Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Rewrite the snippet below in Java so it works the same as the original Python code.
from itertools import chain, count, islice from operator import itemgetter from math import gcd from matplotlib import pyplot def yellowstone(): def relativelyPrime(a): return lambda b: 1 == gcd(a, b) def nextWindow(triple): p2, p1, rest = triple [rp2, rp1] = map(relativelyPrime, [p2, p1]) def match(xxs): x, xs = uncons(xxs)['Just'] return (x, xs) if rp1(x) and not rp2(x) else ( second(cons(x))( match(xs) ) ) n, residue = match(rest) return (p1, n, residue) return chain( range(1, 3), map( itemgetter(1), iterate(nextWindow)( (2, 3, count(4)) ) ) ) def main(): print(showList( take(30)(yellowstone()) )) pyplot.plot( take(100)(yellowstone()) ) pyplot.xlabel(main.__doc__) pyplot.show() def Just(x): return {'type': 'Maybe', 'Nothing': False, 'Just': x} def Nothing(): return {'type': 'Maybe', 'Nothing': True} def cons(x): return lambda xs: [x] + xs if ( isinstance(xs, list) ) else x + xs if ( isinstance(xs, str) ) else chain([x], xs) def iterate(f): def go(x): v = x while True: yield v v = f(v) return go def second(f): return lambda xy: (xy[0], f(xy[1])) def showList(xs): return '[' + ','.join(repr(x) for x in xs) + ']' def take(n): return lambda xs: ( xs[0:n] if isinstance(xs, (list, tuple)) else list(islice(xs, n)) ) def uncons(xs): if isinstance(xs, list): return Just((xs[0], xs[1:])) if xs else Nothing() else: nxt = take(1)(xs) return Just((nxt[0], xs)) if nxt else Nothing() if __name__ == '__main__': main()
import java.util.ArrayList; import java.util.List; public class YellowstoneSequence { public static void main(String[] args) { System.out.printf("First 30 values in the yellowstone sequence:%n%s%n", yellowstoneSequence(30)); } private static List<Integer> yellowstoneSequence(int sequenceCount) { List<Integer> yellowstoneList = new ArrayList<Integer>(); yellowstoneList.add(1); yellowstoneList.add(2); yellowstoneList.add(3); int num = 4; List<Integer> notYellowstoneList = new ArrayList<Integer>(); int yellowSize = 3; while ( yellowSize < sequenceCount ) { int found = -1; for ( int index = 0 ; index < notYellowstoneList.size() ; index++ ) { int test = notYellowstoneList.get(index); if ( gcd(yellowstoneList.get(yellowSize-2), test) > 1 && gcd(yellowstoneList.get(yellowSize-1), test) == 1 ) { found = index; break; } } if ( found >= 0 ) { yellowstoneList.add(notYellowstoneList.remove(found)); yellowSize++; } else { while ( true ) { if ( gcd(yellowstoneList.get(yellowSize-2), num) > 1 && gcd(yellowstoneList.get(yellowSize-1), num) == 1 ) { yellowstoneList.add(num); yellowSize++; num++; break; } notYellowstoneList.add(num); num++; } } } return yellowstoneList; } private static final int gcd(int a, int b) { if ( b == 0 ) { return a; } return gcd(b, a%b); } }
Generate a Java translation of this Python snippet without changing its computational steps.
def cut_it(h, w): dirs = ((1, 0), (-1, 0), (0, -1), (0, 1)) if h % 2: h, w = w, h if h % 2: return 0 if w == 1: return 1 count = 0 next = [w + 1, -w - 1, -1, 1] blen = (h + 1) * (w + 1) - 1 grid = [False] * (blen + 1) def walk(y, x, count): if not y or y == h or not x or x == w: return count + 1 t = y * (w + 1) + x grid[t] = grid[blen - t] = True if not grid[t + next[0]]: count = walk(y + dirs[0][0], x + dirs[0][1], count) if not grid[t + next[1]]: count = walk(y + dirs[1][0], x + dirs[1][1], count) if not grid[t + next[2]]: count = walk(y + dirs[2][0], x + dirs[2][1], count) if not grid[t + next[3]]: count = walk(y + dirs[3][0], x + dirs[3][1], count) grid[t] = grid[blen - t] = False return count t = h // 2 * (w + 1) + w // 2 if w % 2: grid[t] = grid[t + 1] = True count = walk(h // 2, w // 2 - 1, count) res = count count = 0 count = walk(h // 2 - 1, w // 2, count) return res + count * 2 else: grid[t] = True count = walk(h // 2, w // 2 - 1, count) if h == w: return count * 2 count = walk(h // 2 - 1, w // 2, count) return count def main(): for w in xrange(1, 10): for h in xrange(1, w + 1): if not((w * h) % 2): print "%d x %d: %d" % (w, h, cut_it(w, h)) main()
import java.util.*; public class CutRectangle { private static int[][] dirs = {{0, -1}, {-1, 0}, {0, 1}, {1, 0}}; public static void main(String[] args) { cutRectangle(2, 2); cutRectangle(4, 3); } static void cutRectangle(int w, int h) { if (w % 2 == 1 && h % 2 == 1) return; int[][] grid = new int[h][w]; Stack<Integer> stack = new Stack<>(); int half = (w * h) / 2; long bits = (long) Math.pow(2, half) - 1; for (; bits > 0; bits -= 2) { for (int i = 0; i < half; i++) { int r = i / w; int c = i % w; grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0; grid[h - r - 1][w - c - 1] = 1 - grid[r][c]; } stack.push(0); grid[0][0] = 2; int count = 1; while (!stack.empty()) { int pos = stack.pop(); int r = pos / w; int c = pos % w; for (int[] dir : dirs) { int nextR = r + dir[0]; int nextC = c + dir[1]; if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) { if (grid[nextR][nextC] == 1) { stack.push(nextR * w + nextC); grid[nextR][nextC] = 2; count++; } } } } if (count == half) { printResult(grid); } } } static void printResult(int[][] arr) { for (int[] a : arr) System.out.println(Arrays.toString(a)); System.out.println(); } }
Generate a Java translation of this Python snippet without changing its computational steps.
def cut_it(h, w): dirs = ((1, 0), (-1, 0), (0, -1), (0, 1)) if h % 2: h, w = w, h if h % 2: return 0 if w == 1: return 1 count = 0 next = [w + 1, -w - 1, -1, 1] blen = (h + 1) * (w + 1) - 1 grid = [False] * (blen + 1) def walk(y, x, count): if not y or y == h or not x or x == w: return count + 1 t = y * (w + 1) + x grid[t] = grid[blen - t] = True if not grid[t + next[0]]: count = walk(y + dirs[0][0], x + dirs[0][1], count) if not grid[t + next[1]]: count = walk(y + dirs[1][0], x + dirs[1][1], count) if not grid[t + next[2]]: count = walk(y + dirs[2][0], x + dirs[2][1], count) if not grid[t + next[3]]: count = walk(y + dirs[3][0], x + dirs[3][1], count) grid[t] = grid[blen - t] = False return count t = h // 2 * (w + 1) + w // 2 if w % 2: grid[t] = grid[t + 1] = True count = walk(h // 2, w // 2 - 1, count) res = count count = 0 count = walk(h // 2 - 1, w // 2, count) return res + count * 2 else: grid[t] = True count = walk(h // 2, w // 2 - 1, count) if h == w: return count * 2 count = walk(h // 2 - 1, w // 2, count) return count def main(): for w in xrange(1, 10): for h in xrange(1, w + 1): if not((w * h) % 2): print "%d x %d: %d" % (w, h, cut_it(w, h)) main()
import java.util.*; public class CutRectangle { private static int[][] dirs = {{0, -1}, {-1, 0}, {0, 1}, {1, 0}}; public static void main(String[] args) { cutRectangle(2, 2); cutRectangle(4, 3); } static void cutRectangle(int w, int h) { if (w % 2 == 1 && h % 2 == 1) return; int[][] grid = new int[h][w]; Stack<Integer> stack = new Stack<>(); int half = (w * h) / 2; long bits = (long) Math.pow(2, half) - 1; for (; bits > 0; bits -= 2) { for (int i = 0; i < half; i++) { int r = i / w; int c = i % w; grid[r][c] = (bits & (1 << i)) != 0 ? 1 : 0; grid[h - r - 1][w - c - 1] = 1 - grid[r][c]; } stack.push(0); grid[0][0] = 2; int count = 1; while (!stack.empty()) { int pos = stack.pop(); int r = pos / w; int c = pos % w; for (int[] dir : dirs) { int nextR = r + dir[0]; int nextC = c + dir[1]; if (nextR >= 0 && nextR < h && nextC >= 0 && nextC < w) { if (grid[nextR][nextC] == 1) { stack.push(nextR * w + nextC); grid[nextR][nextC] = 2; count++; } } } } if (count == half) { printResult(grid); } } } static void printResult(int[][] arr) { for (int[] a : arr) System.out.println(Arrays.toString(a)); System.out.println(); } }
Port the provided Python code into Java while preserving the original functionality.
def mertens(count): m = [None, 1] for n in range(2, count+1): m.append(1) for k in range(2, n+1): m[n] -= m[n//k] return m ms = mertens(1000) print("The first 99 Mertens numbers are:") print(" ", end=' ') col = 1 for n in ms[1:100]: print("{:2d}".format(n), end=' ') col += 1 if col == 10: print() col = 0 zeroes = sum(x==0 for x in ms) crosses = sum(a!=0 and b==0 for a,b in zip(ms, ms[1:])) print("M(N) equals zero {} times.".format(zeroes)) print("M(N) crosses zero {} times.".format(crosses))
public class MertensFunction { public static void main(String[] args) { System.out.printf("First 199 terms of the merten function are as follows:%n "); for ( int n = 1 ; n < 200 ; n++ ) { System.out.printf("%2d ", mertenFunction(n)); if ( (n+1) % 20 == 0 ) { System.out.printf("%n"); } } for ( int exponent = 3 ; exponent<= 8 ; exponent++ ) { int zeroCount = 0; int zeroCrossingCount = 0; int positiveCount = 0; int negativeCount = 0; int mSum = 0; int mMin = Integer.MAX_VALUE; int mMinIndex = 0; int mMax = Integer.MIN_VALUE; int mMaxIndex = 0; int nMax = (int) Math.pow(10, exponent); for ( int n = 1 ; n <= nMax ; n++ ) { int m = mertenFunction(n); mSum += m; if ( m < mMin ) { mMin = m; mMinIndex = n; } if ( m > mMax ) { mMax = m; mMaxIndex = n; } if ( m > 0 ) { positiveCount++; } if ( m < 0 ) { negativeCount++; } if ( m == 0 ) { zeroCount++; } if ( m == 0 && mertenFunction(n - 1) != 0 ) { zeroCrossingCount++; } } System.out.printf("%nFor M(x) with x from 1 to %,d%n", nMax); System.out.printf("The maximum of M(x) is M(%,d) = %,d.%n", mMaxIndex, mMax); System.out.printf("The minimum of M(x) is M(%,d) = %,d.%n", mMinIndex, mMin); System.out.printf("The sum of M(x) is %,d.%n", mSum); System.out.printf("The count of positive M(x) is %,d, count of negative M(x) is %,d.%n", positiveCount, negativeCount); System.out.printf("M(x) has %,d zeroes in the interval.%n", zeroCount); System.out.printf("M(x) has %,d crossings in the interval.%n", zeroCrossingCount); } } private static int MU_MAX = 100_000_000; private static int[] MU = null; private static int[] MERTEN = null; private static int mertenFunction(int n) { if ( MERTEN != null ) { return MERTEN[n]; } MU = new int[MU_MAX+1]; MERTEN = new int[MU_MAX+1]; MERTEN[1] = 1; int sqrt = (int) Math.sqrt(MU_MAX); for ( int i = 0 ; i < MU_MAX ; i++ ) { MU[i] = 1; } for ( int i = 2 ; i <= sqrt ; i++ ) { if ( MU[i] == 1 ) { for ( int j = i ; j <= MU_MAX ; j += i ) { MU[j] *= -i; } for ( int j = i*i ; j <= MU_MAX ; j += i*i ) { MU[j] = 0; } } } int sum = 1; for ( int i = 2 ; i <= MU_MAX ; i++ ) { if ( MU[i] == i ) { MU[i] = 1; } else if ( MU[i] == -i ) { MU[i] = -1; } else if ( MU[i] < 0 ) { MU[i] = 1; } else if ( MU[i] > 0 ) { MU[i] = -1; } sum += MU[i]; MERTEN[i] = sum; } return MERTEN[n]; } }
Generate an equivalent Java version of this Python code.
def _insort_right(a, x, q): lo, hi = 0, len(a) while lo < hi: mid = (lo+hi)//2 q += 1 less = input(f"{q:2}: IS {x:>6} LESS-THAN {a[mid]:>6} ? y/n: ").strip().lower() == 'y' if less: hi = mid else: lo = mid+1 a.insert(lo, x) return q def order(items): ordered, q = [], 0 for item in items: q = _insort_right(ordered, item, q) return ordered, q if __name__ == '__main__': items = 'violet red green indigo blue yellow orange'.split() ans, questions = order(items) print('\n' + ' '.join(ans))
import java.util.*; public class SortComp1 { public static void main(String[] args) { List<String> items = Arrays.asList("violet", "red", "green", "indigo", "blue", "yellow", "orange"); List<String> sortedItems = new ArrayList<>(); Comparator<String> interactiveCompare = new Comparator<String>() { int count = 0; Scanner s = new Scanner(System.in); public int compare(String s1, String s2) { System.out.printf("(%d) Is %s <, =, or > %s. Answer -1, 0, or 1: ", ++count, s1, s2); return s.nextInt(); } }; for (String item : items) { System.out.printf("Inserting '%s' into %s\n", item, sortedItems); int spotToInsert = Collections.binarySearch(sortedItems, item, interactiveCompare); if (spotToInsert < 0) spotToInsert = ~spotToInsert; sortedItems.add(spotToInsert, item); } System.out.println(sortedItems); } }
Rewrite this program in Java while keeping its functionality equivalent to the Python version.
from __future__ import division from itertools import islice, count from collections import Counter from math import log10 from random import randint expected = [log10(1+1/d) for d in range(1,10)] def fib(): a,b = 1,1 while True: yield a a,b = b,a+b def power_of_threes(): return (3**k for k in count(0)) def heads(s): for a in s: yield int(str(a)[0]) def show_dist(title, s): c = Counter(s) size = sum(c.values()) res = [c[d]/size for d in range(1,10)] print("\n%s Benfords deviation" % title) for r, e in zip(res, expected): print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.)) def rand1000(): while True: yield randint(1,9999) if __name__ == '__main__': show_dist("fibbed", islice(heads(fib()), 1000)) show_dist("threes", islice(heads(power_of_threes()), 1000)) show_dist("random", islice(heads(rand1000()), 10000))
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
Generate an equivalent Java version of this Python code.
from __future__ import division from itertools import islice, count from collections import Counter from math import log10 from random import randint expected = [log10(1+1/d) for d in range(1,10)] def fib(): a,b = 1,1 while True: yield a a,b = b,a+b def power_of_threes(): return (3**k for k in count(0)) def heads(s): for a in s: yield int(str(a)[0]) def show_dist(title, s): c = Counter(s) size = sum(c.values()) res = [c[d]/size for d in range(1,10)] print("\n%s Benfords deviation" % title) for r, e in zip(res, expected): print("%5.1f%% %5.1f%% %5.1f%%" % (r*100., e*100., abs(r - e)*100.)) def rand1000(): while True: yield randint(1,9999) if __name__ == '__main__': show_dist("fibbed", islice(heads(fib()), 1000)) show_dist("threes", islice(heads(power_of_threes()), 1000)) show_dist("random", islice(heads(rand1000()), 10000))
import java.math.BigInteger; import java.util.Locale; public class BenfordsLaw { private static BigInteger[] generateFibonacci(int n) { BigInteger[] fib = new BigInteger[n]; fib[0] = BigInteger.ONE; fib[1] = BigInteger.ONE; for (int i = 2; i < fib.length; i++) { fib[i] = fib[i - 2].add(fib[i - 1]); } return fib; } public static void main(String[] args) { BigInteger[] numbers = generateFibonacci(1000); int[] firstDigits = new int[10]; for (BigInteger number : numbers) { firstDigits[Integer.valueOf(number.toString().substring(0, 1))]++; } for (int i = 1; i < firstDigits.length; i++) { System.out.printf(Locale.ROOT, "%d %10.6f %10.6f%n", i, (double) firstDigits[i] / numbers.length, Math.log10(1.0 + 1.0 / i)); } } }
Can you help me rewrite this code in Java instead of Python, keeping it the same logically?
import time, calendar, sched, winsound duration = 750 freq = 1280 bellchar = "\u2407" watches = 'Middle,Morning,Forenoon,Afternoon,First/Last dog,First'.split(',') def gap(n=1): time.sleep(n * duration / 1000) off = gap def on(n=1): winsound.Beep(freq, n * duration) def bong(): on(); off(0.5) def bongs(m): for i in range(m): print(bellchar, end=' ') bong() if i % 2: print(' ', end='') off(0.5) print('') scheds = sched.scheduler(time.time, time.sleep) def ships_bell(now=None): def adjust_to_half_hour(atime): atime[4] = (atime[4] // 30) * 30 atime[5] = 0 return atime debug = now is not None rightnow = time.gmtime() if not debug: now = adjust_to_half_hour( list(rightnow) ) then = now[::] then[4] += 30 hr, mn = now[3:5] watch, b = divmod(int(2 * hr + mn // 30 - 1), 8) b += 1 bells = '%i bell%s' % (b, 's' if b > 1 else ' ') if debug: print("%02i:%02i, %-20s %s" % (now[3], now[4], watches[watch] + ' watch', bells), end=' ') else: print("%02i:%02i, %-20s %s" % (rightnow[3], rightnow[4], watches[watch] + ' watch', bells), end=' ') bongs(b) if not debug: scheds.enterabs(calendar.timegm(then), 0, ships_bell) scheds.run() def dbg_tester(): for h in range(24): for m in (0, 30): if (h,m) == (24,30): break ships_bell( [2013, 3, 2, h, m, 15, 5, 61, 0] ) if __name__ == '__main__': ships_bell()
import java.text.DateFormat; import java.text.SimpleDateFormat; import java.util.TimeZone; public class NauticalBell extends Thread { public static void main(String[] args) { NauticalBell bells = new NauticalBell(); bells.setDaemon(true); bells.start(); try { bells.join(); } catch (InterruptedException e) { System.out.println(e); } } @Override public void run() { DateFormat sdf = new SimpleDateFormat("HH:mm:ss"); sdf.setTimeZone(TimeZone.getTimeZone("UTC")); int numBells = 0; long time = System.currentTimeMillis(); long next = time - (time % (24 * 60 * 60 * 1000)); while (next < time) { next += 30 * 60 * 1000; numBells = 1 + (numBells % 8); } while (true) { long wait = 100L; time = System.currentTimeMillis(); if (time - next >= 0) { String bells = numBells == 1 ? "bell" : "bells"; String timeString = sdf.format(time); System.out.printf("%s : %d %s\n", timeString, numBells, bells); next += 30 * 60 * 1000; wait = next - time; numBells = 1 + (numBells % 8); } try { Thread.sleep(wait); } catch (InterruptedException e) { return; } } } }
Write the same code in Java as shown below in Python.
import time, calendar, sched, winsound duration = 750 freq = 1280 bellchar = "\u2407" watches = 'Middle,Morning,Forenoon,Afternoon,First/Last dog,First'.split(',') def gap(n=1): time.sleep(n * duration / 1000) off = gap def on(n=1): winsound.Beep(freq, n * duration) def bong(): on(); off(0.5) def bongs(m): for i in range(m): print(bellchar, end=' ') bong() if i % 2: print(' ', end='') off(0.5) print('') scheds = sched.scheduler(time.time, time.sleep) def ships_bell(now=None): def adjust_to_half_hour(atime): atime[4] = (atime[4] // 30) * 30 atime[5] = 0 return atime debug = now is not None rightnow = time.gmtime() if not debug: now = adjust_to_half_hour( list(rightnow) ) then = now[::] then[4] += 30 hr, mn = now[3:5] watch, b = divmod(int(2 * hr + mn // 30 - 1), 8) b += 1 bells = '%i bell%s' % (b, 's' if b > 1 else ' ') if debug: print("%02i:%02i, %-20s %s" % (now[3], now[4], watches[watch] + ' watch', bells), end=' ') else: print("%02i:%02i, %-20s %s" % (rightnow[3], rightnow[4], watches[watch] + ' watch', bells), end=' ') bongs(b) if not debug: scheds.enterabs(calendar.timegm(then), 0, ships_bell) scheds.run() def dbg_tester(): for h in range(24): for m in (0, 30): if (h,m) == (24,30): break ships_bell( [2013, 3, 2, h, m, 15, 5, 61, 0] ) if __name__ == '__main__': ships_bell()
import java.text.DateFormat; import java.text.SimpleDateFormat; import java.util.TimeZone; public class NauticalBell extends Thread { public static void main(String[] args) { NauticalBell bells = new NauticalBell(); bells.setDaemon(true); bells.start(); try { bells.join(); } catch (InterruptedException e) { System.out.println(e); } } @Override public void run() { DateFormat sdf = new SimpleDateFormat("HH:mm:ss"); sdf.setTimeZone(TimeZone.getTimeZone("UTC")); int numBells = 0; long time = System.currentTimeMillis(); long next = time - (time % (24 * 60 * 60 * 1000)); while (next < time) { next += 30 * 60 * 1000; numBells = 1 + (numBells % 8); } while (true) { long wait = 100L; time = System.currentTimeMillis(); if (time - next >= 0) { String bells = numBells == 1 ? "bell" : "bells"; String timeString = sdf.format(time); System.out.printf("%s : %d %s\n", timeString, numBells, bells); next += 30 * 60 * 1000; wait = next - time; numBells = 1 + (numBells % 8); } try { Thread.sleep(wait); } catch (InterruptedException e) { return; } } } }
Port the following code from Python to Java with equivalent syntax and logic.
>>> Y = lambda f: (lambda x: x(x))(lambda y: f(lambda *args: y(y)(*args))) >>> fib = lambda f: lambda n: None if n < 0 else (0 if n == 0 else (1 if n == 1 else f(n-1) + f(n-2))) >>> [ Y(fib)(i) for i in range(-2, 10) ] [None, None, 0, 1, 1, 2, 3, 5, 8, 13, 21, 34]
public static long fib(int n) { if (n < 0) throw new IllegalArgumentException("n can not be a negative number"); return new Object() { private long fibInner(int n) { return (n < 2) ? n : (fibInner(n - 1) + fibInner(n - 2)); } }.fibInner(n); }
Ensure the translated Java code behaves exactly like the original Python snippet.
