Instruction stringlengths 45 106 | input_code stringlengths 1 13.7k | output_code stringlengths 1 13.7k |
|---|---|---|
Convert this Java snippet to PHP and keep its semantics consistent. | import java.util.Arrays;
public class FD {
public static void main(String args[]) {
double[] a = {90, 47, 58, 29, 22, 32, 55, 5, 55, 73};
System.out.println(Arrays.toString(dif(a, 1)));
System.out.println(Arrays.toString(dif(a, 2)));
System.out.println(Arrays.toString(dif(a, 9)));
System.out.println(Arrays.toString(dif(a, 10)));
System.out.println(Arrays.toString(dif(a, 11)));
System.out.println(Arrays.toString(dif(a, -1)));
System.out.println(Arrays.toString(dif(a, 0)));
}
public static double[] dif(double[] a, int n) {
if (n < 0)
return null;
for (int i = 0; i < n && a.length > 0; i++) {
double[] b = new double[a.length - 1];
for (int j = 0; j < b.length; j++){
b[j] = a[j+1] - a[j];
}
a = b;
}
return a;
}
}
| <?php
function forwardDiff($anArray, $times = 1) {
if ($times <= 0) { return $anArray; }
for ($accumilation = array(), $i = 1, $j = count($anArray); $i < $j; ++$i) {
$accumilation[] = $anArray[$i] - $anArray[$i - 1];
}
if ($times === 1) { return $accumilation; }
return forwardDiff($accumilation, $times - 1);
}
class ForwardDiffExample extends PweExample {
function _should_run_empty_array_for_single_elem() {
$expected = array($this->rand()->int());
$this->spec(forwardDiff($expected))->shouldEqual(array());
}
function _should_give_diff_of_two_elem_as_single_elem() {
$twoNums = array($this->rand()->int(), $this->rand()->int());
$expected = array($twoNums[1] - $twoNums[0]);
$this->spec(forwardDiff($twoNums))->shouldEqual($expected);
}
function _should_compute_correct_forward_diff_for_longer_arrays() {
$diffInput = array(10, 2, 9, 6, 5);
$expected = array(-8, 7, -3, -1);
$this->spec(forwardDiff($diffInput))->shouldEqual($expected);
}
function _should_apply_more_than_once_if_specified() {
$diffInput = array(4, 6, 9, 3, 4);
$expectedAfter1 = array(2, 3, -6, 1);
$expectedAfter2 = array(1, -9, 7);
$this->spec(forwardDiff($diffInput, 1))->shouldEqual($expectedAfter1);
$this->spec(forwardDiff($diffInput, 2))->shouldEqual($expectedAfter2);
}
function _should_return_array_unaltered_if_no_times() {
$this->spec(forwardDiff($expected = array(1,2,3), 0))->shouldEqual($expected);
}
}
|
Port the following code from Java to PHP with equivalent syntax and logic. | public static boolean prime(long a){
if(a == 2){
return true;
}else if(a <= 1 || a % 2 == 0){
return false;
}
long max = (long)Math.sqrt(a);
for(long n= 3; n <= max; n+= 2){
if(a % n == 0){ return false; }
}
return true;
}
| <?php
function prime($a) {
if (($a % 2 == 0 && $a != 2) || $a < 2)
return false;
$limit = sqrt($a);
for ($i = 2; $i <= $limit; $i++)
if ($a % $i == 0)
return false;
return true;
}
foreach (range(1, 100) as $x)
if (prime($x)) echo "$x\n";
?>
|
Generate an equivalent PHP version of this Java code. | public static boolean prime(long a){
if(a == 2){
return true;
}else if(a <= 1 || a % 2 == 0){
return false;
}
long max = (long)Math.sqrt(a);
for(long n= 3; n <= max; n+= 2){
if(a % n == 0){ return false; }
}
return true;
}
| <?php
function prime($a) {
if (($a % 2 == 0 && $a != 2) || $a < 2)
return false;
$limit = sqrt($a);
for ($i = 2; $i <= $limit; $i++)
if ($a % $i == 0)
return false;
return true;
}
foreach (range(1, 100) as $x)
if (prime($x)) echo "$x\n";
?>
|
Produce a functionally identical PHP code for the snippet given in Java. | public class Binomial {
private static long binomialInt(int n, int k) {
if (k > n - k)
k = n - k;
long binom = 1;
for (int i = 1; i <= k; i++)
binom = binom * (n + 1 - i) / i;
return binom;
}
private static Object binomialIntReliable(int n, int k) {
if (k > n - k)
k = n - k;
long binom = 1;
for (int i = 1; i <= k; i++) {
try {
binom = Math.multiplyExact(binom, n + 1 - i) / i;
} catch (ArithmeticException e) {
return "overflow";
}
}
return binom;
}
private static double binomialFloat(int n, int k) {
if (k > n - k)
k = n - k;
double binom = 1.0;
for (int i = 1; i <= k; i++)
binom = binom * (n + 1 - i) / i;
return binom;
}
private static BigInteger binomialBigInt(int n, int k) {
if (k > n - k)
k = n - k;
BigInteger binom = BigInteger.ONE;
for (int i = 1; i <= k; i++) {
binom = binom.multiply(BigInteger.valueOf(n + 1 - i));
binom = binom.divide(BigInteger.valueOf(i));
}
return binom;
}
private static void demo(int n, int k) {
List<Object> data = Arrays.asList(
n,
k,
binomialInt(n, k),
binomialIntReliable(n, k),
binomialFloat(n, k),
binomialBigInt(n, k));
System.out.println(data.stream().map(Object::toString).collect(Collectors.joining("\t")));
}
public static void main(String[] args) {
demo(5, 3);
demo(1000, 300);
}
}
| <?php
$n=5;
$k=3;
function factorial($val){
for($f=2;$val-1>1;$f*=$val--);
return $f;
}
$binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k));
echo $binomial_coefficient;
?>
|
Translate the given Java code snippet into PHP without altering its behavior. | public class Binomial {
private static long binomialInt(int n, int k) {
if (k > n - k)
k = n - k;
long binom = 1;
for (int i = 1; i <= k; i++)
binom = binom * (n + 1 - i) / i;
return binom;
}
private static Object binomialIntReliable(int n, int k) {
if (k > n - k)
k = n - k;
long binom = 1;
for (int i = 1; i <= k; i++) {
try {
binom = Math.multiplyExact(binom, n + 1 - i) / i;
} catch (ArithmeticException e) {
return "overflow";
}
}
return binom;
}
private static double binomialFloat(int n, int k) {
if (k > n - k)
k = n - k;
double binom = 1.0;
for (int i = 1; i <= k; i++)
binom = binom * (n + 1 - i) / i;
return binom;
}
private static BigInteger binomialBigInt(int n, int k) {
if (k > n - k)
k = n - k;
BigInteger binom = BigInteger.ONE;
for (int i = 1; i <= k; i++) {
binom = binom.multiply(BigInteger.valueOf(n + 1 - i));
binom = binom.divide(BigInteger.valueOf(i));
}
return binom;
}
private static void demo(int n, int k) {
List<Object> data = Arrays.asList(
n,
k,
binomialInt(n, k),
binomialIntReliable(n, k),
binomialFloat(n, k),
binomialBigInt(n, k));
System.out.println(data.stream().map(Object::toString).collect(Collectors.joining("\t")));
}
public static void main(String[] args) {
demo(5, 3);
demo(1000, 300);
}
}
| <?php
$n=5;
$k=3;
function factorial($val){
for($f=2;$val-1>1;$f*=$val--);
return $f;
}
$binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k));
echo $binomial_coefficient;
?>
|
Convert the following code from Java to PHP, ensuring the logic remains intact. | List arrayList = new ArrayList();
arrayList.add(new Integer(0));
arrayList.add(0);
List<Integer> myarrlist = new ArrayList<Integer>();
int sum;
for(int i = 0; i < 10; i++) {
myarrlist.add(i);
}
| <?php
$a = array();
# add elements "at the end"
array_push($a, 55, 10, 20);
print_r($a);
# using an explicit key
$a['one'] = 1;
$a['two'] = 2;
print_r($a);
?>
|
Change the programming language of this snippet from Java to PHP without modifying what it does. | List arrayList = new ArrayList();
arrayList.add(new Integer(0));
arrayList.add(0);
List<Integer> myarrlist = new ArrayList<Integer>();
int sum;
for(int i = 0; i < 10; i++) {
myarrlist.add(i);
}
| <?php
$a = array();
# add elements "at the end"
array_push($a, 55, 10, 20);
print_r($a);
# using an explicit key
$a['one'] = 1;
$a['two'] = 2;
print_r($a);
?>
|
Generate a PHP translation of this Java snippet without changing its computational steps. | import java.io.BufferedOutputStream;
import java.io.File;
import java.io.FileOutputStream;
import java.io.IOException;
import java.nio.charset.StandardCharsets;
public class PPMWriter {
public void bitmapToPPM(File file, BasicBitmapStorage bitmap) throws IOException {
file.delete();
try (var os = new FileOutputStream(file, true);
var bw = new BufferedOutputStream(os)) {
var header = String.format("P6\n%d %d\n255\n",
bitmap.getWidth(), bitmap.getHeight());
bw.write(header.getBytes(StandardCharsets.US_ASCII));
for (var y = 0; y < bitmap.getHeight(); y++) {
for (var x = 0; x < bitmap.getWidth(); x++) {
var pixel = bitmap.getPixel(x, y);
bw.write(pixel.getRed());
bw.write(pixel.getGreen());
bw.write(pixel.getBlue());
}
}
}
}
}
| class Bitmap {
public $data;
public $w;
public $h;
public function __construct($w = 16, $h = 16){
$white = array_fill(0, $w, array(255,255,255));
$this->data = array_fill(0, $h, $white);
$this->w = $w;
$this->h = $h;
}
public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){
if (is_null($w)) $w = $this->w;
if (is_null($h)) $h = $this->h;
$w += $x;
$h += $y;
for ($i = $y; $i < $h; $i++){
for ($j = $x; $j < $w; $j++){
$this->setPixel($j, $i, $color);
}
}
}
public function setPixel($x, $y, $color = array(0,0,0)){
if ($x >= $this->w) return false;
if ($x < 0) return false;
if ($y >= $this->h) return false;
if ($y < 0) return false;
$this->data[$y][$x] = $color;
}
public function getPixel($x, $y){
return $this->data[$y][$x];
}
public function writeP6($filename){
$fh = fopen($filename, 'w');
if (!$fh) return false;
fputs($fh, "P6 {$this->w} {$this->h} 255\n");
foreach ($this->data as $row){
foreach($row as $pixel){
fputs($fh, pack('C', $pixel[0]));
fputs($fh, pack('C', $pixel[1]));
fputs($fh, pack('C', $pixel[2]));
}
}
fclose($fh);
}
}
$b = new Bitmap(16,16);
$b->fill();
$b->fill(2, 2, 18, 18, array(240,240,240));
$b->setPixel(0, 15, array(255,0,0));
$b->writeP6('p6.ppm');
|
Rewrite this program in PHP while keeping its functionality equivalent to the Java version. | import java.io.BufferedOutputStream;
import java.io.File;
import java.io.FileOutputStream;
import java.io.IOException;
import java.nio.charset.StandardCharsets;
public class PPMWriter {
public void bitmapToPPM(File file, BasicBitmapStorage bitmap) throws IOException {
file.delete();
try (var os = new FileOutputStream(file, true);
var bw = new BufferedOutputStream(os)) {
var header = String.format("P6\n%d %d\n255\n",
bitmap.getWidth(), bitmap.getHeight());
bw.write(header.getBytes(StandardCharsets.US_ASCII));
for (var y = 0; y < bitmap.getHeight(); y++) {
for (var x = 0; x < bitmap.getWidth(); x++) {
var pixel = bitmap.getPixel(x, y);
bw.write(pixel.getRed());
bw.write(pixel.getGreen());
bw.write(pixel.getBlue());
}
}
}
}
}
| class Bitmap {
public $data;
public $w;
public $h;
public function __construct($w = 16, $h = 16){
$white = array_fill(0, $w, array(255,255,255));
$this->data = array_fill(0, $h, $white);
$this->w = $w;
$this->h = $h;
}
public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){
if (is_null($w)) $w = $this->w;
if (is_null($h)) $h = $this->h;
$w += $x;
$h += $y;
for ($i = $y; $i < $h; $i++){
for ($j = $x; $j < $w; $j++){
$this->setPixel($j, $i, $color);
}
}
}
public function setPixel($x, $y, $color = array(0,0,0)){
if ($x >= $this->w) return false;
if ($x < 0) return false;
if ($y >= $this->h) return false;
if ($y < 0) return false;
$this->data[$y][$x] = $color;
}
public function getPixel($x, $y){
return $this->data[$y][$x];
}
public function writeP6($filename){
$fh = fopen($filename, 'w');
if (!$fh) return false;
fputs($fh, "P6 {$this->w} {$this->h} 255\n");
foreach ($this->data as $row){
foreach($row as $pixel){
fputs($fh, pack('C', $pixel[0]));
fputs($fh, pack('C', $pixel[1]));
fputs($fh, pack('C', $pixel[2]));
}
}
fclose($fh);
}
}
$b = new Bitmap(16,16);
$b->fill();
$b->fill(2, 2, 18, 18, array(240,240,240));
$b->setPixel(0, 15, array(255,0,0));
$b->writeP6('p6.ppm');
|
Rewrite this program in PHP while keeping its functionality equivalent to the Java version. | import java.io.File;
public class FileDeleteTest {
public static boolean deleteFile(String filename) {
boolean exists = new File(filename).delete();
return exists;
}
public static void test(String type, String filename) {
System.out.println("The following " + type + " called " + filename +
(deleteFile(filename) ? " was deleted." : " could not be deleted.")
);
}
public static void main(String args[]) {
test("file", "input.txt");
test("file", File.seperator + "input.txt");
test("directory", "docs");
test("directory", File.seperator + "docs" + File.seperator);
}
}
| <?php
unlink('input.txt');
unlink('/input.txt');
rmdir('docs');
rmdir('/docs');
?>
|
Convert the following code from Java to PHP, ensuring the logic remains intact. | import java.io.File;
public class FileDeleteTest {
public static boolean deleteFile(String filename) {
boolean exists = new File(filename).delete();
return exists;
}
public static void test(String type, String filename) {
System.out.println("The following " + type + " called " + filename +
(deleteFile(filename) ? " was deleted." : " could not be deleted.")
);
}
public static void main(String args[]) {
test("file", "input.txt");
test("file", File.seperator + "input.txt");
test("directory", "docs");
test("directory", File.seperator + "docs" + File.seperator);
}
}
| <?php
unlink('input.txt');
unlink('/input.txt');
rmdir('docs');
rmdir('/docs');
?>
|
Generate a PHP translation of this Java snippet without changing its computational steps. | import java.util.Calendar;
import java.util.GregorianCalendar;
public class DiscordianDate {
final static String[] seasons = {"Chaos", "Discord", "Confusion",
"Bureaucracy", "The Aftermath"};
final static String[] weekday = {"Sweetmorn", "Boomtime", "Pungenday",
"Prickle-Prickle", "Setting Orange"};
final static String[] apostle = {"Mungday", "Mojoday", "Syaday",
"Zaraday", "Maladay"};
final static String[] holiday = {"Chaoflux", "Discoflux", "Confuflux",
"Bureflux", "Afflux"};
public static String discordianDate(final GregorianCalendar date) {
int y = date.get(Calendar.YEAR);
int yold = y + 1166;
int dayOfYear = date.get(Calendar.DAY_OF_YEAR);
if (date.isLeapYear(y)) {
if (dayOfYear == 60)
return "St. Tib's Day, in the YOLD " + yold;
else if (dayOfYear > 60)
dayOfYear--;
}
dayOfYear--;
int seasonDay = dayOfYear % 73 + 1;
if (seasonDay == 5)
return apostle[dayOfYear / 73] + ", in the YOLD " + yold;
if (seasonDay == 50)
return holiday[dayOfYear / 73] + ", in the YOLD " + yold;
String season = seasons[dayOfYear / 73];
String dayOfWeek = weekday[dayOfYear % 5];
return String.format("%s, day %s of %s in the YOLD %s",
dayOfWeek, seasonDay, season, yold);
}
public static void main(String[] args) {
System.out.println(discordianDate(new GregorianCalendar()));
test(2010, 6, 22, "Pungenday, day 57 of Confusion in the YOLD 3176");
test(2012, 1, 28, "Prickle-Prickle, day 59 of Chaos in the YOLD 3178");
test(2012, 1, 29, "St. Tib's Day, in the YOLD 3178");
test(2012, 2, 1, "Setting Orange, day 60 of Chaos in the YOLD 3178");
test(2010, 0, 5, "Mungday, in the YOLD 3176");
test(2011, 4, 3, "Discoflux, in the YOLD 3177");
test(2015, 9, 19, "Boomtime, day 73 of Bureaucracy in the YOLD 3181");
}
private static void test(int y, int m, int d, final String result) {
assert (discordianDate(new GregorianCalendar(y, m, d)).equals(result));
}
}
| <?php
$Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31);
$MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath");
$DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle");
$Dsuff = array('th','st','nd','rd','th','th','th','th','th','th');
$Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay");
$Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux");
$edate = explode(" ",date('Y m j L'));
$usery = $edate[0];
$userm = $edate[1];
$userd = $edate[2];
$IsLeap = $edate[3];
if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) {
$usery = $_GET['y'];
$userm = $_GET['m'];
$userd = $_GET['d'];
$IsLeap = 0;
if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1;
if ($usery%400 == 0) $IsLeap = 1;
}
$userdays = 0;
$i = 0;
while ($i < ($userm-1)) {
$userdays = $userdays + $Anerisia[$i];
$i = $i +1;
}
$userdays = $userdays + $userd;
$IsHolyday = 0;
$dyear = $usery + 1166;
$dmonth = $MONTHS[$userdays/73.2];
$dday = $userdays%73;
if (0 == $dday) $dday = 73;
$Dname = $DAYS[$userdays%5];
$Holyday = "St. Tibs Day";
if ($dday == 5) {
$Holyday = $Holy5[$userdays/73.2];
$IsHolyday =1;
}
if ($dday == 50) {
$Holyday = $Holy50[$userdays/73.2];
$IsHolyday =1;
}
if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2;
$suff = $Dsuff[$dday%10] ;
if ((11 <= $dday) && (19 >= $dday)) $suff='th';
if ($IsHolyday ==2)
echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear;
if ($IsHolyday ==1)
echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday;
if ($IsHolyday == 0)
echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear;
?>
|
Write a version of this Java function in PHP with identical behavior. | import java.util.Calendar;
import java.util.GregorianCalendar;
public class DiscordianDate {
final static String[] seasons = {"Chaos", "Discord", "Confusion",
"Bureaucracy", "The Aftermath"};
final static String[] weekday = {"Sweetmorn", "Boomtime", "Pungenday",
"Prickle-Prickle", "Setting Orange"};
final static String[] apostle = {"Mungday", "Mojoday", "Syaday",
"Zaraday", "Maladay"};
final static String[] holiday = {"Chaoflux", "Discoflux", "Confuflux",
"Bureflux", "Afflux"};
public static String discordianDate(final GregorianCalendar date) {
int y = date.get(Calendar.YEAR);
int yold = y + 1166;
int dayOfYear = date.get(Calendar.DAY_OF_YEAR);
if (date.isLeapYear(y)) {
if (dayOfYear == 60)
return "St. Tib's Day, in the YOLD " + yold;
else if (dayOfYear > 60)
dayOfYear--;
}
dayOfYear--;
int seasonDay = dayOfYear % 73 + 1;
if (seasonDay == 5)
return apostle[dayOfYear / 73] + ", in the YOLD " + yold;
if (seasonDay == 50)
return holiday[dayOfYear / 73] + ", in the YOLD " + yold;
String season = seasons[dayOfYear / 73];
String dayOfWeek = weekday[dayOfYear % 5];
return String.format("%s, day %s of %s in the YOLD %s",
dayOfWeek, seasonDay, season, yold);
}
public static void main(String[] args) {
System.out.println(discordianDate(new GregorianCalendar()));
test(2010, 6, 22, "Pungenday, day 57 of Confusion in the YOLD 3176");
test(2012, 1, 28, "Prickle-Prickle, day 59 of Chaos in the YOLD 3178");
test(2012, 1, 29, "St. Tib's Day, in the YOLD 3178");
test(2012, 2, 1, "Setting Orange, day 60 of Chaos in the YOLD 3178");
test(2010, 0, 5, "Mungday, in the YOLD 3176");
test(2011, 4, 3, "Discoflux, in the YOLD 3177");
test(2015, 9, 19, "Boomtime, day 73 of Bureaucracy in the YOLD 3181");
}
private static void test(int y, int m, int d, final String result) {
assert (discordianDate(new GregorianCalendar(y, m, d)).equals(result));
}
}
| <?php
$Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31);
$MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath");
$DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle");
$Dsuff = array('th','st','nd','rd','th','th','th','th','th','th');
$Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay");
$Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux");
$edate = explode(" ",date('Y m j L'));
$usery = $edate[0];
$userm = $edate[1];
$userd = $edate[2];
$IsLeap = $edate[3];
if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) {
$usery = $_GET['y'];
$userm = $_GET['m'];
$userd = $_GET['d'];
$IsLeap = 0;
if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1;
if ($usery%400 == 0) $IsLeap = 1;
}
$userdays = 0;
$i = 0;
while ($i < ($userm-1)) {
$userdays = $userdays + $Anerisia[$i];
$i = $i +1;
}
$userdays = $userdays + $userd;
$IsHolyday = 0;
$dyear = $usery + 1166;
$dmonth = $MONTHS[$userdays/73.2];
$dday = $userdays%73;
if (0 == $dday) $dday = 73;
$Dname = $DAYS[$userdays%5];
$Holyday = "St. Tibs Day";
if ($dday == 5) {
$Holyday = $Holy5[$userdays/73.2];
$IsHolyday =1;
}
if ($dday == 50) {
$Holyday = $Holy50[$userdays/73.2];
$IsHolyday =1;
}
if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2;
$suff = $Dsuff[$dday%10] ;
if ((11 <= $dday) && (19 >= $dday)) $suff='th';
if ($IsHolyday ==2)
echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear;
if ($IsHolyday ==1)
echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday;
if ($IsHolyday == 0)
echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear;
?>
|
Please provide an equivalent version of this Java code in PHP. | String original = "Mary had a X lamb";
String little = "little";
String replaced = original.replace("X", little);
System.out.println(replaced);
System.out.printf("Mary had a %s lamb.", little);
String formatted = String.format("Mary had a %s lamb.", little);
System.out.println(formatted);
| <?php
$extra = 'little';
echo "Mary had a $extra lamb.\n";
printf("Mary had a %s lamb.\n", $extra);
?>
|
Transform the following VB implementation into C, maintaining the same output and logic. | Debug.Print Hex(&HF0F0 And &HFF00)
Debug.Print Hex(&HF0F0 Or &HFF00)
Debug.Print Hex(&HF0F0 Xor &HFF00)
Debug.Print Hex(Not &HF0F0)
Debug.Print Hex(&HF0F0 Eqv &HFF00)
Debug.Print Hex(&HF0F0 Imp &HFF00)
| void bitwise(int a, int b)
{
printf("a and b: %d\n", a & b);
printf("a or b: %d\n", a | b);
printf("a xor b: %d\n", a ^ b);
printf("not a: %d\n", ~a);
printf("a << n: %d\n", a << b);
printf("a >> n: %d\n", a >> b);
unsigned int c = a;
printf("c >> b: %d\n", c >> b);
return 0;
}
|
Produce a language-to-language conversion: from VB to C, same semantics. | option explicit
const pi180= 0.01745329251994329576923690768489
const pi=3.1415926535897932384626433832795
class turtle
dim fso
dim fn
dim svg
dim iang
dim ori
dim incr
dim pdown
dim clr
dim x
dim y
public property let orient(n):ori = n*pi180 :end property
public property let iangle(n):iang= n*pi180 :end property
public sub pd() : pdown=true: end sub
public sub pu() :pdown=FALSE :end sub
public sub rt(i)
ori=ori - i*iang:
end sub
public sub lt(i):
ori=(ori + i*iang)
end sub
public sub bw(l)
x= x+ cos(ori+pi)*l*incr
y= y+ sin(ori+pi)*l*incr
end sub
public sub fw(l)
dim x1,y1
x1=x + cos(ori)*l*incr
y1=y + sin(ori)*l*incr
if pdown then line x,y,x1,y1
x=x1:y=y1
end sub
Private Sub Class_Initialize()
setlocale "us"
initsvg
x=400:y=400:incr=100
ori=90*pi180
iang=90*pi180
clr=0
pdown=true
end sub
Private Sub Class_Terminate()
disply
end sub
private sub line (x,y,x1,y1)
svg.WriteLine "<line x1=""" & x & """ y1= """& y & """ x2=""" & x1& """ y2=""" & y1 & """/>"
end sub
private sub disply()
dim shell
svg.WriteLine "</svg></body></html>"
svg.close
Set shell = CreateObject("Shell.Application")
shell.ShellExecute fn,1,False
end sub
private sub initsvg()
dim scriptpath
Set fso = CreateObject ("Scripting.Filesystemobject")
ScriptPath= Left(WScript.ScriptFullName, InStrRev(WScript.ScriptFullName, "\"))
fn=Scriptpath & "SIERP.HTML"
Set svg = fso.CreateTextFile(fn,True)
if SVG IS nothing then wscript.echo "Can
svg.WriteLine "<!DOCTYPE html>" &vbcrlf & "<html>" &vbcrlf & "<head>"
svg.writeline "<style>" & vbcrlf & "line {stroke:rgb(255,0,0);stroke-width:.5}" &vbcrlf &"</style>"
svg.writeline "</head>"&vbcrlf & "<body>"
svg.WriteLine "<svg xmlns=""http://www.w3.org/2000/svg"" width=""800"" height=""800"" viewBox=""0 0 800 800"">"
end sub
end class
sub dragon(st,le,dir)
if st=0 then x.fw le: exit sub
x.rt dir
dragon st-1, le/1.41421 ,1
x.rt dir*2
dragon st-1, le/1.41421 ,-1
x.rt dir
end sub
dim x
set x=new turtle
x.iangle=45
x.orient=45
x.incr=1
x.x=200:x.y=200
dragon 12,300,1
set x=nothing
| #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <math.h>
long long x, y, dx, dy, scale, clen;
typedef struct { double r, g, b; } rgb;
rgb ** pix;
void sc_up()
{
long long tmp = dx - dy; dy = dx + dy; dx = tmp;
scale *= 2; x *= 2; y *= 2;
}
void h_rgb(long long x, long long y)
{
rgb *p = &pix[y][x];
# define SAT 1
double h = 6.0 * clen / scale;
double VAL = 1 - (cos(3.141592653579 * 64 * clen / scale) - 1) / 4;
double c = SAT * VAL;
double X = c * (1 - fabs(fmod(h, 2) - 1));
switch((int)h) {
case 0: p->r += c; p->g += X; return;
case 1: p->r += X; p->g += c; return;
case 2: p->g += c; p->b += X; return;
case 3: p->g += X; p->b += c; return;
case 4: p->r += X; p->b += c; return;
default:
p->r += c; p->b += X;
}
}
void iter_string(const char * str, int d)
{
long tmp;
# define LEFT tmp = -dy; dy = dx; dx = tmp
# define RIGHT tmp = dy; dy = -dx; dx = tmp
while (*str != '\0') {
switch(*(str++)) {
case 'X': if (d) iter_string("X+YF+", d - 1); continue;
case 'Y': if (d) iter_string("-FX-Y", d - 1); continue;
case '+': RIGHT; continue;
case '-': LEFT; continue;
case 'F':
clen ++;
h_rgb(x/scale, y/scale);
x += dx; y += dy;
continue;
}
}
}
void dragon(long leng, int depth)
{
long i, d = leng / 3 + 1;
long h = leng + 3, w = leng + d * 3 / 2 + 2;
rgb *buf = malloc(sizeof(rgb) * w * h);
pix = malloc(sizeof(rgb *) * h);
for (i = 0; i < h; i++)
pix[i] = buf + w * i;
memset(buf, 0, sizeof(rgb) * w * h);
x = y = d; dx = leng; dy = 0; scale = 1; clen = 0;
for (i = 0; i < depth; i++) sc_up();
iter_string("FX", depth);
unsigned char *fpix = malloc(w * h * 3);
double maxv = 0, *dbuf = (double*)buf;
for (i = 3 * w * h - 1; i >= 0; i--)
if (dbuf[i] > maxv) maxv = dbuf[i];
for (i = 3 * h * w - 1; i >= 0; i--)
fpix[i] = 255 * dbuf[i] / maxv;
printf("P6\n%ld %ld\n255\n", w, h);
fflush(stdout);
fwrite(fpix, h * w * 3, 1, stdout);
}
int main(int c, char ** v)
{
int size, depth;
depth = (c > 1) ? atoi(v[1]) : 10;
size = 1 << depth;
fprintf(stderr, "size: %d depth: %d\n", size, depth);
dragon(size, depth * 2);
return 0;
}
|
Produce a language-to-language conversion: from VB to C, same semantics. | $Include "Rapidq.inc"
dim file as qfilestream
if file.open("c:\A Test.txt", fmOpenRead) then
while not File.eof
print File.readline
wend
else
print "Cannot read file"
end if
input "Press enter to exit: ";a$
|
#include <conio.h>
#include <stdio.h>
int main()
{
int n1, n2, n3;
printf( "\n Introduzca el primer n%cmero (entero): ", 163 );
scanf( "%d", &n1 );
printf( "\n Introduzca el segundo n%cmero (entero): ", 163 );
scanf( "%d", &n2 );
printf( "\n Introduzca el tercer n%cmero (entero): ", 163 );
scanf( "%d", &n3 );
if ( n1 >= n2 && n1 >= n3 )
printf( "\n %d es el mayor.", n1 );
else
if ( n2 > n3 )
printf( "\n %d es el mayor.", n2 );
else
printf( "\n %d es el mayor.", n3 );
getch();
return 0;
}
|
Produce a functionally identical C code for the snippet given in VB. | Public Sub Insert(ByVal a As Node(Of T), ByVal b As Node(Of T), ByVal c As T)
Dim node As New Node(Of T)(value)
a.Next = node
node.Previous = a
b.Previous = node
node.Next = b
End Sub
| void insert(link* anchor, link* newlink) {
newlink->next = anchor->next;
newlink->prev = anchor;
(newlink->next)->prev = newlink;
anchor->next = newlink;
}
|
Please provide an equivalent version of this VB code in C. | Dim s As Variant
Private Function quick_select(ByRef s As Variant, k As Integer) As Integer
Dim left As Integer, right As Integer, pos As Integer
Dim pivotValue As Integer, tmp As Integer
left = 1: right = UBound(s)
Do While left < right
pivotValue = s(k)
tmp = s(k)
s(k) = s(right)
s(right) = tmp
pos = left
For i = left To right
If s(i) < pivotValue Then
tmp = s(i)
s(i) = s(pos)
s(pos) = tmp
pos = pos + 1
End If
Next i
tmp = s(right)
s(right) = s(pos)
s(pos) = tmp
If pos = k Then
Exit Do
End If
If pos < k Then
left = pos + 1
Else
right = pos - 1
End If
Loop
quick_select = s(k)
End Function
Public Sub main()
Dim r As Integer, i As Integer
s = [{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}]
For i = 1 To 10
r = quick_select(s, i)
Debug.Print IIf(i < 10, r & ", ", "" & r);
Next i
End Sub
| #include <stdio.h>
#include <string.h>
int qselect(int *v, int len, int k)
{
# define SWAP(a, b) { tmp = v[a]; v[a] = v[b]; v[b] = tmp; }
int i, st, tmp;
for (st = i = 0; i < len - 1; i++) {
if (v[i] > v[len-1]) continue;
SWAP(i, st);
st++;
}
SWAP(len-1, st);
return k == st ?v[st]
:st > k ? qselect(v, st, k)
: qselect(v + st, len - st, k - st);
}
int main(void)
{
# define N (sizeof(x)/sizeof(x[0]))
int x[] = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4};
int y[N];
int i;
for (i = 0; i < 10; i++) {
memcpy(y, x, sizeof(x));
printf("%d: %d\n", i, qselect(y, 10, i));
}
return 0;
}
|
Produce a functionally identical C code for the snippet given in VB. | Private Function to_base(ByVal number As Long, base As Integer) As String
Dim digits As String, result As String
Dim i As Integer, digit As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
Do While number > 0
digit = number Mod base
result = Mid(digits, digit + 1, 1) & result
number = number \ base
Loop
to_base = result
End Function
Private Function from_base(number As String, base As Integer) As Long
Dim digits As String, result As Long
Dim i As Integer
digits = "0123456789abcdefghijklmnopqrstuvwxyz"
result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1)
For i = 2 To Len(number)
result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1)
Next i
from_base = result
End Function
Public Sub Non_decimal_radices_Convert()
Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16)
End Sub
| #include <stdlib.h>
#include <string.h>
#include <stdio.h>
#include <stdint.h>
char *to_base(int64_t num, int base)
{
char *tbl = "0123456789abcdefghijklmnopqrstuvwxyz";
char buf[66] = {'\0'};
char *out;
uint64_t n;
int i, len = 0, neg = 0;
if (base > 36) {
fprintf(stderr, "base %d too large\n", base);
return 0;
}
n = ((neg = num < 0)) ? (~num) + 1 : num;
do { buf[len++] = tbl[n % base]; } while(n /= base);
out = malloc(len + neg + 1);
for (i = neg; len > 0; i++) out[i] = buf[--len];
if (neg) out[0] = '-';
return out;
}
long from_base(const char *num_str, int base)
{
char *endptr;
int result = strtol(num_str, &endptr, base);
return result;
}
int main()
{
int64_t x;
x = ~(1LL << 63) + 1;
printf("%lld in base 2: %s\n", x, to_base(x, 2));
x = 383;
printf("%lld in base 16: %s\n", x, to_base(x, 16));
return 0;
}
|
Port the following code from VB to C with equivalent syntax and logic. | Sub printFiles(parentDir As FolderItem, pattern As String)
For i As Integer = 1 To parentDir.Count
If parentDir.Item(i).Directory Then
printFiles(parentDir.Item(i), pattern)
Else
Dim rg as New RegEx
Dim myMatch as RegExMatch
rg.SearchPattern = pattern
myMatch = rg.search(parentDir.Item(i).Name)
If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath)
End If
Next
End Sub
| #include <sys/types.h>
#include <sys/stat.h>
#include <unistd.h>
#include <dirent.h>
#include <regex.h>
#include <stdio.h>
#include <string.h>
#include <errno.h>
#include <err.h>
enum {
WALK_OK = 0,
WALK_BADPATTERN,
WALK_NAMETOOLONG,
WALK_BADIO,
};
#define WS_NONE 0
#define WS_RECURSIVE (1 << 0)
#define WS_DEFAULT WS_RECURSIVE
#define WS_FOLLOWLINK (1 << 1)
#define WS_DOTFILES (1 << 2)
#define WS_MATCHDIRS (1 << 3)
int walk_recur(char *dname, regex_t *reg, int spec)
{
struct dirent *dent;
DIR *dir;
struct stat st;
char fn[FILENAME_MAX];
int res = WALK_OK;
int len = strlen(dname);
if (len >= FILENAME_MAX - 1)
return WALK_NAMETOOLONG;
strcpy(fn, dname);
fn[len++] = '/';
if (!(dir = opendir(dname))) {
warn("can't open %s", dname);
return WALK_BADIO;
}
errno = 0;
while ((dent = readdir(dir))) {
if (!(spec & WS_DOTFILES) && dent->d_name[0] == '.')
