Instruction
stringlengths
45
106
input_code
stringlengths
1
13.7k
output_code
stringlengths
1
13.7k
Convert this Java snippet to PHP and keep its semantics consistent.
import java.util.Arrays; public class FD { public static void main(String args[]) { double[] a = {90, 47, 58, 29, 22, 32, 55, 5, 55, 73}; System.out.println(Arrays.toString(dif(a, 1))); System.out.println(Arrays.toString(dif(a, 2))); System.out.println(Arrays.toString(dif(a, 9))); System.out.println(Arrays.toString(dif(a, 10))); System.out.println(Arrays.toString(dif(a, 11))); System.out.println(Arrays.toString(dif(a, -1))); System.out.println(Arrays.toString(dif(a, 0))); } public static double[] dif(double[] a, int n) { if (n < 0) return null; for (int i = 0; i < n && a.length > 0; i++) { double[] b = new double[a.length - 1]; for (int j = 0; j < b.length; j++){ b[j] = a[j+1] - a[j]; } a = b; } return a; } }
<?php function forwardDiff($anArray, $times = 1) { if ($times <= 0) { return $anArray; } for ($accumilation = array(), $i = 1, $j = count($anArray); $i < $j; ++$i) { $accumilation[] = $anArray[$i] - $anArray[$i - 1]; } if ($times === 1) { return $accumilation; } return forwardDiff($accumilation, $times - 1); } class ForwardDiffExample extends PweExample { function _should_run_empty_array_for_single_elem() { $expected = array($this->rand()->int()); $this->spec(forwardDiff($expected))->shouldEqual(array()); } function _should_give_diff_of_two_elem_as_single_elem() { $twoNums = array($this->rand()->int(), $this->rand()->int()); $expected = array($twoNums[1] - $twoNums[0]); $this->spec(forwardDiff($twoNums))->shouldEqual($expected); } function _should_compute_correct_forward_diff_for_longer_arrays() { $diffInput = array(10, 2, 9, 6, 5); $expected = array(-8, 7, -3, -1); $this->spec(forwardDiff($diffInput))->shouldEqual($expected); } function _should_apply_more_than_once_if_specified() { $diffInput = array(4, 6, 9, 3, 4); $expectedAfter1 = array(2, 3, -6, 1); $expectedAfter2 = array(1, -9, 7); $this->spec(forwardDiff($diffInput, 1))->shouldEqual($expectedAfter1); $this->spec(forwardDiff($diffInput, 2))->shouldEqual($expectedAfter2); } function _should_return_array_unaltered_if_no_times() { $this->spec(forwardDiff($expected = array(1,2,3), 0))->shouldEqual($expected); } }
Port the following code from Java to PHP with equivalent syntax and logic.
public static boolean prime(long a){ if(a == 2){ return true; }else if(a <= 1 || a % 2 == 0){ return false; } long max = (long)Math.sqrt(a); for(long n= 3; n <= max; n+= 2){ if(a % n == 0){ return false; } } return true; }
<?php function prime($a) { if (($a % 2 == 0 && $a != 2) || $a < 2) return false; $limit = sqrt($a); for ($i = 2; $i <= $limit; $i++) if ($a % $i == 0) return false; return true; } foreach (range(1, 100) as $x) if (prime($x)) echo "$x\n"; ?>
Generate an equivalent PHP version of this Java code.
public static boolean prime(long a){ if(a == 2){ return true; }else if(a <= 1 || a % 2 == 0){ return false; } long max = (long)Math.sqrt(a); for(long n= 3; n <= max; n+= 2){ if(a % n == 0){ return false; } } return true; }
<?php function prime($a) { if (($a % 2 == 0 && $a != 2) || $a < 2) return false; $limit = sqrt($a); for ($i = 2; $i <= $limit; $i++) if ($a % $i == 0) return false; return true; } foreach (range(1, 100) as $x) if (prime($x)) echo "$x\n"; ?>
Produce a functionally identical PHP code for the snippet given in Java.
public class Binomial { private static long binomialInt(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static Object binomialIntReliable(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) { try { binom = Math.multiplyExact(binom, n + 1 - i) / i; } catch (ArithmeticException e) { return "overflow"; } } return binom; } private static double binomialFloat(int n, int k) { if (k > n - k) k = n - k; double binom = 1.0; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static BigInteger binomialBigInt(int n, int k) { if (k > n - k) k = n - k; BigInteger binom = BigInteger.ONE; for (int i = 1; i <= k; i++) { binom = binom.multiply(BigInteger.valueOf(n + 1 - i)); binom = binom.divide(BigInteger.valueOf(i)); } return binom; } private static void demo(int n, int k) { List<Object> data = Arrays.asList( n, k, binomialInt(n, k), binomialIntReliable(n, k), binomialFloat(n, k), binomialBigInt(n, k)); System.out.println(data.stream().map(Object::toString).collect(Collectors.joining("\t"))); } public static void main(String[] args) { demo(5, 3); demo(1000, 300); } }
<?php $n=5; $k=3; function factorial($val){ for($f=2;$val-1>1;$f*=$val--); return $f; } $binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k)); echo $binomial_coefficient; ?>
Translate the given Java code snippet into PHP without altering its behavior.
