Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Rewrite this program in Python while keeping its functionality equivalent to the Go version.
package main import ( "fmt" "rcu" ) func main() { primes := rcu.Primes(999) sum, n, c := 0, 0, 0 fmt.Println("Summing the first n primes (<1,000) where the sum is itself prime:") fmt.Println(" n cumulative sum") for _, p := range primes { n++ sum += p if rcu.IsPrime(sum) { c++ fmt.Printf("%3d %6s\n", n, rcu.Commatize(sum)) } } fmt.Println() fmt.Println(c, "such prime sums found") }
from itertools import accumulate, chain, takewhile def primeSums(): return ( x for x in enumerate( accumulate( chain([(0, 0)], primes()), lambda a, p: (p, p + a[1]) ) ) if isPrime(x[1][1]) ) def main(): for x in takewhile( lambda t: 1000 > t[1][0], primeSums() ): print(f'{x[0]} -> {x[1][1]}') def isPrime(n): if n in (2, 3): return True if 2 > n or 0 == n % 2: return False if 9 > n: return True if 0 == n % 3: return False def p(x): return 0 == n % x or 0 == n % (2 + x) return not any(map(p, range(5, 1 + int(n ** 0.5), 6))) def primes(): n = 2 dct = {} while True: if n in dct: for p in dct[n]: dct.setdefault(n + p, []).append(p) del dct[n] else: yield n dct[n * n] = [n] n = 1 + n if __name__ == '__main__': main()
Keep all operations the same but rewrite the snippet in Python.
package main import ( "fmt" "sort" ) func distinctSortedUnion(ll [][]int) []int { var res []int for _, l := range ll { res = append(res, l...) } set := make(map[int]bool) for _, e := range res { set[e] = true } res = res[:0] for key := range set { res = append(res, key) } sort.Ints(res) return res } func main() { ll := [][]int{{5, 1, 3, 8, 9, 4, 8, 7}, {3, 5, 9, 8, 4}, {1, 3, 7, 9}} fmt.Println("Distinct sorted union of", ll, "is:") fmt.Println(distinctSortedUnion(ll)) }
from itertools import chain def main(): print( sorted(nub(concat([ [5, 1, 3, 8, 9, 4, 8, 7], [3, 5, 9, 8, 4], [1, 3, 7, 9] ]))) ) def concat(xs): return list(chain(*xs)) def nub(xs): return list(dict.fromkeys(xs)) if __name__ == '__main__': main()
Rewrite the snippet below in Python so it works the same as the original Go code.
package main import ( "fmt" "sort" ) func distinctSortedUnion(ll [][]int) []int { var res []int for _, l := range ll { res = append(res, l...) } set := make(map[int]bool) for _, e := range res { set[e] = true } res = res[:0] for key := range set { res = append(res, key) } sort.Ints(res) return res } func main() { ll := [][]int{{5, 1, 3, 8, 9, 4, 8, 7}, {3, 5, 9, 8, 4}, {1, 3, 7, 9}} fmt.Println("Distinct sorted union of", ll, "is:") fmt.Println(distinctSortedUnion(ll)) }
from itertools import chain def main(): print( sorted(nub(concat([ [5, 1, 3, 8, 9, 4, 8, 7], [3, 5, 9, 8, 4], [1, 3, 7, 9] ]))) ) def concat(xs): return list(chain(*xs)) def nub(xs): return list(dict.fromkeys(xs)) if __name__ == '__main__': main()
Preserve the algorithm and functionality while converting the code from Go to Python.
package main import ( "fmt" "sort" ) func distinctSortedUnion(ll [][]int) []int { var res []int for _, l := range ll { res = append(res, l...) } set := make(map[int]bool) for _, e := range res { set[e] = true } res = res[:0] for key := range set { res = append(res, key) } sort.Ints(res) return res } func main() { ll := [][]int{{5, 1, 3, 8, 9, 4, 8, 7}, {3, 5, 9, 8, 4}, {1, 3, 7, 9}} fmt.Println("Distinct sorted union of", ll, "is:") fmt.Println(distinctSortedUnion(ll)) }
from itertools import chain def main(): print( sorted(nub(concat([ [5, 1, 3, 8, 9, 4, 8, 7], [3, 5, 9, 8, 4], [1, 3, 7, 9] ]))) ) def concat(xs): return list(chain(*xs)) def nub(xs): return list(dict.fromkeys(xs)) if __name__ == '__main__': main()
Maintain the same structure and functionality when rewriting this code in Python.
package main import "fmt" const ( m = iota c cm cmc ) func ncs(s []int) [][]int { if len(s) < 3 { return nil } return append(n2(nil, s[1:], m), n2([]int{s[0]}, s[1:], c)...) } var skip = []int{m, cm, cm, cmc} var incl = []int{c, c, cmc, cmc} func n2(ss, tail []int, seq int) [][]int { if len(tail) == 0 { if seq != cmc { return nil } return [][]int{ss} } return append(n2(append([]int{}, ss...), tail[1:], skip[seq]), n2(append(ss, tail[0]), tail[1:], incl[seq])...) } func main() { ss := ncs([]int{1, 2, 3, 4}) fmt.Println(len(ss), "non-continuous subsequences:") for _, s := range ss { fmt.Println(" ", s) } }
def ncsub(seq, s=0): if seq: x = seq[:1] xs = seq[1:] p2 = s % 2 p1 = not p2 return [x + ys for ys in ncsub(xs, s + p1)] + ncsub(xs, s + p2) else: return [[]] if s >= 3 else []
Write the same code in Python as shown below in Go.
package main import "fmt" const ( m = iota c cm cmc ) func ncs(s []int) [][]int { if len(s) < 3 { return nil } return append(n2(nil, s[1:], m), n2([]int{s[0]}, s[1:], c)...) } var skip = []int{m, cm, cm, cmc} var incl = []int{c, c, cmc, cmc} func n2(ss, tail []int, seq int) [][]int { if len(tail) == 0 { if seq != cmc { return nil } return [][]int{ss} } return append(n2(append([]int{}, ss...), tail[1:], skip[seq]), n2(append(ss, tail[0]), tail[1:], incl[seq])...) } func main() { ss := ncs([]int{1, 2, 3, 4}) fmt.Println(len(ss), "non-continuous subsequences:") for _, s := range ss { fmt.Println(" ", s) } }
def ncsub(seq, s=0): if seq: x = seq[:1] xs = seq[1:] p2 = s % 2 p1 = not p2 return [x + ys for ys in ncsub(xs, s + p1)] + ncsub(xs, s + p2) else: return [[]] if s >= 3 else []
Generate an equivalent Python version of this Go code.
package main import ( "github.com/fogleman/gg" "strings" ) func wordFractal(i int) string { if i < 2 { if i == 1 { return "1" } return "" } var f1 strings.Builder f1.WriteString("1") var f2 strings.Builder f2.WriteString("0") for j := i - 2; j >= 1; j-- { tmp := f2.String() f2.WriteString(f1.String()) f1.Reset() f1.WriteString(tmp) } return f2.String() } func draw(dc *gg.Context, x, y, dx, dy float64, wf string) { for i, c := range wf { dc.DrawLine(x, y, x+dx, y+dy) x += dx y += dy if c == '0' { tx := dx dx = dy if i%2 == 0 { dx = -dy } dy = -tx if i%2 == 0 { dy = tx } } } } func main() { dc := gg.NewContext(450, 620) dc.SetRGB(0, 0, 0) dc.Clear() wf := wordFractal(23) draw(dc, 20, 20, 1, 0, wf) dc.SetRGB(0, 1, 0) dc.SetLineWidth(1) dc.Stroke() dc.SavePNG("fib_wordfractal.png") }
from functools import wraps from turtle import * def memoize(obj): cache = obj.cache = {} @wraps(obj) def memoizer(*args, **kwargs): key = str(args) + str(kwargs) if key not in cache: cache[key] = obj(*args, **kwargs) return cache[key] return memoizer @memoize def fibonacci_word(n): assert n > 0 if n == 1: return "1" if n == 2: return "0" return fibonacci_word(n - 1) + fibonacci_word(n - 2) def draw_fractal(word, step): for i, c in enumerate(word, 1): forward(step) if c == "0": if i % 2 == 0: left(90) else: right(90) def main(): n = 25 step = 1 width = 1050 height = 1050 w = fibonacci_word(n) setup(width=width, height=height) speed(0) setheading(90) left(90) penup() forward(500) right(90) backward(500) pendown() tracer(10000) hideturtle() draw_fractal(w, step) getscreen().getcanvas().postscript(file="fibonacci_word_fractal.eps") exitonclick() if __name__ == '__main__': main()
Generate an equivalent Python version of this Go code.
package main import "fmt" func sieve(limit uint64) []bool { limit++ c := make([]bool, limit) c[0] = true c[1] = true p := uint64(3) for { p2 := p * p if p2 >= limit { break } for i := p2; i < limit; i += 2 * p { c[i] = true } for { p += 2 if !c[p] { break } } } return c } func commatize(n int) string { s := fmt.Sprintf("%d", n) if n < 0 { s = s[1:] } le := len(s) for i := le - 3; i >= 1; i -= 3 { s = s[0:i] + "," + s[i:] } if n >= 0 { return s } return "-" + s } func main() { c := sieve(1e10 - 1) limit := 10 start := 3 twins := 0 for i := 1; i < 11; i++ { for i := start; i < limit; i += 2 { if !c[i] && !c[i-2] { twins++ } } fmt.Printf("Under %14s there are %10s pairs of twin primes.\n", commatize(limit), commatize(twins)) start = limit + 1 limit *= 10 } }
primes = [2, 3, 5, 7, 11, 13, 17, 19] def count_twin_primes(limit: int) -> int: global primes if limit > primes[-1]: ram_limit = primes[-1] + 90000000 - len(primes) reasonable_limit = min(limit, primes[-1] ** 2, ram_limit) - 1 while reasonable_limit < limit: ram_limit = primes[-1] + 90000000 - len(primes) if ram_limit > primes[-1]: reasonable_limit = min(limit, primes[-1] ** 2, ram_limit) else: reasonable_limit = min(limit, primes[-1] ** 2) sieve = list({x for prime in primes for x in range(primes[-1] + prime - (primes[-1] % prime), reasonable_limit, prime)}) primes += [x - 1 for i, x in enumerate(sieve) if i and x - 1 != sieve[i - 1] and x - 1 < limit] count = len([(x, y) for (x, y) in zip(primes, primes[1:]) if x + 2 == y]) return count def test(limit: int): count = count_twin_primes(limit) print(f"Number of twin prime pairs less than {limit} is {count}\n") test(10) test(100) test(1000) test(10000) test(100000) test(1000000) test(10000000) test(100000000)
Please provide an equivalent version of this Go code in Python.
package main import "fmt" var ( Nr = [16]int{3, 0, 0, 0, 0, 1, 1, 1, 1, 2, 2, 2, 2, 3, 3, 3} Nc = [16]int{3, 0, 1, 2, 3, 0, 1, 2, 3, 0, 1, 2, 3, 0, 1, 2} ) var ( n, _n int N0, N3, N4 [85]int N2 [85]uint64 ) const ( i = 1 g = 8 e = 2 l = 4 ) func fY() bool { if N2[n] == 0x123456789abcdef0 { return true } if N4[n] <= _n { return fN() } return false } func fZ(w int) bool { if w&i > 0 { fI() if fY() { return true } n-- } if w&g > 0 { fG() if fY() { return true } n-- } if w&e > 0 { fE() if fY() { return true } n-- } if w&l > 0 { fL() if fY() { return true } n-- } return false } func fN() bool { switch N0[n] { case 0: switch N3[n] { case 'l': return fZ(i) case 'u': return fZ(e) default: return fZ(i + e) } case 3: switch N3[n] { case 'r': return fZ(i) case 'u': return fZ(l) default: return fZ(i + l) } case 1, 2: switch N3[n] { case 'l': return fZ(i + l) case 'r': return fZ(i + e) case 'u': return fZ(e + l) default: return fZ(l + e + i) } case 12: switch N3[n] { case 'l': return fZ(g) case 'd': return fZ(e) default: return fZ(e + g) } case 15: switch N3[n] { case 'r': return fZ(g) case 'd': return fZ(l) default: return fZ(g + l) } case 13, 14: switch N3[n] { case 'l': return fZ(g + l) case 'r': return fZ(e + g) case 'd': return fZ(e + l) default: return fZ(g + e + l) } case 4, 8: switch N3[n] { case 'l': return fZ(i + g) case 'u': return fZ(g + e) case 'd': return fZ(i + e) default: return fZ(i + g + e) } case 7, 11: switch N3[n] { case 'd': return fZ(i + l) case 'u': return fZ(g + l) case 'r': return fZ(i + g) default: return fZ(i + g + l) } default: switch N3[n] { case 'd': return fZ(i + e + l) case 'l': return fZ(i + g + l) case 'r': return fZ(i + g + e) case 'u': return fZ(g + e + l) default: return fZ(i + g + e + l) } } } func fI() { g := (11 - N0[n]) * 4 a := N2[n] & uint64(15<<uint(g)) N0[n+1] = N0[n] + 4 N2[n+1] = N2[n] - a + (a << 16) N3[n+1] = 'd' N4[n+1] = N4[n] cond := Nr[a>>uint(g)] <= N0[n]/4 if !cond { N4[n+1]++ } n++ } func fG() { g := (19 - N0[n]) * 4 a := N2[n] & uint64(15<<uint(g)) N0[n+1] = N0[n] - 4 N2[n+1] = N2[n] - a + (a >> 16) N3[n+1] = 'u' N4[n+1] = N4[n] cond := Nr[a>>uint(g)] >= N0[n]/4 if !cond { N4[n+1]++ } n++ } func fE() { g := (14 - N0[n]) * 4 a := N2[n] & uint64(15<<uint(g)) N0[n+1] = N0[n] + 1 N2[n+1] = N2[n] - a + (a << 4) N3[n+1] = 'r' N4[n+1] = N4[n] cond := Nc[a>>uint(g)] <= N0[n]%4 if !cond { N4[n+1]++ } n++ } func fL() { g := (16 - N0[n]) * 4 a := N2[n] & uint64(15<<uint(g)) N0[n+1] = N0[n] - 1 N2[n+1] = N2[n] - a + (a >> 4) N3[n+1] = 'l' N4[n+1] = N4[n] cond := Nc[a>>uint(g)] >= N0[n]%4 if !cond { N4[n+1]++ } n++ } func fifteenSolver(n int, g uint64) { N0[0] = n N2[0] = g N4[0] = 0 } func solve() { if fN() { fmt.Print("Solution found in ", n, " moves: ") for g := 1; g <= n; g++ { fmt.Printf("%c", N3[g]) } fmt.Println() } else { n = 0 _n++ solve() } } func main() { fifteenSolver(8, 0xfe169b4c0a73d852) solve() }
import random class IDAStar: def __init__(self, h, neighbours): self.h = h self.neighbours = neighbours self.FOUND = object() def solve(self, root, is_goal, max_cost=None): self.is_goal = is_goal self.path = [root] self.is_in_path = {root} self.path_descrs = [] self.nodes_evaluated = 0 bound = self.h(root) while True: t = self._search(0, bound) if t is self.FOUND: return self.path, self.path_descrs, bound, self.nodes_evaluated if t is None: return None bound = t def _search(self, g, bound): self.nodes_evaluated += 1 node = self.path[-1] f = g + self.h(node) if f > bound: return f if self.is_goal(node): return self.FOUND m = None for cost, n, descr in self.neighbours(node): if n in self.is_in_path: continue self.path.append(n) self.is_in_path.add(n) self.path_descrs.append(descr) t = self._search(g + cost, bound) if t == self.FOUND: return self.FOUND if m is None or (t is not None and t < m): m = t self.path.pop() self.path_descrs.pop() self.is_in_path.remove(n) return m def slide_solved_state(n): return tuple(i % (n*n) for i in range(1, n*n+1)) def slide_randomize(p, neighbours): for _ in range(len(p) ** 2): _, p, _ = random.choice(list(neighbours(p))) return p def slide_neighbours(n): movelist = [] for gap in range(n*n): x, y = gap % n, gap // n moves = [] if x > 0: moves.append(-1) if x < n-1: moves.append(+1) if y > 0: moves.append(-n) if y < n-1: moves.append(+n) movelist.append(moves) def neighbours(p): gap = p.index(0) l = list(p) for m in movelist[gap]: l[gap] = l[gap + m] l[gap + m] = 0 yield (1, tuple(l), (l[gap], m)) l[gap + m] = l[gap] l[gap] = 0 return neighbours def slide_print(p): n = int(round(len(p) ** 0.5)) l = len(str(n*n)) for i in range(0, len(p), n): print(" ".join("{:>{}}".format(x, l) for x in p[i:i+n])) def encode_cfg(cfg, n): r = 0 b = n.bit_length() for i in range(len(cfg)): r |= cfg[i] << (b*i) return r def gen_wd_table(n): goal = [[0] * i + [n] + [0] * (n - 1 - i) for i in range(n)] goal[-1][-1] = n - 1 goal = tuple(sum(goal, [])) table = {} to_visit = [(goal, 0, n-1)] while to_visit: cfg, cost, e = to_visit.pop(0) enccfg = encode_cfg(cfg, n) if enccfg in table: continue table[enccfg] = cost for d in [-1, 1]: if 0 <= e + d < n: for c in range(n): if cfg[n*(e+d) + c] > 0: ncfg = list(cfg) ncfg[n*(e+d) + c] -= 1 ncfg[n*e + c] += 1 to_visit.append((tuple(ncfg), cost + 1, e+d)) return table def slide_wd(n, goal): wd = gen_wd_table(n) goals = {i : goal.index(i) for i in goal} b = n.bit_length() def h(p): ht = 0 vt = 0 d = 0 for i, c in enumerate(p): if c == 0: continue g = goals[c] xi, yi = i % n, i // n xg, yg = g % n, g // n ht += 1 << (b*(n*yi+yg)) vt += 1 << (b*(n*xi+xg)) if yg == yi: for k in range(i + 1, i - i%n + n): if p[k] and goals[p[k]] // n == yi and goals[p[k]] < g: d += 2 if xg == xi: for k in range(i + n, n * n, n): if p[k] and goals[p[k]] % n == xi and goals[p[k]] < g: d += 2 d += wd[ht] + wd[vt] return d return h if __name__ == "__main__": solved_state = slide_solved_state(4) neighbours = slide_neighbours(4) is_goal = lambda p: p == solved_state tests = [ (15, 14, 1, 6, 9, 11, 4, 12, 0, 10, 7, 3, 13, 8, 5, 2), ] slide_solver = IDAStar(slide_wd(4, solved_state), neighbours) for p in tests: path, moves, cost, num_eval = slide_solver.solve(p, is_goal, 80) slide_print(p) print(", ".join({-1: "Left", 1: "Right", -4: "Up", 4: "Down"}[move[1]] for move in moves)) print(cost, num_eval)
Generate a Python translation of this Go snippet without changing its computational steps.
package main import ( "fmt" "math" "math/cmplx" ) func main() { for n := 2; n <= 5; n++ { fmt.Printf("%d roots of 1:\n", n) for _, r := range roots(n) { fmt.Printf(" %18.15f\n", r) } } } func roots(n int) []complex128 { r := make([]complex128, n) for i := 0; i < n; i++ { r[i] = cmplx.Rect(1, 2*math.Pi*float64(i)/float64(n)) } return r }
import cmath class Complex(complex): def __repr__(self): rp = '%7.5f' % self.real if not self.pureImag() else '' ip = '%7.5fj' % self.imag if not self.pureReal() else '' conj = '' if ( self.pureImag() or self.pureReal() or self.imag < 0.0 ) else '+' return '0.0' if ( self.pureImag() and self.pureReal() ) else rp + conj + ip def pureImag(self): return abs(self.real) < 0.000005 def pureReal(self): return abs(self.imag) < 0.000005 def croots(n): if n <= 0: return None return (Complex(cmath.rect(1, 2 * k * cmath.pi / n)) for k in range(n)) for nr in range(2, 11): print(nr, list(croots(nr)))
Please provide an equivalent version of this Go code in Python.
package main import "fmt" func d(b byte) byte { if b < '0' || b > '9' { panic("digit 0-9 expected") } return b - '0' } func add(x, y string) string { if len(y) > len(x) { x, y = y, x } b := make([]byte, len(x)+1) var c byte for i := 1; i <= len(x); i++ { if i <= len(y) { c += d(y[len(y)-i]) } s := d(x[len(x)-i]) + c c = s / 10 b[len(b)-i] = (s % 10) + '0' } if c == 0 { return string(b[1:]) } b[0] = c + '0' return string(b) } func mulDigit(x string, y byte) string { if y == '0' { return "0" } y = d(y) b := make([]byte, len(x)+1) var c byte for i := 1; i <= len(x); i++ { s := d(x[len(x)-i])*y + c c = s / 10 b[len(b)-i] = (s % 10) + '0' } if c == 0 { return string(b[1:]) } b[0] = c + '0' return string(b) } func mul(x, y string) string { result := mulDigit(x, y[len(y)-1]) for i, zeros := 2, ""; i <= len(y); i++ { zeros += "0" result = add(result, mulDigit(x, y[len(y)-i])+zeros) } return result } const n = "18446744073709551616" func main() { fmt.Println(mul(n, n)) }
print 2**64*2**64
Rewrite this program in Python while keeping its functionality equivalent to the Go version.