continue;
if (!strcmp(dent->d_name, ".") || !strcmp(dent->d_name, ".."))
continue;
strncpy(fn + len, dent->d_name, FILENAME_MAX - len);
if (lstat(fn, &st) == -1) {
warn("Can't stat %s", fn);
res = WALK_BADIO;
continue;
}
if (S_ISLNK(st.st_mode) && !(spec & WS_FOLLOWLINK))
continue;
if (S_ISDIR(st.st_mode)) {
if ((spec & WS_RECURSIVE))
walk_recur(fn, reg, spec);
if (!(spec & WS_MATCHDIRS)) continue;
}
if (!regexec(reg, fn, 0, 0, 0)) puts(fn);
}
if (dir) closedir(dir);
return res ? res : errno ? WALK_BADIO : WALK_OK;
}
int walk_dir(char *dname, char *pattern, int spec)
{
regex_t r;
int res;
if (regcomp(&r, pattern, REG_EXTENDED | REG_NOSUB))
return WALK_BADPATTERN;
res = walk_recur(dname, &r, spec);
regfree(&r);
return res;
}
int main()
{
int r = walk_dir(".", ".\\.c$", WS_DEFAULT|WS_MATCHDIRS);
switch(r) {
case WALK_OK: break;
case WALK_BADIO: err(1, "IO error");
case WALK_BADPATTERN: err(1, "Bad pattern");
case WALK_NAMETOOLONG: err(1, "Filename too long");
default:
err(1, "Unknown error?");
}
return 0;
}
|
Keep all operations the same but rewrite the snippet in C. | dim crctbl(255)
const crcc =&hEDB88320
sub gencrctable
for i= 0 to 255
k=i
for j=1 to 8
if k and 1 then
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
k=k xor crcc
else
k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0))
end if
next
crctbl(i)=k
next
end sub
function crc32 (buf)
dim r,r1,i
r=&hffffffff
for i=1 to len(buf)
r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0)
r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255)
next
crc32=r xor &hffffffff
end function
gencrctable
wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
| #include <stdio.h>
#include <string.h>
#include <zlib.h>
int main()
{
const char *s = "The quick brown fox jumps over the lazy dog";
printf("%lX\n", crc32(0, (const void*)s, strlen(s)));
return 0;
}
|
Convert this VB block to C, preserving its control flow and logic. | Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
| #include <stdio.h>
const char *input =
"Character,Speech\n"
"The multitude,The messiah! Show us the messiah!\n"
"Brians mother,<angry>Now you listen here! He's not the messiah; "
"he's a very naughty boy! Now go away!</angry>\n"
"The multitude,Who are you?\n"
"Brians mother,I'm his mother; that's who!\n"
"The multitude,Behold his mother! Behold his mother!";
int main()
{
const char *s;
printf("<table>\n<tr><td>");
for (s = input; *s; s++) {
switch(*s) {
case '\n': printf("</td></tr>\n<tr><td>"); break;
case ',': printf("</td><td>"); break;
case '<': printf("<"); break;
case '>': printf(">"); break;
case '&': printf("&"); break;
default: putchar(*s);
}
}
puts("</td></tr>\n</table>");
return 0;
}
|
Generate an equivalent C version of this VB code. | Public Sub CSV_TO_HTML()
input_ = "Character,Speech\n" & _
"The multitude,The messiah! Show us the messiah!\n" & _
"Brians mother,<angry>Now you listen here! He
"he
"The multitude,Who are you?\n" & _
"Brians mother,I
"The multitude,Behold his mother! Behold his mother!"
Debug.Print "<table>" & vbCrLf & "<tr><td>"
For i = 1 To Len(input_)
Select Case Mid(input_, i, 1)
Case "\"
If Mid(input_, i + 1, 1) = "n" Then
Debug.Print "</td></tr>" & vbCrLf & "<tr><td>";
i = i + 1
Else
Debug.Print Mid(input_, i, 1);
End If
Case ",": Debug.Print "</td><td>";
Case "<": Debug.Print "<";
Case ">": Debug.Print ">";
Case "&": Debug.Print "&";
Case Else: Debug.Print Mid(input_, i, 1);
End Select
Next i
Debug.Print "</td></tr>" & vbCrLf & "</table>"
End Sub
| #include <stdio.h>
const char *input =
"Character,Speech\n"
"The multitude,The messiah! Show us the messiah!\n"
"Brians mother,<angry>Now you listen here! He's not the messiah; "
"he's a very naughty boy! Now go away!</angry>\n"
"The multitude,Who are you?\n"
"Brians mother,I'm his mother; that's who!\n"
"The multitude,Behold his mother! Behold his mother!";
int main()
{
const char *s;
printf("<table>\n<tr><td>");
for (s = input; *s; s++) {
switch(*s) {
case '\n': printf("</td></tr>\n<tr><td>"); break;
case ',': printf("</td><td>"); break;
case '<': printf("<"); break;
case '>': printf(">"); break;
case '&': printf("&"); break;
default: putchar(*s);
}
}
puts("</td></tr>\n</table>");
return 0;
}
|
Convert this VB snippet to C and keep its semantics consistent. | Class NumberContainer
Private TheNumber As Integer
Sub Constructor(InitialNumber As Integer)
TheNumber = InitialNumber
End Sub
Function Number() As Integer
Return TheNumber
End Function
Sub Number(Assigns NewNumber As Integer)
TheNumber = NewNumber
End Sub
End Class
| #include <stdlib.h>
typedef struct sMyClass
{
int variable;
} *MyClass;
MyClass MyClass_new()
{
MyClass pthis = malloc(sizeof *pthis);
pthis->variable = 0;
return pthis;
}
void MyClass_delete(MyClass* pthis)
{
if (pthis)
{
free(*pthis);
*pthis = NULL;
}
}
void MyClass_someMethod(MyClass pthis)
{
pthis->variable = 1;
}
MyClass obj = MyClass_new();
MyClass_someMethod(obj);
MyClass_delete(&obj);
|
Write the same algorithm in C as shown in this VB implementation. | Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
| #include <stdio.h>
#include <stdint.h>
typedef uint64_t ulong;
int kaprekar(ulong n, int base)
{
ulong nn = n * n, r, tens = 1;
if ((nn - n) % (base - 1)) return 0;
while (tens < n) tens *= base;
if (n == tens) return 1 == n;
while ((r = nn % tens) < n) {
if (nn / tens + r == n) return tens;
tens *= base;
}
return 0;
}
void print_num(ulong n, int base)
{
ulong q, div = base;
while (div < n) div *= base;
while (n && (div /= base)) {
q = n / div;
if (q < 10) putchar(q + '0');
else putchar(q + 'a' - 10);
n -= q * div;
}
}
int main()
{
ulong i, tens;
int cnt = 0;
int base = 10;
printf("base 10:\n");
for (i = 1; i < 1000000; i++)
if (kaprekar(i, base))
printf("%3d: %llu\n", ++cnt, i);
base = 17;
printf("\nbase %d:\n 1: 1\n", base);
for (i = 2, cnt = 1; i < 1000000; i++)
if ((tens = kaprekar(i, base))) {
printf("%3d: %llu", ++cnt, i);
printf(" \t"); print_num(i, base);
printf("\t"); print_num(i * i, base);
printf("\t"); print_num(i * i / tens, base);
printf(" + "); print_num(i * i % tens, base);
printf("\n");
}
return 0;
}
|
Write the same algorithm in C as shown in this VB implementation. | Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
| #include <stdio.h>
#include <stdint.h>
typedef uint64_t ulong;
int kaprekar(ulong n, int base)
{
ulong nn = n * n, r, tens = 1;
if ((nn - n) % (base - 1)) return 0;
while (tens < n) tens *= base;
if (n == tens) return 1 == n;
while ((r = nn % tens) < n) {
if (nn / tens + r == n) return tens;
tens *= base;
}
return 0;
}
void print_num(ulong n, int base)
{
ulong q, div = base;
while (div < n) div *= base;
while (n && (div /= base)) {
q = n / div;
if (q < 10) putchar(q + '0');
else putchar(q + 'a' - 10);
n -= q * div;
}
}
int main()
{
ulong i, tens;
int cnt = 0;
int base = 10;
printf("base 10:\n");
for (i = 1; i < 1000000; i++)
if (kaprekar(i, base))
printf("%3d: %llu\n", ++cnt, i);
base = 17;
printf("\nbase %d:\n 1: 1\n", base);
for (i = 2, cnt = 1; i < 1000000; i++)
if ((tens = kaprekar(i, base))) {
printf("%3d: %llu", ++cnt, i);
printf(" \t"); print_num(i, base);
printf("\t"); print_num(i * i, base);
printf("\t"); print_num(i * i / tens, base);
printf(" + "); print_num(i * i % tens, base);
printf("\n");
}
return 0;
}
|
Convert this VB block to C, preserving its control flow and logic. | Module Module1
ReadOnly max As ULong = 1000000
Function Kaprekar(n As ULong) As Boolean
If n = 1 Then Return True
Dim sq = n * n
Dim sq_str = Str(sq)
Dim l = Len(sq_str)
For x = l - 1 To 1 Step -1
If sq_str(x) = "0" Then
l = l - 1
Else
Exit For
End If
Next
For x = 1 To l - 1
Dim p2 = Val(Mid(sq_str, x + 1))
If p2 > n Then
Continue For
End If
Dim p1 = Val(Left(sq_str, x))
If p1 > n Then Return False
If (p1 + p2) = n Then Return True
Next
Return False
End Function
Sub Main()
Dim count = 0
Console.WriteLine("Kaprekar numbers below 10000")
For n = 1 To max - 1
If Kaprekar(n) Then
count = count + 1
If n < 10000 Then
Console.WriteLine("{0,2} {1,4}", count, n)
End If
End If
Next
Console.WriteLine()
Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max)
End Sub
End Module
| #include <stdio.h>
#include <stdint.h>
typedef uint64_t ulong;
int kaprekar(ulong n, int base)
{
ulong nn = n * n, r, tens = 1;
if ((nn - n) % (base - 1)) return 0;
while (tens < n) tens *= base;
if (n == tens) return 1 == n;
while ((r = nn % tens) < n) {
if (nn / tens + r == n) return tens;
tens *= base;
}
return 0;
}
void print_num(ulong n, int base)
{
ulong q, div = base;
while (div < n) div *= base;
while (n && (div /= base)) {
q = n / div;
if (q < 10) putchar(q + '0');
else putchar(q + 'a' - 10);
n -= q * div;
}
}
int main()
{
ulong i, tens;
int cnt = 0;
int base = 10;
printf("base 10:\n");
for (i = 1; i < 1000000; i++)
if (kaprekar(i, base))
printf("%3d: %llu\n", ++cnt, i);
base = 17;
printf("\nbase %d:\n 1: 1\n", base);
for (i = 2, cnt = 1; i < 1000000; i++)
if ((tens = kaprekar(i, base))) {
printf("%3d: %llu", ++cnt, i);
printf(" \t"); print_num(i, base);
printf("\t"); print_num(i * i, base);
printf("\t"); print_num(i * i / tens, base);
printf(" + "); print_num(i * i % tens, base);
printf("\n");
}
return 0;
}
|
Produce a language-to-language conversion: from VB to C, same semantics. | Option Explicit
Const numchars=127
Function LZWCompress(si)
Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j
Set oDict = CreateObject("Scripting.Dictionary")
ReDim a(Len(si))
intMaxCode = numchars
For i = 0 To numchars
oDict.Add Chr(i), i
Next
strCurrent = Left(si,1)
j=0
For ii=2 To Len(si)
strNext = Mid(si,ii,1)
ss=strCurrent & strNext
If oDict.Exists(ss) Then
strCurrent = ss
Else
a(j)=oDict.Item(strCurrent) :j=j+1
intMaxCode = intMaxCode + 1
oDict.Add ss, intMaxCode
strCurrent = strNext
End If
Next
a(j)=oDict.Item(strCurrent)
ReDim preserve a(j)
LZWCompress=a
Set oDict = Nothing
End Function
Function lzwUncompress(sc)
Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j
s=""
reDim dict(1000)
intMaxCode = numchars
For i = 0 To numchars : dict(i)= Chr(i) : Next
intCurrent=sc(0)
For j=1 To UBound(sc)
ss=dict(intCurrent)
s= s & ss
intMaxCode = intMaxCode + 1
intnext=sc(j)
If intNext<intMaxCode Then
dict(intMaxCode)=ss & Left(dict(intNext), 1)
Else
dict(intMaxCode)=ss & Left(ss, 1)
End If
intCurrent = intNext
Next
s= s & dict(intCurrent)
lzwUncompress=s
End function
Sub printvec(a)
Dim s,i,x
s="("
For i=0 To UBound (a)
s=s & x & a(i)
x=", "
Next
WScript.echo s &")"
End sub
Dim a,b
b="TOBEORNOTTOBEORTOBEORNOT"
WScript.Echo b
a=LZWCompress (b)
printvec(a)
WScript.echo lzwUncompress (a )
wscript.quit 1
| #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <stdint.h>
#include <unistd.h>
#include <fcntl.h>
#include <sys/types.h>
#include <sys/stat.h>
void* mem_alloc(size_t item_size, size_t n_item)
{
size_t *x = calloc(1, sizeof(size_t)*2 + n_item * item_size);
x[0] = item_size;
x[1] = n_item;
return x + 2;
}
void* mem_extend(void *m, size_t new_n)
{
size_t *x = (size_t*)m - 2;
x = realloc(x, sizeof(size_t) * 2 + *x * new_n);
if (new_n > x[1])
memset((char*)(x + 2) + x[0] * x[1], 0, x[0] * (new_n - x[1]));
x[1] = new_n;
return x + 2;
}
inline void _clear(void *m)
{
size_t *x = (size_t*)m - 2;
memset(m, 0, x[0] * x[1]);
}
#define _new(type, n) mem_alloc(sizeof(type), n)
#define _del(m) { free((size_t*)(m) - 2); m = 0; }
#define _len(m) *((size_t*)m - 1)
#define _setsize(m, n) m = mem_extend(m, n)
#define _extend(m) m = mem_extend(m, _len(m) * 2)
typedef uint8_t byte;
typedef uint16_t ushort;
#define M_CLR 256
#define M_EOD 257
#define M_NEW 258
typedef struct {
ushort next[256];
} lzw_enc_t;
typedef struct {
ushort prev, back;
byte c;
} lzw_dec_t;
byte* lzw_encode(byte *in, int max_bits)
{
int len = _len(in), bits = 9, next_shift = 512;
ushort code, c, nc, next_code = M_NEW;
lzw_enc_t *d = _new(lzw_enc_t, 512);
if (max_bits > 15) max_bits = 15;
if (max_bits < 9 ) max_bits = 12;
byte *out = _new(ushort, 4);
int out_len = 0, o_bits = 0;
uint32_t tmp = 0;
inline void write_bits(ushort x) {
tmp = (tmp << bits) | x;
o_bits += bits;
if (_len(out) <= out_len) _extend(out);
while (o_bits >= 8) {
o_bits -= 8;
out[out_len++] = tmp >> o_bits;
tmp &= (1 << o_bits) - 1;
}
}
for (code = *(in++); --len; ) {
c = *(in++);
if ((nc = d[code].next[c]))
code = nc;
else {
write_bits(code);
nc = d[code].next[c] = next_code++;
code = c;
}
if (next_code == next_shift) {
if (++bits > max_bits) {
write_bits(M_CLR);
bits = 9;
next_shift = 512;
next_code = M_NEW;
_clear(d);
} else
_setsize(d, next_shift *= 2);
}
}
write_bits(code);
write_bits(M_EOD);
if (tmp) write_bits(tmp);
_del(d);
_setsize(out, out_len);
return out;
}
byte* lzw_decode(byte *in)
{
byte *out = _new(byte, 4);
int out_len = 0;
inline void write_out(byte c)
{
while (out_len >= _len(out)) _extend(out);
out[out_len++] = c;
}
lzw_dec_t *d = _new(lzw_dec_t, 512);
int len, j, next_shift = 512, bits = 9, n_bits = 0;
ushort code, c, t, next_code = M_NEW;
uint32_t tmp = 0;
inline void get_code() {
while(n_bits < bits) {
if (len > 0) {
len --;
tmp = (tmp << 8) | *(in++);
n_bits += 8;
} else {
tmp = tmp << (bits - n_bits);
n_bits = bits;
}
}
n_bits -= bits;
code = tmp >> n_bits;
tmp &= (1 << n_bits) - 1;
}
inline void clear_table() {
_clear(d);
for (j = 0; j < 256; j++) d[j].c = j;
next_code = M_NEW;
next_shift = 512;
bits = 9;
};
clear_table();
for (len = _len(in); len;) {
get_code();
if (code == M_EOD) break;
if (code == M_CLR) {
clear_table();
continue;
}
if (code >= next_code) {
fprintf(stderr, "Bad sequence\n");
_del(out);
goto bail;
}
d[next_code].prev = c = code;
while (c > 255) {
t = d[c].prev; d[t].back = c; c = t;
}
d[next_code - 1].c = c;
while (d[c].back) {
write_out(d[c].c);
t = d[c].back; d[c].back = 0; c = t;
}
write_out(d[c].c);
if (++next_code >= next_shift) {
if (++bits > 16) {
fprintf(stderr, "Too many bits\n");
_del(out);
goto bail;
}
_setsize(d, next_shift *= 2);
}
}
if (code != M_EOD) fputs("Bits did not end in EOD\n", stderr);
_setsize(out, out_len);
bail: _del(d);
return out;
}
int main()
{
int i, fd = open("unixdict.txt", O_RDONLY);
if (fd == -1) {
fprintf(stderr, "Can't read file\n");
return 1;
};
struct stat st;
fstat(fd, &st);
byte *in = _new(char, st.st_size);
read(fd, in, st.st_size);
_setsize(in, st.st_size);
close(fd);
printf("input size: %d\n", _len(in));
byte *enc = lzw_encode(in, 9);
printf("encoded size: %d\n", _len(enc));
byte *dec = lzw_decode(enc);
printf("decoded size: %d\n", _len(dec));
for (i = 0; i < _len(dec); i++)
if (dec[i] != in[i]) {
printf("bad decode at %d\n", i);
break;
}
if (i == _len(dec)) printf("Decoded ok\n");
_del(in);
_del(enc);
_del(dec);
return 0;
}
|
Maintain the same structure and functionality when rewriting this code in C. | Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
| #include <stdio.h>
#include <stdlib.h>
typedef unsigned long long xint;
typedef struct {
size_t len, alloc;
xint *buf;
} xarray;
xarray rs, ss;
void setsize(xarray *a, size_t size)
{
size_t n = a->alloc;
if (!n) n = 1;
while (n < size) n <<= 1;
if (a->alloc < n) {
a->buf = realloc(a->buf, sizeof(xint) * n);
if (!a->buf) abort();
a->alloc = n;
}
}
void push(xarray *a, xint v)
{
while (a->alloc <= a->len)
setsize(a, a->alloc * 2);
a->buf[a->len++] = v;
}
void RS_append(void);
xint R(int n)
{
while (n > rs.len) RS_append();
return rs.buf[n - 1];
}
xint S(int n)
{
while (n > ss.len) RS_append();
return ss.buf[n - 1];
}
void RS_append()
{
int n = rs.len;
xint r = R(n) + S(n);
xint s = S(ss.len);
push(&rs, r);
while (++s < r) push(&ss, s);
push(&ss, r + 1);
}
int main(void)
{
push(&rs, 1);
push(&ss, 2);
int i;
printf("R(1 .. 10):");
for (i = 1; i <= 10; i++)
printf(" %llu", R(i));
char seen[1001] = { 0 };
for (i = 1; i <= 40; i++) seen[ R(i) ] = 1;
for (i = 1; i <= 960; i++) seen[ S(i) ] = 1;
for (i = 1; i <= 1000 && seen[i]; i++);
if (i <= 1000) {
fprintf(stderr, "%d not seen\n", i);
abort();
}
puts("\nfirst 1000 ok");
return 0;
}
|
Please provide an equivalent version of this VB code in C. | Private Function ffr(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
Next i
ffr = R(n)
Set R = Nothing
Set S = Nothing
End Function
Private Function ffs(n As Long) As Long
Dim R As New Collection
Dim S As New Collection
R.Add 1
S.Add 2
For i = 2 To n
R.Add R(i - 1) + S(i - 1)
For j = S(S.Count) + 1 To R(i) - 1
S.Add j
Next j
For j = R(i) + 1 To R(i) + S(i - 1)
S.Add j
Next j
If S.Count >= n Then Exit For
Next i
ffs = S(n)
Set R = Nothing
Set S = Nothing
End Function
Public Sub main()
Dim i As Long
Debug.Print "The first ten values of R are:"
For i = 1 To 10
Debug.Print ffr(i);
Next i
Debug.Print
Dim x As New Collection
For i = 1 To 1000
x.Add i, CStr(i)
Next i
For i = 1 To 40
x.Remove CStr(ffr(i))
Next i
For i = 1 To 960
x.Remove CStr(ffs(i))
Next i
Debug.Print "The first 40 values of ffr plus the first 960 values of ffs "
Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0)
End Sub
| #include <stdio.h>
#include <stdlib.h>
typedef unsigned long long xint;
typedef struct {
size_t len, alloc;
xint *buf;
} xarray;
xarray rs, ss;
void setsize(xarray *a, size_t size)
{
size_t n = a->alloc;
if (!n) n = 1;
while (n < size) n <<= 1;
if (a->alloc < n) {
a->buf = realloc(a->buf, sizeof(xint) * n);
if (!a->buf) abort();
a->alloc = n;
}
}
void push(xarray *a, xint v)
{
while (a->alloc <= a->len)
setsize(a, a->alloc * 2);
a->buf[a->len++] = v;
}
void RS_append(void);
xint R(int n)
{
while (n > rs.len) RS_append();
return rs.buf[n - 1];
}
xint S(int n)
{
while (n > ss.len) RS_append();
return ss.buf[n - 1];
}
void RS_append()
{
int n = rs.len;
xint r = R(n) + S(n);
xint s = S(ss.len);
push(&rs, r);
while (++s < r) push(&ss, s);
push(&ss, r + 1);
}
int main(void)
{
push(&rs, 1);
push(&ss, 2);
int i;
printf("R(1 .. 10):");
for (i = 1; i <= 10; i++)
printf(" %llu", R(i));
char seen[1001] = { 0 };
for (i = 1; i <= 40; i++) seen[ R(i) ] = 1;
for (i = 1; i <= 960; i++) seen[ S(i) ] = 1;
for (i = 1; i <= 1000 && seen[i]; i++);
if (i <= 1000) {
fprintf(stderr, "%d not seen\n", i);
abort();
}
puts("\nfirst 1000 ok");
return 0;
}
|
Please provide an equivalent version of this VB code in C. | Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
| #include <stdio.h>
#include <stdlib.h>
int f(int n, int x, int y)
{
return (x + y*2 + 1)%n;
}
int main(int argc, char **argv)
{
int i, j, n;
if(argc!=2) return 1;
n = atoi(argv[1]);
if (n < 3 || (n%2) == 0) return 2;
for (i = 0; i < n; i++) {
for (j = 0; j < n; j++)
printf("% 4d", f(n, n - j - 1, i)*n + f(n, j, i) + 1);
putchar('\n');
}
printf("\n Magic Constant: %d.\n", (n*n+1)/2*n);
return 0;
}
|
Can you help me rewrite this code in C instead of VB, keeping it the same logically? | Sub magicsquare()
Const n = 9
Dim i As Integer, j As Integer, v As Integer
Debug.Print "The square order is: " & n
For i = 1 To n
For j = 1 To n
Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1
Next j
Next i
Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2
End Sub
| #include <stdio.h>
#include <stdlib.h>
int f(int n, int x, int y)
{
return (x + y*2 + 1)%n;
}
int main(int argc, char **argv)
{
int i, j, n;
if(argc!=2) return 1;
n = atoi(argv[1]);
if (n < 3 || (n%2) == 0) return 2;
for (i = 0; i < n; i++) {
for (j = 0; j < n; j++)
printf("% 4d", f(n, n - j - 1, i)*n + f(n, j, i) + 1);
putchar('\n');
}
printf("\n Magic Constant: %d.\n", (n*n+1)/2*n);
return 0;
}
|
Write the same algorithm in C as shown in this VB implementation. | Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
| #include <stdio.h>
#include <stdlib.h>
#include <math.h>
float *benford_distribution(void)
{
static float prob[9];
for (int i = 1; i < 10; i++)
prob[i - 1] = log10f(1 + 1.0 / i);
return prob;
}
float *get_actual_distribution(char *fn)
{
FILE *input = fopen(fn, "r");
if (!input)
{
perror("Can't open file");
exit(EXIT_FAILURE);
}
int tally[9] = { 0 };
char c;
int total = 0;
while ((c = getc(input)) != EOF)
{
while (c < '1' || c > '9')
c = getc(input);
tally[c - '1']++;
total++;
while ((c = getc(input)) != '\n' && c != EOF)
;
}
fclose(input);
static float freq[9];
for (int i = 0; i < 9; i++)
freq[i] = tally[i] / (float) total;
return freq;
}
int main(int argc, char **argv)
{
if (argc != 2)
{
printf("Usage: benford <file>\n");
return EXIT_FAILURE;
}
float *actual = get_actual_distribution(argv[1]);
float *expected = benford_distribution();
puts("digit\tactual\texpected");
for (int i = 0; i < 9; i++)
printf("%d\t%.3f\t%.3f\n", i + 1, actual[i], expected[i]);
return EXIT_SUCCESS;
}
|
Translate this program into C but keep the logic exactly as in VB. | Sub BenfordLaw()
Dim BenResult(1 To 9) As Long
BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%"
For Each c In Selection.Cells
If InStr(1, "-0123456789", Left(c, 1)) > 0 Then
For i = 1 To 9
If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For
Next
End If
Next
Total= Application.Sum(BenResult)
biggest= Len(CStr(BenResult(1)))
txt = "# | Values | Real | Expected " & vbCrLf
For i = 1 To 9
If BenResult(i) > 0 Then
txt = txt & "#" & i & " | " & vbTab
txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab
txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab
txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf
End If
Next
MsgBox txt, vbOKOnly, "Finish"
End Sub
}
| #include <stdio.h>
#include <stdlib.h>
#include <math.h>
float *benford_distribution(void)
{
static float prob[9];
for (int i = 1; i < 10; i++)
prob[i - 1] = log10f(1 + 1.0 / i);
return prob;
}
float *get_actual_distribution(char *fn)
{
FILE *input = fopen(fn, "r");
if (!input)
{
perror("Can't open file");
exit(EXIT_FAILURE);
}
int tally[9] = { 0 };
char c;
int total = 0;
while ((c = getc(input)) != EOF)
{
while (c < '1' || c > '9')
c = getc(input);
tally[c - '1']++;
total++;
while ((c = getc(input)) != '\n' && c != EOF)
;
}
fclose(input);
static float freq[9];
for (int i = 0; i < 9; i++)
freq[i] = tally[i] / (float) total;
return freq;
}
int main(int argc, char **argv)
