:
path, moves, cost, num_eval = slide_solver.solve(p, is_goal, 80)
slide_print(p)
print(", ".join({-1: "Left", 1: "Right", -4: "Up", 4: "Down"}[move[1]] for move in moves))
print(cost, num_eval)
|
Generate a Python translation of this Go snippet without changing its computational steps. | package main
import (
"fmt"
"math"
"math/cmplx"
)
func main() {
for n := 2; n <= 5; n++ {
fmt.Printf("%d roots of 1:\n", n)
for _, r := range roots(n) {
fmt.Printf(" %18.15f\n", r)
}
}
}
func roots(n int) []complex128 {
r := make([]complex128, n)
for i := 0; i < n; i++ {
r[i] = cmplx.Rect(1, 2*math.Pi*float64(i)/float64(n))
}
return r
}
| import cmath
class Complex(complex):
def __repr__(self):
rp = '%7.5f' % self.real if not self.pureImag() else ''
ip = '%7.5fj' % self.imag if not self.pureReal() else ''
conj = '' if (
self.pureImag() or self.pureReal() or self.imag < 0.0
) else '+'
return '0.0' if (
self.pureImag() and self.pureReal()
) else rp + conj + ip
def pureImag(self):
return abs(self.real) < 0.000005
def pureReal(self):
return abs(self.imag) < 0.000005
def croots(n):
if n <= 0:
return None
return (Complex(cmath.rect(1, 2 * k * cmath.pi / n)) for k in range(n))
for nr in range(2, 11):
print(nr, list(croots(nr)))
|
Please provide an equivalent version of this Go code in Python. |
package main
import "fmt"
func d(b byte) byte {
if b < '0' || b > '9' {
panic("digit 0-9 expected")
}
return b - '0'
}
func add(x, y string) string {
if len(y) > len(x) {
x, y = y, x
}
b := make([]byte, len(x)+1)
var c byte
for i := 1; i <= len(x); i++ {
if i <= len(y) {
c += d(y[len(y)-i])
}
s := d(x[len(x)-i]) + c
c = s / 10
b[len(b)-i] = (s % 10) + '0'
}
if c == 0 {
return string(b[1:])
}
b[0] = c + '0'
return string(b)
}
func mulDigit(x string, y byte) string {
if y == '0' {
return "0"
}
y = d(y)
b := make([]byte, len(x)+1)
var c byte
for i := 1; i <= len(x); i++ {
s := d(x[len(x)-i])*y + c
c = s / 10
b[len(b)-i] = (s % 10) + '0'
}
if c == 0 {
return string(b[1:])
}
b[0] = c + '0'
return string(b)
}
func mul(x, y string) string {
result := mulDigit(x, y[len(y)-1])
for i, zeros := 2, ""; i <= len(y); i++ {
zeros += "0"
result = add(result, mulDigit(x, y[len(y)-i])+zeros)
}
return result
}
const n = "18446744073709551616"
func main() {
fmt.Println(mul(n, n))
}
|
print 2**64*2**64
|
Rewrite this program in Python while keeping its functionality equivalent to the Go version. | package main
import (
"fmt"
"math/big"
)
var big1 = new(big.Int).SetUint64(1)
func solvePell(nn uint64) (*big.Int, *big.Int) {
n := new(big.Int).SetUint64(nn)
x := new(big.Int).Set(n)
x.Sqrt(x)
y := new(big.Int).Set(x)
z := new(big.Int).SetUint64(1)
r := new(big.Int).Lsh(x, 1)
e1 := new(big.Int).SetUint64(1)
e2 := new(big.Int)
f1 := new(big.Int)
f2 := new(big.Int).SetUint64(1)
t := new(big.Int)
u := new(big.Int)
a := new(big.Int)
b := new(big.Int)
for {
t.Mul(r, z)
y.Sub(t, y)
t.Mul(y, y)
t.Sub(n, t)
z.Quo(t, z)
t.Add(x, y)
r.Quo(t, z)
u.Set(e1)
e1.Set(e2)
t.Mul(r, e2)
e2.Add(t, u)
u.Set(f1)
f1.Set(f2)
t.Mul(r, f2)
f2.Add(t, u)
t.Mul(x, f2)
a.Add(e2, t)
b.Set(f2)
t.Mul(a, a)
u.Mul(n, b)
u.Mul(u, b)
t.Sub(t, u)
if t.Cmp(big1) == 0 {
return a, b
}
}
}
func main() {
ns := []uint64{61, 109, 181, 277}
for _, n := range ns {
x, y := solvePell(n)
fmt.Printf("x^2 - %3d*y^2 = 1 for x = %-21s and y = %s\n", n, x, y)
}
}
| import math
def solvePell(n):
x = int(math.sqrt(n))
y, z, r = x, 1, x << 1
e1, e2 = 1, 0
f1, f2 = 0, 1
while True:
y = r * z - y
z = (n - y * y) // z
r = (x + y) // z
e1, e2 = e2, e1 + e2 * r
f1, f2 = f2, f1 + f2 * r
a, b = f2 * x + e2, f2
if a * a - n * b * b == 1:
return a, b
for n in [61, 109, 181, 277]:
x, y = solvePell(n)
print("x^2 - %3d * y^2 = 1 for x = %27d and y = %25d" % (n, x, y))
|
Produce a language-to-language conversion: from Go to Python, same semantics. | package main
import (
"bufio"
"bytes"
"fmt"
"math/rand"
"os"
"strings"
"time"
)
func main() {
fmt.Println(`Cows and Bulls
Guess four digit number of unique digits in the range 1 to 9.
A correct digit but not in the correct place is a cow.
A correct digit in the correct place is a bull.`)
pat := make([]byte, 4)
rand.Seed(time.Now().Unix())
r := rand.Perm(9)
for i := range pat {
pat[i] = '1' + byte(r[i])
}
valid := []byte("123456789")
guess:
for in := bufio.NewReader(os.Stdin); ; {
fmt.Print("Guess: ")
guess, err := in.ReadString('\n')
if err != nil {
fmt.Println("\nSo, bye.")
return
}
guess = strings.TrimSpace(guess)
if len(guess) != 4 {
fmt.Println("Please guess a four digit number.")
continue
}
var cows, bulls int
for ig, cg := range guess {
if strings.IndexRune(guess[:ig], cg) >= 0 {
fmt.Printf("Repeated digit: %c\n", cg)
continue guess
}
switch bytes.IndexByte(pat, byte(cg)) {
case -1:
if bytes.IndexByte(valid, byte(cg)) == -1 {
fmt.Printf("Invalid digit: %c\n", cg)
continue guess
}
default:
cows++
case ig:
bulls++
}
}
fmt.Printf("Cows: %d, bulls: %d\n", cows, bulls)
if bulls == 4 {
fmt.Println("You got it.")
return
}
}
}
|
import random
digits = '123456789'
size = 4
chosen = ''.join(random.sample(digits,size))
print % (size, size)
guesses = 0
while True:
guesses += 1
while True:
guess = raw_input('\nNext guess [%i]: ' % guesses).strip()
if len(guess) == size and \
all(char in digits for char in guess) \
and len(set(guess)) == size:
break
print "Problem, try again. You need to enter %i unique digits from 1 to 9" % size
if guess == chosen:
print '\nCongratulations you guessed correctly in',guesses,'attempts'
break
bulls = cows = 0
for i in range(size):
if guess[i] == chosen[i]:
bulls += 1
elif guess[i] in chosen:
cows += 1
print ' %i Bulls\n %i Cows' % (bulls, cows)
|
Write the same algorithm in Python as shown in this Go implementation. | package main
import "fmt"
func main() {
list := []int{31, 41, 59, 26, 53, 58, 97, 93, 23, 84}
fmt.Println("unsorted:", list)
bubblesort(list)
fmt.Println("sorted! ", list)
}
func bubblesort(a []int) {
for itemCount := len(a) - 1; ; itemCount-- {
hasChanged := false
for index := 0; index < itemCount; index++ {
if a[index] > a[index+1] {
a[index], a[index+1] = a[index+1], a[index]
hasChanged = true
}
}
if hasChanged == false {
break
}
}
}
| def bubble_sort(seq):
changed = True
while changed:
changed = False
for i in range(len(seq) - 1):
if seq[i] > seq[i+1]:
seq[i], seq[i+1] = seq[i+1], seq[i]
changed = True
return seq
if __name__ == "__main__":
from random import shuffle
testset = [_ for _ in range(100)]
testcase = testset.copy()
shuffle(testcase)
assert testcase != testset
bubble_sort(testcase)
assert testcase == testset
|
Change the programming language of this snippet from Go to Python without modifying what it does. | package main
import "fmt"
func prodDivisors(n int) int {
prod := 1
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
prod *= i
j := n / i
if j != i {
prod *= j
}
}
i += k
}
return prod
}
func main() {
fmt.Println("The products of positive divisors for the first 50 positive integers are:")
for i := 1; i <= 50; i++ {
fmt.Printf("%9d ", prodDivisors(i))
if i%5 == 0 {
fmt.Println()
}
}
}
| def product_of_divisors(n):
assert(isinstance(n, int) and 0 < n)
ans = i = j = 1
while i*i <= n:
if 0 == n%i:
ans *= i
j = n//i
if j != i:
ans *= j
i += 1
return ans
if __name__ == "__main__":
print([product_of_divisors(n) for n in range(1,51)])
|
Translate this program into Python but keep the logic exactly as in Go. | package main
import "fmt"
func prodDivisors(n int) int {
prod := 1
i := 1
k := 2
if n%2 == 0 {
k = 1
}
for i*i <= n {
if n%i == 0 {
prod *= i
j := n / i
if j != i {
prod *= j
}
}
i += k
}
return prod
}
func main() {
fmt.Println("The products of positive divisors for the first 50 positive integers are:")
for i := 1; i <= 50; i++ {
fmt.Printf("%9d ", prodDivisors(i))
if i%5 == 0 {
fmt.Println()
}
}
}
| def product_of_divisors(n):
assert(isinstance(n, int) and 0 < n)
ans = i = j = 1
while i*i <= n:
if 0 == n%i:
ans *= i
j = n//i
if j != i:
ans *= j
i += 1
return ans
if __name__ == "__main__":
print([product_of_divisors(n) for n in range(1,51)])
|
Maintain the same structure and functionality when rewriting this code in Python. | package main
import (
"fmt"
"io/ioutil"
)
func main() {
b, err := ioutil.ReadFile("input.txt")
if err != nil {
fmt.Println(err)
return
}
if err = ioutil.WriteFile("output.txt", b, 0666); err != nil {
fmt.Println(err)
}
}
| import shutil
shutil.copyfile('input.txt', 'output.txt')
|
Write the same algorithm in Python as shown in this Go implementation. | package main
import "fmt"
func main() {
var a, b int
fmt.Print("enter two integers: ")
fmt.Scanln(&a, &b)
fmt.Printf("%d + %d = %d\n", a, b, a+b)
fmt.Printf("%d - %d = %d\n", a, b, a-b)
fmt.Printf("%d * %d = %d\n", a, b, a*b)
fmt.Printf("%d / %d = %d\n", a, b, a/b)
fmt.Printf("%d %% %d = %d\n", a, b, a%b)
}
| x = int(raw_input("Number 1: "))
y = int(raw_input("Number 2: "))
print "Sum: %d" % (x + y)
print "Difference: %d" % (x - y)
print "Product: %d" % (x * y)
print "Quotient: %d" % (x / y)
print "Remainder: %d" % (x % y)
print "Quotient: %d with Remainder: %d" % divmod(x, y)
print "Power: %d" % x**y
raw_input( )
|
Keep all operations the same but rewrite the snippet in Python. | package main
import (
"fmt"
"gonum.org/v1/gonum/mat"
)
func main() {
m := mat.NewDense(2, 3, []float64{
1, 2, 3,
4, 5, 6,
})
fmt.Println(mat.Formatted(m))
fmt.Println()
fmt.Println(mat.Formatted(m.T()))
}
| m=((1, 1, 1, 1),
(2, 4, 8, 16),
(3, 9, 27, 81),
(4, 16, 64, 256),
(5, 25,125, 625))
print(zip(*m))
|
Rewrite this program in Python while keeping its functionality equivalent to the Go version. | package main
import "fmt"
func a(k int, x1, x2, x3, x4, x5 func() int) int {
var b func() int
b = func() int {
k--
return a(k, b, x1, x2, x3, x4)
}
if k <= 0 {
return x4() + x5()
}
return b()
}
func main() {
x := func(i int) func() int { return func() int { return i } }
fmt.Println(a(10, x(1), x(-1), x(-1), x(1), x(0)))
}
|
import sys
sys.setrecursionlimit(1025)
def a(in_k, x1, x2, x3, x4, x5):
k = [in_k]
def b():
k[0] -= 1
return a(k[0], b, x1, x2, x3, x4)
return x4() + x5() if k[0] <= 0 else b()
x = lambda i: lambda: i
print(a(10, x(1), x(-1), x(-1), x(1), x(0)))
|
Convert the following code from Go to Python, ensuring the logic remains intact. | package main
import "fmt"
func a(v bool) bool {
fmt.Print("a")
return v
}
func b(v bool) bool {
fmt.Print("b")
return v
}
func test(i, j bool) {
fmt.Printf("Testing a(%t) && b(%t)\n", i, j)
fmt.Print("Trace: ")
fmt.Println("\nResult:", a(i) && b(j))
fmt.Printf("Testing a(%t) || b(%t)\n", i, j)
fmt.Print("Trace: ")
fmt.Println("\nResult:", a(i) || b(j))
fmt.Println("")
}
func main() {
test(false, false)
test(false, true)
test(true, false)
test(true, true)
}
| >>> def a(answer):
print("
return answer
>>> def b(answer):
print("
return answer
>>> for i in (False, True):
for j in (False, True):
print ("\nCalculating: x = a(i) and b(j)")
x = a(i) and b(j)
print ("Calculating: y = a(i) or b(j)")
y = a(i) or b(j)
Calculating: x = a(i) and b(j)
Calculating: y = a(i) or b(j)
Calculating: x = a(i) and b(j)
Calculating: y = a(i) or b(j)
Calculating: x = a(i) and b(j)
Calculating: y = a(i) or b(j)
Calculating: x = a(i) and b(j)
Calculating: y = a(i) or b(j)
|
Translate this program into Python but keep the logic exactly as in Go. | package main
import (
"flag"
"fmt"
"runtime/debug"
)
func main() {
stack := flag.Int("stack", 0, "maximum per goroutine stack size or 0 for the default")
flag.Parse()
if *stack > 0 {
debug.SetMaxStack(*stack)
}
r(1)
}
func r(l int) {
if l%1000 == 0 {
fmt.Println(l)
}
r(l + 1)
}
| import sys
print(sys.getrecursionlimit())
|
Produce a language-to-language conversion: from C++ to VB, same semantics. | #include <iostream>
void bitwise(int a, int b)
{
std::cout << "a and b: " << (a & b) << '\n';
std::cout << "a or b: " << (a | b) << '\n';
std::cout << "a xor b: " << (a ^ b) << '\n';
std::cout << "not a: " << ~a << '\n';
std::cout << "a shl b: " << (a << b) << '\n';
std::cout << "a shr b: " << (a >> b) << '\n';
unsigned int ua = a;
std::cout << "a lsr b: " << (ua >> b) << '\n';
std::cout << "a rol b: " << std::rotl(ua, b) << '\n';
std::cout << "a ror b: " << std::rotr(ua, b) << '\n';
}
| Debug.Print Hex(&HF0F0 And &HFF00)
Debug.Print Hex(&HF0F0 Or &HFF00)
Debug.Print Hex(&HF0F0 Xor &HFF00)
Debug.Print Hex(Not &HF0F0)
Debug.Print Hex(&HF0F0 Eqv &HFF00)
Debug.Print Hex(&HF0F0 Imp &HFF00)
|
Maintain the same structure and functionality when rewriting this code in VB. | #include <windows.h>
#include <iostream>
using namespace std;
const int BMP_SIZE = 800, NORTH = 1, EAST = 2, SOUTH = 4, WEST = 8, LEN = 1;
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen ); DeleteObject( brush );
DeleteDC( hdc ); DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c )
{
clr = c; createPen();
}
void setPenWidth( int w )
{
wid = w; createPen();
}
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class dragonC
{
public:
dragonC() { bmp.create( BMP_SIZE, BMP_SIZE ); dir = WEST; }
void draw( int iterations ) { generate( iterations ); draw(); }
private:
void generate( int it )
{
generator.push_back( 1 );
string temp;
for( int y = 0; y < it - 1; y++ )
{
temp = generator; temp.push_back( 1 );
for( string::reverse_iterator x = generator.rbegin(); x != generator.rend(); x++ )
temp.push_back( !( *x ) );
generator = temp;
}
}
void draw()
{
HDC dc = bmp.getDC();
unsigned int clr[] = { 0xff, 0xff00, 0xff0000, 0x00ffff };
int mov[] = { 0, 0, 1, -1, 1, -1, 1, 0 }; int i = 0;
for( int t = 0; t < 4; t++ )
{
int a = BMP_SIZE / 2, b = a; a += mov[i++]; b += mov[i++];
MoveToEx( dc, a, b, NULL );
bmp.setPenColor( clr[t] );
for( string::iterator x = generator.begin(); x < generator.end(); x++ )
{
switch( dir )
{
case NORTH:
if( *x ) { a += LEN; dir = EAST; }
else { a -= LEN; dir = WEST; }
break;
case EAST:
if( *x ) { b += LEN; dir = SOUTH; }
else { b -= LEN; dir = NORTH; }
break;
case SOUTH:
if( *x ) { a -= LEN; dir = WEST; }
else { a += LEN; dir = EAST; }
break;
case WEST:
if( *x ) { b -= LEN; dir = NORTH; }
else { b += LEN; dir = SOUTH; }
}
LineTo( dc, a, b );
}
}
bmp.saveBitmap( "f:/rc/dragonCpp.bmp" );
}
int dir;
myBitmap bmp;
string generator;
};
int main( int argc, char* argv[] )
{
dragonC d; d.draw( 17 );
return system( "pause" );
}
| option explicit
const pi180= 0.01745329251994329576923690768489
const pi=3.1415926535897932384626433832795
class turtle
dim fso
dim fn
dim svg
dim iang
dim ori
dim incr
dim pdown
dim clr
dim x
dim y
public property let orient(n):ori = n*pi180 :end property
public property let iangle(n):iang= n*pi180 :end property
public sub pd() : pdown=true: end sub
public sub pu() :pdown=FALSE :end sub
public sub rt(i)
ori=ori - i*iang:
end sub
public sub lt(i):
ori=(ori + i*iang)
end sub
public sub bw(l)
x= x+ cos(ori+pi)*l*incr
y= y+ sin(ori+pi)*l*incr
end sub
public sub fw(l)
dim x1,y1
x1=x + cos(ori)*l*incr
y1=y + sin(ori)*l*incr
if pdown then line x,y,x1,y1
x=x1:y=y1
end sub
Private Sub Class_Initialize()
setlocale "us"
initsvg
x=400:y=400:incr=100
ori=90*pi180
iang=90*pi180
clr=0
pdown=true
end sub
Private Sub Class_Terminate()
disply
end sub
private sub line (x,y,x1,y1)
svg.WriteLine "<line x1=""" & x & """ y1= """& y & """ x2=""" & x1& """ y2=""" & y1 & """/>"
end sub
private sub disply()
dim shell
svg.WriteLine "</svg></body></html>"
svg.close
Set shell = CreateObject("Shell.Application")
shell.ShellExecute fn,1,False
end sub
private sub initsvg()
dim scriptpath
Set fso = CreateObject ("Scripting.Filesystemobject")
ScriptPath= Left(WScript.ScriptFullName, InStrRev(WScript.ScriptFullName, "\"))
fn=Scriptpath & "SIERP.HTML"
Set svg = fso.CreateTextFile(fn,True)
if SVG IS nothing then wscript.echo "Can
svg.WriteLine "<!DOCTYPE html>" &vbcrlf & "<html>" &vbcrlf & "<head>"
svg.writeline "<style>" & vbcrlf & "line {stroke:rgb(255,0,0);stroke-width:.5}" &vbcrlf &"</style>"
svg.writeline "</head>"&vbcrlf & "<body>"
svg.WriteLine "<svg xmlns=""http://www.w3.org/2000/svg"" width=""800"" height=""800"" viewBox=""0 0 800 800"">"
end sub
end class
sub dragon(st,le,dir)
if st=0 then x.fw le: exit sub
x.rt dir
dragon st-1, le/1.41421 ,1
x.rt dir*2
dragon st-1, le/1.41421 ,-1
x.rt dir
end sub
dim x
set x=new turtle
x.iangle=45
x.orient=45
x.incr=1
x.x=200:x.y=200
dragon 12,300,1
set x=nothing
|
Port the following code from C++ to VB with equivalent syntax and logic. | #include <fstream>
#include <string>
#include <iostream>
int main( int argc , char** argv ) {
int linecount = 0 ;
std::string line ;
std::ifstream infile( argv[ 1 ] ) ;
if ( infile ) {
while ( getline( infile , line ) ) {
std::cout << linecount << ": "
<< line << '\n' ;
linecount++ ;
}
}
infile.close( ) ;
return 0 ;
}
| $Include "Rapidq.inc"
dim file as qfilestream
if file.open("c:\A Test.txt", fmOpenRead) then
while not File.eof
print File.readline
wend
else
print "Cannot read file"
end if
input "Press enter to exit: ";a$
|
Translate this program into VB but keep the logic exactly as in C++. | template <typename T>
void insert_after(Node<T>* N, T&& data)
{
auto node = new Node<T>{N, N->next, std::forward(data)};
if(N->next != nullptr)
N->next->prev = node;
N->next = node;
}
| Public Sub Insert(ByVal a As Node(Of T), ByVal b As Node(Of T), ByVal c As T)
Dim node As New Node(Of T)(value)
a.Next = node
node.Previous = a
b.Previous = node
node.Next = b
End Sub
|
Transform the following C++ implementation into VB, maintaining the same output and logic. | #include <algorithm>
#include <iostream>
int main() {
for (int i = 0; i < 10; i++) {
int a[] = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4};
std::nth_element(a, a + i, a + sizeof(a)/sizeof(*a));
std::cout << a[i];
if (i < 9) std::cout << ", ";
}
std::cout << std::endl;
return 0;
}
| Dim s As Variant
Private Function quick_select(ByRef s As Variant, k As Integer) As Integer
Dim left As Integer, right As Integer, pos As Integer
Dim pivotValue As Integer, tmp As Integer
left = 1: right = UBound(s)
Do While left < right
pivotValue = s(k)
tmp = s(k)
s(k) = s(right)
s(right) = tmp
pos = left
For i = left To right
If s(i) < pivotValue Then
tmp = s(i)
s(i) = s(pos)
s(pos) = tmp
pos = pos + 1
End If
Next i
tmp = s(right)
s(right) = s(pos)
s(pos) = tmp
If pos = k Then
Exit Do
End If
If pos < k Then
left = pos + 1
Else
right = pos - 1
End If
Loop
quick_select = s(k)
End Function
Public Sub main()