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
Convert this Python block to Java, preserving its control flow and logic.
print "knight"[1:] print "socks"[:-1] print "brooms"[1:-1]
String strOrig = 'brooms'; String str1 = strOrig.substring(1, strOrig.length()); system.debug(str1); String str2 = strOrig.substring(0, strOrig.length()-1); system.debug(str2); String str3 = strOrig.substring(1, strOrig.length()-1); system.debug(str3); String strOrig = 'brooms'; String str1 = strOrig.replaceAll( '^.', '' ); system.debug(str1); String str2 = strOrig.replaceAll( '.$', '' ) ; system.debug(str2); String str3 = strOrig.replaceAll( '^.|.$', '' ); system.debug(str3);
Change the programming language of this snippet from Python to Java without modifying what it does.
from primesieve import primes from math import isqrt from functools import cache p = primes(isqrt(1_000_000_000)) @cache def phi(x, a): res = 0 while True: if not a or not x: return x + res a -= 1 res -= phi(x//p[a], a) def legpi(n): if n < 2: return 0 a = legpi(isqrt(n)) return phi(n, a) + a - 1 for e in range(10): print(f'10^{e}', legpi(10**e))
import java.util.*; public class LegendrePrimeCounter { public static void main(String[] args) { LegendrePrimeCounter counter = new LegendrePrimeCounter(1000000000); for (int i = 0, n = 1; i < 10; ++i, n *= 10) System.out.printf("10^%d\t%d\n", i, counter.primeCount((n))); } private List<Integer> primes; public LegendrePrimeCounter(int limit) { primes = generatePrimes((int)Math.sqrt((double)limit)); } public int primeCount(int n) { if (n < 2) return 0; int a = primeCount((int)Math.sqrt((double)n)); return phi(n, a) + a - 1; } private int phi(int x, int a) { if (a == 0) return x; if (a == 1) return x - (x >> 1); int pa = primes.get(a - 1); if (x <= pa) return 1; return phi(x, a - 1) - phi(x / pa, a - 1); } private static List<Integer> generatePrimes(int limit) { boolean[] sieve = new boolean[limit >> 1]; Arrays.fill(sieve, true); for (int p = 3, s = 9; s < limit; p += 2) { if (sieve[p >> 1]) { for (int q = s; q < limit; q += p << 1) sieve[q >> 1] = false; } s += (p + 1) << 2; } List<Integer> primes = new ArrayList<>(); if (limit > 2) primes.add(2); for (int i = 1; i < sieve.length; ++i) { if (sieve[i]) primes.add((i << 1) + 1); } return primes; } }
Port the provided Python code into Java while preserving the original functionality.
def query(buffer_length): message = b'Here am I' L = len(message) return message[0:L*(L <= buffer_length)]
public class Query { public static boolean call(byte[] data, int[] length) throws java.io.UnsupportedEncodingException { String message = "Here am I"; byte[] mb = message.getBytes("utf-8"); if (length[0] < mb.length) return false; length[0] = mb.length; System.arraycopy(mb, 0, data, 0, mb.length); return true; } }
Can you help me rewrite this code in Java instead of Python, keeping it the same logically?
import fileinput def longer(a, b): try: b[len(a)-1] return False except: return True longest, lines = '', '' for x in fileinput.input(): if longer(x, longest): lines, longest = x, x elif not longer(longest, x): lines += x print(lines, end='')
import java.io.File; import java.util.Scanner; public class LongestStringChallenge { public static void main(String[] args) throws Exception { String lines = "", longest = ""; try (Scanner sc = new Scanner(new File("lines.txt"))) { while(sc.hasNext()) { String line = sc.nextLine(); if (longer(longest, line)) lines = longest = line; else if (!longer(line, longest)) lines = lines.concat("\n").concat(line); } } System.out.println(lines); } static boolean longer(String a, String b) { try { String dummy = a.substring(b.length()); } catch (StringIndexOutOfBoundsException e) { return true; } return false; } }
Generate an equivalent Java version of this Python code.
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.ListIterator; import java.util.List; import java.util.Set; import java.util.Map; public class UTM { private List<String> tape; private String blankSymbol; private ListIterator<String> head; private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>(); private Set<String> terminalStates; private String initialState; public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) { this.blankSymbol = blankSymbol; for (Transition t : transitions) { this.transitions.put(t.from, t); } this.terminalStates = terminalStates; this.initialState = initialState; } public static class StateTapeSymbolPair { private String state; private String tapeSymbol; public StateTapeSymbolPair(String state, String tapeSymbol) { this.state = state; this.tapeSymbol = tapeSymbol; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + ((state == null) ? 0 : state.hashCode()); result = prime * result + ((tapeSymbol == null) ? 0 : tapeSymbol .hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; StateTapeSymbolPair other = (StateTapeSymbolPair) obj; if (state == null) { if (other.state != null) return false; } else if (!state.equals(other.state)) return false; if (tapeSymbol == null) { if (other.tapeSymbol != null) return false; } else if (!tapeSymbol.equals(other.tapeSymbol)) return false; return true; } @Override public String toString() { return "(" + state + "," + tapeSymbol + ")"; } } public static class Transition { private StateTapeSymbolPair from; private StateTapeSymbolPair to; private int direction; public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) { this.from = from; this.to = to; this.direction = direction; } @Override public String toString() { return from + "=>" + to + "/" + direction; } } public void initializeTape(List<String> input) { tape = input; } public void initializeTape(String input) { tape = new LinkedList<String>(); for (int i = 0; i < input.length(); i++) { tape.add(input.charAt(i) + ""); } } public List<String> runTM() { if (tape.size() == 0) { tape.add(blankSymbol); } head = tape.listIterator(); head.next(); head.previous(); StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0)); while (transitions.containsKey(tsp)) { System.out.println(this + " --- " + transitions.get(tsp)); Transition trans = transitions.get(tsp); head.set(trans.to.tapeSymbol); tsp.state = trans.to.state; if (trans.direction == -1) { if (!head.hasPrevious()) { head.add(blankSymbol); } tsp.tapeSymbol = head.previous(); } else if (trans.direction == 1) { head.next(); if (!head.hasNext()) { head.add(blankSymbol); head.previous(); } tsp.tapeSymbol = head.next(); head.previous(); } else { tsp.tapeSymbol = trans.to.tapeSymbol; } } System.out.println(this + " --- " + tsp); if (terminalStates.contains(tsp.state)) { return tape; } else { return null; } } @Override public String toString() { try { int headPos = head.previousIndex(); String s = "[ "; for (int i = 0; i <= headPos; i++) { s += tape.get(i) + " "; } s += "[H] "; for (int i = headPos + 1; i < tape.size(); i++) { s += tape.get(i) + " "; } return s + "]"; } catch (Exception e) { return ""; } } public static void main(String[] args) { String init = "q0"; String blank = "b"; Set<String> term = new HashSet<String>(); term.add("qf"); Set<Transition> trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0)); UTM machine = new UTM(trans, term, init, blank); machine.initializeTape("111"); System.out.println("Output (si): " + machine.runTM() + "\n"); init = "a"; term.clear(); term.add("halt"); blank = "0"; trans.clear(); trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0)); machine = new UTM(trans, term, init, blank); machine.initializeTape(""); System.out.println("Output (bb): " + machine.runTM()); init = "s0"; blank = "*"; term = new HashSet<String>(); term.add("see"); trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1)); machine = new UTM(trans, term, init, blank); machine.initializeTape("babbababaa"); System.out.println("Output (sort): " + machine.runTM() + "\n"); } }
Convert the following code from Python to Java, ensuring the logic remains intact.
from __future__ import print_function def run_utm( state = None, blank = None, rules = [], tape = [], halt = None, pos = 0): st = state if not tape: tape = [blank] if pos < 0: pos += len(tape) if pos >= len(tape) or pos < 0: raise Error( "bad init position") rules = dict(((s0, v0), (v1, dr, s1)) for (s0, v0, v1, dr, s1) in rules) while True: print(st, '\t', end=" ") for i, v in enumerate(tape): if i == pos: print("[%s]" % (v,), end=" ") else: print(v, end=" ") print() if st == halt: break if (st, tape[pos]) not in rules: break (v1, dr, s1) = rules[(st, tape[pos])] tape[pos] = v1 if dr == 'left': if pos > 0: pos -= 1 else: tape.insert(0, blank) if dr == 'right': pos += 1 if pos >= len(tape): tape.append(blank) st = s1 print("incr machine\n") run_utm( halt = 'qf', state = 'q0', tape = list("111"), blank = 'B', rules = map(tuple, ["q0 1 1 right q0".split(), "q0 B 1 stay qf".split()] ) ) print("\nbusy beaver\n") run_utm( halt = 'halt', state = 'a', blank = '0', rules = map(tuple, ["a 0 1 right b".split(), "a 1 1 left c".split(), "b 0 1 left a".split(), "b 1 1 right b".split(), "c 0 1 left b".split(), "c 1 1 stay halt".split()] ) ) print("\nsorting test\n") run_utm(halt = 'STOP', state = 'A', blank = '0', tape = "2 2 2 1 2 2 1 2 1 2 1 2 1 2".split(), rules = map(tuple, ["A 1 1 right A".split(), "A 2 3 right B".split(), "A 0 0 left E".split(), "B 1 1 right B".split(), "B 2 2 right B".split(), "B 0 0 left C".split(), "C 1 2 left D".split(), "C 2 2 left C".split(), "C 3 2 left E".split(), "D 1 1 left D".split(), "D 2 2 left D".split(), "D 3 1 right A".split(), "E 1 1 left E".split(), "E 0 0 right STOP".split()] ) )
import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.ListIterator; import java.util.List; import java.util.Set; import java.util.Map; public class UTM { private List<String> tape; private String blankSymbol; private ListIterator<String> head; private Map<StateTapeSymbolPair, Transition> transitions = new HashMap<StateTapeSymbolPair, Transition>(); private Set<String> terminalStates; private String initialState; public UTM(Set<Transition> transitions, Set<String> terminalStates, String initialState, String blankSymbol) { this.blankSymbol = blankSymbol; for (Transition t : transitions) { this.transitions.put(t.from, t); } this.terminalStates = terminalStates; this.initialState = initialState; } public static class StateTapeSymbolPair { private String state; private String tapeSymbol; public StateTapeSymbolPair(String state, String tapeSymbol) { this.state = state; this.tapeSymbol = tapeSymbol; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + ((state == null) ? 0 : state.hashCode()); result = prime * result + ((tapeSymbol == null) ? 0 : tapeSymbol .hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; StateTapeSymbolPair other = (StateTapeSymbolPair) obj; if (state == null) { if (other.state != null) return false; } else if (!state.equals(other.state)) return false; if (tapeSymbol == null) { if (other.tapeSymbol != null) return false; } else if (!tapeSymbol.equals(other.tapeSymbol)) return false; return true; } @Override public String toString() { return "(" + state + "," + tapeSymbol + ")"; } } public static class Transition { private StateTapeSymbolPair from; private StateTapeSymbolPair to; private int direction; public Transition(StateTapeSymbolPair from, StateTapeSymbolPair to, int direction) { this.from = from; this.to = to; this.direction = direction; } @Override public String toString() { return from + "=>" + to + "/" + direction; } } public void initializeTape(List<String> input) { tape = input; } public void initializeTape(String input) { tape = new LinkedList<String>(); for (int i = 0; i < input.length(); i++) { tape.add(input.charAt(i) + ""); } } public List<String> runTM() { if (tape.size() == 0) { tape.add(blankSymbol); } head = tape.listIterator(); head.next(); head.previous(); StateTapeSymbolPair tsp = new StateTapeSymbolPair(initialState, tape.get(0)); while (transitions.containsKey(tsp)) { System.out.println(this + " --- " + transitions.get(tsp)); Transition trans = transitions.get(tsp); head.set(trans.to.tapeSymbol); tsp.state = trans.to.state; if (trans.direction == -1) { if (!head.hasPrevious()) { head.add(blankSymbol); } tsp.tapeSymbol = head.previous(); } else if (trans.direction == 1) { head.next(); if (!head.hasNext()) { head.add(blankSymbol); head.previous(); } tsp.tapeSymbol = head.next(); head.previous(); } else { tsp.tapeSymbol = trans.to.tapeSymbol; } } System.out.println(this + " --- " + tsp); if (terminalStates.contains(tsp.state)) { return tape; } else { return null; } } @Override public String toString() { try { int headPos = head.previousIndex(); String s = "[ "; for (int i = 0; i <= headPos; i++) { s += tape.get(i) + " "; } s += "[H] "; for (int i = headPos + 1; i < tape.size(); i++) { s += tape.get(i) + " "; } return s + "]"; } catch (Exception e) { return ""; } } public static void main(String[] args) { String init = "q0"; String blank = "b"; Set<String> term = new HashSet<String>(); term.add("qf"); Set<Transition> trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("q0", "1"), new StateTapeSymbolPair("q0", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("q0", "b"), new StateTapeSymbolPair("qf", "1"), 0)); UTM machine = new UTM(trans, term, init, blank); machine.initializeTape("111"); System.out.println("Output (si): " + machine.runTM() + "\n"); init = "a"; term.clear(); term.add("halt"); blank = "0"; trans.clear(); trans.add(new Transition(new StateTapeSymbolPair("a", "0"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("a", "1"), new StateTapeSymbolPair("c", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "0"), new StateTapeSymbolPair("a", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("b", "1"), new StateTapeSymbolPair("b", "1"), 1)); trans.add(new Transition(new StateTapeSymbolPair("c", "0"), new StateTapeSymbolPair("b", "1"), -1)); trans.add(new Transition(new StateTapeSymbolPair("c", "1"), new StateTapeSymbolPair("halt", "1"), 0)); machine = new UTM(trans, term, init, blank); machine.initializeTape(""); System.out.println("Output (bb): " + machine.runTM()); init = "s0"; blank = "*"; term = new HashSet<String>(); term.add("see"); trans = new HashSet<Transition>(); trans.add(new Transition(new StateTapeSymbolPair("s0", "a"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "b"), new StateTapeSymbolPair("s1", "B"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s0", "*"), new StateTapeSymbolPair("se", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "a"), new StateTapeSymbolPair("s1", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "b"), new StateTapeSymbolPair("s1", "b"), 1)); trans.add(new Transition(new StateTapeSymbolPair("s1", "*"), new StateTapeSymbolPair("s2", "*"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "a"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "b"), new StateTapeSymbolPair("s2", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s2", "B"), new StateTapeSymbolPair("se", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "a"), new StateTapeSymbolPair("s3", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "b"), new StateTapeSymbolPair("s3", "b"), -1)); trans.add(new Transition(new StateTapeSymbolPair("s3", "B"), new StateTapeSymbolPair("s0", "a"), 1)); trans.add(new Transition(new StateTapeSymbolPair("se", "a"), new StateTapeSymbolPair("se", "a"), -1)); trans.add(new Transition(new StateTapeSymbolPair("se", "*"), new StateTapeSymbolPair("see", "*"), 1)); machine = new UTM(trans, term, init, blank); machine.initializeTape("babbababaa"); System.out.println("Output (sort): " + machine.runTM() + "\n"); } }
Change the following Python code into Java without altering its purpose.
import os for directory in ['/', './']: open(directory + 'output.txt', 'w').close() os.mkdir(directory + 'docs')
import java.io.*; public class CreateFileTest { public static void main(String args[]) { try { new File("output.txt").createNewFile(); new File(File.separator + "output.txt").createNewFile(); new File("docs").mkdir(); new File(File.separator + "docs").mkdir(); } catch (IOException e) { System.err.println(e.getMessage()); } } }
Produce a language-to-language conversion: from Python to Java, same semantics.
from itertools import count, islice def primes(_cache=[2, 3]): yield from _cache for n in count(_cache[-1]+2, 2): if isprime(n): _cache.append(n) yield n def isprime(n, _seen={0: False, 1: False}): def _isprime(n): for p in primes(): if p*p > n: return True if n%p == 0: return False if n not in _seen: _seen[n] = _isprime(n) return _seen[n] def unprime(): for a in count(1): d = 1 while d <= a: base = (a//(d*10))*(d*10) + (a%d) if any(isprime(y) for y in range(base, base + d*10, d)): break d *= 10 else: yield a print('First 35:') print(' '.join(str(i) for i in islice(unprime(), 35))) print('\nThe 600-th:') print(list(islice(unprime(), 599, 600))[0]) print() first, need = [False]*10, 10 for p in unprime(): i = p%10 if first[i]: continue first[i] = p need -= 1 if not need: break for i,v in enumerate(first): print(f'{i} ending: {v}')
public class UnprimeableNumbers { private static int MAX = 10_000_000; private static boolean[] primes = new boolean[MAX]; public static void main(String[] args) { sieve(); System.out.println("First 35 unprimeable numbers:"); displayUnprimeableNumbers(35); int n = 600; System.out.printf("%nThe %dth unprimeable number = %,d%n%n", n, nthUnprimeableNumber(n)); int[] lowest = genLowest(); System.out.println("Least unprimeable number that ends in:"); for ( int i = 0 ; i <= 9 ; i++ ) { System.out.printf(" %d is %,d%n", i, lowest[i]); } } private static int[] genLowest() { int[] lowest = new int[10]; int count = 0; int test = 1; while ( count < 10 ) { test++; if ( unPrimable(test) && lowest[test % 10] == 0 ) { lowest[test % 10] = test; count++; } } return lowest; } private static int nthUnprimeableNumber(int maxCount) { int test = 1; int count = 0; int result = 0; while ( count < maxCount ) { test++; if ( unPrimable(test) ) { count++; result = test; } } return result; } private static void displayUnprimeableNumbers(int maxCount) { int test = 1; int count = 0; while ( count < maxCount ) { test++; if ( unPrimable(test) ) { count++; System.out.printf("%d ", test); } } System.out.println(); } private static boolean unPrimable(int test) { if ( primes[test] ) { return false; } String s = test + ""; for ( int i = 0 ; i < s.length() ; i++ ) { for ( int j = 0 ; j <= 9 ; j++ ) { if ( primes[Integer.parseInt(replace(s, i, j))] ) { return false; } } } return true; } private static String replace(String str, int position, int value) { char[] sChar = str.toCharArray(); sChar[position] = (char) value; return str.substring(0, position) + value + str.substring(position + 1); } private static final void sieve() { for ( int i = 2 ; i < MAX ; i++ ) { primes[i] = true; } for ( int i = 2 ; i < MAX ; i++ ) { if ( primes[i] ) { for ( int j = 2*i ; j < MAX ; j += i ) { primes[j] = false; } } } } }
Produce a language-to-language conversion: from Python to Java, same semantics.
def combine( snl, snr ): cl = {} if isinstance(snl, int): cl['1'] = snl elif isinstance(snl, string): cl[snl] = 1 else: cl.update( snl) if isinstance(snr, int): n = cl.get('1', 0) cl['1'] = n + snr elif isinstance(snr, string): n = cl.get(snr, 0) cl[snr] = n + 1 else: for k,v in snr.items(): n = cl.get(k, 0) cl[k] = n+v return cl def constrain(nsum, vn ): nn = {} nn.update(vn) n = nn.get('1', 0) nn['1'] = n - nsum return nn def makeMatrix( constraints ): vmap = set() for c in constraints: vmap.update( c.keys()) vmap.remove('1') nvars = len(vmap) vmap = sorted(vmap) mtx = [] for c in constraints: row = [] for vv in vmap: row.append(float(c.get(vv, 0))) row.append(-float(c.get('1',0))) mtx.append(row) if len(constraints) == nvars: print 'System appears solvable' elif len(constraints) < nvars: print 'System is not solvable - needs more constraints.' return mtx, vmap def SolvePyramid( vl, cnstr ): vl.reverse() constraints = [cnstr] lvls = len(vl) for lvln in range(1,lvls): lvd = vl[lvln] for k in range(lvls - lvln): sn = lvd[k] ll = vl[lvln-1] vn = combine(ll[k], ll[k+1]) if sn is None: lvd[k] = vn else: constraints.append(constrain( sn, vn )) print 'Constraint Equations:' for cstr in constraints: fset = ('%d*%s'%(v,k) for k,v in cstr.items() ) print ' + '.join(fset), ' = 0' mtx,vmap = makeMatrix(constraints) MtxSolve(mtx) d = len(vmap) for j in range(d): print vmap[j],'=', mtx[j][d] def MtxSolve(mtx): mDim = len(mtx) for j in range(mDim): rw0= mtx[j] f = 1.0/rw0[j] for k in range(j, mDim+1): rw0[k] *= f for l in range(1+j,mDim): rwl = mtx[l] f = -rwl[j] for k in range(j, mDim+1): rwl[k] += f * rw0[k] for j1 in range(1,mDim): j = mDim - j1 rw0= mtx[j] for l in range(0, j): rwl = mtx[l] f = -rwl[j] rwl[j] += f * rw0[j] rwl[mDim] += f * rw0[mDim] return mtx p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ] addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 } SolvePyramid( p, addlConstraint)
import java.util.ArrayList; import java.util.Arrays; import java.util.List; public class PascalsTrianglePuzzle { public static void main(String[] args) { Matrix mat = new Matrix(Arrays.asList(1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d, 0d), Arrays.asList(0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 1d, -1d), Arrays.asList(0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d), Arrays.asList(1d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, -1d, 0d, 1d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 1d, 1d, 0d, 0d, 0d)); List<Double> b = Arrays.asList(11d, 11d, 0d, 4d, 4d, 40d, 0d, 0d, 40d, 0d, 151d); List<Double> solution = cramersRule(mat, b); System.out.println("Solution = " + cramersRule(mat, b)); System.out.printf("X = %.2f%n", solution.get(8)); System.out.printf("Y = %.2f%n", solution.get(9)); System.out.printf("Z = %.2f%n", solution.get(10)); } private static List<Double> cramersRule(Matrix matrix, List<Double> b) { double denominator = matrix.determinant(); List<Double> result = new ArrayList<>(); for ( int i = 0 ; i < b.size() ; i++ ) { result.add(matrix.replaceColumn(b, i).determinant() / denominator); } return result; } private static class Matrix { private List<List<Double>> matrix; @Override public String toString() { return matrix.toString(); } @SafeVarargs public Matrix(List<Double> ... lists) { matrix = new ArrayList<>(); for ( List<Double> list : lists) { matrix.add(list); } } public Matrix(List<List<Double>> mat) { matrix = mat; } public double determinant() { if ( matrix.size() == 1 ) { return get(0, 0); } if ( matrix.size() == 2 ) { return get(0, 0) * get(1, 1) - get(0, 1) * get(1, 0); } double sum = 0; double sign = 1; for ( int i = 0 ; i < matrix.size() ; i++ ) { sum += sign * get(0, i) * coFactor(0, i).determinant(); sign *= -1; } return sum; } private Matrix coFactor(int row, int col) { List<List<Double>> mat = new ArrayList<>(); for ( int i = 0 ; i < matrix.size() ; i++ ) { if ( i == row ) { continue; } List<Double> list = new ArrayList<>(); for ( int j = 0 ; j < matrix.size() ; j++ ) { if ( j == col ) { continue; } list.add(get(i, j)); } mat.add(list); } return new Matrix(mat); } private Matrix replaceColumn(List<Double> b, int column) { List<List<Double>> mat = new ArrayList<>(); for ( int row = 0 ; row < matrix.size() ; row++ ) { List<Double> list = new ArrayList<>(); for ( int col = 0 ; col < matrix.size() ; col++ ) { double value = get(row, col); if ( col == column ) { value = b.get(row); } list.add(value); } mat.add(list); } return new Matrix(mat); } private double get(int row, int col) { return matrix.get(row).get(col); } } }
Preserve the algorithm and functionality while converting the code from Python to Java.