{
if (argc != 2)
{
printf("Usage: benford <file>\n");
return EXIT_FAILURE;
}
float *actual = get_actual_distribution(argv[1]);
float *expected = benford_distribution();
puts("digit\tactual\texpected");
for (int i = 0; i < 9; i++)
printf("%d\t%.3f\t%.3f\n", i + 1, actual[i], expected[i]);
return EXIT_SUCCESS;
}
|
Translate the given VB code snippet into C without altering its behavior. | Sub Main()
Debug.Print F(-10)
Debug.Print F(10)
End Sub
Private Function F(N As Long) As Variant
If N < 0 Then
F = "Error. Negative argument"
ElseIf N <= 1 Then
F = N
Else
F = F(N - 1) + F(N - 2)
End If
End Function
| #include <stdio.h>
long fib(long x)
{
long fib_i(long n) { return n < 2 ? n : fib_i(n - 2) + fib_i(n - 1); };
if (x < 0) {
printf("Bad argument: fib(%ld)\n", x);
return -1;
}
return fib_i(x);
}
long fib_i(long n)
{
printf("This is not the fib you are looking for\n");
return -1;
}
int main()
{
long x;
for (x = -1; x < 4; x ++)
printf("fib %ld = %ld\n", x, fib(x));
printf("calling fib_i from outside fib:\n");
fib_i(3);
return 0;
}
|
Port the following code from VB to C with equivalent syntax and logic. | string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
| #include <string.h>
#include <stdlib.h>
#include <stdio.h>
int main( int argc, char ** argv ){
const char * str_a = "knight";
const char * str_b = "socks";
const char * str_c = "brooms";
char * new_a = malloc( strlen( str_a ) - 1 );
char * new_b = malloc( strlen( str_b ) - 1 );
char * new_c = malloc( strlen( str_c ) - 2 );
strcpy( new_a, str_a + 1 );
strncpy( new_b, str_b, strlen( str_b ) - 1 );
strncpy( new_c, str_c + 1, strlen( str_c ) - 2 );
printf( "%s\n%s\n%s\n", new_a, new_b, new_c );
free( new_a );
free( new_b );
free( new_c );
return 0;
}
|
Rewrite the snippet below in C so it works the same as the original VB code. | string = "Small Basic"
TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2))
TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1))
TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
| #include <string.h>
#include <stdlib.h>
#include <stdio.h>
int main( int argc, char ** argv ){
const char * str_a = "knight";
const char * str_b = "socks";
const char * str_c = "brooms";
char * new_a = malloc( strlen( str_a ) - 1 );
char * new_b = malloc( strlen( str_b ) - 1 );
char * new_c = malloc( strlen( str_c ) - 2 );
strcpy( new_a, str_a + 1 );
strncpy( new_b, str_b, strlen( str_b ) - 1 );
strncpy( new_c, str_c + 1, strlen( str_c ) - 2 );
printf( "%s\n%s\n%s\n", new_a, new_b, new_c );
free( new_a );
free( new_b );
free( new_c );
return 0;
}
|
Convert this VB snippet to C and keep its semantics consistent. |
Set objfso = CreateObject("Scripting.FileSystemObject")
Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_
"\input.txt",1)
list = ""
previous_line = ""
l = Len(previous_line)
Do Until objfile.AtEndOfStream
current_line = objfile.ReadLine
If Mid(current_line,l+1,1) <> "" Then
list = current_line & vbCrLf
previous_line = current_line
l = Len(previous_line)
ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then
list = list & current_line & vbCrLf
End If
Loop
WScript.Echo list
objfile.Close
Set objfso = Nothing
| #include <stdio.h>
#include <string.h>
int cmp(const char *p, const char *q)
{
while (*p && *q) p = &p[1], q = &q[1];
return *p;
}
int main()
{
char line[65536];
char buf[1000000] = {0};
char *last = buf;
char *next = buf;
while (gets(line)) {
strcat(line, "\n");
if (cmp(last, line)) continue;
if (cmp(line, last)) next = buf;
last = next;
strcpy(next, line);
while (*next) next = &next[1];
}
printf("%s", buf);
return 0;
}
|
Rewrite the snippet below in C so it works the same as the original VB code. | Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
| #include <stdio.h>
#include <stdarg.h>
#include <stdlib.h>
#include <string.h>
enum {
LEFT,
RIGHT,
STAY
};
typedef struct {
int state1;
int symbol1;
int symbol2;
int dir;
int state2;
} transition_t;
typedef struct tape_t tape_t;
struct tape_t {
int symbol;
tape_t *left;
tape_t *right;
};
typedef struct {
int states_len;
char **states;
int final_states_len;
int *final_states;
int symbols_len;
char *symbols;
int blank;
int state;
int tape_len;
tape_t *tape;
int transitions_len;
transition_t ***transitions;
} turing_t;
int state_index (turing_t *t, char *state) {
int i;
for (i = 0; i < t->states_len; i++) {
if (!strcmp(t->states[i], state)) {
return i;
}
}
return 0;
}
int symbol_index (turing_t *t, char symbol) {
int i;
for (i = 0; i < t->symbols_len; i++) {
if (t->symbols[i] == symbol) {
return i;
}
}
return 0;
}
void move (turing_t *t, int dir) {
tape_t *orig = t->tape;
if (dir == RIGHT) {
if (orig && orig->right) {
t->tape = orig->right;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->left = orig;
orig->right = t->tape;
}
}
}
else if (dir == LEFT) {
if (orig && orig->left) {
t->tape = orig->left;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->right = orig;
orig->left = t->tape;
}
}
}
}
turing_t *create (int states_len, ...) {
va_list args;
va_start(args, states_len);
turing_t *t = malloc(sizeof (turing_t));
t->states_len = states_len;
t->states = malloc(states_len * sizeof (char *));
int i;
for (i = 0; i < states_len; i++) {
t->states[i] = va_arg(args, char *);
}
t->final_states_len = va_arg(args, int);
t->final_states = malloc(t->final_states_len * sizeof (int));
for (i = 0; i < t->final_states_len; i++) {
t->final_states[i] = state_index(t, va_arg(args, char *));
}
t->symbols_len = va_arg(args, int);
t->symbols = malloc(t->symbols_len);
for (i = 0; i < t->symbols_len; i++) {
t->symbols[i] = va_arg(args, int);
}
t->blank = symbol_index(t, va_arg(args, int));
t->state = state_index(t, va_arg(args, char *));
t->tape_len = va_arg(args, int);
t->tape = NULL;
for (i = 0; i < t->tape_len; i++) {
move(t, RIGHT);
t->tape->symbol = symbol_index(t, va_arg(args, int));
}
if (!t->tape_len) {
move(t, RIGHT);
}
while (t->tape->left) {
t->tape = t->tape->left;
}
t->transitions_len = va_arg(args, int);
t->transitions = malloc(t->states_len * sizeof (transition_t **));
for (i = 0; i < t->states_len; i++) {
t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *));
}
for (i = 0; i < t->transitions_len; i++) {
transition_t *tran = malloc(sizeof (transition_t));
tran->state1 = state_index(t, va_arg(args, char *));
tran->symbol1 = symbol_index(t, va_arg(args, int));
tran->symbol2 = symbol_index(t, va_arg(args, int));
tran->dir = va_arg(args, int);
tran->state2 = state_index(t, va_arg(args, char *));
t->transitions[tran->state1][tran->symbol1] = tran;
}
va_end(args);
return t;
}
void print_state (turing_t *t) {
printf("%-10s ", t->states[t->state]);
tape_t *tape = t->tape;
while (tape->left) {
tape = tape->left;
}
while (tape) {
if (tape == t->tape) {
printf("[%c]", t->symbols[tape->symbol]);
}
else {
printf(" %c ", t->symbols[tape->symbol]);
}
tape = tape->right;
}
printf("\n");
}
void run (turing_t *t) {
int i;
while (1) {
print_state(t);
for (i = 0; i < t->final_states_len; i++) {
if (t->final_states[i] == t->state) {
return;
}
}
transition_t *tran = t->transitions[t->state][t->tape->symbol];
t->tape->symbol = tran->symbol2;
move(t, tran->dir);
t->state = tran->state2;
}
}
int main () {
printf("Simple incrementer\n");
turing_t *t = create(
2, "q0", "qf",
1, "qf",
2, 'B', '1',
'B',
"q0",
3, '1', '1', '1',
2,
"q0", '1', '1', RIGHT, "q0",
"q0", 'B', '1', STAY, "qf"
);
run(t);
printf("\nThree-state busy beaver\n");
t = create(
4, "a", "b", "c", "halt",
1, "halt",
2, '0', '1',
'0',
"a",
0,
6,
"a", '0', '1', RIGHT, "b",
"a", '1', '1', LEFT, "c",
"b", '0', '1', LEFT, "a",
"b", '1', '1', RIGHT, "b",
"c", '0', '1', LEFT, "b",
"c", '1', '1', STAY, "halt"
);
run(t);
return 0;
printf("\nFive-state two-symbol probable busy beaver\n");
t = create(
6, "A", "B", "C", "D", "E", "H",
1, "H",
2, '0', '1',
'0',
"A",
0,
10,
"A", '0', '1', RIGHT, "B",
"A", '1', '1', LEFT, "C",
"B", '0', '1', RIGHT, "C",
"B", '1', '1', RIGHT, "B",
"C", '0', '1', RIGHT, "D",
"C", '1', '0', LEFT, "E",
"D", '0', '1', LEFT, "A",
"D", '1', '1', LEFT, "D",
"E", '0', '1', STAY, "H",
"E", '1', '0', LEFT, "A"
);
run(t);
}
|
Rewrite the snippet below in C so it works the same as the original VB code. | Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
| #include <stdio.h>
#include <stdarg.h>
#include <stdlib.h>
#include <string.h>
enum {
LEFT,
RIGHT,
STAY
};
typedef struct {
int state1;
int symbol1;
int symbol2;
int dir;
int state2;
} transition_t;
typedef struct tape_t tape_t;
struct tape_t {
int symbol;
tape_t *left;
tape_t *right;
};
typedef struct {
int states_len;
char **states;
int final_states_len;
int *final_states;
int symbols_len;
char *symbols;
int blank;
int state;
int tape_len;
tape_t *tape;
int transitions_len;
transition_t ***transitions;
} turing_t;
int state_index (turing_t *t, char *state) {
int i;
for (i = 0; i < t->states_len; i++) {
if (!strcmp(t->states[i], state)) {
return i;
}
}
return 0;
}
int symbol_index (turing_t *t, char symbol) {
int i;
for (i = 0; i < t->symbols_len; i++) {
if (t->symbols[i] == symbol) {
return i;
}
}
return 0;
}
void move (turing_t *t, int dir) {
tape_t *orig = t->tape;
if (dir == RIGHT) {
if (orig && orig->right) {
t->tape = orig->right;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->left = orig;
orig->right = t->tape;
}
}
}
else if (dir == LEFT) {
if (orig && orig->left) {
t->tape = orig->left;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->right = orig;
orig->left = t->tape;
}
}
}
}
turing_t *create (int states_len, ...) {
va_list args;
va_start(args, states_len);
turing_t *t = malloc(sizeof (turing_t));
t->states_len = states_len;
t->states = malloc(states_len * sizeof (char *));
int i;
for (i = 0; i < states_len; i++) {
t->states[i] = va_arg(args, char *);
}
t->final_states_len = va_arg(args, int);
t->final_states = malloc(t->final_states_len * sizeof (int));
for (i = 0; i < t->final_states_len; i++) {
t->final_states[i] = state_index(t, va_arg(args, char *));
}
t->symbols_len = va_arg(args, int);
t->symbols = malloc(t->symbols_len);
for (i = 0; i < t->symbols_len; i++) {
t->symbols[i] = va_arg(args, int);
}
t->blank = symbol_index(t, va_arg(args, int));
t->state = state_index(t, va_arg(args, char *));
t->tape_len = va_arg(args, int);
t->tape = NULL;
for (i = 0; i < t->tape_len; i++) {
move(t, RIGHT);
t->tape->symbol = symbol_index(t, va_arg(args, int));
}
if (!t->tape_len) {
move(t, RIGHT);
}
while (t->tape->left) {
t->tape = t->tape->left;
}
t->transitions_len = va_arg(args, int);
t->transitions = malloc(t->states_len * sizeof (transition_t **));
for (i = 0; i < t->states_len; i++) {
t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *));
}
for (i = 0; i < t->transitions_len; i++) {
transition_t *tran = malloc(sizeof (transition_t));
tran->state1 = state_index(t, va_arg(args, char *));
tran->symbol1 = symbol_index(t, va_arg(args, int));
tran->symbol2 = symbol_index(t, va_arg(args, int));
tran->dir = va_arg(args, int);
tran->state2 = state_index(t, va_arg(args, char *));
t->transitions[tran->state1][tran->symbol1] = tran;
}
va_end(args);
return t;
}
void print_state (turing_t *t) {
printf("%-10s ", t->states[t->state]);
tape_t *tape = t->tape;
while (tape->left) {
tape = tape->left;
}
while (tape) {
if (tape == t->tape) {
printf("[%c]", t->symbols[tape->symbol]);
}
else {
printf(" %c ", t->symbols[tape->symbol]);
}
tape = tape->right;
}
printf("\n");
}
void run (turing_t *t) {
int i;
while (1) {
print_state(t);
for (i = 0; i < t->final_states_len; i++) {
if (t->final_states[i] == t->state) {
return;
}
}
transition_t *tran = t->transitions[t->state][t->tape->symbol];
t->tape->symbol = tran->symbol2;
move(t, tran->dir);
t->state = tran->state2;
}
}
int main () {
printf("Simple incrementer\n");
turing_t *t = create(
2, "q0", "qf",
1, "qf",
2, 'B', '1',
'B',
"q0",
3, '1', '1', '1',
2,
"q0", '1', '1', RIGHT, "q0",
"q0", 'B', '1', STAY, "qf"
);
run(t);
printf("\nThree-state busy beaver\n");
t = create(
4, "a", "b", "c", "halt",
1, "halt",
2, '0', '1',
'0',
"a",
0,
6,
"a", '0', '1', RIGHT, "b",
"a", '1', '1', LEFT, "c",
"b", '0', '1', LEFT, "a",
"b", '1', '1', RIGHT, "b",
"c", '0', '1', LEFT, "b",
"c", '1', '1', STAY, "halt"
);
run(t);
return 0;
printf("\nFive-state two-symbol probable busy beaver\n");
t = create(
6, "A", "B", "C", "D", "E", "H",
1, "H",
2, '0', '1',
'0',
"A",
0,
10,
"A", '0', '1', RIGHT, "B",
"A", '1', '1', LEFT, "C",
"B", '0', '1', RIGHT, "C",
"B", '1', '1', RIGHT, "B",
"C", '0', '1', RIGHT, "D",
"C", '1', '0', LEFT, "E",
"D", '0', '1', LEFT, "A",
"D", '1', '1', LEFT, "D",
"E", '0', '1', STAY, "H",
"E", '1', '0', LEFT, "A"
);
run(t);
}
|
Preserve the algorithm and functionality while converting the code from VB to C. | Option Base 1
Public Enum sett
name_ = 1
initState
endState
blank
rules
End Enum
Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant
Private Sub init()
incrementer = Array("Simple incrementer", _
"q0", _
"qf", _
"B", _
Array( _
Array("q0", "1", "1", "right", "q0"), _
Array("q0", "B", "1", "stay", "qf")))
threeStateBB = Array("Three-state busy beaver", _
"a", _
"halt", _
"0", _
Array( _
Array("a", "0", "1", "right", "b"), _
Array("a", "1", "1", "left", "c"), _
Array("b", "0", "1", "left", "a"), _
Array("b", "1", "1", "right", "b"), _
Array("c", "0", "1", "left", "b"), _
Array("c", "1", "1", "stay", "halt")))
fiveStateBB = Array("Five-state busy beaver", _
"A", _
"H", _
"0", _
Array( _
Array("A", "0", "1", "right", "B"), _
Array("A", "1", "1", "left", "C"), _
Array("B", "0", "1", "right", "C"), _
Array("B", "1", "1", "right", "B"), _
Array("C", "0", "1", "right", "D"), _
Array("C", "1", "0", "left", "E"), _
Array("D", "0", "1", "left", "A"), _
Array("D", "1", "1", "left", "D"), _
Array("E", "0", "1", "stay", "H"), _
Array("E", "1", "0", "left", "A")))
End Sub
Private Sub show(state As String, headpos As Long, tape As Collection)
Debug.Print " "; state; String$(7 - Len(state), " "); "| ";
For p = 1 To tape.Count
Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " ");
Next p
Debug.Print
End Sub
Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0)
Dim state As String: state = machine(initState)
Dim headpos As Long: headpos = 1
Dim counter As Long, rule As Variant
Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=")
If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------"
Do While True
If headpos > tape.Count Then
tape.Add machine(blank)
Else
If headpos < 1 Then
tape.Add machine(blank), Before:=1
headpos = 1
End If
End If
If Not countOnly Then show state, headpos, tape
For i = LBound(machine(rules)) To UBound(machine(rules))
rule = machine(rules)(i)
If rule(1) = state And rule(2) = tape(headpos) Then
tape.Remove headpos
If headpos > tape.Count Then
tape.Add rule(3)
Else
tape.Add rule(3), Before:=headpos
End If
If rule(4) = "left" Then headpos = headpos - 1
If rule(4) = "right" Then headpos = headpos + 1
state = rule(5)
Exit For
End If
Next i
counter = counter + 1
If counter Mod 100000 = 0 Then
Debug.Print counter
DoEvents
DoEvents
End If
If state = machine(endState) Then Exit Do
Loop
DoEvents
If countOnly Then
Debug.Print "Steps taken: ", counter
Else
show state, headpos, tape
Debug.Print
End If
End Sub
Public Sub main()
init
Dim tap As New Collection
tap.Add "1": tap.Add "1": tap.Add "1"
UTM incrementer, tap
Set tap = New Collection
UTM threeStateBB, tap
Set tap = New Collection
UTM fiveStateBB, tap, countOnly:=-1
End Sub
| #include <stdio.h>
#include <stdarg.h>
#include <stdlib.h>
#include <string.h>
enum {
LEFT,
RIGHT,
STAY
};
typedef struct {
int state1;
int symbol1;
int symbol2;
int dir;
int state2;
} transition_t;
typedef struct tape_t tape_t;
struct tape_t {
int symbol;
tape_t *left;
tape_t *right;
};
typedef struct {
int states_len;
char **states;
int final_states_len;
int *final_states;
int symbols_len;
char *symbols;
int blank;
int state;
int tape_len;
tape_t *tape;
int transitions_len;
transition_t ***transitions;
} turing_t;
int state_index (turing_t *t, char *state) {
int i;
for (i = 0; i < t->states_len; i++) {
if (!strcmp(t->states[i], state)) {
return i;
}
}
return 0;
}
int symbol_index (turing_t *t, char symbol) {
int i;
for (i = 0; i < t->symbols_len; i++) {
if (t->symbols[i] == symbol) {
return i;
}
}
return 0;
}
void move (turing_t *t, int dir) {
tape_t *orig = t->tape;
if (dir == RIGHT) {
if (orig && orig->right) {
t->tape = orig->right;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->left = orig;
orig->right = t->tape;
}
}
}
else if (dir == LEFT) {
if (orig && orig->left) {
t->tape = orig->left;
}
else {
t->tape = calloc(1, sizeof (tape_t));
t->tape->symbol = t->blank;
if (orig) {
t->tape->right = orig;
orig->left = t->tape;
}
}
}
}
turing_t *create (int states_len, ...) {
va_list args;
va_start(args, states_len);
turing_t *t = malloc(sizeof (turing_t));
t->states_len = states_len;
t->states = malloc(states_len * sizeof (char *));
int i;
for (i = 0; i < states_len; i++) {
t->states[i] = va_arg(args, char *);
}
t->final_states_len = va_arg(args, int);
t->final_states = malloc(t->final_states_len * sizeof (int));
for (i = 0; i < t->final_states_len; i++) {
t->final_states[i] = state_index(t, va_arg(args, char *));
}
t->symbols_len = va_arg(args, int);
t->symbols = malloc(t->symbols_len);
for (i = 0; i < t->symbols_len; i++) {
t->symbols[i] = va_arg(args, int);
}
t->blank = symbol_index(t, va_arg(args, int));
t->state = state_index(t, va_arg(args, char *));
t->tape_len = va_arg(args, int);
t->tape = NULL;
for (i = 0; i < t->tape_len; i++) {
move(t, RIGHT);
t->tape->symbol = symbol_index(t, va_arg(args, int));
}
if (!t->tape_len) {
move(t, RIGHT);
}
while (t->tape->left) {
t->tape = t->tape->left;
}
t->transitions_len = va_arg(args, int);
t->transitions = malloc(t->states_len * sizeof (transition_t **));
for (i = 0; i < t->states_len; i++) {
t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *));
}
for (i = 0; i < t->transitions_len; i++) {
transition_t *tran = malloc(sizeof (transition_t));
tran->state1 = state_index(t, va_arg(args, char *));
tran->symbol1 = symbol_index(t, va_arg(args, int));
tran->symbol2 = symbol_index(t, va_arg(args, int));
tran->dir = va_arg(args, int);
tran->state2 = state_index(t, va_arg(args, char *));
t->transitions[tran->state1][tran->symbol1] = tran;
}
va_end(args);
return t;
}
void print_state (turing_t *t) {
printf("%-10s ", t->states[t->state]);
tape_t *tape = t->tape;
while (tape->left) {
tape = tape->left;
}
while (tape) {
if (tape == t->tape) {
printf("[%c]", t->symbols[tape->symbol]);
}
else {
printf(" %c ", t->symbols[tape->symbol]);
}
tape = tape->right;
}
printf("\n");
}
void run (turing_t *t) {
int i;
while (1) {
print_state(t);
for (i = 0; i < t->final_states_len; i++) {
if (t->final_states[i] == t->state) {
return;
}
}
transition_t *tran = t->transitions[t->state][t->tape->symbol];
t->tape->symbol = tran->symbol2;
move(t, tran->dir);
t->state = tran->state2;
}
}
int main () {
printf("Simple incrementer\n");
turing_t *t = create(
2, "q0", "qf",
1, "qf",
2, 'B', '1',
'B',
"q0",
3, '1', '1', '1',
2,
"q0", '1', '1', RIGHT, "q0",
"q0", 'B', '1', STAY, "qf"
);
run(t);
printf("\nThree-state busy beaver\n");
t = create(
4, "a", "b", "c", "halt",
1, "halt",
2, '0', '1',
'0',
"a",
0,
6,
"a", '0', '1', RIGHT, "b",
"a", '1', '1', LEFT, "c",
"b", '0', '1', LEFT, "a",
"b", '1', '1', RIGHT, "b",
"c", '0', '1', LEFT, "b",
"c", '1', '1', STAY, "halt"
);
run(t);
return 0;
printf("\nFive-state two-symbol probable busy beaver\n");
t = create(
6, "A", "B", "C", "D", "E", "H",
1, "H",
2, '0', '1',
'0',
"A",
0,
10,
"A", '0', '1', RIGHT, "B",
"A", '1', '1', LEFT, "C",
"B", '0', '1', RIGHT, "C",
"B", '1', '1', RIGHT, "B",
"C", '0', '1', RIGHT, "D",
"C", '1', '0', LEFT, "E",
"D", '0', '1', LEFT, "A",
"D", '1', '1', LEFT, "D",
"E", '0', '1', STAY, "H",
"E", '1', '0', LEFT, "A"
);
run(t);
}
|
Translate the given VB code snippet into C without altering its behavior. | Public Sub create_file()
Dim FileNumber As Integer
FileNumber = FreeFile
MkDir "docs"
Open "docs\output.txt" For Output As #FreeFile
Close #FreeFile
MkDir "C:\docs"
Open "C:\docs\output.txt" For Output As #FreeFile
Close #FreeFile
End Sub
| #include <stdio.h>
int main() {
FILE *fh = fopen("output.txt", "w");
fclose(fh);
return 0;
}
|
Preserve the algorithm and functionality while converting the code from VB to C. | b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
| #include<string.h>
#include<stdlib.h>
#include<stdio.h>
typedef struct genome{
char* strand;
int length;
struct genome* next;
}genome;
genome* genomeData;
int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0;
int numDigits(int num){
int len = 1;
while(num>10){
num = num/10;
len++;
}
return len;
}
void buildGenome(char str[100]){
int len = strlen(str),i;
genome *genomeIterator, *newGenome;
totalLength += len;
for(i=0;i<len;i++){
switch(str[i]){
case 'A': Adenine++;
break;
case 'T': Thymine++;
break;
case 'C': Cytosine++;
break;
case 'G': Guanine++;
break;
};
}
if(genomeData==NULL){
genomeData = (genome*)malloc(sizeof(genome));
genomeData->strand = (char*)malloc(len*sizeof(char));
strcpy(genomeData->strand,str);
genomeData->length = len;
genomeData->next = NULL;
}
else{
genomeIterator = genomeData;
while(genomeIterator->next!=NULL)
genomeIterator = genomeIterator->next;
newGenome = (genome*)malloc(sizeof(genome));
newGenome->strand = (char*)malloc(len*sizeof(char));
strcpy(newGenome->strand,str);
newGenome->length = len;
newGenome->next = NULL;
genomeIterator->next = newGenome;
}
}
void printGenome(){
genome* genomeIterator = genomeData;
int width = numDigits(totalLength), len = 0;
printf("Sequence:\n");
while(genomeIterator!=NULL){
printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand);
len += genomeIterator->length;
genomeIterator = genomeIterator->next;
}
printf("\n\nBase Count\n----------\n\n");
printf("%3c%3s%*d\n",'A',":",width+1,Adenine);