package main import ( "fmt" "math/big" ) var big1 = new(big.Int).SetUint64(1) func solvePell(nn uint64) (*big.Int, *big.Int) { n := new(big.Int).SetUint64(nn) x := new(big.Int).Set(n) x.Sqrt(x) y := new(big.Int).Set(x) z := new(big.Int).SetUint64(1) r := new(big.Int).Lsh(x, 1) e1 := new(big.Int).SetUint64(1) e2 := new(big.Int) f1 := new(big.Int) f2 := new(big.Int).SetUint64(1) t := new(big.Int) u := new(big.Int) a := new(big.Int) b := new(big.Int) for { t.Mul(r, z) y.Sub(t, y) t.Mul(y, y) t.Sub(n, t) z.Quo(t, z) t.Add(x, y) r.Quo(t, z) u.Set(e1) e1.Set(e2) t.Mul(r, e2) e2.Add(t, u) u.Set(f1) f1.Set(f2) t.Mul(r, f2) f2.Add(t, u) t.Mul(x, f2) a.Add(e2, t) b.Set(f2) t.Mul(a, a) u.Mul(n, b) u.Mul(u, b) t.Sub(t, u) if t.Cmp(big1) == 0 { return a, b } } } func main() { ns := []uint64{61, 109, 181, 277} for _, n := range ns { x, y := solvePell(n) fmt.Printf("x^2 - %3d*y^2 = 1 for x = %-21s and y = %s\n", n, x, y) } }
import math def solvePell(n): x = int(math.sqrt(n)) y, z, r = x, 1, x << 1 e1, e2 = 1, 0 f1, f2 = 0, 1 while True: y = r * z - y z = (n - y * y) // z r = (x + y) // z e1, e2 = e2, e1 + e2 * r f1, f2 = f2, f1 + f2 * r a, b = f2 * x + e2, f2 if a * a - n * b * b == 1: return a, b for n in [61, 109, 181, 277]: x, y = solvePell(n) print("x^2 - %3d * y^2 = 1 for x = %27d and y = %25d" % (n, x, y))
Produce a language-to-language conversion: from Go to Python, same semantics.
package main import ( "bufio" "bytes" "fmt" "math/rand" "os" "strings" "time" ) func main() { fmt.Println(`Cows and Bulls Guess four digit number of unique digits in the range 1 to 9. A correct digit but not in the correct place is a cow. A correct digit in the correct place is a bull.`) pat := make([]byte, 4) rand.Seed(time.Now().Unix()) r := rand.Perm(9) for i := range pat { pat[i] = '1' + byte(r[i]) } valid := []byte("123456789") guess: for in := bufio.NewReader(os.Stdin); ; { fmt.Print("Guess: ") guess, err := in.ReadString('\n') if err != nil { fmt.Println("\nSo, bye.") return } guess = strings.TrimSpace(guess) if len(guess) != 4 { fmt.Println("Please guess a four digit number.") continue } var cows, bulls int for ig, cg := range guess { if strings.IndexRune(guess[:ig], cg) >= 0 { fmt.Printf("Repeated digit: %c\n", cg) continue guess } switch bytes.IndexByte(pat, byte(cg)) { case -1: if bytes.IndexByte(valid, byte(cg)) == -1 { fmt.Printf("Invalid digit: %c\n", cg) continue guess } default: cows++ case ig: bulls++ } } fmt.Printf("Cows: %d, bulls: %d\n", cows, bulls) if bulls == 4 { fmt.Println("You got it.") return } } }
import random digits = '123456789' size = 4 chosen = ''.join(random.sample(digits,size)) print % (size, size) guesses = 0 while True: guesses += 1 while True: guess = raw_input('\nNext guess [%i]: ' % guesses).strip() if len(guess) == size and \ all(char in digits for char in guess) \ and len(set(guess)) == size: break print "Problem, try again. You need to enter %i unique digits from 1 to 9" % size if guess == chosen: print '\nCongratulations you guessed correctly in',guesses,'attempts' break bulls = cows = 0 for i in range(size): if guess[i] == chosen[i]: bulls += 1 elif guess[i] in chosen: cows += 1 print ' %i Bulls\n %i Cows' % (bulls, cows)
Write the same algorithm in Python as shown in this Go implementation.
package main import "fmt" func main() { list := []int{31, 41, 59, 26, 53, 58, 97, 93, 23, 84} fmt.Println("unsorted:", list) bubblesort(list) fmt.Println("sorted! ", list) } func bubblesort(a []int) { for itemCount := len(a) - 1; ; itemCount-- { hasChanged := false for index := 0; index < itemCount; index++ { if a[index] > a[index+1] { a[index], a[index+1] = a[index+1], a[index] hasChanged = true } } if hasChanged == false { break } } }
def bubble_sort(seq): changed = True while changed: changed = False for i in range(len(seq) - 1): if seq[i] > seq[i+1]: seq[i], seq[i+1] = seq[i+1], seq[i] changed = True return seq if __name__ == "__main__": from random import shuffle testset = [_ for _ in range(100)] testcase = testset.copy() shuffle(testcase) assert testcase != testset bubble_sort(testcase) assert testcase == testset
Change the programming language of this snippet from Go to Python without modifying what it does.
package main import "fmt" func prodDivisors(n int) int { prod := 1 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { prod *= i j := n / i if j != i { prod *= j } } i += k } return prod } func main() { fmt.Println("The products of positive divisors for the first 50 positive integers are:") for i := 1; i <= 50; i++ { fmt.Printf("%9d ", prodDivisors(i)) if i%5 == 0 { fmt.Println() } } }
def product_of_divisors(n): assert(isinstance(n, int) and 0 < n) ans = i = j = 1 while i*i <= n: if 0 == n%i: ans *= i j = n//i if j != i: ans *= j i += 1 return ans if __name__ == "__main__": print([product_of_divisors(n) for n in range(1,51)])
Translate this program into Python but keep the logic exactly as in Go.
package main import "fmt" func prodDivisors(n int) int { prod := 1 i := 1 k := 2 if n%2 == 0 { k = 1 } for i*i <= n { if n%i == 0 { prod *= i j := n / i if j != i { prod *= j } } i += k } return prod } func main() { fmt.Println("The products of positive divisors for the first 50 positive integers are:") for i := 1; i <= 50; i++ { fmt.Printf("%9d ", prodDivisors(i)) if i%5 == 0 { fmt.Println() } } }
def product_of_divisors(n): assert(isinstance(n, int) and 0 < n) ans = i = j = 1 while i*i <= n: if 0 == n%i: ans *= i j = n//i if j != i: ans *= j i += 1 return ans if __name__ == "__main__": print([product_of_divisors(n) for n in range(1,51)])
Maintain the same structure and functionality when rewriting this code in Python.
package main import ( "fmt" "io/ioutil" ) func main() { b, err := ioutil.ReadFile("input.txt") if err != nil { fmt.Println(err) return } if err = ioutil.WriteFile("output.txt", b, 0666); err != nil { fmt.Println(err) } }
import shutil shutil.copyfile('input.txt', 'output.txt')
Write the same algorithm in Python as shown in this Go implementation.
package main import "fmt" func main() { var a, b int fmt.Print("enter two integers: ") fmt.Scanln(&a, &b) fmt.Printf("%d + %d = %d\n", a, b, a+b) fmt.Printf("%d - %d = %d\n", a, b, a-b) fmt.Printf("%d * %d = %d\n", a, b, a*b) fmt.Printf("%d / %d = %d\n", a, b, a/b) fmt.Printf("%d %% %d = %d\n", a, b, a%b) }
x = int(raw_input("Number 1: ")) y = int(raw_input("Number 2: ")) print "Sum: %d" % (x + y) print "Difference: %d" % (x - y) print "Product: %d" % (x * y) print "Quotient: %d" % (x / y) print "Remainder: %d" % (x % y) print "Quotient: %d with Remainder: %d" % divmod(x, y) print "Power: %d" % x**y raw_input( )
Keep all operations the same but rewrite the snippet in Python.
package main import ( "fmt" "gonum.org/v1/gonum/mat" ) func main() { m := mat.NewDense(2, 3, []float64{ 1, 2, 3, 4, 5, 6, }) fmt.Println(mat.Formatted(m)) fmt.Println() fmt.Println(mat.Formatted(m.T())) }
m=((1, 1, 1, 1), (2, 4, 8, 16), (3, 9, 27, 81), (4, 16, 64, 256), (5, 25,125, 625)) print(zip(*m))
Rewrite this program in Python while keeping its functionality equivalent to the Go version.
package main import "fmt" func a(k int, x1, x2, x3, x4, x5 func() int) int { var b func() int b = func() int { k-- return a(k, b, x1, x2, x3, x4) } if k <= 0 { return x4() + x5() } return b() } func main() { x := func(i int) func() int { return func() int { return i } } fmt.Println(a(10, x(1), x(-1), x(-1), x(1), x(0))) }
import sys sys.setrecursionlimit(1025) def a(in_k, x1, x2, x3, x4, x5): k = [in_k] def b(): k[0] -= 1 return a(k[0], b, x1, x2, x3, x4) return x4() + x5() if k[0] <= 0 else b() x = lambda i: lambda: i print(a(10, x(1), x(-1), x(-1), x(1), x(0)))
Convert the following code from Go to Python, ensuring the logic remains intact.
package main import "fmt" func a(v bool) bool { fmt.Print("a") return v } func b(v bool) bool { fmt.Print("b") return v } func test(i, j bool) { fmt.Printf("Testing a(%t) && b(%t)\n", i, j) fmt.Print("Trace: ") fmt.Println("\nResult:", a(i) && b(j)) fmt.Printf("Testing a(%t) || b(%t)\n", i, j) fmt.Print("Trace: ") fmt.Println("\nResult:", a(i) || b(j)) fmt.Println("") } func main() { test(false, false) test(false, true) test(true, false) test(true, true) }
>>> def a(answer): print(" return answer >>> def b(answer): print(" return answer >>> for i in (False, True): for j in (False, True): print ("\nCalculating: x = a(i) and b(j)") x = a(i) and b(j) print ("Calculating: y = a(i) or b(j)") y = a(i) or b(j) Calculating: x = a(i) and b(j) Calculating: y = a(i) or b(j) Calculating: x = a(i) and b(j) Calculating: y = a(i) or b(j) Calculating: x = a(i) and b(j) Calculating: y = a(i) or b(j) Calculating: x = a(i) and b(j) Calculating: y = a(i) or b(j)
Translate this program into Python but keep the logic exactly as in Go.
package main import ( "flag" "fmt" "runtime/debug" ) func main() { stack := flag.Int("stack", 0, "maximum per goroutine stack size or 0 for the default") flag.Parse() if *stack > 0 { debug.SetMaxStack(*stack) } r(1) } func r(l int) { if l%1000 == 0 { fmt.Println(l) } r(l + 1) }
import sys print(sys.getrecursionlimit())
Produce a language-to-language conversion: from C++ to VB, same semantics.
#include <iostream> void bitwise(int a, int b) { std::cout << "a and b: " << (a & b) << '\n'; std::cout << "a or b: " << (a | b) << '\n'; std::cout << "a xor b: " << (a ^ b) << '\n'; std::cout << "not a: " << ~a << '\n'; std::cout << "a shl b: " << (a << b) << '\n'; std::cout << "a shr b: " << (a >> b) << '\n'; unsigned int ua = a; std::cout << "a lsr b: " << (ua >> b) << '\n'; std::cout << "a rol b: " << std::rotl(ua, b) << '\n'; std::cout << "a ror b: " << std::rotr(ua, b) << '\n'; }
Debug.Print Hex(&HF0F0 And &HFF00) Debug.Print Hex(&HF0F0 Or &HFF00) Debug.Print Hex(&HF0F0 Xor &HFF00) Debug.Print Hex(Not &HF0F0) Debug.Print Hex(&HF0F0 Eqv &HFF00) Debug.Print Hex(&HF0F0 Imp &HFF00)
Maintain the same structure and functionality when rewriting this code in VB.
#include <windows.h> #include <iostream> using namespace std; const int BMP_SIZE = 800, NORTH = 1, EAST = 2, SOUTH = 4, WEST = 8, LEN = 1; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class dragonC { public: dragonC() { bmp.create( BMP_SIZE, BMP_SIZE ); dir = WEST; } void draw( int iterations ) { generate( iterations ); draw(); } private: void generate( int it ) { generator.push_back( 1 ); string temp; for( int y = 0; y < it - 1; y++ ) { temp = generator; temp.push_back( 1 ); for( string::reverse_iterator x = generator.rbegin(); x != generator.rend(); x++ ) temp.push_back( !( *x ) ); generator = temp; } } void draw() { HDC dc = bmp.getDC(); unsigned int clr[] = { 0xff, 0xff00, 0xff0000, 0x00ffff }; int mov[] = { 0, 0, 1, -1, 1, -1, 1, 0 }; int i = 0; for( int t = 0; t < 4; t++ ) { int a = BMP_SIZE / 2, b = a; a += mov[i++]; b += mov[i++]; MoveToEx( dc, a, b, NULL ); bmp.setPenColor( clr[t] ); for( string::iterator x = generator.begin(); x < generator.end(); x++ ) { switch( dir ) { case NORTH: if( *x ) { a += LEN; dir = EAST; } else { a -= LEN; dir = WEST; } break; case EAST: if( *x ) { b += LEN; dir = SOUTH; } else { b -= LEN; dir = NORTH; } break; case SOUTH: if( *x ) { a -= LEN; dir = WEST; } else { a += LEN; dir = EAST; } break; case WEST: if( *x ) { b -= LEN; dir = NORTH; } else { b += LEN; dir = SOUTH; } } LineTo( dc, a, b ); } } bmp.saveBitmap( "f:/rc/dragonCpp.bmp" ); } int dir; myBitmap bmp; string generator; }; int main( int argc, char* argv[] ) { dragonC d; d.draw( 17 ); return system( "pause" ); }
option explicit const pi180= 0.01745329251994329576923690768489 const pi=3.1415926535897932384626433832795 class turtle dim fso dim fn dim svg dim iang dim ori dim incr dim pdown dim clr dim x dim y public property let orient(n):ori = n*pi180 :end property public property let iangle(n):iang= n*pi180 :end property public sub pd() : pdown=true: end sub public sub pu() :pdown=FALSE :end sub public sub rt(i) ori=ori - i*iang: end sub public sub lt(i): ori=(ori + i*iang) end sub public sub bw(l) x= x+ cos(ori+pi)*l*incr y= y+ sin(ori+pi)*l*incr end sub public sub fw(l) dim x1,y1 x1=x + cos(ori)*l*incr y1=y + sin(ori)*l*incr if pdown then line x,y,x1,y1 x=x1:y=y1 end sub Private Sub Class_Initialize() setlocale "us" initsvg x=400:y=400:incr=100 ori=90*pi180 iang=90*pi180 clr=0 pdown=true end sub Private Sub Class_Terminate() disply end sub private sub line (x,y,x1,y1) svg.WriteLine "<line x1=""" & x & """ y1= """& y & """ x2=""" & x1& """ y2=""" & y1 & """/>" end sub private sub disply() dim shell svg.WriteLine "</svg></body></html>" svg.close Set shell = CreateObject("Shell.Application") shell.ShellExecute fn,1,False end sub private sub initsvg() dim scriptpath Set fso = CreateObject ("Scripting.Filesystemobject") ScriptPath= Left(WScript.ScriptFullName, InStrRev(WScript.ScriptFullName, "\")) fn=Scriptpath & "SIERP.HTML" Set svg = fso.CreateTextFile(fn,True) if SVG IS nothing then wscript.echo "Can svg.WriteLine "<!DOCTYPE html>" &vbcrlf & "<html>" &vbcrlf & "<head>" svg.writeline "<style>" & vbcrlf & "line {stroke:rgb(255,0,0);stroke-width:.5}" &vbcrlf &"</style>" svg.writeline "</head>"&vbcrlf & "<body>" svg.WriteLine "<svg xmlns=""http://www.w3.org/2000/svg"" width=""800"" height=""800"" viewBox=""0 0 800 800"">" end sub end class sub dragon(st,le,dir) if st=0 then x.fw le: exit sub x.rt dir dragon st-1, le/1.41421 ,1 x.rt dir*2 dragon st-1, le/1.41421 ,-1 x.rt dir end sub dim x set x=new turtle x.iangle=45 x.orient=45 x.incr=1 x.x=200:x.y=200 dragon 12,300,1 set x=nothing
Port the following code from C++ to VB with equivalent syntax and logic.
#include <fstream> #include <string> #include <iostream> int main( int argc , char** argv ) { int linecount = 0 ; std::string line ; std::ifstream infile( argv[ 1 ] ) ; if ( infile ) { while ( getline( infile , line ) ) { std::cout << linecount << ": " << line << '\n' ; linecount++ ; } } infile.close( ) ; return 0 ; }
$Include "Rapidq.inc" dim file as qfilestream if file.open("c:\A Test.txt", fmOpenRead) then while not File.eof print File.readline wend else print "Cannot read file" end if input "Press enter to exit: ";a$
Translate this program into VB but keep the logic exactly as in C++.
template <typename T> void insert_after(Node<T>* N, T&& data) { auto node = new Node<T>{N, N->next, std::forward(data)}; if(N->next != nullptr) N->next->prev = node; N->next = node; }
Public Sub Insert(ByVal a As Node(Of T), ByVal b As Node(Of T), ByVal c As T) Dim node As New Node(Of T)(value) a.Next = node node.Previous = a b.Previous = node node.Next = b End Sub
Transform the following C++ implementation into VB, maintaining the same output and logic.
#include <algorithm> #include <iostream> int main() { for (int i = 0; i < 10; i++) { int a[] = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4}; std::nth_element(a, a + i, a + sizeof(a)/sizeof(*a)); std::cout << a[i]; if (i < 9) std::cout << ", "; } std::cout << std::endl; return 0; }
Dim s As Variant Private Function quick_select(ByRef s As Variant, k As Integer) As Integer Dim left As Integer, right As Integer, pos As Integer Dim pivotValue As Integer, tmp As Integer left = 1: right = UBound(s) Do While left < right pivotValue = s(k) tmp = s(k) s(k) = s(right) s(right) = tmp pos = left For i = left To right If s(i) < pivotValue Then tmp = s(i) s(i) = s(pos) s(pos) = tmp pos = pos + 1 End If Next i tmp = s(right) s(right) = s(pos) s(pos) = tmp If pos = k Then Exit Do End If If pos < k Then left = pos + 1 Else right = pos - 1 End If Loop quick_select = s(k) End Function Public Sub main() Dim r As Integer, i As Integer s = [{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}] For i = 1 To 10 r = quick_select(s, i) Debug.Print IIf(i < 10, r & ", ", "" & r); Next i End Sub
Can you help me rewrite this code in VB instead of C++, keeping it the same logically?
#include <string> #include <cstdlib> #include <algorithm> #include <cassert> std::string const digits = "0123456789abcdefghijklmnopqrstuvwxyz"; std::string to_base(unsigned long num, int base) { if (num == 0) return "0"; std::string result; while (num > 0) { std::ldiv_t temp = std::div(num, (long)base); result += digits[temp.rem]; num = temp.quot; } std::reverse(result.begin(), result.end()); return result; } unsigned long from_base(std::string const& num_str, int base) { unsigned long result = 0; for (std::string::size_type pos = 0; pos < num_str.length(); ++pos) result = result * base + digits.find(num_str[pos]); return result; }
Private Function to_base(ByVal number As Long, base As Integer) As String Dim digits As String, result As String Dim i As Integer, digit As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" Do While number > 0 digit = number Mod base result = Mid(digits, digit + 1, 1) & result number = number \ base Loop to_base = result End Function Private Function from_base(number As String, base As Integer) As Long Dim digits As String, result As Long Dim i As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1) For i = 2 To Len(number) result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1) Next i from_base = result End Function Public Sub Non_decimal_radices_Convert() Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16) End Sub
Rewrite this program in VB while keeping its functionality equivalent to the C++ version.
#include "boost/filesystem.hpp" #include "boost/regex.hpp" #include <iostream> using namespace boost::filesystem; int main() { path current_dir("."); boost::regex pattern("a.*"); for (recursive_directory_iterator iter(current_dir), end; iter != end; ++iter) { std::string name = iter->path().filename().string(); if (regex_match(name, pattern)) std::cout << iter->path() << "\n"; } }
Sub printFiles(parentDir As FolderItem, pattern As String) For i As Integer = 1 To parentDir.Count If parentDir.Item(i).Directory Then printFiles(parentDir.Item(i), pattern) Else Dim rg as New RegEx Dim myMatch as RegExMatch rg.SearchPattern = pattern myMatch = rg.search(parentDir.Item(i).Name) If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath) End If Next End Sub
Change the programming language of this snippet from C++ to VB without modifying what it does.