def combine( snl, snr ): cl = {} if isinstance(snl, int): cl['1'] = snl elif isinstance(snl, string): cl[snl] = 1 else: cl.update( snl) if isinstance(snr, int): n = cl.get('1', 0) cl['1'] = n + snr elif isinstance(snr, string): n = cl.get(snr, 0) cl[snr] = n + 1 else: for k,v in snr.items(): n = cl.get(k, 0) cl[k] = n+v return cl def constrain(nsum, vn ): nn = {} nn.update(vn) n = nn.get('1', 0) nn['1'] = n - nsum return nn def makeMatrix( constraints ): vmap = set() for c in constraints: vmap.update( c.keys()) vmap.remove('1') nvars = len(vmap) vmap = sorted(vmap) mtx = [] for c in constraints: row = [] for vv in vmap: row.append(float(c.get(vv, 0))) row.append(-float(c.get('1',0))) mtx.append(row) if len(constraints) == nvars: print 'System appears solvable' elif len(constraints) < nvars: print 'System is not solvable - needs more constraints.' return mtx, vmap def SolvePyramid( vl, cnstr ): vl.reverse() constraints = [cnstr] lvls = len(vl) for lvln in range(1,lvls): lvd = vl[lvln] for k in range(lvls - lvln): sn = lvd[k] ll = vl[lvln-1] vn = combine(ll[k], ll[k+1]) if sn is None: lvd[k] = vn else: constraints.append(constrain( sn, vn )) print 'Constraint Equations:' for cstr in constraints: fset = ('%d*%s'%(v,k) for k,v in cstr.items() ) print ' + '.join(fset), ' = 0' mtx,vmap = makeMatrix(constraints) MtxSolve(mtx) d = len(vmap) for j in range(d): print vmap[j],'=', mtx[j][d] def MtxSolve(mtx): mDim = len(mtx) for j in range(mDim): rw0= mtx[j] f = 1.0/rw0[j] for k in range(j, mDim+1): rw0[k] *= f for l in range(1+j,mDim): rwl = mtx[l] f = -rwl[j] for k in range(j, mDim+1): rwl[k] += f * rw0[k] for j1 in range(1,mDim): j = mDim - j1 rw0= mtx[j] for l in range(0, j): rwl = mtx[l] f = -rwl[j] rwl[j] += f * rw0[j] rwl[mDim] += f * rw0[mDim] return mtx p = [ [151], [None,None], [40,None,None], [None,None,None,None], ['X', 11, 'Y', 4, 'Z'] ] addlConstraint = { 'X':1, 'Y':-1, 'Z':1, '1':0 } SolvePyramid( p, addlConstraint)
import java.util.ArrayList; import java.util.Arrays; import java.util.List; public class PascalsTrianglePuzzle { public static void main(String[] args) { Matrix mat = new Matrix(Arrays.asList(1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d, 0d), Arrays.asList(0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 1d, -1d), Arrays.asList(0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d, 0d), Arrays.asList(0d, 0d, 0d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, -1d), Arrays.asList(1d, 1d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, -1d, 0d, 1d, 0d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 1d, 1d, 0d, -1d, 0d, 0d, 0d), Arrays.asList(0d, 0d, 0d, 0d, 0d, 0d, 1d, 1d, 0d, 0d, 0d)); List<Double> b = Arrays.asList(11d, 11d, 0d, 4d, 4d, 40d, 0d, 0d, 40d, 0d, 151d); List<Double> solution = cramersRule(mat, b); System.out.println("Solution = " + cramersRule(mat, b)); System.out.printf("X = %.2f%n", solution.get(8)); System.out.printf("Y = %.2f%n", solution.get(9)); System.out.printf("Z = %.2f%n", solution.get(10)); } private static List<Double> cramersRule(Matrix matrix, List<Double> b) { double denominator = matrix.determinant(); List<Double> result = new ArrayList<>(); for ( int i = 0 ; i < b.size() ; i++ ) { result.add(matrix.replaceColumn(b, i).determinant() / denominator); } return result; } private static class Matrix { private List<List<Double>> matrix; @Override public String toString() { return matrix.toString(); } @SafeVarargs public Matrix(List<Double> ... lists) { matrix = new ArrayList<>(); for ( List<Double> list : lists) { matrix.add(list); } } public Matrix(List<List<Double>> mat) { matrix = mat; } public double determinant() { if ( matrix.size() == 1 ) { return get(0, 0); } if ( matrix.size() == 2 ) { return get(0, 0) * get(1, 1) - get(0, 1) * get(1, 0); } double sum = 0; double sign = 1; for ( int i = 0 ; i < matrix.size() ; i++ ) { sum += sign * get(0, i) * coFactor(0, i).determinant(); sign *= -1; } return sum; } private Matrix coFactor(int row, int col) { List<List<Double>> mat = new ArrayList<>(); for ( int i = 0 ; i < matrix.size() ; i++ ) { if ( i == row ) { continue; } List<Double> list = new ArrayList<>(); for ( int j = 0 ; j < matrix.size() ; j++ ) { if ( j == col ) { continue; } list.add(get(i, j)); } mat.add(list); } return new Matrix(mat); } private Matrix replaceColumn(List<Double> b, int column) { List<List<Double>> mat = new ArrayList<>(); for ( int row = 0 ; row < matrix.size() ; row++ ) { List<Double> list = new ArrayList<>(); for ( int col = 0 ; col < matrix.size() ; col++ ) { double value = get(row, col); if ( col == column ) { value = b.get(row); } list.add(value); } mat.add(list); } return new Matrix(mat); } private double get(int row, int col) { return matrix.get(row).get(col); } } }
Convert this Python block to Java, preserving its control flow and logic.
from sympy import isprime def primality_pretest(k): if not (k % 3) or not (k % 5) or not (k % 7) or not (k % 11) or not(k % 13) or not (k % 17) or not (k % 19) or not (k % 23): return (k <= 23) return True def is_chernick(n, m): t = 9 * m if not primality_pretest(6 * m + 1): return False if not primality_pretest(12 * m + 1): return False for i in range(1,n-1): if not primality_pretest((t << i) + 1): return False if not isprime(6 * m + 1): return False if not isprime(12 * m + 1): return False for i in range(1,n - 1): if not isprime((t << i) + 1): return False return True for n in range(3,10): if n > 4: multiplier = 1 << (n - 4) else: multiplier = 1 if n > 5: multiplier *= 5 k = 1 while True: m = k * multiplier if is_chernick(n, m): print("a("+str(n)+") has m = "+str(m)) break k += 1
import java.math.BigInteger; import java.util.ArrayList; import java.util.List; public class ChernicksCarmichaelNumbers { public static void main(String[] args) { for ( long n = 3 ; n < 10 ; n++ ) { long m = 0; boolean foundComposite = true; List<Long> factors = null; while ( foundComposite ) { m += (n <= 4 ? 1 : (long) Math.pow(2, n-4) * 5); factors = U(n, m); foundComposite = false; for ( long factor : factors ) { if ( ! isPrime(factor) ) { foundComposite = true; break; } } } System.out.printf("U(%d, %d) = %s = %s %n", n, m, display(factors), multiply(factors)); } } private static String display(List<Long> factors) { return factors.toString().replace("[", "").replace("]", "").replaceAll(", ", " * "); } private static BigInteger multiply(List<Long> factors) { BigInteger result = BigInteger.ONE; for ( long factor : factors ) { result = result.multiply(BigInteger.valueOf(factor)); } return result; } private static List<Long> U(long n, long m) { List<Long> factors = new ArrayList<>(); factors.add(6*m + 1); factors.add(12*m + 1); for ( int i = 1 ; i <= n-2 ; i++ ) { factors.add(((long)Math.pow(2, i)) * 9 * m + 1); } return factors; } private static final int MAX = 100_000; private static final boolean[] primes = new boolean[MAX]; private static boolean SIEVE_COMPLETE = false; private static final boolean isPrimeTrivial(long test) { if ( ! SIEVE_COMPLETE ) { sieve(); SIEVE_COMPLETE = true; } return primes[(int) test]; } private static final void sieve() { for ( int i = 2 ; i < MAX ; i++ ) { primes[i] = true; } for ( int i = 2 ; i < MAX ; i++ ) { if ( primes[i] ) { for ( int j = 2*i ; j < MAX ; j += i ) { primes[j] = false; } } } } public static final boolean isPrime(long testValue) { if ( testValue == 2 ) return true; if ( testValue % 2 == 0 ) return false; if ( testValue <= MAX ) return isPrimeTrivial(testValue); long d = testValue-1; int s = 0; while ( d % 2 == 0 ) { s += 1; d /= 2; } if ( testValue < 1373565L ) { if ( ! aSrp(2, s, d, testValue) ) { return false; } if ( ! aSrp(3, s, d, testValue) ) { return false; } return true; } if ( testValue < 4759123141L ) { if ( ! aSrp(2, s, d, testValue) ) { return false; } if ( ! aSrp(7, s, d, testValue) ) { return false; } if ( ! aSrp(61, s, d, testValue) ) { return false; } return true; } if ( testValue < 10000000000000000L ) { if ( ! aSrp(3, s, d, testValue) ) { return false; } if ( ! aSrp(24251, s, d, testValue) ) { return false; } return true; } if ( ! aSrp(37, s, d, testValue) ) { return false; } if ( ! aSrp(47, s, d, testValue) ) { return false; } if ( ! aSrp(61, s, d, testValue) ) { return false; } if ( ! aSrp(73, s, d, testValue) ) { return false; } if ( ! aSrp(83, s, d, testValue) ) { return false; } return true; } private static final boolean aSrp(int a, int s, long d, long n) { long modPow = modPow(a, d, n); if ( modPow == 1 ) { return true; } int twoExpR = 1; for ( int r = 0 ; r < s ; r++ ) { if ( modPow(modPow, twoExpR, n) == n-1 ) { return true; } twoExpR *= 2; } return false; } private static final long SQRT = (long) Math.sqrt(Long.MAX_VALUE); public static final long modPow(long base, long exponent, long modulus) { long result = 1; while ( exponent > 0 ) { if ( exponent % 2 == 1 ) { if ( result > SQRT || base > SQRT ) { result = multiply(result, base, modulus); } else { result = (result * base) % modulus; } } exponent >>= 1; if ( base > SQRT ) { base = multiply(base, base, modulus); } else { base = (base * base) % modulus; } } return result; } public static final long multiply(long a, long b, long modulus) { long x = 0; long y = a % modulus; long t; while ( b > 0 ) { if ( b % 2 == 1 ) { t = x + y; x = (t > modulus ? t-modulus : t); } t = y << 1; y = (t > modulus ? t-modulus : t); b >>= 1; } return x % modulus; } }
Port the provided Python code into Java while preserving the original functionality.
from sympy.geometry import Point, Triangle def sign(pt1, pt2, pt3): return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y) def iswithin(point, pt1, pt2, pt3): zval1 = sign(point, pt1, pt2) zval2 = sign(point, pt2, pt3) zval3 = sign(point, pt3, pt1) notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0 notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0 return notanyneg or notanypos if __name__ == "__main__": POINTS = [Point(0, 0)] TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5)) for pnt in POINTS: a, b, c = TRI.vertices isornot = "is" if iswithin(pnt, a, b, c) else "is not" print("Point", pnt, isornot, "within the triangle", TRI)
import java.util.Objects; public class FindTriangle { private static final double EPS = 0.001; private static final double EPS_SQUARE = EPS * EPS; public static class Point { private final double x, y; public Point(double x, double y) { this.x = x; this.y = y; } public double getX() { return x; } public double getY() { return y; } @Override public String toString() { return String.format("(%f, %f)", x, y); } } public static class Triangle { private final Point p1, p2, p3; public Triangle(Point p1, Point p2, Point p3) { this.p1 = Objects.requireNonNull(p1); this.p2 = Objects.requireNonNull(p2); this.p3 = Objects.requireNonNull(p3); } public Point getP1() { return p1; } public Point getP2() { return p2; } public Point getP3() { return p3; } private boolean pointInTriangleBoundingBox(Point p) { var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS; var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS; var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS; var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS; return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY()); } private static double side(Point p1, Point p2, Point p) { return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY()); } private boolean nativePointInTriangle(Point p) { boolean checkSide1 = side(p1, p2, p) >= 0; boolean checkSide2 = side(p2, p3, p) >= 0; boolean checkSide3 = side(p3, p1, p) >= 0; return checkSide1 && checkSide2 && checkSide3; } private double distanceSquarePointToSegment(Point p1, Point p2, Point p) { double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY()); double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength; if (dotProduct < 0) { return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY()); } if (dotProduct <= 1) { double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY()); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY()); } private boolean accuratePointInTriangle(Point p) { if (!pointInTriangleBoundingBox(p)) { return false; } if (nativePointInTriangle(p)) { return true; } if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) { return true; } return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE; } public boolean within(Point p) { Objects.requireNonNull(p); return accuratePointInTriangle(p); } @Override public String toString() { return String.format("Triangle[%s, %s, %s]", p1, p2, p3); } } private static void test(Triangle t, Point p) { System.out.println(t); System.out.printf("Point %s is within triangle? %s\n", p, t.within(p)); } public static void main(String[] args) { var p1 = new Point(1.5, 2.4); var p2 = new Point(5.1, -3.1); var p3 = new Point(-3.8, 1.2); var tri = new Triangle(p1, p2, p3); test(tri, new Point(0, 0)); test(tri, new Point(0, 1)); test(tri, new Point(3, 1)); System.out.println(); p1 = new Point(1.0 / 10, 1.0 / 9); p2 = new Point(100.0 / 8, 100.0 / 3); p3 = new Point(100.0 / 4, 100.0 / 9); tri = new Triangle(p1, p2, p3); var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY())); test(tri, pt); System.out.println(); p3 = new Point(-100.0 / 8, 100.0 / 6); tri = new Triangle(p1, p2, p3); test(tri, pt); } }
Rewrite the snippet below in Java so it works the same as the original Python code.
from sympy.geometry import Point, Triangle def sign(pt1, pt2, pt3): return (pt1.x - pt3.x) * (pt2.y - pt3.y) - (pt2.x - pt3.x) * (pt1.y - pt3.y) def iswithin(point, pt1, pt2, pt3): zval1 = sign(point, pt1, pt2) zval2 = sign(point, pt2, pt3) zval3 = sign(point, pt3, pt1) notanyneg = zval1 >= 0 and zval2 >= 0 and zval3 >= 0 notanypos = zval1 <= 0 and zval2 <= 0 and zval3 <= 0 return notanyneg or notanypos if __name__ == "__main__": POINTS = [Point(0, 0)] TRI = Triangle(Point(1.5, 2.4), Point(5.1, -3.1), Point(-3.8, 0.5)) for pnt in POINTS: a, b, c = TRI.vertices isornot = "is" if iswithin(pnt, a, b, c) else "is not" print("Point", pnt, isornot, "within the triangle", TRI)
import java.util.Objects; public class FindTriangle { private static final double EPS = 0.001; private static final double EPS_SQUARE = EPS * EPS; public static class Point { private final double x, y; public Point(double x, double y) { this.x = x; this.y = y; } public double getX() { return x; } public double getY() { return y; } @Override public String toString() { return String.format("(%f, %f)", x, y); } } public static class Triangle { private final Point p1, p2, p3; public Triangle(Point p1, Point p2, Point p3) { this.p1 = Objects.requireNonNull(p1); this.p2 = Objects.requireNonNull(p2); this.p3 = Objects.requireNonNull(p3); } public Point getP1() { return p1; } public Point getP2() { return p2; } public Point getP3() { return p3; } private boolean pointInTriangleBoundingBox(Point p) { var xMin = Math.min(p1.getX(), Math.min(p2.getX(), p3.getX())) - EPS; var xMax = Math.max(p1.getX(), Math.max(p2.getX(), p3.getX())) + EPS; var yMin = Math.min(p1.getY(), Math.min(p2.getY(), p3.getY())) - EPS; var yMax = Math.max(p1.getY(), Math.max(p2.getY(), p3.getY())) + EPS; return !(p.getX() < xMin || xMax < p.getX() || p.getY() < yMin || yMax < p.getY()); } private static double side(Point p1, Point p2, Point p) { return (p2.getY() - p1.getY()) * (p.getX() - p1.getX()) + (-p2.getX() + p1.getX()) * (p.getY() - p1.getY()); } private boolean nativePointInTriangle(Point p) { boolean checkSide1 = side(p1, p2, p) >= 0; boolean checkSide2 = side(p2, p3, p) >= 0; boolean checkSide3 = side(p3, p1, p) >= 0; return checkSide1 && checkSide2 && checkSide3; } private double distanceSquarePointToSegment(Point p1, Point p2, Point p) { double p1_p2_squareLength = (p2.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p2.getY() - p1.getY()) * (p2.getY() - p1.getY()); double dotProduct = ((p.getX() - p1.getX()) * (p2.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p2.getY() - p1.getY())) / p1_p2_squareLength; if (dotProduct < 0) { return (p.getX() - p1.getX()) * (p.getX() - p1.getX()) + (p.getY() - p1.getY()) * (p.getY() - p1.getY()); } if (dotProduct <= 1) { double p_p1_squareLength = (p1.getX() - p.getX()) * (p1.getX() - p.getX()) + (p1.getY() - p.getY()) * (p1.getY() - p.getY()); return p_p1_squareLength - dotProduct * dotProduct * p1_p2_squareLength; } return (p.getX() - p2.getX()) * (p.getX() - p2.getX()) + (p.getY() - p2.getY()) * (p.getY() - p2.getY()); } private boolean accuratePointInTriangle(Point p) { if (!pointInTriangleBoundingBox(p)) { return false; } if (nativePointInTriangle(p)) { return true; } if (distanceSquarePointToSegment(p1, p2, p) <= EPS_SQUARE) { return true; } if (distanceSquarePointToSegment(p2, p3, p) <= EPS_SQUARE) { return true; } return distanceSquarePointToSegment(p3, p1, p) <= EPS_SQUARE; } public boolean within(Point p) { Objects.requireNonNull(p); return accuratePointInTriangle(p); } @Override public String toString() { return String.format("Triangle[%s, %s, %s]", p1, p2, p3); } } private static void test(Triangle t, Point p) { System.out.println(t); System.out.printf("Point %s is within triangle? %s\n", p, t.within(p)); } public static void main(String[] args) { var p1 = new Point(1.5, 2.4); var p2 = new Point(5.1, -3.1); var p3 = new Point(-3.8, 1.2); var tri = new Triangle(p1, p2, p3); test(tri, new Point(0, 0)); test(tri, new Point(0, 1)); test(tri, new Point(3, 1)); System.out.println(); p1 = new Point(1.0 / 10, 1.0 / 9); p2 = new Point(100.0 / 8, 100.0 / 3); p3 = new Point(100.0 / 4, 100.0 / 9); tri = new Triangle(p1, p2, p3); var pt = new Point(p1.getX() + (3.0 / 7) * (p2.getX() - p1.getX()), p1.getY() + (3.0 / 7) * (p2.getY() - p1.getY())); test(tri, pt); System.out.println(); p3 = new Point(-100.0 / 8, 100.0 / 6); tri = new Triangle(p1, p2, p3); test(tri, pt); } }
Rewrite the snippet below in Java so it works the same as the original Python code.
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
public class TauFunction { private static long divisorCount(long n) { long total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (long p = 3; p * p <= n; p += 2) { long count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } public static void main(String[] args) { final int limit = 100; System.out.printf("Count of divisors for the first %d positive integers:\n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%3d", divisorCount(n)); if (n % 20 == 0) { System.out.println(); } } } }
Produce a functionally identical Java code for the snippet given in Python.
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
public class TauFunction { private static long divisorCount(long n) { long total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (long p = 3; p * p <= n; p += 2) { long count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } public static void main(String[] args) { final int limit = 100; System.out.printf("Count of divisors for the first %d positive integers:\n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%3d", divisorCount(n)); if (n % 20 == 0) { System.out.println(); } } } }
Convert this Python block to Java, preserving its control flow and logic.
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def tau(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= 1 + k return ans if __name__ == "__main__": print(*map(tau, range(1, 101)))
public class TauFunction { private static long divisorCount(long n) { long total = 1; for (; (n & 1) == 0; n >>= 1) { ++total; } for (long p = 3; p * p <= n; p += 2) { long count = 1; for (; n % p == 0; n /= p) { ++count; } total *= count; } if (n > 1) { total *= 2; } return total; } public static void main(String[] args) { final int limit = 100; System.out.printf("Count of divisors for the first %d positive integers:\n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%3d", divisorCount(n)); if (n % 20 == 0) { System.out.println(); } } } }
Can you help me rewrite this code in Java instead of Python, keeping it the same logically?
import pyprimes def primorial_prime(_pmax=500): isprime = pyprimes.isprime n, primo = 0, 1 for prime in pyprimes.nprimes(_pmax): n, primo = n+1, primo * prime if isprime(primo-1) or isprime(primo+1): yield n if __name__ == '__main__': pyprimes.warn_probably = False for i, n in zip(range(20), primorial_prime()): print('Primorial prime %2i at primorial index: %3i' % (i+1, n))
import java.math.BigInteger; public class PrimorialPrimes { final static int sieveLimit = 1550_000; static boolean[] notPrime = sieve(sieveLimit); public static void main(String[] args) { int count = 0; for (int i = 1; i < 1000_000 && count < 20; i++) { BigInteger b = primorial(i); if (b.add(BigInteger.ONE).isProbablePrime(1) || b.subtract(BigInteger.ONE).isProbablePrime(1)) { System.out.printf("%d ", i); count++; } } } static BigInteger primorial(int n) { if (n == 0) return BigInteger.ONE; BigInteger result = BigInteger.ONE; for (int i = 0; i < sieveLimit && n > 0; i++) { if (notPrime[i]) continue; result = result.multiply(BigInteger.valueOf(i)); n--; } return result; } public static boolean[] sieve(int limit) { boolean[] composite = new boolean[limit]; composite[0] = composite[1] = true; int max = (int) Math.sqrt(limit); for (int n = 2; n <= max; n++) { if (!composite[n]) { for (int k = n * n; k < limit; k += n) { composite[k] = true; } } } return composite; } }
Transform the following Python implementation into Java, maintaining the same output and logic.
import pyprimes def primorial_prime(_pmax=500): isprime = pyprimes.isprime n, primo = 0, 1 for prime in pyprimes.nprimes(_pmax): n, primo = n+1, primo * prime if isprime(primo-1) or isprime(primo+1): yield n if __name__ == '__main__': pyprimes.warn_probably = False for i, n in zip(range(20), primorial_prime()): print('Primorial prime %2i at primorial index: %3i' % (i+1, n))
import java.math.BigInteger; public class PrimorialPrimes { final static int sieveLimit = 1550_000; static boolean[] notPrime = sieve(sieveLimit); public static void main(String[] args) { int count = 0; for (int i = 1; i < 1000_000 && count < 20; i++) { BigInteger b = primorial(i); if (b.add(BigInteger.ONE).isProbablePrime(1) || b.subtract(BigInteger.ONE).isProbablePrime(1)) { System.out.printf("%d ", i); count++; } } } static BigInteger primorial(int n) { if (n == 0) return BigInteger.ONE; BigInteger result = BigInteger.ONE; for (int i = 0; i < sieveLimit && n > 0; i++) { if (notPrime[i]) continue; result = result.multiply(BigInteger.valueOf(i)); n--; } return result; } public static boolean[] sieve(int limit) { boolean[] composite = new boolean[limit]; composite[0] = composite[1] = true; int max = (int) Math.sqrt(limit); for (int n = 2; n <= max; n++) { if (!composite[n]) { for (int k = n * n; k < limit; k += n) { composite[k] = true; } } } return composite; } }
Convert this Python block to Java, preserving its control flow and logic.