printf("%3c%3s%*d\n",'T',":",width+1,Thymine);
printf("%3c%3s%*d\n",'C',":",width+1,Cytosine);
printf("%3c%3s%*d\n",'G',":",width+1,Guanine);
printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine);
free(genomeData);
}
int main(int argc,char** argv)
{
char str[100];
int counter = 0, len;
if(argc!=2){
printf("Usage : %s <Gene file name>\n",argv[0]);
return 0;
}
FILE *fp = fopen(argv[1],"r");
while(fscanf(fp,"%s",str)!=EOF)
buildGenome(str);
fclose(fp);
printGenome();
return 0;
}
|
Generate an equivalent C version of this VB code. | b=_
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
s="SEQUENCE:"
acnt=0:ccnt=0:gcnt=0:tcnt=0
for i=0 to len(b)-1
if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": "
if (i mod 5)=0 then s=s& " "
m=mid(b,i+1,1)
s=s & m
select case m
case "A":acnt=acnt+1
case "C":ccnt=ccnt+1
case "G":gcnt=gcnt+1
case "T":tcnt=tcnt+1
case else
wscript.echo "error at ",i+1, m
end select
next
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
| #include<string.h>
#include<stdlib.h>
#include<stdio.h>
typedef struct genome{
char* strand;
int length;
struct genome* next;
}genome;
genome* genomeData;
int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0;
int numDigits(int num){
int len = 1;
while(num>10){
num = num/10;
len++;
}
return len;
}
void buildGenome(char str[100]){
int len = strlen(str),i;
genome *genomeIterator, *newGenome;
totalLength += len;
for(i=0;i<len;i++){
switch(str[i]){
case 'A': Adenine++;
break;
case 'T': Thymine++;
break;
case 'C': Cytosine++;
break;
case 'G': Guanine++;
break;
};
}
if(genomeData==NULL){
genomeData = (genome*)malloc(sizeof(genome));
genomeData->strand = (char*)malloc(len*sizeof(char));
strcpy(genomeData->strand,str);
genomeData->length = len;
genomeData->next = NULL;
}
else{
genomeIterator = genomeData;
while(genomeIterator->next!=NULL)
genomeIterator = genomeIterator->next;
newGenome = (genome*)malloc(sizeof(genome));
newGenome->strand = (char*)malloc(len*sizeof(char));
strcpy(newGenome->strand,str);
newGenome->length = len;
newGenome->next = NULL;
genomeIterator->next = newGenome;
}
}
void printGenome(){
genome* genomeIterator = genomeData;
int width = numDigits(totalLength), len = 0;
printf("Sequence:\n");
while(genomeIterator!=NULL){
printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand);
len += genomeIterator->length;
genomeIterator = genomeIterator->next;
}
printf("\n\nBase Count\n----------\n\n");
printf("%3c%3s%*d\n",'A',":",width+1,Adenine);
printf("%3c%3s%*d\n",'T',":",width+1,Thymine);
printf("%3c%3s%*d\n",'C',":",width+1,Cytosine);
printf("%3c%3s%*d\n",'G',":",width+1,Guanine);
printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine);
free(genomeData);
}
int main(int argc,char** argv)
{
char str[100];
int counter = 0, len;
if(argc!=2){
printf("Usage : %s <Gene file name>\n",argv[0]);
return 0;
}
FILE *fp = fopen(argv[1],"r");
while(fscanf(fp,"%s",str)!=EOF)
buildGenome(str);
fclose(fp);
printGenome();
return 0;
}
|
Convert the following code from VB to C, ensuring the logic remains intact. |
Public Const HOLDON = False
Public Const DIJKSTRASOLUTION = True
Public Const X = 10
Public Const GETS = 0
Public Const PUTS = 1
Public Const EATS = 2
Public Const THKS = 5
Public Const FRSTFORK = 0
Public Const SCNDFORK = 1
Public Const SPAGHETI = 0
Public Const UNIVERSE = 1
Public Const MAXCOUNT = 100000
Public Const PHILOSOPHERS = 5
Public semaphore(PHILOSOPHERS - 1) As Integer
Public positi0n(1, PHILOSOPHERS - 1) As Integer
Public programcounter(PHILOSOPHERS - 1) As Long
Public statistics(PHILOSOPHERS - 1, 5, 1) As Long
Public names As Variant
Private Sub init()
names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}]
For j = 0 To PHILOSOPHERS - 2
positi0n(0, j) = j + 1
positi0n(1, j) = j
Next j
If DIJKSTRASOLUTION Then
positi0n(0, PHILOSOPHERS - 1) = j
positi0n(1, PHILOSOPHERS - 1) = 0
Else
positi0n(0, PHILOSOPHERS - 1) = 0
positi0n(1, PHILOSOPHERS - 1) = j
End If
End Sub
Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer)
statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1
If verb < 2 Then
If semaphore(positi0n(objekt, subject)) <> verb Then
If Not HOLDON Then
semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt
programcounter(subject) = 0
End If
Else
semaphore(positi0n(objekt, subject)) = 1 - verb
programcounter(subject) = (programcounter(subject) + 1) Mod 6
End If
Else
programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6
End If
End Sub
Private Sub dine()
Dim ph As Integer
Do While TC < MAXCOUNT
For ph = 0 To PHILOSOPHERS - 1
Select Case programcounter(ph)
Case 0: philosopher ph, GETS, FRSTFORK
Case 1: philosopher ph, GETS, SCNDFORK
Case 2: philosopher ph, EATS, SPAGHETI
Case 3: philosopher ph, PUTS, FRSTFORK
Case 4: philosopher ph, PUTS, SCNDFORK
Case 5: philosopher ph, THKS, UNIVERSE
End Select
TC = TC + 1
Next ph
Loop
End Sub
Private Sub show()
Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks"
Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About"
Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe"
For subject = 0 To PHILOSOPHERS - 1
Debug.Print names(subject + 1),
For objekt = 0 To 1
Debug.Print statistics(subject, GETS, objekt),
Next objekt
Debug.Print statistics(subject, EATS, SPAGHETI),
For objekt = 0 To 1
Debug.Print statistics(subject, PUTS, objekt),
Next objekt
Debug.Print statistics(subject, THKS, UNIVERSE)
Next subject
End Sub
Public Sub main()
init
dine
show
End Sub
| #include <pthread.h>
#include <stdio.h>
#include <stdlib.h>
#include <unistd.h>
#include <stdarg.h>
#define N 5
const char *names[N] = { "Aristotle", "Kant", "Spinoza", "Marx", "Russell" };
pthread_mutex_t forks[N];
#define M 5
const char *topic[M] = { "Spaghetti!", "Life", "Universe", "Everything", "Bathroom" };
#define lock pthread_mutex_lock
#define unlock pthread_mutex_unlock
#define xy(x, y) printf("\033[%d;%dH", x, y)
#define clear_eol(x) print(x, 12, "\033[K")
void print(int y, int x, const char *fmt, ...)
{
static pthread_mutex_t screen = PTHREAD_MUTEX_INITIALIZER;
va_list ap;
va_start(ap, fmt);
lock(&screen);
xy(y + 1, x), vprintf(fmt, ap);
xy(N + 1, 1), fflush(stdout);
unlock(&screen);
}
void eat(int id)
{
int f[2], ration, i;
f[0] = f[1] = id;
f[id & 1] = (id + 1) % N;
clear_eol(id);
print(id, 12, "..oO (forks, need forks)");
for (i = 0; i < 2; i++) {
lock(forks + f[i]);
if (!i) clear_eol(id);
print(id, 12 + (f[i] != id) * 6, "fork%d", f[i]);
sleep(1);
}
for (i = 0, ration = 3 + rand() % 8; i < ration; i++)
print(id, 24 + i * 4, "nom"), sleep(1);
for (i = 0; i < 2; i++) unlock(forks + f[i]);
}
void think(int id)
{
int i, t;
char buf[64] = {0};
do {
clear_eol(id);
sprintf(buf, "..oO (%s)", topic[t = rand() % M]);
for (i = 0; buf[i]; i++) {
print(id, i+12, "%c", buf[i]);
if (i < 5) usleep(200000);
}
usleep(500000 + rand() % 1000000);
} while (t);
}
void* philosophize(void *a)
{
int id = *(int*)a;
print(id, 1, "%10s", names[id]);
while(1) think(id), eat(id);
}
int main()
{
int i, id[N];
pthread_t tid[N];
for (i = 0; i < N; i++)
pthread_mutex_init(forks + (id[i] = i), 0);
for (i = 0; i < N; i++)
pthread_create(tid + i, 0, philosophize, id + i);
return pthread_join(tid[0], 0);
}
|
Generate an equivalent C version of this VB code. |
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
| #include <stdio.h>
int main() {
int n, b, d;
unsigned long long i, j, sum, fact[12];
fact[0] = 1;
for (n = 1; n < 12; ++n) {
fact[n] = fact[n-1] * n;
}
for (b = 9; b <= 12; ++b) {
printf("The factorions for base %d are:\n", b);
for (i = 1; i < 1500000; ++i) {
sum = 0;
j = i;
while (j > 0) {
d = j % b;
sum += fact[d];
j /= b;
}
if (sum == i) printf("%llu ", i);
}
printf("\n\n");
}
return 0;
}
|
Port the following code from VB to C with equivalent syntax and logic. |
Dim fact()
nn1=9 : nn2=12
lim=1499999
ReDim fact(nn2)
fact(0)=1
For i=1 To nn2
fact(i)=fact(i-1)*i
Next
For base=nn1 To nn2
list=""
For i=1 To lim
s=0
t=i
Do While t<>0
d=t Mod base
s=s+fact(d)
t=t\base
Loop
If s=i Then list=list &" "& i
Next
Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list
Next
| #include <stdio.h>
int main() {
int n, b, d;
unsigned long long i, j, sum, fact[12];
fact[0] = 1;
for (n = 1; n < 12; ++n) {
fact[n] = fact[n-1] * n;
}
for (b = 9; b <= 12; ++b) {
printf("The factorions for base %d are:\n", b);
for (i = 1; i < 1500000; ++i) {
sum = 0;
j = i;
while (j > 0) {
d = j % b;
sum += fact[d];
j /= b;
}
if (sum == i) printf("%llu ", i);
}
printf("\n\n");
}
return 0;
}
|
Ensure the translated C code behaves exactly like the original VB snippet. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| #include <ctype.h>
#include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
typedef struct command_tag {
char* cmd;
size_t length;
size_t min_len;
struct command_tag* next;
} command_t;
bool command_match(const command_t* command, const char* str) {
size_t olen = strlen(str);
return olen >= command->min_len && olen <= command->length
&& strncmp(str, command->cmd, olen) == 0;
}
char* uppercase(char* str, size_t n) {
for (size_t i = 0; i < n; ++i)
str[i] = toupper((unsigned char)str[i]);
return str;
}
size_t get_min_length(const char* str, size_t n) {
size_t len = 0;
while (len < n && isupper((unsigned char)str[len]))
++len;
return len;
}
void fatal(const char* message) {
fprintf(stderr, "%s\n", message);
exit(1);
}
void* xmalloc(size_t n) {
void* ptr = malloc(n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
void* xrealloc(void* p, size_t n) {
void* ptr = realloc(p, n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
char** split_into_words(const char* str, size_t* count) {
size_t size = 0;
size_t capacity = 16;
char** words = xmalloc(capacity * sizeof(char*));
size_t len = strlen(str);
for (size_t begin = 0; begin < len; ) {
size_t i = begin;
for (; i < len && isspace((unsigned char)str[i]); ++i) {}
begin = i;
for (; i < len && !isspace((unsigned char)str[i]); ++i) {}
size_t word_len = i - begin;
if (word_len == 0)
break;
char* word = xmalloc(word_len + 1);
memcpy(word, str + begin, word_len);
word[word_len] = 0;
begin += word_len;
if (capacity == size) {
capacity *= 2;
words = xrealloc(words, capacity * sizeof(char*));
}
words[size++] = word;
}
*count = size;
return words;
}
command_t* make_command_list(const char* table) {
command_t* cmd = NULL;
size_t count = 0;
char** words = split_into_words(table, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
command_t* new_cmd = xmalloc(sizeof(command_t));
size_t word_len = strlen(word);
new_cmd->length = word_len;
new_cmd->min_len = get_min_length(word, word_len);
new_cmd->cmd = uppercase(word, word_len);
new_cmd->next = cmd;
cmd = new_cmd;
}
free(words);
return cmd;
}
void free_command_list(command_t* cmd) {
while (cmd != NULL) {
command_t* next = cmd->next;
free(cmd->cmd);
free(cmd);
cmd = next;
}
}
const command_t* find_command(const command_t* commands, const char* word) {
for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) {
if (command_match(cmd, word))
return cmd;
}
return NULL;
}
void test(const command_t* commands, const char* input) {
printf(" input: %s\n", input);
printf("output:");
size_t count = 0;
char** words = split_into_words(input, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
uppercase(word, strlen(word));
const command_t* cmd_ptr = find_command(commands, word);
printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*");
free(word);
}
free(words);
printf("\n");
}
int main() {
command_t* commands = make_command_list(command_table);
const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin";
test(commands, input);
free_command_list(commands);
return 0;
}
|
Produce a functionally identical C code for the snippet given in VB. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| #include <ctype.h>
#include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
typedef struct command_tag {
char* cmd;
size_t length;
size_t min_len;
struct command_tag* next;
} command_t;
bool command_match(const command_t* command, const char* str) {
size_t olen = strlen(str);
return olen >= command->min_len && olen <= command->length
&& strncmp(str, command->cmd, olen) == 0;
}
char* uppercase(char* str, size_t n) {
for (size_t i = 0; i < n; ++i)
str[i] = toupper((unsigned char)str[i]);
return str;
}
size_t get_min_length(const char* str, size_t n) {
size_t len = 0;
while (len < n && isupper((unsigned char)str[len]))
++len;
return len;
}
void fatal(const char* message) {
fprintf(stderr, "%s\n", message);
exit(1);
}
void* xmalloc(size_t n) {
void* ptr = malloc(n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
void* xrealloc(void* p, size_t n) {
void* ptr = realloc(p, n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
char** split_into_words(const char* str, size_t* count) {
size_t size = 0;
size_t capacity = 16;
char** words = xmalloc(capacity * sizeof(char*));
size_t len = strlen(str);
for (size_t begin = 0; begin < len; ) {
size_t i = begin;
for (; i < len && isspace((unsigned char)str[i]); ++i) {}
begin = i;
for (; i < len && !isspace((unsigned char)str[i]); ++i) {}
size_t word_len = i - begin;
if (word_len == 0)
break;
char* word = xmalloc(word_len + 1);
memcpy(word, str + begin, word_len);
word[word_len] = 0;
begin += word_len;
if (capacity == size) {
capacity *= 2;
words = xrealloc(words, capacity * sizeof(char*));
}
words[size++] = word;
}
*count = size;
return words;
}
command_t* make_command_list(const char* table) {
command_t* cmd = NULL;
size_t count = 0;
char** words = split_into_words(table, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
command_t* new_cmd = xmalloc(sizeof(command_t));
size_t word_len = strlen(word);
new_cmd->length = word_len;
new_cmd->min_len = get_min_length(word, word_len);
new_cmd->cmd = uppercase(word, word_len);
new_cmd->next = cmd;
cmd = new_cmd;
}
free(words);
return cmd;
}
void free_command_list(command_t* cmd) {
while (cmd != NULL) {
command_t* next = cmd->next;
free(cmd->cmd);
free(cmd);
cmd = next;
}
}
const command_t* find_command(const command_t* commands, const char* word) {
for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) {
if (command_match(cmd, word))
return cmd;
}
return NULL;
}
void test(const command_t* commands, const char* input) {
printf(" input: %s\n", input);
printf("output:");
size_t count = 0;
char** words = split_into_words(input, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
uppercase(word, strlen(word));
const command_t* cmd_ptr = find_command(commands, word);
printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*");
free(word);
}
free(words);
printf("\n");
}
int main() {
command_t* commands = make_command_list(command_table);
const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin";
test(commands, input);
free_command_list(commands);
return 0;
}
|
Maintain the same structure and functionality when rewriting this code in C. | Private Function ValidateUserWords(userstring As String) As String
Dim s As String
Dim user_words() As String
Dim command_table As Scripting.Dictionary
Set command_table = New Scripting.Dictionary
Dim abbreviations As Scripting.Dictionary
Set abbreviations = New Scripting.Dictionary
abbreviations.CompareMode = TextCompare
Dim commandtable() As String
Dim commands As String
s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up "
commandtable = Split(s, " ")
Dim i As Integer
For Each word In commandtable
If Len(word) > 0 Then
i = 1
Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z"
i = i + 1
Loop
command_table.Add Key:=word, Item:=i - 1
End If
Next word
For Each word In command_table
For i = command_table(word) To Len(word)
On Error Resume Next
abbreviations.Add Key:=Left(word, i), Item:=UCase(word)
Next i
Next word
user_words() = Split(userstring, " ")
For Each word In user_words
If Len(word) > 0 Then
If abbreviations.exists(word) Then
commands = commands & abbreviations(word) & " "
Else
commands = commands & "*error* "
End If
End If
Next word
ValidateUserWords = commands
End Function
Public Sub program()
Dim guserstring As String
guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin"
Debug.Print "user words:", guserstring
Debug.Print "full words:", ValidateUserWords(guserstring)
End Sub
| #include <ctype.h>
#include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
const char* command_table =
"Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy "
"COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find "
"NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput "
"Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO "
"MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT "
"READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT "
"RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up";
typedef struct command_tag {
char* cmd;
size_t length;
size_t min_len;
struct command_tag* next;
} command_t;
bool command_match(const command_t* command, const char* str) {
size_t olen = strlen(str);
return olen >= command->min_len && olen <= command->length
&& strncmp(str, command->cmd, olen) == 0;
}
char* uppercase(char* str, size_t n) {
for (size_t i = 0; i < n; ++i)
str[i] = toupper((unsigned char)str[i]);
return str;
}
size_t get_min_length(const char* str, size_t n) {
size_t len = 0;
while (len < n && isupper((unsigned char)str[len]))
++len;
return len;
}
void fatal(const char* message) {
fprintf(stderr, "%s\n", message);
exit(1);
}
void* xmalloc(size_t n) {
void* ptr = malloc(n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
void* xrealloc(void* p, size_t n) {
void* ptr = realloc(p, n);
if (ptr == NULL)
fatal("Out of memory");
return ptr;
}
char** split_into_words(const char* str, size_t* count) {
size_t size = 0;
size_t capacity = 16;
char** words = xmalloc(capacity * sizeof(char*));
size_t len = strlen(str);
for (size_t begin = 0; begin < len; ) {
size_t i = begin;
for (; i < len && isspace((unsigned char)str[i]); ++i) {}
begin = i;
for (; i < len && !isspace((unsigned char)str[i]); ++i) {}
size_t word_len = i - begin;
if (word_len == 0)
break;
char* word = xmalloc(word_len + 1);
memcpy(word, str + begin, word_len);
word[word_len] = 0;
begin += word_len;
if (capacity == size) {
capacity *= 2;
words = xrealloc(words, capacity * sizeof(char*));
}
words[size++] = word;
}
*count = size;
return words;
}
command_t* make_command_list(const char* table) {
command_t* cmd = NULL;
size_t count = 0;
char** words = split_into_words(table, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
command_t* new_cmd = xmalloc(sizeof(command_t));
size_t word_len = strlen(word);
new_cmd->length = word_len;
new_cmd->min_len = get_min_length(word, word_len);
new_cmd->cmd = uppercase(word, word_len);
new_cmd->next = cmd;
cmd = new_cmd;
}
free(words);
return cmd;
}
void free_command_list(command_t* cmd) {
while (cmd != NULL) {
command_t* next = cmd->next;
free(cmd->cmd);
free(cmd);
cmd = next;
}
}
const command_t* find_command(const command_t* commands, const char* word) {
for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) {
if (command_match(cmd, word))
return cmd;
}
return NULL;
}
void test(const command_t* commands, const char* input) {
printf(" input: %s\n", input);
printf("output:");
size_t count = 0;
char** words = split_into_words(input, &count);
for (size_t i = 0; i < count; ++i) {
char* word = words[i];
uppercase(word, strlen(word));
const command_t* cmd_ptr = find_command(commands, word);
printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*");
free(word);
}
free(words);
printf("\n");
}
int main() {
command_t* commands = make_command_list(command_table);
const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin";
test(commands, input);
free_command_list(commands);
return 0;
}
|
Convert the following code from VB to C, ensuring the logic remains intact. | Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
| #include <stdio.h>
#include <string.h>
#include <stdlib.h>
char *codes[] = {
"AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA",
"AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB",
"ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA",
"ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB",
"BABAA", "BABAB", "BABBA", "BABBB", "BBAAA",
"BBAAB", "BBBAA"
};
char *get_code(const char c) {
if (c >= 97 && c <= 122) return codes[c - 97];
return codes[26];
}
char get_char(const char *code) {
int i;
if (!strcmp(codes[26], code)) return ' ';
for (i = 0; i < 26; ++i) {
if (strcmp(codes[i], code) == 0) return 97 + i;
}
printf("\nCode \"%s\" is invalid\n", code);
exit(1);
}
void str_tolower(char s[]) {
int i;
for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]);
}
char *bacon_encode(char plain_text[], char message[]) {
int i, count;
int plen = strlen(plain_text), mlen = strlen(message);
int elen = 5 * plen;
char c;
char *p, *et, *mt;
et = malloc(elen + 1);
str_tolower(plain_text);
for (i = 0, p = et; i < plen; ++i, p += 5) {
c = plain_text[i];
strncpy(p, get_code(c), 5);
}
*++p = '\0';
str_tolower(message);
mt = calloc(mlen + 1, 1);
for (i = 0, count = 0; i < mlen; ++i) {
c = message[i];
if (c >= 'a' && c <= 'z') {
if (et[count] == 'A')
mt[i] = c;
else
mt[i] = c - 32;
if (++count == elen) break;
}
else mt[i] = c;
}
free(et);
return mt;
}
char *bacon_decode(char cipher_text[]) {
int i, count, clen = strlen(cipher_text);
int plen;
char *p, *ct, *pt;
char c, quintet[6];
ct = calloc(clen + 1, 1);
for (i = 0, count = 0; i < clen; ++i) {
c = cipher_text[i];
if (c >= 'a' && c <= 'z')
ct[count++] = 'A';
else if (c >= 'A' && c <= 'Z')
ct[count++] = 'B';
}
plen = strlen(ct) / 5;
pt = malloc(plen + 1);
for (i = 0, p = ct; i < plen; ++i, p += 5) {
strncpy(quintet, p, 5);
quintet[5] = '\0';
pt[i] = get_char(quintet);
}
pt[plen] = '\0';
free(ct);
return pt;
}
int main() {
char plain_text[] = "the quick brown fox jumps over the lazy dog";
char message[] = "bacon's cipher is a method of steganography created by francis bacon."