Dim r As Integer, i As Integer
s = [{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}]
For i = 1 To 10
r = quick_select(s, i)
Debug.Print IIf(i < 10, r & ", ", "" & r);
Next i
End Sub
|
Can you help me rewrite this code in VB instead of C++, keeping it the same logically? | #include <string>
#include <cstdlib>
#include <algorithm>
#include <cassert>
std::string const digits = "0123456789abcdefghijklmnopqrstuvwxyz";
std::string to_base(unsigned long num, int base)
{
if (num == 0)
return "0";
std::string result;
while (num > 0) {
std::ldiv_t temp = std::div(num, (long)base);
result += digits[temp.rem];
num = temp.quot;
}
std::reverse(result.begin(), result.end());
return result;
}
unsigned long from_base(std::string const& num_str, int base)
{
unsigned long result = 0;
for (std::string::size_type pos = 0; pos < num_str.length(); ++pos)
result = result * base + digits.find(num_str[pos]);
return result;
}
| Private Function to_base(ByVal number As Long, base As Integer) As String
Dim digits As String, result As String
Dim i As Integer, digit As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
Do While number > 0
digit = number Mod base
result = Mid(digits, digit + 1, 1) & result
number = number \ base
Loop
to_base = result
End Function
Private Function from_base(number As String, base As Integer) As Long
Dim digits As String, result As Long
Dim i As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1)
For i = 2 To Len(number)
result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1)
Next i
from_base = result
End Function
Public Sub Non_decimal_radices_Convert()
Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16)
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the C++ version. | #include "boost/filesystem.hpp"
#include "boost/regex.hpp"
#include <iostream>
using namespace boost::filesystem;
int main()
{
path current_dir(".");
boost::regex pattern("a.*");
for (recursive_directory_iterator iter(current_dir), end;
iter != end;
++iter)
{
std::string name = iter->path().filename().string();
if (regex_match(name, pattern))
std::cout << iter->path() << "\n";
}
}
| Sub printFiles(parentDir As FolderItem, pattern As String)
For i As Integer = 1 To parentDir.Count
If parentDir.Item(i).Directory Then
printFiles(parentDir.Item(i), pattern)
Else
Dim rg as New RegEx
Dim myMatch as RegExMatch
rg.SearchPattern = pattern
myMatch = rg.search(parentDir.Item(i).Name)
If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath)
End If
Next
End Sub
|
Change the programming language of this snippet from C++ to VB without modifying what it does. | #include <algorithm>
#include <array>
#include <cstdint>
#include <numeric>
#include <iomanip>
#include <iostream>
#include <string>
std::array<std::uint_fast32_t, 256> generate_crc_lookup_table() noexcept
{
auto const reversed_polynomial = std::uint_fast32_t{0xEDB88320uL};
struct byte_checksum
{
std::uint_fast32_t operator()() noexcept
{
auto checksum = static_cast<std::uint_fast32_t>(n++);
for (auto i = 0; i < 8; ++i)
checksum = (checksum >> 1) ^ ((checksum & 0x1u) ? reversed_polynomial : 0);
return checksum;
}
unsigned n = 0;
};
auto table = std::array<std::uint_fast32_t, 256>{};
std::generate(table.begin(), table.end(), byte_checksum{});
return table;
}
template <typename InputIterator>
std::uint_fast32_t crc(InputIterator first, InputIterator last)
{
static auto const table = generate_crc_lookup_table();
return std::uint_fast32_t{0xFFFFFFFFuL} &
~std::accumulate(first, last,
~std::uint_fast32_t{0} & std::uint_fast32_t{0xFFFFFFFFuL},
[](std::uint_fast32_t checksum, std::uint_fast8_t value)
{ return table[(checksum ^ value) & 0xFFu] ^ (checksum >> 8); });
}
int main()
{
auto const s = std::string{"The quick brown fox jumps over the lazy dog"};
std::cout << std::hex << std::setw(8) << std::setfill('0') << crc(s.begin(), s.end()) << '\n';
}
| dim crctbl(255)
const crcc =&hEDB88320
sub gencrctable
for i= 0 to 255
k=i
for j=1 to 8
if k and 1 then
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
k=k xor crcc
else
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
end if
next
crctbl(i)=k
next
end sub
function crc32 (buf)
dim r,r1,i
r=&hffffffff
for i=1 to len(buf)
r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0)
r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255)
next
crc32=r xor &hffffffff
end function
gencrctable
wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
|
Convert the following code from C++ to VB, ensuring the logic remains intact. | #include <string>
#include <boost/regex.hpp>
#include <iostream>
std::string csvToHTML( const std::string & ) ;
int main( ) {
std::string text = "Character,Speech\n"
"The multitude,The messiah! Show us the messiah!\n"
"Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>\n"
"The multitude,Who are you?\n"
"Brians mother,I'm his mother; that's who!\n"
"The multitude,Behold his mother! Behold his mother!\n" ;
std::cout << csvToHTML( text ) ;
return 0 ;
}
std::string csvToHTML( const std::string & csvtext ) {
std::string regexes[ 5 ] = { "<" , ">" , "^(.+?)\\b" , "," , "\n" } ;
const char* replacements [ 5 ] = { "<" , ">" , " <TR><TD>$1" , "</TD><TD>", "</TD></TR>\n" } ;
boost::regex e1( regexes[ 0 ] ) ;
std::string tabletext = boost::regex_replace( csvtext , e1 ,
replacements[ 0 ] , boost::match_default | boost::format_all ) ;
for ( int i = 1 ; i < 5 ; i++ ) {
e1.assign( regexes[ i ] ) ;
tabletext = boost::regex_replace( tabletext , e1 , replacements[ i ] , boost::match_default | boost::format_all ) ;
}
tabletext = std::string( "<TABLE>\n" ) + tabletext ;
tabletext.append( "</TABLE>\n" ) ;
return tabletext ;
}
| Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the C++ version. | #include <string>
#include <boost/regex.hpp>
#include <iostream>
std::string csvToHTML( const std::string & ) ;
int main( ) {
std::string text = "Character,Speech\n"
"The multitude,The messiah! Show us the messiah!\n"
"Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>\n"
"The multitude,Who are you?\n"
"Brians mother,I'm his mother; that's who!\n"
"The multitude,Behold his mother! Behold his mother!\n" ;
std::cout << csvToHTML( text ) ;
return 0 ;
}
std::string csvToHTML( const std::string & csvtext ) {
std::string regexes[ 5 ] = { "<" , ">" , "^(.+?)\\b" , "," , "\n" } ;
const char* replacements [ 5 ] = { "<" , ">" , " <TR><TD>$1" , "</TD><TD>", "</TD></TR>\n" } ;
boost::regex e1( regexes[ 0 ] ) ;
std::string tabletext = boost::regex_replace( csvtext , e1 ,
replacements[ 0 ] , boost::match_default | boost::format_all ) ;
for ( int i = 1 ; i < 5 ; i++ ) {
e1.assign( regexes[ i ] ) ;
tabletext = boost::regex_replace( tabletext , e1 , replacements[ i ] , boost::match_default | boost::format_all ) ;
}
tabletext = std::string( "<TABLE>\n" ) + tabletext ;
tabletext.append( "</TABLE>\n" ) ;
return tabletext ;
}
| Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
|
Rewrite the snippet below in VB so it works the same as the original C++ code. | #include <string>
#include <boost/regex.hpp>
#include <iostream>
std::string csvToHTML( const std::string & ) ;
int main( ) {
std::string text = "Character,Speech\n"
"The multitude,The messiah! Show us the messiah!\n"
"Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>\n"
"The multitude,Who are you?\n"
"Brians mother,I'm his mother; that's who!\n"
"The multitude,Behold his mother! Behold his mother!\n" ;
std::cout << csvToHTML( text ) ;
return 0 ;
}
std::string csvToHTML( const std::string & csvtext ) {
std::string regexes[ 5 ] = { "<" , ">" , "^(.+?)\\b" , "," , "\n" } ;
const char* replacements [ 5 ] = { "<" , ">" , " <TR><TD>$1" , "</TD><TD>", "</TD></TR>\n" } ;
boost::regex e1( regexes[ 0 ] ) ;
std::string tabletext = boost::regex_replace( csvtext , e1 ,
replacements[ 0 ] , boost::match_default | boost::format_all ) ;
for ( int i = 1 ; i < 5 ; i++ ) {
e1.assign( regexes[ i ] ) ;
tabletext = boost::regex_replace( tabletext , e1 , replacements[ i ] , boost::match_default | boost::format_all ) ;
}
tabletext = std::string( "<TABLE>\n" ) + tabletext ;
tabletext.append( "</TABLE>\n" ) ;
return tabletext ;
}
| Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
|
Please provide an equivalent version of this C++ code in VB. | PRAGMA COMPILER g++
PRAGMA OPTIONS -Wno-write-strings -Wno-pointer-arith -fpermissive
OPTION PARSE FALSE
'---The class does the declaring for you
CLASS Books
public:
const char* title;
const char* author;
const char* subject;
int book_id;
END CLASS
'---pointer to an object declaration (we use a class called Books)
DECLARE Book1 TYPE Books
'--- the correct syntax for class
Book1 = Books()
'--- initialize the strings const char* in c++
Book1.title = "C++ Programming to bacon "
Book1.author = "anyone"
Book1.subject ="RECORD Tutorial"
Book1.book_id = 1234567
PRINT "Book title : " ,Book1.title FORMAT "%s%s\n"
PRINT "Book author : ", Book1.author FORMAT "%s%s\n"
PRINT "Book subject : ", Book1.subject FORMAT "%s%s\n"
PRINT "Book book_id : ", Book1.book_id FORMAT "%s%d\n"
| Class NumberContainer
Private TheNumber As Integer
Sub Constructor(InitialNumber As Integer)
TheNumber = InitialNumber
End Sub
Function Number() As Integer
Return TheNumber
End Function
Sub Number(Assigns NewNumber As Integer)
TheNumber = NewNumber
End Sub
End Class
|
Convert this C++ snippet to VB and keep its semantics consistent. | #include <vector>
#include <string>
#include <iostream>
#include <sstream>
#include <algorithm>
#include <iterator>
#include <utility>
long string2long( const std::string & s ) {
long result ;
std::istringstream( s ) >> result ;
return result ;
}
bool isKaprekar( long number ) {
long long squarenumber = ((long long)number) * number ;
std::ostringstream numberbuf ;
numberbuf << squarenumber ;
std::string numberstring = numberbuf.str( ) ;
for ( int i = 0 ; i < numberstring.length( ) ; i++ ) {
std::string firstpart = numberstring.substr( 0 , i ) ,
secondpart = numberstring.substr( i ) ;
if ( secondpart.find_first_not_of( "0" ) == std::string::npos ) {
return false ;
}
if ( string2long( firstpart ) + string2long( secondpart ) == number ) {
return true ;
}
}
return false ;
}
int main( ) {
std::vector<long> kaprekarnumbers ;
kaprekarnumbers.push_back( 1 ) ;
for ( int i = 2 ; i < 1000001 ; i++ ) {
if ( isKaprekar( i ) )
kaprekarnumbers.push_back( i ) ;
}
std::vector<long>::const_iterator svi = kaprekarnumbers.begin( ) ;
std::cout << "Kaprekar numbers up to 10000: \n" ;
while ( *svi < 10000 ) {
std::cout << *svi << " " ;
svi++ ;
}
std::cout << '\n' ;
std::cout << "All the Kaprekar numbers up to 1000000 :\n" ;
std::copy( kaprekarnumbers.begin( ) , kaprekarnumbers.end( ) ,
std::ostream_iterator<long>( std::cout , "\n" ) ) ;
std::cout << "There are " << kaprekarnumbers.size( )
<< " Kaprekar numbers less than one million!\n" ;
return 0 ;
}
| Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
|
Write the same code in VB as shown below in C++. | #include <vector>
#include <string>
#include <iostream>
#include <sstream>
#include <algorithm>
#include <iterator>
#include <utility>
long string2long( const std::string & s ) {
long result ;
std::istringstream( s ) >> result ;
return result ;
}
bool isKaprekar( long number ) {
long long squarenumber = ((long long)number) * number ;
std::ostringstream numberbuf ;
numberbuf << squarenumber ;
std::string numberstring = numberbuf.str( ) ;
for ( int i = 0 ; i < numberstring.length( ) ; i++ ) {
std::string firstpart = numberstring.substr( 0 , i ) ,
secondpart = numberstring.substr( i ) ;
if ( secondpart.find_first_not_of( "0" ) == std::string::npos ) {
return false ;
}
if ( string2long( firstpart ) + string2long( secondpart ) == number ) {
return true ;
}
}
return false ;
}
int main( ) {
std::vector<long> kaprekarnumbers ;
kaprekarnumbers.push_back( 1 ) ;
for ( int i = 2 ; i < 1000001 ; i++ ) {
if ( isKaprekar( i ) )
kaprekarnumbers.push_back( i ) ;
}
std::vector<long>::const_iterator svi = kaprekarnumbers.begin( ) ;
std::cout << "Kaprekar numbers up to 10000: \n" ;
while ( *svi < 10000 ) {
std::cout << *svi << " " ;
svi++ ;
}
std::cout << '\n' ;
std::cout << "All the Kaprekar numbers up to 1000000 :\n" ;
std::copy( kaprekarnumbers.begin( ) , kaprekarnumbers.end( ) ,
std::ostream_iterator<long>( std::cout , "\n" ) ) ;
std::cout << "There are " << kaprekarnumbers.size( )
<< " Kaprekar numbers less than one million!\n" ;
return 0 ;
}
| Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
|
Please provide an equivalent version of this C++ code in VB. | #include <string>
#include <map>
template <typename Iterator>
Iterator compress(const std::string &uncompressed, Iterator result) {
int dictSize = 256;
std::map<std::string,int> dictionary;
for (int i = 0; i < 256; i++)
dictionary[std::string(1, i)] = i;
std::string w;
for (std::string::const_iterator it = uncompressed.begin();
it != uncompressed.end(); ++it) {
char c = *it;
std::string wc = w + c;
if (dictionary.count(wc))
w = wc;
else {
*result++ = dictionary[w];
dictionary[wc] = dictSize++;
w = std::string(1, c);
}
}
if (!w.empty())
*result++ = dictionary[w];
return result;
}
template <typename Iterator>
std::string decompress(Iterator begin, Iterator end) {
int dictSize = 256;
std::map<int,std::string> dictionary;
for (int i = 0; i < 256; i++)
dictionary[i] = std::string(1, i);
std::string w(1, *begin++);
std::string result = w;
std::string entry;
for ( ; begin != end; begin++) {
int k = *begin;
if (dictionary.count(k))
entry = dictionary[k];
else if (k == dictSize)
entry = w + w[0];
else
throw "Bad compressed k";
result += entry;
dictionary[dictSize++] = w + entry[0];
w = entry;
}
return result;
}
#include <iostream>
#include <iterator>
#include <vector>
int main() {
std::vector<int> compressed;
compress("TOBEORNOTTOBEORTOBEORNOT", std::back_inserter(compressed));
copy(compressed.begin(), compressed.end(), std::ostream_iterator<int>(std::cout, ", "));
std::cout << std::endl;
std::string decompressed = decompress(compressed.begin(), compressed.end());
std::cout << decompressed << std::endl;
return 0;
}
| Option Explicit
Const numchars=127
Function LZWCompress(si)
Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j
Set oDict = CreateObject("Scripting.Dictionary")
ReDim a(Len(si))
intMaxCode = numchars
For i = 0 To numchars
oDict.Add Chr(i), i
Next
strCurrent = Left(si,1)
j=0
For ii=2 To Len(si)
strNext = Mid(si,ii,1)
ss=strCurrent & strNext
If oDict.Exists(ss) Then
strCurrent = ss
Else
a(j)=oDict.Item(strCurrent) :j=j+1
intMaxCode = intMaxCode + 1
oDict.Add ss, intMaxCode
strCurrent = strNext
End If
Next
a(j)=oDict.Item(strCurrent)
ReDim preserve a(j)
LZWCompress=a
Set oDict = Nothing
End Function
Function lzwUncompress(sc)
Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j
s=""
reDim dict(1000)
intMaxCode = numchars
For i = 0 To numchars : dict(i)= Chr(i) : Next
intCurrent=sc(0)
For j=1 To UBound(sc)
ss=dict(intCurrent)
s= s & ss
intMaxCode = intMaxCode + 1
intnext=sc(j)
If intNext<intMaxCode Then
dict(intMaxCode)=ss & Left(dict(intNext), 1)
Else
dict(intMaxCode)=ss & Left(ss, 1)
End If
intCurrent = intNext
Next
s= s & dict(intCurrent)
lzwUncompress=s
End function
Sub printvec(a)
Dim s,i,x
s="("
For i=0 To UBound (a)
s=s & x & a(i)
x=", "
Next
WScript.echo s &")"
End sub
Dim a,b
b="TOBEORNOTTOBEORTOBEORNOT"
WScript.Echo b
a=LZWCompress (b)
printvec(a)
WScript.echo lzwUncompress (a )
wscript.quit 1
|
Change the following C++ code into VB without altering its purpose. | #include <iomanip>
#include <iostream>
#include <set>
#include <vector>
using namespace std;
unsigned hofstadter(unsigned rlistSize, unsigned slistSize)
{
auto n = rlistSize > slistSize ? rlistSize : slistSize;
auto rlist = new vector<unsigned> { 1, 3, 7 };
auto slist = new vector<unsigned> { 2, 4, 5, 6 };
auto list = rlistSize > 0 ? rlist : slist;
auto target_size = rlistSize > 0 ? rlistSize : slistSize;
while (list->size() > target_size) list->pop_back();
while (list->size() < target_size)
{
auto lastIndex = rlist->size() - 1;
auto lastr = (*rlist)[lastIndex];
auto r = lastr + (*slist)[lastIndex];
rlist->push_back(r);
for (auto s = lastr + 1; s < r && list->size() < target_size;)
slist->push_back(s++);
}
auto v = (*list)[n - 1];
delete rlist;
delete slist;
return v;
}
ostream& operator<<(ostream& os, const set<unsigned>& s)
{
cout << '(' << s.size() << "):";
auto i = 0;
for (auto c = s.begin(); c != s.end();)
{
if (i++ % 20 == 0) os << endl;
os << setw(5) << *c++;
}
return os;
}
int main(int argc, const char* argv[])
{
const auto v1 = atoi(argv[1]);
const auto v2 = atoi(argv[2]);
set<unsigned> r, s;
for (auto n = 1; n <= v2; n++)
{
if (n <= v1)
r.insert(hofstadter(n, 0));
s.insert(hofstadter(0, n));
}
cout << "R" << r << endl;
cout << "S" << s << endl;
int m = max(*r.rbegin(), *s.rbegin());
for (auto n = 1; n <= m; n++)
if (r.count(n) == s.count(n))
clog << "integer " << n << " either in both or neither set" << endl;
return 0;
}
| Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
|
Generate a VB translation of this C++ snippet without changing its computational steps. | #include <iomanip>
#include <iostream>
#include <set>
#include <vector>
using namespace std;
unsigned hofstadter(unsigned rlistSize, unsigned slistSize)
{
auto n = rlistSize > slistSize ? rlistSize : slistSize;
auto rlist = new vector<unsigned> { 1, 3, 7 };
auto slist = new vector<unsigned> { 2, 4, 5, 6 };
auto list = rlistSize > 0 ? rlist : slist;
auto target_size = rlistSize > 0 ? rlistSize : slistSize;
while (list->size() > target_size) list->pop_back();
while (list->size() < target_size)
{
auto lastIndex = rlist->size() - 1;
auto lastr = (*rlist)[lastIndex];
auto r = lastr + (*slist)[lastIndex];
rlist->push_back(r);
for (auto s = lastr + 1; s < r && list->size() < target_size;)
slist->push_back(s++);
}
auto v = (*list)[n - 1];
delete rlist;
delete slist;
return v;
}
ostream& operator<<(ostream& os, const set<unsigned>& s)
{
cout << '(' << s.size() << "):";
auto i = 0;
for (auto c = s.begin(); c != s.end();)
{
if (i++ % 20 == 0) os << endl;
os << setw(5) << *c++;
}
return os;
}
int main(int argc, const char* argv[])
{
const auto v1 = atoi(argv[1]);
const auto v2 = atoi(argv[2]);
set<unsigned> r, s;
for (auto n = 1; n <= v2; n++)
{
if (n <= v1)
r.insert(hofstadter(n, 0));
s.insert(hofstadter(0, n));
}