public class Binomial { private static long binomialInt(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static Object binomialIntReliable(int n, int k) { if (k > n - k) k = n - k; long binom = 1; for (int i = 1; i <= k; i++) { try { binom = Math.multiplyExact(binom, n + 1 - i) / i; } catch (ArithmeticException e) { return "overflow"; } } return binom; } private static double binomialFloat(int n, int k) { if (k > n - k) k = n - k; double binom = 1.0; for (int i = 1; i <= k; i++) binom = binom * (n + 1 - i) / i; return binom; } private static BigInteger binomialBigInt(int n, int k) { if (k > n - k) k = n - k; BigInteger binom = BigInteger.ONE; for (int i = 1; i <= k; i++) { binom = binom.multiply(BigInteger.valueOf(n + 1 - i)); binom = binom.divide(BigInteger.valueOf(i)); } return binom; } private static void demo(int n, int k) { List<Object> data = Arrays.asList( n, k, binomialInt(n, k), binomialIntReliable(n, k), binomialFloat(n, k), binomialBigInt(n, k)); System.out.println(data.stream().map(Object::toString).collect(Collectors.joining("\t"))); } public static void main(String[] args) { demo(5, 3); demo(1000, 300); } }
<?php $n=5; $k=3; function factorial($val){ for($f=2;$val-1>1;$f*=$val--); return $f; } $binomial_coefficient=factorial($n)/(factorial($k)*factorial($n-$k)); echo $binomial_coefficient; ?>
Convert the following code from Java to PHP, ensuring the logic remains intact.
List arrayList = new ArrayList(); arrayList.add(new Integer(0)); arrayList.add(0); List<Integer> myarrlist = new ArrayList<Integer>(); int sum; for(int i = 0; i < 10; i++) { myarrlist.add(i); }
<?php $a = array(); # add elements "at the end" array_push($a, 55, 10, 20); print_r($a); # using an explicit key $a['one'] = 1; $a['two'] = 2; print_r($a); ?>
Change the programming language of this snippet from Java to PHP without modifying what it does.
List arrayList = new ArrayList(); arrayList.add(new Integer(0)); arrayList.add(0); List<Integer> myarrlist = new ArrayList<Integer>(); int sum; for(int i = 0; i < 10; i++) { myarrlist.add(i); }
<?php $a = array(); # add elements "at the end" array_push($a, 55, 10, 20); print_r($a); # using an explicit key $a['one'] = 1; $a['two'] = 2; print_r($a); ?>
Generate a PHP translation of this Java snippet without changing its computational steps.
import java.io.BufferedOutputStream; import java.io.File; import java.io.FileOutputStream; import java.io.IOException; import java.nio.charset.StandardCharsets; public class PPMWriter { public void bitmapToPPM(File file, BasicBitmapStorage bitmap) throws IOException { file.delete(); try (var os = new FileOutputStream(file, true); var bw = new BufferedOutputStream(os)) { var header = String.format("P6\n%d %d\n255\n", bitmap.getWidth(), bitmap.getHeight()); bw.write(header.getBytes(StandardCharsets.US_ASCII)); for (var y = 0; y < bitmap.getHeight(); y++) { for (var x = 0; x < bitmap.getWidth(); x++) { var pixel = bitmap.getPixel(x, y); bw.write(pixel.getRed()); bw.write(pixel.getGreen()); bw.write(pixel.getBlue()); } } } } }
class Bitmap { public $data; public $w; public $h; public function __construct($w = 16, $h = 16){ $white = array_fill(0, $w, array(255,255,255)); $this->data = array_fill(0, $h, $white); $this->w = $w; $this->h = $h; } public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){ if (is_null($w)) $w = $this->w; if (is_null($h)) $h = $this->h; $w += $x; $h += $y; for ($i = $y; $i < $h; $i++){ for ($j = $x; $j < $w; $j++){ $this->setPixel($j, $i, $color); } } } public function setPixel($x, $y, $color = array(0,0,0)){ if ($x >= $this->w) return false; if ($x < 0) return false; if ($y >= $this->h) return false; if ($y < 0) return false; $this->data[$y][$x] = $color; } public function getPixel($x, $y){ return $this->data[$y][$x]; } public function writeP6($filename){ $fh = fopen($filename, 'w'); if (!$fh) return false; fputs($fh, "P6 {$this->w} {$this->h} 255\n"); foreach ($this->data as $row){ foreach($row as $pixel){ fputs($fh, pack('C', $pixel[0])); fputs($fh, pack('C', $pixel[1])); fputs($fh, pack('C', $pixel[2])); } } fclose($fh); } } $b = new Bitmap(16,16); $b->fill(); $b->fill(2, 2, 18, 18, array(240,240,240)); $b->setPixel(0, 15, array(255,0,0)); $b->writeP6('p6.ppm');
Rewrite this program in PHP while keeping its functionality equivalent to the Java version.
import java.io.BufferedOutputStream; import java.io.File; import java.io.FileOutputStream; import java.io.IOException; import java.nio.charset.StandardCharsets; public class PPMWriter { public void bitmapToPPM(File file, BasicBitmapStorage bitmap) throws IOException { file.delete(); try (var os = new FileOutputStream(file, true); var bw = new BufferedOutputStream(os)) { var header = String.format("P6\n%d %d\n255\n", bitmap.getWidth(), bitmap.getHeight()); bw.write(header.getBytes(StandardCharsets.US_ASCII)); for (var y = 0; y < bitmap.getHeight(); y++) { for (var x = 0; x < bitmap.getWidth(); x++) { var pixel = bitmap.getPixel(x, y); bw.write(pixel.getRed()); bw.write(pixel.getGreen()); bw.write(pixel.getBlue()); } } } } }
class Bitmap { public $data; public $w; public $h; public function __construct($w = 16, $h = 16){ $white = array_fill(0, $w, array(255,255,255)); $this->data = array_fill(0, $h, $white); $this->w = $w; $this->h = $h; } public function fill($x = 0, $y = 0, $w = null, $h = null, $color = array(0,0,0)){ if (is_null($w)) $w = $this->w; if (is_null($h)) $h = $this->h; $w += $x; $h += $y; for ($i = $y; $i < $h; $i++){ for ($j = $x; $j < $w; $j++){ $this->setPixel($j, $i, $color); } } } public function setPixel($x, $y, $color = array(0,0,0)){ if ($x >= $this->w) return false; if ($x < 0) return false; if ($y >= $this->h) return false; if ($y < 0) return false; $this->data[$y][$x] = $color; } public function getPixel($x, $y){ return $this->data[$y][$x]; } public function writeP6($filename){ $fh = fopen($filename, 'w'); if (!$fh) return false; fputs($fh, "P6 {$this->w} {$this->h} 255\n"); foreach ($this->data as $row){ foreach($row as $pixel){ fputs($fh, pack('C', $pixel[0])); fputs($fh, pack('C', $pixel[1])); fputs($fh, pack('C', $pixel[2])); } } fclose($fh); } } $b = new Bitmap(16,16); $b->fill(); $b->fill(2, 2, 18, 18, array(240,240,240)); $b->setPixel(0, 15, array(255,0,0)); $b->writeP6('p6.ppm');
Rewrite this program in PHP while keeping its functionality equivalent to the Java version.