#include <algorithm> #include <array> #include <cstdint> #include <numeric> #include <iomanip> #include <iostream> #include <string> std::array<std::uint_fast32_t, 256> generate_crc_lookup_table() noexcept { auto const reversed_polynomial = std::uint_fast32_t{0xEDB88320uL}; struct byte_checksum { std::uint_fast32_t operator()() noexcept { auto checksum = static_cast<std::uint_fast32_t>(n++); for (auto i = 0; i < 8; ++i) checksum = (checksum >> 1) ^ ((checksum & 0x1u) ? reversed_polynomial : 0); return checksum; } unsigned n = 0; }; auto table = std::array<std::uint_fast32_t, 256>{}; std::generate(table.begin(), table.end(), byte_checksum{}); return table; } template <typename InputIterator> std::uint_fast32_t crc(InputIterator first, InputIterator last) { static auto const table = generate_crc_lookup_table(); return std::uint_fast32_t{0xFFFFFFFFuL} & ~std::accumulate(first, last, ~std::uint_fast32_t{0} & std::uint_fast32_t{0xFFFFFFFFuL}, [](std::uint_fast32_t checksum, std::uint_fast8_t value) { return table[(checksum ^ value) & 0xFFu] ^ (checksum >> 8); }); } int main() { auto const s = std::string{"The quick brown fox jumps over the lazy dog"}; std::cout << std::hex << std::setw(8) << std::setfill('0') << crc(s.begin(), s.end()) << '\n'; }
dim crctbl(255) const crcc =&hEDB88320 sub gencrctable for i= 0 to 255 k=i for j=1 to 8 if k and 1 then k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) k=k xor crcc else k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) end if next crctbl(i)=k next end sub function crc32 (buf) dim r,r1,i r=&hffffffff for i=1 to len(buf) r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0) r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255) next crc32=r xor &hffffffff end function gencrctable wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
Convert the following code from C++ to VB, ensuring the logic remains intact.
#include <string> #include <boost/regex.hpp> #include <iostream> std::string csvToHTML( const std::string & ) ; int main( ) { std::string text = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!\n" ; std::cout << csvToHTML( text ) ; return 0 ; } std::string csvToHTML( const std::string & csvtext ) { std::string regexes[ 5 ] = { "<" , ">" , "^(.+?)\\b" , "," , "\n" } ; const char* replacements [ 5 ] = { "&lt;" , "&gt;" , " <TR><TD>$1" , "</TD><TD>", "</TD></TR>\n" } ; boost::regex e1( regexes[ 0 ] ) ; std::string tabletext = boost::regex_replace( csvtext , e1 , replacements[ 0 ] , boost::match_default | boost::format_all ) ; for ( int i = 1 ; i < 5 ; i++ ) { e1.assign( regexes[ i ] ) ; tabletext = boost::regex_replace( tabletext , e1 , replacements[ i ] , boost::match_default | boost::format_all ) ; } tabletext = std::string( "<TABLE>\n" ) + tabletext ; tabletext.append( "</TABLE>\n" ) ; return tabletext ; }
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
Rewrite this program in VB while keeping its functionality equivalent to the C++ version.
#include <string> #include <boost/regex.hpp> #include <iostream> std::string csvToHTML( const std::string & ) ; int main( ) { std::string text = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!\n" ; std::cout << csvToHTML( text ) ; return 0 ; } std::string csvToHTML( const std::string & csvtext ) { std::string regexes[ 5 ] = { "<" , ">" , "^(.+?)\\b" , "," , "\n" } ; const char* replacements [ 5 ] = { "&lt;" , "&gt;" , " <TR><TD>$1" , "</TD><TD>", "</TD></TR>\n" } ; boost::regex e1( regexes[ 0 ] ) ; std::string tabletext = boost::regex_replace( csvtext , e1 , replacements[ 0 ] , boost::match_default | boost::format_all ) ; for ( int i = 1 ; i < 5 ; i++ ) { e1.assign( regexes[ i ] ) ; tabletext = boost::regex_replace( tabletext , e1 , replacements[ i ] , boost::match_default | boost::format_all ) ; } tabletext = std::string( "<TABLE>\n" ) + tabletext ; tabletext.append( "</TABLE>\n" ) ; return tabletext ; }
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
Rewrite the snippet below in VB so it works the same as the original C++ code.
#include <string> #include <boost/regex.hpp> #include <iostream> std::string csvToHTML( const std::string & ) ; int main( ) { std::string text = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!\n" ; std::cout << csvToHTML( text ) ; return 0 ; } std::string csvToHTML( const std::string & csvtext ) { std::string regexes[ 5 ] = { "<" , ">" , "^(.+?)\\b" , "," , "\n" } ; const char* replacements [ 5 ] = { "&lt;" , "&gt;" , " <TR><TD>$1" , "</TD><TD>", "</TD></TR>\n" } ; boost::regex e1( regexes[ 0 ] ) ; std::string tabletext = boost::regex_replace( csvtext , e1 , replacements[ 0 ] , boost::match_default | boost::format_all ) ; for ( int i = 1 ; i < 5 ; i++ ) { e1.assign( regexes[ i ] ) ; tabletext = boost::regex_replace( tabletext , e1 , replacements[ i ] , boost::match_default | boost::format_all ) ; } tabletext = std::string( "<TABLE>\n" ) + tabletext ; tabletext.append( "</TABLE>\n" ) ; return tabletext ; }
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
Please provide an equivalent version of this C++ code in VB.
PRAGMA COMPILER g++ PRAGMA OPTIONS -Wno-write-strings -Wno-pointer-arith -fpermissive OPTION PARSE FALSE '---The class does the declaring for you CLASS Books public: const char* title; const char* author; const char* subject; int book_id; END CLASS '---pointer to an object declaration (we use a class called Books) DECLARE Book1 TYPE Books '--- the correct syntax for class Book1 = Books() '--- initialize the strings const char* in c++ Book1.title = "C++ Programming to bacon " Book1.author = "anyone" Book1.subject ="RECORD Tutorial" Book1.book_id = 1234567 PRINT "Book title  : " ,Book1.title FORMAT "%s%s\n" PRINT "Book author  : ", Book1.author FORMAT "%s%s\n" PRINT "Book subject : ", Book1.subject FORMAT "%s%s\n" PRINT "Book book_id : ", Book1.book_id FORMAT "%s%d\n"
Class NumberContainer Private TheNumber As Integer Sub Constructor(InitialNumber As Integer) TheNumber = InitialNumber End Sub Function Number() As Integer Return TheNumber End Function Sub Number(Assigns NewNumber As Integer) TheNumber = NewNumber End Sub End Class
Convert this C++ snippet to VB and keep its semantics consistent.
#include <vector> #include <string> #include <iostream> #include <sstream> #include <algorithm> #include <iterator> #include <utility> long string2long( const std::string & s ) { long result ; std::istringstream( s ) >> result ; return result ; } bool isKaprekar( long number ) { long long squarenumber = ((long long)number) * number ; std::ostringstream numberbuf ; numberbuf << squarenumber ; std::string numberstring = numberbuf.str( ) ; for ( int i = 0 ; i < numberstring.length( ) ; i++ ) { std::string firstpart = numberstring.substr( 0 , i ) , secondpart = numberstring.substr( i ) ; if ( secondpart.find_first_not_of( "0" ) == std::string::npos ) { return false ; } if ( string2long( firstpart ) + string2long( secondpart ) == number ) { return true ; } } return false ; } int main( ) { std::vector<long> kaprekarnumbers ; kaprekarnumbers.push_back( 1 ) ; for ( int i = 2 ; i < 1000001 ; i++ ) { if ( isKaprekar( i ) ) kaprekarnumbers.push_back( i ) ; } std::vector<long>::const_iterator svi = kaprekarnumbers.begin( ) ; std::cout << "Kaprekar numbers up to 10000: \n" ; while ( *svi < 10000 ) { std::cout << *svi << " " ; svi++ ; } std::cout << '\n' ; std::cout << "All the Kaprekar numbers up to 1000000 :\n" ; std::copy( kaprekarnumbers.begin( ) , kaprekarnumbers.end( ) , std::ostream_iterator<long>( std::cout , "\n" ) ) ; std::cout << "There are " << kaprekarnumbers.size( ) << " Kaprekar numbers less than one million!\n" ; return 0 ; }
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
Write the same code in VB as shown below in C++.
#include <vector> #include <string> #include <iostream> #include <sstream> #include <algorithm> #include <iterator> #include <utility> long string2long( const std::string & s ) { long result ; std::istringstream( s ) >> result ; return result ; } bool isKaprekar( long number ) { long long squarenumber = ((long long)number) * number ; std::ostringstream numberbuf ; numberbuf << squarenumber ; std::string numberstring = numberbuf.str( ) ; for ( int i = 0 ; i < numberstring.length( ) ; i++ ) { std::string firstpart = numberstring.substr( 0 , i ) , secondpart = numberstring.substr( i ) ; if ( secondpart.find_first_not_of( "0" ) == std::string::npos ) { return false ; } if ( string2long( firstpart ) + string2long( secondpart ) == number ) { return true ; } } return false ; } int main( ) { std::vector<long> kaprekarnumbers ; kaprekarnumbers.push_back( 1 ) ; for ( int i = 2 ; i < 1000001 ; i++ ) { if ( isKaprekar( i ) ) kaprekarnumbers.push_back( i ) ; } std::vector<long>::const_iterator svi = kaprekarnumbers.begin( ) ; std::cout << "Kaprekar numbers up to 10000: \n" ; while ( *svi < 10000 ) { std::cout << *svi << " " ; svi++ ; } std::cout << '\n' ; std::cout << "All the Kaprekar numbers up to 1000000 :\n" ; std::copy( kaprekarnumbers.begin( ) , kaprekarnumbers.end( ) , std::ostream_iterator<long>( std::cout , "\n" ) ) ; std::cout << "There are " << kaprekarnumbers.size( ) << " Kaprekar numbers less than one million!\n" ; return 0 ; }
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
Please provide an equivalent version of this C++ code in VB.
#include <string> #include <map> template <typename Iterator> Iterator compress(const std::string &uncompressed, Iterator result) { int dictSize = 256; std::map<std::string,int> dictionary; for (int i = 0; i < 256; i++) dictionary[std::string(1, i)] = i; std::string w; for (std::string::const_iterator it = uncompressed.begin(); it != uncompressed.end(); ++it) { char c = *it; std::string wc = w + c; if (dictionary.count(wc)) w = wc; else { *result++ = dictionary[w]; dictionary[wc] = dictSize++; w = std::string(1, c); } } if (!w.empty()) *result++ = dictionary[w]; return result; } template <typename Iterator> std::string decompress(Iterator begin, Iterator end) { int dictSize = 256; std::map<int,std::string> dictionary; for (int i = 0; i < 256; i++) dictionary[i] = std::string(1, i); std::string w(1, *begin++); std::string result = w; std::string entry; for ( ; begin != end; begin++) { int k = *begin; if (dictionary.count(k)) entry = dictionary[k]; else if (k == dictSize) entry = w + w[0]; else throw "Bad compressed k"; result += entry; dictionary[dictSize++] = w + entry[0]; w = entry; } return result; } #include <iostream> #include <iterator> #include <vector> int main() { std::vector<int> compressed; compress("TOBEORNOTTOBEORTOBEORNOT", std::back_inserter(compressed)); copy(compressed.begin(), compressed.end(), std::ostream_iterator<int>(std::cout, ", ")); std::cout << std::endl; std::string decompressed = decompress(compressed.begin(), compressed.end()); std::cout << decompressed << std::endl; return 0; }
Option Explicit Const numchars=127 Function LZWCompress(si) Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j Set oDict = CreateObject("Scripting.Dictionary") ReDim a(Len(si)) intMaxCode = numchars For i = 0 To numchars oDict.Add Chr(i), i Next strCurrent = Left(si,1) j=0 For ii=2 To Len(si) strNext = Mid(si,ii,1) ss=strCurrent & strNext If oDict.Exists(ss) Then strCurrent = ss Else a(j)=oDict.Item(strCurrent) :j=j+1 intMaxCode = intMaxCode + 1 oDict.Add ss, intMaxCode strCurrent = strNext End If Next a(j)=oDict.Item(strCurrent) ReDim preserve a(j) LZWCompress=a Set oDict = Nothing End Function Function lzwUncompress(sc) Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j s="" reDim dict(1000) intMaxCode = numchars For i = 0 To numchars : dict(i)= Chr(i) : Next intCurrent=sc(0) For j=1 To UBound(sc) ss=dict(intCurrent) s= s & ss intMaxCode = intMaxCode + 1 intnext=sc(j) If intNext<intMaxCode Then dict(intMaxCode)=ss & Left(dict(intNext), 1) Else dict(intMaxCode)=ss & Left(ss, 1) End If intCurrent = intNext Next s= s & dict(intCurrent) lzwUncompress=s End function Sub printvec(a) Dim s,i,x s="(" For i=0 To UBound (a) s=s & x & a(i) x=", " Next WScript.echo s &")" End sub Dim a,b b="TOBEORNOTTOBEORTOBEORNOT" WScript.Echo b a=LZWCompress (b) printvec(a) WScript.echo lzwUncompress (a ) wscript.quit 1
Change the following C++ code into VB without altering its purpose.
#include <iomanip> #include <iostream> #include <set> #include <vector> using namespace std; unsigned hofstadter(unsigned rlistSize, unsigned slistSize) { auto n = rlistSize > slistSize ? rlistSize : slistSize; auto rlist = new vector<unsigned> { 1, 3, 7 }; auto slist = new vector<unsigned> { 2, 4, 5, 6 }; auto list = rlistSize > 0 ? rlist : slist; auto target_size = rlistSize > 0 ? rlistSize : slistSize; while (list->size() > target_size) list->pop_back(); while (list->size() < target_size) { auto lastIndex = rlist->size() - 1; auto lastr = (*rlist)[lastIndex]; auto r = lastr + (*slist)[lastIndex]; rlist->push_back(r); for (auto s = lastr + 1; s < r && list->size() < target_size;) slist->push_back(s++); } auto v = (*list)[n - 1]; delete rlist; delete slist; return v; } ostream& operator<<(ostream& os, const set<unsigned>& s) { cout << '(' << s.size() << "):"; auto i = 0; for (auto c = s.begin(); c != s.end();) { if (i++ % 20 == 0) os << endl; os << setw(5) << *c++; } return os; } int main(int argc, const char* argv[]) { const auto v1 = atoi(argv[1]); const auto v2 = atoi(argv[2]); set<unsigned> r, s; for (auto n = 1; n <= v2; n++) { if (n <= v1) r.insert(hofstadter(n, 0)); s.insert(hofstadter(0, n)); } cout << "R" << r << endl; cout << "S" << s << endl; int m = max(*r.rbegin(), *s.rbegin()); for (auto n = 1; n <= m; n++) if (r.count(n) == s.count(n)) clog << "integer " << n << " either in both or neither set" << endl; return 0; }
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
Generate a VB translation of this C++ snippet without changing its computational steps.
#include <iomanip> #include <iostream> #include <set> #include <vector> using namespace std; unsigned hofstadter(unsigned rlistSize, unsigned slistSize) { auto n = rlistSize > slistSize ? rlistSize : slistSize; auto rlist = new vector<unsigned> { 1, 3, 7 }; auto slist = new vector<unsigned> { 2, 4, 5, 6 }; auto list = rlistSize > 0 ? rlist : slist; auto target_size = rlistSize > 0 ? rlistSize : slistSize; while (list->size() > target_size) list->pop_back(); while (list->size() < target_size) { auto lastIndex = rlist->size() - 1; auto lastr = (*rlist)[lastIndex]; auto r = lastr + (*slist)[lastIndex]; rlist->push_back(r); for (auto s = lastr + 1; s < r && list->size() < target_size;) slist->push_back(s++); } auto v = (*list)[n - 1]; delete rlist; delete slist; return v; } ostream& operator<<(ostream& os, const set<unsigned>& s) { cout << '(' << s.size() << "):"; auto i = 0; for (auto c = s.begin(); c != s.end();) { if (i++ % 20 == 0) os << endl; os << setw(5) << *c++; } return os; } int main(int argc, const char* argv[]) { const auto v1 = atoi(argv[1]); const auto v2 = atoi(argv[2]); set<unsigned> r, s; for (auto n = 1; n <= v2; n++) { if (n <= v1) r.insert(hofstadter(n, 0)); s.insert(hofstadter(0, n)); } cout << "R" << r << endl; cout << "S" << s << endl; int m = max(*r.rbegin(), *s.rbegin()); for (auto n = 1; n <= m; n++) if (r.count(n) == s.count(n)) clog << "integer " << n << " either in both or neither set" << endl; return 0; }
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
Write the same algorithm in VB as shown in this C++ implementation.
#include <iostream> #include <sstream> #include <iomanip> #include <cassert> #include <vector> using namespace std; class MagicSquare { public: MagicSquare(int d) : sqr(d*d,0), sz(d) { assert(d&1); fillSqr(); } void display() { cout << "Odd Magic Square: " << sz << " x " << sz << "\n"; cout << "It's Magic Sum is: " << magicNumber() << "\n\n"; ostringstream cvr; cvr << sz * sz; int l = cvr.str().size(); for( int y = 0; y < sz; y++ ) { int yy = y * sz; for( int x = 0; x < sz; x++ ) cout << setw( l + 2 ) << sqr[yy + x]; cout << "\n"; } cout << "\n\n"; } private: void fillSqr() { int sx = sz / 2, sy = 0, c = 0; while( c < sz * sz ) { if( !sqr[sx + sy * sz] ) { sqr[sx + sy * sz]= c + 1; inc( sx ); dec( sy ); c++; } else { dec( sx ); inc( sy ); inc( sy ); } } } int magicNumber() { return sz * ( ( sz * sz ) + 1 ) / 2; } void inc( int& a ) { if( ++a == sz ) a = 0; } void dec( int& a ) { if( --a < 0 ) a = sz - 1; } bool checkPos( int x, int y ) { return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); } bool isInside( int s ) { return ( s < sz && s > -1 ); } vector<int> sqr; int sz; }; int main() { MagicSquare s(7); s.display(); return 0; }
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
Can you help me rewrite this code in VB instead of C++, keeping it the same logically?
#include <iostream> #include <sstream> #include <iomanip> #include <cassert> #include <vector> using namespace std; class MagicSquare { public: MagicSquare(int d) : sqr(d*d,0), sz(d) { assert(d&1); fillSqr(); } void display() { cout << "Odd Magic Square: " << sz << " x " << sz << "\n"; cout << "It's Magic Sum is: " << magicNumber() << "\n\n"; ostringstream cvr; cvr << sz * sz; int l = cvr.str().size(); for( int y = 0; y < sz; y++ ) { int yy = y * sz; for( int x = 0; x < sz; x++ ) cout << setw( l + 2 ) << sqr[yy + x]; cout << "\n"; } cout << "\n\n"; } private: void fillSqr() { int sx = sz / 2, sy = 0, c = 0; while( c < sz * sz ) { if( !sqr[sx + sy * sz] ) { sqr[sx + sy * sz]= c + 1; inc( sx ); dec( sy ); c++; } else { dec( sx ); inc( sy ); inc( sy ); } } } int magicNumber() { return sz * ( ( sz * sz ) + 1 ) / 2; } void inc( int& a ) { if( ++a == sz ) a = 0; } void dec( int& a ) { if( --a < 0 ) a = sz - 1; } bool checkPos( int x, int y ) { return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); } bool isInside( int s ) { return ( s < sz && s > -1 ); } vector<int> sqr; int sz; }; int main() { MagicSquare s(7); s.display(); return 0; }
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
Convert this C++ block to VB, preserving its control flow and logic.
#include <iostream> #include <sstream> #include <iomanip> #include <cassert> #include <vector> using namespace std; class MagicSquare { public: MagicSquare(int d) : sqr(d*d,0), sz(d) { assert(d&1); fillSqr(); } void display() { cout << "Odd Magic Square: " << sz << " x " << sz << "\n"; cout << "It's Magic Sum is: " << magicNumber() << "\n\n"; ostringstream cvr; cvr << sz * sz; int l = cvr.str().size(); for( int y = 0; y < sz; y++ ) { int yy = y * sz; for( int x = 0; x < sz; x++ ) cout << setw( l + 2 ) << sqr[yy + x]; cout << "\n"; } cout << "\n\n"; } private: void fillSqr() { int sx = sz / 2, sy = 0, c = 0; while( c < sz * sz ) { if( !sqr[sx + sy * sz] ) { sqr[sx + sy * sz]= c + 1; inc( sx ); dec( sy ); c++; } else { dec( sx ); inc( sy ); inc( sy ); } } } int magicNumber() { return sz * ( ( sz * sz ) + 1 ) / 2; } void inc( int& a ) { if( ++a == sz ) a = 0; } void dec( int& a ) { if( --a < 0 ) a = sz - 1; } bool checkPos( int x, int y ) { return( isInside( x ) && isInside( y ) && !sqr[sz * y + x] ); } bool isInside( int s ) { return ( s < sz && s > -1 ); } vector<int> sqr; int sz; }; int main() { MagicSquare s(7); s.display(); return 0; }
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
Transform the following C++ implementation into VB, maintaining the same output and logic.
#include <cln/integer.h> #include <cln/integer_io.h> #include <iostream> #include <algorithm> #include <vector> #include <iomanip> #include <sstream> #include <string> #include <cstdlib> #include <cmath> #include <map> using namespace cln ; class NextNum { public : NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { } cl_I operator( )( ) { cl_I result = first + second ; first = second ; second = result ; return result ; } private : cl_I first ; cl_I second ; } ; void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) { for ( cl_I bignumber : fibos ) { std::ostringstream os ; fprintdecimal ( os , bignumber ) ; int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ; auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ; if ( ! result.second ) numberfrequencies[ firstdigit ]++ ; } } int main( ) { std::vector<cl_I> fibonaccis( 1000 ) ; fibonaccis[ 0 ] = 0 ; fibonaccis[ 1 ] = 1 ; cl_I a = 0 ; cl_I b = 1 ; std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ; std::cout << std::endl ; std::map<int , int> frequencies ; findFrequencies( fibonaccis , frequencies ) ; std::cout << " found expected\n" ; for ( int i = 1 ; i < 10 ; i++ ) { double found = static_cast<double>( frequencies[ i ] ) / 1000 ; double expected = std::log10( 1 + 1 / static_cast<double>( i )) ; std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ; std::cout.precision( 3 ) ; std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ; } return 0 ; }
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
Rewrite the snippet below in VB so it works the same as the original C++ code.