cout << "R" << r << endl;
cout << "S" << s << endl;
int m = max(*r.rbegin(), *s.rbegin());
for (auto n = 1; n <= m; n++)
if (r.count(n) == s.count(n))
clog << "integer " << n << " either in both or neither set" << endl;
return 0;
}
| Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
|
Write the same algorithm in VB as shown in this C++ implementation. | #include <iostream>
#include <sstream>
#include <iomanip>
#include <cassert>
#include <vector>
using namespace std;
class MagicSquare
{
public:
MagicSquare(int d) : sqr(d*d,0), sz(d)
{
assert(d&1);
fillSqr();
}
void display()
{
cout << "Odd Magic Square: " << sz << " x " << sz << "\n";
cout << "It's Magic Sum is: " << magicNumber() << "\n\n";
ostringstream cvr;
cvr << sz * sz;
int l = cvr.str().size();
for( int y = 0; y < sz; y++ )
{
int yy = y * sz;
for( int x = 0; x < sz; x++ )
cout << setw( l + 2 ) << sqr[yy + x];
cout << "\n";
}
cout << "\n\n";
}
private:
void fillSqr()
{
int sx = sz / 2, sy = 0, c = 0;
while( c < sz * sz )
{
if( !sqr[sx + sy * sz] )
{
sqr[sx + sy * sz]= c + 1;
inc( sx ); dec( sy );
c++;
}
else
{
dec( sx ); inc( sy ); inc( sy );
}
}
}
int magicNumber()
{ return sz * ( ( sz * sz ) + 1 ) / 2; }
void inc( int& a )
{ if( ++a == sz ) a = 0; }
void dec( int& a )
{ if( --a < 0 ) a = sz - 1; }
bool checkPos( int x, int y )
{ return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); }
bool isInside( int s )
{ return ( s < sz && s > -1 ); }
vector<int> sqr;
int sz;
};
int main()
{
MagicSquare s(7);
s.display();
return 0;
}
| Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
|
Can you help me rewrite this code in VB instead of C++, keeping it the same logically? | #include <iostream>
#include <sstream>
#include <iomanip>
#include <cassert>
#include <vector>
using namespace std;
class MagicSquare
{
public:
MagicSquare(int d) : sqr(d*d,0), sz(d)
{
assert(d&1);
fillSqr();
}
void display()
{
cout << "Odd Magic Square: " << sz << " x " << sz << "\n";
cout << "It's Magic Sum is: " << magicNumber() << "\n\n";
ostringstream cvr;
cvr << sz * sz;
int l = cvr.str().size();
for( int y = 0; y < sz; y++ )
{
int yy = y * sz;
for( int x = 0; x < sz; x++ )
cout << setw( l + 2 ) << sqr[yy + x];
cout << "\n";
}
cout << "\n\n";
}
private:
void fillSqr()
{
int sx = sz / 2, sy = 0, c = 0;
while( c < sz * sz )
{
if( !sqr[sx + sy * sz] )
{
sqr[sx + sy * sz]= c + 1;
inc( sx ); dec( sy );
c++;
}
else
{
dec( sx ); inc( sy ); inc( sy );
}
}
}
int magicNumber()
{ return sz * ( ( sz * sz ) + 1 ) / 2; }
void inc( int& a )
{ if( ++a == sz ) a = 0; }
void dec( int& a )
{ if( --a < 0 ) a = sz - 1; }
bool checkPos( int x, int y )
{ return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); }
bool isInside( int s )
{ return ( s < sz && s > -1 ); }
vector<int> sqr;
int sz;
};
int main()
{
MagicSquare s(7);
s.display();
return 0;
}
| Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
|
Convert this C++ block to VB, preserving its control flow and logic. | #include <iostream>
#include <sstream>
#include <iomanip>
#include <cassert>
#include <vector>
using namespace std;
class MagicSquare
{
public:
MagicSquare(int d) : sqr(d*d,0), sz(d)
{
assert(d&1);
fillSqr();
}
void display()
{
cout << "Odd Magic Square: " << sz << " x " << sz << "\n";
cout << "It's Magic Sum is: " << magicNumber() << "\n\n";
ostringstream cvr;
cvr << sz * sz;
int l = cvr.str().size();
for( int y = 0; y < sz; y++ )
{
int yy = y * sz;
for( int x = 0; x < sz; x++ )
cout << setw( l + 2 ) << sqr[yy + x];
cout << "\n";
}
cout << "\n\n";
}
private:
void fillSqr()
{
int sx = sz / 2, sy = 0, c = 0;
while( c < sz * sz )
{
if( !sqr[sx + sy * sz] )
{
sqr[sx + sy * sz]= c + 1;
inc( sx ); dec( sy );
c++;
}
else
{
dec( sx ); inc( sy ); inc( sy );
}
}
}
int magicNumber()
{ return sz * ( ( sz * sz ) + 1 ) / 2; }
void inc( int& a )
{ if( ++a == sz ) a = 0; }
void dec( int& a )
{ if( --a < 0 ) a = sz - 1; }
bool checkPos( int x, int y )
{ return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); }
bool isInside( int s )
{ return ( s < sz && s > -1 ); }
vector<int> sqr;
int sz;
};
int main()
{
MagicSquare s(7);
s.display();
return 0;
}
| Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
|
Transform the following C++ implementation into VB, maintaining the same output and logic. |
#include <cln/integer.h>
#include <cln/integer_io.h>
#include <iostream>
#include <algorithm>
#include <vector>
#include <iomanip>
#include <sstream>
#include <string>
#include <cstdlib>
#include <cmath>
#include <map>
using namespace cln ;
class NextNum {
public :
NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { }
cl_I operator( )( ) {
cl_I result = first + second ;
first = second ;
second = result ;
return result ;
}
private :
cl_I first ;
cl_I second ;
} ;
void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) {
for ( cl_I bignumber : fibos ) {
std::ostringstream os ;
fprintdecimal ( os , bignumber ) ;
int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ;
auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ;
if ( ! result.second )
numberfrequencies[ firstdigit ]++ ;
}
}
int main( ) {
std::vector<cl_I> fibonaccis( 1000 ) ;
fibonaccis[ 0 ] = 0 ;
fibonaccis[ 1 ] = 1 ;
cl_I a = 0 ;
cl_I b = 1 ;
std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ;
std::cout << std::endl ;
std::map<int , int> frequencies ;
findFrequencies( fibonaccis , frequencies ) ;
std::cout << " found expected\n" ;
for ( int i = 1 ; i < 10 ; i++ ) {
double found = static_cast<double>( frequencies[ i ] ) / 1000 ;
double expected = std::log10( 1 + 1 / static_cast<double>( i )) ;
std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ;
std::cout.precision( 3 ) ;
std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ;
}
return 0 ;
}
| Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
|
Rewrite the snippet below in VB so it works the same as the original C++ code. |
#include <cln/integer.h>
#include <cln/integer_io.h>
#include <iostream>
#include <algorithm>
#include <vector>
#include <iomanip>
#include <sstream>
#include <string>
#include <cstdlib>
#include <cmath>
#include <map>
using namespace cln ;
class NextNum {
public :
NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { }
cl_I operator( )( ) {
cl_I result = first + second ;
first = second ;
second = result ;
return result ;
}
private :
cl_I first ;
cl_I second ;
} ;
void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) {
for ( cl_I bignumber : fibos ) {
std::ostringstream os ;
fprintdecimal ( os , bignumber ) ;
int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ;
auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ;
if ( ! result.second )
numberfrequencies[ firstdigit ]++ ;
}
}
int main( ) {
std::vector<cl_I> fibonaccis( 1000 ) ;
fibonaccis[ 0 ] = 0 ;
fibonaccis[ 1 ] = 1 ;
cl_I a = 0 ;
cl_I b = 1 ;
std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ;
std::cout << std::endl ;
std::map<int , int> frequencies ;
findFrequencies( fibonaccis , frequencies ) ;
std::cout << " found expected\n" ;
for ( int i = 1 ; i < 10 ; i++ ) {
double found = static_cast<double>( frequencies[ i ] ) / 1000 ;
double expected = std::log10( 1 + 1 / static_cast<double>( i )) ;
std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ;
std::cout.precision( 3 ) ;
std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ;
}
return 0 ;
}
| Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
|
Transform the following C++ implementation into VB, maintaining the same output and logic. | double fib(double n)
{
if(n < 0)
{
throw "Invalid argument passed to fib";
}
else
{
struct actual_fib
{
static double calc(double n)
{
if(n < 2)
{
return n;
}
else
{
return calc(n-1) + calc(n-2);
}
}
};
return actual_fib::calc(n);
}
}
| Sub Main()
Debug.Print F(-10)
Debug.Print F(10)
End Sub
Private Function F(N As Long) As Variant
If N < 0 Then
F = "Error. Negative argument"
ElseIf N <= 1 Then
F = N
Else
F = F(N - 1) + F(N - 2)
End If
End Function
|
Convert this C++ block to VB, preserving its control flow and logic. | #include <string>
#include <iostream>
int main( ) {
std::string word( "Premier League" ) ;
std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ;
std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ;
std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ;
return 0 ;
}
| string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
|
Write a version of this C++ function in VB with identical behavior. | #include <string>
#include <iostream>
int main( ) {
std::string word( "Premier League" ) ;
std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ;
std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ;
std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ;
return 0 ;
}
| string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
|
Convert the following code from C++ to VB, ensuring the logic remains intact. | #include <string>
#include <iostream>
int main( ) {
std::string word( "Premier League" ) ;
std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ;
std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ;
std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ;
return 0 ;
}
| string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
|
Rewrite the snippet below in VB so it works the same as the original C++ code. | #include <iostream>
#include <string.h>
int main()
{
std::string longLine, longestLines, newLine;
while (std::cin >> newLine)
{
auto isNewLineShorter = longLine.c_str();
auto isLongLineShorter = newLine.c_str();
while (*isNewLineShorter && *isLongLineShorter)
{
isNewLineShorter = &isNewLineShorter[1];
isLongLineShorter = &isLongLineShorter[1];
}
if(*isNewLineShorter) continue;
if(*isLongLineShorter)
{
longLine = newLine;
longestLines = newLine;
}
else
{
longestLines+=newLine;
}
longestLines+="\n";
}
std::cout << "\nLongest string:\n" << longestLines;
}
|
Set objfso = CreateObject("Scripting.FileSystemObject")
Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_
"\input.txt",1)
list = ""
previous_line = ""
l = Len(previous_line)
Do Until objfile.AtEndOfStream
current_line = objfile.ReadLine
If Mid(current_line,l+1,1) <> "" Then
list = current_line & vbCrLf
previous_line = current_line
l = Len(previous_line)
ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then
list = list & current_line & vbCrLf
End If
Loop
WScript.Echo list
objfile.Close
Set objfso = Nothing
|
Translate the given C++ code snippet into VB without altering its behavior. | #include <vector>
#include <string>
#include <iostream>
#include <algorithm>
#include <fstream>
#include <iomanip>
typedef unsigned int uint;
using namespace std;
const uint TAPE_MAX_LEN = 49152;
struct action { char write, direction; };
class tape
{
public:
tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); }
void reset() { clear( '0' ); headPos = _sp; }
char read(){ return _t[headPos]; }
void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; }
void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); }
void action( const action* a ) { write( a->write ); move( a->direction ); }
void print( int c = 10 )
{
int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx;
for( int x = st; x < ed; x++ )
{ tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; }
cout << endl << setw( c + 1 ) << "^" << endl;
}
private:
void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; }
void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } }
string _t; uint headPos, _sp; char blk; const uint MAX_LEN;
};
class state
{
public:
bool operator ==( const string o ) { return o == name; }
string name, next; char symbol, write, direction;
};
class actionTable
{
public:
bool loadTable( string file )
{
reset();
ifstream mf; mf.open( file.c_str() ); if( mf.is_open() )
{
string str; state stt;
while( mf.good() )
{
getline( mf, str ); if( str[0] == '\'' ) break;
parseState( str, stt ); states.push_back( stt );
}
while( mf.good() )
{
getline( mf, str ); if( str == "" ) continue;
if( str[0] == '!' ) blank = str.erase( 0, 1 )[0];
if( str[0] == '^' ) curState = str.erase( 0, 1 );
if( str[0] == '>' ) input = str.erase( 0, 1 );
}
mf.close(); return true;
}
cout << "Could not open " << file << endl; return false;
}
bool action( char symbol, action& a )
{
vector<state>::iterator f = states.begin();
while( true )
{
f = find( f, states.end(), curState );
if( f == states.end() ) return false;
if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) )
{ a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; }
f++;
}
return true;
}
void reset() { states.clear(); blank = '0'; curState = input = ""; }
string getInput() { return input; }
char getBlank() { return blank; }
private:
void parseState( string str, state& stt )
{
string a[5]; int idx = 0;
for( string::iterator si = str.begin(); si != str.end(); si++ )
{ if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); }
stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4];
}
vector<state> states; char blank; string curState, input;
};
class utm
{
public:
utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; }
void start()
{
while( true )
{
reset(); int t = showMenu(); if( t == 0 ) return;
if( !at.loadTable( files[t - 1] ) ) return; startMachine();
}
}
private:
void simulate()
{
char r; action a;
while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); }
cout << endl << endl; system( "pause" );
}
int showMenu()
{
int t = -1;
while( t < 0 || t > 3 )
{
system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit";
cout << endl << endl << "Choose an action "; cin >> t;
}
return t;
}
void reset() { tp.reset(); at.reset(); }
void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); }
tape tp; actionTable at; string files[7];
};
int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
| Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
|
Please provide an equivalent version of this C++ code in VB. | #include <vector>
#include <string>
#include <iostream>
#include <algorithm>
#include <fstream>
#include <iomanip>
typedef unsigned int uint;
using namespace std;
const uint TAPE_MAX_LEN = 49152;
struct action { char write, direction; };
class tape
{
public:
tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); }
void reset() { clear( '0' ); headPos = _sp; }
char read(){ return _t[headPos]; }
void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; }
void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); }
void action( const action* a ) { write( a->write ); move( a->direction ); }
void print( int c = 10 )
{
int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx;
for( int x = st; x < ed; x++ )
{ tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; }
cout << endl << setw( c + 1 ) << "^" << endl;
}
private:
void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; }
void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } }
string _t; uint headPos, _sp; char blk; const uint MAX_LEN;
};
class state
{
public:
bool operator ==( const string o ) { return o == name; }
string name, next; char symbol, write, direction;
};
class actionTable
{
public:
bool loadTable( string file )
{
reset();
ifstream mf; mf.open( file.c_str() ); if( mf.is_open() )
{
string str; state stt;
while( mf.good() )
{
getline( mf, str ); if( str[0] == '\'' ) break;
parseState( str, stt ); states.push_back( stt );
}
while( mf.good() )
{
getline( mf, str ); if( str == "" ) continue;
if( str[0] == '!' ) blank = str.erase( 0, 1 )[0];
if( str[0] == '^' ) curState = str.erase( 0, 1 );
if( str[0] == '>' ) input = str.erase( 0, 1 );
}
mf.close(); return true;
}
cout << "Could not open " << file << endl; return false;
}
bool action( char symbol, action& a )
{
vector<state>::iterator f = states.begin();
while( true )
{
f = find( f, states.end(), curState );
if( f == states.end() ) return false;
if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) )
{ a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; }
f++;
}
return true;
}
void reset() { states.clear(); blank = '0'; curState = input = ""; }
string getInput() { return input; }
char getBlank() { return blank; }
private:
void parseState( string str, state& stt )
{
string a[5]; int idx = 0;
for( string::iterator si = str.begin(); si != str.end(); si++ )
{ if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); }
stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4];
}
vector<state> states; char blank; string curState, input;
};
class utm
{
public:
utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; }
void start()
{
while( true )
{
reset(); int t = showMenu(); if( t == 0 ) return;
if( !at.loadTable( files[t - 1] ) ) return; startMachine();
}
}
private:
void simulate()
{
char r; action a;
while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); }
cout << endl << endl; system( "pause" );
}
int showMenu()
{
int t = -1;
while( t < 0 || t > 3 )
{
system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit";
cout << endl << endl << "Choose an action "; cin >> t;
}
return t;
}
void reset() { tp.reset(); at.reset(); }
void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); }
tape tp; actionTable at; string files[7];
};
int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
| Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
|
Convert the following code from C++ to VB, ensuring the logic remains intact. | #include <direct.h>
#include <fstream>
int main() {
std::fstream f("output.txt", std::ios::out);
f.close();
f.open("/output.txt", std::ios::out);
f.close();
_mkdir("docs");
_mkdir("/docs");
return 0;
}
| Public Sub create_file()
Dim FileNumber As Integer
FileNumber = FreeFile
MkDir "docs"
Open "docs\output.txt" For Output As #FreeFile
Close #FreeFile
MkDir "C:\docs"
Open "C:\docs\output.txt" For Output As #FreeFile
Close #FreeFile
End Sub
|
Convert the following code from C++ to VB, ensuring the logic remains intact. | #include <map>
#include <string>
#include <iostream>
#include <iomanip>
const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT";
class DnaBase {
public:
DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) {
for (auto elm : dna) {
if (count.find(elm) == count.end())
count[elm] = 0;
++count[elm];
}
}
void viewGenome() {
std::cout << "Sequence:" << std::endl;
std::cout << std::endl;
int limit = genome.size() / displayWidth;
if (genome.size() % displayWidth != 0)
++limit;
for (int i = 0; i < limit; ++i) {