"this task is to implement a program for encryption and decryption of "
"plaintext using the simple alphabet of the baconian cipher or some "
"other kind of representation of this alphabet (make anything signify anything). "
"the baconian alphabet may optionally be extended to encode all lower "
"case characters individually and/or adding a few punctuation characters "
"such as the space.";
char *cipher_text, *hidden_text;
cipher_text = bacon_encode(plain_text, message);
printf("Cipher text ->\n\n%s\n", cipher_text);
hidden_text = bacon_decode(cipher_text);
printf("\nHidden text ->\n\n%s\n", hidden_text);
free(cipher_text);
free(hidden_text);
return 0;
}
|
Produce a language-to-language conversion: from VB to C, same semantics. | Imports System.Text
Module Module1
ReadOnly CODES As New Dictionary(Of Char, String) From {
{"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"},
{"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"},
{"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"},
{"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"},
{"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"},
{"z", "BBAAB"}, {" ", "BBBAA"}
}
Function Encode(plainText As String, message As String) As String
Dim pt = plainText.ToLower()
Dim sb As New StringBuilder()
For Each c In pt
If "a" <= c AndAlso c <= "z" Then
sb.Append(CODES(c))
Else
sb.Append(CODES(" "))
End If
Next
Dim et = sb.ToString()
Dim mg = message.ToLower()
sb.Length = 0
Dim count = 0
For Each c In mg
If "a" <= c AndAlso c <= "z" Then
If et(count) = "A" Then
sb.Append(c)
Else
sb.Append(Chr(Asc(c) - 32))
End If
count += 1
If count = et.Length Then
Exit For
End If
Else
sb.Append(c)
End If
Next
Return sb.ToString()
End Function
Function Decode(message As String) As String
Dim sb As New StringBuilder
For Each c In message
If "a" <= c AndAlso c <= "z" Then
sb.Append("A")
ElseIf "A" <= c AndAlso c <= "Z" Then
sb.Append("B")
End If
Next
Dim et = sb.ToString()
sb.Length = 0
For index = 0 To et.Length - 1 Step 5
Dim quintet = et.Substring(index, 5)
Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key
sb.Append(key)
Next
Return sb.ToString()
End Function
Sub Main()
Dim plainText = "the quick brown fox jumps over the lazy dog"
Dim message =
"bacon
"this task is to implement a program for encryption and decryption of " +
"plaintext using the simple alphabet of the baconian cipher or some " +
"other kind of representation of this alphabet (make anything signify anything). " +
"the baconian alphabet may optionally be extended to encode all lower " +
"case characters individually and/or adding a few punctuation characters " +
"such as the space."
Dim cipherText = Encode(plainText, message)
Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText)
Dim decodedText = Decode(cipherText)
Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText)
End Sub
End Module
| #include <stdio.h>
#include <string.h>
#include <stdlib.h>
char *codes[] = {
"AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA",
"AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB",
"ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA",
"ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB",
"BABAA", "BABAB", "BABBA", "BABBB", "BBAAA",
"BBAAB", "BBBAA"
};
char *get_code(const char c) {
if (c >= 97 && c <= 122) return codes[c - 97];
return codes[26];
}
char get_char(const char *code) {
int i;
if (!strcmp(codes[26], code)) return ' ';
for (i = 0; i < 26; ++i) {
if (strcmp(codes[i], code) == 0) return 97 + i;
}
printf("\nCode \"%s\" is invalid\n", code);
exit(1);
}
void str_tolower(char s[]) {
int i;
for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]);
}
char *bacon_encode(char plain_text[], char message[]) {
int i, count;
int plen = strlen(plain_text), mlen = strlen(message);
int elen = 5 * plen;
char c;
char *p, *et, *mt;
et = malloc(elen + 1);
str_tolower(plain_text);
for (i = 0, p = et; i < plen; ++i, p += 5) {
c = plain_text[i];
strncpy(p, get_code(c), 5);
}
*++p = '\0';
str_tolower(message);
mt = calloc(mlen + 1, 1);
for (i = 0, count = 0; i < mlen; ++i) {
c = message[i];
if (c >= 'a' && c <= 'z') {
if (et[count] == 'A')
mt[i] = c;
else
mt[i] = c - 32;
if (++count == elen) break;
}
else mt[i] = c;
}
free(et);
return mt;
}
char *bacon_decode(char cipher_text[]) {
int i, count, clen = strlen(cipher_text);
int plen;
char *p, *ct, *pt;
char c, quintet[6];
ct = calloc(clen + 1, 1);
for (i = 0, count = 0; i < clen; ++i) {
c = cipher_text[i];
if (c >= 'a' && c <= 'z')
ct[count++] = 'A';
else if (c >= 'A' && c <= 'Z')
ct[count++] = 'B';
}
plen = strlen(ct) / 5;
pt = malloc(plen + 1);
for (i = 0, p = ct; i < plen; ++i, p += 5) {
strncpy(quintet, p, 5);
quintet[5] = '\0';
pt[i] = get_char(quintet);
}
pt[plen] = '\0';
free(ct);
return pt;
}
int main() {
char plain_text[] = "the quick brown fox jumps over the lazy dog";
char message[] = "bacon's cipher is a method of steganography created by francis bacon."
"this task is to implement a program for encryption and decryption of "
"plaintext using the simple alphabet of the baconian cipher or some "
"other kind of representation of this alphabet (make anything signify anything). "
"the baconian alphabet may optionally be extended to encode all lower "
"case characters individually and/or adding a few punctuation characters "
"such as the space.";
char *cipher_text, *hidden_text;
cipher_text = bacon_encode(plain_text, message);
printf("Cipher text ->\n\n%s\n", cipher_text);
hidden_text = bacon_decode(cipher_text);
printf("\nHidden text ->\n\n%s\n", hidden_text);
free(cipher_text);
free(hidden_text);
return 0;
}
|
Can you help me rewrite this code in C instead of VB, keeping it the same logically? | Function build_spiral(n)
botcol = 0 : topcol = n - 1
botrow = 0 : toprow = n - 1
Dim matrix()
ReDim matrix(topcol,toprow)
dir = 0 : col = 0 : row = 0
For i = 0 To n*n-1
matrix(col,row) = i
Select Case dir
Case 0
If col < topcol Then
col = col + 1
Else
dir = 1 : row = row + 1 : botrow = botrow + 1
End If
Case 1
If row < toprow Then
row = row + 1
Else
dir = 2 : col = col - 1 : topcol = topcol - 1
End If
Case 2
If col > botcol Then
col = col - 1
Else
dir = 3 : row = row - 1 : toprow = toprow - 1
End If
Case 3
If row > botrow Then
row = row - 1
Else
dir = 0 : col = col + 1 : botcol = botcol + 1
End If
End Select
Next
For y = 0 To n-1
For x = 0 To n-1
WScript.StdOut.Write matrix(x,y) & vbTab
Next
WScript.StdOut.WriteLine
Next
End Function
build_spiral(CInt(WScript.Arguments(0)))
| #include <stdio.h>
#include <stdlib.h>
#define valid(i, j) 0 <= i && i < m && 0 <= j && j < n && !s[i][j]
int main(int c, char **v)
{
int i, j, m = 0, n = 0;
if (c >= 2) m = atoi(v[1]);
if (c >= 3) n = atoi(v[2]);
if (m <= 0) m = 5;
if (n <= 0) n = m;
int **s = calloc(1, sizeof(int *) * m + sizeof(int) * m * n);
s[0] = (int*)(s + m);
for (i = 1; i < m; i++) s[i] = s[i - 1] + n;
int dx = 1, dy = 0, val = 0, t;
for (i = j = 0; valid(i, j); i += dy, j += dx ) {
for (; valid(i, j); j += dx, i += dy)
s[i][j] = ++val;
j -= dx; i -= dy;
t = dy; dy = dx; dx = -t;
}
for (t = 2; val /= 10; t++);
for(i = 0; i < m; i++)
for(j = 0; j < n || !putchar('\n'); j++)
printf("%*d", t, s[i][j]);
return 0;
}
|
Write the same code in C as shown below in VB. | Function build_spiral(n)
botcol = 0 : topcol = n - 1
botrow = 0 : toprow = n - 1
Dim matrix()
ReDim matrix(topcol,toprow)
dir = 0 : col = 0 : row = 0
For i = 0 To n*n-1
matrix(col,row) = i
Select Case dir
Case 0
If col < topcol Then
col = col + 1
Else
dir = 1 : row = row + 1 : botrow = botrow + 1
End If
Case 1
If row < toprow Then
row = row + 1
Else
dir = 2 : col = col - 1 : topcol = topcol - 1
End If
Case 2
If col > botcol Then
col = col - 1
Else
dir = 3 : row = row - 1 : toprow = toprow - 1
End If
Case 3
If row > botrow Then
row = row - 1
Else
dir = 0 : col = col + 1 : botcol = botcol + 1
End If
End Select
Next
For y = 0 To n-1
For x = 0 To n-1
WScript.StdOut.Write matrix(x,y) & vbTab
Next
WScript.StdOut.WriteLine
Next
End Function
build_spiral(CInt(WScript.Arguments(0)))
| #include <stdio.h>
#include <stdlib.h>
#define valid(i, j) 0 <= i && i < m && 0 <= j && j < n && !s[i][j]
int main(int c, char **v)
{
int i, j, m = 0, n = 0;
if (c >= 2) m = atoi(v[1]);
if (c >= 3) n = atoi(v[2]);
if (m <= 0) m = 5;
if (n <= 0) n = m;
int **s = calloc(1, sizeof(int *) * m + sizeof(int) * m * n);
s[0] = (int*)(s + m);
for (i = 1; i < m; i++) s[i] = s[i - 1] + n;
int dx = 1, dy = 0, val = 0, t;
for (i = j = 0; valid(i, j); i += dy, j += dx ) {
for (; valid(i, j); j += dx, i += dy)
s[i][j] = ++val;
j -= dx; i -= dy;
t = dy; dy = dx; dx = -t;
}
for (t = 2; val /= 10; t++);
for(i = 0; i < m; i++)
for(j = 0; j < n || !putchar('\n'); j++)
printf("%*d", t, s[i][j]);
return 0;
}
|
Translate this program into C but keep the logic exactly as in VB. | Private Sub optional_parameters(theRange As String, _
Optional ordering As Integer = 0, _
Optional column As Integer = 1, _
Optional reverse As Integer = 1)
ActiveSheet.Sort.SortFields.Clear
ActiveSheet.Sort.SortFields.Add _
Key:=Range(theRange).Columns(column), _
SortOn:=SortOnValues, _
Order:=reverse, _
DataOption:=ordering
With ActiveSheet.Sort
.SetRange Range(theRange)
.Header = xlGuess
.MatchCase = False
.Orientation = xlTopToBottom
.SortMethod = xlPinYin
.Apply
End With
End Sub
Public Sub main()
optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1
End Sub
| #include <stdlib.h>
#include <stdarg.h>
#include <stdio.h>
#include <ctype.h>
#include <string.h>
typedef const char * String;
typedef struct sTable {
String * *rows;
int n_rows,n_cols;
} *Table;
typedef int (*CompareFctn)(String a, String b);
struct {
CompareFctn compare;
int column;
int reversed;
} sortSpec;
int CmprRows( const void *aa, const void *bb)
{
String *rA = *(String *const *)aa;
String *rB = *(String *const *)bb;
int sortCol = sortSpec.column;
String left = sortSpec.reversed ? rB[sortCol] : rA[sortCol];
String right = sortSpec.reversed ? rA[sortCol] : rB[sortCol];
return sortSpec.compare( left, right );
}
int sortTable(Table tbl, const char* argSpec,... )
{
va_list vl;
const char *p;
int c;
sortSpec.compare = &strcmp;
sortSpec.column = 0;
sortSpec.reversed = 0;
va_start(vl, argSpec);
if (argSpec)
for (p=argSpec; *p; p++) {
switch (*p) {
case 'o':
sortSpec.compare = va_arg(vl,CompareFctn);
break;
case 'c':
c = va_arg(vl,int);
if ( 0<=c && c<tbl->n_cols)
sortSpec.column = c;
break;
case 'r':
sortSpec.reversed = (0!=va_arg(vl,int));
break;
}
}
va_end(vl);
qsort( tbl->rows, tbl->n_rows, sizeof(String *), CmprRows);
return 0;
}
void printTable( Table tbl, FILE *fout, const char *colFmts[])
{
int row, col;
for (row=0; row<tbl->n_rows; row++) {
fprintf(fout, " ");
for(col=0; col<tbl->n_cols; col++) {
fprintf(fout, colFmts[col], tbl->rows[row][col]);
}
fprintf(fout, "\n");
}
fprintf(fout, "\n");
}
int ord(char v)
{
return v-'0';
}
int cmprStrgs(String s1, String s2)
{
const char *p1 = s1;
const char *p2 = s2;
const char *mrk1, *mrk2;
while ((tolower(*p1) == tolower(*p2)) && *p1) {
p1++; p2++;
}
if (isdigit(*p1) && isdigit(*p2)) {
long v1, v2;
if ((*p1 == '0') ||(*p2 == '0')) {
while (p1 > s1) {
p1--; p2--;
if (*p1 != '0') break;
}
if (!isdigit(*p1)) {
p1++; p2++;
}
}
mrk1 = p1; mrk2 = p2;
v1 = 0;
while(isdigit(*p1)) {
v1 = 10*v1+ord(*p1);
p1++;
}
v2 = 0;
while(isdigit(*p2)) {
v2 = 10*v2+ord(*p2);
p2++;
}
if (v1 == v2)
return(p2-mrk2)-(p1-mrk1);
return v1 - v2;
}
if (tolower(*p1) != tolower(*p2))
return (tolower(*p1) - tolower(*p2));
for(p1=s1, p2=s2; (*p1 == *p2) && *p1; p1++, p2++);
return (*p1 -*p2);
}
int main()
{
const char *colFmts[] = {" %-5.5s"," %-5.5s"," %-9.9s"};
String r1[] = { "a101", "red", "Java" };
String r2[] = { "ab40", "gren", "Smalltalk" };
String r3[] = { "ab9", "blue", "Fortran" };
String r4[] = { "ab09", "ylow", "Python" };
String r5[] = { "ab1a", "blak", "Factor" };
String r6[] = { "ab1b", "brwn", "C Sharp" };
String r7[] = { "Ab1b", "pink", "Ruby" };
String r8[] = { "ab1", "orng", "Scheme" };
String *rows[] = { r1, r2, r3, r4, r5, r6, r7, r8 };
struct sTable table;
table.rows = rows;
table.n_rows = 8;
table.n_cols = 3;
sortTable(&table, "");
printf("sort on col 0, ascending\n");
printTable(&table, stdout, colFmts);
sortTable(&table, "ro", 1, &cmprStrgs);
printf("sort on col 0, reverse.special\n");
printTable(&table, stdout, colFmts);
sortTable(&table, "c", 1);
printf("sort on col 1, ascending\n");
printTable(&table, stdout, colFmts);
sortTable(&table, "cr", 2, 1);
printf("sort on col 2, reverse\n");
printTable(&table, stdout, colFmts);
return 0;
}
|
Port the provided VB code into C while preserving the original functionality. | Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _
CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer
Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _
overlapped As Ptr) As Boolean
Declare Function GetLastError Lib "Kernel32" () As Integer
Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean
Const FILE_SHARE_READ = &h00000001
Const FILE_SHARE_WRITE = &h00000002
Const OPEN_EXISTING = 3
Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0)
If fHandle > 0 Then
Dim mb As MemoryBlock = "Hello, World!"
Dim bytesWritten As Integer
If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then
MsgBox("Error Number: " + Str(GetLastError))
End If
Call CloseHandle(fHandle)
Else
MsgBox("Error Number: " + Str(GetLastError))
End If
|
#include <stdio.h>
void sayHello(char* name){
printf("Hello %s!\n", name);
}
int doubleNum(int num){
return num * 2;
}
|
Translate the given VB code snippet into C without altering its behavior. | Module Module1
Class Frac
Private ReadOnly num As Long
Private ReadOnly denom As Long
Public Shared ReadOnly ZERO = New Frac(0, 1)
Public Shared ReadOnly ONE = New Frac(1, 1)
Public Sub New(n As Long, d As Long)
If d = 0 Then
Throw New ArgumentException("d must not be zero")
End If
Dim nn = n
Dim dd = d
If nn = 0 Then
dd = 1
ElseIf dd < 0 Then
nn = -nn
dd = -dd
End If
Dim g = Math.Abs(Gcd(nn, dd))
If g > 1 Then
nn /= g
dd /= g
End If
num = nn
denom = dd
End Sub
Private Shared Function Gcd(a As Long, b As Long) As Long
If b = 0 Then
Return a
Else
Return Gcd(b, a Mod b)
End If
End Function
Public Shared Operator -(self As Frac) As Frac
Return New Frac(-self.num, self.denom)
End Operator
Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom)
End Operator
Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac
Return lhs + -rhs
End Operator
Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac
Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom)
End Operator
Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x < y
End Operator
Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean
Dim x = lhs.num / lhs.denom
Dim y = rhs.num / rhs.denom
Return x > y
End Operator
Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom
End Operator
Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean
Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom
End Operator
Public Overrides Function ToString() As String
If denom = 1 Then
Return num.ToString
Else
Return String.Format("{0}/{1}", num, denom)
End If
End Function
Public Overrides Function Equals(obj As Object) As Boolean
Dim frac = CType(obj, Frac)
Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom
End Function
End Class
Function Bernoulli(n As Integer) As Frac
If n < 0 Then
Throw New ArgumentException("n may not be negative or zero")
End If
Dim a(n + 1) As Frac
For m = 0 To n
a(m) = New Frac(1, m + 1)
For j = m To 1 Step -1
a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1)
Next
Next
If n <> 1 Then
Return a(0)
Else
Return -a(0)
End If
End Function
Function Binomial(n As Integer, k As Integer) As Integer
If n < 0 OrElse k < 0 OrElse n < k Then
Throw New ArgumentException()
End If
If n = 0 OrElse k = 0 Then
Return 1
End If
Dim num = 1
For i = k + 1 To n
num *= i
Next
Dim denom = 1
For i = 2 To n - k
denom *= i
Next
Return num \ denom
End Function
Function FaulhaberTriangle(p As Integer) As Frac()
Dim coeffs(p + 1) As Frac
For i = 1 To p + 1
coeffs(i - 1) = Frac.ZERO
Next
Dim q As New Frac(1, p + 1)
Dim sign = -1
For j = 0 To p
sign *= -1
coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j)
Next
Return coeffs
End Function
Sub Main()
For i = 1 To 10
Dim coeffs = FaulhaberTriangle(i - 1)
For Each coeff In coeffs
Console.Write("{0,5} ", coeff)
Next
Console.WriteLine()
Next
End Sub
End Module
| #include <stdbool.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
int binomial(int n, int k) {
int num, denom, i;
if (n < 0 || k < 0 || n < k) return -1;
if (n == 0 || k == 0) return 1;
num = 1;
for (i = k + 1; i <= n; ++i) {
num = num * i;
}
denom = 1;
for (i = 2; i <= n - k; ++i) {
denom *= i;
}
return num / denom;
}
int gcd(int a, int b) {
int temp;
while (b != 0) {
temp = a % b;
a = b;
b = temp;
}
return a;
}
typedef struct tFrac {
int num, denom;
} Frac;
Frac makeFrac(int n, int d) {
Frac result;
int g;
if (d == 0) {
result.num = 0;
result.denom = 0;
return result;
}
if (n == 0) {
d = 1;
} else if (d < 0) {
n = -n;
d = -d;
}
g = abs(gcd(n, d));
if (g > 1) {
n = n / g;
d = d / g;
}
result.num = n;
result.denom = d;
return result;
}
Frac negateFrac(Frac f) {
return makeFrac(-f.num, f.denom);
}
Frac subFrac(Frac lhs, Frac rhs) {
return makeFrac(lhs.num * rhs.denom - lhs.denom * rhs.num, rhs.denom * lhs.denom);
}
Frac multFrac(Frac lhs, Frac rhs) {
return makeFrac(lhs.num * rhs.num, lhs.denom * rhs.denom);
}
bool equalFrac(Frac lhs, Frac rhs) {
return (lhs.num == rhs.num) && (lhs.denom == rhs.denom);
}
bool lessFrac(Frac lhs, Frac rhs) {
return (lhs.num * rhs.denom) < (rhs.num * lhs.denom);
}
void printFrac(Frac f) {
char buffer[7];
int len;
if (f.denom != 1) {
snprintf(buffer, 7, "%d/%d", f.num, f.denom);
} else {
snprintf(buffer, 7, "%d", f.num);
}
len = 7 - strlen(buffer);
while (len-- > 0) {
putc(' ', stdout);
}
printf(buffer);
}
Frac bernoulli(int n) {
Frac a[16];
int j, m;
if (n < 0) {
a[0].num = 0;
a[0].denom = 0;
return a[0];
}
for (m = 0; m <= n; ++m) {
a[m] = makeFrac(1, m + 1);
for (j = m; j >= 1; --j) {
a[j - 1] = multFrac(subFrac(a[j - 1], a[j]), makeFrac(j, 1));
}
}
if (n != 1) {
return a[0];
}
return negateFrac(a[0]);
}
void faulhaber(int p) {
Frac q, *coeffs;
int j, sign;
coeffs = malloc(sizeof(Frac)*(p + 1));
q = makeFrac(1, p + 1);
sign = -1;
for (j = 0; j <= p; ++j) {
sign = -1 * sign;
coeffs[p - j] = multFrac(multFrac(multFrac(q, makeFrac(sign, 1)), makeFrac(binomial(p + 1, j), 1)), bernoulli(j));
}
for (j = 0; j <= p; ++j) {
printFrac(coeffs[j]);
}
printf("\n");
free(coeffs);
}
int main() {
int i;
for (i = 0; i < 10; ++i) {
faulhaber(i);
}
return 0;
}
|
Port the provided VB code into C while preserving the original functionality. | Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
| #include <stdlib.h>
#include <stdio.h>
int main(int argc, char* argv[])
{
int i;
(void) printf("This program is named %s.\n", argv[0]);
for (i = 1; i < argc; ++i)
(void) printf("the argument #%d is %s\n", i, argv[i]);
return EXIT_SUCCESS;
}
|
Produce a language-to-language conversion: from VB to C, same semantics. | Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
| #include <stdlib.h>
#include <stdio.h>
int main(int argc, char* argv[])
{
int i;
(void) printf("This program is named %s.\n", argv[0]);
for (i = 1; i < argc; ++i)
(void) printf("the argument #%d is %s\n", i, argv[i]);
return EXIT_SUCCESS;
}
|
Keep all operations the same but rewrite the snippet in C. | Function Run(args() as String) As Integer
For each arg As String In args
Stdout.WriteLine(arg)
Next
End Function
| #include <stdlib.h>
#include <stdio.h>
int main(int argc, char* argv[])
{
int i;
(void) printf("This program is named %s.\n", argv[0]);
for (i = 1; i < argc; ++i)
(void) printf("the argument #%d is %s\n", i, argv[i]);
return EXIT_SUCCESS;
}
|
Rewrite this program in C while keeping its functionality equivalent to the VB version. | Const wheel="ndeokgelw"
Sub print(s):
On Error Resume Next
WScript.stdout.WriteLine (s)
If err= &h80070006& Then WScript.Echo " Please run this script with CScript": WScript.quit
End Sub
Dim oDic
Set oDic = WScript.CreateObject("scripting.dictionary")
Dim cnt(127)
Dim fso
Set fso = WScript.CreateObject("Scripting.Filesystemobject")
Set ff=fso.OpenTextFile("unixdict.txt")
i=0
print "reading words of 3 or more letters"
While Not ff.AtEndOfStream
x=LCase(ff.ReadLine)
If Len(x)>=3 Then
If Not odic.exists(x) Then oDic.Add x,0
End If
Wend
print "remaining words: "& oDic.Count & vbcrlf
ff.Close
Set ff=Nothing
Set fso=Nothing
Set re=New RegExp
print "removing words with chars not in the wheel"
re.pattern="[^"& wheel &"]"
For Each w In oDic.Keys
If re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "ensuring the mandatory letter "& Mid(wheel,5,1) & " is present"
re.Pattern=Mid(wheel,5,1)
For Each w In oDic.Keys
If Not re.test(w) Then oDic.remove(w)
Next
print "remaining words: "& oDic.Count & vbcrlf
print "checking number of chars"
Dim nDic
Set nDic = WScript.CreateObject("scripting.dictionary")
For i=1 To Len(wheel)
x=Mid(wheel,i,1)
If nDic.Exists(x) Then
a=nDic(x)
nDic(x)=Array(a(0)+1,0)
Else
nDic.add x,Array(1,0)
End If
Next
For Each w In oDic.Keys
For Each c In nDic.Keys
ndic(c)=Array(nDic(c)(0),0)
Next
For ii = 1 To len(w)
c=Mid(w,ii,1)
a=nDic(c)
If (a(0)=a(1)) Then
oDic.Remove(w):Exit For
End If
nDic(c)=Array(a(0),a(1)+1)
Next
Next
print "Remaining words "& oDic.count
For Each w In oDic.Keys
print w
Next
| #include <stdbool.h>
#include <stdio.h>
#define MAX_WORD 80
#define LETTERS 26
bool is_letter(char c) { return c >= 'a' && c <= 'z'; }
int index(char c) { return c - 'a'; }
void word_wheel(const char* letters, char central, int min_length, FILE* dict) {
int max_count[LETTERS] = { 0 };
for (const char* p = letters; *p; ++p) {
char c = *p;
if (is_letter(c))
++max_count[index(c)];
}
char word[MAX_WORD + 1] = { 0 };
while (fgets(word, MAX_WORD, dict)) {
int count[LETTERS] = { 0 };
for (const char* p = word; *p; ++p) {
char c = *p;
if (c == '\n') {
if (p >= word + min_length && count[index(central)] > 0)
printf("%s", word);
} else if (is_letter(c)) {
int i = index(c);
if (++count[i] > max_count[i]) {
break;
}
} else {
break;
}
}
}
}
int main(int argc, char** argv) {
const char* dict = argc == 2 ? argv[1] : "unixdict.txt";
FILE* in = fopen(dict, "r");
if (in == NULL) {
perror(dict);
return 1;
}
word_wheel("ndeokgelw", 'k', 3, in);
fclose(in);
return 0;
}
|
Change the following VB code into C without altering its purpose. | DEFINT A(1 to 4) = {1, 2, 3, 4}
DEFINT B(1 to 4) = {10, 20, 30, 40}
Redim A(1 to 8) as integer
MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
| #include <stdlib.h>
#include <stdio.h>
#include <string.h>
#define ARRAY_CONCAT(TYPE, A, An, B, Bn) \
(TYPE *)array_concat((const void *)(A), (An), (const void *)(B), (Bn), sizeof(TYPE));
void *array_concat(const void *a, size_t an,
const void *b, size_t bn, size_t s)
{
char *p = malloc(s * (an + bn));
memcpy(p, a, an*s);
memcpy(p + an*s, b, bn*s);
return p;
}
const int a[] = { 1, 2, 3, 4, 5 };
const int b[] = { 6, 7, 8, 9, 0 };
int main(void)
{
unsigned int i;
int *c = ARRAY_CONCAT(int, a, 5, b, 5);
for(i = 0; i < 10; i++)
printf("%d\n", c[i]);
free(c);
return EXIT_SUCCCESS;
}
|
Port the provided VB code into C while preserving the original functionality. | Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
| #include <stdio.h>
#include <stdlib.h>
int main(void)
{
char str[BUFSIZ];
puts("Enter a string: ");
fgets(str, sizeof(str), stdin);
long num;
char buf[BUFSIZ];
do
{
puts("Enter 75000: ");
fgets(buf, sizeof(buf), stdin);
num = strtol(buf, NULL, 10);
} while (num != 75000);
return EXIT_SUCCESS;
}
|
Keep all operations the same but rewrite the snippet in C. | Public Sub text()
Debug.Print InputBox("Input a string")
Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long")
End Sub
| #include <stdio.h>
#include <stdlib.h>
int main(void)
{
char str[BUFSIZ];
puts("Enter a string: ");
fgets(str, sizeof(str), stdin);
long num;
char buf[BUFSIZ];
do
{
puts("Enter 75000: ");
fgets(buf, sizeof(buf), stdin);
num = strtol(buf, NULL, 10);
} while (num != 75000);
return EXIT_SUCCESS;
}
|
Can you help me rewrite this code in C instead of VB, keeping it the same logically? | Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
| #include<stdio.h>
#include<conio.h>
#include<math.h>
#include<dos.h>
typedef struct{
char str[3];
int key;
}note;
note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}};
int main(void)
{
int i=0;
while(!kbhit())
{
printf("\t%s",sequence[i].str);
sound(261.63*pow(2,sequence[i].key/12.0));
delay(sequence[i].key%12==0?500:1000);
i = (i+1)%8;
i==0?printf("\n"):printf("");
}
nosound();
return 0;
}
|
Translate this program into C but keep the logic exactly as in VB. | Option Explicit
Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long
Sub Musical_Scale()
Dim Fqs, i As Integer
Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528)
For i = LBound(Fqs) To UBound(Fqs)
Beep Fqs(i), 500
Next
End Sub
| #include<stdio.h>
#include<conio.h>
#include<math.h>
#include<dos.h>
typedef struct{
char str[3];
int key;
}note;
note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}};
int main(void)
{
int i=0;
while(!kbhit())
{
printf("\t%s",sequence[i].str);
sound(261.63*pow(2,sequence[i].key/12.0));
delay(sequence[i].key%12==0?500:1000);
i = (i+1)%8;
i==0?printf("\n"):printf("");
}
nosound();
return 0;
}
|
Port the provided VB code into C while preserving the original functionality. |
Option Explicit
Const maxWeight = 400
Dim DataList As Variant
Dim xList(64, 3) As Variant
Dim nItems As Integer
Dim s As String, xss As String
Dim xwei As Integer, xval As Integer, nn As Integer
Sub Main()
Dim i As Integer, j As Integer
DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _
"glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _
"cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _
"T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _
"waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _
"note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50)
nItems = (UBound(DataList) + 1) / 3
j = 0
For i = 1 To nItems
xList(i, 1) = DataList(j)
xList(i, 2) = DataList(j + 1)
xList(i, 3) = DataList(j + 2)
j = j + 3
Next i
s = ""
For i = 1 To nItems
s = s & Chr(i)
Next
nn = 0
Call ChoiceBin(1, "")
For i = 1 To Len(xss)
j = Asc(Mid(xss, i, 1))
Debug.Print xList(j, 1)
Next i
Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval
End Sub
Private Sub ChoiceBin(n As String, ss As String)
Dim r As String
Dim i As Integer, j As Integer, iwei As Integer, ival As Integer
Dim ipct As Integer
If n = Len(s) + 1 Then
iwei = 0: ival = 0
For i = 1 To Len(ss)
j = Asc(Mid(ss, i, 1))
iwei = iwei + xList(j, 2)
ival = ival + xList(j, 3)
Next
If iwei <= maxWeight And ival > xval Then
xss = ss: xwei = iwei: xval = ival
End If
Else
r = Mid(s, n, 1)
Call ChoiceBin(n + 1, ss & r)
Call ChoiceBin(n + 1, ss)
End If
End Sub
| #include <stdio.h>
#include <stdlib.h>
typedef struct {
char *name;
int weight;
int value;
} item_t;
item_t items[] = {
{"map", 9, 150},
{"compass", 13, 35},
{"water", 153, 200},
{"sandwich", 50, 160},
{"glucose", 15, 60},
{"tin", 68, 45},
{"banana", 27, 60},
{"apple", 39, 40},
{"cheese", 23, 30},
{"beer", 52, 10},
{"suntan cream", 11, 70},
{"camera", 32, 30},
{"T-shirt", 24, 15},
{"trousers", 48, 10},
{"umbrella", 73, 40},
{"waterproof trousers", 42, 70},
{"waterproof overclothes", 43, 75},
{"note-case", 22, 80},
{"sunglasses", 7, 20},
{"towel", 18, 12},
{"socks", 4, 50},
{"book", 30, 10},
};
int *knapsack (item_t *items, int n, int w) {
int i, j, a, b, *mm, **m, *s;
mm = calloc((n + 1) * (w + 1), sizeof (int));
m = malloc((n + 1) * sizeof (int *));
m[0] = mm;
for (i = 1; i <= n; i++) {
m[i] = &mm[i * (w + 1)];
for (j = 0; j <= w; j++) {
if (items[i - 1].weight > j) {
m[i][j] = m[i - 1][j];
}
else {
a = m[i - 1][j];
b = m[i - 1][j - items[i - 1].weight] + items[i - 1].value;
m[i][j] = a > b ? a : b;
}
}
}
s = calloc(n, sizeof (int));
for (i = n, j = w; i > 0; i--) {
if (m[i][j] > m[i - 1][j]) {
s[i - 1] = 1;
j -= items[i - 1].weight;
}
}
free(mm);
free(m);
return s;
}
int main () {
int i, n, tw = 0, tv = 0, *s;
n = sizeof (items) / sizeof (item_t);
s = knapsack(items, n, 400);
for (i = 0; i < n; i++) {
if (s[i]) {
printf("%-22s %5d %5d\n", items[i].name, items[i].weight, items[i].value);
tw += items[i].weight;
tv += items[i].value;
}
}
printf("%-22s %5d %5d\n", "totals:", tw, tv);
return 0;
}
|
Generate a C translation of this VB snippet without changing its computational steps. | Imports System.Math
Module Module1
Const MAXPRIME = 99
Const MAXPARENT = 99
Const NBRCHILDREN = 547100
Public Primes As New Collection()
Public PrimesR As New Collection()
Public Ancestors As New Collection()
Public Parents(MAXPARENT + 1) As Integer
Public CptDescendants(MAXPARENT + 1) As Integer
Public Children(NBRCHILDREN) As ChildStruct
Public iChildren As Integer
Public Delimiter As String = ", "
Public Structure ChildStruct
Public Child As Long
Public pLower As Integer
Public pHigher As Integer
End Structure
Sub Main()
Dim Parent As Short
Dim Sum As Short
Dim i As Short
Dim TotDesc As Integer = 0
Dim MidPrime As Integer
If GetPrimes(Primes, MAXPRIME) = vbFalse Then
Return
End If
For i = Primes.Count To 1 Step -1
PrimesR.Add(Primes.Item(i))
Next
MidPrime = PrimesR.Item(1) / 2
For Each Prime In PrimesR
Parents(Prime) = InsertChild(Parents(Prime), Prime)
CptDescendants(Prime) += 1
If Prime > MidPrime Then
Continue For
End If
For Parent = 1 To MAXPARENT
Sum = Parent + Prime
If Sum > MAXPARENT Then
Exit For
End If
If Parents(Parent) Then
InsertPreorder(Parents(Parent), Sum, Prime)
CptDescendants(Sum) += CptDescendants(Parent)
End If
Next
Next
RemoveFalseChildren()
If MAXPARENT > MAXPRIME Then
If GetPrimes(Primes, MAXPARENT) = vbFalse Then
Return
End If
End If
FileOpen(1, "Ancestors.txt", OpenMode.Output)
For Parent = 1 To MAXPARENT
GetAncestors(Parent)
PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString)
If Ancestors.Count Then
Print(1, "Ancestors: " & Ancestors.Item(1).ToString)
For i = 2 To Ancestors.Count
Print(1, ", " & Ancestors.Item(i).ToString)
Next
PrintLine(1)
Ancestors.Clear()
Else
PrintLine(1, "Ancestors: None")
End If
If CptDescendants(Parent) Then
PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString)
Delimiter = ""
PrintDescendants(Parents(Parent))
PrintLine(1)
TotDesc += CptDescendants(Parent)
Else
PrintLine(1, "Descendants: None")
End If
PrintLine(1)
Next
Primes.Clear()
PrimesR.Clear()
PrintLine(1, "Total descendants " & TotDesc.ToString)
PrintLine(1)
FileClose(1)
End Sub
Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short)
Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime)
If Children(_index).pLower Then
InsertPreorder(Children(_index).pLower, _sum, _prime)
End If
If Children(_index).pHigher Then
InsertPreorder(Children(_index).pHigher, _sum, _prime)
End If
Return Nothing
End Function
Function InsertChild(_index As Integer, _child As Long) As Integer
If _index Then
If _child <= Children(_index).Child Then
Children(_index).pLower = InsertChild(Children(_index).pLower, _child)
Else
Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child)
End If
Else
iChildren += 1
_index = iChildren
Children(_index).Child = _child
Children(_index).pLower = 0
Children(_index).pHigher = 0
End If
Return _index
End Function
Function RemoveFalseChildren()
Dim Exclusions As New Collection
Exclusions.Add(4)
For Each Prime In Primes
Exclusions.Add(Prime)
Next
For Each ex In Exclusions
Parents(ex) = Children(Parents(ex)).pHigher
CptDescendants(ex) -= 1
Next
Exclusions.Clear()
Return Nothing
End Function
Function GetAncestors(_child As Short)
Dim Child As Short = _child
Dim Parent As Short = 0
For Each Prime In Primes
If Child = 1 Then
Exit For
End If
While Child Mod Prime = 0
Child /= Prime
Parent += Prime
End While
Next
If Parent = _child Or _child = 1 Then
Return Nothing
End If
GetAncestors(Parent)
Ancestors.Add(Parent)
Return Nothing
End Function
Function PrintDescendants(_index As Integer)
If Children(_index).pLower Then
PrintDescendants(Children(_index).pLower)
End If
Print(1, Delimiter.ToString & Children(_index).Child.ToString)
Delimiter = ", "
If Children(_index).pHigher Then
PrintDescendants(Children(_index).pHigher)
End If
Return Nothing
End Function
Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean
Dim Value As Integer = 3
Dim Max As Integer
Dim Prime As Integer
If _maxPrime < 2 Then
Return vbFalse
End If
_primes.Add(2)
While Value <= _maxPrime
Max = Floor(Sqrt(Value))
For Each Prime In _primes
If Prime > Max Then
_primes.Add(Value)
Exit For
End If
If Value Mod Prime = 0 Then
Exit For
End If
Next
Value += 2
End While
Return vbTrue
End Function
End Module
| #include <math.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#define MAXPRIME 99
#define MAXPARENT 99
#define NBRPRIMES 30
#define NBRANCESTORS 10
FILE *FileOut;
char format[] = ", %lld";
int Primes[NBRPRIMES];
int iPrimes;
short Ancestors[NBRANCESTORS];
struct Children {
long long Child;
struct Children *pNext;
};
struct Children *Parents[MAXPARENT+1][2];
int CptDescendants[MAXPARENT+1];
long long MaxDescendant = (long long) pow(3.0, 33.0);
short GetParent(long long child);
struct Children *AppendChild(struct Children *node, long long child);
short GetAncestors(short child);
void PrintDescendants(struct Children *node);
int GetPrimes(int primes[], int maxPrime);
int main()
{
long long Child;
short i, Parent, Level;
int TotDesc = 0;
if ((iPrimes = GetPrimes(Primes, MAXPRIME)) < 0)
return 1;
for (Child = 1; Child <= MaxDescendant; Child++)
{
if (Parent = GetParent(Child))
{
Parents[Parent][1] = AppendChild(Parents[Parent][1], Child);
if (Parents[Parent][0] == NULL)
Parents[Parent][0] = Parents[Parent][1];
CptDescendants[Parent]++;
}
}
if (MAXPARENT > MAXPRIME)
if (GetPrimes(Primes, MAXPARENT) < 0)
return 1;
if (fopen_s(&FileOut, "Ancestors.txt", "w"))
return 1;
for (Parent = 1; Parent <= MAXPARENT; Parent++)
{
Level = GetAncestors(Parent);
fprintf(FileOut, "[%d] Level: %d\n", Parent, Level);
if (Level)
{
fprintf(FileOut, "Ancestors: %d", Ancestors[0]);
for (i = 1; i < Level; i++)
fprintf(FileOut, ", %d", Ancestors[i]);
}
else
fprintf(FileOut, "Ancestors: None");
if (CptDescendants[Parent])
{
fprintf(FileOut, "\nDescendants: %d\n", CptDescendants[Parent]);
strcpy_s(format, "%lld");
PrintDescendants(Parents[Parent][0]);
fprintf(FileOut, "\n");
}
else
fprintf(FileOut, "\nDescendants: None\n");
fprintf(FileOut, "\n");
TotDesc += CptDescendants[Parent];
}
fprintf(FileOut, "Total descendants %d\n\n", TotDesc);
if (fclose(FileOut))
return 1;
return 0;
}
short GetParent(long long child)
{
long long Child = child;
short Parent = 0;
short Index = 0;
while (Child > 1 && Parent <= MAXPARENT)
{
if (Index > iPrimes)
return 0;
while (Child % Primes[Index] == 0)
{
Child /= Primes[Index];
Parent += Primes[Index];
}
Index++;
}
if (Parent == child || Parent > MAXPARENT || child == 1)
return 0;
return Parent;
}
struct Children *AppendChild(struct Children *node, long long child)
{
static struct Children *NodeNew;
if (NodeNew = (struct Children *) malloc(sizeof(struct Children)))
{
NodeNew->Child = child;
NodeNew->pNext = NULL;
if (node != NULL)
node->pNext = NodeNew;
}
return NodeNew;
}
short GetAncestors(short child)
{
short Child = child;
short Parent = 0;
short Index = 0;
while (Child > 1)
{
while (Child % Primes[Index] == 0)
{
Child /= Primes[Index];
Parent += Primes[Index];
}
Index++;
}
if (Parent == child || child == 1)
return 0;
Index = GetAncestors(Parent);
Ancestors[Index] = Parent;
return ++Index;
}
void PrintDescendants(struct Children *node)
{
static struct Children *NodeCurr;
static struct Children *NodePrev;
NodeCurr = node;
NodePrev = NULL;
while (NodeCurr)
{
fprintf(FileOut, format, NodeCurr->Child);
strcpy_s(format, ", %lld");
NodePrev = NodeCurr;
NodeCurr = NodeCurr->pNext;
free(NodePrev);
}
return;
}
int GetPrimes(int primes[], int maxPrime)
{
if (maxPrime < 2)
return -1;
int Index = 0, Value = 1;
int Max, i;
primes[0] = 2;
while ((Value += 2) <= maxPrime)
{
Max = (int) floor(sqrt((double) Value));
for (i = 0; i <= Index; i++)
{
if (primes[i] > Max)
{
if (++Index >= NBRPRIMES)
return -1;
primes[Index] = Value;
break;
}
if (Value % primes[i] == 0)
break;
}
}
return Index;
}
|
Generate a C translation of this VB snippet without changing its computational steps. | Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
| #include<string.h>
#include<stdlib.h>
#include<stdio.h>
void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){
int i,j;
if(times==numSets){
printf("(");
for(i=0;i<times;i++){
printf("%d,",currentSet[i]);
}
printf("\b),");
}
else{
for(j=0;j<setLengths[times];j++){
currentSet[times] = sets[times][j];
cartesianProduct(sets,setLengths,currentSet,numSets,times+1);
}
}
}
void printSets(int** sets, int* setLengths, int numSets){
int i,j;
printf("\nNumber of sets : %d",numSets);
for(i=0;i<numSets+1;i++){
printf("\nSet %d : ",i+1);
for(j=0;j<setLengths[i];j++){
printf(" %d ",sets[i][j]);
}
}
}
void processInputString(char* str){
int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0;
char *token,*holder,*holderToken;
for(i=0;str[i]!=00;i++)
if(str[i]=='x')
numSets++;
if(numSets==0){
printf("\n%s",str);
return;
}
currentSet = (int*)calloc(sizeof(int),numSets + 1);
setLengths = (int*)calloc(sizeof(int),numSets + 1);
sets = (int**)malloc((numSets + 1)*sizeof(int*));
token = strtok(str,"x");
while(token!=NULL){
holder = (char*)malloc(strlen(token)*sizeof(char));
j = 0;
for(i=0;token[i]!=00;i++){
if(token[i]>='0' && token[i]<='9')
holder[j++] = token[i];
else if(token[i]==',')
holder[j++] = ' ';
}
holder[j] = 00;
setLength = 0;
for(i=0;holder[i]!=00;i++)
if(holder[i]==' ')
setLength++;
if(setLength==0 && strlen(holder)==0){
printf("\n{}");
return;
}
setLengths[counter] = setLength+1;
sets[counter] = (int*)malloc((1+setLength)*sizeof(int));
k = 0;
start = 0;
for(l=0;holder[l]!=00;l++){
if(holder[l+1]==' '||holder[l+1]==00){
holderToken = (char*)malloc((l+1-start)*sizeof(char));
strncpy(holderToken,holder + start,l+1-start);
sets[counter][k++] = atoi(holderToken);
start = l+2;
}
}
counter++;
token = strtok(NULL,"x");
}
printf("\n{");
cartesianProduct(sets,setLengths,currentSet,numSets + 1,0);
printf("\b}");
}
int main(int argC,char* argV[])
{
if(argC!=2)
printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]);
else
processInputString(argV[1]);
return 0;
}
|
Write the same code in C as shown below in VB. | Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
| #include<string.h>
#include<stdlib.h>
#include<stdio.h>
void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){
int i,j;
if(times==numSets){
printf("(");
for(i=0;i<times;i++){
printf("%d,",currentSet[i]);
}
printf("\b),");
}
else{
for(j=0;j<setLengths[times];j++){
currentSet[times] = sets[times][j];
cartesianProduct(sets,setLengths,currentSet,numSets,times+1);
}
}
}
void printSets(int** sets, int* setLengths, int numSets){
int i,j;
printf("\nNumber of sets : %d",numSets);
for(i=0;i<numSets+1;i++){
printf("\nSet %d : ",i+1);
for(j=0;j<setLengths[i];j++){
printf(" %d ",sets[i][j]);
}
}
}
void processInputString(char* str){
int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0;
char *token,*holder,*holderToken;
for(i=0;str[i]!=00;i++)
if(str[i]=='x')
numSets++;
if(numSets==0){
printf("\n%s",str);
return;
}
currentSet = (int*)calloc(sizeof(int),numSets + 1);
setLengths = (int*)calloc(sizeof(int),numSets + 1);
sets = (int**)malloc((numSets + 1)*sizeof(int*));
token = strtok(str,"x");
while(token!=NULL){
holder = (char*)malloc(strlen(token)*sizeof(char));
j = 0;
for(i=0;token[i]!=00;i++){
if(token[i]>='0' && token[i]<='9')
holder[j++] = token[i];
else if(token[i]==',')
holder[j++] = ' ';
}
holder[j] = 00;
setLength = 0;
for(i=0;holder[i]!=00;i++)
if(holder[i]==' ')
setLength++;
if(setLength==0 && strlen(holder)==0){
printf("\n{}");
return;
}
setLengths[counter] = setLength+1;
sets[counter] = (int*)malloc((1+setLength)*sizeof(int));
k = 0;
start = 0;
for(l=0;holder[l]!=00;l++){
if(holder[l+1]==' '||holder[l+1]==00){
holderToken = (char*)malloc((l+1-start)*sizeof(char));
strncpy(holderToken,holder + start,l+1-start);
sets[counter][k++] = atoi(holderToken);
start = l+2;
}
}
counter++;
token = strtok(NULL,"x");
}
printf("\n{");
cartesianProduct(sets,setLengths,currentSet,numSets + 1,0);
printf("\b}");
}
int main(int argC,char* argV[])
{
if(argC!=2)
printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]);
else
processInputString(argV[1]);
return 0;
}
|
Translate this program into C but keep the logic exactly as in VB. | Imports System.Runtime.CompilerServices
Module Module1
<Extension()>
Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T))
Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)}
Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item}))
End Function
Sub Main()
Dim empty(-1) As Integer
Dim list1 = {1, 2}
Dim list2 = {3, 4}
Dim list3 = {1776, 1789}
Dim list4 = {7, 12}
Dim list5 = {4, 14, 23}
Dim list6 = {0, 1}
Dim list7 = {1, 2, 3}
Dim list8 = {30}
Dim list9 = {500, 100}
For Each sequnceList As Integer()() In {
({list1, list2}),
({list2, list1}),
({list1, empty}),
({empty, list1}),
({list3, list4, list5, list6}),
({list7, list8, list9}),
({list7, empty, list9})
}
Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})")
Console.WriteLine($"{{{String.Join(", ", cart)}}}")
Next
End Sub
End Module
| #include<string.h>
#include<stdlib.h>
#include<stdio.h>
void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){
int i,j;
if(times==numSets){
printf("(");
for(i=0;i<times;i++){
printf("%d,",currentSet[i]);
}
printf("\b),");
}
else{
for(j=0;j<setLengths[times];j++){
currentSet[times] = sets[times][j];
cartesianProduct(sets,setLengths,currentSet,numSets,times+1);
}
}
}
void printSets(int** sets, int* setLengths, int numSets){
int i,j;
printf("\nNumber of sets : %d",numSets);
for(i=0;i<numSets+1;i++){
printf("\nSet %d : ",i+1);
for(j=0;j<setLengths[i];j++){
printf(" %d ",sets[i][j]);
}
}
}
void processInputString(char* str){
int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0;
char *token,*holder,*holderToken;
for(i=0;str[i]!=00;i++)
if(str[i]=='x')
numSets++;
if(numSets==0){
printf("\n%s",str);
return;
}
currentSet = (int*)calloc(sizeof(int),numSets + 1);
setLengths = (int*)calloc(sizeof(int),numSets + 1);
sets = (int**)malloc((numSets + 1)*sizeof(int*));
token = strtok(str,"x");
while(token!=NULL){
holder = (char*)malloc(strlen(token)*sizeof(char));
j = 0;
for(i=0;token[i]!=00;i++){
if(token[i]>='0' && token[i]<='9')
holder[j++] = token[i];
else if(token[i]==',')
holder[j++] = ' ';
}
holder[j] = 00;
setLength = 0;
for(i=0;holder[i]!=00;i++)
if(holder[i]==' ')
setLength++;
if(setLength==0 && strlen(holder)==0){
printf("\n{}");
return;
}
setLengths[counter] = setLength+1;
sets[counter] = (int*)malloc((1+setLength)*sizeof(int));
k = 0;
start = 0;
for(l=0;holder[l]!=00;l++){
if(holder[l+1]==' '||holder[l+1]==00){
holderToken = (char*)malloc((l+1-start)*sizeof(char));
strncpy(holderToken,holder + start,l+1-start);
sets[counter][k++] = atoi(holderToken);
start = l+2;
}
}
counter++;
token = strtok(NULL,"x");
}
printf("\n{");
cartesianProduct(sets,setLengths,currentSet,numSets + 1,0);
printf("\b}");
}
int main(int argC,char* argV[])
{
if(argC!=2)
printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]);
else
processInputString(argV[1]);
return 0;
}
|
Write the same algorithm in C as shown in this VB implementation. | dim _proper_divisors(100)
sub proper_divisors(n)
dim i
dim _proper_divisors_count = 0
if n <> 1 then
for i = 1 to (n \ 2)
if n %% i = 0 then
_proper_divisors_count = _proper_divisors_count + 1
_proper_divisors(_proper_divisors_count) = i
end if
next
end if
return _proper_divisors_count
end sub
sub show_proper_divisors(n, tabbed)
dim cnt = proper_divisors(n)
print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) ";
dim j
for j = 1 to cnt
if tabbed then
print str$(_proper_divisors(j)),
else
print str$(_proper_divisors(j));
end if
if (j < cnt) then print ",";
next
print
end sub
dim i
for i = 1 to 10
show_proper_divisors(i, false)
next
dim c
dim maxindex = 0
dim maxlength = 0
for t = 1 to 20000
c = proper_divisors(t)
if c > maxlength then
maxindex = t
maxlength = c
end if
next
print "A maximum at ";
show_proper_divisors(maxindex, false)
| #include <stdio.h>
#include <stdbool.h>
int proper_divisors(const int n, bool print_flag)
{
int count = 0;
for (int i = 1; i < n; ++i) {
if (n % i == 0) {
count++;
if (print_flag)
printf("%d ", i);
}
}
if (print_flag)
printf("\n");
return count;
}
int main(void)
{
for (int i = 1; i <= 10; ++i) {
printf("%d: ", i);
proper_divisors(i, true);
}
int max = 0;
int max_i = 1;
for (int i = 1; i <= 20000; ++i) {
int v = proper_divisors(i, false);
if (v >= max) {
max = v;
max_i = i;
}
}
printf("%d with %d divisors\n", max_i, max);
return 0;
}
|
Preserve the algorithm and functionality while converting the code from VB to C. | Module XMLOutput
Sub Main()
Dim charRemarks As New Dictionary(Of String, String)
charRemarks.Add("April", "Bubbly: I
charRemarks.Add("Tam O
charRemarks.Add("Emily", "Short & shrift")
Dim xml = <CharacterRemarks>
<%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %>
</CharacterRemarks>
Console.WriteLine(xml)
End Sub
End Module
| #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <libxml/parser.h>
#include <libxml/tree.h>
const char *names[] = {
"April", "Tam O'Shanter", "Emily", NULL
};
const char *remarks[] = {
"Bubbly: I'm > Tam and <= Emily",
"Burns: \"When chapman billies leave the street ...\"",
"Short & shrift", NULL
};
int main()
{
xmlDoc *doc = NULL;
xmlNode *root = NULL, *node;
const char **next;
int a;
doc = xmlNewDoc("1.0");
root = xmlNewNode(NULL, "CharacterRemarks");
xmlDocSetRootElement(doc, root);
for(next = names, a = 0; *next != NULL; next++, a++) {
node = xmlNewNode(NULL, "Character");
(void)xmlNewProp(node, "name", *next);
xmlAddChild(node, xmlNewText(remarks[a]));
xmlAddChild(root, node);
}
xmlElemDump(stdout, doc, root);
xmlFreeDoc(doc);
xmlCleanupParser();
return EXIT_SUCCESS;
}
|
Produce a functionally identical C code for the snippet given in VB. | Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
| #include <stdio.h>
#include <stdlib.h>
#include <math.h>
#include <plot.h>
#define NP 10
double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9};
double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0};
void minmax(double *x, double *y,
double *minx, double *maxx,
double *miny, double *maxy, int n)
{
int i;
*minx = *maxx = x[0];
*miny = *maxy = y[0];
for(i=1; i < n; i++) {
if ( x[i] < *minx ) *minx = x[i];
if ( x[i] > *maxx ) *maxx = x[i];
if ( y[i] < *miny ) *miny = y[i];
if ( y[i] > *maxy ) *maxy = y[i];
}
}
#define YLAB_HEIGHT_F 0.1
#define XLAB_WIDTH_F 0.2
#define XDIV (NP*1.0)
#define YDIV (NP*1.0)
#define EXTRA_W 0.01
#define EXTRA_H 0.01
#define DOTSCALE (1.0/150.0)
#define MAXLABLEN 32
#define PUSHSCALE(X,Y) pl_fscale((X),(Y))
#define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y))
#define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy)
int main()
{
int plotter, i;
double minx, miny, maxx, maxy;
double lx, ly;
double xticstep, yticstep, nx, ny;
double sx, sy;
char labs[MAXLABLEN+1];
plotter = pl_newpl("png", NULL, stdout, NULL);
if ( plotter < 0 ) exit(1);
pl_selectpl(plotter);
if ( pl_openpl() < 0 ) exit(1);
minmax(x, y, &minx, &maxx, &miny, &maxy, NP);
lx = maxx - minx;
ly = maxy - miny;
pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly,
ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly);
xticstep = (ceil(maxx) - floor(minx)) / XDIV;
yticstep = (ceil(maxy) - floor(miny)) / YDIV;
pl_flinewidth(0.25);
if ( lx < ly ) {
sx = lx/ly;
sy = 1.0;
} else {
sx = 1.0;
sy = ly/lx;
}
pl_erase();
pl_fbox(floor(minx), floor(miny),
ceil(maxx), ceil(maxy));
pl_fontname("HersheySerif");
for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) {
pl_fline(floor(minx), ny, ceil(maxx), ny);
snprintf(labs, MAXLABLEN, "%6.2lf", ny);
FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny);
PUSHSCALE(sx,sy);
pl_label(labs);
POPSCALE(sx,sy);
}
for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) {
pl_fline(nx, floor(miny), nx, ceil(maxy));
snprintf(labs, MAXLABLEN, "%6.2lf", nx);
FMOVESCALE(nx, floor(miny));
PUSHSCALE(sx,sy);
pl_ftextangle(-90);
pl_alabel('l', 'b', labs);
POPSCALE(sx,sy);
}
pl_fillcolorname("red");
pl_filltype(1);
for(i=0; i < NP; i++)
{
pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE,
x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE);
}
pl_flushpl();
pl_closepl();
}
|
Convert the following code from VB to C, ensuring the logic remains intact. | Private Sub plot_coordinate_pairs(x As Variant, y As Variant)
Dim chrt As Chart
Set chrt = ActiveSheet.Shapes.AddChart.Chart
With chrt
.ChartType = xlLine
.HasLegend = False
.HasTitle = True
.ChartTitle.Text = "Time"
.SeriesCollection.NewSeries
.SeriesCollection.Item(1).XValues = x
.SeriesCollection.Item(1).Values = y
.Axes(xlValue, xlPrimary).HasTitle = True
.Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds"
End With
End Sub
Public Sub main()
x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}]
y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}]
plot_coordinate_pairs x, y
End Sub
| #include <stdio.h>
#include <stdlib.h>
#include <math.h>
#include <plot.h>
#define NP 10
double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9};
double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0};
void minmax(double *x, double *y,
double *minx, double *maxx,
double *miny, double *maxy, int n)
{
int i;
*minx = *maxx = x[0];
*miny = *maxy = y[0];
for(i=1; i < n; i++) {
if ( x[i] < *minx ) *minx = x[i];
if ( x[i] > *maxx ) *maxx = x[i];
if ( y[i] < *miny ) *miny = y[i];
if ( y[i] > *maxy ) *maxy = y[i];
}
}
#define YLAB_HEIGHT_F 0.1
#define XLAB_WIDTH_F 0.2
#define XDIV (NP*1.0)
#define YDIV (NP*1.0)
#define EXTRA_W 0.01
#define EXTRA_H 0.01
#define DOTSCALE (1.0/150.0)
#define MAXLABLEN 32
#define PUSHSCALE(X,Y) pl_fscale((X),(Y))
#define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y))
#define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy)
int main()
{
int plotter, i;
double minx, miny, maxx, maxy;
double lx, ly;
double xticstep, yticstep, nx, ny;
double sx, sy;
char labs[MAXLABLEN+1];
plotter = pl_newpl("png", NULL, stdout, NULL);
if ( plotter < 0 ) exit(1);
pl_selectpl(plotter);
if ( pl_openpl() < 0 ) exit(1);
minmax(x, y, &minx, &maxx, &miny, &maxy, NP);
lx = maxx - minx;
ly = maxy - miny;
pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly,
ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly);
xticstep = (ceil(maxx) - floor(minx)) / XDIV;
yticstep = (ceil(maxy) - floor(miny)) / YDIV;
pl_flinewidth(0.25);
if ( lx < ly ) {
sx = lx/ly;
sy = 1.0;
} else {
sx = 1.0;
sy = ly/lx;
}
pl_erase();
pl_fbox(floor(minx), floor(miny),
ceil(maxx), ceil(maxy));
pl_fontname("HersheySerif");
for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) {
pl_fline(floor(minx), ny, ceil(maxx), ny);
snprintf(labs, MAXLABLEN, "%6.2lf", ny);
FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny);
PUSHSCALE(sx,sy);
pl_label(labs);
POPSCALE(sx,sy);
}
for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) {
pl_fline(nx, floor(miny), nx, ceil(maxy));
snprintf(labs, MAXLABLEN, "%6.2lf", nx);
FMOVESCALE(nx, floor(miny));
PUSHSCALE(sx,sy);
pl_ftextangle(-90);
pl_alabel('l', 'b', labs);
POPSCALE(sx,sy);
}
pl_fillcolorname("red");
pl_filltype(1);
for(i=0; i < NP; i++)
{
pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE,
x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE);
}
pl_flushpl();
pl_closepl();
}
|
Please provide an equivalent version of this VB code in C. | text = "I need more coffee!!!"