#include <cln/integer.h> #include <cln/integer_io.h> #include <iostream> #include <algorithm> #include <vector> #include <iomanip> #include <sstream> #include <string> #include <cstdlib> #include <cmath> #include <map> using namespace cln ; class NextNum { public : NextNum ( cl_I & a , cl_I & b ) : first( a ) , second ( b ) { } cl_I operator( )( ) { cl_I result = first + second ; first = second ; second = result ; return result ; } private : cl_I first ; cl_I second ; } ; void findFrequencies( const std::vector<cl_I> & fibos , std::map<int , int> &numberfrequencies ) { for ( cl_I bignumber : fibos ) { std::ostringstream os ; fprintdecimal ( os , bignumber ) ; int firstdigit = std::atoi( os.str( ).substr( 0 , 1 ).c_str( )) ; auto result = numberfrequencies.insert( std::make_pair( firstdigit , 1 ) ) ; if ( ! result.second ) numberfrequencies[ firstdigit ]++ ; } } int main( ) { std::vector<cl_I> fibonaccis( 1000 ) ; fibonaccis[ 0 ] = 0 ; fibonaccis[ 1 ] = 1 ; cl_I a = 0 ; cl_I b = 1 ; std::generate_n( fibonaccis.begin( ) + 2 , 998 , NextNum( a , b ) ) ; std::cout << std::endl ; std::map<int , int> frequencies ; findFrequencies( fibonaccis , frequencies ) ; std::cout << " found expected\n" ; for ( int i = 1 ; i < 10 ; i++ ) { double found = static_cast<double>( frequencies[ i ] ) / 1000 ; double expected = std::log10( 1 + 1 / static_cast<double>( i )) ; std::cout << i << " :" << std::setw( 16 ) << std::right << found * 100 << " %" ; std::cout.precision( 3 ) ; std::cout << std::setw( 26 ) << std::right << expected * 100 << " %\n" ; } return 0 ; }
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
Transform the following C++ implementation into VB, maintaining the same output and logic.
double fib(double n) { if(n < 0) { throw "Invalid argument passed to fib"; } else { struct actual_fib { static double calc(double n) { if(n < 2) { return n; } else { return calc(n-1) + calc(n-2); } } }; return actual_fib::calc(n); } }
Sub Main() Debug.Print F(-10) Debug.Print F(10) End Sub Private Function F(N As Long) As Variant If N < 0 Then F = "Error. Negative argument" ElseIf N <= 1 Then F = N Else F = F(N - 1) + F(N - 2) End If End Function
Convert this C++ block to VB, preserving its control flow and logic.
#include <string> #include <iostream> int main( ) { std::string word( "Premier League" ) ; std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ; std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ; std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ; return 0 ; }
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
Write a version of this C++ function in VB with identical behavior.
#include <string> #include <iostream> int main( ) { std::string word( "Premier League" ) ; std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ; std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ; std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ; return 0 ; }
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
Convert the following code from C++ to VB, ensuring the logic remains intact.
#include <string> #include <iostream> int main( ) { std::string word( "Premier League" ) ; std::cout << "Without first letter: " << word.substr( 1 ) << " !\n" ; std::cout << "Without last letter: " << word.substr( 0 , word.length( ) - 1 ) << " !\n" ; std::cout << "Without first and last letter: " << word.substr( 1 , word.length( ) - 2 ) << " !\n" ; return 0 ; }
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
Rewrite the snippet below in VB so it works the same as the original C++ code.
#include <iostream> #include <string.h> int main() { std::string longLine, longestLines, newLine; while (std::cin >> newLine) { auto isNewLineShorter = longLine.c_str(); auto isLongLineShorter = newLine.c_str(); while (*isNewLineShorter && *isLongLineShorter) { isNewLineShorter = &isNewLineShorter[1]; isLongLineShorter = &isLongLineShorter[1]; } if(*isNewLineShorter) continue; if(*isLongLineShorter) { longLine = newLine; longestLines = newLine; } else { longestLines+=newLine; } longestLines+="\n"; } std::cout << "\nLongest string:\n" << longestLines; }
Set objfso = CreateObject("Scripting.FileSystemObject") Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_ "\input.txt",1) list = "" previous_line = "" l = Len(previous_line) Do Until objfile.AtEndOfStream current_line = objfile.ReadLine If Mid(current_line,l+1,1) <> "" Then list = current_line & vbCrLf previous_line = current_line l = Len(previous_line) ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then list = list & current_line & vbCrLf End If Loop WScript.Echo list objfile.Close Set objfso = Nothing
Translate the given C++ code snippet into VB without altering its behavior.
#include <vector> #include <string> #include <iostream> #include <algorithm> #include <fstream> #include <iomanip> typedef unsigned int uint; using namespace std; const uint TAPE_MAX_LEN = 49152; struct action { char write, direction; }; class tape { public: tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); } void reset() { clear( '0' ); headPos = _sp; } char read(){ return _t[headPos]; } void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; } void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); } void action( const action* a ) { write( a->write ); move( a->direction ); } void print( int c = 10 ) { int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx; for( int x = st; x < ed; x++ ) { tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; } cout << endl << setw( c + 1 ) << "^" << endl; } private: void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; } void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } } string _t; uint headPos, _sp; char blk; const uint MAX_LEN; }; class state { public: bool operator ==( const string o ) { return o == name; } string name, next; char symbol, write, direction; }; class actionTable { public: bool loadTable( string file ) { reset(); ifstream mf; mf.open( file.c_str() ); if( mf.is_open() ) { string str; state stt; while( mf.good() ) { getline( mf, str ); if( str[0] == '\'' ) break; parseState( str, stt ); states.push_back( stt ); } while( mf.good() ) { getline( mf, str ); if( str == "" ) continue; if( str[0] == '!' ) blank = str.erase( 0, 1 )[0]; if( str[0] == '^' ) curState = str.erase( 0, 1 ); if( str[0] == '>' ) input = str.erase( 0, 1 ); } mf.close(); return true; } cout << "Could not open " << file << endl; return false; } bool action( char symbol, action& a ) { vector<state>::iterator f = states.begin(); while( true ) { f = find( f, states.end(), curState ); if( f == states.end() ) return false; if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) ) { a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; } f++; } return true; } void reset() { states.clear(); blank = '0'; curState = input = ""; } string getInput() { return input; } char getBlank() { return blank; } private: void parseState( string str, state& stt ) { string a[5]; int idx = 0; for( string::iterator si = str.begin(); si != str.end(); si++ ) { if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); } stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4]; } vector<state> states; char blank; string curState, input; }; class utm { public: utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; } void start() { while( true ) { reset(); int t = showMenu(); if( t == 0 ) return; if( !at.loadTable( files[t - 1] ) ) return; startMachine(); } } private: void simulate() { char r; action a; while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); } cout << endl << endl; system( "pause" ); } int showMenu() { int t = -1; while( t < 0 || t > 3 ) { system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit"; cout << endl << endl << "Choose an action "; cin >> t; } return t; } void reset() { tp.reset(); at.reset(); } void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); } tape tp; actionTable at; string files[7]; }; int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
Please provide an equivalent version of this C++ code in VB.
#include <vector> #include <string> #include <iostream> #include <algorithm> #include <fstream> #include <iomanip> typedef unsigned int uint; using namespace std; const uint TAPE_MAX_LEN = 49152; struct action { char write, direction; }; class tape { public: tape( uint startPos = TAPE_MAX_LEN >> 1 ) : MAX_LEN( TAPE_MAX_LEN ) { _sp = startPos; reset(); } void reset() { clear( '0' ); headPos = _sp; } char read(){ return _t[headPos]; } void input( string a ){ if( a == "" ) return; for( uint s = 0; s < a.length(); s++ ) _t[headPos + s] = a[s]; } void clear( char c ) { _t.clear(); blk = c; _t.resize( MAX_LEN, blk ); } void action( const action* a ) { write( a->write ); move( a->direction ); } void print( int c = 10 ) { int ml = static_cast<int>( MAX_LEN ), st = static_cast<int>( headPos ) - c, ed = static_cast<int>( headPos ) + c + 1, tx; for( int x = st; x < ed; x++ ) { tx = x; if( tx < 0 ) tx += ml; if( tx >= ml ) tx -= ml; cout << _t[tx]; } cout << endl << setw( c + 1 ) << "^" << endl; } private: void move( char d ) { if( d == 'N' ) return; headPos += d == 'R' ? 1 : -1; if( headPos >= MAX_LEN ) headPos = d == 'R' ? 0 : MAX_LEN - 1; } void write( char a ) { if( a != 'N' ) { if( a == 'B' ) _t[headPos] = blk; else _t[headPos] = a; } } string _t; uint headPos, _sp; char blk; const uint MAX_LEN; }; class state { public: bool operator ==( const string o ) { return o == name; } string name, next; char symbol, write, direction; }; class actionTable { public: bool loadTable( string file ) { reset(); ifstream mf; mf.open( file.c_str() ); if( mf.is_open() ) { string str; state stt; while( mf.good() ) { getline( mf, str ); if( str[0] == '\'' ) break; parseState( str, stt ); states.push_back( stt ); } while( mf.good() ) { getline( mf, str ); if( str == "" ) continue; if( str[0] == '!' ) blank = str.erase( 0, 1 )[0]; if( str[0] == '^' ) curState = str.erase( 0, 1 ); if( str[0] == '>' ) input = str.erase( 0, 1 ); } mf.close(); return true; } cout << "Could not open " << file << endl; return false; } bool action( char symbol, action& a ) { vector<state>::iterator f = states.begin(); while( true ) { f = find( f, states.end(), curState ); if( f == states.end() ) return false; if( ( *f ).symbol == '*' || ( *f ).symbol == symbol || ( ( *f ).symbol == 'B' && blank == symbol ) ) { a.direction = ( *f ).direction; a.write = ( *f ).write; curState = ( *f ).next; break; } f++; } return true; } void reset() { states.clear(); blank = '0'; curState = input = ""; } string getInput() { return input; } char getBlank() { return blank; } private: void parseState( string str, state& stt ) { string a[5]; int idx = 0; for( string::iterator si = str.begin(); si != str.end(); si++ ) { if( ( *si ) == ';' ) idx++; else a[idx].append( &( *si ), 1 ); } stt.name = a[0]; stt.symbol = a[1][0]; stt.write = a[2][0]; stt.direction = a[3][0]; stt.next = a[4]; } vector<state> states; char blank; string curState, input; }; class utm { public: utm() { files[0] = "incrementer.utm"; files[1] = "busy_beaver.utm"; files[2] = "sort.utm"; } void start() { while( true ) { reset(); int t = showMenu(); if( t == 0 ) return; if( !at.loadTable( files[t - 1] ) ) return; startMachine(); } } private: void simulate() { char r; action a; while( true ) { tp.print(); r = tp.read(); if( !( at.action( r, a ) ) ) break; tp.action( &a ); } cout << endl << endl; system( "pause" ); } int showMenu() { int t = -1; while( t < 0 || t > 3 ) { system( "cls" ); cout << "1. Incrementer\n2. Busy beaver\n3. Sort\n\n0. Quit"; cout << endl << endl << "Choose an action "; cin >> t; } return t; } void reset() { tp.reset(); at.reset(); } void startMachine() { system( "cls" ); tp.clear( at.getBlank() ); tp.input( at.getInput() ); simulate(); } tape tp; actionTable at; string files[7]; }; int main( int a, char* args[] ){ utm mm; mm.start(); return 0; }
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
Convert the following code from C++ to VB, ensuring the logic remains intact.
#include <direct.h> #include <fstream> int main() { std::fstream f("output.txt", std::ios::out); f.close(); f.open("/output.txt", std::ios::out); f.close(); _mkdir("docs"); _mkdir("/docs"); return 0; }
Public Sub create_file() Dim FileNumber As Integer FileNumber = FreeFile MkDir "docs" Open "docs\output.txt" For Output As #FreeFile Close #FreeFile MkDir "C:\docs" Open "C:\docs\output.txt" For Output As #FreeFile Close #FreeFile End Sub
Convert the following code from C++ to VB, ensuring the logic remains intact.
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
Rewrite the snippet below in VB so it works the same as the original C++ code.
#include <map> #include <string> #include <iostream> #include <iomanip> const std::string DEFAULT_DNA = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"; class DnaBase { public: DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) { for (auto elm : dna) { if (count.find(elm) == count.end()) count[elm] = 0; ++count[elm]; } } void viewGenome() { std::cout << "Sequence:" << std::endl; std::cout << std::endl; int limit = genome.size() / displayWidth; if (genome.size() % displayWidth != 0) ++limit; for (int i = 0; i < limit; ++i) { int beginPos = i * displayWidth; std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl; } std::cout << std::endl; std::cout << "Base Count" << std::endl; std::cout << "----------" << std::endl; std::cout << std::endl; int total = 0; for (auto elm : count) { std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl; total += elm.second; } std::cout << std::endl; std::cout << "Total: " << total << std::endl; } private: std::string genome; std::map<char, int> count; int displayWidth; }; int main(void) { auto d = new DnaBase(); d->viewGenome(); delete d; return 0; }
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
Please provide an equivalent version of this C++ code in VB.
#include <algorithm> #include <array> #include <chrono> #include <iostream> #include <mutex> #include <random> #include <string> #include <string_view> #include <thread> const int timeScale = 42; void Message(std::string_view message) { static std::mutex cout_mutex; std::scoped_lock cout_lock(cout_mutex); std::cout << message << std::endl; } struct Fork { std::mutex mutex; }; struct Dinner { std::array<Fork, 5> forks; ~Dinner() { Message("Dinner is over"); } }; class Philosopher { std::mt19937 rng{std::random_device {}()}; const std::string name; Fork& left; Fork& right; std::thread worker; void live(); void dine(); void ponder(); public: Philosopher(std::string name_, Fork& l, Fork& r) : name(std::move(name_)), left(l), right(r), worker(&Philosopher::live, this) {} ~Philosopher() { worker.join(); Message(name + " went to sleep."); } }; void Philosopher::live() { for(;;) { { std::scoped_lock dine_lock(left.mutex, right.mutex); dine(); } ponder(); } } void Philosopher::dine() { Message(name + " started eating."); thread_local std::array<const char*, 3> foods {"chicken", "rice", "soda"}; thread_local std::array<const char*, 3> reactions { "I like this %s!", "This %s is good.", "Mmm, %s..." }; thread_local std::uniform_int_distribution<> dist(1, 6); std::shuffle( foods.begin(), foods.end(), rng); std::shuffle(reactions.begin(), reactions.end(), rng); constexpr size_t buf_size = 64; char buffer[buf_size]; for(int i = 0; i < 3; ++i) { std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng) * timeScale)); snprintf(buffer, buf_size, reactions[i], foods[i]); Message(name + ": " + buffer); } std::this_thread::sleep_for(std::chrono::milliseconds(dist(rng)) * timeScale); Message(name + " finished and left."); } void Philosopher::ponder() { static constexpr std::array<const char*, 5> topics {{ "politics", "art", "meaning of life", "source of morality", "how many straws makes a bale" }}; thread_local std::uniform_int_distribution<> wait(1, 6); thread_local std::uniform_int_distribution<> dist(0, topics.size() - 1); while(dist(rng) > 0) { std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is pondering about " + topics[dist(rng)] + "."); } std::this_thread::sleep_for(std::chrono::milliseconds(wait(rng) * 3 * timeScale)); Message(name + " is hungry again!"); } int main() { Dinner dinner; Message("Dinner started!"); std::array<Philosopher, 5> philosophers {{ {"Aristotle", dinner.forks[0], dinner.forks[1]}, {"Democritus", dinner.forks[1], dinner.forks[2]}, {"Plato", dinner.forks[2], dinner.forks[3]}, {"Pythagoras", dinner.forks[3], dinner.forks[4]}, {"Socrates", dinner.forks[4], dinner.forks[0]}, }}; Message("It is dark outside..."); }
Public Const HOLDON = False Public Const DIJKSTRASOLUTION = True Public Const X = 10 Public Const GETS = 0 Public Const PUTS = 1 Public Const EATS = 2 Public Const THKS = 5 Public Const FRSTFORK = 0 Public Const SCNDFORK = 1 Public Const SPAGHETI = 0 Public Const UNIVERSE = 1 Public Const MAXCOUNT = 100000 Public Const PHILOSOPHERS = 5 Public semaphore(PHILOSOPHERS - 1) As Integer Public positi0n(1, PHILOSOPHERS - 1) As Integer Public programcounter(PHILOSOPHERS - 1) As Long Public statistics(PHILOSOPHERS - 1, 5, 1) As Long Public names As Variant Private Sub init() names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}] For j = 0 To PHILOSOPHERS - 2 positi0n(0, j) = j + 1 positi0n(1, j) = j Next j If DIJKSTRASOLUTION Then positi0n(0, PHILOSOPHERS - 1) = j positi0n(1, PHILOSOPHERS - 1) = 0 Else positi0n(0, PHILOSOPHERS - 1) = 0 positi0n(1, PHILOSOPHERS - 1) = j End If End Sub Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer) statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1 If verb < 2 Then If semaphore(positi0n(objekt, subject)) <> verb Then If Not HOLDON Then semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt programcounter(subject) = 0 End If Else semaphore(positi0n(objekt, subject)) = 1 - verb programcounter(subject) = (programcounter(subject) + 1) Mod 6 End If Else programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6 End If End Sub Private Sub dine() Dim ph As Integer Do While TC < MAXCOUNT For ph = 0 To PHILOSOPHERS - 1 Select Case programcounter(ph) Case 0: philosopher ph, GETS, FRSTFORK Case 1: philosopher ph, GETS, SCNDFORK Case 2: philosopher ph, EATS, SPAGHETI Case 3: philosopher ph, PUTS, FRSTFORK Case 4: philosopher ph, PUTS, SCNDFORK Case 5: philosopher ph, THKS, UNIVERSE End Select TC = TC + 1 Next ph Loop End Sub Private Sub show() Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks" Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About" Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe" For subject = 0 To PHILOSOPHERS - 1 Debug.Print names(subject + 1), For objekt = 0 To 1 Debug.Print statistics(subject, GETS, objekt), Next objekt Debug.Print statistics(subject, EATS, SPAGHETI), For objekt = 0 To 1 Debug.Print statistics(subject, PUTS, objekt), Next objekt Debug.Print statistics(subject, THKS, UNIVERSE) Next subject End Sub Public Sub main() init dine show End Sub
Convert this C++ snippet to VB and keep its semantics consistent.
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
Convert the following code from C++ to VB, ensuring the logic remains intact.
#include <iostream> class factorion_t { public: factorion_t() { f[0] = 1u; for (uint n = 1u; n < 12u; n++) f[n] = f[n - 1] * n; } bool operator()(uint i, uint b) const { uint sum = 0; for (uint j = i; j > 0u; j /= b) sum += f[j % b]; return sum == i; } private: ulong f[12]; }; int main() { factorion_t factorion; for (uint b = 9u; b <= 12u; ++b) { std::cout << "factorions for base " << b << ':'; for (uint i = 1u; i < 1500000u; ++i) if (factorion(i, b)) std::cout << ' ' << i; std::cout << std::endl; } return 0; }
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
Preserve the algorithm and functionality while converting the code from C++ to VB.
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Ensure the translated VB code behaves exactly like the original C++ snippet.
#include <algorithm> #include <cctype> #include <iostream> #include <sstream> #include <string> #include <vector> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; class command { public: command(const std::string&, size_t); const std::string& cmd() const { return cmd_; } size_t min_length() const { return min_len_; } bool match(const std::string&) const; private: std::string cmd_; size_t min_len_; }; command::command(const std::string& cmd, size_t min_len) : cmd_(cmd), min_len_(min_len) {} bool command::match(const std::string& str) const { size_t olen = str.length(); return olen >= min_len_ && olen <= cmd_.length() && cmd_.compare(0, olen, str) == 0; } void uppercase(std::string& str) { std::transform(str.begin(), str.end(), str.begin(), [](unsigned char c) -> unsigned char { return std::toupper(c); }); } size_t get_min_length(const std::string& str) { size_t len = 0, n = str.length(); while (len < n && std::isupper(static_cast<unsigned char>(str[len]))) ++len; return len; } class command_list { public: explicit command_list(const char*); const command* find_command(const std::string&) const; private: std::vector<command> commands_; }; command_list::command_list(const char* table) { std::vector<command> commands; std::istringstream is(table); std::string word; while (is >> word) { size_t len = get_min_length(word); uppercase(word); commands_.push_back(command(word, len)); } } const command* command_list::find_command(const std::string& word) const { auto iter = std::find_if(commands_.begin(), commands_.end(), [&word](const command& cmd) { return cmd.match(word); }); return (iter != commands_.end()) ? &*iter : nullptr; } std::string test(const command_list& commands, const std::string& input) { std::string output; std::istringstream is(input); std::string word; while (is >> word) { if (!output.empty()) output += ' '; uppercase(word); const command* cmd_ptr = commands.find_command(word); if (cmd_ptr) output += cmd_ptr->cmd(); else output += "*error*"; } return output; } int main() { command_list commands(command_table); std::string input("riG rePEAT copies put mo rest types fup. 6 poweRin"); std::string output(test(commands, input)); std::cout << " input: " << input << '\n'; std::cout << "output: " << output << '\n'; return 0; }
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
Write the same code in VB as shown below in C++.