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
Rewrite this program in Java while keeping its functionality equivalent to the Python version.
from collections import Counter def basecount(dna): return sorted(Counter(dna).items()) def seq_split(dna, n=50): return [dna[i: i+n] for i in range(0, len(dna), n)] def seq_pp(dna, n=50): for i, part in enumerate(seq_split(dna, n)): print(f"{i*n:>5}: {part}") print("\n BASECOUNT:") tot = 0 for base, count in basecount(dna): print(f" {base:>3}: {count}") tot += count base, count = 'TOT', tot print(f" {base:>3}= {count}") if __name__ == '__main__': print("SEQUENCE:") sequence = seq_pp(sequence)
import java.util.HashMap; import java.util.Map; public class orderedSequence { public static void main(String[] args) { Sequence gene = new Sequence("CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"); gene.runSequence(); } } public class Sequence { private final String seq; public Sequence(String sq) { this.seq = sq; } public void prettyPrint() { System.out.println("Sequence:"); int i = 0; for ( ; i < seq.length() - 50 ; i += 50) { System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50)); } System.out.printf("%5s : %s\n", seq.length(), seq.substring(i)); } public void displayCount() { Map<Character, Integer> counter = new HashMap<>(); for (int i = 0 ; i < seq.length() ; ++i) { counter.merge(seq.charAt(i), 1, Integer::sum); } System.out.println("Base vs. Count:"); counter.forEach( key, value -> System.out.printf("%5s : %s\n", key, value)); System.out.printf("%5s: %s\n", "SUM", seq.length()); } public void runSequence() { this.prettyPrint(); this.displayCount(); } }
Translate this program into Java but keep the logic exactly as in Python.
import threading import random import time class Philosopher(threading.Thread): running = True def __init__(self, xname, forkOnLeft, forkOnRight): threading.Thread.__init__(self) self.name = xname self.forkOnLeft = forkOnLeft self.forkOnRight = forkOnRight def run(self): while(self.running): time.sleep( random.uniform(3,13)) print '%s is hungry.' % self.name self.dine() def dine(self): fork1, fork2 = self.forkOnLeft, self.forkOnRight while self.running: fork1.acquire(True) locked = fork2.acquire(False) if locked: break fork1.release() print '%s swaps forks' % self.name fork1, fork2 = fork2, fork1 else: return self.dining() fork2.release() fork1.release() def dining(self): print '%s starts eating '% self.name time.sleep(random.uniform(1,10)) print '%s finishes eating and leaves to think.' % self.name def DiningPhilosophers(): forks = [threading.Lock() for n in range(5)] philosopherNames = ('Aristotle','Kant','Spinoza','Marx', 'Russel') philosophers= [Philosopher(philosopherNames[i], forks[i%5], forks[(i+1)%5]) \ for i in range(5)] random.seed(507129) Philosopher.running = True for p in philosophers: p.start() time.sleep(100) Philosopher.running = False print ("Now we're finishing.") DiningPhilosophers()
package diningphilosophers; import java.util.ArrayList; import java.util.Random; import java.util.concurrent.atomic.AtomicBoolean; import java.util.concurrent.atomic.AtomicInteger; enum PhilosopherState { Get, Eat, Pon } class Fork { public static final int ON_TABLE = -1; static int instances = 0; public int id; public AtomicInteger holder = new AtomicInteger(ON_TABLE); Fork() { id = instances++; } } class Philosopher implements Runnable { static final int maxWaitMs = 100; static AtomicInteger token = new AtomicInteger(0); static int instances = 0; static Random rand = new Random(); AtomicBoolean end = new AtomicBoolean(false); int id; PhilosopherState state = PhilosopherState.Get; Fork left; Fork right; int timesEaten = 0; Philosopher() { id = instances++; left = Main.forks.get(id); right = Main.forks.get((id+1)%Main.philosopherCount); } void sleep() { try { Thread.sleep(rand.nextInt(maxWaitMs)); } catch (InterruptedException ex) {} } void waitForFork(Fork fork) { do { if (fork.holder.get() == Fork.ON_TABLE) { fork.holder.set(id); return; } else { sleep(); } } while (true); } public void run() { do { if (state == PhilosopherState.Pon) { state = PhilosopherState.Get; } else { if (token.get() == id) { waitForFork(left); waitForFork(right); token.set((id+2)% Main.philosopherCount); state = PhilosopherState.Eat; timesEaten++; sleep(); left.holder.set(Fork.ON_TABLE); right.holder.set(Fork.ON_TABLE); state = PhilosopherState.Pon; sleep(); } else { sleep(); } } } while (!end.get()); } } public class Main { static final int philosopherCount = 5; static final int runSeconds = 15; static ArrayList<Fork> forks = new ArrayList<Fork>(); static ArrayList<Philosopher> philosophers = new ArrayList<Philosopher>(); public static void main(String[] args) { for (int i = 0 ; i < philosopherCount ; i++) forks.add(new Fork()); for (int i = 0 ; i < philosopherCount ; i++) philosophers.add(new Philosopher()); for (Philosopher p : philosophers) new Thread(p).start(); long endTime = System.currentTimeMillis() + (runSeconds * 1000); do { StringBuilder sb = new StringBuilder("|"); for (Philosopher p : philosophers) { sb.append(p.state.toString()); sb.append("|"); } sb.append(" |"); for (Fork f : forks) { int holder = f.holder.get(); sb.append(holder==-1?" ":String.format("P%02d",holder)); sb.append("|"); } System.out.println(sb.toString()); try {Thread.sleep(1000);} catch (Exception ex) {} } while (System.currentTimeMillis() < endTime); for (Philosopher p : philosophers) p.end.set(true); for (Philosopher p : philosophers) System.out.printf("P%02d: ate %,d times, %,d/sec\n", p.id, p.timesEaten, p.timesEaten/runSeconds); } }
Preserve the algorithm and functionality while converting the code from Python to Java.
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
Ensure the translated Java code behaves exactly like the original Python snippet.
fact = [1] for n in range(1, 12): fact.append(fact[n-1] * n) for b in range(9, 12+1): print(f"The factorions for base {b} are:") for i in range(1, 1500000): fact_sum = 0 j = i while j > 0: d = j % b fact_sum += fact[d] j = j//b if fact_sum == i: print(i, end=" ") print("\n")
public class Factorion { public static void main(String [] args){ System.out.println("Base 9:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,9); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 10:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,10); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 11:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,11); if(multiplied == i){ System.out.print(i + "\t"); } } System.out.println("\nBase 12:"); for(int i = 1; i <= 1499999; i++){ String iStri = String.valueOf(i); int multiplied = operate(iStri,12); if(multiplied == i){ System.out.print(i + "\t"); } } } public static int factorialRec(int n){ int result = 1; return n == 0 ? result : result * n * factorialRec(n-1); } public static int operate(String s, int base){ int sum = 0; String strx = fromDeci(base, Integer.parseInt(s)); for(int i = 0; i < strx.length(); i++){ if(strx.charAt(i) == 'A'){ sum += factorialRec(10); }else if(strx.charAt(i) == 'B') { sum += factorialRec(11); }else if(strx.charAt(i) == 'C') { sum += factorialRec(12); }else { sum += factorialRec(Integer.parseInt(String.valueOf(strx.charAt(i)), base)); } } return sum; } static char reVal(int num) { if (num >= 0 && num <= 9) return (char)(num + 48); else return (char)(num - 10 + 65); } static String fromDeci(int base, int num){ StringBuilder s = new StringBuilder(); while (num > 0) { s.append(reVal(num % base)); num /= base; } return new String(new StringBuilder(s).reverse()); } }
Write the same code in Java as shown below in Python.
import numpy as np import scipy.optimize as opt n0, K = 27, 7_800_000_000 def f(t, r): return (n0 * np.exp(r * t)) / (( 1 + n0 * (np.exp(r * t) - 1) / K)) y = [ 27, 27, 27, 44, 44, 59, 59, 59, 59, 59, 59, 59, 59, 60, 60, 61, 61, 66, 83, 219, 239, 392, 534, 631, 897, 1350, 2023, 2820, 4587, 6067, 7823, 9826, 11946, 14554, 17372, 20615, 24522, 28273, 31491, 34933, 37552, 40540, 43105, 45177, 60328, 64543, 67103, 69265, 71332, 73327, 75191, 75723, 76719, 77804, 78812, 79339, 80132, 80995, 82101, 83365, 85203, 87024, 89068, 90664, 93077, 95316, 98172, 102133, 105824, 109695, 114232, 118610, 125497, 133852, 143227, 151367, 167418, 180096, 194836, 213150, 242364, 271106, 305117, 338133, 377918, 416845, 468049, 527767, 591704, 656866, 715353, 777796, 851308, 928436, 1000249, 1082054, 1174652, ] x = np.linspace(0.0, 96, 97) r, cov = opt.curve_fit(f, x, y, [0.5]) print("The r for the world Covid-19 data is:", r, ", with covariance of", cov) print("The calculated R0 is then", np.exp(12 * r))
import java.util.List; import java.util.function.Function; public class LogisticCurveFitting { private static final double K = 7.8e9; private static final int N0 = 27; private static final List<Double> ACTUAL = List.of( 27.0, 27.0, 27.0, 44.0, 44.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 59.0, 60.0, 60.0, 61.0, 61.0, 66.0, 83.0, 219.0, 239.0, 392.0, 534.0, 631.0, 897.0, 1350.0, 2023.0, 2820.0, 4587.0, 6067.0, 7823.0, 9826.0, 11946.0, 14554.0, 17372.0, 20615.0, 24522.0, 28273.0, 31491.0, 34933.0, 37552.0, 40540.0, 43105.0, 45177.0, 60328.0, 64543.0, 67103.0, 69265.0, 71332.0, 73327.0, 75191.0, 75723.0, 76719.0, 77804.0, 78812.0, 79339.0, 80132.0, 80995.0, 82101.0, 83365.0, 85203.0, 87024.0, 89068.0, 90664.0, 93077.0, 95316.0, 98172.0, 102133.0, 105824.0, 109695.0, 114232.0, 118610.0, 125497.0, 133852.0, 143227.0, 151367.0, 167418.0, 180096.0, 194836.0, 213150.0, 242364.0, 271106.0, 305117.0, 338133.0, 377918.0, 416845.0, 468049.0, 527767.0, 591704.0, 656866.0, 715353.0, 777796.0, 851308.0, 928436.0, 1000249.0, 1082054.0, 1174652.0 ); private static double f(double r) { var sq = 0.0; var len = ACTUAL.size(); for (int i = 0; i < len; i++) { var eri = Math.exp(r * i); var guess = (N0 * eri) / (1.0 + N0 * (eri - 1.0) / K); var diff = guess - ACTUAL.get(i); sq += diff * diff; } return sq; } private static double solve(Function<Double, Double> fn) { return solve(fn, 0.5, 0.0); } private static double solve(Function<Double, Double> fn, double guess, double epsilon) { double delta; if (guess != 0.0) { delta = guess; } else { delta = 1.0; } var f0 = fn.apply(guess); var factor = 2.0; while (delta > epsilon && guess != guess - delta) { var nf = fn.apply(guess - delta); if (nf < f0) { f0 = nf; guess -= delta; } else { nf = fn.apply(guess + delta); if (nf < f0) { f0 = nf; guess += delta; } else { factor = 0.5; } } delta *= factor; } return guess; } public static void main(String[] args) { var r = solve(LogisticCurveFitting::f); var r0 = Math.exp(12.0 * r); System.out.printf("r = %.16f, R0 = %.16f\n", r, r0); } }
Generate a Java translation of this Python snippet without changing its computational steps.
def merge_list(a, b): out = [] while len(a) and len(b): if a[0] < b[0]: out.append(a.pop(0)) else: out.append(b.pop(0)) out += a out += b return out def strand(a): i, s = 0, [a.pop(0)] while i < len(a): if a[i] > s[-1]: s.append(a.pop(i)) else: i += 1 return s def strand_sort(a): out = strand(a) while len(a): out = merge_list(out, strand(a)) return out print strand_sort([1, 6, 3, 2, 1, 7, 5, 3])
import java.util.Arrays; import java.util.LinkedList; public class Strand{ public static <E extends Comparable<? super E>> LinkedList<E> strandSort(LinkedList<E> list){ if(list.size() <= 1) return list; LinkedList<E> result = new LinkedList<E>(); while(list.size() > 0){ LinkedList<E> sorted = new LinkedList<E>(); sorted.add(list.removeFirst()); for(Iterator<E> it = list.iterator(); it.hasNext(); ){ E elem = it.next(); if(sorted.peekLast().compareTo(elem) <= 0){ sorted.addLast(elem); it.remove(); } } result = merge(sorted, result); } return result; } private static <E extends Comparable<? super E>> LinkedList<E> merge(LinkedList<E> left, LinkedList<E> right){ LinkedList<E> result = new LinkedList<E>(); while(!left.isEmpty() && !right.isEmpty()){ if(left.peek().compareTo(right.peek()) <= 0) result.add(left.remove()); else result.add(right.remove()); } result.addAll(left); result.addAll(right); return result; } public static void main(String[] args){ System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,1,2,4,5)))); System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,5)))); System.out.println(strandSort(new LinkedList<Integer>(Arrays.asList(3,3,1,2,4,3,5,6)))); } }
Generate a Java translation of this Python snippet without changing its computational steps.
def is_prime(n: int) -> bool: if n <= 3: return n > 1 if n % 2 == 0 or n % 3 == 0: return False i = 5 while i ** 2 <= n: if n % i == 0 or n % (i + 2) == 0: return False i += 6 return True def digit_sum(n: int) -> int: sum = 0 while n > 0: sum += n % 10 n //= 10 return sum def main() -> None: additive_primes = 0 for i in range(2, 500): if is_prime(i) and is_prime(digit_sum(i)): additive_primes += 1 print(i, end=" ") print(f"\nFound {additive_primes} additive primes less than 500") if __name__ == "__main__": main()
public class additivePrimes { public static void main(String[] args) { int additive_primes = 0; for (int i = 2; i < 500; i++) { if(isPrime(i) && isPrime(digitSum(i))){ additive_primes++; System.out.print(i + " "); } } System.out.print("\nFound " + additive_primes + " additive primes less than 500"); } static boolean isPrime(int n) { int counter = 1; if (n < 2 || (n != 2 && n % 2 == 0) || (n != 3 && n % 3 == 0)) { return false; } while (counter * 6 - 1 <= Math.sqrt(n)) { if (n % (counter * 6 - 1) == 0 || n % (counter * 6 + 1) == 0) { return false; } else { counter++; } } return true; } static int digitSum(int n) { int sum = 0; while (n > 0) { sum += n % 10; n /= 10; } return sum; } }
Port the following code from Python to Java with equivalent syntax and logic.
from math import gcd from functools import lru_cache from itertools import islice, count @lru_cache(maxsize=None) def φ(n): return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1) def perfect_totient(): for n0 in count(1): parts, n = 0, n0 while n != 1: n = φ(n) parts += n if parts == n0: yield n0 if __name__ == '__main__': print(list(islice(perfect_totient(), 20)))
import java.util.ArrayList; import java.util.List; public class PerfectTotientNumbers { public static void main(String[] args) { computePhi(); int n = 20; System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n)); } private static final List<Integer> perfectTotient(int n) { int test = 2; List<Integer> results = new ArrayList<Integer>(); for ( int i = 0 ; i < n ; test++ ) { int phiLoop = test; int sum = 0; do { phiLoop = phi[phiLoop]; sum += phiLoop; } while ( phiLoop > 1); if ( sum == test ) { i++; results.add(test); } } return results; } private static final int max = 100000; private static final int[] phi = new int[max+1]; private static final void computePhi() { for ( int i = 1 ; i <= max ; i++ ) { phi[i] = i; } for ( int i = 2 ; i <= max ; i++ ) { if (phi[i] < i) continue; for ( int j = i ; j <= max ; j += i ) { phi[j] -= phi[j] / i; } } } }
Translate this program into Java but keep the logic exactly as in Python.
from math import gcd from functools import lru_cache from itertools import islice, count @lru_cache(maxsize=None) def φ(n): return sum(1 for k in range(1, n + 1) if gcd(n, k) == 1) def perfect_totient(): for n0 in count(1): parts, n = 0, n0 while n != 1: n = φ(n) parts += n if parts == n0: yield n0 if __name__ == '__main__': print(list(islice(perfect_totient(), 20)))
import java.util.ArrayList; import java.util.List; public class PerfectTotientNumbers { public static void main(String[] args) { computePhi(); int n = 20; System.out.printf("The first %d perfect totient numbers:%n%s%n", n, perfectTotient(n)); } private static final List<Integer> perfectTotient(int n) { int test = 2; List<Integer> results = new ArrayList<Integer>(); for ( int i = 0 ; i < n ; test++ ) { int phiLoop = test; int sum = 0; do { phiLoop = phi[phiLoop]; sum += phiLoop; } while ( phiLoop > 1); if ( sum == test ) { i++; results.add(test); } } return results; } private static final int max = 100000; private static final int[] phi = new int[max+1]; private static final void computePhi() { for ( int i = 1 ; i <= max ; i++ ) { phi[i] = i; } for ( int i = 2 ; i <= max ; i++ ) { if (phi[i] < i) continue; for ( int j = i ; j <= max ; j += i ) { phi[j] -= phi[j] / i; } } } }
Rewrite the snippet below in Java so it works the same as the original Python code.
class Delegator: def __init__(self): self.delegate = None def operation(self): if hasattr(self.delegate, 'thing') and callable(self.delegate.thing): return self.delegate.thing() return 'default implementation' class Delegate: def thing(self): return 'delegate implementation' if __name__ == '__main__': a = Delegator() assert a.operation() == 'default implementation' a.delegate = 'A delegate may be any object' assert a.operation() == 'default implementation' a.delegate = Delegate() assert a.operation() == 'delegate implementation'
interface Thingable { String thing(); } class Delegator { public Thingable delegate; public String operation() { if (delegate == null) return "default implementation"; else return delegate.thing(); } } class Delegate implements Thingable { public String thing() { return "delegate implementation"; } } public class DelegateExample { public static void main(String[] args) { Delegator a = new Delegator(); assert a.operation().equals("default implementation"); Delegate d = new Delegate(); a.delegate = d; assert a.operation().equals("delegate implementation"); a.delegate = new Thingable() { public String thing() { return "anonymous delegate implementation"; } }; assert a.operation().equals("anonymous delegate implementation"); } }
Rewrite this program in Java while keeping its functionality equivalent to the Python version.
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
public class DivisorSum { private static long divisorSum(long n) { var total = 1L; var power = 2L; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (long p = 3; p * p <= n; p += 2) { long sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } public static void main(String[] args) { final long limit = 100; System.out.printf("Sum of divisors for the first %d positive integers:%n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%4d", divisorSum(n)); if (n % 10 == 0) { System.out.println(); } } } }
Port the provided Python code into Java while preserving the original functionality.
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
public class DivisorSum { private static long divisorSum(long n) { var total = 1L; var power = 2L; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (long p = 3; p * p <= n; p += 2) { long sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } public static void main(String[] args) { final long limit = 100; System.out.printf("Sum of divisors for the first %d positive integers:%n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%4d", divisorSum(n)); if (n % 10 == 0) { System.out.println(); } } } }
Convert this Python snippet to Java and keep its semantics consistent.
def factorize(n): assert(isinstance(n, int)) if n < 0: n = -n if n < 2: return k = 0 while 0 == n%2: k += 1 n //= 2 if 0 < k: yield (2,k) p = 3 while p*p <= n: k = 0 while 0 == n%p: k += 1 n //= p if 0 < k: yield (p,k) p += 2 if 1 < n: yield (n,1) def sum_of_divisors(n): assert(n != 0) ans = 1 for (p,k) in factorize(n): ans *= (pow(p,k+1) - 1)//(p-1) return ans if __name__ == "__main__": print([sum_of_divisors(n) for n in range(1,101)])
public class DivisorSum { private static long divisorSum(long n) { var total = 1L; var power = 2L; for (; (n & 1) == 0; power <<= 1, n >>= 1) { total += power; } for (long p = 3; p * p <= n; p += 2) { long sum = 1; for (power = p; n % p == 0; power *= p, n /= p) { sum += power; } total *= sum; } if (n > 1) { total *= n + 1; } return total; } public static void main(String[] args) { final long limit = 100; System.out.printf("Sum of divisors for the first %d positive integers:%n", limit); for (long n = 1; n <= limit; ++n) { System.out.printf("%4d", divisorSum(n)); if (n % 10 == 0) { System.out.println(); } } } }
Write the same algorithm in Java as shown in this Python implementation.