Set regex = New RegExp
regex.Global = True
regex.Pattern = "\s"
If regex.Test(text) Then
WScript.StdOut.Write regex.Replace(text,vbCrLf)
Else
WScript.StdOut.Write "No matching pattern"
End If
| #include <stdio.h>
#include <stdlib.h>
#include <sys/types.h>
#include <regex.h>
#include <string.h>
int main()
{
regex_t preg;
regmatch_t substmatch[1];
const char *tp = "string$";
const char *t1 = "this is a matching string";
const char *t2 = "this is not a matching string!";
const char *ss = "istyfied";
regcomp(&preg, "string$", REG_EXTENDED);
printf("'%s' %smatched with '%s'\n", t1,
(regexec(&preg, t1, 0, NULL, 0)==0) ? "" : "did not ", tp);
printf("'%s' %smatched with '%s'\n", t2,
(regexec(&preg, t2, 0, NULL, 0)==0) ? "" : "did not ", tp);
regfree(&preg);
regcomp(&preg, "a[a-z]+", REG_EXTENDED);
if ( regexec(&preg, t1, 1, substmatch, 0) == 0 )
{
char *ns = malloc(substmatch[0].rm_so + 1 + strlen(ss) +
(strlen(t1) - substmatch[0].rm_eo) + 2);
memcpy(ns, t1, substmatch[0].rm_so+1);
memcpy(&ns[substmatch[0].rm_so], ss, strlen(ss));
memcpy(&ns[substmatch[0].rm_so+strlen(ss)], &t1[substmatch[0].rm_eo],
strlen(&t1[substmatch[0].rm_eo]));
ns[ substmatch[0].rm_so + strlen(ss) +
strlen(&t1[substmatch[0].rm_eo]) ] = 0;
printf("mod string: '%s'\n", ns);
free(ns);
} else {
printf("the string '%s' is the same: no matching!\n", t1);
}
regfree(&preg);
return 0;
}
|
Ensure the translated C code behaves exactly like the original VB snippet. | Set dict = CreateObject("Scripting.Dictionary")
os = Array("Windows", "Linux", "MacOS")
owner = Array("Microsoft", "Linus Torvalds", "Apple")
For n = 0 To 2
dict.Add os(n), owner(n)
Next
MsgBox dict.Item("Linux")
MsgBox dict.Item("MacOS")
MsgBox dict.Item("Windows")
| #include <stdio.h>
#include <stdlib.h>
#include <string.h>
#define KeyType const char *
#define ValType int
#define HASH_SIZE 4096
unsigned strhashkey( const char * key, int max)
{
unsigned h=0;
unsigned hl, hr;
while(*key) {
h += *key;
hl= 0x5C5 ^ (h&0xfff00000 )>>18;
hr =(h&0x000fffff );
h = hl ^ hr ^ *key++;
}
return h % max;
}
typedef struct sHme {
KeyType key;
ValType value;
struct sHme *link;
} *MapEntry;
typedef struct he {
MapEntry first, last;
} HashElement;
HashElement hash[HASH_SIZE];
typedef void (*KeyCopyF)(KeyType *kdest, KeyType ksrc);
typedef void (*ValCopyF)(ValType *vdest, ValType vsrc);
typedef unsigned (*KeyHashF)( KeyType key, int upperBound );
typedef int (*KeyCmprF)(KeyType key1, KeyType key2);
void HashAddH( KeyType key, ValType value,
KeyCopyF copyKey, ValCopyF copyVal, KeyHashF hashKey, KeyCmprF keySame )
{
unsigned hix = (*hashKey)(key, HASH_SIZE);
MapEntry m_ent;
for (m_ent= hash[hix].first;
m_ent && !(*keySame)(m_ent->key,key); m_ent=m_ent->link);
if (m_ent) {
(*copyVal)(&m_ent->value, value);
}
else {
MapEntry last;
MapEntry hme = malloc(sizeof(struct sHme));
(*copyKey)(&hme->key, key);
(*copyVal)(&hme->value, value);
hme->link = NULL;
last = hash[hix].last;
if (last) {
last->link = hme;
}
else
hash[hix].first = hme;
hash[hix].last = hme;
}
}
int HashGetH(ValType *val, KeyType key, KeyHashF hashKey, KeyCmprF keySame )
{
unsigned hix = (*hashKey)(key, HASH_SIZE);
MapEntry m_ent;
for (m_ent= hash[hix].first;
m_ent && !(*keySame)(m_ent->key,key); m_ent=m_ent->link);
if (m_ent) {
*val = m_ent->value;
}
return (m_ent != NULL);
}
void copyStr(const char**dest, const char *src)
{
*dest = strdup(src);
}
void copyInt( int *dest, int src)
{
*dest = src;
}
int strCompare( const char *key1, const char *key2)
{
return strcmp(key1, key2) == 0;
}
void HashAdd( KeyType key, ValType value )
{
HashAddH( key, value, ©Str, ©Int, &strhashkey, &strCompare);
}
int HashGet(ValType *val, KeyType key)
{
return HashGetH( val, key, &strhashkey, &strCompare);
}
int main()
{
static const char * keyList[] = {"red","orange","yellow","green", "blue", "violet" };
static int valuList[] = {1,43,640, 747, 42, 42};
int ix;
for (ix=0; ix<6; ix++) {
HashAdd(keyList[ix], valuList[ix]);
}
return 0;
}
|
Port the following code from VB to C with equivalent syntax and logic. | Public Class Main
Inherits System.Windows.Forms.Form
Public Sub New()
Me.FormBorderStyle = FormBorderStyle.None
Me.WindowState = FormWindowState.Maximized
End Sub
Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load
Dim Index As Integer
Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White}
Dim Height = (Me.ClientSize.Height / 4) + 1
For y = 1 To 4
Dim Top = Me.ClientSize.Height / 4 * (y - 1)
For x = 0 To Me.ClientSize.Width Step y
If Index = 6 Then Index = 0 Else Index += 1
Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)})
Next
Next
End Sub
End Class
| #include<graphics.h>
#include<conio.h>
#define sections 4
int main()
{
int d=DETECT,m,maxX,maxY,x,y,colour=0,increment=1;
initgraph(&d,&m,"c:/turboc3/bgi");
maxX = getmaxx();
maxY = getmaxy();
for(y=0;y<maxY;y+=maxY/sections)
{
for(x=0;x<maxX;x+=increment)
{
setfillstyle(SOLID_FILL,(colour++)%16);
bar(x,y,x+increment,y+maxY/sections);
}
increment++;
colour = 0;
}
getch();
closegraph();
return 0;
}
|
Write the same algorithm in C as shown in this VB implementation. |
Function cocktailShakerSort(ByVal A As Variant) As Variant
beginIdx = LBound(A)
endIdx = UBound(A) - 1
Do While beginIdx <= endIdx
newBeginIdx = endIdx
newEndIdx = beginIdx
For ii = beginIdx To endIdx
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newEndIdx = ii
End If
Next ii
endIdx = newEndIdx - 1
For ii = endIdx To beginIdx Step -1
If A(ii) > A(ii + 1) Then
tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp
newBeginIdx = ii
End If
Next ii
beginIdx = newBeginIdx + 1
Loop
cocktailShakerSort = A
End Function
Public Sub main()
Dim B(20) As Variant
For i = LBound(B) To UBound(B)
B(i) = Int(Rnd() * 100)
Next i
Debug.Print Join(B, ", ")
Debug.Print Join(cocktailShakerSort(B), ", ")
End Sub
| #include <stdio.h>
#include <string.h>
void swap(char* p1, char* p2, size_t size) {
for (; size-- > 0; ++p1, ++p2) {
char tmp = *p1;
*p1 = *p2;
*p2 = tmp;
}
}
void cocktail_shaker_sort(void* base, size_t count, size_t size,
int (*cmp)(const void*, const void*)) {
char* begin = base;
char* end = base + size * count;
if (end == begin)
return;
for (end -= size; begin < end; ) {
char* new_begin = end;
char* new_end = begin;
for (char* p = begin; p < end; p += size) {
char* q = p + size;
if (cmp(p, q) > 0) {
swap(p, q, size);
new_end = p;
}
}
end = new_end;
for (char* p = end; p > begin; p -= size) {
char* q = p - size;
if (cmp(q, p) > 0) {
swap(p, q, size);
new_begin = p;
}
}
begin = new_begin;
}
}
int string_compare(const void* p1, const void* p2) {
const char* const* s1 = p1;
const char* const* s2 = p2;
return strcmp(*s1, *s2);
}
void print(const char** a, size_t len) {
for (size_t i = 0; i < len; ++i)
printf("%s ", a[i]);
printf("\n");
}
int main() {
const char* a[] = { "one", "two", "three", "four", "five",
"six", "seven", "eight" };
const size_t len = sizeof(a)/sizeof(a[0]);
printf("before: ");
print(a, len);
cocktail_shaker_sort(a, len, sizeof(char*), string_compare);
printf("after: ");
print(a, len);
return 0;
}
|
Generate an equivalent C version of this VB code. | option explicit
const dt = 0.15
const length=23
dim ans0:ans0=chr(27)&"["
dim Veloc,Accel,angle,olr,olc,r,c
const r0=1
const c0=40
cls
angle=0.7
while 1
wscript.sleep(50)
Accel = -.9 * sin(Angle)
Veloc = Veloc + Accel * dt
Angle = Angle + Veloc * dt
r = r0 + int(cos(Angle) * Length)
c = c0+ int(2*sin(Angle) * Length)
cls
draw_line r,c,r0,c0
toxy r,c,"O"
olr=r :olc=c
wend
sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub
sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub
Sub draw_line(r1,c1, r2,c2)
Dim x,y,xf,yf,dx,dy,sx,sy,err,err2
x =r1 : y =c1
xf=r2 : yf=c2
dx=Abs(xf-x) : dy=Abs(yf-y)
If x<xf Then sx=+1: Else sx=-1
If y<yf Then sy=+1: Else sy=-1
err=dx-dy
Do
toxy x,y,"."
If x=xf And y=yf Then Exit Do
err2=err+err
If err2>-dy Then err=err-dy: x=x+sx
If err2< dx Then err=err+dx: y=y+sy
Loop
End Sub
| #include <stdlib.h>
#include <math.h>
#include <GL/glut.h>
#include <GL/gl.h>
#include <sys/time.h>
#define length 5
#define g 9.8
double alpha, accl, omega = 0, E;
struct timeval tv;
double elappsed() {
struct timeval now;
gettimeofday(&now, 0);
int ret = (now.tv_sec - tv.tv_sec) * 1000000
+ now.tv_usec - tv.tv_usec;
tv = now;
return ret / 1.e6;
}
void resize(int w, int h)
{
glViewport(0, 0, w, h);
glMatrixMode(GL_PROJECTION);
glLoadIdentity();
glMatrixMode(GL_MODELVIEW);
glLoadIdentity();
glOrtho(0, w, h, 0, -1, 1);
}
void render()
{
double x = 320 + 300 * sin(alpha), y = 300 * cos(alpha);
resize(640, 320);
glClear(GL_COLOR_BUFFER_BIT);
glBegin(GL_LINES);
glVertex2d(320, 0);
glVertex2d(x, y);
glEnd();
glFlush();
double us = elappsed();
alpha += (omega + us * accl / 2) * us;
omega += accl * us;
if (length * g * (1 - cos(alpha)) >= E) {
alpha = (alpha < 0 ? -1 : 1) * acos(1 - E / length / g);
omega = 0;
}
accl = -g / length * sin(alpha);
}
void init_gfx(int *c, char **v)
{
glutInit(c, v);
glutInitDisplayMode(GLUT_RGB);
glutInitWindowSize(640, 320);
glutIdleFunc(render);
glutCreateWindow("Pendulum");
}
int main(int c, char **v)
{
alpha = 4 * atan2(1, 1) / 2.1;
E = length * g * (1 - cos(alpha));
accl = -g / length * sin(alpha);
omega = 0;
gettimeofday(&tv, 0);
init_gfx(&c, v);
glutMainLoop();
return 0;
}
|
Generate an equivalent C version of this VB code. | Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
| int gray_encode(int n) {
return n ^ (n >> 1);
}
int gray_decode(int n) {
int p = n;
while (n >>= 1) p ^= n;
return p;
}
|
Write a version of this VB function in C with identical behavior. | Function Encoder(ByVal n)
Encoder = n Xor (n \ 2)
End Function
Function Decoder(ByVal n)
Dim g : g = 0
Do While n > 0
g = g Xor n
n = n \ 2
Loop
Decoder = g
End Function
Function Dec2bin(ByVal n, ByVal length)
Dim i, strbin : strbin = ""
For i = 1 to 5
strbin = (n Mod 2) & strbin
n = n \ 2
Next
Dec2Bin = strbin
End Function
WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary")
For i = 0 to 31
encoded = Encoder(i)
decoded = Decoder(encoded)
WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5))
Next
| int gray_encode(int n) {
return n ^ (n >> 1);
}
int gray_decode(int n) {
int p = n;
while (n >>= 1) p ^= n;
return p;
}
|
Port the provided VB code into C while preserving the original functionality. | class playingcard
dim suit
dim pips
end class
class carddeck
private suitnames
private pipnames
private cardno
private deck(52)
private nTop
sub class_initialize
dim suit
dim pips
suitnames = split("H,D,C,S",",")
pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",")
cardno = 0
for suit = 1 to 4
for pips = 1 to 13
set deck(cardno) = new playingcard
deck(cardno).suit = suitnames(suit-1)
deck(cardno).pips = pipnames(pips-1)
cardno = cardno + 1
next
next
nTop = 0
end sub
public sub showdeck
dim a
redim a(51-nTop)
for i = nTop to 51
a(i) = deck(i).pips & deck(i).suit
next
wscript.echo join( a, ", ")
end sub
public sub shuffle
dim r
randomize timer
for i = nTop to 51
r = int( rnd * ( 52 - nTop ) )
if r <> i then
objswap deck(i),deck(r)
end if
next
end sub
public function deal()
set deal = deck( nTop )
nTop = nTop + 1
end function
public property get cardsRemaining
cardsRemaining = 52 - nTop
end property
private sub objswap( a, b )
dim tmp
set tmp = a
set a = b
set b = tmp
end sub
end class
| #include <stdio.h>
#include <stdlib.h>
#include <locale.h>
int locale_ok = 0;
wchar_t s_suits[] = L"♠♥♦♣";
const char *s_suits_ascii[] = { "S", "H", "D", "C" };
const char *s_nums[] = { "WHAT",
"A", "2", "3", "4", "5", "6", "7", "8", "9", "10", "J", "Q", "K",
"OVERFLOW"
};
typedef struct { int suit, number, _s; } card_t, *card;
typedef struct { int n; card_t cards[52]; } deck_t, *deck;
void show_card(card c)
{
if (locale_ok)
printf(" %lc%s", s_suits[c->suit], s_nums[c->number]);
else
printf(" %s%s", s_suits_ascii[c->suit], s_nums[c->number]);
}
deck new_deck()
{
int i, j, k;
deck d = malloc(sizeof(deck_t));
d->n = 52;
for (i = k = 0; i < 4; i++)
for (j = 1; j <= 13; j++, k++) {
d->cards[k].suit = i;
d->cards[k].number = j;
}
return d;
}
void show_deck(deck d)
{
int i;
printf("%d cards:", d->n);
for (i = 0; i < d->n; i++)
show_card(d->cards + i);
printf("\n");
}
int cmp_card(const void *a, const void *b)
{
int x = ((card)a)->_s, y = ((card)b)->_s;
return x < y ? -1 : x > y;
}
card deal_card(deck d)
{
if (!d->n) return 0;
return d->cards + --d->n;
}
void shuffle_deck(deck d)
{
int i;
for (i = 0; i < d->n; i++)
d->cards[i]._s = rand();
qsort(d->cards, d->n, sizeof(card_t), cmp_card);
}
int main()
{
int i, j;
deck d = new_deck();
locale_ok = (0 != setlocale(LC_CTYPE, ""));
printf("New deck, "); show_deck(d);
printf("\nShuffle and deal to three players:\n");
shuffle_deck(d);
for (i = 0; i < 3; i++) {
for (j = 0; j < 5; j++)
show_card(deal_card(d));
printf("\n");
}
printf("Left in deck "); show_deck(d);
return 0;
}
|
Write the same code in C as shown below in VB. | Option Base {0|1}
| char foo()
{
char array[5] = {3,6,9,12,15};
return array[2];
}
|
Change the programming language of this snippet from VB to C without modifying what it does. | Const Order = 4
Function InCarpet(ByVal x As Integer, ByVal y As Integer)
Do While x <> 0 And y <> 0
If x Mod 3 = 1 And y Mod 3 = 1 Then
InCarpet = " "
Exit Function
End If
x = x \ 3
y = y \ 3
Loop
InCarpet = "#"
End Function
Public Sub sierpinski_carpet()
Dim i As Integer, j As Integer
For i = 0 To 3 ^ Order - 1
For j = 0 To 3 ^ Order - 1
Debug.Print InCarpet(i, j);
Next j
Debug.Print
Next i
End Sub
| #include <stdio.h>
int main()
{
int i, j, dim, d;
int depth = 3;
for (i = 0, dim = 1; i < depth; i++, dim *= 3);
for (i = 0; i < dim; i++) {
for (j = 0; j < dim; j++) {
for (d = dim / 3; d; d /= 3)
if ((i % (d * 3)) / d == 1 && (j % (d * 3)) / d == 1)
break;
printf(d ? " " : "##");
}
printf("\n");
}
return 0;
}
|
Translate the given VB code snippet into C without altering its behavior. | Private Function Knuth(a As Variant) As Variant
Dim t As Variant, i As Integer
If Not IsMissing(a) Then
For i = UBound(a) To LBound(a) + 1 Step -1
j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a))
t = a(i)
a(i) = a(j)
a(j) = t
Next i
End If
Knuth = a
End Function
Private Function inOrder(s As Variant)
i = 2
Do While i <= UBound(s)
If s(i) < s(i - 1) Then
inOrder = False
Exit Function
End If
i = i + 1
Loop
inOrder = True
End Function
Private Function bogosort(ByVal s As Variant) As Variant
Do While Not inOrder(s)
Debug.Print Join(s, ", ")
s = Knuth(s)
Loop
bogosort = s
End Function
Public Sub main()
Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ")
End Sub
| #include <stdio.h>
#include <stdlib.h>
#include <stdbool.h>
bool is_sorted(int *a, int n)
{
while ( --n >= 1 ) {
if ( a[n] < a[n-1] ) return false;
}
return true;
}
void shuffle(int *a, int n)
{
int i, t, r;
for(i=0; i < n; i++) {
t = a[i];
r = rand() % n;
a[i] = a[r];
a[r] = t;
}
}
void bogosort(int *a, int n)
{
while ( !is_sorted(a, n) ) shuffle(a, n);
}
int main()
{
int numbers[] = { 1, 10, 9, 7, 3, 0 };
int i;
bogosort(numbers, 6);
for (i=0; i < 6; i++) printf("%d ", numbers[i]);
printf("\n");
}
|
Keep all operations the same but rewrite the snippet in C. | Private Sub ivp_euler(f As String, y As Double, step As Integer, end_t As Integer)
Dim t As Integer
Debug.Print " Step "; step; ": ",
Do While t <= end_t
If t Mod 10 = 0 Then Debug.Print Format(y, "0.000"),
y = y + step * Application.Run(f, y)
t = t + step
Loop
Debug.Print
End Sub
Sub analytic()
Debug.Print " Time: ",
For t = 0 To 100 Step 10
Debug.Print " "; t,
Next t
Debug.Print
Debug.Print "Analytic: ",
For t = 0 To 100 Step 10
Debug.Print Format(20 + 80 * Exp(-0.07 * t), "0.000"),
Next t
Debug.Print
End Sub
Private Function cooling(temp As Double) As Double
cooling = -0.07 * (temp - 20)
End Function
Public Sub euler_method()
Dim r_cooling As String
r_cooling = "cooling"
analytic
ivp_euler r_cooling, 100, 2, 100
ivp_euler r_cooling, 100, 5, 100
ivp_euler r_cooling, 100, 10, 100
End Sub
| #include <stdio.h>
#include <math.h>
typedef double (*deriv_f)(double, double);
#define FMT " %7.3f"
void ivp_euler(deriv_f f, double y, int step, int end_t)
{
int t = 0;
printf(" Step %2d: ", (int)step);
do {
if (t % 10 == 0) printf(FMT, y);
y += step * f(t, y);
} while ((t += step) <= end_t);
printf("\n");
}
void analytic()
{
double t;
printf(" Time: ");
for (t = 0; t <= 100; t += 10) printf(" %7g", t);
printf("\nAnalytic: ");
for (t = 0; t <= 100; t += 10)
printf(FMT, 20 + 80 * exp(-0.07 * t));
printf("\n");
}
double cooling(double t, double temp)
{
return -0.07 * (temp - 20);
}
int main()
{
analytic();
ivp_euler(cooling, 100, 2, 100);
ivp_euler(cooling, 100, 5, 100);
ivp_euler(cooling, 100, 10, 100);
return 0;
}
|
Change the following VB code into C without altering its purpose. | Sub Main()
Dim i&, c&, j#, s$
Const N& = 1000000
s = "values for n in the range 1 to 22 : "
For i = 1 To 22
s = s & ns(i) & ", "
Next
For i = 1 To N
j = Sqr(ns(i))
If j = CInt(j) Then c = c + 1
Next
Debug.Print s
Debug.Print c & " squares less than " & N
End Sub
Private Function ns(l As Long) As Long
ns = l + Int(1 / 2 + Sqr(l))
End Function
| #include <math.h>
#include <stdio.h>
#include <assert.h>
int nonsqr(int n) {
return n + (int)(0.5 + sqrt(n));
}
int main() {
int i;
for (i = 1; i < 23; i++)
printf("%d ", nonsqr(i));
printf("\n");
for (i = 1; i < 1000000; i++) {
double j = sqrt(nonsqr(i));
assert(j != floor(j));
}
return 0;
}
|
Convert this VB snippet to C and keep its semantics consistent. | Sub Main()
Dim i&, c&, j#, s$
Const N& = 1000000
s = "values for n in the range 1 to 22 : "
For i = 1 To 22
s = s & ns(i) & ", "
Next
For i = 1 To N
j = Sqr(ns(i))
If j = CInt(j) Then c = c + 1
Next
Debug.Print s
Debug.Print c & " squares less than " & N
End Sub
Private Function ns(l As Long) As Long
ns = l + Int(1 / 2 + Sqr(l))
End Function
| #include <math.h>
#include <stdio.h>
#include <assert.h>
int nonsqr(int n) {
return n + (int)(0.5 + sqrt(n));
}
int main() {
int i;
for (i = 1; i < 23; i++)
printf("%d ", nonsqr(i));
printf("\n");
for (i = 1; i < 1000000; i++) {
double j = sqrt(nonsqr(i));
assert(j != floor(j));
}
return 0;
}
|
Translate the given VB code snippet into C without altering its behavior. | Public Sub substring()
sentence = "the last thing the man said was the"
n = 10: m = 5
Debug.Print Mid(sentence, n, 5)
Debug.Print Right(sentence, Len(sentence) - n + 1)
Debug.Print Left(sentence, Len(sentence) - 1)
k = InStr(1, sentence, "m")
Debug.Print Mid(sentence, k, 5)
k = InStr(1, sentence, "aid")
Debug.Print Mid(sentence, k, 5)
End Sub
|
#define _CRT_SECURE_NO_WARNINGS
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
void putm(char* string, size_t m)
{
while(*string && m--)
putchar(*string++);
}
int main(void)
{
char string[] =
"Programs for other encodings (such as 8-bit ASCII, or EUC-JP)."