import java.io.File; public class FileDeleteTest { public static boolean deleteFile(String filename) { boolean exists = new File(filename).delete(); return exists; } public static void test(String type, String filename) { System.out.println("The following " + type + " called " + filename + (deleteFile(filename) ? " was deleted." : " could not be deleted.") ); } public static void main(String args[]) { test("file", "input.txt"); test("file", File.seperator + "input.txt"); test("directory", "docs"); test("directory", File.seperator + "docs" + File.seperator); } }
<?php unlink('input.txt'); unlink('/input.txt'); rmdir('docs'); rmdir('/docs'); ?>
Convert the following code from Java to PHP, ensuring the logic remains intact.
import java.io.File; public class FileDeleteTest { public static boolean deleteFile(String filename) { boolean exists = new File(filename).delete(); return exists; } public static void test(String type, String filename) { System.out.println("The following " + type + " called " + filename + (deleteFile(filename) ? " was deleted." : " could not be deleted.") ); } public static void main(String args[]) { test("file", "input.txt"); test("file", File.seperator + "input.txt"); test("directory", "docs"); test("directory", File.seperator + "docs" + File.seperator); } }
<?php unlink('input.txt'); unlink('/input.txt'); rmdir('docs'); rmdir('/docs'); ?>
Generate a PHP translation of this Java snippet without changing its computational steps.
import java.util.Calendar; import java.util.GregorianCalendar; public class DiscordianDate { final static String[] seasons = {"Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath"}; final static String[] weekday = {"Sweetmorn", "Boomtime", "Pungenday", "Prickle-Prickle", "Setting Orange"}; final static String[] apostle = {"Mungday", "Mojoday", "Syaday", "Zaraday", "Maladay"}; final static String[] holiday = {"Chaoflux", "Discoflux", "Confuflux", "Bureflux", "Afflux"}; public static String discordianDate(final GregorianCalendar date) { int y = date.get(Calendar.YEAR); int yold = y + 1166; int dayOfYear = date.get(Calendar.DAY_OF_YEAR); if (date.isLeapYear(y)) { if (dayOfYear == 60) return "St. Tib's Day, in the YOLD " + yold; else if (dayOfYear > 60) dayOfYear--; } dayOfYear--; int seasonDay = dayOfYear % 73 + 1; if (seasonDay == 5) return apostle[dayOfYear / 73] + ", in the YOLD " + yold; if (seasonDay == 50) return holiday[dayOfYear / 73] + ", in the YOLD " + yold; String season = seasons[dayOfYear / 73]; String dayOfWeek = weekday[dayOfYear % 5]; return String.format("%s, day %s of %s in the YOLD %s", dayOfWeek, seasonDay, season, yold); } public static void main(String[] args) { System.out.println(discordianDate(new GregorianCalendar())); test(2010, 6, 22, "Pungenday, day 57 of Confusion in the YOLD 3176"); test(2012, 1, 28, "Prickle-Prickle, day 59 of Chaos in the YOLD 3178"); test(2012, 1, 29, "St. Tib's Day, in the YOLD 3178"); test(2012, 2, 1, "Setting Orange, day 60 of Chaos in the YOLD 3178"); test(2010, 0, 5, "Mungday, in the YOLD 3176"); test(2011, 4, 3, "Discoflux, in the YOLD 3177"); test(2015, 9, 19, "Boomtime, day 73 of Bureaucracy in the YOLD 3181"); } private static void test(int y, int m, int d, final String result) { assert (discordianDate(new GregorianCalendar(y, m, d)).equals(result)); } }
<?php $Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31); $MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath"); $DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle"); $Dsuff = array('th','st','nd','rd','th','th','th','th','th','th'); $Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay"); $Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux"); $edate = explode(" ",date('Y m j L')); $usery = $edate[0]; $userm = $edate[1]; $userd = $edate[2]; $IsLeap = $edate[3]; if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) { $usery = $_GET['y']; $userm = $_GET['m']; $userd = $_GET['d']; $IsLeap = 0; if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1; if ($usery%400 == 0) $IsLeap = 1; } $userdays = 0; $i = 0; while ($i < ($userm-1)) { $userdays = $userdays + $Anerisia[$i]; $i = $i +1; } $userdays = $userdays + $userd; $IsHolyday = 0; $dyear = $usery + 1166; $dmonth = $MONTHS[$userdays/73.2]; $dday = $userdays%73; if (0 == $dday) $dday = 73; $Dname = $DAYS[$userdays%5]; $Holyday = "St. Tibs Day"; if ($dday == 5) { $Holyday = $Holy5[$userdays/73.2]; $IsHolyday =1; } if ($dday == 50) { $Holyday = $Holy50[$userdays/73.2]; $IsHolyday =1; } if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2; $suff = $Dsuff[$dday%10] ; if ((11 <= $dday) && (19 >= $dday)) $suff='th'; if ($IsHolyday ==2) echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear; if ($IsHolyday ==1) echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday; if ($IsHolyday == 0) echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear; ?>
Write a version of this Java function in PHP with identical behavior.