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
Maintain the same structure and functionality when rewriting this code in Java.
command_table_text = \ user_words = "riG rePEAT copies put mo rest types fup. 6 poweRin" def find_abbreviations_length(command_table_text): command_table = dict() for word in command_table_text.split(): abbr_len = sum(1 for c in word if c.isupper()) if abbr_len == 0: abbr_len = len(word) command_table[word] = abbr_len return command_table def find_abbreviations(command_table): abbreviations = dict() for command, min_abbr_len in command_table.items(): for l in range(min_abbr_len, len(command)+1): abbr = command[:l].lower() abbreviations[abbr] = command.upper() return abbreviations def parse_user_string(user_string, abbreviations): user_words = [word.lower() for word in user_string.split()] commands = [abbreviations.get(user_word, "*error*") for user_word in user_words] return " ".join(commands) command_table = find_abbreviations_length(command_table_text) abbreviations_table = find_abbreviations(command_table) full_words = parse_user_string(user_words, abbreviations_table) print("user words:", user_words) print("full words:", full_words)
import java.util.HashMap; import java.util.Map; import java.util.Scanner; public class AbbreviationsEasy { private static final Scanner input = new Scanner(System.in); private static final String COMMAND_TABLE = " Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy\n" + " COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find\n" + " NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput\n" + " Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO\n" + " MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT\n" + " READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT\n" + " RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; public static void main(String[] args) { String[] cmdTableArr = COMMAND_TABLE.split("\\s+"); Map<String, Integer> cmd_table = new HashMap<String, Integer>(); for (String word : cmdTableArr) { cmd_table.put(word, countCaps(word)); } System.out.print("Please enter your command to verify: "); String userInput = input.nextLine(); String[] user_input = userInput.split("\\s+"); for (String s : user_input) { boolean match = false; for (String cmd : cmd_table.keySet()) { if (s.length() >= cmd_table.get(cmd) && s.length() <= cmd.length()) { String temp = cmd.toUpperCase(); if (temp.startsWith(s.toUpperCase())) { System.out.print(temp + " "); match = true; } } } if (!match) { System.out.print("*error* "); } } } private static int countCaps(String word) { int numCaps = 0; for (int i = 0; i < word.length(); i++) { if (Character.isUpperCase(word.charAt(i))) { numCaps++; } } return numCaps; } }
Port the following code from Python to Java with equivalent syntax and logic.
>>> s = "Hello" >>> s[0] = "h" Traceback (most recent call last): File "<pyshell s[0] = "h" TypeError: 'str' object does not support item assignment
final int immutableInt = 4; int mutableInt = 4; mutableInt = 6; immutableInt = 6;
Convert the following code from Python to Java, ensuring the logic remains intact.
def clip(subjectPolygon, clipPolygon): def inside(p): return(cp2[0]-cp1[0])*(p[1]-cp1[1]) > (cp2[1]-cp1[1])*(p[0]-cp1[0]) def computeIntersection(): dc = [ cp1[0] - cp2[0], cp1[1] - cp2[1] ] dp = [ s[0] - e[0], s[1] - e[1] ] n1 = cp1[0] * cp2[1] - cp1[1] * cp2[0] n2 = s[0] * e[1] - s[1] * e[0] n3 = 1.0 / (dc[0] * dp[1] - dc[1] * dp[0]) return [(n1*dp[0] - n2*dc[0]) * n3, (n1*dp[1] - n2*dc[1]) * n3] outputList = subjectPolygon cp1 = clipPolygon[-1] for clipVertex in clipPolygon: cp2 = clipVertex inputList = outputList outputList = [] s = inputList[-1] for subjectVertex in inputList: e = subjectVertex if inside(e): if not inside(s): outputList.append(computeIntersection()) outputList.append(e) elif inside(s): outputList.append(computeIntersection()) s = e cp1 = cp2 return(outputList)
import java.awt.*; import java.awt.geom.Line2D; import java.util.*; import java.util.List; import javax.swing.*; public class SutherlandHodgman extends JFrame { SutherlandHodgmanPanel panel; public static void main(String[] args) { JFrame f = new SutherlandHodgman(); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setVisible(true); } public SutherlandHodgman() { Container content = getContentPane(); content.setLayout(new BorderLayout()); panel = new SutherlandHodgmanPanel(); content.add(panel, BorderLayout.CENTER); setTitle("SutherlandHodgman"); pack(); setLocationRelativeTo(null); } } class SutherlandHodgmanPanel extends JPanel { List<double[]> subject, clipper, result; public SutherlandHodgmanPanel() { setPreferredSize(new Dimension(600, 500)); double[][] subjPoints = {{50, 150}, {200, 50}, {350, 150}, {350, 300}, {250, 300}, {200, 250}, {150, 350}, {100, 250}, {100, 200}}; double[][] clipPoints = {{100, 100}, {300, 100}, {300, 300}, {100, 300}}; subject = new ArrayList<>(Arrays.asList(subjPoints)); result = new ArrayList<>(subject); clipper = new ArrayList<>(Arrays.asList(clipPoints)); clipPolygon(); } private void clipPolygon() { int len = clipper.size(); for (int i = 0; i < len; i++) { int len2 = result.size(); List<double[]> input = result; result = new ArrayList<>(len2); double[] A = clipper.get((i + len - 1) % len); double[] B = clipper.get(i); for (int j = 0; j < len2; j++) { double[] P = input.get((j + len2 - 1) % len2); double[] Q = input.get(j); if (isInside(A, B, Q)) { if (!isInside(A, B, P)) result.add(intersection(A, B, P, Q)); result.add(Q); } else if (isInside(A, B, P)) result.add(intersection(A, B, P, Q)); } } } private boolean isInside(double[] a, double[] b, double[] c) { return (a[0] - c[0]) * (b[1] - c[1]) > (a[1] - c[1]) * (b[0] - c[0]); } private double[] intersection(double[] a, double[] b, double[] p, double[] q) { double A1 = b[1] - a[1]; double B1 = a[0] - b[0]; double C1 = A1 * a[0] + B1 * a[1]; double A2 = q[1] - p[1]; double B2 = p[0] - q[0]; double C2 = A2 * p[0] + B2 * p[1]; double det = A1 * B2 - A2 * B1; double x = (B2 * C1 - B1 * C2) / det; double y = (A1 * C2 - A2 * C1) / det; return new double[]{x, y}; } @Override public void paintComponent(Graphics g) { super.paintComponent(g); Graphics2D g2 = (Graphics2D) g; g2.translate(80, 60); g2.setStroke(new BasicStroke(3)); g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); drawPolygon(g2, subject, Color.blue); drawPolygon(g2, clipper, Color.red); drawPolygon(g2, result, Color.green); } private void drawPolygon(Graphics2D g2, List<double[]> points, Color color) { g2.setColor(color); int len = points.size(); Line2D line = new Line2D.Double(); for (int i = 0; i < len; i++) { double[] p1 = points.get(i); double[] p2 = points.get((i + 1) % len); line.setLine(p1[0], p1[1], p2[0], p2[1]); g2.draw(line); } } }
Generate a Java translation of this Python snippet without changing its computational steps.
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
Port the following code from Python to Java with equivalent syntax and logic.
import string sometext = .lower() lc2bin = {ch: '{:05b}'.format(i) for i, ch in enumerate(string.ascii_lowercase + ' .')} bin2lc = {val: key for key, val in lc2bin.items()} phrase = 'Rosetta code Bacon cipher example secret phrase to encode in the capitalisation of peter pan'.lower() def to_5binary(msg): return ( ch == '1' for ch in ''.join(lc2bin.get(ch, '') for ch in msg.lower())) def encrypt(message, text): bin5 = to_5binary(message) textlist = list(text.lower()) out = [] for capitalise in bin5: while textlist: ch = textlist.pop(0) if ch.isalpha(): if capitalise: ch = ch.upper() out.append(ch) break else: out.append(ch) else: raise Exception('ERROR: Ran out of characters in sometext') return ''.join(out) + '...' def decrypt(bacontext): binary = [] bin5 = [] out = [] for ch in bacontext: if ch.isalpha(): binary.append('1' if ch.isupper() else '0') if len(binary) == 5: bin5 = ''.join(binary) out.append(bin2lc[bin5]) binary = [] return ''.join(out) print('PLAINTEXT = \n%s\n' % phrase) encrypted = encrypt(phrase, sometext) print('ENCRYPTED = \n%s\n' % encrypted) decrypted = decrypt(encrypted) print('DECRYPTED = \n%s\n' % decrypted) assert phrase == decrypted, 'Round-tripping error'
import java.util.HashMap; import java.util.Map; import java.util.Objects; public class BaconCipher { private static final Map<Character, String> codes; static { codes = new HashMap<>(); codes.putAll(Map.of( 'a', "AAAAA", 'b', "AAAAB", 'c', "AAABA", 'd', "AAABB", 'e', "AABAA", 'f', "AABAB", 'g', "AABBA", 'h', "AABBB", 'i', "ABAAA", 'j', "ABAAB" )); codes.putAll(Map.of( 'k', "ABABA", 'l', "ABABB", 'm', "ABBAA", 'n', "ABBAB", 'o', "ABBBA", 'p', "ABBBB", 'q', "BAAAA", 'r', "BAAAB", 's', "BAABA", 't', "BAABB" )); codes.putAll(Map.of( 'u', "BABAA", 'v', "BABAB", 'w', "BABBA", 'x', "BABBB", 'y', "BBAAA", 'z', "BBAAB", ' ', "BBBAA" )); } private static String encode(String plainText, String message) { String pt = plainText.toLowerCase(); StringBuilder sb = new StringBuilder(); for (char c : pt.toCharArray()) { if ('a' <= c && c <= 'z') sb.append(codes.get(c)); else sb.append(codes.get(' ')); } String et = sb.toString(); String mg = message.toLowerCase(); sb.setLength(0); int count = 0; for (char c : mg.toCharArray()) { if ('a' <= c && c <= 'z') { if (et.charAt(count) == 'A') sb.append(c); else sb.append(((char) (c - 32))); count++; if (count == et.length()) break; } else sb.append(c); } return sb.toString(); } private static String decode(String message) { StringBuilder sb = new StringBuilder(); for (char c : message.toCharArray()) { if ('a' <= c && c <= 'z') sb.append('A'); if ('A' <= c && c <= 'Z') sb.append('B'); } String et = sb.toString(); sb.setLength(0); for (int i = 0; i < et.length(); i += 5) { String quintet = et.substring(i, i + 5); Character key = codes.entrySet().stream().filter(a -> Objects.equals(a.getValue(), quintet)).findFirst().map(Map.Entry::getKey).orElse(null); sb.append(key); } return sb.toString(); } public static void main(String[] args) { String plainText = "the quick brown fox jumps over the lazy dog"; String message = "bacon's cipher is a method of steganography created by francis bacon. " + "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space."; String cipherText = encode(plainText, message); System.out.printf("Cipher text ->\n\n%s\n", cipherText); String decodedText = decode(cipherText); System.out.printf("\nHidden text ->\n\n%s\n", decodedText); } }
Maintain the same structure and functionality when rewriting this code in Java.
def spiral(n): dx,dy = 1,0 x,y = 0,0 myarray = [[None]* n for j in range(n)] for i in xrange(n**2): myarray[x][y] = i nx,ny = x+dx, y+dy if 0<=nx<n and 0<=ny<n and myarray[nx][ny] == None: x,y = nx,ny else: dx,dy = -dy,dx x,y = x+dx, y+dy return myarray def printspiral(myarray): n = range(len(myarray)) for y in n: for x in n: print "%2i" % myarray[x][y], print printspiral(spiral(5))
public class Blah { public static void main(String[] args) { print2dArray(getSpiralArray(5)); } public static int[][] getSpiralArray(int dimension) { int[][] spiralArray = new int[dimension][dimension]; int numConcentricSquares = (int) Math.ceil((dimension) / 2.0); int j; int sideLen = dimension; int currNum = 0; for (int i = 0; i < numConcentricSquares; i++) { for (j = 0; j < sideLen; j++) { spiralArray[i][i + j] = currNum++; } for (j = 1; j < sideLen; j++) { spiralArray[i + j][dimension - 1 - i] = currNum++; } for (j = sideLen - 2; j > -1; j--) { spiralArray[dimension - 1 - i][i + j] = currNum++; } for (j = sideLen - 2; j > 0; j--) { spiralArray[i + j][i] = currNum++; } sideLen -= 2; } return spiralArray; } public static void print2dArray(int[][] array) { for (int[] row : array) { for (int elem : row) { System.out.printf("%3d", elem); } System.out.println(); } } }
Produce a functionally identical Java code for the snippet given in Python.
>>> def printtable(data): for row in data: print ' '.join('%-5s' % ('"%s"' % cell) for cell in row) >>> import operator >>> def sorttable(table, ordering=None, column=0, reverse=False): return sorted(table, cmp=ordering, key=operator.itemgetter(column), reverse=reverse) >>> data = [["a", "b", "c"], ["", "q", "z"], ["zap", "zip", "Zot"]] >>> printtable(data) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data) ) "" "q" "z" "a" "b" "c" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=2) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>> printtable( sorttable(data, column=1) ) "a" "b" "c" "" "q" "z" "zap" "zip" "Zot" >>> printtable( sorttable(data, column=1, reverse=True) ) "zap" "zip" "Zot" "" "q" "z" "a" "b" "c" >>> printtable( sorttable(data, ordering=lambda a,b: cmp(len(b),len(a))) ) "zap" "zip" "Zot" "a" "b" "c" "" "q" "z" >>>
module OptionalParameters { typedef Type<String >.Orderer as ColumnOrderer; typedef Type<String[]>.Orderer as RowOrderer; static String[][] sort(String[][] table, ColumnOrderer? orderer = Null, Int column = 0, Boolean reverse = False, ) { orderer ?:= (s1, s2) -> s1 <=> s2; ColumnOrderer byString = reverse ? ((s1, s2) -> orderer(s1, s2).reversed) : orderer; RowOrderer byColumn = (row1, row2) -> byString(row1[column], row2[column]); return table.sorted(byColumn); } void run() { String[][] table = [ ["c", "x", "i"], ["a", "y", "p"], ["b", "z", "a"], ]; show("original input", table); show("by default sort on column 0", sort(table)); show("by column 2", sort(table, column=2)); show("by column 2 reversed", sort(table, column=2, reverse=True)); } void show(String title, String[][] table) { @Inject Console console; console.print($"{title}:"); for (val row : table) { console.print($" {row}"); } console.print(); } }
Can you help me rewrite this code in Java instead of Python, keeping it the same logically?
def setup(): size(500, 500) generate_voronoi_diagram(width, height, 25) saveFrame("VoronoiDiagram.png") def generate_voronoi_diagram(w, h, num_cells): nx, ny, nr, ng, nb = [], [], [], [], [] for i in range(num_cells): nx.append(int(random(w))) ny.append(int(random(h))) nr.append(int(random(256))) ng.append(int(random(256))) nb.append(int(random(256))) for y in range(h): for x in range(w): dmin = dist(0, 0, w - 1, h - 1) j = -1 for i in range(num_cells): d = dist(0, 0, nx[i] - x, ny[i] - y) if d < dmin: dmin = d j = i set(x, y, color(nr[j], ng[j], nb[j]))
import java.awt.Color; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.geom.Ellipse2D; import java.awt.image.BufferedImage; import java.io.File; import java.io.IOException; import java.util.Random; import javax.imageio.ImageIO; import javax.swing.JFrame; public class Voronoi extends JFrame { static double p = 3; static BufferedImage I; static int px[], py[], color[], cells = 100, size = 1000; public Voronoi() { super("Voronoi Diagram"); setBounds(0, 0, size, size); setDefaultCloseOperation(EXIT_ON_CLOSE); int n = 0; Random rand = new Random(); I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB); px = new int[cells]; py = new int[cells]; color = new int[cells]; for (int i = 0; i < cells; i++) { px[i] = rand.nextInt(size); py[i] = rand.nextInt(size); color[i] = rand.nextInt(16777215); } for (int x = 0; x < size; x++) { for (int y = 0; y < size; y++) { n = 0; for (byte i = 0; i < cells; i++) { if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) { n = i; } } I.setRGB(x, y, color[n]); } } Graphics2D g = I.createGraphics(); g.setColor(Color.BLACK); for (int i = 0; i < cells; i++) { g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5)); } try { ImageIO.write(I, "png", new File("voronoi.png")); } catch (IOException e) { } } public void paint(Graphics g) { g.drawImage(I, 0, 0, this); } static double distance(int x1, int x2, int y1, int y2) { double d; d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2)); return d; } public static void main(String[] args) { new Voronoi().setVisible(true); } }
Generate a Java translation of this Python snippet without changing its computational steps.
def setup(): size(500, 500) generate_voronoi_diagram(width, height, 25) saveFrame("VoronoiDiagram.png") def generate_voronoi_diagram(w, h, num_cells): nx, ny, nr, ng, nb = [], [], [], [], [] for i in range(num_cells): nx.append(int(random(w))) ny.append(int(random(h))) nr.append(int(random(256))) ng.append(int(random(256))) nb.append(int(random(256))) for y in range(h): for x in range(w): dmin = dist(0, 0, w - 1, h - 1) j = -1 for i in range(num_cells): d = dist(0, 0, nx[i] - x, ny[i] - y) if d < dmin: dmin = d j = i set(x, y, color(nr[j], ng[j], nb[j]))
import java.awt.Color; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.geom.Ellipse2D; import java.awt.image.BufferedImage; import java.io.File; import java.io.IOException; import java.util.Random; import javax.imageio.ImageIO; import javax.swing.JFrame; public class Voronoi extends JFrame { static double p = 3; static BufferedImage I; static int px[], py[], color[], cells = 100, size = 1000; public Voronoi() { super("Voronoi Diagram"); setBounds(0, 0, size, size); setDefaultCloseOperation(EXIT_ON_CLOSE); int n = 0; Random rand = new Random(); I = new BufferedImage(size, size, BufferedImage.TYPE_INT_RGB); px = new int[cells]; py = new int[cells]; color = new int[cells]; for (int i = 0; i < cells; i++) { px[i] = rand.nextInt(size); py[i] = rand.nextInt(size); color[i] = rand.nextInt(16777215); } for (int x = 0; x < size; x++) { for (int y = 0; y < size; y++) { n = 0; for (byte i = 0; i < cells; i++) { if (distance(px[i], x, py[i], y) < distance(px[n], x, py[n], y)) { n = i; } } I.setRGB(x, y, color[n]); } } Graphics2D g = I.createGraphics(); g.setColor(Color.BLACK); for (int i = 0; i < cells; i++) { g.fill(new Ellipse2D .Double(px[i] - 2.5, py[i] - 2.5, 5, 5)); } try { ImageIO.write(I, "png", new File("voronoi.png")); } catch (IOException e) { } } public void paint(Graphics g) { g.drawImage(I, 0, 0, this); } static double distance(int x1, int x2, int y1, int y2) { double d; d = Math.sqrt((x1 - x2) * (x1 - x2) + (y1 - y2) * (y1 - y2)); return d; } public static void main(String[] args) { new Voronoi().setVisible(true); } }
Port the provided Python code into Java while preserving the original functionality.
import ctypes libc = ctypes.CDLL("/lib/libc.so.6") libc.strcmp("abc", "def") libc.strcmp("hello", "hello")
public class JNIDemo { static { System.loadLibrary("JNIDemo"); } public static void main(String[] args) { System.out.println(callStrdup("Hello World!")); } private static native String callStrdup(String s); }
Produce a language-to-language conversion: from Python to Java, same semantics.
from random import randrange def s_of_n_creator(n): sample, i = [], 0 def s_of_n(item): nonlocal i i += 1 if i <= n: sample.append(item) elif randrange(i) < n: sample[randrange(n)] = item return sample return s_of_n if __name__ == '__main__': bin = [0]* 10 items = range(10) print("Single run samples for n = 3:") s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) print(" Item: %i -> sample: %s" % (item, sample)) for trial in range(100000): s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) for s in sample: bin[s] += 1 print("\nTest item frequencies for 100000 runs:\n ", '\n '.join("%i:%i" % x for x in enumerate(bin)))
import java.util.*; class SOfN<T> { private static final Random rand = new Random(); private List<T> sample; private int i = 0; private int n; public SOfN(int _n) { n = _n; sample = new ArrayList<T>(n); } public List<T> process(T item) { if (++i <= n) { sample.add(item); } else if (rand.nextInt(i) < n) { sample.set(rand.nextInt(n), item); } return sample; } } public class AlgorithmS { public static void main(String[] args) { int[] bin = new int[10]; for (int trial = 0; trial < 100000; trial++) { SOfN<Integer> s_of_n = new SOfN<Integer>(3); for (int i = 0; i < 9; i++) s_of_n.process(i); for (int s : s_of_n.process(9)) bin[s]++; } System.out.println(Arrays.toString(bin)); } }
Rewrite this program in Java while keeping its functionality equivalent to the Python version.
from random import randrange def s_of_n_creator(n): sample, i = [], 0 def s_of_n(item): nonlocal i i += 1 if i <= n: sample.append(item) elif randrange(i) < n: sample[randrange(n)] = item return sample return s_of_n if __name__ == '__main__': bin = [0]* 10 items = range(10) print("Single run samples for n = 3:") s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) print(" Item: %i -> sample: %s" % (item, sample)) for trial in range(100000): s_of_n = s_of_n_creator(3) for item in items: sample = s_of_n(item) for s in sample: bin[s] += 1 print("\nTest item frequencies for 100000 runs:\n ", '\n '.join("%i:%i" % x for x in enumerate(bin)))
import java.util.*; class SOfN<T> { private static final Random rand = new Random(); private List<T> sample; private int i = 0; private int n; public SOfN(int _n) { n = _n; sample = new ArrayList<T>(n); } public List<T> process(T item) { if (++i <= n) { sample.add(item); } else if (rand.nextInt(i) < n) { sample.set(rand.nextInt(n), item); } return sample; } } public class AlgorithmS { public static void main(String[] args) { int[] bin = new int[10]; for (int trial = 0; trial < 100000; trial++) { SOfN<Integer> s_of_n = new SOfN<Integer>(3); for (int i = 0; i < 9; i++) s_of_n.process(i); for (int s : s_of_n.process(9)) bin[s]++; } System.out.println(Arrays.toString(bin)); } }
Write the same code in Java as shown below in Python.