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
Produce a language-to-language conversion: from C++ to VB, same semantics.
#include <iostream> #include <algorithm> #include <vector> #include <bitset> #include <string> class bacon { public: bacon() { int x = 0; for( ; x < 9; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 20; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); bAlphabet.push_back( bAlphabet.back() ); for( ; x < 24; x++ ) bAlphabet.push_back( std::bitset<5>( x ).to_string() ); } std::string encode( std::string txt ) { std::string r; size_t z; for( std::string::iterator i = txt.begin(); i != txt.end(); i++ ) { z = toupper( *i ); if( z < 'A' || z > 'Z' ) continue; r.append( bAlphabet.at( ( *i & 31 ) - 1 ) ); } return r; } std::string decode( std::string txt ) { size_t len = txt.length(); while( len % 5 != 0 ) len--; if( len != txt.length() ) txt = txt.substr( 0, len ); std::string r; for( size_t i = 0; i < len; i += 5 ) { r.append( 1, 'A' + std::distance( bAlphabet.begin(), std::find( bAlphabet.begin(), bAlphabet.end(), txt.substr( i, 5 ) ) ) ); } return r; } private: std::vector<std::string> bAlphabet; };
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
Write the same code in VB as shown below in C++.
#include <vector> #include <memory> #include <cmath> #include <iostream> #include <iomanip> using namespace std; typedef vector< int > IntRow; typedef vector< IntRow > IntTable; auto_ptr< IntTable > getSpiralArray( int dimension ) { auto_ptr< IntTable > spiralArrayPtr( new IntTable( dimension, IntRow( dimension ) ) ); int numConcentricSquares = static_cast< int >( ceil( static_cast< double >( dimension ) / 2.0 ) ); int j; int sideLen = dimension; int currNum = 0; for ( int i = 0; i < numConcentricSquares; i++ ) { for ( j = 0; j < sideLen; j++ ) ( *spiralArrayPtr )[ i ][ i + j ] = currNum++; for ( j = 1; j < sideLen; j++ ) ( *spiralArrayPtr )[ i + j ][ dimension - 1 - i ] = currNum++; for ( j = sideLen - 2; j > -1; j-- ) ( *spiralArrayPtr )[ dimension - 1 - i ][ i + j ] = currNum++; for ( j = sideLen - 2; j > 0; j-- ) ( *spiralArrayPtr )[ i + j ][ i ] = currNum++; sideLen -= 2; } return spiralArrayPtr; } void printSpiralArray( const auto_ptr< IntTable >& spiralArrayPtr ) { size_t dimension = spiralArrayPtr->size(); int fieldWidth = static_cast< int >( floor( log10( static_cast< double >( dimension * dimension - 1 ) ) ) ) + 2; size_t col; for ( size_t row = 0; row < dimension; row++ ) { for ( col = 0; col < dimension; col++ ) cout << setw( fieldWidth ) << ( *spiralArrayPtr )[ row ][ col ]; cout << endl; } } int main() { printSpiralArray( getSpiralArray( 5 ) ); }
Function build_spiral(n) botcol = 0 : topcol = n - 1 botrow = 0 : toprow = n - 1 Dim matrix() ReDim matrix(topcol,toprow) dir = 0 : col = 0 : row = 0 For i = 0 To n*n-1 matrix(col,row) = i Select Case dir Case 0 If col < topcol Then col = col + 1 Else dir = 1 : row = row + 1 : botrow = botrow + 1 End If Case 1 If row < toprow Then row = row + 1 Else dir = 2 : col = col - 1 : topcol = topcol - 1 End If Case 2 If col > botcol Then col = col - 1 Else dir = 3 : row = row - 1 : toprow = toprow - 1 End If Case 3 If row > botrow Then row = row - 1 Else dir = 0 : col = col + 1 : botcol = botcol + 1 End If End Select Next For y = 0 To n-1 For x = 0 To n-1 WScript.StdOut.Write matrix(x,y) & vbTab Next WScript.StdOut.WriteLine Next End Function build_spiral(CInt(WScript.Arguments(0)))
Port the provided C++ code into VB while preserving the original functionality.
#include <vector> #include <algorithm> #include <string> template <class T> struct sort_table_functor { typedef bool (*CompFun)(const T &, const T &); const CompFun ordering; const int column; const bool reverse; sort_table_functor(CompFun o, int c, bool r) : ordering(o), column(c), reverse(r) { } bool operator()(const std::vector<T> &x, const std::vector<T> &y) const { const T &a = x[column], &b = y[column]; return reverse ? ordering(b, a) : ordering(a, b); } }; template <class T> bool myLess(const T &x, const T &y) { return x < y; } template <class T> void sort_table(std::vector<std::vector<T> > &table, int column = 0, bool reverse = false, bool (*ordering)(const T &, const T &) = myLess) { std::sort(table.begin(), table.end(), sort_table_functor<T>(ordering, column, reverse)); } #include <iostream> template <class T> void print_matrix(std::vector<std::vector<T> > &data) { for () { for (int j = 0; j < 3; j++) std::cout << data[i][j] << "\t"; std::cout << std::endl; } } bool desc_len_comparator(const std::string &x, const std::string &y) { return x.length() > y.length(); } int main() { std::string data_array[3][3] = { {"a", "b", "c"}, {"", "q", "z"}, {"zap", "zip", "Zot"} }; std::vector<std::vector<std::string> > data_orig; for (int i = 0; i < 3; i++) { std::vector<std::string> row; for (int j = 0; j < 3; j++) row.push_back(data_array[i][j]); data_orig.push_back(row); } print_matrix(data_orig); std::vector<std::vector<std::string> > data = data_orig; sort_table(data); print_matrix(data); data = data_orig; sort_table(data, 2); print_matrix(data); data = data_orig; sort_table(data, 1); print_matrix(data); data = data_orig; sort_table(data, 1, true); print_matrix(data); data = data_orig; sort_table(data, 0, false, desc_len_comparator); print_matrix(data); return 0; }
Private Sub optional_parameters(theRange As String, _ Optional ordering As Integer = 0, _ Optional column As Integer = 1, _ Optional reverse As Integer = 1) ActiveSheet.Sort.SortFields.Clear ActiveSheet.Sort.SortFields.Add _ Key:=Range(theRange).Columns(column), _ SortOn:=SortOnValues, _ Order:=reverse, _ DataOption:=ordering With ActiveSheet.Sort .SetRange Range(theRange) .Header = xlGuess .MatchCase = False .Orientation = xlTopToBottom .SortMethod = xlPinYin .Apply End With End Sub Public Sub main() optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1 End Sub
Rewrite this program in VB while keeping its functionality equivalent to the C++ version.
FUNCTION MULTIPLY(X, Y) DOUBLE PRECISION MULTIPLY, X, Y
Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _ CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _ overlapped As Ptr) As Boolean Declare Function GetLastError Lib "Kernel32" () As Integer Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean Const FILE_SHARE_READ = &h00000001 Const FILE_SHARE_WRITE = &h00000002 Const OPEN_EXISTING = 3 Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0) If fHandle > 0 Then Dim mb As MemoryBlock = "Hello, World!" Dim bytesWritten As Integer If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then MsgBox("Error Number: " + Str(GetLastError)) End If Call CloseHandle(fHandle) Else MsgBox("Error Number: " + Str(GetLastError)) End If
Convert this C++ block to VB, preserving its control flow and logic.
FUNCTION MULTIPLY(X, Y) DOUBLE PRECISION MULTIPLY, X, Y
Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _ CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _ overlapped As Ptr) As Boolean Declare Function GetLastError Lib "Kernel32" () As Integer Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean Const FILE_SHARE_READ = &h00000001 Const FILE_SHARE_WRITE = &h00000002 Const OPEN_EXISTING = 3 Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0) If fHandle > 0 Then Dim mb As MemoryBlock = "Hello, World!" Dim bytesWritten As Integer If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then MsgBox("Error Number: " + Str(GetLastError)) End If Call CloseHandle(fHandle) Else MsgBox("Error Number: " + Str(GetLastError)) End If
Translate the given C++ code snippet into VB without altering its behavior.
#include <exception> #include <iomanip> #include <iostream> #include <numeric> #include <sstream> #include <vector> class Frac { public: Frac() : num(0), denom(1) {} Frac(int n, int d) { if (d == 0) { throw std::runtime_error("d must not be zero"); } int sign_of_d = d < 0 ? -1 : 1; int g = std::gcd(n, d); num = sign_of_d * n / g; denom = sign_of_d * d / g; } Frac operator-() const { return Frac(-num, denom); } Frac operator+(const Frac& rhs) const { return Frac(num*rhs.denom + denom * rhs.num, rhs.denom*denom); } Frac operator-(const Frac& rhs) const { return Frac(num*rhs.denom - denom * rhs.num, rhs.denom*denom); } Frac operator*(const Frac& rhs) const { return Frac(num*rhs.num, denom*rhs.denom); } Frac operator*(int rhs) const { return Frac(num * rhs, denom); } friend std::ostream& operator<<(std::ostream&, const Frac&); private: int num; int denom; }; std::ostream & operator<<(std::ostream & os, const Frac &f) { if (f.num == 0 || f.denom == 1) { return os << f.num; } std::stringstream ss; ss << f.num << "/" << f.denom; return os << ss.str(); } Frac bernoulli(int n) { if (n < 0) { throw std::runtime_error("n may not be negative or zero"); } std::vector<Frac> a; for (int m = 0; m <= n; m++) { a.push_back(Frac(1, m + 1)); for (int j = m; j >= 1; j--) { a[j - 1] = (a[j - 1] - a[j]) * j; } } if (n != 1) return a[0]; return -a[0]; } int binomial(int n, int k) { if (n < 0 || k < 0 || n < k) { throw std::runtime_error("parameters are invalid"); } if (n == 0 || k == 0) return 1; int num = 1; for (int i = k + 1; i <= n; i++) { num *= i; } int denom = 1; for (int i = 2; i <= n - k; i++) { denom *= i; } return num / denom; } std::vector<Frac> faulhaberTraingle(int p) { std::vector<Frac> coeffs(p + 1); Frac q{ 1, p + 1 }; int sign = -1; for (int j = 0; j <= p; j++) { sign *= -1; coeffs[p - j] = q * sign * binomial(p + 1, j) * bernoulli(j); } return coeffs; } int main() { for (int i = 0; i < 10; i++) { std::vector<Frac> coeffs = faulhaberTraingle(i); for (auto frac : coeffs) { std::cout << std::right << std::setw(5) << frac << " "; } std::cout << std::endl; } return 0; }
Module Module1 Class Frac Private ReadOnly num As Long Private ReadOnly denom As Long Public Shared ReadOnly ZERO = New Frac(0, 1) Public Shared ReadOnly ONE = New Frac(1, 1) Public Sub New(n As Long, d As Long) If d = 0 Then Throw New ArgumentException("d must not be zero") End If Dim nn = n Dim dd = d If nn = 0 Then dd = 1 ElseIf dd < 0 Then nn = -nn dd = -dd End If Dim g = Math.Abs(Gcd(nn, dd)) If g > 1 Then nn /= g dd /= g End If num = nn denom = dd End Sub Private Shared Function Gcd(a As Long, b As Long) As Long If b = 0 Then Return a Else Return Gcd(b, a Mod b) End If End Function Public Shared Operator -(self As Frac) As Frac Return New Frac(-self.num, self.denom) End Operator Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom) End Operator Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac Return lhs + -rhs End Operator Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom) End Operator Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x < y End Operator Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x > y End Operator Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom End Operator Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom End Operator Public Overrides Function ToString() As String If denom = 1 Then Return num.ToString Else Return String.Format("{0}/{1}", num, denom) End If End Function Public Overrides Function Equals(obj As Object) As Boolean Dim frac = CType(obj, Frac) Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom End Function End Class Function Bernoulli(n As Integer) As Frac If n < 0 Then Throw New ArgumentException("n may not be negative or zero") End If Dim a(n + 1) As Frac For m = 0 To n a(m) = New Frac(1, m + 1) For j = m To 1 Step -1 a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1) Next Next If n <> 1 Then Return a(0) Else Return -a(0) End If End Function Function Binomial(n As Integer, k As Integer) As Integer If n < 0 OrElse k < 0 OrElse n < k Then Throw New ArgumentException() End If If n = 0 OrElse k = 0 Then Return 1 End If Dim num = 1 For i = k + 1 To n num *= i Next Dim denom = 1 For i = 2 To n - k denom *= i Next Return num \ denom End Function Function FaulhaberTriangle(p As Integer) As Frac() Dim coeffs(p + 1) As Frac For i = 1 To p + 1 coeffs(i - 1) = Frac.ZERO Next Dim q As New Frac(1, p + 1) Dim sign = -1 For j = 0 To p sign *= -1 coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j) Next Return coeffs End Function Sub Main() For i = 1 To 10 Dim coeffs = FaulhaberTriangle(i - 1) For Each coeff In coeffs Console.Write("{0,5} ", coeff) Next Console.WriteLine() Next End Sub End Module
Change the programming language of this snippet from C++ to VB without modifying what it does.
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
Translate the given C++ code snippet into VB without altering its behavior.
#include <iostream> int main(int argc, char* argv[]) { std::cout << "This program is named " << argv[0] << std::endl; std::cout << "There are " << argc-1 << " arguments given." << std::endl; for (int i = 1; i < argc; ++i) std::cout << "the argument #" << i << " is " << argv[i] << std::endl; return 0; }
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
Can you help me rewrite this code in VB instead of C++, keeping it the same logically?
#include <array> #include <iostream> #include <fstream> #include <map> #include <string> #include <vector> #include <boost/program_options.hpp> class letterset { public: letterset() { count_.fill(0); } explicit letterset(const std::string& str) { count_.fill(0); for (char c : str) add(c); } bool contains(const letterset& set) const { for (size_t i = 0; i < count_.size(); ++i) { if (set.count_[i] > count_[i]) return false; } return true; } unsigned int count(char c) const { return count_[index(c)]; } bool is_valid() const { return count_[0] == 0; } void add(char c) { ++count_[index(c)]; } private: static bool is_letter(char c) { return c >= 'a' && c <= 'z'; } static int index(char c) { return is_letter(c) ? c - 'a' + 1 : 0; } std::array<unsigned int, 27> count_; }; template <typename iterator, typename separator> std::string join(iterator begin, iterator end, separator sep) { std::string result; if (begin != end) { result += *begin++; for (; begin != end; ++begin) { result += sep; result += *begin; } } return result; } using dictionary = std::vector<std::pair<std::string, letterset>>; dictionary load_dictionary(const std::string& filename, int min_length, int max_length) { std::ifstream in(filename); if (!in) throw std::runtime_error("Cannot open file " + filename); std::string word; dictionary result; while (getline(in, word)) { if (word.size() < min_length) continue; if (word.size() > max_length) continue; letterset set(word); if (set.is_valid()) result.emplace_back(word, set); } return result; } void word_wheel(const dictionary& dict, const std::string& letters, char central_letter) { letterset set(letters); if (central_letter == 0 && !letters.empty()) central_letter = letters.at(letters.size()/2); std::map<size_t, std::vector<std::string>> words; for (const auto& pair : dict) { const auto& word = pair.first; const auto& subset = pair.second; if (subset.count(central_letter) > 0 && set.contains(subset)) words[word.size()].push_back(word); } size_t total = 0; for (const auto& p : words) { const auto& v = p.second; auto n = v.size(); total += n; std::cout << "Found " << n << " " << (n == 1 ? "word" : "words") << " of length " << p.first << ": " << join(v.begin(), v.end(), ", ") << '\n'; } std::cout << "Number of words found: " << total << '\n'; } void find_max_word_count(const dictionary& dict, int word_length) { size_t max_count = 0; std::vector<std::pair<std::string, char>> max_words; for (const auto& pair : dict) { const auto& word = pair.first; if (word.size() != word_length) continue; const auto& set = pair.second; dictionary subsets; for (const auto& p : dict) { if (set.contains(p.second)) subsets.push_back(p); } letterset done; for (size_t index = 0; index < word_length; ++index) { char central_letter = word[index]; if (done.count(central_letter) > 0) continue; done.add(central_letter); size_t count = 0; for (const auto& p : subsets) { const auto& subset = p.second; if (subset.count(central_letter) > 0) ++count; } if (count > max_count) { max_words.clear(); max_count = count; } if (count == max_count) max_words.emplace_back(word, central_letter); } } std::cout << "Maximum word count: " << max_count << '\n'; std::cout << "Words of " << word_length << " letters producing this count:\n"; for (const auto& pair : max_words) std::cout << pair.first << " with central letter " << pair.second << '\n'; } constexpr const char* option_filename = "filename"; constexpr const char* option_wheel = "wheel"; constexpr const char* option_central = "central"; constexpr const char* option_min_length = "min-length"; constexpr const char* option_part2 = "part2"; int main(int argc, char** argv) { const int word_length = 9; int min_length = 3; std::string letters = "ndeokgelw"; std::string filename = "unixdict.txt"; char central_letter = 0; bool do_part2 = false; namespace po = boost::program_options; po::options_description desc("Allowed options"); desc.add_options() (option_filename, po::value<std::string>(), "name of dictionary file") (option_wheel, po::value<std::string>(), "word wheel letters") (option_central, po::value<char>(), "central letter (defaults to middle letter of word)") (option_min_length, po::value<int>(), "minimum word length") (option_part2, "include part 2"); try { po::variables_map vm; po::store(po::parse_command_line(argc, argv, desc), vm); po::notify(vm); if (vm.count(option_filename)) filename = vm[option_filename].as<std::string>(); if (vm.count(option_wheel)) letters = vm[option_wheel].as<std::string>(); if (vm.count(option_central)) central_letter = vm[option_central].as<char>(); if (vm.count(option_min_length)) min_length = vm[option_min_length].as<int>(); if (vm.count(option_part2)) do_part2 = true; auto dict = load_dictionary(filename, min_length, word_length); word_wheel(dict, letters, central_letter); if (do_part2) { std::cout << '\n'; find_max_word_count(dict, word_length); } } catch (const std::exception& ex) { std::cerr << ex.what() << '\n'; return EXIT_FAILURE; } return EXIT_SUCCESS; }
Const wheel="ndeokgelw" Sub print(s): On Error Resume Next WScript.stdout.WriteLine (s) If err= &h80070006& Then WScript.Echo " Please run this script with CScript": WScript.quit End Sub Dim oDic Set oDic = WScript.CreateObject("scripting.dictionary") Dim cnt(127) Dim fso Set fso = WScript.CreateObject("Scripting.Filesystemobject") Set ff=fso.OpenTextFile("unixdict.txt") i=0 print "reading words of 3 or more letters" While Not ff.AtEndOfStream x=LCase(ff.ReadLine) If Len(x)>=3 Then If Not odic.exists(x) Then oDic.Add x,0 End If Wend print "remaining words: "& oDic.Count & vbcrlf ff.Close Set ff=Nothing Set fso=Nothing Set re=New RegExp print "removing words with chars not in the wheel" re.pattern="[^"& wheel &"]" For Each w In oDic.Keys If re.test(w) Then oDic.remove(w) Next print "remaining words: "& oDic.Count & vbcrlf print "ensuring the mandatory letter "& Mid(wheel,5,1) & " is present" re.Pattern=Mid(wheel,5,1) For Each w In oDic.Keys If Not re.test(w) Then oDic.remove(w) Next print "remaining words: "& oDic.Count & vbcrlf print "checking number of chars" Dim nDic Set nDic = WScript.CreateObject("scripting.dictionary") For i=1 To Len(wheel) x=Mid(wheel,i,1) If nDic.Exists(x) Then a=nDic(x) nDic(x)=Array(a(0)+1,0) Else nDic.add x,Array(1,0) End If Next For Each w In oDic.Keys For Each c In nDic.Keys ndic(c)=Array(nDic(c)(0),0) Next For ii = 1 To len(w) c=Mid(w,ii,1) a=nDic(c) If (a(0)=a(1)) Then oDic.Remove(w):Exit For End If nDic(c)=Array(a(0),a(1)+1) Next Next print "Remaining words "& oDic.count For Each w In oDic.Keys print w Next
Change the programming language of this snippet from C++ to VB without modifying what it does.
#include <vector> #include <iostream> int main() { std::vector<int> a(3), b(4); a[0] = 11; a[1] = 12; a[2] = 13; b[0] = 21; b[1] = 22; b[2] = 23; b[3] = 24; a.insert(a.end(), b.begin(), b.end()); for (int i = 0; i < a.size(); ++i) std::cout << "a[" << i << "] = " << a[i] << "\n"; }
DEFINT A(1 to 4) = {1, 2, 3, 4} DEFINT B(1 to 4) = {10, 20, 30, 40} Redim A(1 to 8) as integer MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
Produce a functionally identical VB code for the snippet given in C++.