import java.util.Calendar; import java.util.GregorianCalendar; public class DiscordianDate { final static String[] seasons = {"Chaos", "Discord", "Confusion", "Bureaucracy", "The Aftermath"}; final static String[] weekday = {"Sweetmorn", "Boomtime", "Pungenday", "Prickle-Prickle", "Setting Orange"}; final static String[] apostle = {"Mungday", "Mojoday", "Syaday", "Zaraday", "Maladay"}; final static String[] holiday = {"Chaoflux", "Discoflux", "Confuflux", "Bureflux", "Afflux"}; public static String discordianDate(final GregorianCalendar date) { int y = date.get(Calendar.YEAR); int yold = y + 1166; int dayOfYear = date.get(Calendar.DAY_OF_YEAR); if (date.isLeapYear(y)) { if (dayOfYear == 60) return "St. Tib's Day, in the YOLD " + yold; else if (dayOfYear > 60) dayOfYear--; } dayOfYear--; int seasonDay = dayOfYear % 73 + 1; if (seasonDay == 5) return apostle[dayOfYear / 73] + ", in the YOLD " + yold; if (seasonDay == 50) return holiday[dayOfYear / 73] + ", in the YOLD " + yold; String season = seasons[dayOfYear / 73]; String dayOfWeek = weekday[dayOfYear % 5]; return String.format("%s, day %s of %s in the YOLD %s", dayOfWeek, seasonDay, season, yold); } public static void main(String[] args) { System.out.println(discordianDate(new GregorianCalendar())); test(2010, 6, 22, "Pungenday, day 57 of Confusion in the YOLD 3176"); test(2012, 1, 28, "Prickle-Prickle, day 59 of Chaos in the YOLD 3178"); test(2012, 1, 29, "St. Tib's Day, in the YOLD 3178"); test(2012, 2, 1, "Setting Orange, day 60 of Chaos in the YOLD 3178"); test(2010, 0, 5, "Mungday, in the YOLD 3176"); test(2011, 4, 3, "Discoflux, in the YOLD 3177"); test(2015, 9, 19, "Boomtime, day 73 of Bureaucracy in the YOLD 3181"); } private static void test(int y, int m, int d, final String result) { assert (discordianDate(new GregorianCalendar(y, m, d)).equals(result)); } }
<?php $Anerisia = array(31,28,31,30,31,30,31,31,30,31,30,31); $MONTHS = array("Choas","Discord","Confusion","Bureacracy","The Aftermath"); $DAYS = array("Setting Orange","Sweetmorn","BoomTime","Pungenday","Prickle-Prickle"); $Dsuff = array('th','st','nd','rd','th','th','th','th','th','th'); $Holy5 = array("Mungday","MojoDay","Syaday","Zaraday","Maladay"); $Holy50 = array("Chaoflux","Discoflux","Confuflux","Bureflux","Afflux"); $edate = explode(" ",date('Y m j L')); $usery = $edate[0]; $userm = $edate[1]; $userd = $edate[2]; $IsLeap = $edate[3]; if (isset($_GET['y']) && isset($_GET['m']) && isset($_GET['d'])) { $usery = $_GET['y']; $userm = $_GET['m']; $userd = $_GET['d']; $IsLeap = 0; if (($usery%4 == 0) && ($usery%100 >0)) $IsLeap =1; if ($usery%400 == 0) $IsLeap = 1; } $userdays = 0; $i = 0; while ($i < ($userm-1)) { $userdays = $userdays + $Anerisia[$i]; $i = $i +1; } $userdays = $userdays + $userd; $IsHolyday = 0; $dyear = $usery + 1166; $dmonth = $MONTHS[$userdays/73.2]; $dday = $userdays%73; if (0 == $dday) $dday = 73; $Dname = $DAYS[$userdays%5]; $Holyday = "St. Tibs Day"; if ($dday == 5) { $Holyday = $Holy5[$userdays/73.2]; $IsHolyday =1; } if ($dday == 50) { $Holyday = $Holy50[$userdays/73.2]; $IsHolyday =1; } if (($IsLeap ==1) && ($userd ==29) and ($userm ==2)) $IsHolyday = 2; $suff = $Dsuff[$dday%10] ; if ((11 <= $dday) && (19 >= $dday)) $suff='th'; if ($IsHolyday ==2) echo "</br>Celeberate ",$Holyday," ",$dmonth," YOLD ",$dyear; if ($IsHolyday ==1) echo "</br>Celeberate for today ", $Dname , " The ", $dday,"<sup>",$suff,"</sup>", " day of ", $dmonth , " YOLD " , $dyear , " is the holy day of " , $Holyday; if ($IsHolyday == 0) echo "</br>Today is " , $Dname , " the " , $dday ,"<sup>",$suff, "</sup> day of " , $dmonth , " YOLD " , $dyear; ?>
Please provide an equivalent version of this Java code in PHP.
String original = "Mary had a X lamb"; String little = "little"; String replaced = original.replace("X", little); System.out.println(replaced); System.out.printf("Mary had a %s lamb.", little); String formatted = String.format("Mary had a %s lamb.", little); System.out.println(formatted);
<?php $extra = 'little'; echo "Mary had a $extra lamb.\n"; printf("Mary had a %s lamb.\n", $extra); ?>
Transform the following VB implementation into C, maintaining the same output and logic.