from itertools import accumulate, chain, count, islice from fractions import Fraction def faulhaberTriangle(m): def go(rs, n): def f(x, y): return Fraction(n, x) * y xs = list(map(f, islice(count(2), m), rs)) return [Fraction(1 - sum(xs), 1)] + xs return list(accumulate( [[]] + list(islice(count(0), 1 + m)), go ))[1:] def faulhaberSum(p, n): def go(x, y): return y * (n ** x) return sum( map(go, count(1), faulhaberTriangle(p)[-1]) ) def main(): fs = faulhaberTriangle(9) print( fTable(__doc__ + ':\n')(str)( compose(concat)( fmap(showRatio(3)(3)) ) )( index(fs) )(range(0, len(fs))) ) print('') print( faulhaberSum(17, 1000) ) def fTable(s): def gox(xShow): def gofx(fxShow): def gof(f): def goxs(xs): ys = [xShow(x) for x in xs] w = max(map(len, ys)) def arrowed(x, y): return y.rjust(w, ' ') + ' -> ' + ( fxShow(f(x)) ) return s + '\n' + '\n'.join( map(arrowed, xs, ys) ) return goxs return gof return gofx return gox def compose(g): return lambda f: lambda x: g(f(x)) def concat(xs): def f(ys): zs = list(chain(*ys)) return ''.join(zs) if isinstance(ys[0], str) else zs return ( f(xs) if isinstance(xs, list) else ( chain.from_iterable(xs) ) ) if xs else [] def fmap(f): def go(xs): return list(map(f, xs)) return go def index(xs): return lambda n: None if 0 > n else ( xs[n] if ( hasattr(xs, "__getitem__") ) else next(islice(xs, n, None)) ) def showRatio(m): def go(n): def f(r): d = r.denominator return str(r.numerator).rjust(m, ' ') + ( ('/' + str(d).ljust(n, ' ')) if 1 != d else ( ' ' * (1 + n) ) ) return f return go if __name__ == '__main__': main()
import java.math.BigDecimal; import java.math.MathContext; import java.util.Arrays; import java.util.stream.LongStream; public class FaulhabersTriangle { private static final MathContext MC = new MathContext(256); private static long gcd(long a, long b) { if (b == 0) { return a; } return gcd(b, a % b); } private static class Frac implements Comparable<Frac> { private long num; private long denom; public static final Frac ZERO = new Frac(0, 1); public Frac(long n, long d) { if (d == 0) throw new IllegalArgumentException("d must not be zero"); long nn = n; long dd = d; if (nn == 0) { dd = 1; } else if (dd < 0) { nn = -nn; dd = -dd; } long g = Math.abs(gcd(nn, dd)); if (g > 1) { nn /= g; dd /= g; } num = nn; denom = dd; } public Frac plus(Frac rhs) { return new Frac(num * rhs.denom + denom * rhs.num, rhs.denom * denom); } public Frac unaryMinus() { return new Frac(-num, denom); } public Frac minus(Frac rhs) { return this.plus(rhs.unaryMinus()); } public Frac times(Frac rhs) { return new Frac(this.num * rhs.num, this.denom * rhs.denom); } @Override public int compareTo(Frac o) { double diff = toDouble() - o.toDouble(); return Double.compare(diff, 0.0); } @Override public boolean equals(Object obj) { return null != obj && obj instanceof Frac && this.compareTo((Frac) obj) == 0; } @Override public String toString() { if (denom == 1) { return Long.toString(num); } return String.format("%d/%d", num, denom); } public double toDouble() { return (double) num / denom; } public BigDecimal toBigDecimal() { return BigDecimal.valueOf(num).divide(BigDecimal.valueOf(denom), MC); } } private static Frac bernoulli(int n) { if (n < 0) throw new IllegalArgumentException("n may not be negative or zero"); Frac[] a = new Frac[n + 1]; Arrays.fill(a, Frac.ZERO); for (int m = 0; m <= n; ++m) { a[m] = new Frac(1, m + 1); for (int j = m; j >= 1; --j) { a[j - 1] = a[j - 1].minus(a[j]).times(new Frac(j, 1)); } } if (n != 1) return a[0]; return a[0].unaryMinus(); } private static long binomial(int n, int k) { if (n < 0 || k < 0 || n < k) throw new IllegalArgumentException(); if (n == 0 || k == 0) return 1; long num = LongStream.rangeClosed(k + 1, n).reduce(1, (a, b) -> a * b); long den = LongStream.rangeClosed(2, n - k).reduce(1, (acc, i) -> acc * i); return num / den; } private static Frac[] faulhaberTriangle(int p) { Frac[] coeffs = new Frac[p + 1]; Arrays.fill(coeffs, Frac.ZERO); Frac q = new Frac(1, p + 1); int sign = -1; for (int j = 0; j <= p; ++j) { sign *= -1; coeffs[p - j] = q.times(new Frac(sign, 1)).times(new Frac(binomial(p + 1, j), 1)).times(bernoulli(j)); } return coeffs; } public static void main(String[] args) { for (int i = 0; i <= 9; ++i) { Frac[] coeffs = faulhaberTriangle(i); for (Frac coeff : coeffs) { System.out.printf("%5s ", coeff); } System.out.println(); } System.out.println(); int k = 17; Frac[] cc = faulhaberTriangle(k); int n = 1000; BigDecimal nn = BigDecimal.valueOf(n); BigDecimal np = BigDecimal.ONE; BigDecimal sum = BigDecimal.ZERO; for (Frac c : cc) { np = np.multiply(nn); sum = sum.add(np.multiply(c.toBigDecimal())); } System.out.println(sum.toBigInteger()); } }
Maintain the same structure and functionality when rewriting this code in Java.
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
Write the same algorithm in Java as shown in this Python implementation.
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
Can you help me rewrite this code in Java instead of Python, keeping it the same logically?
import sys program_name = sys.argv[0] arguments = sys.argv[1:] count = len(arguments)
public class Arguments { public static void main(String[] args) { System.out.println("There are " + args.length + " arguments given."); for(int i = 0; i < args.length; i++) System.out.println("The argument #" + (i+1) + " is " + args[i] + " and is at index " + i); } }
Convert this Python block to Java, preserving its control flow and logic.
arr1 = [1, 2, 3] arr2 = [4, 5, 6] arr3 = [7, 8, 9] arr4 = arr1 + arr2 assert arr4 == [1, 2, 3, 4, 5, 6] arr4.extend(arr3) assert arr4 == [1, 2, 3, 4, 5, 6, 7, 8, 9]
String[] fruits = ["apples", "oranges"]; String[] grains = ["wheat", "corn"]; String[] all = fruits + grains;
Translate this program into Java but keep the logic exactly as in Python.
string = raw_input("Input a string: ")
import java.util.Scanner; public class GetInput { public static void main(String[] args) throws Exception { Scanner s = new Scanner(System.in); System.out.print("Enter a string: "); String str = s.nextLine(); System.out.print("Enter an integer: "); int i = Integer.parseInt(s.next()); } }
Produce a functionally identical Java code for the snippet given in Python.
>>> import winsound >>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]: winsound.Beep(int(note+.5), 500) >>>
import processing.sound.*; float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25}; SinOsc sine; size(500,500); sine = new SinOsc(this); for(int i=0;i<frequencies.length;i++){ sine.freq(frequencies[i]); sine.play(); delay(500); }
Generate an equivalent Java version of this Python code.
>>> import winsound >>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]: winsound.Beep(int(note+.5), 500) >>>
import processing.sound.*; float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25}; SinOsc sine; size(500,500); sine = new SinOsc(this); for(int i=0;i<frequencies.length;i++){ sine.freq(frequencies[i]); sine.play(); delay(500); }
Write the same code in Java as shown below in Python.
>>> import winsound >>> for note in [261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25]: winsound.Beep(int(note+.5), 500) >>>
import processing.sound.*; float[] frequencies = {261.63, 293.66, 329.63, 349.23, 392.00, 440.00, 493.88, 523.25}; SinOsc sine; size(500,500); sine = new SinOsc(this); for(int i=0;i<frequencies.length;i++){ sine.freq(frequencies[i]); sine.play(); delay(500); }
Write a version of this Python function in Java with identical behavior.
from itertools import combinations def anycomb(items): ' return combinations of any length from the items ' return ( comb for r in range(1, len(items)+1) for comb in combinations(items, r) ) def totalvalue(comb): ' Totalise a particular combination of items' totwt = totval = 0 for item, wt, val in comb: totwt += wt totval += val return (totval, -totwt) if totwt <= 400 else (0, 0) items = ( ("map", 9, 150), ("compass", 13, 35), ("water", 153, 200), ("sandwich", 50, 160), ("glucose", 15, 60), ("tin", 68, 45), ("banana", 27, 60), ("apple", 39, 40), ("cheese", 23, 30), ("beer", 52, 10), ("suntan cream", 11, 70), ("camera", 32, 30), ("t-shirt", 24, 15), ("trousers", 48, 10), ("umbrella", 73, 40), ("waterproof trousers", 42, 70), ("waterproof overclothes", 43, 75), ("note-case", 22, 80), ("sunglasses", 7, 20), ("towel", 18, 12), ("socks", 4, 50), ("book", 30, 10), ) bagged = max( anycomb(items), key=totalvalue) print("Bagged the following items\n " + '\n '.join(sorted(item for item,_,_ in bagged))) val, wt = totalvalue(bagged) print("for a total value of %i and a total weight of %i" % (val, -wt))
package hu.pj.alg.test; import hu.pj.alg.ZeroOneKnapsack; import hu.pj.obj.Item; import java.util.*; import java.text.*; public class ZeroOneKnapsackForTourists { public ZeroOneKnapsackForTourists() { ZeroOneKnapsack zok = new ZeroOneKnapsack(400); zok.add("map", 9, 150); zok.add("compass", 13, 35); zok.add("water", 153, 200); zok.add("sandwich", 50, 160); zok.add("glucose", 15, 60); zok.add("tin", 68, 45); zok.add("banana", 27, 60); zok.add("apple", 39, 40); zok.add("cheese", 23, 30); zok.add("beer", 52, 10); zok.add("suntan cream", 11, 70); zok.add("camera", 32, 30); zok.add("t-shirt", 24, 15); zok.add("trousers", 48, 10); zok.add("umbrella", 73, 40); zok.add("waterproof trousers", 42, 70); zok.add("waterproof overclothes", 43, 75); zok.add("note-case", 22, 80); zok.add("sunglasses", 7, 20); zok.add("towel", 18, 12); zok.add("socks", 4, 50); zok.add("book", 30, 10); List<Item> itemList = zok.calcSolution(); if (zok.isCalculated()) { NumberFormat nf = NumberFormat.getInstance(); System.out.println( "Maximal weight = " + nf.format(zok.getMaxWeight() / 100.0) + " kg" ); System.out.println( "Total weight of solution = " + nf.format(zok.getSolutionWeight() / 100.0) + " kg" ); System.out.println( "Total value = " + zok.getProfit() ); System.out.println(); System.out.println( "You can carry the following materials " + "in the knapsack:" ); for (Item item : itemList) { if (item.getInKnapsack() == 1) { System.out.format( "%1$-23s %2$-3s %3$-5s %4$-15s \n", item.getName(), item.getWeight(), "dag ", "(value = " + item.getValue() + ")" ); } } } else { System.out.println( "The problem is not solved. " + "Maybe you gave wrong data." ); } } public static void main(String[] args) { new ZeroOneKnapsackForTourists(); } }
Change the programming language of this snippet from Python to Java without modifying what it does.
from __future__ import print_function from itertools import takewhile maxsum = 99 def get_primes(max): if max < 2: return [] lprimes = [2] for x in range(3, max + 1, 2): for p in lprimes: if x % p == 0: break else: lprimes.append(x) return lprimes descendants = [[] for _ in range(maxsum + 1)] ancestors = [[] for _ in range(maxsum + 1)] primes = get_primes(maxsum) for p in primes: descendants[p].append(p) for s in range(1, len(descendants) - p): descendants[s + p] += [p * pr for pr in descendants[s]] for p in primes + [4]: descendants[p].pop() total = 0 for s in range(1, maxsum + 1): descendants[s].sort() for d in takewhile(lambda x: x <= maxsum, descendants[s]): ancestors[d] = ancestors[s] + [s] print([s], "Level:", len(ancestors[s])) print("Ancestors:", ancestors[s] if len(ancestors[s]) else "None") print("Descendants:", len(descendants[s]) if len(descendants[s]) else "None") if len(descendants[s]): print(descendants[s]) print() total += len(descendants[s]) print("Total descendants", total)
import java.io.*; import java.util.*; public class PrimeDescendants { public static void main(String[] args) { try (Writer writer = new BufferedWriter(new OutputStreamWriter(System.out))) { printPrimeDesc(writer, 100); } catch (IOException ex) { ex.printStackTrace(); } } private static void printPrimeDesc(Writer writer, int limit) throws IOException { List<Long> primes = findPrimes(limit); List<Long> ancestor = new ArrayList<>(limit); List<List<Long>> descendants = new ArrayList<>(limit); for (int i = 0; i < limit; ++i) { ancestor.add(Long.valueOf(0)); descendants.add(new ArrayList<Long>()); } for (Long prime : primes) { int p = prime.intValue(); descendants.get(p).add(prime); for (int i = 0; i + p < limit; ++i) { int s = i + p; for (Long n : descendants.get(i)) { Long prod = n * p; descendants.get(s).add(prod); if (prod < limit) ancestor.set(prod.intValue(), Long.valueOf(s)); } } } int totalDescendants = 0; for (int i = 1; i < limit; ++i) { List<Long> ancestors = getAncestors(ancestor, i); writer.write("[" + i + "] Level: " + ancestors.size() + "\n"); writer.write("Ancestors: "); Collections.sort(ancestors); print(writer, ancestors); writer.write("Descendants: "); List<Long> desc = descendants.get(i); if (!desc.isEmpty()) { Collections.sort(desc); if (desc.get(0) == i) desc.remove(0); } writer.write(desc.size() + "\n"); totalDescendants += desc.size(); if (!desc.isEmpty()) print(writer, desc); writer.write("\n"); } writer.write("Total descendants: " + totalDescendants + "\n"); } private static List<Long> findPrimes(int limit) { boolean[] isprime = new boolean[limit]; Arrays.fill(isprime, true); isprime[0] = isprime[1] = false; for (int p = 2; p * p < limit; ++p) { if (isprime[p]) { for (int i = p * p; i < limit; i += p) isprime[i] = false; } } List<Long> primes = new ArrayList<>(); for (int p = 2; p < limit; ++p) { if (isprime[p]) primes.add(Long.valueOf(p)); } return primes; } private static List<Long> getAncestors(List<Long> ancestor, int n) { List<Long> result = new ArrayList<>(); for (Long a = ancestor.get(n); a != 0 && a != n; ) { n = a.intValue(); a = ancestor.get(n); result.add(Long.valueOf(n)); } return result; } private static void print(Writer writer, List<Long> list) throws IOException { if (list.isEmpty()) { writer.write("none\n"); return; } int i = 0; writer.write(String.valueOf(list.get(i++))); for (; i != list.size(); ++i) writer.write(", " + list.get(i)); writer.write("\n"); } }
Convert this Python snippet to Java and keep its semantics consistent.
import itertools def cp(lsts): return list(itertools.product(*lsts)) if __name__ == '__main__': from pprint import pprint as pp for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []], ((1776, 1789), (7, 12), (4, 14, 23), (0, 1)), ((1, 2, 3), (30,), (500, 100)), ((1, 2, 3), (), (500, 100))]: print(lists, '=>') pp(cp(lists), indent=2)
import static java.util.Arrays.asList; import static java.util.Collections.emptyList; import static java.util.Optional.of; import static java.util.stream.Collectors.toList; import java.util.List; public class CartesianProduct { public List<?> product(List<?>... a) { if (a.length >= 2) { List<?> product = a[0]; for (int i = 1; i < a.length; i++) { product = product(product, a[i]); } return product; } return emptyList(); } private <A, B> List<?> product(List<A> a, List<B> b) { return of(a.stream() .map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList())) .flatMap(List::stream) .collect(toList())).orElse(emptyList()); } }
Convert the following code from Python to Java, ensuring the logic remains intact.
import itertools def cp(lsts): return list(itertools.product(*lsts)) if __name__ == '__main__': from pprint import pprint as pp for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []], ((1776, 1789), (7, 12), (4, 14, 23), (0, 1)), ((1, 2, 3), (30,), (500, 100)), ((1, 2, 3), (), (500, 100))]: print(lists, '=>') pp(cp(lists), indent=2)
import static java.util.Arrays.asList; import static java.util.Collections.emptyList; import static java.util.Optional.of; import static java.util.stream.Collectors.toList; import java.util.List; public class CartesianProduct { public List<?> product(List<?>... a) { if (a.length >= 2) { List<?> product = a[0]; for (int i = 1; i < a.length; i++) { product = product(product, a[i]); } return product; } return emptyList(); } private <A, B> List<?> product(List<A> a, List<B> b) { return of(a.stream() .map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList())) .flatMap(List::stream) .collect(toList())).orElse(emptyList()); } }
Translate this program into Java but keep the logic exactly as in Python.
import itertools def cp(lsts): return list(itertools.product(*lsts)) if __name__ == '__main__': from pprint import pprint as pp for lists in [[[1,2],[3,4]], [[3,4],[1,2]], [[], [1, 2]], [[1, 2], []], ((1776, 1789), (7, 12), (4, 14, 23), (0, 1)), ((1, 2, 3), (30,), (500, 100)), ((1, 2, 3), (), (500, 100))]: print(lists, '=>') pp(cp(lists), indent=2)
import static java.util.Arrays.asList; import static java.util.Collections.emptyList; import static java.util.Optional.of; import static java.util.stream.Collectors.toList; import java.util.List; public class CartesianProduct { public List<?> product(List<?>... a) { if (a.length >= 2) { List<?> product = a[0]; for (int i = 1; i < a.length; i++) { product = product(product, a[i]); } return product; } return emptyList(); } private <A, B> List<?> product(List<A> a, List<B> b) { return of(a.stream() .map(e1 -> of(b.stream().map(e2 -> asList(e1, e2)).collect(toList())).orElse(emptyList())) .flatMap(List::stream) .collect(toList())).orElse(emptyList()); } }
Produce a language-to-language conversion: from Python to Java, same semantics.
>>> >>> from math import sin, cos, acos, asin >>> >>> cube = lambda x: x * x * x >>> croot = lambda x: x ** (1/3.0) >>> >>> >>> compose = lambda f1, f2: ( lambda x: f1(f2(x)) ) >>> >>> funclist = [sin, cos, cube] >>> funclisti = [asin, acos, croot] >>> >>> [compose(inversef, f)(.5) for f, inversef in zip(funclist, funclisti)] [0.5, 0.4999999999999999, 0.5] >>>
import java.util.ArrayList; public class FirstClass{ public interface Function<A,B>{ B apply(A x); } public static <A,B,C> Function<A, C> compose( final Function<B, C> f, final Function<A, B> g) { return new Function<A, C>() { @Override public C apply(A x) { return f.apply(g.apply(x)); } }; } public static void main(String[] args){ ArrayList<Function<Double, Double>> functions = new ArrayList<Function<Double,Double>>(); functions.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.cos(x); } }); functions.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.tan(x); } }); functions.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return x * x; } }); ArrayList<Function<Double, Double>> inverse = new ArrayList<Function<Double,Double>>(); inverse.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.acos(x); } }); inverse.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.atan(x); } }); inverse.add( new Function<Double, Double>(){ @Override public Double apply(Double x){ return Math.sqrt(x); } }); System.out.println("Compositions:"); for(int i = 0; i < functions.size(); i++){ System.out.println(compose(functions.get(i), inverse.get(i)).apply(0.5)); } System.out.println("Hard-coded compositions:"); System.out.println(Math.cos(Math.acos(0.5))); System.out.println(Math.tan(Math.atan(0.5))); System.out.println(Math.pow(Math.sqrt(0.5), 2)); } }
Ensure the translated Java code behaves exactly like the original Python snippet.
>>> def proper_divs2(n): ... return {x for x in range(1, (n + 1) // 2 + 1) if n % x == 0 and n != x} ... >>> [proper_divs2(n) for n in range(1, 11)] [set(), {1}, {1}, {1, 2}, {1}, {1, 2, 3}, {1}, {1, 2, 4}, {1, 3}, {1, 2, 5}] >>> >>> n, length = max(((n, len(proper_divs2(n))) for n in range(1, 20001)), key=lambda pd: pd[1]) >>> n 15120 >>> length 79 >>>
import java.util.Collections; import java.util.LinkedList; import java.util.List; public class Proper{ public static List<Integer> properDivs(int n){ List<Integer> divs = new LinkedList<Integer>(); if(n == 1) return divs; divs.add(1); for(int x = 2; x < n; x++){ if(n % x == 0) divs.add(x); } Collections.sort(divs); return divs; } public static void main(String[] args){ for(int x = 1; x <= 10; x++){ System.out.println(x + ": " + properDivs(x)); } int x = 0, count = 0; for(int n = 1; n <= 20000; n++){ if(properDivs(n).size() > count){ x = n; count = properDivs(n).size(); } } System.out.println(x + ": " + count); } }
Translate this program into Java but keep the logic exactly as in Python.
>>> from xml.etree import ElementTree as ET >>> from itertools import izip >>> def characterstoxml(names, remarks): root = ET.Element("CharacterRemarks") for name, remark in izip(names, remarks): c = ET.SubElement(root, "Character", {'name': name}) c.text = remark return ET.tostring(root) >>> print characterstoxml( names = ["April", "Tam O'Shanter", "Emily"], remarks = [ "Bubbly: I'm > Tam and <= Emily", 'Burns: "When chapman billies leave the street ..."', 'Short & shrift' ] ).replace('><','>\n<')
import java.io.StringWriter; import javax.xml.parsers.DocumentBuilderFactory; import javax.xml.transform.Result; import javax.xml.transform.Source; import javax.xml.transform.Transformer; import javax.xml.transform.TransformerFactory; import javax.xml.transform.dom.DOMSource; import javax.xml.transform.stream.StreamResult; import org.w3c.dom.Document; import org.w3c.dom.Element; public class XmlCreation { private static final String[] names = {"April", "Tam O'Shanter", "Emily"}; private static final String[] remarks = {"Bubbly: I'm > Tam and <= Emily", "Burns: \"When chapman billies leave the street ...\"", "Short & shrift"}; public static void main(String[] args) { try { final Document doc = DocumentBuilderFactory.newInstance().newDocumentBuilder().newDocument(); final Element root = doc.createElement("CharacterRemarks"); doc.appendChild(root); for(int i = 0; i < names.length; i++) { final Element character = doc.createElement("Character"); root.appendChild(character); character.setAttribute("name", names[i]); character.appendChild(doc.createTextNode(remarks[i])); } final Source source = new DOMSource(doc); final StringWriter buffer = new StringWriter(); final Result result = new StreamResult(buffer); final Transformer transformer = TransformerFactory.newInstance().newTransformer(); transformer.setOutputProperty("indent", "yes"); transformer.transform(source, result); System.out.println(buffer.toString()); } catch (Exception e) { e.printStackTrace(); } } }
Port the following code from Python to Java with equivalent syntax and logic.