#include <iostream> #include <string> using namespace std; int main() { long int integer_input; string string_input; cout << "Enter an integer: "; cin >> integer_input; cout << "Enter a string: "; cin >> string_input; return 0; }
Public Sub text() Debug.Print InputBox("Input a string") Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long") End Sub
Produce a functionally identical VB code for the snippet given in C++.
#include <iostream> #include <string> using namespace std; int main() { long int integer_input; string string_input; cout << "Enter an integer: "; cin >> integer_input; cout << "Enter a string: "; cin >> string_input; return 0; }
Public Sub text() Debug.Print InputBox("Input a string") Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long") End Sub
Translate the given C++ code snippet into VB without altering its behavior.
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
Option Explicit Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long Sub Musical_Scale() Dim Fqs, i As Integer Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528) For i = LBound(Fqs) To UBound(Fqs) Beep Fqs(i), 500 Next End Sub
Produce a language-to-language conversion: from C++ to VB, same semantics.
#include <iostream> #include <windows.h> #include <mmsystem.h> #pragma comment ( lib, "winmm.lib" ) typedef unsigned char byte; typedef union { unsigned long word; unsigned char data[4]; } midi_msg; class midi { public: midi() { if( midiOutOpen( &device, 0, 0, 0, CALLBACK_NULL) != MMSYSERR_NOERROR ) { std::cout << "Error opening MIDI Output..." << std::endl; device = 0; } } ~midi() { midiOutReset( device ); midiOutClose( device ); } bool isOpen() { return device != 0; } void setInstrument( byte i ) { message.data[0] = 0xc0; message.data[1] = i; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void playNote( byte n, unsigned i ) { playNote( n ); Sleep( i ); stopNote( n ); } private: void playNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 127; message.data[3] = 0; midiOutShortMsg( device, message.word ); } void stopNote( byte n ) { message.data[0] = 0x90; message.data[1] = n; message.data[2] = 0; message.data[3] = 0; midiOutShortMsg( device, message.word ); } HMIDIOUT device; midi_msg message; }; int main( int argc, char* argv[] ) { midi m; if( m.isOpen() ) { byte notes[] = { 60, 62, 64, 65, 67, 69, 71, 72 }; m.setInstrument( 42 ); for( int x = 0; x < 8; x++ ) m.playNote( notes[x], rand() % 100 + 158 ); Sleep( 1000 ); } return 0; }
Option Explicit Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long Sub Musical_Scale() Dim Fqs, i As Integer Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528) For i = LBound(Fqs) To UBound(Fqs) Beep Fqs(i), 500 Next End Sub
Write the same code in VB as shown below in C++.
#include <vector> #include <string> #include <iostream> #include <boost/tuple/tuple.hpp> #include <set> int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & , std::set<int> & , const int ) ; int main( ) { std::vector<boost::tuple<std::string , int , int> > items ; items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ; items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ; items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ; items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ; items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ; items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ; items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ; items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ; items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ; items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ; items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ; items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ; items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ; items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ; items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ; items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ; items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ; items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ; items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ; items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ; items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ; items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ; items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ; const int maximumWeight = 400 ; std::set<int> bestItems ; int bestValue = findBestPack( items , bestItems , maximumWeight ) ; std::cout << "The best value that can be packed in the given knapsack is " << bestValue << " !\n" ; int totalweight = 0 ; std::cout << "The following items should be packed in the knapsack:\n" ; for ( std::set<int>::const_iterator si = bestItems.begin( ) ; si != bestItems.end( ) ; si++ ) { std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ; totalweight += (items.begin( ) + *si)->get<1>( ) ; } std::cout << "The total weight of all items is " << totalweight << " !\n" ; return 0 ; } int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) { const int n = items.size( ) ; int bestValues [ n ][ weightlimit ] ; std::set<int> solutionSets[ n ][ weightlimit ] ; std::set<int> emptyset ; for ( int i = 0 ; i < n ; i++ ) { for ( int j = 0 ; j < weightlimit ; j++ ) { bestValues[ i ][ j ] = 0 ; solutionSets[ i ][ j ] = emptyset ; } } for ( int i = 0 ; i < n ; i++ ) { for ( int weight = 0 ; weight < weightlimit ; weight++ ) { if ( i == 0 ) bestValues[ i ][ weight ] = 0 ; else { int itemweight = (items.begin( ) + i)->get<1>( ) ; if ( weight < itemweight ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } else { if ( bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) > bestValues[ i - 1 ][ weight ] ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight - itemweight ] ; solutionSets[ i ][ weight ].insert( i ) ; } else { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } } } } } bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ; return bestValues[ n - 1 ][ weightlimit - 1 ] ; }
Option Explicit Const maxWeight = 400 Dim DataList As Variant Dim xList(64, 3) As Variant Dim nItems As Integer Dim s As String, xss As String Dim xwei As Integer, xval As Integer, nn As Integer Sub Main() Dim i As Integer, j As Integer DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _ "glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _ "cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _ "T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _ "waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _ "note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50) nItems = (UBound(DataList) + 1) / 3 j = 0 For i = 1 To nItems xList(i, 1) = DataList(j) xList(i, 2) = DataList(j + 1) xList(i, 3) = DataList(j + 2) j = j + 3 Next i s = "" For i = 1 To nItems s = s & Chr(i) Next nn = 0 Call ChoiceBin(1, "") For i = 1 To Len(xss) j = Asc(Mid(xss, i, 1)) Debug.Print xList(j, 1) Next i Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval End Sub Private Sub ChoiceBin(n As String, ss As String) Dim r As String Dim i As Integer, j As Integer, iwei As Integer, ival As Integer Dim ipct As Integer If n = Len(s) + 1 Then iwei = 0: ival = 0 For i = 1 To Len(ss) j = Asc(Mid(ss, i, 1)) iwei = iwei + xList(j, 2) ival = ival + xList(j, 3) Next If iwei <= maxWeight And ival > xval Then xss = ss: xwei = iwei: xval = ival End If Else r = Mid(s, n, 1) Call ChoiceBin(n + 1, ss & r) Call ChoiceBin(n + 1, ss) End If End Sub
Rewrite this program in VB while keeping its functionality equivalent to the C++ version.
#include <vector> #include <string> #include <iostream> #include <boost/tuple/tuple.hpp> #include <set> int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & , std::set<int> & , const int ) ; int main( ) { std::vector<boost::tuple<std::string , int , int> > items ; items.push_back( boost::make_tuple( "" , 0 , 0 ) ) ; items.push_back( boost::make_tuple( "map" , 9 , 150 ) ) ; items.push_back( boost::make_tuple( "compass" , 13 , 35 ) ) ; items.push_back( boost::make_tuple( "water" , 153 , 200 ) ) ; items.push_back( boost::make_tuple( "sandwich", 50 , 160 ) ) ; items.push_back( boost::make_tuple( "glucose" , 15 , 60 ) ) ; items.push_back( boost::make_tuple( "tin", 68 , 45 ) ) ; items.push_back( boost::make_tuple( "banana", 27 , 60 ) ) ; items.push_back( boost::make_tuple( "apple" , 39 , 40 ) ) ; items.push_back( boost::make_tuple( "cheese" , 23 , 30 ) ) ; items.push_back( boost::make_tuple( "beer" , 52 , 10 ) ) ; items.push_back( boost::make_tuple( "suntan creme" , 11 , 70 ) ) ; items.push_back( boost::make_tuple( "camera" , 32 , 30 ) ) ; items.push_back( boost::make_tuple( "T-shirt" , 24 , 15 ) ) ; items.push_back( boost::make_tuple( "trousers" , 48 , 10 ) ) ; items.push_back( boost::make_tuple( "umbrella" , 73 , 40 ) ) ; items.push_back( boost::make_tuple( "waterproof trousers" , 42 , 70 ) ) ; items.push_back( boost::make_tuple( "waterproof overclothes" , 43 , 75 ) ) ; items.push_back( boost::make_tuple( "note-case" , 22 , 80 ) ) ; items.push_back( boost::make_tuple( "sunglasses" , 7 , 20 ) ) ; items.push_back( boost::make_tuple( "towel" , 18 , 12 ) ) ; items.push_back( boost::make_tuple( "socks" , 4 , 50 ) ) ; items.push_back( boost::make_tuple( "book" , 30 , 10 ) ) ; const int maximumWeight = 400 ; std::set<int> bestItems ; int bestValue = findBestPack( items , bestItems , maximumWeight ) ; std::cout << "The best value that can be packed in the given knapsack is " << bestValue << " !\n" ; int totalweight = 0 ; std::cout << "The following items should be packed in the knapsack:\n" ; for ( std::set<int>::const_iterator si = bestItems.begin( ) ; si != bestItems.end( ) ; si++ ) { std::cout << (items.begin( ) + *si)->get<0>( ) << "\n" ; totalweight += (items.begin( ) + *si)->get<1>( ) ; } std::cout << "The total weight of all items is " << totalweight << " !\n" ; return 0 ; } int findBestPack( const std::vector<boost::tuple<std::string , int , int> > & items ,std::set<int> & bestItems , const int weightlimit ) { const int n = items.size( ) ; int bestValues [ n ][ weightlimit ] ; std::set<int> solutionSets[ n ][ weightlimit ] ; std::set<int> emptyset ; for ( int i = 0 ; i < n ; i++ ) { for ( int j = 0 ; j < weightlimit ; j++ ) { bestValues[ i ][ j ] = 0 ; solutionSets[ i ][ j ] = emptyset ; } } for ( int i = 0 ; i < n ; i++ ) { for ( int weight = 0 ; weight < weightlimit ; weight++ ) { if ( i == 0 ) bestValues[ i ][ weight ] = 0 ; else { int itemweight = (items.begin( ) + i)->get<1>( ) ; if ( weight < itemweight ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } else { if ( bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) > bestValues[ i - 1 ][ weight ] ) { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight - itemweight ] + (items.begin( ) + i)->get<2>( ) ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight - itemweight ] ; solutionSets[ i ][ weight ].insert( i ) ; } else { bestValues[ i ][ weight ] = bestValues[ i - 1 ][ weight ] ; solutionSets[ i ][ weight ] = solutionSets[ i - 1 ][ weight ] ; } } } } } bestItems.swap( solutionSets[ n - 1][ weightlimit - 1 ] ) ; return bestValues[ n - 1 ][ weightlimit - 1 ] ; }
Option Explicit Const maxWeight = 400 Dim DataList As Variant Dim xList(64, 3) As Variant Dim nItems As Integer Dim s As String, xss As String Dim xwei As Integer, xval As Integer, nn As Integer Sub Main() Dim i As Integer, j As Integer DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _ "glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _ "cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _ "T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _ "waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _ "note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50) nItems = (UBound(DataList) + 1) / 3 j = 0 For i = 1 To nItems xList(i, 1) = DataList(j) xList(i, 2) = DataList(j + 1) xList(i, 3) = DataList(j + 2) j = j + 3 Next i s = "" For i = 1 To nItems s = s & Chr(i) Next nn = 0 Call ChoiceBin(1, "") For i = 1 To Len(xss) j = Asc(Mid(xss, i, 1)) Debug.Print xList(j, 1) Next i Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval End Sub Private Sub ChoiceBin(n As String, ss As String) Dim r As String Dim i As Integer, j As Integer, iwei As Integer, ival As Integer Dim ipct As Integer If n = Len(s) + 1 Then iwei = 0: ival = 0 For i = 1 To Len(ss) j = Asc(Mid(ss, i, 1)) iwei = iwei + xList(j, 2) ival = ival + xList(j, 3) Next If iwei <= maxWeight And ival > xval Then xss = ss: xwei = iwei: xval = ival End If Else r = Mid(s, n, 1) Call ChoiceBin(n + 1, ss & r) Call ChoiceBin(n + 1, ss) End If End Sub
Keep all operations the same but rewrite the snippet in VB.
#include <algorithm> #include <iostream> #include <vector> typedef unsigned long long integer; std::vector<integer> get_ancestors(const std::vector<integer>& ancestor, integer n) { std::vector<integer> result; for (integer a = ancestor[n]; a != 0 && a != n; ) { n = a; a = ancestor[n]; result.push_back(n); } return result; } void print_vector(const std::vector<integer>& vec) { if (vec.empty()) { std::cout << "none\n"; return; } auto i = vec.begin(); std::cout << *i++; for (; i != vec.end(); ++i) std::cout << ", " << *i; std::cout << '\n'; } bool is_prime(integer n) { if (n < 2) return false; if (n % 2 == 0) return n == 2; for (integer p = 3; p * p <= n; p += 2) { if (n % p == 0) return false; } return true; } int main(int argc, char** argv) { const size_t limit = 100; std::vector<integer> ancestor(limit, 0); std::vector<std::vector<integer>> descendants(limit); for (size_t prime = 0; prime < limit; ++prime) { if (!is_prime(prime)) continue; descendants[prime].push_back(prime); for (size_t i = 0; i + prime < limit; ++i) { integer s = i + prime; for (integer n : descendants[i]) { integer prod = n * prime; descendants[s].push_back(prod); if (prod < limit) ancestor[prod] = s; } } } size_t total_descendants = 0; for (integer i = 1; i < limit; ++i) { std::vector<integer> ancestors(get_ancestors(ancestor, i)); std::cout << "[" << i << "] Level: " << ancestors.size() << '\n'; std::cout << "Ancestors: "; std::sort(ancestors.begin(), ancestors.end()); print_vector(ancestors); std::cout << "Descendants: "; std::vector<integer>& desc = descendants[i]; if (!desc.empty()) { std::sort(desc.begin(), desc.end()); if (desc[0] == i) desc.erase(desc.begin()); } std::cout << desc.size() << '\n'; total_descendants += desc.size(); if (!desc.empty()) print_vector(desc); std::cout << '\n'; } std::cout << "Total descendants: " << total_descendants << '\n'; return 0; }
Imports System.Math Module Module1 Const MAXPRIME = 99 Const MAXPARENT = 99 Const NBRCHILDREN = 547100 Public Primes As New Collection() Public PrimesR As New Collection() Public Ancestors As New Collection() Public Parents(MAXPARENT + 1) As Integer Public CptDescendants(MAXPARENT + 1) As Integer Public Children(NBRCHILDREN) As ChildStruct Public iChildren As Integer Public Delimiter As String = ", " Public Structure ChildStruct Public Child As Long Public pLower As Integer Public pHigher As Integer End Structure Sub Main() Dim Parent As Short Dim Sum As Short Dim i As Short Dim TotDesc As Integer = 0 Dim MidPrime As Integer If GetPrimes(Primes, MAXPRIME) = vbFalse Then Return End If For i = Primes.Count To 1 Step -1 PrimesR.Add(Primes.Item(i)) Next MidPrime = PrimesR.Item(1) / 2 For Each Prime In PrimesR Parents(Prime) = InsertChild(Parents(Prime), Prime) CptDescendants(Prime) += 1 If Prime > MidPrime Then Continue For End If For Parent = 1 To MAXPARENT Sum = Parent + Prime If Sum > MAXPARENT Then Exit For End If If Parents(Parent) Then InsertPreorder(Parents(Parent), Sum, Prime) CptDescendants(Sum) += CptDescendants(Parent) End If Next Next RemoveFalseChildren() If MAXPARENT > MAXPRIME Then If GetPrimes(Primes, MAXPARENT) = vbFalse Then Return End If End If FileOpen(1, "Ancestors.txt", OpenMode.Output) For Parent = 1 To MAXPARENT GetAncestors(Parent) PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString) If Ancestors.Count Then Print(1, "Ancestors: " & Ancestors.Item(1).ToString) For i = 2 To Ancestors.Count Print(1, ", " & Ancestors.Item(i).ToString) Next PrintLine(1) Ancestors.Clear() Else PrintLine(1, "Ancestors: None") End If If CptDescendants(Parent) Then PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString) Delimiter = "" PrintDescendants(Parents(Parent)) PrintLine(1) TotDesc += CptDescendants(Parent) Else PrintLine(1, "Descendants: None") End If PrintLine(1) Next Primes.Clear() PrimesR.Clear() PrintLine(1, "Total descendants " & TotDesc.ToString) PrintLine(1) FileClose(1) End Sub Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short) Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime) If Children(_index).pLower Then InsertPreorder(Children(_index).pLower, _sum, _prime) End If If Children(_index).pHigher Then InsertPreorder(Children(_index).pHigher, _sum, _prime) End If Return Nothing End Function Function InsertChild(_index As Integer, _child As Long) As Integer If _index Then If _child <= Children(_index).Child Then Children(_index).pLower = InsertChild(Children(_index).pLower, _child) Else Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child) End If Else iChildren += 1 _index = iChildren Children(_index).Child = _child Children(_index).pLower = 0 Children(_index).pHigher = 0 End If Return _index End Function Function RemoveFalseChildren() Dim Exclusions As New Collection Exclusions.Add(4) For Each Prime In Primes Exclusions.Add(Prime) Next For Each ex In Exclusions Parents(ex) = Children(Parents(ex)).pHigher CptDescendants(ex) -= 1 Next Exclusions.Clear() Return Nothing End Function Function GetAncestors(_child As Short) Dim Child As Short = _child Dim Parent As Short = 0 For Each Prime In Primes If Child = 1 Then Exit For End If While Child Mod Prime = 0 Child /= Prime Parent += Prime End While Next If Parent = _child Or _child = 1 Then Return Nothing End If GetAncestors(Parent) Ancestors.Add(Parent) Return Nothing End Function Function PrintDescendants(_index As Integer) If Children(_index).pLower Then PrintDescendants(Children(_index).pLower) End If Print(1, Delimiter.ToString & Children(_index).Child.ToString) Delimiter = ", " If Children(_index).pHigher Then PrintDescendants(Children(_index).pHigher) End If Return Nothing End Function Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean Dim Value As Integer = 3 Dim Max As Integer Dim Prime As Integer If _maxPrime < 2 Then Return vbFalse End If _primes.Add(2) While Value <= _maxPrime Max = Floor(Sqrt(Value)) For Each Prime In _primes If Prime > Max Then _primes.Add(Value) Exit For End If If Value Mod Prime = 0 Then Exit For End If Next Value += 2 End While Return vbTrue End Function End Module
Change the programming language of this snippet from C++ to VB without modifying what it does.
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
Rewrite the snippet below in VB so it works the same as the original C++ code.
#include <iostream> #include <vector> #include <algorithm> void print(const std::vector<std::vector<int>>& v) { std::cout << "{ "; for (const auto& p : v) { std::cout << "("; for (const auto& e : p) { std::cout << e << " "; } std::cout << ") "; } std::cout << "}" << std::endl; } auto product(const std::vector<std::vector<int>>& lists) { std::vector<std::vector<int>> result; if (std::find_if(std::begin(lists), std::end(lists), [](auto e) -> bool { return e.size() == 0; }) != std::end(lists)) { return result; } for (auto& e : lists[0]) { result.push_back({ e }); } for (size_t i = 1; i < lists.size(); ++i) { std::vector<std::vector<int>> temp; for (auto& e : result) { for (auto f : lists[i]) { auto e_tmp = e; e_tmp.push_back(f); temp.push_back(e_tmp); } } result = temp; } return result; } int main() { std::vector<std::vector<int>> prods[] = { { { 1, 2 }, { 3, 4 } }, { { 3, 4 }, { 1, 2} }, { { 1, 2 }, { } }, { { }, { 1, 2 } }, { { 1776, 1789 }, { 7, 12 }, { 4, 14, 23 }, { 0, 1 } }, { { 1, 2, 3 }, { 30 }, { 500, 100 } }, { { 1, 2, 3 }, { }, { 500, 100 } } }; for (const auto& p : prods) { print(product(p)); } std::cin.ignore(); std::cin.get(); return 0; }
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
Maintain the same structure and functionality when rewriting this code in VB.
#include <vector> #include <iostream> #include <algorithm> std::vector<int> properDivisors ( int number ) { std::vector<int> divisors ; for ( int i = 1 ; i < number / 2 + 1 ; i++ ) if ( number % i == 0 ) divisors.push_back( i ) ; return divisors ; } int main( ) { std::vector<int> divisors ; unsigned int maxdivisors = 0 ; int corresponding_number = 0 ; for ( int i = 1 ; i < 11 ; i++ ) { divisors = properDivisors ( i ) ; std::cout << "Proper divisors of " << i << ":\n" ; for ( int number : divisors ) { std::cout << number << " " ; } std::cout << std::endl ; divisors.clear( ) ; } for ( int i = 11 ; i < 20001 ; i++ ) { divisors = properDivisors ( i ) ; if ( divisors.size( ) > maxdivisors ) { maxdivisors = divisors.size( ) ; corresponding_number = i ; } divisors.clear( ) ; } std::cout << "Most divisors has " << corresponding_number << " , it has " << maxdivisors << " divisors!\n" ; return 0 ; }
dim _proper_divisors(100) sub proper_divisors(n) dim i dim _proper_divisors_count = 0 if n <> 1 then for i = 1 to (n \ 2) if n %% i = 0 then _proper_divisors_count = _proper_divisors_count + 1 _proper_divisors(_proper_divisors_count) = i end if next end if return _proper_divisors_count end sub sub show_proper_divisors(n, tabbed) dim cnt = proper_divisors(n) print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) "; dim j for j = 1 to cnt if tabbed then print str$(_proper_divisors(j)), else print str$(_proper_divisors(j)); end if if (j < cnt) then print ","; next print end sub dim i for i = 1 to 10 show_proper_divisors(i, false) next dim c dim maxindex = 0 dim maxlength = 0 for t = 1 to 20000 c = proper_divisors(t) if c > maxlength then maxindex = t maxlength = c end if next print "A maximum at "; show_proper_divisors(maxindex, false)
Port the following code from C++ to VB with equivalent syntax and logic.