Debug.Print Hex(&HF0F0 And &HFF00) Debug.Print Hex(&HF0F0 Or &HFF00) Debug.Print Hex(&HF0F0 Xor &HFF00) Debug.Print Hex(Not &HF0F0) Debug.Print Hex(&HF0F0 Eqv &HFF00) Debug.Print Hex(&HF0F0 Imp &HFF00)
void bitwise(int a, int b) { printf("a and b: %d\n", a & b); printf("a or b: %d\n", a | b); printf("a xor b: %d\n", a ^ b); printf("not a: %d\n", ~a); printf("a << n: %d\n", a << b); printf("a >> n: %d\n", a >> b); unsigned int c = a; printf("c >> b: %d\n", c >> b); return 0; }
Produce a language-to-language conversion: from VB to C, same semantics.
option explicit const pi180= 0.01745329251994329576923690768489 const pi=3.1415926535897932384626433832795 class turtle dim fso dim fn dim svg dim iang dim ori dim incr dim pdown dim clr dim x dim y public property let orient(n):ori = n*pi180 :end property public property let iangle(n):iang= n*pi180 :end property public sub pd() : pdown=true: end sub public sub pu() :pdown=FALSE :end sub public sub rt(i) ori=ori - i*iang: end sub public sub lt(i): ori=(ori + i*iang) end sub public sub bw(l) x= x+ cos(ori+pi)*l*incr y= y+ sin(ori+pi)*l*incr end sub public sub fw(l) dim x1,y1 x1=x + cos(ori)*l*incr y1=y + sin(ori)*l*incr if pdown then line x,y,x1,y1 x=x1:y=y1 end sub Private Sub Class_Initialize() setlocale "us" initsvg x=400:y=400:incr=100 ori=90*pi180 iang=90*pi180 clr=0 pdown=true end sub Private Sub Class_Terminate() disply end sub private sub line (x,y,x1,y1) svg.WriteLine "<line x1=""" & x & """ y1= """& y & """ x2=""" & x1& """ y2=""" & y1 & """/>" end sub private sub disply() dim shell svg.WriteLine "</svg></body></html>" svg.close Set shell = CreateObject("Shell.Application") shell.ShellExecute fn,1,False end sub private sub initsvg() dim scriptpath Set fso = CreateObject ("Scripting.Filesystemobject") ScriptPath= Left(WScript.ScriptFullName, InStrRev(WScript.ScriptFullName, "\")) fn=Scriptpath & "SIERP.HTML" Set svg = fso.CreateTextFile(fn,True) if SVG IS nothing then wscript.echo "Can svg.WriteLine "<!DOCTYPE html>" &vbcrlf & "<html>" &vbcrlf & "<head>" svg.writeline "<style>" & vbcrlf & "line {stroke:rgb(255,0,0);stroke-width:.5}" &vbcrlf &"</style>" svg.writeline "</head>"&vbcrlf & "<body>" svg.WriteLine "<svg xmlns=""http://www.w3.org/2000/svg"" width=""800"" height=""800"" viewBox=""0 0 800 800"">" end sub end class sub dragon(st,le,dir) if st=0 then x.fw le: exit sub x.rt dir dragon st-1, le/1.41421 ,1 x.rt dir*2 dragon st-1, le/1.41421 ,-1 x.rt dir end sub dim x set x=new turtle x.iangle=45 x.orient=45 x.incr=1 x.x=200:x.y=200 dragon 12,300,1 set x=nothing
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <math.h> long long x, y, dx, dy, scale, clen; typedef struct { double r, g, b; } rgb; rgb ** pix; void sc_up() { long long tmp = dx - dy; dy = dx + dy; dx = tmp; scale *= 2; x *= 2; y *= 2; } void h_rgb(long long x, long long y) { rgb *p = &pix[y][x]; # define SAT 1 double h = 6.0 * clen / scale; double VAL = 1 - (cos(3.141592653579 * 64 * clen / scale) - 1) / 4; double c = SAT * VAL; double X = c * (1 - fabs(fmod(h, 2) - 1)); switch((int)h) { case 0: p->r += c; p->g += X; return; case 1: p->r += X; p->g += c; return; case 2: p->g += c; p->b += X; return; case 3: p->g += X; p->b += c; return; case 4: p->r += X; p->b += c; return; default: p->r += c; p->b += X; } } void iter_string(const char * str, int d) { long tmp; # define LEFT tmp = -dy; dy = dx; dx = tmp # define RIGHT tmp = dy; dy = -dx; dx = tmp while (*str != '\0') { switch(*(str++)) { case 'X': if (d) iter_string("X+YF+", d - 1); continue; case 'Y': if (d) iter_string("-FX-Y", d - 1); continue; case '+': RIGHT; continue; case '-': LEFT; continue; case 'F': clen ++; h_rgb(x/scale, y/scale); x += dx; y += dy; continue; } } } void dragon(long leng, int depth) { long i, d = leng / 3 + 1; long h = leng + 3, w = leng + d * 3 / 2 + 2; rgb *buf = malloc(sizeof(rgb) * w * h); pix = malloc(sizeof(rgb *) * h); for (i = 0; i < h; i++) pix[i] = buf + w * i; memset(buf, 0, sizeof(rgb) * w * h); x = y = d; dx = leng; dy = 0; scale = 1; clen = 0; for (i = 0; i < depth; i++) sc_up(); iter_string("FX", depth); unsigned char *fpix = malloc(w * h * 3); double maxv = 0, *dbuf = (double*)buf; for (i = 3 * w * h - 1; i >= 0; i--) if (dbuf[i] > maxv) maxv = dbuf[i]; for (i = 3 * h * w - 1; i >= 0; i--) fpix[i] = 255 * dbuf[i] / maxv; printf("P6\n%ld %ld\n255\n", w, h); fflush(stdout); fwrite(fpix, h * w * 3, 1, stdout); } int main(int c, char ** v) { int size, depth; depth = (c > 1) ? atoi(v[1]) : 10; size = 1 << depth; fprintf(stderr, "size: %d depth: %d\n", size, depth); dragon(size, depth * 2); return 0; }
Produce a language-to-language conversion: from VB to C, same semantics.