>>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0] >>> import pylab >>> pylab.plot(x, y, 'bo') >>> pylab.savefig('qsort-range-10-9.png')
import java.awt.*; import java.awt.event.*; import java.awt.geom.*; import javax.swing.JApplet; import javax.swing.JFrame; public class Plot2d extends JApplet { double[] xi; double[] yi; public Plot2d(double[] x, double[] y) { this.xi = x; this.yi = y; } public static double max(double[] t) { double maximum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] > maximum) { maximum = t[i]; } } return maximum; } public static double min(double[] t) { double minimum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] < minimum) { minimum = t[i]; } } return minimum; } public void init() { setBackground(Color.white); setForeground(Color.white); } public void paint(Graphics g) { Graphics2D g2 = (Graphics2D) g; g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); g2.setPaint(Color.black); int x0 = 70; int y0 = 10; int xm = 670; int ym = 410; int xspan = xm - x0; int yspan = ym - y0; double xmax = max(xi); double xmin = min(xi); double ymax = max(yi); double ymin = min(yi); g2.draw(new Line2D.Double(x0, ym, xm, ym)); g2.draw(new Line2D.Double(x0, ym, x0, y0)); for (int j = 0; j < 5; j++) { int interv = 4; g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20); g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)), ym - j * yspan / interv + y0 - 5); g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5)); g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0)); } for (int i = 0; i < xi.length; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); g2.drawString("o", x0 + f - 3, h + 14); } for (int i = 0; i < xi.length - 1; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin)); g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0)); } } public static void main(String args[]) { JFrame f = new JFrame("ShapesDemo2D"); f.addWindowListener(new WindowAdapter() { public void windowClosing(WindowEvent e) { System.exit(0); } }); double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09}; JApplet applet = new Plot2d(r, t); f.getContentPane().add("Center", applet); applet.init(); f.pack(); f.setSize(new Dimension(720, 480)); f.show(); } }
Produce a functionally identical Java code for the snippet given in Python.
>>> x = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] >>> y = [2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0] >>> import pylab >>> pylab.plot(x, y, 'bo') >>> pylab.savefig('qsort-range-10-9.png')
import java.awt.*; import java.awt.event.*; import java.awt.geom.*; import javax.swing.JApplet; import javax.swing.JFrame; public class Plot2d extends JApplet { double[] xi; double[] yi; public Plot2d(double[] x, double[] y) { this.xi = x; this.yi = y; } public static double max(double[] t) { double maximum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] > maximum) { maximum = t[i]; } } return maximum; } public static double min(double[] t) { double minimum = t[0]; for (int i = 1; i < t.length; i++) { if (t[i] < minimum) { minimum = t[i]; } } return minimum; } public void init() { setBackground(Color.white); setForeground(Color.white); } public void paint(Graphics g) { Graphics2D g2 = (Graphics2D) g; g2.setRenderingHint(RenderingHints.KEY_ANTIALIASING, RenderingHints.VALUE_ANTIALIAS_ON); g2.setPaint(Color.black); int x0 = 70; int y0 = 10; int xm = 670; int ym = 410; int xspan = xm - x0; int yspan = ym - y0; double xmax = max(xi); double xmin = min(xi); double ymax = max(yi); double ymin = min(yi); g2.draw(new Line2D.Double(x0, ym, xm, ym)); g2.draw(new Line2D.Double(x0, ym, x0, y0)); for (int j = 0; j < 5; j++) { int interv = 4; g2.drawString("" + (j * (xmax - xmin) / interv + xmin), j * xspan / interv + x0 - 10, ym + 20); g2.drawString("" + (j * (ymax - ymin) / interv + ymin), x0 - 20 - (int) (9 * Math.log10(ymax)), ym - j * yspan / interv + y0 - 5); g2.draw(new Line2D.Double(j * xspan / interv + x0, ym, j * xspan / interv + x0, ym + 5)); g2.draw(new Line2D.Double(x0 - 5, j * yspan / interv + y0, x0, j * yspan / interv + y0)); } for (int i = 0; i < xi.length; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); g2.drawString("o", x0 + f - 3, h + 14); } for (int i = 0; i < xi.length - 1; i++) { int f = (int) ((xi[i] - xmin) * xspan / (xmax - xmin)); int f2 = (int) ((xi[i + 1] - xmin) * xspan / (xmax - xmin)); int h = (int) (((ymax - ymin) - (yi[i] - ymin)) * yspan / (ymax - ymin)); int h2 = (int) (((ymax - ymin) - (yi[i + 1] - ymin)) * yspan / (ymax - ymin)); g2.draw(new Line2D.Double(f + x0, h + y0, f2 + x0, h2 + y0)); } } public static void main(String args[]) { JFrame f = new JFrame("ShapesDemo2D"); f.addWindowListener(new WindowAdapter() { public void windowClosing(WindowEvent e) { System.exit(0); } }); double[] r = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double[] t = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.09}; JApplet applet = new Plot2d(r, t); f.getContentPane().add("Center", applet); applet.init(); f.pack(); f.setSize(new Dimension(720, 480)); f.show(); } }
Generate a Java translation of this Python snippet without changing its computational steps.
import re string = "This is a string" if re.search('string$', string): print("Ends with string.") string = re.sub(" a ", " another ", string) print(string)
String str = "I am a string"; if (str.matches(".*string")) { System.out.println("ends with 'string'"); }
Port the provided Python code into Java while preserving the original functionality.
inclusive_range = mn, mx = (1, 10) print( % inclusive_range) i = 0 while True: i += 1 guess = (mn+mx)//2 txt = input("Guess %2i is: %2i. The score for which is (h,l,=): " % (i, guess)).strip().lower()[0] if txt not in 'hl=': print(" I don't understand your input of '%s' ?" % txt) continue if txt == 'h': mx = guess-1 if txt == 'l': mn = guess+1 if txt == '=': print(" Ye-Haw!!") break if (mn > mx) or (mn < inclusive_range[0]) or (mx > inclusive_range[1]): print("Please check your scoring as I cannot find the value") break print("\nThanks for keeping score.")
import java.util.AbstractList; import java.util.Collections; import java.util.Scanner; public class GuessNumber { public static final int LOWER = 0, UPPER = 100; public static void main(String[] args) { System.out.printf("Instructions:\n" + "Think of integer number from %d (inclusive) to %d (exclusive) and\n" + "I will guess it. After each guess, you respond with L, H, or C depending\n" + "on if my guess was too low, too high, or correct.\n", LOWER, UPPER); int result = Collections.binarySearch(new AbstractList<Integer>() { private final Scanner in = new Scanner(System.in); public int size() { return UPPER - LOWER; } public Integer get(int i) { System.out.printf("My guess is: %d. Is it too high, too low, or correct? (H/L/C) ", LOWER+i); String s = in.nextLine(); assert s.length() > 0; switch (Character.toLowerCase(s.charAt(0))) { case 'l': return -1; case 'h': return 1; case 'c': return 0; } return -1; } }, 0); if (result < 0) System.out.println("That is impossible."); else System.out.printf("Your number is %d.\n", result); } }
Transform the following Python implementation into Java, maintaining the same output and logic.
keys = ['a', 'b', 'c'] values = [1, 2, 3] hash = {key: value for key, value in zip(keys, values)}
import java.util.HashMap; public static void main(String[] args){ String[] keys= {"a", "b", "c"}; int[] vals= {1, 2, 3}; HashMap<String, Integer> hash= new HashMap<String, Integer>(); for(int i= 0; i < keys.length; i++){ hash.put(keys[i], vals[i]); } }
Please provide an equivalent version of this Python code in Java.
keys = ['a', 'b', 'c'] values = [1, 2, 3] hash = {key: value for key, value in zip(keys, values)}
import java.util.HashMap; public static void main(String[] args){ String[] keys= {"a", "b", "c"}; int[] vals= {1, 2, 3}; HashMap<String, Integer> hash= new HashMap<String, Integer>(); for(int i= 0; i < keys.length; i++){ hash.put(keys[i], vals[i]); } }
Write a version of this Python function in Java with identical behavior.
from bisect import bisect_right def bin_it(limits: list, data: list) -> list: "Bin data according to (ascending) limits." bins = [0] * (len(limits) + 1) for d in data: bins[bisect_right(limits, d)] += 1 return bins def bin_print(limits: list, bins: list) -> list: print(f" < {limits[0]:3} := {bins[0]:3}") for lo, hi, count in zip(limits, limits[1:], bins[1:]): print(f">= {lo:3} .. < {hi:3} := {count:3}") print(f">= {limits[-1]:3}  := {bins[-1]:3}") if __name__ == "__main__": print("RC FIRST EXAMPLE\n") limits = [23, 37, 43, 53, 67, 83] data = [95,21,94,12,99,4,70,75,83,93,52,80,57,5,53,86,65,17,92,83,71,61,54,58,47, 16, 8, 9,32,84,7,87,46,19,30,37,96,6,98,40,79,97,45,64,60,29,49,36,43,55] bins = bin_it(limits, data) bin_print(limits, bins) print("\nRC SECOND EXAMPLE\n") limits = [14, 18, 249, 312, 389, 392, 513, 591, 634, 720] data = [445,814,519,697,700,130,255,889,481,122,932, 77,323,525,570,219,367,523,442,933, 416,589,930,373,202,253,775, 47,731,685,293,126,133,450,545,100,741,583,763,306, 655,267,248,477,549,238, 62,678, 98,534,622,907,406,714,184,391,913, 42,560,247, 346,860, 56,138,546, 38,985,948, 58,213,799,319,390,634,458,945,733,507,916,123, 345,110,720,917,313,845,426, 9,457,628,410,723,354,895,881,953,677,137,397, 97, 854,740, 83,216,421, 94,517,479,292,963,376,981,480, 39,257,272,157, 5,316,395, 787,942,456,242,759,898,576, 67,298,425,894,435,831,241,989,614,987,770,384,692, 698,765,331,487,251,600,879,342,982,527,736,795,585, 40, 54,901,408,359,577,237, 605,847,353,968,832,205,838,427,876,959,686,646,835,127,621,892,443,198,988,791, 466, 23,707,467, 33,670,921,180,991,396,160,436,717,918, 8,374,101,684,727,749] bins = bin_it(limits, data) bin_print(limits, bins)
import java.util.Arrays; import java.util.Collections; import java.util.List; public class Bins { public static <T extends Comparable<? super T>> int[] bins( List<? extends T> limits, Iterable<? extends T> data) { int[] result = new int[limits.size() + 1]; for (T n : data) { int i = Collections.binarySearch(limits, n); if (i >= 0) { i = i+1; } else { i = ~i; } result[i]++; } return result; } public static void printBins(List<?> limits, int[] bins) { int n = limits.size(); if (n == 0) { return; } assert n+1 == bins.length; System.out.printf(" < %3s: %2d\n", limits.get(0), bins[0]); for (int i = 1; i < n; i++) { System.out.printf(">= %3s and < %3s: %2d\n", limits.get(i-1), limits.get(i), bins[i]); } System.out.printf(">= %3s  : %2d\n", limits.get(n-1), bins[n]); } public static void main(String[] args) { List<Integer> limits = Arrays.asList(23, 37, 43, 53, 67, 83); List<Integer> data = Arrays.asList( 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55); System.out.println("Example 1:"); printBins(limits, bins(limits, data)); limits = Arrays.asList(14, 18, 249, 312, 389, 392, 513, 591, 634, 720); data = Arrays.asList( 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749); System.out.println(); System.out.println("Example 2:"); printBins(limits, bins(limits, data)); } }
Write a version of this Python function in Java with identical behavior.
from bisect import bisect_right def bin_it(limits: list, data: list) -> list: "Bin data according to (ascending) limits." bins = [0] * (len(limits) + 1) for d in data: bins[bisect_right(limits, d)] += 1 return bins def bin_print(limits: list, bins: list) -> list: print(f" < {limits[0]:3} := {bins[0]:3}") for lo, hi, count in zip(limits, limits[1:], bins[1:]): print(f">= {lo:3} .. < {hi:3} := {count:3}") print(f">= {limits[-1]:3}  := {bins[-1]:3}") if __name__ == "__main__": print("RC FIRST EXAMPLE\n") limits = [23, 37, 43, 53, 67, 83] data = [95,21,94,12,99,4,70,75,83,93,52,80,57,5,53,86,65,17,92,83,71,61,54,58,47, 16, 8, 9,32,84,7,87,46,19,30,37,96,6,98,40,79,97,45,64,60,29,49,36,43,55] bins = bin_it(limits, data) bin_print(limits, bins) print("\nRC SECOND EXAMPLE\n") limits = [14, 18, 249, 312, 389, 392, 513, 591, 634, 720] data = [445,814,519,697,700,130,255,889,481,122,932, 77,323,525,570,219,367,523,442,933, 416,589,930,373,202,253,775, 47,731,685,293,126,133,450,545,100,741,583,763,306, 655,267,248,477,549,238, 62,678, 98,534,622,907,406,714,184,391,913, 42,560,247, 346,860, 56,138,546, 38,985,948, 58,213,799,319,390,634,458,945,733,507,916,123, 345,110,720,917,313,845,426, 9,457,628,410,723,354,895,881,953,677,137,397, 97, 854,740, 83,216,421, 94,517,479,292,963,376,981,480, 39,257,272,157, 5,316,395, 787,942,456,242,759,898,576, 67,298,425,894,435,831,241,989,614,987,770,384,692, 698,765,331,487,251,600,879,342,982,527,736,795,585, 40, 54,901,408,359,577,237, 605,847,353,968,832,205,838,427,876,959,686,646,835,127,621,892,443,198,988,791, 466, 23,707,467, 33,670,921,180,991,396,160,436,717,918, 8,374,101,684,727,749] bins = bin_it(limits, data) bin_print(limits, bins)
import java.util.Arrays; import java.util.Collections; import java.util.List; public class Bins { public static <T extends Comparable<? super T>> int[] bins( List<? extends T> limits, Iterable<? extends T> data) { int[] result = new int[limits.size() + 1]; for (T n : data) { int i = Collections.binarySearch(limits, n); if (i >= 0) { i = i+1; } else { i = ~i; } result[i]++; } return result; } public static void printBins(List<?> limits, int[] bins) { int n = limits.size(); if (n == 0) { return; } assert n+1 == bins.length; System.out.printf(" < %3s: %2d\n", limits.get(0), bins[0]); for (int i = 1; i < n; i++) { System.out.printf(">= %3s and < %3s: %2d\n", limits.get(i-1), limits.get(i), bins[i]); } System.out.printf(">= %3s  : %2d\n", limits.get(n-1), bins[n]); } public static void main(String[] args) { List<Integer> limits = Arrays.asList(23, 37, 43, 53, 67, 83); List<Integer> data = Arrays.asList( 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55); System.out.println("Example 1:"); printBins(limits, bins(limits, data)); limits = Arrays.asList(14, 18, 249, 312, 389, 392, 513, 591, 634, 720); data = Arrays.asList( 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749); System.out.println(); System.out.println("Example 2:"); printBins(limits, bins(limits, data)); } }
Change the programming language of this snippet from Python to Java without modifying what it does.
from bisect import bisect_right def bin_it(limits: list, data: list) -> list: "Bin data according to (ascending) limits." bins = [0] * (len(limits) + 1) for d in data: bins[bisect_right(limits, d)] += 1 return bins def bin_print(limits: list, bins: list) -> list: print(f" < {limits[0]:3} := {bins[0]:3}") for lo, hi, count in zip(limits, limits[1:], bins[1:]): print(f">= {lo:3} .. < {hi:3} := {count:3}") print(f">= {limits[-1]:3}  := {bins[-1]:3}") if __name__ == "__main__": print("RC FIRST EXAMPLE\n") limits = [23, 37, 43, 53, 67, 83] data = [95,21,94,12,99,4,70,75,83,93,52,80,57,5,53,86,65,17,92,83,71,61,54,58,47, 16, 8, 9,32,84,7,87,46,19,30,37,96,6,98,40,79,97,45,64,60,29,49,36,43,55] bins = bin_it(limits, data) bin_print(limits, bins) print("\nRC SECOND EXAMPLE\n") limits = [14, 18, 249, 312, 389, 392, 513, 591, 634, 720] data = [445,814,519,697,700,130,255,889,481,122,932, 77,323,525,570,219,367,523,442,933, 416,589,930,373,202,253,775, 47,731,685,293,126,133,450,545,100,741,583,763,306, 655,267,248,477,549,238, 62,678, 98,534,622,907,406,714,184,391,913, 42,560,247, 346,860, 56,138,546, 38,985,948, 58,213,799,319,390,634,458,945,733,507,916,123, 345,110,720,917,313,845,426, 9,457,628,410,723,354,895,881,953,677,137,397, 97, 854,740, 83,216,421, 94,517,479,292,963,376,981,480, 39,257,272,157, 5,316,395, 787,942,456,242,759,898,576, 67,298,425,894,435,831,241,989,614,987,770,384,692, 698,765,331,487,251,600,879,342,982,527,736,795,585, 40, 54,901,408,359,577,237, 605,847,353,968,832,205,838,427,876,959,686,646,835,127,621,892,443,198,988,791, 466, 23,707,467, 33,670,921,180,991,396,160,436,717,918, 8,374,101,684,727,749] bins = bin_it(limits, data) bin_print(limits, bins)
import java.util.Arrays; import java.util.Collections; import java.util.List; public class Bins { public static <T extends Comparable<? super T>> int[] bins( List<? extends T> limits, Iterable<? extends T> data) { int[] result = new int[limits.size() + 1]; for (T n : data) { int i = Collections.binarySearch(limits, n); if (i >= 0) { i = i+1; } else { i = ~i; } result[i]++; } return result; } public static void printBins(List<?> limits, int[] bins) { int n = limits.size(); if (n == 0) { return; } assert n+1 == bins.length; System.out.printf(" < %3s: %2d\n", limits.get(0), bins[0]); for (int i = 1; i < n; i++) { System.out.printf(">= %3s and < %3s: %2d\n", limits.get(i-1), limits.get(i), bins[i]); } System.out.printf(">= %3s  : %2d\n", limits.get(n-1), bins[n]); } public static void main(String[] args) { List<Integer> limits = Arrays.asList(23, 37, 43, 53, 67, 83); List<Integer> data = Arrays.asList( 95, 21, 94, 12, 99, 4, 70, 75, 83, 93, 52, 80, 57, 5, 53, 86, 65, 17, 92, 83, 71, 61, 54, 58, 47, 16, 8, 9, 32, 84, 7, 87, 46, 19, 30, 37, 96, 6, 98, 40, 79, 97, 45, 64, 60, 29, 49, 36, 43, 55); System.out.println("Example 1:"); printBins(limits, bins(limits, data)); limits = Arrays.asList(14, 18, 249, 312, 389, 392, 513, 591, 634, 720); data = Arrays.asList( 445, 814, 519, 697, 700, 130, 255, 889, 481, 122, 932, 77, 323, 525, 570, 219, 367, 523, 442, 933, 416, 589, 930, 373, 202, 253, 775, 47, 731, 685, 293, 126, 133, 450, 545, 100, 741, 583, 763, 306, 655, 267, 248, 477, 549, 238, 62, 678, 98, 534, 622, 907, 406, 714, 184, 391, 913, 42, 560, 247, 346, 860, 56, 138, 546, 38, 985, 948, 58, 213, 799, 319, 390, 634, 458, 945, 733, 507, 916, 123, 345, 110, 720, 917, 313, 845, 426, 9, 457, 628, 410, 723, 354, 895, 881, 953, 677, 137, 397, 97, 854, 740, 83, 216, 421, 94, 517, 479, 292, 963, 376, 981, 480, 39, 257, 272, 157, 5, 316, 395, 787, 942, 456, 242, 759, 898, 576, 67, 298, 425, 894, 435, 831, 241, 989, 614, 987, 770, 384, 692, 698, 765, 331, 487, 251, 600, 879, 342, 982, 527, 736, 795, 585, 40, 54, 901, 408, 359, 577, 237, 605, 847, 353, 968, 832, 205, 838, 427, 876, 959, 686, 646, 835, 127, 621, 892, 443, 198, 988, 791, 466, 23, 707, 467, 33, 670, 921, 180, 991, 396, 160, 436, 717, 918, 8, 374, 101, 684, 727, 749); System.out.println(); System.out.println("Example 2:"); printBins(limits, bins(limits, data)); } }
Convert this Python snippet to Java and keep its semantics consistent.
def setup(): size(600, 600) background(0) stroke(255) drawTree(300, 550, 9) def drawTree(x, y, depth): fork_ang = radians(20) base_len = 10 if depth > 0: pushMatrix() translate(x, y - baseLen * depth) line(0, baseLen * depth, 0, 0) rotate(fork_ang) drawTree(0, 0, depth - 1) rotate(2 * -fork_ang) drawTree(0, 0, depth - 1) popMatrix()
import java.awt.Color; import java.awt.Graphics; import javax.swing.JFrame; public class FractalTree extends JFrame { public FractalTree() { super("Fractal Tree"); setBounds(100, 100, 800, 600); setResizable(false); setDefaultCloseOperation(EXIT_ON_CLOSE); } private void drawTree(Graphics g, int x1, int y1, double angle, int depth) { if (depth == 0) return; int x2 = x1 + (int) (Math.cos(Math.toRadians(angle)) * depth * 10.0); int y2 = y1 + (int) (Math.sin(Math.toRadians(angle)) * depth * 10.0); g.drawLine(x1, y1, x2, y2); drawTree(g, x2, y2, angle - 20, depth - 1); drawTree(g, x2, y2, angle + 20, depth - 1); } @Override public void paint(Graphics g) { g.setColor(Color.BLACK); drawTree(g, 400, 500, -90, 9); } public static void main(String[] args) { new FractalTree().setVisible(true); } }
Convert this Python block to Java, preserving its control flow and logic.
from turtle import * colors = ["black", "red", "green", "blue", "magenta", "cyan", "yellow", "white"] screen = getscreen() left_edge = -screen.window_width()//2 right_edge = screen.window_width()//2 quarter_height = screen.window_height()//4 half_height = quarter_height * 2 speed("fastest") for quarter in range(4): pensize(quarter+1) colornum = 0 min_y = half_height - ((quarter + 1) * quarter_height) max_y = half_height - ((quarter) * quarter_height) for x in range(left_edge,right_edge,quarter+1): penup() pencolor(colors[colornum]) colornum = (colornum + 1) % len(colors) setposition(x,min_y) pendown() setposition(x,max_y) notused = input("Hit enter to continue: ")
import java.awt.*; import static java.awt.Color.*; import javax.swing.*; public class ColourPinstripeDisplay extends JPanel { final static Color[] palette = {black, red, green, blue, magenta,cyan, yellow, white}; final int bands = 4; public ColourPinstripeDisplay() { setPreferredSize(new Dimension(900, 600)); } @Override public void paintComponent(Graphics g) { super.paintComponent(g); int h = getHeight(); for (int b = 1; b <= bands; b++) { for (int x = 0, colIndex = 0; x < getWidth(); x += b, colIndex++) { g.setColor(palette[colIndex % palette.length]); g.fillRect(x, (b - 1) * (h / bands), x + b, b * (h / bands)); } } } public static void main(String[] args) { SwingUtilities.invokeLater(() -> { JFrame f = new JFrame(); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setTitle("ColourPinstripeDisplay"); f.add(new ColourPinstripeDisplay(), BorderLayout.CENTER); f.pack(); f.setLocationRelativeTo(null); f.setVisible(true); }); } }
Convert the following code from Python to Java, ensuring the logic remains intact.