#include <vector> #include <utility> #include <iostream> #include <boost/algorithm/string.hpp> std::string create_xml( std::vector<std::string> & ,std::vector<std::string> & ) ; int main( ) { std::vector<std::string> names , remarks ; names.push_back( "April" ) ; names.push_back( "Tam O'Shantor" ) ; names.push_back ( "Emily" ) ; remarks.push_back( "Bubbly, I'm > Tam and <= Emily" ) ; remarks.push_back( "Burns: \"When chapman billies leave the street ...\"" ) ; remarks.push_back( "Short & shrift" ) ; std::cout << "This is in XML:\n" ; std::cout << create_xml( names , remarks ) << std::endl ; return 0 ; } std::string create_xml( std::vector<std::string> & names , std::vector<std::string> & remarks ) { std::vector<std::pair<std::string , std::string> > entities ; entities.push_back( std::make_pair( "&" , "&amp;" ) ) ; entities.push_back( std::make_pair( "<" , "&lt;" ) ) ; entities.push_back( std::make_pair( ">" , "&gt;" ) ) ; std::string xmlstring ( "<CharacterRemarks>\n" ) ; std::vector<std::string>::iterator vsi = names.begin( ) ; typedef std::vector<std::pair<std::string , std::string> >::iterator Vpss ; for ( ; vsi != names.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( vsi = remarks.begin( ) ; vsi != remarks.end( ) ; vsi++ ) { for ( Vpss vs = entities.begin( ) ; vs != entities.end( ) ; vs++ ) { boost::replace_all ( *vsi , vs->first , vs->second ) ; } } for ( int i = 0 ; i < names.size( ) ; i++ ) { xmlstring.append( "\t<Character name=\"").append( names[ i ] ).append( "\">") .append( remarks[ i ] ).append( "</Character>\n" ) ; } xmlstring.append( "</CharacterRemarks>" ) ; return xmlstring ; }
Module XMLOutput Sub Main() Dim charRemarks As New Dictionary(Of String, String) charRemarks.Add("April", "Bubbly: I charRemarks.Add("Tam O charRemarks.Add("Emily", "Short & shrift") Dim xml = <CharacterRemarks> <%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %> </CharacterRemarks> Console.WriteLine(xml) End Sub End Module
Port the following code from C++ to VB with equivalent syntax and logic.
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
Private Sub plot_coordinate_pairs(x As Variant, y As Variant) Dim chrt As Chart Set chrt = ActiveSheet.Shapes.AddChart.Chart With chrt .ChartType = xlLine .HasLegend = False .HasTitle = True .ChartTitle.Text = "Time" .SeriesCollection.NewSeries .SeriesCollection.Item(1).XValues = x .SeriesCollection.Item(1).Values = y .Axes(xlValue, xlPrimary).HasTitle = True .Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds" End With End Sub Public Sub main() x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}] y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}] plot_coordinate_pairs x, y End Sub
Write a version of this C++ function in VB with identical behavior.
#include <windows.h> #include <string> #include <vector> using namespace std; const int HSTEP = 46, MWID = 40, MHEI = 471; const float VSTEP = 2.3f; class vector2 { public: vector2() { x = y = 0; } vector2( float a, float b ) { x = a; y = b; } void set( float a, float b ) { x = a; y = b; } float x, y; }; class myBitmap { public: myBitmap() : pen( NULL ), brush( NULL ), clr( 0 ), wid( 1 ) {} ~myBitmap() { DeleteObject( pen ); DeleteObject( brush ); DeleteDC( hdc ); DeleteObject( bmp ); } bool create( int w, int h ) { BITMAPINFO bi; ZeroMemory( &bi, sizeof( bi ) ); bi.bmiHeader.biSize = sizeof( bi.bmiHeader ); bi.bmiHeader.biBitCount = sizeof( DWORD ) * 8; bi.bmiHeader.biCompression = BI_RGB; bi.bmiHeader.biPlanes = 1; bi.bmiHeader.biWidth = w; bi.bmiHeader.biHeight = -h; HDC dc = GetDC( GetConsoleWindow() ); bmp = CreateDIBSection( dc, &bi, DIB_RGB_COLORS, &pBits, NULL, 0 ); if( !bmp ) return false; hdc = CreateCompatibleDC( dc ); SelectObject( hdc, bmp ); ReleaseDC( GetConsoleWindow(), dc ); width = w; height = h; return true; } void clear( BYTE clr = 0 ) { memset( pBits, clr, width * height * sizeof( DWORD ) ); } void setBrushColor( DWORD bClr ) { if( brush ) DeleteObject( brush ); brush = CreateSolidBrush( bClr ); SelectObject( hdc, brush ); } void setPenColor( DWORD c ) { clr = c; createPen(); } void setPenWidth( int w ) { wid = w; createPen(); } void saveBitmap( string path ) { BITMAPFILEHEADER fileheader; BITMAPINFO infoheader; BITMAP bitmap; DWORD wb; GetObject( bmp, sizeof( bitmap ), &bitmap ); DWORD* dwpBits = new DWORD[bitmap.bmWidth * bitmap.bmHeight]; ZeroMemory( dwpBits, bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ) ); ZeroMemory( &infoheader, sizeof( BITMAPINFO ) ); ZeroMemory( &fileheader, sizeof( BITMAPFILEHEADER ) ); infoheader.bmiHeader.biBitCount = sizeof( DWORD ) * 8; infoheader.bmiHeader.biCompression = BI_RGB; infoheader.bmiHeader.biPlanes = 1; infoheader.bmiHeader.biSize = sizeof( infoheader.bmiHeader ); infoheader.bmiHeader.biHeight = bitmap.bmHeight; infoheader.bmiHeader.biWidth = bitmap.bmWidth; infoheader.bmiHeader.biSizeImage = bitmap.bmWidth * bitmap.bmHeight * sizeof( DWORD ); fileheader.bfType = 0x4D42; fileheader.bfOffBits = sizeof( infoheader.bmiHeader ) + sizeof( BITMAPFILEHEADER ); fileheader.bfSize = fileheader.bfOffBits + infoheader.bmiHeader.biSizeImage; GetDIBits( hdc, bmp, 0, height, ( LPVOID )dwpBits, &infoheader, DIB_RGB_COLORS ); HANDLE file = CreateFile( path.c_str(), GENERIC_WRITE, 0, NULL, CREATE_ALWAYS, FILE_ATTRIBUTE_NORMAL, NULL ); WriteFile( file, &fileheader, sizeof( BITMAPFILEHEADER ), &wb, NULL ); WriteFile( file, &infoheader.bmiHeader, sizeof( infoheader.bmiHeader ), &wb, NULL ); WriteFile( file, dwpBits, bitmap.bmWidth * bitmap.bmHeight * 4, &wb, NULL ); CloseHandle( file ); delete [] dwpBits; } HDC getDC() const { return hdc; } int getWidth() const { return width; } int getHeight() const { return height; } private: void createPen() { if( pen ) DeleteObject( pen ); pen = CreatePen( PS_SOLID, wid, clr ); SelectObject( hdc, pen ); } HBITMAP bmp; HDC hdc; HPEN pen; HBRUSH brush; void *pBits; int width, height, wid; DWORD clr; }; class plot { public: plot() { bmp.create( 512, 512 ); } void draw( vector<vector2>* pairs ) { bmp.clear( 0xff ); drawGraph( pairs ); plotIt( pairs ); HDC dc = GetDC( GetConsoleWindow() ); BitBlt( dc, 0, 30, 512, 512, bmp.getDC(), 0, 0, SRCCOPY ); ReleaseDC( GetConsoleWindow(), dc ); } private: void drawGraph( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); bmp.setPenColor( RGB( 240, 240, 240 ) ); DWORD b = 11, c = 40, x; RECT rc; char txt[8]; for( x = 0; x < pairs->size(); x++ ) { MoveToEx( dc, 40, b, NULL ); LineTo( dc, 500, b ); MoveToEx( dc, c, 11, NULL ); LineTo( dc, c, 471 ); wsprintf( txt, "%d", ( pairs->size() - x ) * 20 ); SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); wsprintf( txt, "%d", x ); SetRect( &rc, c - 8, 472, c + 8, 492 ); DrawText( dc, txt, lstrlen( txt ), &rc, DT_CENTER | DT_VCENTER | DT_SINGLELINE ); c += 46; b += 46; } SetRect( &rc, 0, b - 9, 36, b + 11 ); DrawText( dc, "0", 1, &rc, DT_RIGHT | DT_VCENTER | DT_SINGLELINE ); bmp.setPenColor( 0 ); bmp.setPenWidth( 3 ); MoveToEx( dc, 40, 11, NULL ); LineTo( dc, 40, 471 ); MoveToEx( dc, 40, 471, NULL ); LineTo( dc, 500, 471 ); } void plotIt( vector<vector2>* pairs ) { HDC dc = bmp.getDC(); HBRUSH br = CreateSolidBrush( 255 ); RECT rc; bmp.setPenColor( 255 ); bmp.setPenWidth( 2 ); vector<vector2>::iterator it = pairs->begin(); int a = MWID + HSTEP * static_cast<int>( ( *it ).x ), b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); MoveToEx( dc, a, b, NULL ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); it++; for( ; it < pairs->end(); it++ ) { a = MWID + HSTEP * static_cast<int>( ( *it ).x ); b = MHEI - static_cast<int>( VSTEP * ( *it ).y ); SetRect( &rc, a - 3, b - 3, a + 3, b + 3 ); FillRect( dc, &rc, br ); LineTo( dc, a, b ); } DeleteObject( br ); } myBitmap bmp; }; int main( int argc, char* argv[] ) { ShowWindow( GetConsoleWindow(), SW_MAXIMIZE ); plot pt; vector<vector2> pairs; pairs.push_back( vector2( 0, 2.7f ) ); pairs.push_back( vector2( 1, 2.8f ) ); pairs.push_back( vector2( 2.0f, 31.4f ) ); pairs.push_back( vector2( 3.0f, 38.1f ) ); pairs.push_back( vector2( 4.0f, 58.0f ) ); pairs.push_back( vector2( 5.0f, 76.2f ) ); pairs.push_back( vector2( 6.0f, 100.5f ) ); pairs.push_back( vector2( 7.0f, 130.0f ) ); pairs.push_back( vector2( 8.0f, 149.3f ) ); pairs.push_back( vector2( 9.0f, 180.0f ) ); pt.draw( &pairs ); system( "pause" ); return 0; }
Private Sub plot_coordinate_pairs(x As Variant, y As Variant) Dim chrt As Chart Set chrt = ActiveSheet.Shapes.AddChart.Chart With chrt .ChartType = xlLine .HasLegend = False .HasTitle = True .ChartTitle.Text = "Time" .SeriesCollection.NewSeries .SeriesCollection.Item(1).XValues = x .SeriesCollection.Item(1).Values = y .Axes(xlValue, xlPrimary).HasTitle = True .Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds" End With End Sub Public Sub main() x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}] y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}] plot_coordinate_pairs x, y End Sub
Generate a VB translation of this C++ snippet without changing its computational steps.
#include <iostream> #include <string> #include <iterator> #include <regex> int main() { std::regex re(".* string$"); std::string s = "Hi, I am a string"; if (std::regex_match(s, re)) std::cout << "The string matches.\n"; else std::cout << "Oops - not found?\n"; std::regex re2(" a.*a"); std::smatch match; if (std::regex_search(s, match, re2)) { std::cout << "Matched " << match.length() << " characters starting at " << match.position() << ".\n"; std::cout << "Matched character sequence: \"" << match.str() << "\"\n"; } else { std::cout << "Oops - not found?\n"; } std::string dest_string; std::regex_replace(std::back_inserter(dest_string), s.begin(), s.end(), re2, "'m now a changed"); std::cout << dest_string << std::endl; }
text = "I need more coffee!!!" Set regex = New RegExp regex.Global = True regex.Pattern = "\s" If regex.Test(text) Then WScript.StdOut.Write regex.Replace(text,vbCrLf) Else WScript.StdOut.Write "No matching pattern" End If
Write the same code in VB as shown below in C++.
#include <unordered_map> #include <string> int main() { std::string keys[] = { "1", "2", "3" }; std::string vals[] = { "a", "b", "c" }; std::unordered_map<std::string, std::string> hash; for( int i = 0 ; i < 3 ; i++ ) hash[ keys[i] ] = vals[i] ; }
Set dict = CreateObject("Scripting.Dictionary") os = Array("Windows", "Linux", "MacOS") owner = Array("Microsoft", "Linus Torvalds", "Apple") For n = 0 To 2 dict.Add os(n), owner(n) Next MsgBox dict.Item("Linux") MsgBox dict.Item("MacOS") MsgBox dict.Item("Windows")
Write a version of this C++ function in VB with identical behavior.
#include <windows.h> class pinstripe { public: pinstripe() { createColors(); } void setDimensions( int x, int y ) { _mw = x; _mh = y; } void createColors() { colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 ); colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 ); colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 ); colors[7] = RGB( 255, 255, 255 ); } void draw( HDC dc ) { HPEN pen; int lh = _mh / 4, row, cp; for( int lw = 1; lw < 5; lw++ ) { cp = 0; row = ( lw - 1 ) * lh; for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw ) { pen = CreatePen( PS_SOLID, lw, colors[cp] ); ++cp %= 8; SelectObject( dc, pen ); MoveToEx( dc, x, row, NULL ); LineTo( dc, x, row + lh ); DeleteObject( pen ); } } } private: int _mw, _mh; DWORD colors[8]; }; pinstripe pin; void PaintWnd( HWND hWnd ) { PAINTSTRUCT ps; HDC hdc = BeginPaint( hWnd, &ps ); pin.draw( hdc ); EndPaint( hWnd, &ps ); } LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam ) { switch( msg ) { case WM_DESTROY: PostQuitMessage( 0 ); break; case WM_PAINT: PaintWnd( hWnd ); break; default: return DefWindowProc( hWnd, msg, wParam, lParam ); } return 0; } HWND InitAll( HINSTANCE hInstance ) { WNDCLASSEX wcex; ZeroMemory( &wcex, sizeof( wcex ) ); wcex.cbSize = sizeof( WNDCLASSEX ); wcex.style = CS_HREDRAW | CS_VREDRAW; wcex.lpfnWndProc = WndProc; wcex.hInstance = hInstance; wcex.hCursor = LoadCursor( NULL, IDC_ARROW ); wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 ); wcex.lpszClassName = "_CLR_PS_"; RegisterClassEx( &wcex ); return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL ); } int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow ) { srand( GetTickCount() ); HWND hwnd = InitAll( hInstance ); if( !hwnd ) return -1; int mw = GetSystemMetrics( SM_CXSCREEN ), mh = GetSystemMetrics( SM_CYSCREEN ); pin.setDimensions( mw, mh ); RECT rc = { 0, 0, mw, mh }; AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 ); int w = rc.right - rc.left, h = rc.bottom - rc.top; int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ), posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 ); SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER ); ShowWindow( hwnd, nCmdShow ); UpdateWindow( hwnd ); MSG msg; ZeroMemory( &msg, sizeof( msg ) ); while( msg.message != WM_QUIT ) { if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 ) { TranslateMessage( &msg ); DispatchMessage( &msg ); } } return UnregisterClass( "_CLR_PS_", hInstance ); }
Public Class Main Inherits System.Windows.Forms.Form Public Sub New() Me.FormBorderStyle = FormBorderStyle.None Me.WindowState = FormWindowState.Maximized End Sub Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load Dim Index As Integer Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White} Dim Height = (Me.ClientSize.Height / 4) + 1 For y = 1 To 4 Dim Top = Me.ClientSize.Height / 4 * (y - 1) For x = 0 To Me.ClientSize.Width Step y If Index = 6 Then Index = 0 Else Index += 1 Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)}) Next Next End Sub End Class
Ensure the translated VB code behaves exactly like the original C++ snippet.
#include <windows.h> class pinstripe { public: pinstripe() { createColors(); } void setDimensions( int x, int y ) { _mw = x; _mh = y; } void createColors() { colors[0] = 0; colors[1] = 255; colors[2] = RGB( 0, 255, 0 ); colors[3] = RGB( 0, 0, 255 ); colors[4] = RGB( 255, 0, 255 ); colors[5] = RGB( 0, 255, 255 ); colors[6] = RGB( 255, 255, 0 ); colors[7] = RGB( 255, 255, 255 ); } void draw( HDC dc ) { HPEN pen; int lh = _mh / 4, row, cp; for( int lw = 1; lw < 5; lw++ ) { cp = 0; row = ( lw - 1 ) * lh; for( int x = 0 + lw > 1 ? lw > 3 ? 2 : 1 : 0; x < _mw; x += lw ) { pen = CreatePen( PS_SOLID, lw, colors[cp] ); ++cp %= 8; SelectObject( dc, pen ); MoveToEx( dc, x, row, NULL ); LineTo( dc, x, row + lh ); DeleteObject( pen ); } } } private: int _mw, _mh; DWORD colors[8]; }; pinstripe pin; void PaintWnd( HWND hWnd ) { PAINTSTRUCT ps; HDC hdc = BeginPaint( hWnd, &ps ); pin.draw( hdc ); EndPaint( hWnd, &ps ); } LRESULT CALLBACK WndProc( HWND hWnd, UINT msg, WPARAM wParam, LPARAM lParam ) { switch( msg ) { case WM_DESTROY: PostQuitMessage( 0 ); break; case WM_PAINT: PaintWnd( hWnd ); break; default: return DefWindowProc( hWnd, msg, wParam, lParam ); } return 0; } HWND InitAll( HINSTANCE hInstance ) { WNDCLASSEX wcex; ZeroMemory( &wcex, sizeof( wcex ) ); wcex.cbSize = sizeof( WNDCLASSEX ); wcex.style = CS_HREDRAW | CS_VREDRAW; wcex.lpfnWndProc = WndProc; wcex.hInstance = hInstance; wcex.hCursor = LoadCursor( NULL, IDC_ARROW ); wcex.hbrBackground = ( HBRUSH )( COLOR_WINDOW + 1 ); wcex.lpszClassName = "_CLR_PS_"; RegisterClassEx( &wcex ); return CreateWindow( "_CLR_PS_", ".: Clr Pinstripe -- PJorente :.", WS_POPUP, CW_USEDEFAULT, 0, 200, 200, NULL, NULL, hInstance, NULL ); } int APIENTRY _tWinMain( HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow ) { srand( GetTickCount() ); HWND hwnd = InitAll( hInstance ); if( !hwnd ) return -1; int mw = GetSystemMetrics( SM_CXSCREEN ), mh = GetSystemMetrics( SM_CYSCREEN ); pin.setDimensions( mw, mh ); RECT rc = { 0, 0, mw, mh }; AdjustWindowRectEx( &rc, WS_POPUP, FALSE, 0 ); int w = rc.right - rc.left, h = rc.bottom - rc.top; int posX = ( GetSystemMetrics( SM_CXSCREEN ) >> 1 ) - ( w >> 1 ), posY = ( GetSystemMetrics( SM_CYSCREEN ) >> 1 ) - ( h >> 1 ); SetWindowPos( hwnd, HWND_TOP, posX, posY, w, h, SWP_NOZORDER ); ShowWindow( hwnd, nCmdShow ); UpdateWindow( hwnd ); MSG msg; ZeroMemory( &msg, sizeof( msg ) ); while( msg.message != WM_QUIT ) { if( PeekMessage( &msg, NULL, 0, 0, PM_REMOVE ) != 0 ) { TranslateMessage( &msg ); DispatchMessage( &msg ); } } return UnregisterClass( "_CLR_PS_", hInstance ); }
Public Class Main Inherits System.Windows.Forms.Form Public Sub New() Me.FormBorderStyle = FormBorderStyle.None Me.WindowState = FormWindowState.Maximized End Sub Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load Dim Index As Integer Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White} Dim Height = (Me.ClientSize.Height / 4) + 1 For y = 1 To 4 Dim Top = Me.ClientSize.Height / 4 * (y - 1) For x = 0 To Me.ClientSize.Width Step y If Index = 6 Then Index = 0 Else Index += 1 Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)}) Next Next End Sub End Class
Maintain the same structure and functionality when rewriting this code in VB.
#include <algorithm> #include <cassert> #include <iostream> #include <iterator> #include <vector> template <typename iterator> void cocktail_shaker_sort(iterator begin, iterator end) { if (begin == end) return; for (--end; begin < end; ) { iterator new_begin = end; iterator new_end = begin; for (iterator i = begin; i < end; ++i) { iterator j = i + 1; if (*j < *i) { std::iter_swap(i, j); new_end = i; } } end = new_end; for (iterator i = end; i > begin; --i) { iterator j = i - 1; if (*i < *j) { std::iter_swap(i, j); new_begin = i; } } begin = new_begin; } } template <typename iterator> void print(iterator begin, iterator end) { if (begin == end) return; std::cout << *begin++; while (begin != end) std::cout << ' ' << *begin++; std::cout << '\n'; } int main() { std::vector<int> v{5, 1, -6, 12, 3, 13, 2, 4, 0, 15}; std::cout << "before: "; print(v.begin(), v.end()); cocktail_shaker_sort(v.begin(), v.end()); assert(std::is_sorted(v.begin(), v.end())); std::cout << "after: "; print(v.begin(), v.end()); return 0; }
Function cocktailShakerSort(ByVal A As Variant) As Variant beginIdx = LBound(A) endIdx = UBound(A) - 1 Do While beginIdx <= endIdx newBeginIdx = endIdx newEndIdx = beginIdx For ii = beginIdx To endIdx If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newEndIdx = ii End If Next ii endIdx = newEndIdx - 1 For ii = endIdx To beginIdx Step -1 If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newBeginIdx = ii End If Next ii beginIdx = newBeginIdx + 1 Loop cocktailShakerSort = A End Function Public Sub main() Dim B(20) As Variant For i = LBound(B) To UBound(B) B(i) = Int(Rnd() * 100) Next i Debug.Print Join(B, ", ") Debug.Print Join(cocktailShakerSort(B), ", ") End Sub
Translate this program into VB but keep the logic exactly as in C++.