$Include "Rapidq.inc" dim file as qfilestream if file.open("c:\A Test.txt", fmOpenRead) then while not File.eof print File.readline wend else print "Cannot read file" end if input "Press enter to exit: ";a$
#include <conio.h> #include <stdio.h> int main() { int n1, n2, n3; printf( "\n Introduzca el primer n%cmero (entero): ", 163 ); scanf( "%d", &n1 ); printf( "\n Introduzca el segundo n%cmero (entero): ", 163 ); scanf( "%d", &n2 ); printf( "\n Introduzca el tercer n%cmero (entero): ", 163 ); scanf( "%d", &n3 ); if ( n1 >= n2 && n1 >= n3 ) printf( "\n %d es el mayor.", n1 ); else if ( n2 > n3 ) printf( "\n %d es el mayor.", n2 ); else printf( "\n %d es el mayor.", n3 ); getch(); return 0; }
Produce a functionally identical C code for the snippet given in VB.
Public Sub Insert(ByVal a As Node(Of T), ByVal b As Node(Of T), ByVal c As T) Dim node As New Node(Of T)(value) a.Next = node node.Previous = a b.Previous = node node.Next = b End Sub
void insert(link* anchor, link* newlink) { newlink->next = anchor->next; newlink->prev = anchor; (newlink->next)->prev = newlink; anchor->next = newlink; }
Please provide an equivalent version of this VB code in C.
Dim s As Variant Private Function quick_select(ByRef s As Variant, k As Integer) As Integer Dim left As Integer, right As Integer, pos As Integer Dim pivotValue As Integer, tmp As Integer left = 1: right = UBound(s) Do While left < right pivotValue = s(k) tmp = s(k) s(k) = s(right) s(right) = tmp pos = left For i = left To right If s(i) < pivotValue Then tmp = s(i) s(i) = s(pos) s(pos) = tmp pos = pos + 1 End If Next i tmp = s(right) s(right) = s(pos) s(pos) = tmp If pos = k Then Exit Do End If If pos < k Then left = pos + 1 Else right = pos - 1 End If Loop quick_select = s(k) End Function Public Sub main() Dim r As Integer, i As Integer s = [{9, 8, 7, 6, 5, 0, 1, 2, 3, 4}] For i = 1 To 10 r = quick_select(s, i) Debug.Print IIf(i < 10, r & ", ", "" & r); Next i End Sub
#include <stdio.h> #include <string.h> int qselect(int *v, int len, int k) { # define SWAP(a, b) { tmp = v[a]; v[a] = v[b]; v[b] = tmp; } int i, st, tmp; for (st = i = 0; i < len - 1; i++) { if (v[i] > v[len-1]) continue; SWAP(i, st); st++; } SWAP(len-1, st); return k == st ?v[st] :st > k ? qselect(v, st, k) : qselect(v + st, len - st, k - st); } int main(void) { # define N (sizeof(x)/sizeof(x[0])) int x[] = {9, 8, 7, 6, 5, 0, 1, 2, 3, 4}; int y[N]; int i; for (i = 0; i < 10; i++) { memcpy(y, x, sizeof(x)); printf("%d: %d\n", i, qselect(y, 10, i)); } return 0; }
Produce a functionally identical C code for the snippet given in VB.
Private Function to_base(ByVal number As Long, base As Integer) As String Dim digits As String, result As String Dim i As Integer, digit As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" Do While number > 0 digit = number Mod base result = Mid(digits, digit + 1, 1) & result number = number \ base Loop to_base = result End Function Private Function from_base(number As String, base As Integer) As Long Dim digits As String, result As Long Dim i As Integer digits = "0123456789abcdefghijklmnopqrstuvwxyz" result = Val(InStr(1, digits, Mid(number, 1, 1), vbTextCompare) - 1) For i = 2 To Len(number) result = result * base + Val(InStr(1, digits, Mid(number, i, 1), vbTextCompare) - 1) Next i from_base = result End Function Public Sub Non_decimal_radices_Convert() Debug.Print "26 decimal in base 16 is: "; to_base(26, 16); ". Conversely, hexadecimal 1a in decimal is: "; from_base("1a", 16) End Sub
#include <stdlib.h> #include <string.h> #include <stdio.h> #include <stdint.h> char *to_base(int64_t num, int base) { char *tbl = "0123456789abcdefghijklmnopqrstuvwxyz"; char buf[66] = {'\0'}; char *out; uint64_t n; int i, len = 0, neg = 0; if (base > 36) { fprintf(stderr, "base %d too large\n", base); return 0; } n = ((neg = num < 0)) ? (~num) + 1 : num; do { buf[len++] = tbl[n % base]; } while(n /= base); out = malloc(len + neg + 1); for (i = neg; len > 0; i++) out[i] = buf[--len]; if (neg) out[0] = '-'; return out; } long from_base(const char *num_str, int base) { char *endptr; int result = strtol(num_str, &endptr, base); return result; } int main() { int64_t x; x = ~(1LL << 63) + 1; printf("%lld in base 2: %s\n", x, to_base(x, 2)); x = 383; printf("%lld in base 16: %s\n", x, to_base(x, 16)); return 0; }
Port the following code from VB to C with equivalent syntax and logic.