int beginPos = i * displayWidth;
std::cout << std::setw(4) << beginPos << " :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl;
}
std::cout << std::endl;
std::cout << "Base Count" << std::endl;
std::cout << "----------" << std::endl;
std::cout << std::endl;
int total = 0;
for (auto elm : count) {
std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl;
total += elm.second;
}
std::cout << std::endl;
std::cout << "Total: " << total << std::endl;
}
private:
std::string genome;
std::map<char, int> count;
int displayWidth;
};
int main(void) {
auto d = new DnaBase();
d->viewGenome();
delete d;
return 0;
}
| b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
|
Rewrite the snippet below in VB so it works the same as the original C++ code. | #include <map>
#include <string>
#include <iostream>
#include <iomanip>
const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT";
class DnaBase {
public:
DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) {
for (auto elm : dna) {
if (count.find(elm) == count.end())
count[elm] = 0;
++count[elm];
}
}
void viewGenome() {
std::cout << "Sequence:" << std::endl;
std::cout << std::endl;
int limit = genome.size() / displayWidth;
if (genome.size() % displayWidth != 0)
++limit;
for (int i = 0; i < limit; ++i) {
int beginPos = i * displayWidth;
std::cout << std::setw(4) << beginPos << " :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl;
}
std::cout << std::endl;
std::cout << "Base Count" << std::endl;
std::cout << "----------" << std::endl;
std::cout << std::endl;
int total = 0;
for (auto elm : count) {
std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl;
total += elm.second;
}
std::cout << std::endl;
std::cout << "Total: " << total << std::endl;
}
private:
std::string genome;
std::map<char, int> count;
int displayWidth;
};
int main(void) {
auto d = new DnaBase();
d->viewGenome();
delete d;
return 0;
}
| b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
|
Please provide an equivalent version of this C++ code in VB. | #include <algorithm>
#include <array>
#include <chrono>
#include <iostream>
#include <mutex>
#include <random>
#include <string>
#include <string_view>
#include <thread>
const int timeScale = 42;
void Message(std::string_view message)
{
static std::mutex cout_mutex;
std::scoped_lock cout_lock(cout_mutex);
std::cout << message << std::endl;
}
struct Fork {
std::mutex mutex;
};
struct Dinner {
std::array<Fork, 5> forks;
~Dinner() { Message("Dinner is over"); }
};
class Philosopher
{
std::mt19937 rng{std::random_device {}()};
const std::string name;
Fork& left;
Fork& right;
std::thread worker;
void live();
void dine();
void ponder();
public:
Philosopher(std::string name_, Fork& l, Fork& r)
: name(std::move(name_)), left(l), right(r), worker(&Philosopher::live, this)
{}
~Philosopher()
{
worker.join();
Message(name + " went to sleep.");
}
};
void Philosopher::live()
{
for(;;)
{
{
std::scoped_lock dine_lock(left.mutex, right.mutex);
dine();
}
ponder();
}
}
void Philosopher::dine()
{
Message(name + " started eating.");
thread_local std::array<const char*, 3> foods {"chicken", "rice", "soda"};
thread_local std::array<const char*, 3> reactions {
"I like this %s!", "This %s is good.", "Mmm, %s..."
};
thread_local std::uniform_int_distribution<> dist(1, 6);
std::shuffle( foods.begin(), foods.end(), rng);
std::shuffle(reactions.begin(), reactions.end(), rng);
constexpr size_t buf_size = 64;
char buffer[buf_size];
for(int i = 0; i < 3; ++i) {
std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng) * timeScale));
snprintf(buffer, buf_size, reactions[i], foods[i]);
Message(name + ": " + buffer);
}
std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng)) * timeScale);
Message(name + " finished and left.");
}
void Philosopher::ponder()
{
static constexpr std::array<const char*, 5> topics {{
"politics", "art", "meaning of life", "source of morality", "how many straws makes a bale"
}};
thread_local std::uniform_int_distribution<> wait(1, 6);
thread_local std::uniform_int_distribution<> dist(0, topics.size() - 1);
while(dist(rng) > 0) {
std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale));
Message(name + " is pondering about " + topics[dist(rng)] + ".");
}
std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale));
Message(name + " is hungry again!");
}
int main()
{
Dinner dinner;
Message("Dinner started!");
std::array<Philosopher, 5> philosophers {{
{"Aristotle", dinner.forks[0], dinner.forks[1]},
{"Democritus", dinner.forks[1], dinner.forks[2]},
{"Plato", dinner.forks[2], dinner.forks[3]},
{"Pythagoras", dinner.forks[3], dinner.forks[4]},
{"Socrates", dinner.forks[4], dinner.forks[0]},
}};
Message("It is dark outside...");
}
|
Public Const HOLDON = False
Public Const DIJKSTRASOLUTION = True
Public Const X = 10
Public Const GETS = 0
Public Const PUTS = 1
Public Const EATS = 2
Public Const THKS = 5
Public Const FRSTFORK = 0
Public Const SCNDFORK = 1
Public Const SPAGHETI = 0
Public Const UNIVERSE = 1
Public Const MAXCOUNT = 100000
Public Const PHILOSOPHERS = 5
Public semaphore(PHILOSOPHERS - 1) As Integer
Public positi0n(1, PHILOSOPHERS - 1) As Integer
Public programcounter(PHILOSOPHERS - 1) As Long
Public statistics(PHILOSOPHERS - 1, 5, 1) As Long
Public names As Variant
Private Sub init()
names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}]
For j = 0 To PHILOSOPHERS - 2
positi0n(0, j) = j + 1
positi0n(1, j) = j
Next j
If DIJKSTRASOLUTION Then
positi0n(0, PHILOSOPHERS - 1) = j
positi0n(1, PHILOSOPHERS - 1) = 0
Else
positi0n(0, PHILOSOPHERS - 1) = 0
positi0n(1, PHILOSOPHERS - 1) = j
End If
End Sub
Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer)
statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1
If verb < 2 Then
If semaphore(positi0n(objekt, subject)) <> verb Then
If Not HOLDON Then
semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt
programcounter(subject) = 0
End If
Else
semaphore(positi0n(objekt, subject)) = 1 - verb
programcounter(subject) = (programcounter(subject) + 1) Mod 6
End If
Else
programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6
End If
End Sub
Private Sub dine()
Dim ph As Integer
Do While TC < MAXCOUNT
For ph = 0 To PHILOSOPHERS - 1
Select Case programcounter(ph)
Case 0: philosopher ph, GETS, FRSTFORK
Case 1: philosopher ph, GETS, SCNDFORK
Case 2: philosopher ph, EATS, SPAGHETI
Case 3: philosopher ph, PUTS, FRSTFORK
Case 4: philosopher ph, PUTS, SCNDFORK
Case 5: philosopher ph, THKS, UNIVERSE
End Select
TC = TC + 1
Next ph
Loop
End Sub
Private Sub show()
Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks"
Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About"
Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe"
For subject = 0 To PHILOSOPHERS - 1
Debug.Print names(subject + 1),
For objekt = 0 To 1
Debug.Print statistics(subject, GETS, objekt),
Next objekt
Debug.Print statistics(subject, EATS, SPAGHETI),
For objekt = 0 To 1
Debug.Print statistics(subject, PUTS, objekt),
Next objekt
Debug.Print statistics(subject, THKS, UNIVERSE)
Next subject
End Sub
Public Sub main()
init
dine
show
End Sub
|
Convert this C++ snippet to VB and keep its semantics consistent. | #include <iostream>
class factorion_t {
public:
factorion_t() {
f[0] = 1u;
for (uint n = 1u; n < 12u; n++)
f[n] = f[n - 1] * n;
}
bool operator()(uint i, uint b) const {
uint sum = 0;
for (uint j = i; j > 0u; j /= b)
sum += f[j % b];
return sum == i;
}
private:
ulong f[12];
};
int main() {
factorion_t factorion;
for (uint b = 9u; b <= 12u; ++b) {
std::cout << "factorions for base " << b << ':';
for (uint i = 1u; i < 1500000u; ++i)
if (factorion(i, b))
std::cout << ' ' << i;
std::cout << std::endl;
}
return 0;
}
|
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
|
Convert the following code from C++ to VB, ensuring the logic remains intact. | #include <iostream>
class factorion_t {
public:
factorion_t() {
f[0] = 1u;
for (uint n = 1u; n < 12u; n++)
f[n] = f[n - 1] * n;
}
bool operator()(uint i, uint b) const {
uint sum = 0;
for (uint j = i; j > 0u; j /= b)
sum += f[j % b];
return sum == i;
}
private:
ulong f[12];
};
int main() {
factorion_t factorion;
for (uint b = 9u; b <= 12u; ++b) {
std::cout << "factorions for base " << b << ':';
for (uint i = 1u; i < 1500000u; ++i)
if (factorion(i, b))
std::cout << ' ' << i;
std::cout << std::endl;
}
return 0;
}
|
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
|
Preserve the algorithm and functionality while converting the code from C++ to VB. | #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Ensure the translated VB code behaves exactly like the original C++ snippet. | #include <algorithm>
#include <cctype>
#include <iostream>
#include <sstream>
#include <string>
#include <vector>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
class command {
public:
command(const std::string&, size_t);
const std::string& cmd() const { return cmd_; }
size_t min_length() const { return min_len_; }
bool match(const std::string&) const;
private:
std::string cmd_;
size_t min_len_;
};
command::command(const std::string& cmd, size_t min_len)
: cmd_(cmd), min_len_(min_len) {}
bool command::match(const std::string& str) const {
size_t olen = str.length();
return olen >= min_len_ && olen <= cmd_.length()
&& cmd_.compare(0, olen, str) == 0;
}
void uppercase(std::string& str) {
std::transform(str.begin(), str.end(), str.begin(),
[](unsigned char c) -> unsigned char { return std::toupper(c); });
}
size_t get_min_length(const std::string& str) {
size_t len = 0, n = str.length();
while (len < n && std::isupper(static_cast<unsigned char>(str[len])))
++len;
return len;
}
class command_list {
public:
explicit command_list(const char*);
const command* find_command(const std::string&) const;
private:
std::vector<command> commands_;
};
command_list::command_list(const char* table) {
std::vector<command> commands;
std::istringstream is(table);
std::string word;
while (is >> word) {
size_t len = get_min_length(word);
uppercase(word);
commands_.push_back(command(word, len));
}
}
const command* command_list::find_command(const std::string& word) const {
auto iter = std::find_if(commands_.begin(), commands_.end(),
[&word](const command& cmd) { return cmd.match(word); });
return (iter != commands_.end()) ? &*iter : nullptr;
}
std::string test(const command_list& commands, const std::string& input) {
std::string output;
std::istringstream is(input);
std::string word;
while (is >> word) {
if (!output.empty())
output += ' ';
uppercase(word);
const command* cmd_ptr = commands.find_command(word);
if (cmd_ptr)
output += cmd_ptr->cmd();
else
output += "*error*";
}
return output;
}
int main() {
command_list commands(command_table);
std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin");
std::string output(test(commands, input));
std::cout << " input: " << input << '\n';
std::cout << "output: " << output << '\n';
return 0;
}
| Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
|
Write the same code in VB as shown below in C++. | #include <iostream>
#include <algorithm>
#include <vector>
#include <bitset>
#include <string>
class bacon {
public:
bacon() {
int x = 0;
for( ; x < 9; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 20; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 24; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
}
std::string encode( std::string txt ) {
std::string r;
size_t z;
for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) {
z = toupper( *i );
if( z < 'A' || z > 'Z' ) continue;
r.append( bAlphabet.at( ( *i & 31 ) - 1 ) );
}
return r;
}
std::string decode( std::string txt ) {
size_t len = txt.length();
while( len % 5 != 0 ) len--;
if( len != txt.length() ) txt = txt.substr( 0, len );
std::string r;
for( size_t i = 0; i < len; i += 5 ) {
r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) );
}
return r;
}
private:
std::vector<std::string> bAlphabet;
};
| Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
|
Produce a language-to-language conversion: from C++ to VB, same semantics. | #include <iostream>
#include <algorithm>
#include <vector>
#include <bitset>
#include <string>
class bacon {
public:
bacon() {
int x = 0;
for( ; x < 9; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 20; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
bAlphabet.push_back( bAlphabet.back() );
for( ; x < 24; x++ )
bAlphabet.push_back( std::bitset<5>( x ).to_string() );
}
std::string encode( std::string txt ) {
std::string r;
size_t z;
for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) {
z = toupper( *i );
if( z < 'A' || z > 'Z' ) continue;
r.append( bAlphabet.at( ( *i & 31 ) - 1 ) );
}
return r;
}
std::string decode( std::string txt ) {
size_t len = txt.length();
while( len % 5 != 0 ) len--;
if( len != txt.length() ) txt = txt.substr( 0, len );
std::string r;
for( size_t i = 0; i < len; i += 5 ) {
r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) );
}
return r;
}
private:
std::vector<std::string> bAlphabet;
};
| Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
|
Write the same code in VB as shown below in C++. | #include <vector>
#include <memory>
#include <cmath>
#include <iostream>
#include <iomanip>
using namespace std;
typedef vector< int > IntRow;
typedef vector< IntRow > IntTable;
auto_ptr< IntTable > getSpiralArray( int dimension )
{
auto_ptr< IntTable > spiralArrayPtr( new IntTable(
dimension, IntRow( dimension ) ) );
int numConcentricSquares = static_cast< int >( ceil(
static_cast< double >( dimension ) / 2.0 ) );
int j;
int sideLen = dimension;
int currNum = 0;
for ( int i = 0; i < numConcentricSquares; i++ )
{
for ( j = 0; j < sideLen; j++ )
( *spiralArrayPtr )[ i ][ i + j ] = currNum++;
for ( j = 1; j < sideLen; j++ )
( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++;
for ( j = sideLen - 2; j > -1; j-- )
( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++;
for ( j = sideLen - 2; j > 0; j-- )
( *spiralArrayPtr )[ i + j ][ i ] = currNum++;
sideLen -= 2;
}
return spiralArrayPtr;
}
void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr )
{
size_t dimension = spiralArrayPtr->size();
int fieldWidth = static_cast< int >( floor( log10(
static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2;
size_t col;
for ( size_t row = 0; row < dimension; row++ )
{
for ( col = 0; col < dimension; col++ )
cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ];
cout << endl;
}
}
int main()
{
printSpiralArray( getSpiralArray( 5 ) );
}
| Function build_spiral(n)
botcol = 0 : topcol = n - 1
botrow = 0 : toprow = n - 1
Dim matrix()
ReDim matrix(topcol,toprow)
dir = 0 : col = 0 : row = 0
For i = 0 To n*n-1
matrix(col,row) = i
Select Case dir
Case 0
If col < topcol Then
col = col + 1
Else
dir = 1 : row = row + 1 : botrow = botrow + 1
End If
Case 1
If row < toprow Then
row = row + 1
Else
dir = 2 : col = col - 1 : topcol = topcol - 1
End If
Case 2
If col > botcol Then
col = col - 1
Else
dir = 3 : row = row - 1 : toprow = toprow - 1
End If
Case 3
If row > botrow Then
row = row - 1
Else
dir = 0 : col = col + 1 : botcol = botcol + 1
End If
End Select
Next
For y = 0 To n-1
For x = 0 To n-1
WScript.StdOut.Write matrix(x,y) & vbTab
Next
WScript.StdOut.WriteLine
Next
End Function
build_spiral(CInt(WScript.Arguments(0)))
|
Port the provided C++ code into VB while preserving the original functionality. | #include <vector>
#include <algorithm>
#include <string>
template <class T>
struct sort_table_functor {
typedef bool (*CompFun)(const T &, const T &);
const CompFun ordering;
const int column;
const bool reverse;
sort_table_functor(CompFun o, int c, bool r) :
ordering(o), column(c), reverse(r) { }
bool operator()(const std::vector<T> &x, const std::vector<T> &y) const {
const T &a = x[column],
&b = y[column];
return reverse ? ordering(b, a)
: ordering(a, b);
}
};
template <class T>
bool myLess(const T &x, const T &y) { return x < y; }
template <class T>
void sort_table(std::vector<std::vector<T> > &table,
int column = 0, bool reverse = false,
bool (*ordering)(const T &, const T &) = myLess) {
std::sort(table.begin(), table.end(),
sort_table_functor<T>(ordering, column, reverse));
}
#include <iostream>
template <class T>
void print_matrix(std::vector<std::vector<T> > &data) {
for () {
for (int j = 0; j < 3; j++)
std::cout << data[i][j] << "\t";
std::cout << std::endl;
}
}
bool desc_len_comparator(const std::string &x, const std::string &y) {
return x.length() > y.length();
}
int main() {
std::string data_array[3][3] =
{
{"a", "b", "c"},
{"", "q", "z"},
{"zap", "zip", "Zot"}
};
std::vector<std::vector<std::string> > data_orig;
for (int i = 0; i < 3; i++) {
std::vector<std::string> row;
for (int j = 0; j < 3; j++)
row.push_back(data_array[i][j]);
data_orig.push_back(row);
}
print_matrix(data_orig);
std::vector<std::vector<std::string> > data = data_orig;
sort_table(data);
print_matrix(data);
data = data_orig;
sort_table(data, 2);
print_matrix(data);
data = data_orig;
sort_table(data, 1);
print_matrix(data);
data = data_orig;
sort_table(data, 1, true);
print_matrix(data);
data = data_orig;
sort_table(data, 0, false, desc_len_comparator);
print_matrix(data);
return 0;
}
| Private Sub optional_parameters(theRange As String, _
Optional ordering As Integer = 0, _
Optional column As Integer = 1, _
Optional reverse As Integer = 1)
ActiveSheet.Sort.SortFields.Clear
ActiveSheet.Sort.SortFields.Add _
Key:=Range(theRange).Columns(column), _
SortOn:=SortOnValues, _
Order:=reverse, _
DataOption:=ordering
With ActiveSheet.Sort
.SetRange Range(theRange)
.Header = xlGuess
.MatchCase = False
.Orientation = xlTopToBottom
.SortMethod = xlPinYin
.Apply
End With
End Sub
Public Sub main()
optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the C++ version. | FUNCTION MULTIPLY(X, Y)
DOUBLE PRECISION MULTIPLY, X, Y
| Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _
CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer
Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _
overlapped As Ptr) As Boolean
Declare Function GetLastError Lib "Kernel32" () As Integer
Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean
Const FILE_SHARE_READ = &h00000001
Const FILE_SHARE_WRITE = &h00000002
Const OPEN_EXISTING = 3
Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0)
If fHandle > 0 Then
Dim mb As MemoryBlock = "Hello, World!"