#ifndef __wxPendulumDlg_h__ #define __wxPendulumDlg_h__ #ifdef __BORLANDC__ #pragma hdrstop #endif #ifndef WX_PRECOMP #include <wx/wx.h> #include <wx/dialog.h> #else #include <wx/wxprec.h> #endif #include <wx/timer.h> #include <wx/dcbuffer.h> #include <cmath> class wxPendulumDlgApp : public wxApp { public: bool OnInit(); int OnExit(); }; class wxPendulumDlg : public wxDialog { public: wxPendulumDlg(wxWindow *parent, wxWindowID id = 1, const wxString &title = wxT("wxPendulum"), const wxPoint& pos = wxDefaultPosition, const wxSize& size = wxDefaultSize, long style = wxSUNKEN_BORDER | wxCAPTION | wxRESIZE_BORDER | wxSYSTEM_MENU | wxDIALOG_NO_PARENT | wxMINIMIZE_BOX | wxMAXIMIZE_BOX | wxCLOSE_BOX); virtual ~wxPendulumDlg(); void wxPendulumDlgPaint(wxPaintEvent& event); void wxPendulumDlgSize(wxSizeEvent& event); void OnTimer(wxTimerEvent& event); private: wxTimer *m_timer; unsigned int m_uiLength; double m_Angle; double m_AngleVelocity; enum wxIDs { ID_WXTIMER1 = 1001, ID_DUMMY_VALUE_ }; void OnClose(wxCloseEvent& event); void CreateGUIControls(); DECLARE_EVENT_TABLE() }; #endif
option explicit const dt = 0.15 const length=23 dim ans0:ans0=chr(27)&"[" dim Veloc,Accel,angle,olr,olc,r,c const r0=1 const c0=40 cls angle=0.7 while 1 wscript.sleep(50) Accel = -.9 * sin(Angle) Veloc = Veloc + Accel * dt Angle = Angle + Veloc * dt r = r0 + int(cos(Angle) * Length) c = c0+ int(2*sin(Angle) * Length) cls draw_line r,c,r0,c0 toxy r,c,"O" olr=r :olc=c wend sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub Sub draw_line(r1,c1, r2,c2) Dim x,y,xf,yf,dx,dy,sx,sy,err,err2 x =r1 : y =c1 xf=r2 : yf=c2 dx=Abs(xf-x) : dy=Abs(yf-y) If x<xf Then sx=+1: Else sx=-1 If y<yf Then sy=+1: Else sy=-1 err=dx-dy Do toxy x,y,"." If x=xf And y=yf Then Exit Do err2=err+err If err2>-dy Then err=err-dy: x=x+sx If err2< dx Then err=err+dx: y=y+sy Loop End Sub
Keep all operations the same but rewrite the snippet in VB.
#include <bitset> #include <iostream> #include <string> #include <assert.h> uint32_t gray_encode(uint32_t b) { return b ^ (b >> 1); } uint32_t gray_decode(uint32_t g) { for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1) { if (g & bit) g ^= bit >> 1; } return g; } std::string to_binary(int value) { const std::bitset<32> bs(value); const std::string str(bs.to_string()); const size_t pos(str.find('1')); return pos == std::string::npos ? "0" : str.substr(pos); } int main() { std::cout << "Number\tBinary\tGray\tDecoded\n"; for (uint32_t n = 0; n < 32; ++n) { uint32_t g = gray_encode(n); assert(gray_decode(g) == n); std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n"; } }
Function Encoder(ByVal n) Encoder = n Xor (n \ 2) End Function Function Decoder(ByVal n) Dim g : g = 0 Do While n > 0 g = g Xor n n = n \ 2 Loop Decoder = g End Function Function Dec2bin(ByVal n, ByVal length) Dim i, strbin : strbin = "" For i = 1 to 5 strbin = (n Mod 2) & strbin n = n \ 2 Next Dec2Bin = strbin End Function WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary") For i = 0 to 31 encoded = Encoder(i) decoded = Decoder(encoded) WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5)) Next
Preserve the algorithm and functionality while converting the code from C++ to VB.
#include <bitset> #include <iostream> #include <string> #include <assert.h> uint32_t gray_encode(uint32_t b) { return b ^ (b >> 1); } uint32_t gray_decode(uint32_t g) { for (uint32_t bit = 1U << 31; bit > 1; bit >>= 1) { if (g & bit) g ^= bit >> 1; } return g; } std::string to_binary(int value) { const std::bitset<32> bs(value); const std::string str(bs.to_string()); const size_t pos(str.find('1')); return pos == std::string::npos ? "0" : str.substr(pos); } int main() { std::cout << "Number\tBinary\tGray\tDecoded\n"; for (uint32_t n = 0; n < 32; ++n) { uint32_t g = gray_encode(n); assert(gray_decode(g) == n); std::cout << n << "\t" << to_binary(n) << "\t" << to_binary(g) << "\t" << g << "\n"; } }
Function Encoder(ByVal n) Encoder = n Xor (n \ 2) End Function Function Decoder(ByVal n) Dim g : g = 0 Do While n > 0 g = g Xor n n = n \ 2 Loop Decoder = g End Function Function Dec2bin(ByVal n, ByVal length) Dim i, strbin : strbin = "" For i = 1 to 5 strbin = (n Mod 2) & strbin n = n \ 2 Next Dec2Bin = strbin End Function WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary") For i = 0 to 31 encoded = Encoder(i) decoded = Decoder(encoded) WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5)) Next
Write the same code in VB as shown below in C++.
#include <deque> #include <algorithm> #include <ostream> #include <iterator> namespace cards { class card { public: enum pip_type { two, three, four, five, six, seven, eight, nine, ten, jack, queen, king, ace, pip_count }; enum suite_type { hearts, spades, diamonds, clubs, suite_count }; enum { unique_count = pip_count * suite_count }; card(suite_type s, pip_type p): value(s + suite_count * p) {} explicit card(unsigned char v = 0): value(v) {} pip_type pip() { return pip_type(value / suite_count); } suite_type suite() { return suite_type(value % suite_count); } private: unsigned char value; }; const char* const pip_names[] = { "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "jack", "queen", "king", "ace" }; std::ostream& operator<<(std::ostream& os, card::pip_type pip) { return os << pip_names[pip]; } const char* const suite_names[] = { "hearts", "spades", "diamonds", "clubs" }; std::ostream& operator<<(std::ostream& os, card::suite_type suite) { return os << suite_names[suite]; } std::ostream& operator<<(std::ostream& os, card c) { return os << c.pip() << " of " << c.suite(); } class deck { public: deck() { for (int i = 0; i < card::unique_count; ++i) { cards.push_back(card(i)); } } void shuffle() { std::random_shuffle(cards.begin(), cards.end()); } card deal() { card c = cards.front(); cards.pop_front(); return c; } typedef std::deque<card>::const_iterator const_iterator; const_iterator begin() const { return cards.cbegin(); } const_iterator end() const { return cards.cend(); } private: std::deque<card> cards; }; inline std::ostream& operator<<(std::ostream& os, const deck& d) { std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n")); return os; } }
class playingcard dim suit dim pips end class class carddeck private suitnames private pipnames private cardno private deck(52) private nTop sub class_initialize dim suit dim pips suitnames = split("H,D,C,S",",") pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",") cardno = 0 for suit = 1 to 4 for pips = 1 to 13 set deck(cardno) = new playingcard deck(cardno).suit = suitnames(suit-1) deck(cardno).pips = pipnames(pips-1) cardno = cardno + 1 next next nTop = 0 end sub public sub showdeck dim a redim a(51-nTop) for i = nTop to 51 a(i) = deck(i).pips & deck(i).suit next wscript.echo join( a, ", ") end sub public sub shuffle dim r randomize timer for i = nTop to 51 r = int( rnd * ( 52 - nTop ) ) if r <> i then objswap deck(i),deck(r) end if next end sub public function deal() set deal = deck( nTop ) nTop = nTop + 1 end function public property get cardsRemaining cardsRemaining = 52 - nTop end property private sub objswap( a, b ) dim tmp set tmp = a set a = b set b = tmp end sub end class
Preserve the algorithm and functionality while converting the code from C++ to VB.
#include <deque> #include <algorithm> #include <ostream> #include <iterator> namespace cards { class card { public: enum pip_type { two, three, four, five, six, seven, eight, nine, ten, jack, queen, king, ace, pip_count }; enum suite_type { hearts, spades, diamonds, clubs, suite_count }; enum { unique_count = pip_count * suite_count }; card(suite_type s, pip_type p): value(s + suite_count * p) {} explicit card(unsigned char v = 0): value(v) {} pip_type pip() { return pip_type(value / suite_count); } suite_type suite() { return suite_type(value % suite_count); } private: unsigned char value; }; const char* const pip_names[] = { "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "jack", "queen", "king", "ace" }; std::ostream& operator<<(std::ostream& os, card::pip_type pip) { return os << pip_names[pip]; } const char* const suite_names[] = { "hearts", "spades", "diamonds", "clubs" }; std::ostream& operator<<(std::ostream& os, card::suite_type suite) { return os << suite_names[suite]; } std::ostream& operator<<(std::ostream& os, card c) { return os << c.pip() << " of " << c.suite(); } class deck { public: deck() { for (int i = 0; i < card::unique_count; ++i) { cards.push_back(card(i)); } } void shuffle() { std::random_shuffle(cards.begin(), cards.end()); } card deal() { card c = cards.front(); cards.pop_front(); return c; } typedef std::deque<card>::const_iterator const_iterator; const_iterator begin() const { return cards.cbegin(); } const_iterator end() const { return cards.cend(); } private: std::deque<card> cards; }; inline std::ostream& operator<<(std::ostream& os, const deck& d) { std::copy(d.begin(), d.end(), std::ostream_iterator<card>(os, "\n")); return os; } }
class playingcard dim suit dim pips end class class carddeck private suitnames private pipnames private cardno private deck(52) private nTop sub class_initialize dim suit dim pips suitnames = split("H,D,C,S",",") pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",") cardno = 0 for suit = 1 to 4 for pips = 1 to 13 set deck(cardno) = new playingcard deck(cardno).suit = suitnames(suit-1) deck(cardno).pips = pipnames(pips-1) cardno = cardno + 1 next next nTop = 0 end sub public sub showdeck dim a redim a(51-nTop) for i = nTop to 51 a(i) = deck(i).pips & deck(i).suit next wscript.echo join( a, ", ") end sub public sub shuffle dim r randomize timer for i = nTop to 51 r = int( rnd * ( 52 - nTop ) ) if r <> i then objswap deck(i),deck(r) end if next end sub public function deal() set deal = deck( nTop ) nTop = nTop + 1 end function public property get cardsRemaining cardsRemaining = 52 - nTop end property private sub objswap( a, b ) dim tmp set tmp = a set a = b set b = tmp end sub end class
Keep all operations the same but rewrite the snippet in VB.
#include <array> #include <vector> #include <algorithm> #include <iostream> #include <iterator> #include <string> template <typename Array> void demonstrate(Array& array) { array[2] = "Three"; array.at(1) = "Two"; std::reverse(begin(array), end(array)); std::for_each(begin(array), end(array), [](typename Array::value_type const& element) { std::cout << element << ' '; }); std::cout << '\n'; } int main() { auto fixed_size_array = std::array<std::string, 3>{ "One", "Four", "Eight" }; auto dynamic_array = std::vector<std::string>{ "One", "Four" }; dynamic_array.push_back("Eight"); demonstrate(fixed_size_array); demonstrate(dynamic_array); }
Option Base {0|1}
Ensure the translated VB code behaves exactly like the original C++ snippet.
#include <cstdint> #include <cstdlib> #include <cstdio> static constexpr int32_t bct_low_bits = 0x55555555; static int32_t bct_decrement(int32_t v) { --v; return v ^ (v & (v>>1) & bct_low_bits); } int main (int argc, char *argv[]) { const int32_t n = (1 < argc) ? std::atoi(argv[1]) : 3; if (n < 0 || 9 < n) { std::printf("N out of range (use 0..9): %ld\n", long(n)); return 1; } const int32_t size_bct = 1<<(n*2); int32_t y = size_bct; do { y = bct_decrement(y); int32_t x = size_bct; do { x = bct_decrement(x); std::putchar((x & y & bct_low_bits) ? ' ' : '#'); } while (0 < x); std::putchar('\n'); } while (0 < y); return 0; }
Const Order = 4 Function InCarpet(ByVal x As Integer, ByVal y As Integer) Do While x <> 0 And y <> 0 If x Mod 3 = 1 And y Mod 3 = 1 Then InCarpet = " " Exit Function End If x = x \ 3 y = y \ 3 Loop InCarpet = "#" End Function Public Sub sierpinski_carpet() Dim i As Integer, j As Integer For i = 0 To 3 ^ Order - 1 For j = 0 To 3 ^ Order - 1 Debug.Print InCarpet(i, j); Next j Debug.Print Next i End Sub
Please provide an equivalent version of this C++ code in VB.
#include <algorithm> #include <iostream> #include <iterator> #include <random> template <typename RandomAccessIterator, typename Predicate> void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end, Predicate p) { std::random_device rd; std::mt19937 generator(rd()); while (!std::is_sorted(begin, end, p)) { std::shuffle(begin, end, generator); } } template <typename RandomAccessIterator> void bogo_sort(RandomAccessIterator begin, RandomAccessIterator end) { bogo_sort( begin, end, std::less< typename std::iterator_traits<RandomAccessIterator>::value_type>()); } int main() { int a[] = {100, 2, 56, 200, -52, 3, 99, 33, 177, -199}; bogo_sort(std::begin(a), std::end(a)); copy(std::begin(a), std::end(a), std::ostream_iterator<int>(std::cout, " ")); std::cout << "\n"; }
Private Function Knuth(a As Variant) As Variant Dim t As Variant, i As Integer If Not IsMissing(a) Then For i = UBound(a) To LBound(a) + 1 Step -1 j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a)) t = a(i) a(i) = a(j) a(j) = t Next i End If Knuth = a End Function Private Function inOrder(s As Variant) i = 2 Do While i <= UBound(s) If s(i) < s(i - 1) Then inOrder = False Exit Function End If i = i + 1 Loop inOrder = True End Function Private Function bogosort(ByVal s As Variant) As Variant Do While Not inOrder(s) Debug.Print Join(s, ", ") s = Knuth(s) Loop bogosort = s End Function Public Sub main() Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ") End Sub
Convert this C++ block to VB, preserving its control flow and logic.
#include <iomanip> #include <iostream> typedef double F(double,double); void euler(F f, double y0, double a, double b, double h) { double y = y0; for (double t = a; t < b; t += h) { std::cout << std::fixed << std::setprecision(3) << t << " " << y << "\n"; y += h * f(t, y); } std::cout << "done\n"; } double newtonCoolingLaw(double, double t) { return -0.07 * (t - 20); } int main() { euler(newtonCoolingLaw, 100, 0, 100, 2); euler(newtonCoolingLaw, 100, 0, 100, 5); euler(newtonCoolingLaw, 100, 0, 100, 10); }
Private Sub ivp_euler(f As String, y As Double, step As Integer, end_t As Integer) Dim t As Integer Debug.Print " Step "; step; ": ", Do While t <= end_t If t Mod 10 = 0 Then Debug.Print Format(y, "0.000"), y = y + step * Application.Run(f, y) t = t + step Loop Debug.Print End Sub Sub analytic() Debug.Print " Time: ", For t = 0 To 100 Step 10 Debug.Print " "; t, Next t Debug.Print Debug.Print "Analytic: ", For t = 0 To 100 Step 10 Debug.Print Format(20 + 80 * Exp(-0.07 * t), "0.000"), Next t Debug.Print End Sub Private Function cooling(temp As Double) As Double cooling = -0.07 * (temp - 20) End Function Public Sub euler_method() Dim r_cooling As String r_cooling = "cooling" analytic ivp_euler r_cooling, 100, 2, 100 ivp_euler r_cooling, 100, 5, 100 ivp_euler r_cooling, 100, 10, 100 End Sub
Maintain the same structure and functionality when rewriting this code in VB.
#include <iostream> #include <algorithm> #include <vector> #include <cmath> #include <boost/bind.hpp> #include <iterator> double nextNumber( double number ) { return number + floor( 0.5 + sqrt( number ) ) ; } int main( ) { std::vector<double> non_squares ; typedef std::vector<double>::iterator SVI ; non_squares.reserve( 1000000 ) ; for ( double i = 1.0 ; i < 100001.0 ; i += 1 ) non_squares.push_back( nextNumber( i ) ) ; std::copy( non_squares.begin( ) , non_squares.begin( ) + 22 , std::ostream_iterator<double>(std::cout, " " ) ) ; std::cout << '\n' ; SVI found = std::find_if ( non_squares.begin( ) , non_squares.end( ) , boost::bind( &floor, boost::bind( &sqrt, _1 ) ) == boost::bind( &sqrt, _1 ) ) ; if ( found != non_squares.end( ) ) { std::cout << "Found a square number in the sequence!\n" ; std::cout << "It is " << *found << " !\n" ; } else { std::cout << "Up to 1000000, found no square number in the sequence!\n" ; } return 0 ; }
Sub Main() Dim i&, c&, j#, s$ Const N& = 1000000 s = "values for n in the range 1 to 22 : " For i = 1 To 22 s = s & ns(i) & ", " Next For i = 1 To N j = Sqr(ns(i)) If j = CInt(j) Then c = c + 1 Next Debug.Print s Debug.Print c & " squares less than " & N End Sub Private Function ns(l As Long) As Long ns = l + Int(1 / 2 + Sqr(l)) End Function
Maintain the same structure and functionality when rewriting this code in VB.
#include <iostream> #include <string> int main() { std::string s = "0123456789"; int const n = 3; int const m = 4; char const c = '2'; std::string const sub = "456"; std::cout << s.substr(n, m)<< "\n"; std::cout << s.substr(n) << "\n"; std::cout << s.substr(0, s.size()-1) << "\n"; std::cout << s.substr(s.find(c), m) << "\n"; std::cout << s.substr(s.find(sub), m) << "\n"; }
Public Sub substring() sentence = "the last thing the man said was the" n = 10: m = 5 Debug.Print Mid(sentence, n, 5) Debug.Print Right(sentence, Len(sentence) - n + 1) Debug.Print Left(sentence, Len(sentence) - 1) k = InStr(1, sentence, "m") Debug.Print Mid(sentence, k, 5) k = InStr(1, sentence, "aid") Debug.Print Mid(sentence, k, 5) End Sub
Convert this C++ snippet to VB and keep its semantics consistent.
#include <algorithm> #include <string> #include <iostream> #include <iterator> class jortSort { public: template<class T> bool jort_sort( T* o, size_t s ) { T* n = copy_array( o, s ); sort_array( n, s ); bool r = false; if( n ) { r = check( o, n, s ); delete [] n; } return r; } private: template<class T> T* copy_array( T* o, size_t s ) { T* z = new T[s]; memcpy( z, o, s * sizeof( T ) ); return z; } template<class T> void sort_array( T* n, size_t s ) { std::sort( n, n + s ); } template<class T> bool check( T* n, T* o, size_t s ) { for( size_t x = 0; x < s; x++ ) if( n[x] != o[x] ) return false; return true; } }; jortSort js; template<class T> void displayTest( T* o, size_t s ) { std::copy( o, o + s, std::ostream_iterator<T>( std::cout, " " ) ); std::cout << ": -> The array is " << ( js.jort_sort( o, s ) ? "sorted!" : "not sorted!" ) << "\n\n"; } int main( int argc, char* argv[] ) { const size_t s = 5; std::string oStr[] = { "5", "A", "D", "R", "S" }; displayTest( oStr, s ); std::swap( oStr[0], oStr[1] ); displayTest( oStr, s ); int oInt[] = { 1, 2, 3, 4, 5 }; displayTest( oInt, s ); std::swap( oInt[0], oInt[1] ); displayTest( oInt, s ); return 0; }
Function JortSort(s) JortSort = True arrPreSort = Split(s,",") Set arrSorted = CreateObject("System.Collections.ArrayList") For i = 0 To UBound(arrPreSort) arrSorted.Add(arrPreSort(i)) Next arrSorted.Sort() For j = 0 To UBound(arrPreSort) If arrPreSort(j) <> arrSorted(j) Then JortSort = False Exit For End If Next End Function WScript.StdOut.Write JortSort("1,2,3,4,5") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("1,2,3,5,4") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("a,b,c") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("a,c,b")