Sub printFiles(parentDir As FolderItem, pattern As String) For i As Integer = 1 To parentDir.Count If parentDir.Item(i).Directory Then printFiles(parentDir.Item(i), pattern) Else Dim rg as New RegEx Dim myMatch as RegExMatch rg.SearchPattern = pattern myMatch = rg.search(parentDir.Item(i).Name) If myMatch <> Nil Then Print(parentDir.Item(i).AbsolutePath) End If Next End Sub
#include <sys/types.h> #include <sys/stat.h> #include <unistd.h> #include <dirent.h> #include <regex.h> #include <stdio.h> #include <string.h> #include <errno.h> #include <err.h> enum { WALK_OK = 0, WALK_BADPATTERN, WALK_NAMETOOLONG, WALK_BADIO, }; #define WS_NONE 0 #define WS_RECURSIVE (1 << 0) #define WS_DEFAULT WS_RECURSIVE #define WS_FOLLOWLINK (1 << 1) #define WS_DOTFILES (1 << 2) #define WS_MATCHDIRS (1 << 3) int walk_recur(char *dname, regex_t *reg, int spec) { struct dirent *dent; DIR *dir; struct stat st; char fn[FILENAME_MAX]; int res = WALK_OK; int len = strlen(dname); if (len >= FILENAME_MAX - 1) return WALK_NAMETOOLONG; strcpy(fn, dname); fn[len++] = '/'; if (!(dir = opendir(dname))) { warn("can't open %s", dname); return WALK_BADIO; } errno = 0; while ((dent = readdir(dir))) { if (!(spec & WS_DOTFILES) && dent->d_name[0] == '.') continue; if (!strcmp(dent->d_name, ".") || !strcmp(dent->d_name, "..")) continue; strncpy(fn + len, dent->d_name, FILENAME_MAX - len); if (lstat(fn, &st) == -1) { warn("Can't stat %s", fn); res = WALK_BADIO; continue; } if (S_ISLNK(st.st_mode) && !(spec & WS_FOLLOWLINK)) continue; if (S_ISDIR(st.st_mode)) { if ((spec & WS_RECURSIVE)) walk_recur(fn, reg, spec); if (!(spec & WS_MATCHDIRS)) continue; } if (!regexec(reg, fn, 0, 0, 0)) puts(fn); } if (dir) closedir(dir); return res ? res : errno ? WALK_BADIO : WALK_OK; } int walk_dir(char *dname, char *pattern, int spec) { regex_t r; int res; if (regcomp(&r, pattern, REG_EXTENDED | REG_NOSUB)) return WALK_BADPATTERN; res = walk_recur(dname, &r, spec); regfree(&r); return res; } int main() { int r = walk_dir(".", ".\\.c$", WS_DEFAULT|WS_MATCHDIRS); switch(r) { case WALK_OK: break; case WALK_BADIO: err(1, "IO error"); case WALK_BADPATTERN: err(1, "Bad pattern"); case WALK_NAMETOOLONG: err(1, "Filename too long"); default: err(1, "Unknown error?"); } return 0; }
Keep all operations the same but rewrite the snippet in C.
dim crctbl(255) const crcc =&hEDB88320 sub gencrctable for i= 0 to 255 k=i for j=1 to 8 if k and 1 then k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) k=k xor crcc else k=(k and &h7fffffff)\2 or (&h40000000 and ((k and &h80000000)<>0)) end if next crctbl(i)=k next end sub function crc32 (buf) dim r,r1,i r=&hffffffff for i=1 to len(buf) r1=(r and &h7fffffff)\&h100 or (&h800000 and (r and &h80000000)<>0) r=r1 xor crctbl((asc(mid(buf,i,1))xor r) and 255) next crc32=r xor &hffffffff end function gencrctable wscript.stdout.writeline hex(crc32("The quick brown fox jumps over the lazy dog"))
#include <stdio.h> #include <string.h> #include <zlib.h> int main() { const char *s = "The quick brown fox jumps over the lazy dog"; printf("%lX\n", crc32(0, (const void*)s, strlen(s))); return 0; }
Convert this VB block to C, preserving its control flow and logic.
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
#include <stdio.h> const char *input = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; " "he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!"; int main() { const char *s; printf("<table>\n<tr><td>"); for (s = input; *s; s++) { switch(*s) { case '\n': printf("</td></tr>\n<tr><td>"); break; case ',': printf("</td><td>"); break; case '<': printf("&lt;"); break; case '>': printf("&gt;"); break; case '&': printf("&amp;"); break; default: putchar(*s); } } puts("</td></tr>\n</table>"); return 0; }
Generate an equivalent C version of this VB code.