Dim bytesWritten As Integer
If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then
MsgBox("Error Number: " + Str(GetLastError))
End If
Call CloseHandle(fHandle)
Else
MsgBox("Error Number: " + Str(GetLastError))
End If
|
Convert this C++ block to VB, preserving its control flow and logic. | FUNCTION MULTIPLY(X, Y)
DOUBLE PRECISION MULTIPLY, X, Y
| Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _
CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer
Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _
overlapped As Ptr) As Boolean
Declare Function GetLastError Lib "Kernel32" () As Integer
Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean
Const FILE_SHARE_READ = &h00000001
Const FILE_SHARE_WRITE = &h00000002
Const OPEN_EXISTING = 3
Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0)
If fHandle > 0 Then
Dim mb As MemoryBlock = "Hello, World!"
Dim bytesWritten As Integer
If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then
MsgBox("Error Number: " + Str(GetLastError))
End If
Call CloseHandle(fHandle)
Else
MsgBox("Error Number: " + Str(GetLastError))
End If
|
Translate the given C++ code snippet into VB without altering its behavior. | #include <exception>
#include <iomanip>
#include <iostream>
#include <numeric>
#include <sstream>
#include <vector>
class Frac {
public:
Frac() : num(0), denom(1) {}
Frac(int n, int d) {
if (d == 0) {
throw std::runtime_error("d must not be zero");
}
int sign_of_d = d < 0 ? -1 : 1;
int g = std::gcd(n, d);
num = sign_of_d * n / g;
denom = sign_of_d * d / g;
}
Frac operator-() const {
return Frac(-num, denom);
}
Frac operator+(const Frac& rhs) const {
return Frac(num*rhs.denom + denom * rhs.num, rhs.denom*denom);
}
Frac operator-(const Frac& rhs) const {
return Frac(num*rhs.denom - denom * rhs.num, rhs.denom*denom);
}
Frac operator*(const Frac& rhs) const {
return Frac(num*rhs.num, denom*rhs.denom);
}
Frac operator*(int rhs) const {
return Frac(num * rhs, denom);
}
friend std::ostream& operator<<(std::ostream&, const Frac&);
private:
int num;
int denom;
};
std::ostream & operator<<(std::ostream & os, const Frac &f) {
if (f.num == 0 || f.denom == 1) {
return os << f.num;
}
std::stringstream ss;
ss << f.num << "/" << f.denom;
return os << ss.str();
}
Frac bernoulli(int n) {
if (n < 0) {
throw std::runtime_error("n may not be negative or zero");
}
std::vector<Frac> a;
for (int m = 0; m <= n; m++) {
a.push_back(Frac(1, m + 1));
for (int j = m; j >= 1; j--) {
a[j - 1] = (a[j - 1] - a[j]) * j;
}
}
if (n != 1) return a[0];
return -a[0];
}
int binomial(int n, int k) {
if (n < 0 || k < 0 || n < k) {
throw std::runtime_error("parameters are invalid");
}
if (n == 0 || k == 0) return 1;
int num = 1;
for (int i = k + 1; i <= n; i++) {
num *= i;
}
int denom = 1;
for (int i = 2; i <= n - k; i++) {
denom *= i;
}
return num / denom;
}
std::vector<Frac> faulhaberTraingle(int p) {
std::vector<Frac> coeffs(p + 1);
Frac q{ 1, p + 1 };
int sign = -1;
for (int j = 0; j <= p; j++) {
sign *= -1;
coeffs[p - j] = q * sign * binomial(p + 1, j) * bernoulli(j);
}
return coeffs;
}
int main() {
for (int i = 0; i < 10; i++) {
std::vector<Frac> coeffs = faulhaberTraingle(i);
for (auto frac : coeffs) {
std::cout << std::right << std::setw(5) << frac << " ";
}
std::cout << std::endl;
}
return 0;
}
| Module Module1
Class Frac
Private ReadOnly num As Long
Private ReadOnly denom As Long
Public Shared ReadOnly ZERO = New Frac(0, 1)
Public Shared ReadOnly ONE = New Frac(1, 1)
Public Sub New(n As Long, d As Long)
If d = 0 Then
Throw New ArgumentException("d must not be zero")
End If
Dim nn = n
Dim dd = d
If nn = 0 Then
dd = 1
ElseIf dd < 0 Then
nn = -nn
dd = -dd
End If
Dim g = Math.Abs(Gcd(nn, dd))
If g > 1 Then
nn /= g
dd /= g
End If
num = nn
denom = dd
End Sub
Private Shared Function Gcd(a As Long, b As Long) As Long
If b = 0 Then
Return a
Else
Return Gcd(b, a Mod b)
End If
End Function
Public Shared Operator -(self As Frac) As Frac
Return New Frac(-self.num, self.denom)
End Operator
Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom)
End Operator
Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac
Return lhs + -rhs
End Operator
Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom)
End Operator
Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x < y
End Operator
Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x > y
End Operator
Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom
End Operator
Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom
End Operator
Public Overrides Function ToString() As String
If denom = 1 Then
Return num.ToString
Else
Return String.Format("{0}/{1}", num, denom)
End If
End Function
Public Overrides Function Equals(obj As Object) As Boolean
Dim frac = CType(obj, Frac)
Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom
End Function
End Class
Function Bernoulli(n As Integer) As Frac
If n < 0 Then
Throw New ArgumentException("n may not be negative or zero")
End If
Dim a(n + 1) As Frac
For m = 0 To n
a(m) = New Frac(1, m + 1)
For j = m To 1 Step -1
a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1)
Next
Next
If n <> 1 Then
Return a(0)
Else
Return -a(0)
End If
End Function
Function Binomial(n As Integer, k As Integer) As Integer
If n < 0 OrElse k < 0 OrElse n < k Then
Throw New ArgumentException()
End If
If n = 0 OrElse k = 0 Then
Return 1
End If
Dim num = 1
For i = k + 1 To n
num *= i
Next
Dim denom = 1
For i = 2 To n - k
denom *= i
Next
Return num \ denom
End Function
Function FaulhaberTriangle(p As Integer) As Frac()
Dim coeffs(p + 1) As Frac
For i = 1 To p + 1
coeffs(i - 1) = Frac.ZERO
Next
Dim q As New Frac(1, p + 1)
Dim sign = -1
For j = 0 To p
sign *= -1
coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j)
Next
Return coeffs
End Function
Sub Main()
For i = 1 To 10
Dim coeffs = FaulhaberTriangle(i - 1)
For Each coeff In coeffs
Console.Write("{0,5} ", coeff)
Next
Console.WriteLine()
Next
End Sub
End Module
|
Change the programming language of this snippet from C++ to VB without modifying what it does. | #include <iostream>
int main(int argc, char* argv[])
{
std::cout << "This program is named " << argv[0] << std::endl;
std::cout << "There are " << argc-1 << " arguments given." << std::endl;
for (int i = 1; i < argc; ++i)
std::cout << "the argument #" << i << " is " << argv[i] << std::endl;
return 0;
}
| Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
|
Translate the given C++ code snippet into VB without altering its behavior. | #include <iostream>
int main(int argc, char* argv[])
{
std::cout << "This program is named " << argv[0] << std::endl;
std::cout << "There are " << argc-1 << " arguments given." << std::endl;
for (int i = 1; i < argc; ++i)
std::cout << "the argument #" << i << " is " << argv[i] << std::endl;
return 0;
}
| Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
|
Can you help me rewrite this code in VB instead of C++, keeping it the same logically? | #include <array>
#include <iostream>
#include <fstream>
#include <map>
#include <string>
#include <vector>
#include <boost/program_options.hpp>
class letterset {
public:
letterset() {
count_.fill(0);
}
explicit letterset(const std::string& str) {
count_.fill(0);
for (char c : str)
add(c);
}
bool contains(const letterset& set) const {
for (size_t i = 0; i < count_.size(); ++i) {
if (set.count_[i] > count_[i])
return false;
}
return true;
}
unsigned int count(char c) const {
return count_[index(c)];
}
bool is_valid() const {
return count_[0] == 0;
}
void add(char c) {
++count_[index(c)];
}
private:
static bool is_letter(char c) { return c >= 'a' && c <= 'z'; }
static int index(char c) { return is_letter(c) ? c - 'a' + 1 : 0; }
std::array<unsigned int, 27> count_;
};
template <typename iterator, typename separator>
std::string join(iterator begin, iterator end, separator sep) {
std::string result;
if (begin != end) {
result += *begin++;
for (; begin != end; ++begin) {
result += sep;
result += *begin;
}
}
return result;
}
using dictionary = std::vector<std::pair<std::string, letterset>>;
dictionary load_dictionary(const std::string& filename, int min_length,
int max_length) {
std::ifstream in(filename);
if (!in)
throw std::runtime_error("Cannot open file " + filename);
std::string word;
dictionary result;
while (getline(in, word)) {
if (word.size() < min_length)
continue;
if (word.size() > max_length)
continue;
letterset set(word);
if (set.is_valid())
result.emplace_back(word, set);
}
return result;
}
void word_wheel(const dictionary& dict, const std::string& letters,
char central_letter) {
letterset set(letters);
if (central_letter == 0 && !letters.empty())
central_letter = letters.at(letters.size()/2);
std::map<size_t, std::vector<std::string>> words;
for (const auto& pair : dict) {
const auto& word = pair.first;
const auto& subset = pair.second;
if (subset.count(central_letter) > 0 && set.contains(subset))
words[word.size()].push_back(word);
}
size_t total = 0;
for (const auto& p : words) {
const auto& v = p.second;
auto n = v.size();
total += n;
std::cout << "Found " << n << " " << (n == 1 ? "word" : "words")
<< " of length " << p.first << ": "
<< join(v.begin(), v.end(), ", ") << '\n';
}
std::cout << "Number of words found: " << total << '\n';
}
void find_max_word_count(const dictionary& dict, int word_length) {
size_t max_count = 0;
std::vector<std::pair<std::string, char>> max_words;
for (const auto& pair : dict) {
const auto& word = pair.first;
if (word.size() != word_length)
continue;
const auto& set = pair.second;
dictionary subsets;
for (const auto& p : dict) {
if (set.contains(p.second))
subsets.push_back(p);
}
letterset done;
for (size_t index = 0; index < word_length; ++index) {
char central_letter = word[index];
if (done.count(central_letter) > 0)
continue;
done.add(central_letter);
size_t count = 0;
for (const auto& p : subsets) {
const auto& subset = p.second;
if (subset.count(central_letter) > 0)
++count;
}
if (count > max_count) {
max_words.clear();
max_count = count;
}
if (count == max_count)
max_words.emplace_back(word, central_letter);
}
}
std::cout << "Maximum word count: " << max_count << '\n';
std::cout << "Words of " << word_length << " letters producing this count:\n";
for (const auto& pair : max_words)
std::cout << pair.first << " with central letter " << pair.second << '\n';
}
constexpr const char* option_filename = "filename";
constexpr const char* option_wheel = "wheel";
constexpr const char* option_central = "central";
constexpr const char* option_min_length = "min-length";
constexpr const char* option_part2 = "part2";
int main(int argc, char** argv) {
const int word_length = 9;
int min_length = 3;
std::string letters = "ndeokgelw";
std::string filename = "unixdict.txt";
char central_letter = 0;
bool do_part2 = false;
namespace po = boost::program_options;
po::options_description desc("Allowed options");
desc.add_options()
(option_filename, po::value<std::string>(), "name of dictionary file")
(option_wheel, po::value<std::string>(), "word wheel letters")
(option_central, po::value<char>(), "central letter (defaults to middle letter of word)")
(option_min_length, po::value<int>(), "minimum word length")
(option_part2, "include part 2");
try {
po::variables_map vm;
po::store(po::parse_command_line(argc, argv, desc), vm);
po::notify(vm);
if (vm.count(option_filename))
filename = vm[option_filename].as<std::string>();
if (vm.count(option_wheel))
letters = vm[option_wheel].as<std::string>();
if (vm.count(option_central))
central_letter = vm[option_central].as<char>();
if (vm.count(option_min_length))
min_length = vm[option_min_length].as<int>();
if (vm.count(option_part2))
do_part2 = true;
auto dict = load_dictionary(filename, min_length, word_length);
word_wheel(dict, letters, central_letter);
if (do_part2) {
std::cout << '\n';
find_max_word_count(dict, word_length);
}
} catch (const std::exception& ex) {
std::cerr << ex.what() << '\n';
return EXIT_FAILURE;
}
return EXIT_SUCCESS;
}
| Const wheel="ndeokgelw"
Sub print(s):
On Error Resume Next
WScript.stdout.WriteLine (s)
If err= &h80070006& Then WScript.Echo " Please run this script with CScript": WScript.quit
End Sub
Dim oDic
Set oDic = WScript.CreateObject("scripting.dictionary")
Dim cnt(127)
Dim fso
Set fso = WScript.CreateObject("Scripting.Filesystemobject")
Set ff=fso.OpenTextFile("unixdict.txt")
i=0
print "reading words of 3 or more letters"
While Not ff.AtEndOfStream
x=LCase(ff.ReadLine)
If Len(x)>=3 Then
If Not odic.exists(x) Then oDic.Add x,0
End If
Wend
print "remaining words: "& oDic.Count & vbcrlf
ff.Close
Set ff=Nothing
Set fso=Nothing
Set re=New RegExp
print "removing words with chars not in the wheel"
re.pattern="[^"& wheel &"]"
For Each w In oDic.Keys
If re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "ensuring the mandatory letter "& Mid(wheel,5,1) & " is present"
re.Pattern=Mid(wheel,5,1)
For Each w In oDic.Keys
If Not re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "checking number of chars"
Dim nDic
Set nDic = WScript.CreateObject("scripting.dictionary")
For i=1 To Len(wheel)
x=Mid(wheel,i,1)
If nDic.Exists(x) Then
a=nDic(x)
nDic(x)=Array(a(0)+1,0)
Else
nDic.add x,Array(1,0)
End If
Next
For Each w In oDic.Keys
For Each c In nDic.Keys
ndic(c)=Array(nDic(c)(0),0)
Next
For ii = 1 To len(w)
c=Mid(w,ii,1)
a=nDic(c)
If (a(0)=a(1)) Then
oDic.Remove(w):Exit For
End If
nDic(c)=Array(a(0),a(1)+1)
Next
Next
print "Remaining words "& oDic.count
For Each w In oDic.Keys
print w
Next
|
Change the programming language of this snippet from C++ to VB without modifying what it does. | #include <vector>
#include <iostream>
int main()
{
std::vector<int> a(3), b(4);
a[0] = 11; a[1] = 12; a[2] = 13;
b[0] = 21; b[1] = 22; b[2] = 23; b[3] = 24;
a.insert(a.end(), b.begin(), b.end());
for (int i = 0; i < a.size(); ++i)
std::cout << "a[" << i << "] = " << a[i] << "\n";
}
| DEFINT A(1 to 4) = {1, 2, 3, 4}
DEFINT B(1 to 4) = {10, 20, 30, 40}
Redim A(1 to 8) as integer
MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
|
Produce a functionally identical VB code for the snippet given in C++. | #include <iostream>
#include <string>
using namespace std;
int main()
{
long int integer_input;
string string_input;
cout << "Enter an integer: ";
cin >> integer_input;
cout << "Enter a string: ";
cin >> string_input;
return 0;
}
| Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
|
Produce a functionally identical VB code for the snippet given in C++. | #include <iostream>
#include <string>
using namespace std;
int main()
{
long int integer_input;
string string_input;
cout << "Enter an integer: ";
cin >> integer_input;
cout << "Enter a string: ";
cin >> string_input;
return 0;
}
| Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
|
Translate the given C++ code snippet into VB without altering its behavior. | #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
| Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
|
Produce a language-to-language conversion: from C++ to VB, same semantics. | #include <iostream>
#include <windows.h>
#include <mmsystem.h>
#pragma comment ( lib, "winmm.lib" )
typedef unsigned char byte;
typedef union
{
unsigned long word;
unsigned char data[4];
}
midi_msg;
class midi
{
public:
midi()
{
if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR )
{
std::cout << "Error opening MIDI Output..." << std::endl;
device = 0;
}
}
~midi()
{
midiOutReset( device );
midiOutClose( device );
}
bool isOpen() { return device != 0; }
void setInstrument( byte i )
{
message.data[0] = 0xc0; message.data[1] = i;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void playNote( byte n, unsigned i )
{
playNote( n ); Sleep( i ); stopNote( n );
}
private:
void playNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 127; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
void stopNote( byte n )
{
message.data[0] = 0x90; message.data[1] = n;
message.data[2] = 0; message.data[3] = 0;
midiOutShortMsg( device, message.word );
}
HMIDIOUT device;
midi_msg message;
};
int main( int argc, char* argv[] )
{
midi m;
if( m.isOpen() )
{
byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 };
m.setInstrument( 42 );
for( int x = 0; x < 8; x++ )
m.playNote( notes[x], rand() % 100 + 158 );
Sleep( 1000 );
}
return 0;
}
| Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
|
Write the same code in VB as shown below in C++. | #include <vector>
#include <string>
#include <iostream>
#include <boost/tuple/tuple.hpp>
#include <set>
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & ,
std::set<int> & , const int ) ;
int main( ) {
std::vector<boost::tuple<std::string , int , int> > items ;
items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ;
items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ;
items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ;
items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ;
items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ;
items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ;
items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ;
items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ;
items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ;
items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ;
items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ;
items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ;
items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ;
items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ;
items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ;
items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ;
items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ;
items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ;
items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ;
items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ;
items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ;
items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ;
items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ;
const int maximumWeight = 400 ;
std::set<int> bestItems ;
int bestValue = findBestPack( items , bestItems , maximumWeight ) ;
std::cout << "The best value that can be packed in the given knapsack is " <<
bestValue << " !\n" ;
int totalweight = 0 ;
std::cout << "The following items should be packed in the knapsack:\n" ;
for ( std::set<int>::const_iterator si = bestItems.begin( ) ;
si != bestItems.end( ) ; si++ ) {
std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ;
totalweight += (items.begin( ) + *si)->get<1>( ) ;
}
std::cout << "The total weight of all items is " << totalweight << " !\n" ;