int n = 3;
int m = 4;
char knownCharacter = '(';
char knownSubstring[] = "encodings";
putm(string+n-1, m ); putchar('\n');
puts(string+n+1); putchar('\n');
putm(string, strlen(string)-1); putchar('\n');
putm(strchr(string, knownCharacter), m ); putchar('\n');
putm(strstr(string, knownSubstring), m ); putchar('\n');
return EXIT_SUCCESS;
}
|
Transform the following VB implementation into C, maintaining the same output and logic. | Function JortSort(s)
JortSort = True
arrPreSort = Split(s,",")
Set arrSorted = CreateObject("System.Collections.ArrayList")
For i = 0 To UBound(arrPreSort)
arrSorted.Add(arrPreSort(i))
Next
arrSorted.Sort()
For j = 0 To UBound(arrPreSort)
If arrPreSort(j) <> arrSorted(j) Then
JortSort = False
Exit For
End If
Next
End Function
WScript.StdOut.Write JortSort("1,2,3,4,5")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("1,2,3,5,4")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,b,c")
WScript.StdOut.WriteLine
WScript.StdOut.Write JortSort("a,c,b")
| #include <stdio.h>
#include <stdlib.h>
int number_of_digits(int x){
int NumberOfDigits;
for(NumberOfDigits=0;x!=0;NumberOfDigits++){
x=x/10;
}
return NumberOfDigits;
}
int* convert_array(char array[], int NumberOfElements)
{
int *convertedArray=malloc(NumberOfElements*sizeof(int));
int originalElement, convertedElement;
for(convertedElement=0, originalElement=0; convertedElement<NumberOfElements; convertedElement++)
{
convertedArray[convertedElement]=atoi(&array[originalElement]);
originalElement+=number_of_digits(convertedArray[convertedElement])+1;
}
return convertedArray;
}
int isSorted(int array[], int numberOfElements){
int sorted=1;
for(int counter=0;counter<numberOfElements;counter++){
if(counter!=0 && array[counter-1]>array[counter]) sorted--;
}
return sorted;
}
int main(int argc, char* argv[])
{
int* convertedArray;
convertedArray=convert_array(*(argv+1), argc-1);
if(isSorted(convertedArray, argc-1)==1) printf("Did you forgot to turn on your brain?! This array is already sorted!\n");
else if(argc-1<=10) printf("Am I really supposed to sort this? Sort it by yourself!\n");
else printf("Am I really supposed to sort this? Bhahahaha!\n");
free(convertedArray);
return 0;
}
|
Port the provided VB code into C while preserving the original functionality. | Public Function Leap_year(year As Integer) As Boolean
Leap_year = (Month(DateSerial(year, 2, 29)) = 2)
End Function
| #include <stdio.h>
int is_leap_year(unsigned year)
{
return !(year & (year % 100 ? 3 : 15));
}
int main(void)
{
const unsigned test_case[] = {
1900, 1994, 1996, 1997, 2000, 2024, 2025, 2026, 2100
};
const unsigned n = sizeof test_case / sizeof test_case[0];
for (unsigned i = 0; i != n; ++i) {
unsigned year = test_case[i];
printf("%u is %sa leap year.\n", year, is_leap_year(year) ? "" : "not ");
}
return 0;
}
|
Port the following code from VB to C with equivalent syntax and logic. |
dim i,j
Wscript.StdOut.WriteLine "-- Long Integer - Permutations - from 1 to 12"
for i=1 to 12
for j=1 to i
Wscript.StdOut.Write "P(" & i & "," & j & ")=" & perm(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Combinations from 10 to 60"
for i=10 to 60 step 10
for j=1 to i step i\5
Wscript.StdOut.Write "C(" & i & "," & j & ")=" & comb(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Permutations from 5000 to 15000"
for i=5000 to 15000 step 5000
for j=10 to 70 step 20
Wscript.StdOut.Write "C(" & i & "," & j & ")=" & perm(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
Wscript.StdOut.WriteLine "-- Float integer - Combinations from 200 to 1000"
for i=200 to 1000 step 200
for j=20 to 100 step 20
Wscript.StdOut.Write "P(" & i & "," & j & ")=" & comb(i,j) & " "
next
Wscript.StdOut.WriteLine ""
next
function perm(x,y)
dim i,z
z=1
for i=x-y+1 to x
z=z*i
next
perm=z
end function
function fact(x)
dim i,z
z=1
for i=2 to x
z=z*i
next
fact=z
end function
function comb(byval x,byval y)
if y>x then
comb=0
elseif x=y then
comb=1
else
if x-y<y then y=x-y
comb=perm(x,y)/fact(y)
end if
end function
| #include <gmp.h>
void perm(mpz_t out, int n, int k)
{
mpz_set_ui(out, 1);
k = n - k;
while (n > k) mpz_mul_ui(out, out, n--);
}
void comb(mpz_t out, int n, int k)
{
perm(out, n, k);
while (k) mpz_divexact_ui(out, out, k--);
}
int main(void)
{
mpz_t x;
mpz_init(x);
perm(x, 1000, 969);
gmp_printf("P(1000,969) = %Zd\n", x);
comb(x, 1000, 969);
gmp_printf("C(1000,969) = %Zd\n", x);
return 0;
}
|
Produce a language-to-language conversion: from VB to C, same semantics. | Public Function sortlexicographically(N As Integer)
Dim arrList As Object
Set arrList = CreateObject("System.Collections.ArrayList")
For i = 1 To N
arrList.Add CStr(i)
Next i
arrList.Sort
Dim item As Variant
For Each item In arrList
Debug.Print item & ", ";
Next
End Function
Public Sub main()
Call sortlexicographically(13)
End Sub
| #include <math.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
int compareStrings(const void *a, const void *b) {
const char **aa = (const char **)a;
const char **bb = (const char **)b;
return strcmp(*aa, *bb);
}
void lexOrder(int n, int *ints) {
char **strs;
int i, first = 1, last = n, k = n, len;
if (n < 1) {
first = n; last = 1; k = 2 - n;
}
strs = malloc(k * sizeof(char *));
for (i = first; i <= last; ++i) {
if (i >= 1) len = (int)log10(i) + 2;
else if (i == 0) len = 2;
else len = (int)log10(-i) + 3;
strs[i-first] = malloc(len);
sprintf(strs[i-first], "%d", i);
}
qsort(strs, k, sizeof(char *), compareStrings);
for (i = 0; i < k; ++i) {
ints[i] = atoi(strs[i]);
free(strs[i]);
}
free(strs);
}
int main() {
int i, j, k, n, *ints;
int numbers[5] = {0, 5, 13, 21, -22};
printf("In lexicographical order:\n\n");
for (i = 0; i < 5; ++i) {
k = n = numbers[i];
if (k < 1) k = 2 - k;
ints = malloc(k * sizeof(int));
lexOrder(n, ints);
printf("%3d: [", n);
for (j = 0; j < k; ++j) {
printf("%d ", ints[j]);
}
printf("\b]\n");
free(ints);
}
return 0;
}
|
Change the programming language of this snippet from VB to C without modifying what it does. | Public twenties As Variant
Public decades As Variant
Public orders As Variant
Private Sub init()
twenties = [{"zero","one","two","three","four","five","six","seven","eight","nine","ten", "eleven","twelve","thirteen","fourteen","fifteen","sixteen","seventeen","eighteen","nineteen"}]
decades = [{"twenty","thirty","forty","fifty","sixty","seventy","eighty","ninety"}]
orders = [{1E15,"quadrillion"; 1E12,"trillion"; 1E9,"billion"; 1E6,"million"; 1E3,"thousand"}]
End Sub
Private Function Twenty(N As Variant)
Twenty = twenties(N Mod 20 + 1)
End Function
Private Function Decade(N As Variant)
Decade = decades(N Mod 10 - 1)
End Function
Private Function Hundred(N As Variant)
If N < 20 Then
Hundred = Twenty(N)
Exit Function
Else
If N Mod 10 = 0 Then
Hundred = Decade((N \ 10) Mod 10)
Exit Function
End If
End If
Hundred = Decade(N \ 10) & "-" & Twenty(N Mod 10)
End Function
Private Function Thousand(N As Variant, withand As String)
If N < 100 Then
Thousand = withand & Hundred(N)
Exit Function
Else
If N Mod 100 = 0 Then
Thousand = withand & Twenty(WorksheetFunction.Floor_Precise(N / 100)) & " hundred"
Exit Function
End If
End If
Thousand = Twenty(N \ 100) & " hundred and " & Hundred(N Mod 100)
End Function
Private Function Triplet(N As Variant)
Dim Order, High As Variant, Low As Variant
Dim Name As String, res As String
For i = 1 To UBound(orders)
Order = orders(i, 1)
Name = orders(i, 2)
High = WorksheetFunction.Floor_Precise(N / Order)
Low = N - High * Order
If High <> 0 Then
res = res & Thousand(High, "") & " " & Name
End If
N = Low
If Low = 0 Then Exit For
If Len(res) And High <> 0 Then
res = res & ", "
End If
Next i
If N <> 0 Or res = "" Then
res = res & Thousand(WorksheetFunction.Floor_Precise(N), IIf(res = "", "", "and "))
N = N - Int(N)
If N > 0.000001 Then
res = res & " point"
For i = 1 To 10
n_ = WorksheetFunction.Floor_Precise(N * 10.0000001)
res = res & " " & twenties(n_ + 1)
N = N * 10 - n_
If Abs(N) < 0.000001 Then Exit For
Next i
End If
End If
Triplet = res
End Function
Private Function spell(N As Variant)
Dim res As String
If N < 0 Then
res = "minus "
N = -N
End If
res = res & Triplet(N)
spell = res
End Function
Private Function smartp(N As Variant)
Dim res As String
If N = WorksheetFunction.Floor_Precise(N) Then
smartp = CStr(N)
Exit Function
End If
res = CStr(N)
If InStr(1, res, ".") Then
res = Left(res, InStr(1, res, "."))
End If
smartp = res
End Function
Sub Main()
Dim si As Variant
init
Samples1 = [{99, 300, 310, 417, 1501, 12609, 200000000000100, 999999999999999, -123456787654321,102003000400005,1020030004,102003,102,1,0,-1,-99, -1501,1234,12.34}]
Samples2 = [{10000001.2,1E-3,-2.7182818, 201021002001,-20102100200,2010210020,-201021002,20102100,-2010210, 201021,-20102,2010,-201,20,-2}]
For i = 1 To UBound(Samples1)
si = Samples1(i)
Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si)
Next i
For i = 1 To UBound(Samples2)
si = Samples2(i)
Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si)
Next i
End Sub
| #include <stdio.h>
#include <string.h>
const char *ones[] = { 0, "one", "two", "three", "four",
"five", "six", "seven", "eight", "nine",
"ten", "eleven", "twelve", "thirteen", "fourteen",
"fifteen", "sixteen", "seventeen", "eighteen", "nineteen" };
const char *tens[] = { 0, "ten", "twenty", "thirty", "forty",
"fifty", "sixty", "seventy", "eighty", "ninety" };
const char *llions[] = { 0, "thousand", "million", "billion", "trillion",
};
const int maxillion = sizeof(llions) / sizeof(llions[0]) * 3 - 3;
int say_hundred(const char *s, int len, int depth, int has_lead)
{
int c[3], i;
for (i = -3; i < 0; i++) {
if (len + i >= 0) c[i + 3] = s[len + i] - '0';
else c[i + 3] = 0;
}
if (!(c[0] + c[1] + c[2])) return 0;
if (c[0]) {
printf("%s hundred", ones[c[0]]);
has_lead = 1;
}
if (has_lead && (c[1] || c[2]))
printf((!depth || c[0]) && (!c[0] || !c[1]) ? "and " :
c[0] ? " " : "");
if (c[1] < 2) {
if (c[1] || c[2]) printf("%s", ones[c[1] * 10 + c[2]]);
} else {
if (c[1]) {
printf("%s", tens[c[1]]);
if (c[2]) putchar('-');
}
if (c[2]) printf("%s", ones[c[2]]);
}
return 1;
}
int say_maxillion(const char *s, int len, int depth, int has_lead)
{
int n = len / 3, r = len % 3;
if (!r) {
n--;
r = 3;
}
const char *e = s + r;
do {
if (say_hundred(s, r, n, has_lead) && n) {
has_lead = 1;
printf(" %s", llions[n]);
if (!depth) printf(", ");
else printf(" ");
}
s = e; e += 3;
} while (r = 3, n--);
return 1;
}
void say_number(const char *s)
{
int len, i, got_sign = 0;
while (*s == ' ') s++;
if (*s < '0' || *s > '9') {
if (*s == '-') got_sign = -1;
else if (*s == '+') got_sign = 1;
else goto nan;
s++;
} else
got_sign = 1;
while (*s == '0') {
s++;
if (*s == '\0') {
printf("zero\n");
return;
}
}
len = strlen(s);
if (!len) goto nan;
for (i = 0; i < len; i++) {
if (s[i] < '0' || s[i] > '9') {
printf("(not a number)");
return;
}
}
if (got_sign == -1) printf("minus ");
int n = len / maxillion;
int r = len % maxillion;
if (!r) {
r = maxillion;
n--;
}
const char *end = s + len - n * maxillion;
int has_lead = 0;
do {
if ((has_lead = say_maxillion(s, r, n, has_lead))) {
for (i = 0; i < n; i++)
printf(" %s", llions[maxillion / 3]);
if (n) printf(", ");
}
n--;
r = maxillion;
s = end;
end += r;
} while (n >= 0);
printf("\n");
return;
nan: printf("not a number\n");
return;
}
int main()
{
say_number("-42");
say_number("1984");
say_number("10000");
say_number("1024");
say_number("1001001001001");
say_number("123456789012345678901234567890123456789012345678900000001");
return 0;
}
|
Preserve the algorithm and functionality while converting the code from VB to C. | Sub arrShellSort(ByVal arrData As Variant)
Dim lngHold, lngGap As Long
Dim lngCount, lngMin, lngMax As Long
Dim varItem As Variant
lngMin = LBound(arrData)
lngMax = UBound(arrData)
lngGap = lngMin
Do While (lngGap < lngMax)
lngGap = 3 * lngGap + 1
Loop
Do While (lngGap > 1)
lngGap = lngGap \ 3
For lngCount = lngGap + lngMin To lngMax
varItem = arrData(lngCount)
lngHold = lngCount
Do While ((arrData(lngHold - lngGap) > varItem))
arrData(lngHold) = arrData(lngHold - lngGap)
lngHold = lngHold - lngGap
If (lngHold < lngMin + lngGap) Then Exit Do
Loop
arrData(lngHold) = varItem
Next
Loop
arrShellSort = arrData
End Sub
| #include <stdio.h>
void shell_sort (int *a, int n) {
int h, i, j, t;
for (h = n; h /= 2;) {
for (i = h; i < n; i++) {
t = a[i];
for (j = i; j >= h && t < a[j - h]; j -= h) {
a[j] = a[j - h];
}
a[j] = t;
}
}
}
int main (int ac, char **av) {
int a[] = {4, 65, 2, -31, 0, 99, 2, 83, 782, 1};
int n = sizeof a / sizeof a[0];
int i;
for (i = 0; i < n; i++)
printf("%d%s", a[i], i == n - 1 ? "\n" : " ");
shell_sort(a, n);
for (i = 0; i < n; i++)
printf("%d%s", a[i], i == n - 1 ? "\n" : " ");
return 0;
}
|
Produce a functionally identical C code for the snippet given in VB. | Public Class DoubleLinkList(Of T)
Private m_Head As Node(Of T)
Private m_Tail As Node(Of T)
Public Sub AddHead(ByVal value As T)
Dim node As New Node(Of T)(Me, value)
If m_Head Is Nothing Then
m_Head = Node
m_Tail = m_Head
Else
node.Next = m_Head
m_Head = node
End If
End Sub
Public Sub AddTail(ByVal value As T)
Dim node As New Node(Of T)(Me, value)
If m_Tail Is Nothing Then
m_Head = node
m_Tail = m_Head
Else
node.Previous = m_Tail
m_Tail = node
End If
End Sub
Public ReadOnly Property Head() As Node(Of T)
Get
Return m_Head
End Get
End Property
Public ReadOnly Property Tail() As Node(Of T)
Get
Return m_Tail
End Get
End Property
Public Sub RemoveTail()
If m_Tail Is Nothing Then Return
If m_Tail.Previous Is Nothing Then
m_Head = Nothing
m_Tail = Nothing
Else
m_Tail = m_Tail.Previous
m_Tail.Next = Nothing
End If
End Sub
Public Sub RemoveHead()
If m_Head Is Nothing Then Return
If m_Head.Next Is Nothing Then
m_Head = Nothing
m_Tail = Nothing
Else
m_Head = m_Head.Next
m_Head.Previous = Nothing
End If
End Sub
End Class
Public Class Node(Of T)
Private ReadOnly m_Value As T
Private m_Next As Node(Of T)
Private m_Previous As Node(Of T)
Private ReadOnly m_Parent As DoubleLinkList(Of T)
Public Sub New(ByVal parent As DoubleLinkList(Of T), ByVal value As T)
m_Parent = parent
m_Value = value
End Sub
Public Property [Next]() As Node(Of T)
Get
Return m_Next
End Get
Friend Set(ByVal value As Node(Of T))
m_Next = value
End Set
End Property
Public Property Previous() As Node(Of T)
Get
Return m_Previous
End Get
Friend Set(ByVal value As Node(Of T))
m_Previous = value
End Set
End Property
Public ReadOnly Property Value() As T
Get
Return m_Value
End Get
End Property
Public Sub InsertAfter(ByVal value As T)
If m_Next Is Nothing Then
m_Parent.AddTail(value)
ElseIf m_Previous Is Nothing Then
m_Parent.AddHead(value)
Else
Dim node As New Node(Of T)(m_Parent, value)
node.Previous = Me
node.Next = Me.Next
Me.Next.Previous = node
Me.Next = node
End If
End Sub
Public Sub Remove()
If m_Next Is Nothing Then
m_Parent.RemoveTail()
ElseIf m_Previous Is Nothing Then
m_Parent.RemoveHead()
Else
m_Previous.Next = Me.Next
m_Next.Previous = Me.Previous
End If
End Sub
End Class
|
#include <stdio.h>
#include <stdlib.h>
struct List {
struct MNode *head;
struct MNode *tail;
struct MNode *tail_pred;
};
struct MNode {
struct MNode *succ;
struct MNode *pred;
};
typedef struct MNode *NODE;
typedef struct List *LIST;
LIST newList(void);
int isEmpty(LIST);
NODE getTail(LIST);
NODE getHead(LIST);
NODE addTail(LIST, NODE);
NODE addHead(LIST, NODE);
NODE remHead(LIST);
NODE remTail(LIST);
NODE insertAfter(LIST, NODE, NODE);
NODE removeNode(LIST, NODE);
LIST newList(void)
{
LIST tl = malloc(sizeof(struct List));
if ( tl != NULL )
{
tl->tail_pred = (NODE)&tl->head;
tl->tail = NULL;
tl->head = (NODE)&tl->tail;
return tl;
}
return NULL;
}
int isEmpty(LIST l)
{
return (l->head->succ == 0);
}
NODE getHead(LIST l)
{
return l->head;
}
NODE getTail(LIST l)
{
return l->tail_pred;
}
NODE addTail(LIST l, NODE n)
{
n->succ = (NODE)&l->tail;
n->pred = l->tail_pred;
l->tail_pred->succ = n;
l->tail_pred = n;
return n;
}
NODE addHead(LIST l, NODE n)
{
n->succ = l->head;
n->pred = (NODE)&l->head;
l->head->pred = n;
l->head = n;
return n;
}
NODE remHead(LIST l)
{
NODE h;
h = l->head;
l->head = l->head->succ;
l->head->pred = (NODE)&l->head;
return h;
}
NODE remTail(LIST l)
{
NODE t;
t = l->tail_pred;
l->tail_pred = l->tail_pred->pred;
l->tail_pred->succ = (NODE)&l->tail;
return t;
}
NODE insertAfter(LIST l, NODE r, NODE n)
{
n->pred = r; n->succ = r->succ;
n->succ->pred = n; r->succ = n;
return n;
}
NODE removeNode(LIST l, NODE n)
{
n->pred->succ = n->succ;
n->succ->pred = n->pred;
return n;
}
|
Rewrite the snippet below in C so it works the same as the original VB code. |
TYPE regChar
Character AS STRING * 3
Count AS LONG
END TYPE
DIM iChar AS INTEGER
DIM iCL AS INTEGER
DIM iCountChars AS INTEGER
DIM iFile AS INTEGER
DIM i AS INTEGER
DIM lMUC AS LONG
DIM iMUI AS INTEGER
DIM lLUC AS LONG
DIM iLUI AS INTEGER
DIM iMaxIdx AS INTEGER
DIM iP AS INTEGER
DIM iPause AS INTEGER
DIM iPMI AS INTEGER
DIM iPrint AS INTEGER
DIM lHowMany AS LONG
DIM lTotChars AS LONG
DIM sTime AS SINGLE
DIM strFile AS STRING
DIM strTxt AS STRING
DIM strDate AS STRING
DIM strTime AS STRING
DIM strKey AS STRING
CONST LngReg = 256
CONST Letters = 1
CONST FALSE = 0
CONST TRUE = NOT FALSE
strDate = DATE$
strTime = TIME$
iFile = FREEFILE
DO
CLS
PRINT "This program counts letters or characters in a text file."
PRINT
INPUT "File to open: ", strFile
OPEN strFile FOR BINARY AS #iFile
IF LOF(iFile) > 0 THEN
PRINT "Count: 1) Letters 2) Characters (1 or 2)";
DO
strKey = INKEY$
LOOP UNTIL strKey = "1" OR strKey = "2"
PRINT ". Option selected: "; strKey
iCL = VAL(strKey)
sTime = TIMER
iP = POS(0)
lHowMany = LOF(iFile)
strTxt = SPACE$(LngReg)
IF iCL = Letters THEN
iMaxIdx = 26
ELSE
iMaxIdx = 255
END IF
IF iMaxIdx <> iPMI THEN
iPMI = iMaxIdx
REDIM rChar(0 TO iMaxIdx) AS regChar
FOR i = 0 TO iMaxIdx
IF iCL = Letters THEN
strTxt = CHR$(i + 65)
IF i = 26 THEN strTxt = CHR$(165)
ELSE
SELECT CASE i
CASE 0: strTxt = "nul"
CASE 7: strTxt = "bel"
CASE 9: strTxt = "tab"
CASE 10: strTxt = "lf"
CASE 11: strTxt = "vt"
CASE 12: strTxt = "ff"
CASE 13: strTxt = "cr"
CASE 28: strTxt = "fs"
CASE 29: strTxt = "gs"
CASE 30: strTxt = "rs"
CASE 31: strTxt = "us"
CASE 32: strTxt = "sp"
CASE ELSE: strTxt = CHR$(i)
END SELECT
END IF
rChar(i).Character = strTxt
NEXT i
ELSE
FOR i = 0 TO iMaxIdx
rChar(i).Count = 0
NEXT i
END IF
PRINT "Looking for ";
IF iCL = Letters THEN PRINT "letters."; ELSE PRINT "characters.";
PRINT " File is"; STR$(lHowMany); " in size. Working"; : COLOR 23: PRINT "..."; : COLOR (7)
DO WHILE LOC(iFile) < LOF(iFile)
IF LOC(iFile) + LngReg > LOF(iFile) THEN
strTxt = SPACE$(LOF(iFile) - LOC(iFile))
END IF
GET #iFile, , strTxt
FOR i = 1 TO LEN(strTxt)
IF iCL = Letters THEN
iChar = ASC(UCASE$(MID$(strTxt, i, 1)))
SELECT CASE iChar
CASE 164: iChar = 165
CASE 160: iChar = 65
CASE 130, 144: iChar = 69
CASE 161: iChar = 73
CASE 162: iChar = 79
CASE 163, 129: iChar = 85
END SELECT
iChar = iChar - 65
IF iChar >= 0 AND iChar <= 25 THEN
rChar(iChar).Count = rChar(iChar).Count + 1
ELSEIF iChar = 100 THEN
rChar(iMaxIdx).Count = rChar(iMaxIdx).Count + 1
END IF
ELSE
iChar = ASC(MID$(strTxt, i, 1))
rChar(iChar).Count = rChar(iChar).Count + 1
END IF
NEXT i
LOOP
CLOSE #iFile
lMUC = 0
iMUI = 0
lLUC = 2147483647
iLUI = 0
iPrint = FALSE
lTotChars = 0
iCountChars = 0
iPause = FALSE
CLS
IF iCL = Letters THEN PRINT "Letters found: "; ELSE PRINT "Characters found: ";
FOR i = 0 TO iMaxIdx
IF lMUC < rChar(i).Count THEN
lMUC = rChar(i).Count
iMUI = i
END IF
IF rChar(i).Count > 0 THEN
strTxt = ""
IF iPrint THEN strTxt = ", " ELSE iPrint = TRUE
strTxt = strTxt + LTRIM$(RTRIM$(rChar(i).Character))
strTxt = strTxt + "=" + LTRIM$(STR$(rChar(i).Count))
iP = POS(0)
IF iP + LEN(strTxt) + 1 >= 80 AND iPrint THEN
PRINT ","
IF CSRLIN >= 23 AND NOT iPause THEN
iPause = TRUE
PRINT "Press a key to continue..."
DO
strKey = INKEY$
LOOP UNTIL strKey <> ""
END IF
strTxt = MID$(strTxt, 3)
END IF
PRINT strTxt;
lTotChars = lTotChars + rChar(i).Count
iCountChars = iCountChars + 1
IF lLUC > rChar(i).Count THEN
lLUC = rChar(i).Count
iLUI = i
END IF
END IF
NEXT i
PRINT "."
PRINT
PRINT "File analyzed....................: "; strFile
PRINT "Looked for.......................: "; : IF iCL = Letters THEN PRINT "Letters" ELSE PRINT "Characters"
PRINT "Total characters in file.........:"; lHowMany
PRINT "Total characters counted.........:"; lTotChars
IF iCL = Letters THEN PRINT "Characters discarded on count....:"; lHowMany - lTotChars
PRINT "Distinct characters found in file:"; iCountChars; "of"; iMaxIdx + 1
PRINT "Most used character was..........: ";
iPrint = FALSE
FOR i = 0 TO iMaxIdx
IF rChar(i).Count = lMUC THEN
IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE
PRINT RTRIM$(LTRIM$(rChar(i).Character));
END IF
NEXT i
PRINT " ("; LTRIM$(STR$(rChar(iMUI).Count)); " times)"
PRINT "Least used character was.........: ";
iPrint = FALSE
FOR i = 0 TO iMaxIdx
IF rChar(i).Count = lLUC THEN
IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE
PRINT RTRIM$(LTRIM$(rChar(i).Character));
END IF
NEXT i
PRINT " ("; LTRIM$(STR$(rChar(iLUI).Count)); " times)"
PRINT "Time spent in the process........:"; TIMER - sTime; "seconds"
ELSE
CLOSE #iFile
KILL strFile
PRINT
PRINT "File does not exist."
END IF
PRINT
PRINT "Again? (Y/n)"
DO
strTxt = UCASE$(INKEY$)
LOOP UNTIL strTxt = "N" OR strTxt = "Y" OR strTxt = CHR$(13) OR strTxt = CHR$(27)
LOOP UNTIL strTxt = "N" OR strTxt = CHR$(27)
CLS
PRINT "End of execution."
PRINT "Start time: "; strDate; " "; strTime; ", end time: "; DATE$; " "; TIME$; "."
END
|
int frequency[26];
int ch;
FILE* txt_file = fopen ("a_text_file.txt", "rt");
for (ch = 0; ch < 26; ch++)
frequency[ch] = 0;
while (1) {
ch = fgetc(txt_file);
if (ch == EOF) break;
if ('a' <= ch && ch <= 'z')
frequency[ch-'a']++;
else if ('A' <= ch && ch <= 'Z')
frequency[ch-'A']++;
}
|
Change the following VB code into C without altering its purpose. | Dim s As String = "123"
s = CStr(CInt("123") + 1)
s = (CInt("123") + 1).ToString
| #include <stdio.h>
#include <string.h>
#include <stdlib.h>
char * incr(char *s)
{
int i, begin, tail, len;
int neg = (*s == '-');
char tgt = neg ? '0' : '9';
if (!strcmp(s, "-1")) {
s[0] = '0', s[1] = '\0';
return s;
}
len = strlen(s);
begin = (*s == '-' || *s == '+') ? 1 : 0;
for (tail = len - 1; tail >= begin && s[tail] == tgt; tail--);
if (tail < begin && !neg) {
if (!begin) s = realloc(s, len + 2);
s[0] = '1';
for (i = 1; i <= len - begin; i++) s[i] = '0';
s[len + 1] = '\0';
} else if (tail == begin && neg && s[1] == '1') {
for (i = 1; i < len - begin; i++) s[i] = '9';
s[len - 1] = '\0';
} else {
for (i = len - 1; i > tail; i--)
s[i] = neg ? '9' : '0';
s[tail] += neg ? -1 : 1;
}
return s;
}
void string_test(const char *s)
{
char *ret = malloc(strlen(s));
strcpy(ret, s);
printf("text: %s\n", ret);
printf(" ->: %s\n", ret = incr(ret));
free(ret);
}
int main()
{
string_test("+0");
string_test("-1");
string_test("-41");
string_test("+41");
string_test("999");
string_test("+999");
string_test("109999999999999999999999999999999999999999");
string_test("-100000000000000000000000000000000000000000000");
return 0;
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.