from datetime import date from calendar import isleap def weekday(d): days = ["Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"] dooms = [ [3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5], [4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5] ] c = d.year // 100 r = d.year % 100 s = r // 12 t = r % 12 c_anchor = (5 * (c % 4) + 2) % 7 doomsday = (s + t + (t // 4) + c_anchor) % 7 anchorday = dooms[isleap(d.year)][d.month - 1] weekday = (doomsday + d.day - anchorday + 7) % 7 return days[weekday] dates = [date(*x) for x in [(1800, 1, 6), (1875, 3, 29), (1915, 12, 7), (1970, 12, 23), (2043, 5, 14), (2077, 2, 12), (2101, 4, 2)] ] for d in dates: tense = "was" if d < date.today() else "is" if d == date.today() else "will be" print("{} {} a {}".format(d.strftime("%B %d, %Y"), tense, weekday(d)))
class Doom { public static void main(String[] args) { final Date[] dates = { new Date(1800,1,6), new Date(1875,3,29), new Date(1915,12,7), new Date(1970,12,23), new Date(2043,5,14), new Date(2077,2,12), new Date(2101,4,2) }; for (Date d : dates) System.out.println( String.format("%s: %s", d.format(), d.weekday())); } } class Date { private int year, month, day; private static final int[] leapdoom = {4,1,7,4,2,6,4,1,5,3,7,5}; private static final int[] normdoom = {3,7,7,4,2,6,4,1,5,3,7,5}; public static final String[] weekdays = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; public Date(int year, int month, int day) { this.year = year; this.month = month; this.day = day; } public boolean isLeapYear() { return year%4 == 0 && (year%100 != 0 || year%400 == 0); } public String format() { return String.format("%02d/%02d/%04d", month, day, year); } public String weekday() { final int c = year/100; final int r = year%100; final int s = r/12; final int t = r%12; final int c_anchor = (5 * (c%4) + 2) % 7; final int doom = (s + t + t/4 + c_anchor) % 7; final int anchor = isLeapYear() ? leapdoom[month-1] : normdoom[month-1]; return weekdays[(doom + day - anchor + 7) % 7]; } }
Convert this Python block to Java, preserving its control flow and logic.
from datetime import date from calendar import isleap def weekday(d): days = ["Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"] dooms = [ [3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5], [4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5] ] c = d.year // 100 r = d.year % 100 s = r // 12 t = r % 12 c_anchor = (5 * (c % 4) + 2) % 7 doomsday = (s + t + (t // 4) + c_anchor) % 7 anchorday = dooms[isleap(d.year)][d.month - 1] weekday = (doomsday + d.day - anchorday + 7) % 7 return days[weekday] dates = [date(*x) for x in [(1800, 1, 6), (1875, 3, 29), (1915, 12, 7), (1970, 12, 23), (2043, 5, 14), (2077, 2, 12), (2101, 4, 2)] ] for d in dates: tense = "was" if d < date.today() else "is" if d == date.today() else "will be" print("{} {} a {}".format(d.strftime("%B %d, %Y"), tense, weekday(d)))
class Doom { public static void main(String[] args) { final Date[] dates = { new Date(1800,1,6), new Date(1875,3,29), new Date(1915,12,7), new Date(1970,12,23), new Date(2043,5,14), new Date(2077,2,12), new Date(2101,4,2) }; for (Date d : dates) System.out.println( String.format("%s: %s", d.format(), d.weekday())); } } class Date { private int year, month, day; private static final int[] leapdoom = {4,1,7,4,2,6,4,1,5,3,7,5}; private static final int[] normdoom = {3,7,7,4,2,6,4,1,5,3,7,5}; public static final String[] weekdays = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; public Date(int year, int month, int day) { this.year = year; this.month = month; this.day = day; } public boolean isLeapYear() { return year%4 == 0 && (year%100 != 0 || year%400 == 0); } public String format() { return String.format("%02d/%02d/%04d", month, day, year); } public String weekday() { final int c = year/100; final int r = year%100; final int s = r/12; final int t = r%12; final int c_anchor = (5 * (c%4) + 2) % 7; final int doom = (s + t + t/4 + c_anchor) % 7; final int anchor = isLeapYear() ? leapdoom[month-1] : normdoom[month-1]; return weekdays[(doom + day - anchor + 7) % 7]; } }
Port the following code from Python to Java with equivalent syntax and logic.
from datetime import date from calendar import isleap def weekday(d): days = ["Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday"] dooms = [ [3, 7, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5], [4, 1, 7, 4, 2, 6, 4, 1, 5, 3, 7, 5] ] c = d.year // 100 r = d.year % 100 s = r // 12 t = r % 12 c_anchor = (5 * (c % 4) + 2) % 7 doomsday = (s + t + (t // 4) + c_anchor) % 7 anchorday = dooms[isleap(d.year)][d.month - 1] weekday = (doomsday + d.day - anchorday + 7) % 7 return days[weekday] dates = [date(*x) for x in [(1800, 1, 6), (1875, 3, 29), (1915, 12, 7), (1970, 12, 23), (2043, 5, 14), (2077, 2, 12), (2101, 4, 2)] ] for d in dates: tense = "was" if d < date.today() else "is" if d == date.today() else "will be" print("{} {} a {}".format(d.strftime("%B %d, %Y"), tense, weekday(d)))
class Doom { public static void main(String[] args) { final Date[] dates = { new Date(1800,1,6), new Date(1875,3,29), new Date(1915,12,7), new Date(1970,12,23), new Date(2043,5,14), new Date(2077,2,12), new Date(2101,4,2) }; for (Date d : dates) System.out.println( String.format("%s: %s", d.format(), d.weekday())); } } class Date { private int year, month, day; private static final int[] leapdoom = {4,1,7,4,2,6,4,1,5,3,7,5}; private static final int[] normdoom = {3,7,7,4,2,6,4,1,5,3,7,5}; public static final String[] weekdays = { "Sunday", "Monday", "Tuesday", "Wednesday", "Thursday", "Friday", "Saturday" }; public Date(int year, int month, int day) { this.year = year; this.month = month; this.day = day; } public boolean isLeapYear() { return year%4 == 0 && (year%100 != 0 || year%400 == 0); } public String format() { return String.format("%02d/%02d/%04d", month, day, year); } public String weekday() { final int c = year/100; final int r = year%100; final int s = r/12; final int t = r%12; final int c_anchor = (5 * (c%4) + 2) % 7; final int doom = (s + t + t/4 + c_anchor) % 7; final int anchor = isLeapYear() ? leapdoom[month-1] : normdoom[month-1]; return weekdays[(doom + day - anchor + 7) % 7]; } }
Write the same algorithm in Java as shown in this Python implementation.
def cocktailshiftingbounds(A): beginIdx = 0 endIdx = len(A) - 1 while beginIdx <= endIdx: newBeginIdx = endIdx newEndIdx = beginIdx for ii in range(beginIdx,endIdx): if A[ii] > A[ii + 1]: A[ii+1], A[ii] = A[ii], A[ii+1] newEndIdx = ii endIdx = newEndIdx for ii in range(endIdx,beginIdx-1,-1): if A[ii] > A[ii + 1]: A[ii+1], A[ii] = A[ii], A[ii+1] newBeginIdx = ii beginIdx = newBeginIdx + 1 test1 = [7, 6, 5, 9, 8, 4, 3, 1, 2, 0] cocktailshiftingbounds(test1) print(test1) test2=list('big fjords vex quick waltz nymph') cocktailshiftingbounds(test2) print(''.join(test2))
import java.util.*; public class CocktailSort { public static void main(String[] args) { Integer[] array = new Integer[]{ 5, 1, -6, 12, 3, 13, 2, 4, 0, 15 }; System.out.println("before: " + Arrays.toString(array)); cocktailSort(array); System.out.println("after: " + Arrays.toString(array)); } public static void cocktailSort(Object[] array) { int begin = 0; int end = array.length; if (end == 0) return; for (--end; begin < end; ) { int new_begin = end; int new_end = begin; for (int i = begin; i < end; ++i) { Comparable c1 = (Comparable)array[i]; Comparable c2 = (Comparable)array[i + 1]; if (c1.compareTo(c2) > 0) { swap(array, i, i + 1); new_end = i; } } end = new_end; for (int i = end; i > begin; --i) { Comparable c1 = (Comparable)array[i - 1]; Comparable c2 = (Comparable)array[i]; if (c1.compareTo(c2) > 0) { swap(array, i, i - 1); new_begin = i; } } begin = new_begin; } } private static void swap(Object[] array, int i, int j) { Object tmp = array[i]; array[i] = array[j]; array[j] = tmp; } }
Can you help me rewrite this code in Java instead of Python, keeping it the same logically?
def cocktailshiftingbounds(A): beginIdx = 0 endIdx = len(A) - 1 while beginIdx <= endIdx: newBeginIdx = endIdx newEndIdx = beginIdx for ii in range(beginIdx,endIdx): if A[ii] > A[ii + 1]: A[ii+1], A[ii] = A[ii], A[ii+1] newEndIdx = ii endIdx = newEndIdx for ii in range(endIdx,beginIdx-1,-1): if A[ii] > A[ii + 1]: A[ii+1], A[ii] = A[ii], A[ii+1] newBeginIdx = ii beginIdx = newBeginIdx + 1 test1 = [7, 6, 5, 9, 8, 4, 3, 1, 2, 0] cocktailshiftingbounds(test1) print(test1) test2=list('big fjords vex quick waltz nymph') cocktailshiftingbounds(test2) print(''.join(test2))
import java.util.*; public class CocktailSort { public static void main(String[] args) { Integer[] array = new Integer[]{ 5, 1, -6, 12, 3, 13, 2, 4, 0, 15 }; System.out.println("before: " + Arrays.toString(array)); cocktailSort(array); System.out.println("after: " + Arrays.toString(array)); } public static void cocktailSort(Object[] array) { int begin = 0; int end = array.length; if (end == 0) return; for (--end; begin < end; ) { int new_begin = end; int new_end = begin; for (int i = begin; i < end; ++i) { Comparable c1 = (Comparable)array[i]; Comparable c2 = (Comparable)array[i + 1]; if (c1.compareTo(c2) > 0) { swap(array, i, i + 1); new_end = i; } } end = new_end; for (int i = end; i > begin; --i) { Comparable c1 = (Comparable)array[i - 1]; Comparable c2 = (Comparable)array[i]; if (c1.compareTo(c2) > 0) { swap(array, i, i - 1); new_begin = i; } } begin = new_begin; } } private static void swap(Object[] array, int i, int j) { Object tmp = array[i]; array[i] = array[j]; array[j] = tmp; } }
Change the following Python code into Java without altering its purpose.
import pygame, sys from pygame.locals import * from math import sin, cos, radians pygame.init() WINDOWSIZE = 250 TIMETICK = 100 BOBSIZE = 15 window = pygame.display.set_mode((WINDOWSIZE, WINDOWSIZE)) pygame.display.set_caption("Pendulum") screen = pygame.display.get_surface() screen.fill((255,255,255)) PIVOT = (WINDOWSIZE/2, WINDOWSIZE/10) SWINGLENGTH = PIVOT[1]*4 class BobMass(pygame.sprite.Sprite): def __init__(self): pygame.sprite.Sprite.__init__(self) self.theta = 45 self.dtheta = 0 self.rect = pygame.Rect(PIVOT[0]-SWINGLENGTH*cos(radians(self.theta)), PIVOT[1]+SWINGLENGTH*sin(radians(self.theta)), 1,1) self.draw() def recomputeAngle(self): scaling = 3000.0/(SWINGLENGTH**2) firstDDtheta = -sin(radians(self.theta))*scaling midDtheta = self.dtheta + firstDDtheta midtheta = self.theta + (self.dtheta + midDtheta)/2.0 midDDtheta = -sin(radians(midtheta))*scaling midDtheta = self.dtheta + (firstDDtheta + midDDtheta)/2 midtheta = self.theta + (self.dtheta + midDtheta)/2 midDDtheta = -sin(radians(midtheta)) * scaling lastDtheta = midDtheta + midDDtheta lasttheta = midtheta + (midDtheta + lastDtheta)/2.0 lastDDtheta = -sin(radians(lasttheta)) * scaling lastDtheta = midDtheta + (midDDtheta + lastDDtheta)/2.0 lasttheta = midtheta + (midDtheta + lastDtheta)/2.0 self.dtheta = lastDtheta self.theta = lasttheta self.rect = pygame.Rect(PIVOT[0]- SWINGLENGTH*sin(radians(self.theta)), PIVOT[1]+ SWINGLENGTH*cos(radians(self.theta)),1,1) def draw(self): pygame.draw.circle(screen, (0,0,0), PIVOT, 5, 0) pygame.draw.circle(screen, (0,0,0), self.rect.center, BOBSIZE, 0) pygame.draw.aaline(screen, (0,0,0), PIVOT, self.rect.center) pygame.draw.line(screen, (0,0,0), (0, PIVOT[1]), (WINDOWSIZE, PIVOT[1])) def update(self): self.recomputeAngle() screen.fill((255,255,255)) self.draw() bob = BobMass() TICK = USEREVENT + 2 pygame.time.set_timer(TICK, TIMETICK) def input(events): for event in events: if event.type == QUIT: sys.exit(0) elif event.type == TICK: bob.update() while True: input(pygame.event.get()) pygame.display.flip()
import java.awt.*; import javax.swing.*; public class Pendulum extends JPanel implements Runnable { private double angle = Math.PI / 2; private int length; public Pendulum(int length) { this.length = length; setDoubleBuffered(true); } @Override public void paint(Graphics g) { g.setColor(Color.WHITE); g.fillRect(0, 0, getWidth(), getHeight()); g.setColor(Color.BLACK); int anchorX = getWidth() / 2, anchorY = getHeight() / 4; int ballX = anchorX + (int) (Math.sin(angle) * length); int ballY = anchorY + (int) (Math.cos(angle) * length); g.drawLine(anchorX, anchorY, ballX, ballY); g.fillOval(anchorX - 3, anchorY - 4, 7, 7); g.fillOval(ballX - 7, ballY - 7, 14, 14); } public void run() { double angleAccel, angleVelocity = 0, dt = 0.1; while (true) { angleAccel = -9.81 / length * Math.sin(angle); angleVelocity += angleAccel * dt; angle += angleVelocity * dt; repaint(); try { Thread.sleep(15); } catch (InterruptedException ex) {} } } @Override public Dimension getPreferredSize() { return new Dimension(2 * length + 50, length / 2 * 3); } public static void main(String[] args) { JFrame f = new JFrame("Pendulum"); Pendulum p = new Pendulum(200); f.add(p); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.pack(); f.setVisible(true); new Thread(p).start(); } }
Ensure the translated Java code behaves exactly like the original Python snippet.
>>> def int2bin(n): 'From positive integer to list of binary bits, msb at index 0' if n: bits = [] while n: n,remainder = divmod(n, 2) bits.insert(0, remainder) return bits else: return [0] >>> def bin2int(bits): 'From binary bits, msb at index 0 to integer' i = 0 for bit in bits: i = i * 2 + bit return i
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
Preserve the algorithm and functionality while converting the code from Python to Java.
>>> def int2bin(n): 'From positive integer to list of binary bits, msb at index 0' if n: bits = [] while n: n,remainder = divmod(n, 2) bits.insert(0, remainder) return bits else: return [0] >>> def bin2int(bits): 'From binary bits, msb at index 0 to integer' i = 0 for bit in bits: i = i * 2 + bit return i
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
Change the following Python code into Java without altering its purpose.
>>> def int2bin(n): 'From positive integer to list of binary bits, msb at index 0' if n: bits = [] while n: n,remainder = divmod(n, 2) bits.insert(0, remainder) return bits else: return [0] >>> def bin2int(bits): 'From binary bits, msb at index 0 to integer' i = 0 for bit in bits: i = i * 2 + bit return i
public class Gray { public static long grayEncode(long n){ return n ^ (n >>> 1); } public static long grayDecode(long n) { long p = n; while ((n >>>= 1) != 0) p ^= n; return p; } public static void main(String[] args){ System.out.println("i\tBinary\tGray\tDecoded"); for(int i = -1; i < 32;i++){ System.out.print(i +"\t"); System.out.print(Integer.toBinaryString(i) + "\t"); System.out.print(Long.toBinaryString(grayEncode(i))+ "\t"); System.out.println(grayDecode(grayEncode(i))); } } }
Transform the following Python implementation into Java, maintaining the same output and logic.
>>> with open('/dev/tape', 'w') as t: t.write('Hi Tape!\n') ... >>>
import java.io.IOException; import java.nio.file.Files; import java.nio.file.Path; import java.nio.file.Paths; import java.util.Collections; public class CreateFile { public static void main(String[] args) throws IOException { String os = System.getProperty("os.name"); if (os.contains("Windows")) { Path path = Paths.get("tape.file"); Files.write(path, Collections.singletonList("Hello World!")); } else { Path path = Paths.get("/dev/tape"); Files.write(path, Collections.singletonList("Hello World!")); } } }
Transform the following Python implementation into Java, maintaining the same output and logic.
def heapsort(lst): for start in range((len(lst)-2)/2, -1, -1): siftdown(lst, start, len(lst)-1) for end in range(len(lst)-1, 0, -1): lst[end], lst[0] = lst[0], lst[end] siftdown(lst, 0, end - 1) return lst def siftdown(lst, start, end): root = start while True: child = root * 2 + 1 if child > end: break if child + 1 <= end and lst[child] < lst[child + 1]: child += 1 if lst[root] < lst[child]: lst[root], lst[child] = lst[child], lst[root] root = child else: break
public static void heapSort(int[] a){ int count = a.length; heapify(a, count); int end = count - 1; while(end > 0){ int tmp = a[end]; a[end] = a[0]; a[0] = tmp; siftDown(a, 0, end - 1); end--; } } public static void heapify(int[] a, int count){ int start = (count - 2) / 2; while(start >= 0){ siftDown(a, start, count - 1); start--; } } public static void siftDown(int[] a, int start, int end){ int root = start; while((root * 2 + 1) <= end){ int child = root * 2 + 1; if(child + 1 <= end && a[child] < a[child + 1]) child = child + 1; if(a[root] < a[child]){ int tmp = a[root]; a[root] = a[child]; a[child] = tmp; root = child; }else return; } }
Please provide an equivalent version of this Python code in Java.
import random class Card(object): suits = ("Clubs","Hearts","Spades","Diamonds") pips = ("2","3","4","5","6","7","8","9","10","Jack","Queen","King","Ace") def __init__(self, pip,suit): self.pip=pip self.suit=suit def __str__(self): return "%s %s"%(self.pip,self.suit) class Deck(object): def __init__(self): self.deck = [Card(pip,suit) for suit in Card.suits for pip in Card.pips] def __str__(self): return "[%s]"%", ".join( (str(card) for card in self.deck)) def shuffle(self): random.shuffle(self.deck) def deal(self): self.shuffle() return self.deck.pop(0)
public enum Pip { Two, Three, Four, Five, Six, Seven, Eight, Nine, Ten, Jack, Queen, King, Ace }
Write the same algorithm in Java as shown in this Python implementation.
array = [] array.append(1) array.append(3) array[0] = 2 print array[0]
Int[] literalArray = [1,2,3]; Int[] fixedLengthArray = new Int[10]; Int[] variableArray = new Int[]; assert literalArray.size == 3; Int n = literalArray[2]; fixedLengthArray[4] = 12345; fixedLengthArray += 6789; variableArray += 6789;
Please provide an equivalent version of this Python code in Java.
def setup(): size(729, 729) fill(0) background(255) noStroke() rect(width / 3, height / 3, width / 3, width / 3) rectangles(width / 3, height / 3, width / 3) def rectangles(x, y, s): if s < 1: return xc, yc = x - s, y - s for row in range(3): for col in range(3): if not (row == 1 and col == 1): xx, yy = xc + row * s, yc + col * s delta = s / 3 rect(xx + delta, yy + delta, delta, delta) rectangles(xx + s / 3, yy + s / 3, s / 3)
public static boolean inCarpet(long x, long y) { while (x!=0 && y!=0) { if (x % 3 == 1 && y % 3 == 1) return false; x /= 3; y /= 3; } return true; } public static void carpet(final int n) { final double power = Math.pow(3,n); for(long i = 0; i < power; i++) { for(long j = 0; j < power; j++) { System.out.print(inCarpet(i, j) ? "*" : " "); } System.out.println(); } }
Can you help me rewrite this code in Java instead of Python, keeping it the same logically?
import random def bogosort(l): while not in_order(l): random.shuffle(l) return l def in_order(l): if not l: return True last = l[0] for x in l[1:]: if x < last: return False last = x return True
public class BogoSort { public static void main(String[] args) { int[] arr={4,5,6,0,7,8,9,1,2,3}; BogoSort now=new BogoSort(); System.out.print("Unsorted: "); now.display1D(arr); now.bogo(arr); System.out.print("Sorted: "); now.display1D(arr); } void bogo(int[] arr) { int shuffle=1; for(;!isSorted(arr);shuffle++) shuffle(arr); System.out.println("This took "+shuffle+" shuffles."); } void shuffle(int[] arr) { int i=arr.length-1; while(i>0) swap(arr,i--,(int)(Math.random()*i)); } void swap(int[] arr,int i,int j) { int temp=arr[i]; arr[i]=arr[j]; arr[j]=temp; } boolean isSorted(int[] arr) { for(int i=1;i<arr.length;i++) if(arr[i]<arr[i-1]) return false; return true; } void display1D(int[] arr) { for(int i=0;i<arr.length;i++) System.out.print(arr[i]+" "); System.out.println(); } }
Translate this program into Java but keep the logic exactly as in Python.
def euler(f,y0,a,b,h): t,y = a,y0 while t <= b: print "%6.3f %6.3f" % (t,y) t += h y += h * f(t,y) def newtoncooling(time, temp): return -0.07 * (temp - 20) euler(newtoncooling,100,0,100,10)
public class Euler { private static void euler (Callable f, double y0, int a, int b, int h) { int t = a; double y = y0; while (t < b) { System.out.println ("" + t + " " + y); t += h; y += h * f.compute (t, y); } System.out.println ("DONE"); } public static void main (String[] args) { Callable cooling = new Cooling (); int[] steps = {2, 5, 10}; for (int stepSize : steps) { System.out.println ("Step size: " + stepSize); euler (cooling, 100.0, 0, 100, stepSize); } } } interface Callable { public double compute (int time, double t); } class Cooling implements Callable { public double compute (int time, double t) { return -0.07 * (t - 20); } }