return 0 ;
}
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) {
const int n = items.size( ) ;
int bestValues [ n ][ weightlimit ] ;
std::set<int> solutionSets[ n ][ weightlimit ] ;
std::set<int> emptyset ;
for ( int i = 0 ; i < n ; i++ ) {
for ( int j = 0 ; j < weightlimit ; j++ ) {
bestValues[ i ][ j ] = 0 ;
solutionSets[ i ][ j ] = emptyset ;
}
}
for ( int i = 0 ; i < n ; i++ ) {
for ( int weight = 0 ; weight < weightlimit ; weight++ ) {
if ( i == 0 )
bestValues[ i ][ weight ] = 0 ;
else {
int itemweight = (items.begin( ) + i)->get<1>( ) ;
if ( weight < itemweight ) {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
} else {
if ( bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) >
bestValues[ i - 1 ][ weight ] ) {
bestValues[ i ][ weight ] =
bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) ;
solutionSets[ i ][ weight ] =
solutionSets[ i - 1 ][ weight - itemweight ] ;
solutionSets[ i ][ weight ].insert( i ) ;
}
else {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
}
}
}
}
}
bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ;
return bestValues[ n - 1 ][ weightlimit - 1 ] ;
}
|
Option Explicit
Const maxWeight = 400
Dim DataList As Variant
Dim xList(64, 3) As Variant
Dim nItems As Integer
Dim s As String, xss As String
Dim xwei As Integer, xval As Integer, nn As Integer
Sub Main()
Dim i As Integer, j As Integer
DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _
"glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _
"cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _
"T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _
"waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _
"note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50)
nItems = (UBound(DataList) + 1) / 3
j = 0
For i = 1 To nItems
xList(i, 1) = DataList(j)
xList(i, 2) = DataList(j + 1)
xList(i, 3) = DataList(j + 2)
j = j + 3
Next i
s = ""
For i = 1 To nItems
s = s & Chr(i)
Next
nn = 0
Call ChoiceBin(1, "")
For i = 1 To Len(xss)
j = Asc(Mid(xss, i, 1))
Debug.Print xList(j, 1)
Next i
Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval
End Sub
Private Sub ChoiceBin(n As String, ss As String)
Dim r As String
Dim i As Integer, j As Integer, iwei As Integer, ival As Integer
Dim ipct As Integer
If n = Len(s) + 1 Then
iwei = 0: ival = 0
For i = 1 To Len(ss)
j = Asc(Mid(ss, i, 1))
iwei = iwei + xList(j, 2)
ival = ival + xList(j, 3)
Next
If iwei <= maxWeight And ival > xval Then
xss = ss: xwei = iwei: xval = ival
End If
Else
r = Mid(s, n, 1)
Call ChoiceBin(n + 1, ss & r)
Call ChoiceBin(n + 1, ss)
End If
End Sub
|
Rewrite this program in VB while keeping its functionality equivalent to the C++ version. | #include <vector>
#include <string>
#include <iostream>
#include <boost/tuple/tuple.hpp>
#include <set>
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & ,
std::set<int> & , const int ) ;
int main( ) {
std::vector<boost::tuple<std::string , int , int> > items ;
items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ;
items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ;
items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ;
items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ;
items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ;
items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ;
items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ;
items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ;
items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ;
items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ;
items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ;
items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ;
items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ;
items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ;
items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ;
items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ;
items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ;
items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ;
items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ;
items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ;
items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ;
items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ;
items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ;
const int maximumWeight = 400 ;
std::set<int> bestItems ;
int bestValue = findBestPack( items , bestItems , maximumWeight ) ;
std::cout << "The best value that can be packed in the given knapsack is " <<
bestValue << " !\n" ;
int totalweight = 0 ;
std::cout << "The following items should be packed in the knapsack:\n" ;
for ( std::set<int>::const_iterator si = bestItems.begin( ) ;
si != bestItems.end( ) ; si++ ) {
std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ;
totalweight += (items.begin( ) + *si)->get<1>( ) ;
}
std::cout << "The total weight of all items is " << totalweight << " !\n" ;
return 0 ;
}
int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) {
const int n = items.size( ) ;
int bestValues [ n ][ weightlimit ] ;
std::set<int> solutionSets[ n ][ weightlimit ] ;
std::set<int> emptyset ;
for ( int i = 0 ; i < n ; i++ ) {
for ( int j = 0 ; j < weightlimit ; j++ ) {
bestValues[ i ][ j ] = 0 ;
solutionSets[ i ][ j ] = emptyset ;
}
}
for ( int i = 0 ; i < n ; i++ ) {
for ( int weight = 0 ; weight < weightlimit ; weight++ ) {
if ( i == 0 )
bestValues[ i ][ weight ] = 0 ;
else {
int itemweight = (items.begin( ) + i)->get<1>( ) ;
if ( weight < itemweight ) {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
} else {
if ( bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) >
bestValues[ i - 1 ][ weight ] ) {
bestValues[ i ][ weight ] =
bestValues[ i - 1 ][ weight - itemweight ] +
(items.begin( ) + i)->get<2>( ) ;
solutionSets[ i ][ weight ] =
solutionSets[ i - 1 ][ weight - itemweight ] ;
solutionSets[ i ][ weight ].insert( i ) ;
}
else {
bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ;
solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ;
}
}
}
}
}
bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ;
return bestValues[ n - 1 ][ weightlimit - 1 ] ;
}
|
Option Explicit
Const maxWeight = 400
Dim DataList As Variant
Dim xList(64, 3) As Variant
Dim nItems As Integer
Dim s As String, xss As String
Dim xwei As Integer, xval As Integer, nn As Integer
Sub Main()
Dim i As Integer, j As Integer
DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _
"glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _
"cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _
"T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _
"waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _
"note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50)
nItems = (UBound(DataList) + 1) / 3
j = 0
For i = 1 To nItems
xList(i, 1) = DataList(j)
xList(i, 2) = DataList(j + 1)
xList(i, 3) = DataList(j + 2)
j = j + 3
Next i
s = ""
For i = 1 To nItems
s = s & Chr(i)
Next
nn = 0
Call ChoiceBin(1, "")
For i = 1 To Len(xss)
j = Asc(Mid(xss, i, 1))
Debug.Print xList(j, 1)
Next i
Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval
End Sub
Private Sub ChoiceBin(n As String, ss As String)
Dim r As String
Dim i As Integer, j As Integer, iwei As Integer, ival As Integer
Dim ipct As Integer
If n = Len(s) + 1 Then
iwei = 0: ival = 0
For i = 1 To Len(ss)
j = Asc(Mid(ss, i, 1))
iwei = iwei + xList(j, 2)
ival = ival + xList(j, 3)
Next
If iwei <= maxWeight And ival > xval Then
xss = ss: xwei = iwei: xval = ival
End If
Else
r = Mid(s, n, 1)
Call ChoiceBin(n + 1, ss & r)
Call ChoiceBin(n + 1, ss)
End If
End Sub
|
Keep all operations the same but rewrite the snippet in VB. | #include <algorithm>
#include <iostream>
#include <vector>
typedef unsigned long long integer;
std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) {
std::vector<integer> result;
for (integer a = ancestor[n]; a != 0 && a != n; ) {
n = a;
a = ancestor[n];
result.push_back(n);
}
return result;
}
void print_vector(const std::vector<integer>& vec) {
if (vec.empty()) {
std::cout << "none\n";
return;
}
auto i = vec.begin();
std::cout << *i++;
for (; i != vec.end(); ++i)
std::cout << ", " << *i;
std::cout << '\n';
}
bool is_prime(integer n) {
if (n < 2)
return false;
if (n % 2 == 0)
return n == 2;
for (integer p = 3; p * p <= n; p += 2) {
if (n % p == 0)
return false;
}
return true;
}
int main(int argc, char** argv) {
const size_t limit = 100;
std::vector<integer> ancestor(limit, 0);
std::vector<std::vector<integer>> descendants(limit);
for (size_t prime = 0; prime < limit; ++prime) {
if (!is_prime(prime))
continue;
descendants[prime].push_back(prime);
for (size_t i = 0; i + prime < limit; ++i) {
integer s = i + prime;
for (integer n : descendants[i]) {
integer prod = n * prime;
descendants[s].push_back(prod);
if (prod < limit)
ancestor[prod] = s;
}
}
}
size_t total_descendants = 0;
for (integer i = 1; i < limit; ++i) {
std::vector<integer> ancestors(get_ancestors(ancestor, i));
std::cout << "[" << i << "] Level: " << ancestors.size() << '\n';
std::cout << "Ancestors: ";
std::sort(ancestors.begin(), ancestors.end());
print_vector(ancestors);
std::cout << "Descendants: ";
std::vector<integer>& desc = descendants[i];
if (!desc.empty()) {
std::sort(desc.begin(), desc.end());
if (desc[0] == i)
desc.erase(desc.begin());
}
std::cout << desc.size() << '\n';
total_descendants += desc.size();
if (!desc.empty())
print_vector(desc);
std::cout << '\n';
}
std::cout << "Total descendants: " << total_descendants << '\n';
return 0;
}
| Imports System.Math
Module Module1
Const MAXPRIME = 99
Const MAXPARENT = 99
Const NBRCHILDREN = 547100
Public Primes As New Collection()
Public PrimesR As New Collection()
Public Ancestors As New Collection()
Public Parents(MAXPARENT + 1) As Integer
Public CptDescendants(MAXPARENT + 1) As Integer
Public Children(NBRCHILDREN) As ChildStruct
Public iChildren As Integer
Public Delimiter As String = ", "
Public Structure ChildStruct
Public Child As Long
Public pLower As Integer
Public pHigher As Integer
End Structure
Sub Main()
Dim Parent As Short
Dim Sum As Short
Dim i As Short
Dim TotDesc As Integer = 0
Dim MidPrime As Integer
If GetPrimes(Primes, MAXPRIME) = vbFalse Then
Return
End If
For i = Primes.Count To 1 Step -1
PrimesR.Add(Primes.Item(i))
Next
MidPrime = PrimesR.Item(1) / 2
For Each Prime In PrimesR
Parents(Prime) = InsertChild(Parents(Prime), Prime)
CptDescendants(Prime) += 1
If Prime > MidPrime Then
Continue For
End If
For Parent = 1 To MAXPARENT
Sum = Parent + Prime
If Sum > MAXPARENT Then
Exit For
End If
If Parents(Parent) Then
InsertPreorder(Parents(Parent), Sum, Prime)
CptDescendants(Sum) += CptDescendants(Parent)
End If
Next
Next
RemoveFalseChildren()
If MAXPARENT > MAXPRIME Then
If GetPrimes(Primes, MAXPARENT) = vbFalse Then
Return
End If
End If
FileOpen(1, "Ancestors.txt", OpenMode.Output)
For Parent = 1 To MAXPARENT
GetAncestors(Parent)
PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString)
If Ancestors.Count Then
Print(1, "Ancestors: " & Ancestors.Item(1).ToString)
For i = 2 To Ancestors.Count
Print(1, ", " & Ancestors.Item(i).ToString)
Next
PrintLine(1)
Ancestors.Clear()
Else
PrintLine(1, "Ancestors: None")
End If
If CptDescendants(Parent) Then
PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString)
Delimiter = ""
PrintDescendants(Parents(Parent))
PrintLine(1)
TotDesc += CptDescendants(Parent)
Else
PrintLine(1, "Descendants: None")
End If
PrintLine(1)
Next
Primes.Clear()
PrimesR.Clear()
PrintLine(1, "Total descendants " & TotDesc.ToString)
PrintLine(1)
FileClose(1)
End Sub
Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short)
Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime)
If Children(_index).pLower Then
InsertPreorder(Children(_index).pLower, _sum, _prime)
End If
If Children(_index).pHigher Then
InsertPreorder(Children(_index).pHigher, _sum, _prime)
End If
Return Nothing
End Function
Function InsertChild(_index As Integer, _child As Long) As Integer
If _index Then
If _child <= Children(_index).Child Then
Children(_index).pLower = InsertChild(Children(_index).pLower, _child)
Else
Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child)
End If
Else
iChildren += 1
_index = iChildren
Children(_index).Child = _child
Children(_index).pLower = 0
Children(_index).pHigher = 0
End If
Return _index
End Function
Function RemoveFalseChildren()
Dim Exclusions As New Collection
Exclusions.Add(4)
For Each Prime In Primes
Exclusions.Add(Prime)
Next
For Each ex In Exclusions
Parents(ex) = Children(Parents(ex)).pHigher
CptDescendants(ex) -= 1
Next
Exclusions.Clear()
Return Nothing
End Function
Function GetAncestors(_child As Short)
Dim Child As Short = _child
Dim Parent As Short = 0
For Each Prime In Primes
If Child = 1 Then
Exit For
End If
While Child Mod Prime = 0
Child /= Prime
Parent += Prime
End While
Next
If Parent = _child Or _child = 1 Then
Return Nothing
End If
GetAncestors(Parent)
Ancestors.Add(Parent)
Return Nothing
End Function
Function PrintDescendants(_index As Integer)
If Children(_index).pLower Then
PrintDescendants(Children(_index).pLower)
End If
Print(1, Delimiter.ToString & Children(_index).Child.ToString)
Delimiter = ", "
If Children(_index).pHigher Then
PrintDescendants(Children(_index).pHigher)
End If
Return Nothing
End Function
Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean
Dim Value As Integer = 3
Dim Max As Integer
Dim Prime As Integer
If _maxPrime < 2 Then
Return vbFalse
End If
_primes.Add(2)
While Value <= _maxPrime
Max = Floor(Sqrt(Value))
For Each Prime In _primes
If Prime > Max Then
_primes.Add(Value)
Exit For
End If
If Value Mod Prime = 0 Then
Exit For
End If
Next
Value += 2
End While
Return vbTrue
End Function
End Module
|
Change the programming language of this snippet from C++ to VB without modifying what it does. | #include <iostream>
#include <vector>
#include <algorithm>
void print(const std::vector<std::vector<int>>& v) {
std::cout << "{ ";
for (const auto& p : v) {
std::cout << "(";
for (const auto& e : p) {
std::cout << e << " ";
}
std::cout << ") ";
}
std::cout << "}" << std::endl;
}
auto product(const std::vector<std::vector<int>>& lists) {
std::vector<std::vector<int>> result;
if (std::find_if(std::begin(lists), std::end(lists),
[](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) {
return result;
}
for (auto& e : lists[0]) {
result.push_back({ e });
}
for (size_t i = 1; i < lists.size(); ++i) {
std::vector<std::vector<int>> temp;
for (auto& e : result) {
for (auto f : lists[i]) {
auto e_tmp = e;
e_tmp.push_back(f);
temp.push_back(e_tmp);
}
}
result = temp;
}
return result;
}
int main() {
std::vector<std::vector<int>> prods[] = {
{ { 1, 2 }, { 3, 4 } },
{ { 3, 4 }, { 1, 2} },
{ { 1, 2 }, { } },
{ { }, { 1, 2 } },
{ { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } },
{ { 1, 2, 3 }, { 30 }, { 500, 100 } },
{ { 1, 2, 3 }, { }, { 500, 100 } }
};
for (const auto& p : prods) {
print(product(p));
}
std::cin.ignore();
std::cin.get();
return 0;
}
| Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
|
Rewrite the snippet below in VB so it works the same as the original C++ code. | #include <iostream>
#include <vector>
#include <algorithm>
void print(const std::vector<std::vector<int>>& v) {
std::cout << "{ ";
for (const auto& p : v) {
std::cout << "(";
for (const auto& e : p) {
std::cout << e << " ";
}
std::cout << ") ";
}
std::cout << "}" << std::endl;
}
auto product(const std::vector<std::vector<int>>& lists) {
std::vector<std::vector<int>> result;
if (std::find_if(std::begin(lists), std::end(lists),
[](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) {
return result;
}
for (auto& e : lists[0]) {
result.push_back({ e });
}
for (size_t i = 1; i < lists.size(); ++i) {
std::vector<std::vector<int>> temp;
for (auto& e : result) {
for (auto f : lists[i]) {
auto e_tmp = e;
e_tmp.push_back(f);
temp.push_back(e_tmp);
}
}
result = temp;
}
return result;
}
int main() {
std::vector<std::vector<int>> prods[] = {
{ { 1, 2 }, { 3, 4 } },
{ { 3, 4 }, { 1, 2} },
{ { 1, 2 }, { } },
{ { }, { 1, 2 } },
{ { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } },
{ { 1, 2, 3 }, { 30 }, { 500, 100 } },
{ { 1, 2, 3 }, { }, { 500, 100 } }
};
for (const auto& p : prods) {
print(product(p));
}
std::cin.ignore();
std::cin.get();
return 0;
}
| Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
|
Maintain the same structure and functionality when rewriting this code in VB. | #include <vector>
#include <iostream>
#include <algorithm>
std::vector<int> properDivisors ( int number ) {
std::vector<int> divisors ;
for ( int i = 1 ; i < number / 2 + 1 ; i++ )
if ( number % i == 0 )
divisors.push_back( i ) ;
return divisors ;
}
int main( ) {
std::vector<int> divisors ;
unsigned int maxdivisors = 0 ;
int corresponding_number = 0 ;
for ( int i = 1 ; i < 11 ; i++ ) {
divisors = properDivisors ( i ) ;
std::cout << "Proper divisors of " << i << ":\n" ;
for ( int number : divisors ) {
std::cout << number << " " ;
}
std::cout << std::endl ;
divisors.clear( ) ;
}
for ( int i = 11 ; i < 20001 ; i++ ) {
divisors = properDivisors ( i ) ;
if ( divisors.size( ) > maxdivisors ) {
maxdivisors = divisors.size( ) ;
corresponding_number = i ;
}
divisors.clear( ) ;
}
std::cout << "Most divisors has " << corresponding_number <<
" , it has " << maxdivisors << " divisors!\n" ;
return 0 ;
}
| dim _proper_divisors(100)
sub proper_divisors(n)
dim i
dim _proper_divisors_count = 0
if n <> 1 then
for i = 1 to (n \ 2)
if n %% i = 0 then
_proper_divisors_count = _proper_divisors_count + 1
_proper_divisors(_proper_divisors_count) = i
end if
next
end if
return _proper_divisors_count
end sub
sub show_proper_divisors(n, tabbed)
dim cnt = proper_divisors(n)
print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) ";
dim j
for j = 1 to cnt
if tabbed then
print str$(_proper_divisors(j)),
else
print str$(_proper_divisors(j));
end if
if (j < cnt) then print ",";
next
print
end sub
dim i
for i = 1 to 10
show_proper_divisors(i, false)
next
dim c
dim maxindex = 0
dim maxlength = 0
for t = 1 to 20000
c = proper_divisors(t)
if c > maxlength then
maxindex = t
maxlength = c
end if
next
print "A maximum at ";
show_proper_divisors(maxindex, false)
|
Port the following code from C++ to VB with equivalent syntax and logic. | #include <vector>
#include <utility>
#include <iostream>
#include <boost/algorithm/string.hpp>
std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ;
int main( ) {
std::vector<std::string> names , remarks ;
names.push_back( "April" ) ;
names.push_back( "Tam O'Shantor" ) ;
names.push_back ( "Emily" ) ;
remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ;
remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ;
remarks.push_back( "Short & shrift" ) ;
std::cout << "This is in XML:\n" ;
std::cout << create_xml( names , remarks ) << std::endl ;
return 0 ;
}
std::string create_xml( std::vector<std::string> & names ,
std::vector<std::string> & remarks ) {
std::vector<std::pair<std::string , std::string> > entities ;
entities.push_back( std::make_pair( "&" , "&" ) ) ;
entities.push_back( std::make_pair( "<" , "<" ) ) ;
entities.push_back( std::make_pair( ">" , ">" ) ) ;
std::string xmlstring ( "<CharacterRemarks>\n" ) ;
std::vector<std::string>::iterator vsi = names.begin( ) ;
typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ;
for ( ; vsi != names.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) {
for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) {
boost::replace_all ( *vsi , vs->first , vs->second ) ;
}
}
for ( int i = 0 ; i < names.size( ) ; i++ ) {
xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">")
.append( remarks[ i ] ).append( "</Character>\n" ) ;
}
xmlstring.append( "</CharacterRemarks>" ) ;
return xmlstring ;
}
| Module XMLOutput
Sub Main()
Dim charRemarks As New Dictionary(Of String, String)
charRemarks.Add("April", "Bubbly: I
charRemarks.Add("Tam O
charRemarks.Add("Emily", "Short & shrift")
Dim xml = <CharacterRemarks>
<%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %>
</CharacterRemarks>
Console.WriteLine(xml)
End Sub
End Module
|
Port the following code from C++ to VB with equivalent syntax and logic. | #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
| Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
|
Write a version of this C++ function in VB with identical behavior. | #include <windows.h>
#include <string>
#include <vector>
using namespace std;
const int HSTEP = 46, MWID = 40, MHEI = 471;
const float VSTEP = 2.3f;
class vector2
{
public:
vector2() { x = y = 0; }
vector2( float a, float b ) { x = a; y = b; }
void set( float a, float b ) { x = a; y = b; }
float x, y;
};
class myBitmap
{
public:
myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {}
~myBitmap()
{
DeleteObject( pen );
DeleteObject( brush );
DeleteDC( hdc );
DeleteObject( bmp );
}
bool create( int w, int h )
{
BITMAPINFO bi;
ZeroMemory( &bi, sizeof( bi ) );
bi.bmiHeader.biSize = sizeof( bi.bmiHeader );
bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
bi.bmiHeader.biCompression = BI_RGB;
bi.bmiHeader.biPlanes = 1;
bi.bmiHeader.biWidth = w;
bi.bmiHeader.biHeight = -h;
HDC dc = GetDC( GetConsoleWindow() );
bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 );
if( !bmp ) return false;
hdc = CreateCompatibleDC( dc );
SelectObject( hdc, bmp );
ReleaseDC( GetConsoleWindow(), dc );
width = w; height = h;
return true;
}
void clear( BYTE clr = 0 )
{
memset( pBits, clr, width * height * sizeof( DWORD ) );
}
void setBrushColor( DWORD bClr )
{
if( brush ) DeleteObject( brush );
brush = CreateSolidBrush( bClr );
SelectObject( hdc, brush );
}
void setPenColor( DWORD c ) { clr = c; createPen(); }
void setPenWidth( int w ) { wid = w; createPen(); }
void saveBitmap( string path )
{
BITMAPFILEHEADER fileheader;
BITMAPINFO infoheader;
BITMAP bitmap;
DWORD wb;
GetObject( bmp, sizeof( bitmap ), &bitmap );
DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight];
ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) );
ZeroMemory( &infoheader, sizeof( BITMAPINFO ) );
ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) );
infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8;
infoheader.bmiHeader.biCompression = BI_RGB;
infoheader.bmiHeader.biPlanes = 1;
infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader );
infoheader.bmiHeader.biHeight = bitmap.bmHeight;
infoheader.bmiHeader.biWidth = bitmap.bmWidth;
infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD );
fileheader.bfType = 0x4D42;
fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER );
fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage;
GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS );
HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL );
WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL );
WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL );
WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL );
CloseHandle( file );
delete [] dwpBits;
}
HDC getDC() const { return hdc; }
int getWidth() const { return width; }
int getHeight() const { return height; }
private:
void createPen()
{
if( pen ) DeleteObject( pen );
pen = CreatePen( PS_SOLID, wid, clr );
SelectObject( hdc, pen );
}
HBITMAP bmp;
HDC hdc;
HPEN pen;
HBRUSH brush;
void *pBits;
int width, height, wid;
DWORD clr;
};
class plot
{
public:
plot() { bmp.create( 512, 512 ); }
void draw( vector<vector2>* pairs )
{
bmp.clear( 0xff );
drawGraph( pairs );
plotIt( pairs );
HDC dc = GetDC( GetConsoleWindow() );
BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY );
ReleaseDC( GetConsoleWindow(), dc );
}
private:
void drawGraph( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
bmp.setPenColor( RGB( 240, 240, 240 ) );
DWORD b = 11, c = 40, x;
RECT rc; char txt[8];
for( x = 0; x < pairs->size(); x++ )
{
MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b );
MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 );
wsprintf( txt, "%d", ( pairs->size() - x ) * 20 );
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
wsprintf( txt, "%d", x );
SetRect( &rc, c - 8, 472, c + 8, 492 );
DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE );
c += 46; b += 46;
}
SetRect( &rc, 0, b - 9, 36, b + 11 );
DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE );
bmp.setPenColor( 0 ); bmp.setPenWidth( 3 );
MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 );
MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 );
}
void plotIt( vector<vector2>* pairs )
{
HDC dc = bmp.getDC();
HBRUSH br = CreateSolidBrush( 255 );
RECT rc;
bmp.setPenColor( 255 ); bmp.setPenWidth( 2 );
vector<vector2>::iterator it = pairs->begin();
int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
MoveToEx( dc, a, b, NULL );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br );
it++;
for( ; it < pairs->end(); it++ )
{
a = MWID + HSTEP * static_cast<int>( ( *it ).x );
b = MHEI - static_cast<int>( VSTEP * ( *it ).y );
SetRect( &rc, a - 3, b - 3, a + 3, b + 3 );
FillRect( dc, &rc, br ); LineTo( dc, a, b );
}
DeleteObject( br );
}
myBitmap bmp;
};
int main( int argc, char* argv[] )
{
ShowWindow( GetConsoleWindow(), SW_MAXIMIZE );
plot pt;
vector<vector2> pairs;
pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) );
pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) );
pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) );
pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) );
pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) );
pt.draw( &pairs );
system( "pause" );
return 0;
}
| Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
|
Generate a VB translation of this C++ snippet without changing its computational steps. | #include <iostream>
#include <string>
#include <iterator>
#include <regex>
int main()
{
std::regex re(".* string$");
std::string s = "Hi, I am a string";
if (std::regex_match(s, re))
std::cout << "The string matches.\n";
else
std::cout << "Oops - not found?\n";
std::regex re2(" a.*a");
std::smatch match;
if (std::regex_search(s, match, re2))
{
std::cout << "Matched " << match.length()
<< " characters starting at " << match.position() << ".\n";
std::cout << "Matched character sequence: \""
<< match.str() << "\"\n";
}
else
{
std::cout << "Oops - not found?\n";
}
std::string dest_string;
std::regex_replace(std::back_inserter(dest_string),
s.begin(), s.end(),
re2,
"'m now a changed");
std::cout << dest_string << std::endl;
}
| text = "I need more coffee!!!"
Set regex = New RegExp
regex.Global = True
regex.Pattern = "\s"
If regex.Test(text) Then
WScript.StdOut.Write regex.Replace(text,vbCrLf)
Else
WScript.StdOut.Write "No matching pattern"
End If
|
Write the same code in VB as shown below in C++. | #include <unordered_map>
#include <string>
int main()
{
std::string keys[] = { "1", "2", "3" };
std::string vals[] = { "a", "b", "c" };
std::unordered_map<std::string, std::string> hash;
for( int i = 0 ; i < 3 ; i++ )
hash[ keys[i] ] = vals[i] ;
}
| Set dict = CreateObject("Scripting.Dictionary")
os = Array("Windows", "Linux", "MacOS")
owner = Array("Microsoft", "Linus Torvalds", "Apple")
For n = 0 To 2
dict.Add os(n), owner(n)
Next
MsgBox dict.Item("Linux")
MsgBox dict.Item("MacOS")
MsgBox dict.Item("Windows")
|
Write a version of this C++ function in VB with identical behavior. | #include <windows.h>
class pinstripe
{
public:
pinstripe() { createColors(); }
void setDimensions( int x, int y ) { _mw = x; _mh = y; }
void createColors()
{
colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 );
colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 );
colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 );
colors[7] = RGB( 255, 255, 255 );
}
void draw( HDC dc )
{
HPEN pen;
int lh = _mh / 4, row, cp;
for( int lw = 1; lw < 5; lw++ )
{
cp = 0;
row = ( lw - 1 ) * lh;
for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw )
{
pen = CreatePen( PS_SOLID, lw, colors[cp] );
++cp %= 8;
SelectObject( dc, pen );
MoveToEx( dc, x, row, NULL );
LineTo( dc, x, row + lh );
DeleteObject( pen );
}
}
}
private:
int _mw, _mh;
DWORD colors[8];
};
pinstripe pin;
void PaintWnd( HWND hWnd )
{
PAINTSTRUCT ps;
HDC hdc = BeginPaint( hWnd, &ps );
pin.draw( hdc );
EndPaint( hWnd, &ps );
}
LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam )
{
switch( msg )
{
case WM_DESTROY: PostQuitMessage( 0 ); break;
case WM_PAINT: PaintWnd( hWnd ); break;
default:
return DefWindowProc( hWnd, msg, wParam, lParam );
}
return 0;
}
HWND InitAll( HINSTANCE hInstance )
{
WNDCLASSEX wcex;
ZeroMemory( &wcex, sizeof( wcex ) );
wcex.cbSize = sizeof( WNDCLASSEX );
wcex.style = CS_HREDRAW | CS_VREDRAW;
wcex.lpfnWndProc = WndProc;
wcex.hInstance = hInstance;
wcex.hCursor = LoadCursor( NULL, IDC_ARROW );
wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 );
wcex.lpszClassName = "_CLR_PS_";
RegisterClassEx( &wcex );
return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL );
}
int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow )
{
srand( GetTickCount() );
HWND hwnd = InitAll( hInstance );
if( !hwnd ) return -1;
int mw = GetSystemMetrics( SM_CXSCREEN ),
mh = GetSystemMetrics( SM_CYSCREEN );
pin.setDimensions( mw, mh );
RECT rc = { 0, 0, mw, mh };
AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 );
int w = rc.right - rc.left,
h = rc.bottom - rc.top;
int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ),
posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 );
SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER );
ShowWindow( hwnd, nCmdShow );
UpdateWindow( hwnd );
MSG msg;
ZeroMemory( &msg, sizeof( msg ) );
while( msg.message != WM_QUIT )
{
if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 )
{
TranslateMessage( &msg );
DispatchMessage( &msg );
}
}
return UnregisterClass( "_CLR_PS_", hInstance );
}
| Public Class Main
Inherits System.Windows.Forms.Form
Public Sub New()
Me.FormBorderStyle = FormBorderStyle.None
Me.WindowState = FormWindowState.Maximized
End Sub
Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load
Dim Index As Integer
Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White}
Dim Height = (Me.ClientSize.Height / 4) + 1
For y = 1 To 4
Dim Top = Me.ClientSize.Height / 4 * (y - 1)
For x = 0 To Me.ClientSize.Width Step y
If Index = 6 Then Index = 0 Else Index += 1
Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)})
Next
Next
End Sub
End Class
|
Ensure the translated VB code behaves exactly like the original C++ snippet. | #include <windows.h>
class pinstripe
{
public:
pinstripe() { createColors(); }
void setDimensions( int x, int y ) { _mw = x; _mh = y; }
void createColors()
{
colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 );
colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 );
colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 );
colors[7] = RGB( 255, 255, 255 );
}
void draw( HDC dc )
{
HPEN pen;
int lh = _mh / 4, row, cp;
for( int lw = 1; lw < 5; lw++ )
{
cp = 0;
row = ( lw - 1 ) * lh;
for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw )
{
pen = CreatePen( PS_SOLID, lw, colors[cp] );
++cp %= 8;
SelectObject( dc, pen );
MoveToEx( dc, x, row, NULL );
LineTo( dc, x, row + lh );
DeleteObject( pen );
}
}
}
private:
int _mw, _mh;
DWORD colors[8];
};
pinstripe pin;
void PaintWnd( HWND hWnd )
{
PAINTSTRUCT ps;
HDC hdc = BeginPaint( hWnd, &ps );
pin.draw( hdc );
EndPaint( hWnd, &ps );
}
LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam )
{
switch( msg )
{
case WM_DESTROY: PostQuitMessage( 0 ); break;
case WM_PAINT: PaintWnd( hWnd ); break;
default:
return DefWindowProc( hWnd, msg, wParam, lParam );
}
return 0;
}
HWND InitAll( HINSTANCE hInstance )
{
WNDCLASSEX wcex;
ZeroMemory( &wcex, sizeof( wcex ) );
wcex.cbSize = sizeof( WNDCLASSEX );
wcex.style = CS_HREDRAW | CS_VREDRAW;
wcex.lpfnWndProc = WndProc;
wcex.hInstance = hInstance;
wcex.hCursor = LoadCursor( NULL, IDC_ARROW );
wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 );
wcex.lpszClassName = "_CLR_PS_";
RegisterClassEx( &wcex );
return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL );
}
int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow )
{
srand( GetTickCount() );
HWND hwnd = InitAll( hInstance );
if( !hwnd ) return -1;
int mw = GetSystemMetrics( SM_CXSCREEN ),
mh = GetSystemMetrics( SM_CYSCREEN );
pin.setDimensions( mw, mh );
RECT rc = { 0, 0, mw, mh };
AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 );
int w = rc.right - rc.left,
h = rc.bottom - rc.top;
int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ),
posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 );
SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER );
ShowWindow( hwnd, nCmdShow );
UpdateWindow( hwnd );
MSG msg;
ZeroMemory( &msg, sizeof( msg ) );
while( msg.message != WM_QUIT )
{
if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 )
{
TranslateMessage( &msg );
DispatchMessage( &msg );
}
}
return UnregisterClass( "_CLR_PS_", hInstance );
}
| Public Class Main
Inherits System.Windows.Forms.Form
Public Sub New()
Me.FormBorderStyle = FormBorderStyle.None
Me.WindowState = FormWindowState.Maximized
End Sub
Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load
Dim Index As Integer
Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White}
Dim Height = (Me.ClientSize.Height / 4) + 1
For y = 1 To 4
Dim Top = Me.ClientSize.Height / 4 * (y - 1)
For x = 0 To Me.ClientSize.Width Step y
If Index = 6 Then Index = 0 Else Index += 1
Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)})
Next
Next
End Sub
End Class
|
Maintain the same structure and functionality when rewriting this code in VB. | #include <algorithm>
#include <cassert>
#include <iostream>
#include <iterator>
#include <vector>
template <typename iterator>
void cocktail_shaker_sort(iterator begin, iterator end) {
if (begin == end)
return;
for (--end; begin < end; ) {
iterator new_begin = end;
iterator new_end = begin;
for (iterator i = begin; i < end; ++i) {
iterator j = i + 1;
if (*j < *i) {
std::iter_swap(i, j);
new_end = i;
}
}
end = new_end;
for (iterator i = end; i > begin; --i) {
iterator j = i - 1;
if (*i < *j) {
std::iter_swap(i, j);
new_begin = i;
}
}
begin = new_begin;
}
}
template <typename iterator>
void print(iterator begin, iterator end) {
if (begin == end)
return;
std::cout << *begin++;
while (begin != end)
std::cout << ' ' << *begin++;
std::cout << '\n';
}
int main() {
std::vector<int> v{5, 1, -6, 12, 3, 13, 2, 4, 0, 15};
std::cout << "before: ";
print(v.begin(), v.end());
cocktail_shaker_sort(v.begin(), v.end());
assert(std::is_sorted(v.begin(), v.end()));
std::cout << "after: ";
print(v.begin(), v.end());
return 0;
}
|
Function cocktailShakerSort(ByVal A As Variant) As Variant
beginIdx = LBound(A)
endIdx = UBound(A) - 1
Do While beginIdx <= endIdx
newBeginIdx = endIdx
newEndIdx = beginIdx
For ii = beginIdx To endIdx
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newEndIdx = ii
End If
Next ii
endIdx = newEndIdx - 1
For ii = endIdx To beginIdx Step -1
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newBeginIdx = ii
End If
Next ii
beginIdx = newBeginIdx + 1
Loop
cocktailShakerSort = A
End Function
Public Sub main()
Dim B(20) As Variant
For i = LBound(B) To UBound(B)
B(i) = Int(Rnd() * 100)
Next i
Debug.Print Join(B, ", ")
Debug.Print Join(cocktailShakerSort(B), ", ")
End Sub
|
Translate this program into VB but keep the logic exactly as in C++. | #ifndef __wxPendulumDlg_h__
#define __wxPendulumDlg_h__
#ifdef __BORLANDC__
#pragma hdrstop
#endif
#ifndef WX_PRECOMP
#include <wx/wx.h>
#include <wx/dialog.h>
#else
#include <wx/wxprec.h>
#endif
#include <wx/timer.h>
#include <wx/dcbuffer.h>
#include <cmath>
class wxPendulumDlgApp : public wxApp
{
public:
bool OnInit();
int OnExit();
};
class wxPendulumDlg : public wxDialog
{
public:
wxPendulumDlg(wxWindow *parent, wxWindowID id = 1, const wxString &title = wxT("wxPendulum"),
const wxPoint& pos = wxDefaultPosition, const wxSize& size = wxDefaultSize,
long style = wxSUNKEN_BORDER | wxCAPTION | wxRESIZE_BORDER | wxSYSTEM_MENU | wxDIALOG_NO_PARENT | wxMINIMIZE_BOX | wxMAXIMIZE_BOX | wxCLOSE_BOX);
virtual ~wxPendulumDlg();
void wxPendulumDlgPaint(wxPaintEvent& event);
void wxPendulumDlgSize(wxSizeEvent& event);
void OnTimer(wxTimerEvent& event);
private:
wxTimer *m_timer;
unsigned int m_uiLength;
double m_Angle;
double m_AngleVelocity;
enum wxIDs
{
ID_WXTIMER1 = 1001,
ID_DUMMY_VALUE_
};
void OnClose(wxCloseEvent& event);
void CreateGUIControls();
DECLARE_EVENT_TABLE()
};
#endif
| option explicit
const dt = 0.15
const length=23
dim ans0:ans0=chr(27)&"["
dim Veloc,Accel,angle,olr,olc,r,c
const r0=1
const c0=40
cls
angle=0.7
while 1
wscript.sleep(50)
Accel = -.9 * sin(Angle)
Veloc = Veloc + Accel * dt
Angle = Angle + Veloc * dt
r = r0 + int(cos(Angle) * Length)
c = c0+ int(2*sin(Angle) * Length)
cls
draw_line r,c,r0,c0
toxy r,c,"O"
olr=r :olc=c
wend
sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub
sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub
Sub draw_line(r1,c1, r2,c2)
Dim x,y,xf,yf,dx,dy,sx,sy,err,err2
x =r1 : y =c1
xf=r2 : yf=c2
dx=Abs(xf-x) : dy=Abs(yf-y)
If x<xf Then sx=+1: Else sx=-1
If y<yf Then sy=+1: Else sy=-1
err=dx-dy
Do
toxy x,y,"."
If x=xf And y=yf Then Exit Do
err2=err+err
If err2>-dy Then err=err-dy: x=x+sx
If err2< dx Then err=err+dx: y=y+sy
Loop
End Sub
|
Keep all operations the same but rewrite the snippet in VB. | #include <bitset>
#include <iostream>
#include <string>
#include <assert.h>
uint32_t gray_encode(uint32_t b)
{
return b ^ (b >> 1);
}
uint32_t gray_decode(uint32_t g)
{
for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1)
{
if (g & bit) g ^= bit >> 1;
}
return g;
}
std::string to_binary(int value)
{
const std::bitset<32> bs(value);
const std::string str(bs.to_string());
const size_t pos(str.find('1'));
return pos == std::string::npos ? "0" : str.substr(pos);
}
int main()
{
std::cout << "Number\tBinary\tGray\tDecoded\n";
for (uint32_t n = 0; n < 32; ++n)
{
uint32_t g = gray_encode(n);
assert(gray_decode(g) == n);
std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n";
}
}
| Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
|
Preserve the algorithm and functionality while converting the code from C++ to VB. | #include <bitset>
#include <iostream>
#include <string>
#include <assert.h>
uint32_t gray_encode(uint32_t b)
{
return b ^ (b >> 1);
}
uint32_t gray_decode(uint32_t g)
{
for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1)
{
if (g & bit) g ^= bit >> 1;
}
return g;
}
std::string to_binary(int value)
{
const std::bitset<32> bs(value);
const std::string str(bs.to_string());
const size_t pos(str.find('1'));
return pos == std::string::npos ? "0" : str.substr(pos);
}
int main()
{
std::cout << "Number\tBinary\tGray\tDecoded\n";
for (uint32_t n = 0; n < 32; ++n)
{
uint32_t g = gray_encode(n);
assert(gray_decode(g) == n);
std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n";
}
}
| Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
|
Write the same code in VB as shown below in C++. | #include <deque>
#include <algorithm>
#include <ostream>
#include <iterator>
namespace cards
{
class card
{
public:
enum pip_type { two, three, four, five, six, seven, eight, nine, ten,
jack, queen, king, ace, pip_count };
enum suite_type { hearts, spades, diamonds, clubs, suite_count };
enum { unique_count = pip_count * suite_count };
card(suite_type s, pip_type p): value(s + suite_count * p) {}
explicit card(unsigned char v = 0): value(v) {}
pip_type pip() { return pip_type(value / suite_count); }
suite_type suite() { return suite_type(value % suite_count); }
private:
unsigned char value;
};
const char* const pip_names[] =
{ "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten",
"jack", "queen", "king", "ace" };
std::ostream& operator<<(std::ostream& os, card::pip_type pip)
{
return os << pip_names[pip];
}
const char* const suite_names[] =
{ "hearts", "spades", "diamonds", "clubs" };
std::ostream& operator<<(std::ostream& os, card::suite_type suite)
{
return os << suite_names[suite];
}
std::ostream& operator<<(std::ostream& os, card c)
{
return os << c.pip() << " of " << c.suite();
}
class deck
{
public:
deck()
{
for (int i = 0; i < card::unique_count; ++i) {
cards.push_back(card(i));
}
}
void shuffle() { std::random_shuffle(cards.begin(), cards.end()); }
card deal() { card c = cards.front(); cards.pop_front(); return c; }
typedef std::deque<card>::const_iterator const_iterator;
const_iterator begin() const { return cards.cbegin(); }
const_iterator end() const { return cards.cend(); }
private:
std::deque<card> cards;
};
inline std::ostream& operator<<(std::ostream& os, const deck& d)
{
std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n"));
return os;
}
}
| class playingcard
dim suit
dim pips
end class
class carddeck
private suitnames
private pipnames
private cardno
private deck(52)
private nTop
sub class_initialize
dim suit
dim pips
suitnames = split("H,D,C,S",",")
pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",")
cardno = 0
for suit = 1 to 4
for pips = 1 to 13
set deck(cardno) = new playingcard
deck(cardno).suit = suitnames(suit-1)
deck(cardno).pips = pipnames(pips-1)
cardno = cardno + 1
next
next
nTop = 0
end sub
public sub showdeck
dim a
redim a(51-nTop)
for i = nTop to 51
a(i) = deck(i).pips & deck(i).suit
next
wscript.echo join( a, ", ")
end sub
public sub shuffle
dim r
randomize timer
for i = nTop to 51
r = int( rnd * ( 52 - nTop ) )
if r <> i then
objswap deck(i),deck(r)
end if
next
end sub
public function deal()
set deal = deck( nTop )
nTop = nTop + 1
end function
public property get cardsRemaining
cardsRemaining = 52 - nTop
end property
private sub objswap( a, b )
dim tmp
set tmp = a
set a = b
set b = tmp
end sub
end class
|
Preserve the algorithm and functionality while converting the code from C++ to VB. | #include <deque>
#include <algorithm>
#include <ostream>
#include <iterator>
namespace cards
{
class card
{
public:
enum pip_type { two, three, four, five, six, seven, eight, nine, ten,
jack, queen, king, ace, pip_count };
enum suite_type { hearts, spades, diamonds, clubs, suite_count };
enum { unique_count = pip_count * suite_count };
card(suite_type s, pip_type p): value(s + suite_count * p) {}
explicit card(unsigned char v = 0): value(v) {}
pip_type pip() { return pip_type(value / suite_count); }
suite_type suite() { return suite_type(value % suite_count); }
private:
unsigned char value;
};
const char* const pip_names[] =
{ "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten",
"jack", "queen", "king", "ace" };
std::ostream& operator<<(std::ostream& os, card::pip_type pip)
{
return os << pip_names[pip];
}
const char* const suite_names[] =
{ "hearts", "spades", "diamonds", "clubs" };
std::ostream& operator<<(std::ostream& os, card::suite_type suite)
{
return os << suite_names[suite];
}
std::ostream& operator<<(std::ostream& os, card c)
{
return os << c.pip() << " of " << c.suite();
}
class deck
{
public:
deck()
{
for (int i = 0; i < card::unique_count; ++i) {
cards.push_back(card(i));
}
}
void shuffle() { std::random_shuffle(cards.begin(), cards.end()); }
card deal() { card c = cards.front(); cards.pop_front(); return c; }
typedef std::deque<card>::const_iterator const_iterator;
const_iterator begin() const { return cards.cbegin(); }
const_iterator end() const { return cards.cend(); }
private:
std::deque<card> cards;
};
inline std::ostream& operator<<(std::ostream& os, const deck& d)
{
std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n"));
return os;
}
}
| class playingcard
dim suit
dim pips
end class
class carddeck
private suitnames
private pipnames
private cardno
private deck(52)
private nTop
sub class_initialize
dim suit
dim pips
suitnames = split("H,D,C,S",",")
pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",")
cardno = 0
for suit = 1 to 4
for pips = 1 to 13
set deck(cardno) = new playingcard
deck(cardno).suit = suitnames(suit-1)
deck(cardno).pips = pipnames(pips-1)
cardno = cardno + 1
next
next
nTop = 0
end sub
public sub showdeck
dim a
redim a(51-nTop)
for i = nTop to 51
a(i) = deck(i).pips & deck(i).suit
next
wscript.echo join( a, ", ")
end sub
public sub shuffle
dim r
randomize timer
for i = nTop to 51
r = int( rnd * ( 52 - nTop ) )
if r <> i then
objswap deck(i),deck(r)
end if
next
end sub
public function deal()
set deal = deck( nTop )
nTop = nTop + 1
end function
public property get cardsRemaining
cardsRemaining = 52 - nTop
end property
private sub objswap( a, b )
dim tmp
set tmp = a
set a = b
set b = tmp
end sub
end class
|
Keep all operations the same but rewrite the snippet in VB. | #include <array>
#include <vector>
#include <algorithm>
#include <iostream>
#include <iterator>
#include <string>
template <typename Array>
void demonstrate(Array& array)
{
array[2] = "Three";
array.at(1) = "Two";
std::reverse(begin(array), end(array));
std::for_each(begin(array), end(array),
[](typename Array::value_type const& element)
{
std::cout << element << ' ';
});
std::cout << '\n';
}
int main()
{
auto fixed_size_array = std::array<std::string, 3>{ "One", "Four", "Eight" };
auto dynamic_array = std::vector<std::string>{ "One", "Four" };
dynamic_array.push_back("Eight");
demonstrate(fixed_size_array);
demonstrate(dynamic_array);
}
| Option Base {0|1}
|
Ensure the translated VB code behaves exactly like the original C++ snippet. |
#include <cstdint>
#include <cstdlib>
#include <cstdio>
static constexpr int32_t bct_low_bits = 0x55555555;
static int32_t bct_decrement(int32_t v) {
--v;
return v ^ (v & (v>>1) & bct_low_bits);
}
int main (int argc, char *argv[])
{
const int32_t n = (1 < argc) ? std::atoi(argv[1]) : 3;
if (n < 0 || 9 < n) {
std::printf("N out of range (use 0..9): %ld\n", long(n));
return 1;
}
const int32_t size_bct = 1<<(n*2);
int32_t y = size_bct;
do {
y = bct_decrement(y);
int32_t x = size_bct;
do {
x = bct_decrement(x);
std::putchar((x & y & bct_low_bits) ? ' ' : '#');
} while (0 < x);
std::putchar('\n');
} while (0 < y);
return 0;
}
| Const Order = 4
Function InCarpet(ByVal x As Integer, ByVal y As Integer)
Do While x <> 0 And y <> 0
If x Mod 3 = 1 And y Mod 3 = 1 Then
InCarpet = " "
Exit Function
End If
x = x \ 3
y = y \ 3
Loop
InCarpet = "#"
End Function
Public Sub sierpinski_carpet()
Dim i As Integer, j As Integer
For i = 0 To 3 ^ Order - 1
For j = 0 To 3 ^ Order - 1
Debug.Print InCarpet(i, j);
Next j
Debug.Print
Next i
End Sub
|
Please provide an equivalent version of this C++ code in VB. | #include <algorithm>
#include <iostream>
#include <iterator>
#include <random>
template <typename RandomAccessIterator, typename Predicate>
void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end,
Predicate p) {
std::random_device rd;
std::mt19937 generator(rd());
while (!std::is_sorted(begin, end, p)) {
std::shuffle(begin, end, generator);
}
}
template <typename RandomAccessIterator>
void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end) {
bogo_sort(
begin, end,
std::less<
typename std::iterator_traits<RandomAccessIterator>::value_type>());
}
int main() {
int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199};
bogo_sort(std::begin(a), std::end(a));
copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " "));
std::cout << "\n";
}
| Private Function Knuth(a As Variant) As Variant
Dim t As Variant, i As Integer
If Not IsMissing(a) Then
For i = UBound(a) To LBound(a) + 1 Step -1
j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a))
t = a(i)
a(i) = a(j)
a(j) = t
Next i
End If
Knuth = a
End Function
Private Function inOrder(s As Variant)
i = 2
Do While i <= UBound(s)
If s(i) < s(i - 1) Then
inOrder = False
Exit Function
End If
i = i + 1
Loop
inOrder = True
End Function
Private Function bogosort(ByVal s As Variant) As Variant
Do While Not inOrder(s)
Debug.Print Join(s, ", ")
s = Knuth(s)
Loop
bogosort = s
End Function
Public Sub main()
Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ")
End Sub
|
Convert this C++ block to VB, preserving its control flow and logic. | #include <iomanip>
#include <iostream>
typedef double F(double,double);
void euler(F f, double y0, double a, double b, double h)
{
double y = y0;
for (double t = a; t < b; t += h)
{
std::cout << std::fixed << std::setprecision(3) << t << " " << y << "\n";
y += h * f(t, y);
}
std::cout << "done\n";
}
double newtonCoolingLaw(double, double t)
{
return -0.07 * (t - 20);
}
int main()
{
euler(newtonCoolingLaw, 100, 0, 100, 2);
euler(newtonCoolingLaw, 100, 0, 100, 5);
euler(newtonCoolingLaw, 100, 0, 100, 10);
}
| Private Sub ivp_euler(f As String, y As Double, step As Integer, end_t As Integer)
Dim t As Integer
Debug.Print " Step "; step; ": ",
Do While t <= end_t
If t Mod 10 = 0 Then Debug.Print Format(y, "0.000"),
y = y + step * Application.Run(f, y)
t = t + step
Loop
Debug.Print
End Sub
Sub analytic()
Debug.Print " Time: ",
For t = 0 To 100 Step 10
Debug.Print " "; t,
Next t
Debug.Print
Debug.Print "Analytic: ",
For t = 0 To 100 Step 10
Debug.Print Format(20 + 80 * Exp(-0.07 * t), "0.000"),
Next t
Debug.Print
End Sub
Private Function cooling(temp As Double) As Double
cooling = -0.07 * (temp - 20)
End Function
Public Sub euler_method()
Dim r_cooling As String
r_cooling = "cooling"
analytic
ivp_euler r_cooling, 100, 2, 100
ivp_euler r_cooling, 100, 5, 100
ivp_euler r_cooling, 100, 10, 100
End Sub
|
Maintain the same structure and functionality when rewriting this code in VB. | #include <iostream>
#include <algorithm>
#include <vector>
#include <cmath>
#include <boost/bind.hpp>
#include <iterator>
double nextNumber( double number ) {
return number + floor( 0.5 + sqrt( number ) ) ;
}
int main( ) {
std::vector<double> non_squares ;
typedef std::vector<double>::iterator SVI ;
non_squares.reserve( 1000000 ) ;
for ( double i = 1.0 ; i < 100001.0 ; i += 1 )
non_squares.push_back( nextNumber( i ) ) ;
std::copy( non_squares.begin( ) , non_squares.begin( ) + 22 ,
std::ostream_iterator<double>(std::cout, " " ) ) ;
std::cout << '\n' ;
SVI found = std::find_if ( non_squares.begin( ) , non_squares.end( ) ,
boost::bind( &floor, boost::bind( &sqrt, _1 ) ) == boost::bind( &sqrt, _1 ) ) ;
if ( found != non_squares.end( ) ) {
std::cout << "Found a square number in the sequence!\n" ;
std::cout << "It is " << *found << " !\n" ;
}
else {
std::cout << "Up to 1000000, found no square number in the sequence!\n" ;
}
return 0 ;
}
| Sub Main()
Dim i&, c&, j#, s$
Const N& = 1000000
s = "values for n in the range 1 to 22 : "
For i = 1 To 22
s = s & ns(i) & ", "
Next
For i = 1 To N
j = Sqr(ns(i))
If j = CInt(j) Then c = c + 1
Next
Debug.Print s
Debug.Print c & " squares less than " & N
End Sub
Private Function ns(l As Long) As Long
ns = l + Int(1 / 2 + Sqr(l))
End Function
|
Maintain the same structure and functionality when rewriting this code in VB. | #include <iostream>
#include <string>
int main()
{
std::string s = "0123456789";
int const n = 3;
int const m = 4;
char const c = '2';
std::string const sub = "456";
std::cout << s.substr(n, m)<< "\n";
std::cout << s.substr(n) << "\n";
std::cout << s.substr(0, s.size()-1) << "\n";
std::cout << s.substr(s.find(c), m) << "\n";
std::cout << s.substr(s.find(sub), m) << "\n";
}
| Public Sub substring()
sentence = "the last thing the man said was the"
n = 10: m = 5
Debug.Print Mid(sentence, n, 5)
Debug.Print Right(sentence, Len(sentence) - n + 1)
Debug.Print Left(sentence, Len(sentence) - 1)
k = InStr(1, sentence, "m")
Debug.Print Mid(sentence, k, 5)
k = InStr(1, sentence, "aid")
Debug.Print Mid(sentence, k, 5)
End Sub
|
Convert this C++ snippet to VB and keep its semantics consistent. | #include <algorithm>
#include <string>
#include <iostream>
#include <iterator>
class jortSort {
public:
template<class T>
bool jort_sort( T* o, size_t s ) {
T* n = copy_array( o, s );
sort_array( n, s );
bool r = false;
if( n ) {
r = check( o, n, s );
delete [] n;
}
return r;
}
private:
template<class T>
T* copy_array( T* o, size_t s ) {
T* z = new T[s];
memcpy( z, o, s * sizeof( T ) );
return z;
}
template<class T>
void sort_array( T* n, size_t s ) {
std::sort( n, n + s );
}
template<class T>
bool check( T* n, T* o, size_t s ) {
for( size_t x = 0; x < s; x++ )
if( n[x] != o[x] ) return false;
return true;
}
};
jortSort js;
template<class T>
void displayTest( T* o, size_t s ) {
std::copy( o, o + s, std::ostream_iterator<T>( std::cout, " " ) );
std::cout << ": -> The array is " << ( js.jort_sort( o, s ) ? "sorted!" : "not sorted!" ) << "\n\n";
}
int main( int argc, char* argv[] ) {
const size_t s = 5;
std::string oStr[] = { "5", "A", "D", "R", "S" };
displayTest( oStr, s );
std::swap( oStr[0], oStr[1] );
displayTest( oStr, s );
int oInt[] = { 1, 2, 3, 4, 5 };
displayTest( oInt, s );
std::swap( oInt[0], oInt[1] );
displayTest( oInt, s );
return 0;
}
| Function JortSort(s)
JortSort = True
arrPreSort = Split(s,",")
Set arrSorted = CreateObject("System.Collections.ArrayList")
For i = 0 To UBound(arrPreSort)
arrSorted.Add(arrPreSort(i))
Next
arrSorted.Sort()
For j = 0 To UBound(arrPreSort)
If arrPreSort(j) <> arrSorted(j) Then
JortSort = False
Exit For
End If
Next
End Function
WScript.StdOut.Write JortSort("1,2,3,4,5")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("1,2,3,5,4")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,b,c")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,c,b")
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.