Public Sub CSV_TO_HTML() input_ = "Character,Speech\n" & _ "The multitude,The messiah! Show us the messiah!\n" & _ "Brians mother,<angry>Now you listen here! He "he "The multitude,Who are you?\n" & _ "Brians mother,I "The multitude,Behold his mother! Behold his mother!" Debug.Print "<table>" & vbCrLf & "<tr><td>" For i = 1 To Len(input_) Select Case Mid(input_, i, 1) Case "\" If Mid(input_, i + 1, 1) = "n" Then Debug.Print "</td></tr>" & vbCrLf & "<tr><td>"; i = i + 1 Else Debug.Print Mid(input_, i, 1); End If Case ",": Debug.Print "</td><td>"; Case "<": Debug.Print "&lt;"; Case ">": Debug.Print "&gt;"; Case "&": Debug.Print "&amp;"; Case Else: Debug.Print Mid(input_, i, 1); End Select Next i Debug.Print "</td></tr>" & vbCrLf & "</table>" End Sub
#include <stdio.h> const char *input = "Character,Speech\n" "The multitude,The messiah! Show us the messiah!\n" "Brians mother,<angry>Now you listen here! He's not the messiah; " "he's a very naughty boy! Now go away!</angry>\n" "The multitude,Who are you?\n" "Brians mother,I'm his mother; that's who!\n" "The multitude,Behold his mother! Behold his mother!"; int main() { const char *s; printf("<table>\n<tr><td>"); for (s = input; *s; s++) { switch(*s) { case '\n': printf("</td></tr>\n<tr><td>"); break; case ',': printf("</td><td>"); break; case '<': printf("&lt;"); break; case '>': printf("&gt;"); break; case '&': printf("&amp;"); break; default: putchar(*s); } } puts("</td></tr>\n</table>"); return 0; }
Convert this VB snippet to C and keep its semantics consistent.
Class NumberContainer Private TheNumber As Integer Sub Constructor(InitialNumber As Integer) TheNumber = InitialNumber End Sub Function Number() As Integer Return TheNumber End Function Sub Number(Assigns NewNumber As Integer) TheNumber = NewNumber End Sub End Class
#include <stdlib.h> typedef struct sMyClass { int variable; } *MyClass; MyClass MyClass_new() { MyClass pthis = malloc(sizeof *pthis); pthis->variable = 0; return pthis; } void MyClass_delete(MyClass* pthis) { if (pthis) { free(*pthis); *pthis = NULL; } } void MyClass_someMethod(MyClass pthis) { pthis->variable = 1; } MyClass obj = MyClass_new(); MyClass_someMethod(obj); MyClass_delete(&obj);
Write the same algorithm in C as shown in this VB implementation.
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
#include <stdio.h> #include <stdint.h> typedef uint64_t ulong; int kaprekar(ulong n, int base) { ulong nn = n * n, r, tens = 1; if ((nn - n) % (base - 1)) return 0; while (tens < n) tens *= base; if (n == tens) return 1 == n; while ((r = nn % tens) < n) { if (nn / tens + r == n) return tens; tens *= base; } return 0; } void print_num(ulong n, int base) { ulong q, div = base; while (div < n) div *= base; while (n && (div /= base)) { q = n / div; if (q < 10) putchar(q + '0'); else putchar(q + 'a' - 10); n -= q * div; } } int main() { ulong i, tens; int cnt = 0; int base = 10; printf("base 10:\n"); for (i = 1; i < 1000000; i++) if (kaprekar(i, base)) printf("%3d: %llu\n", ++cnt, i); base = 17; printf("\nbase %d:\n 1: 1\n", base); for (i = 2, cnt = 1; i < 1000000; i++) if ((tens = kaprekar(i, base))) { printf("%3d: %llu", ++cnt, i); printf(" \t"); print_num(i, base); printf("\t"); print_num(i * i, base); printf("\t"); print_num(i * i / tens, base); printf(" + "); print_num(i * i % tens, base); printf("\n"); } return 0; }
Write the same algorithm in C as shown in this VB implementation.
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
#include <stdio.h> #include <stdint.h> typedef uint64_t ulong; int kaprekar(ulong n, int base) { ulong nn = n * n, r, tens = 1; if ((nn - n) % (base - 1)) return 0; while (tens < n) tens *= base; if (n == tens) return 1 == n; while ((r = nn % tens) < n) { if (nn / tens + r == n) return tens; tens *= base; } return 0; } void print_num(ulong n, int base) { ulong q, div = base; while (div < n) div *= base; while (n && (div /= base)) { q = n / div; if (q < 10) putchar(q + '0'); else putchar(q + 'a' - 10); n -= q * div; } } int main() { ulong i, tens; int cnt = 0; int base = 10; printf("base 10:\n"); for (i = 1; i < 1000000; i++) if (kaprekar(i, base)) printf("%3d: %llu\n", ++cnt, i); base = 17; printf("\nbase %d:\n 1: 1\n", base); for (i = 2, cnt = 1; i < 1000000; i++) if ((tens = kaprekar(i, base))) { printf("%3d: %llu", ++cnt, i); printf(" \t"); print_num(i, base); printf("\t"); print_num(i * i, base); printf("\t"); print_num(i * i / tens, base); printf(" + "); print_num(i * i % tens, base); printf("\n"); } return 0; }
Convert this VB block to C, preserving its control flow and logic.
Module Module1 ReadOnly max As ULong = 1000000 Function Kaprekar(n As ULong) As Boolean If n = 1 Then Return True Dim sq = n * n Dim sq_str = Str(sq) Dim l = Len(sq_str) For x = l - 1 To 1 Step -1 If sq_str(x) = "0" Then l = l - 1 Else Exit For End If Next For x = 1 To l - 1 Dim p2 = Val(Mid(sq_str, x + 1)) If p2 > n Then Continue For End If Dim p1 = Val(Left(sq_str, x)) If p1 > n Then Return False If (p1 + p2) = n Then Return True Next Return False End Function Sub Main() Dim count = 0 Console.WriteLine("Kaprekar numbers below 10000") For n = 1 To max - 1 If Kaprekar(n) Then count = count + 1 If n < 10000 Then Console.WriteLine("{0,2} {1,4}", count, n) End If End If Next Console.WriteLine() Console.WriteLine("{0} numbers below {1} are kaprekar numbers", count, max) End Sub End Module
#include <stdio.h> #include <stdint.h> typedef uint64_t ulong; int kaprekar(ulong n, int base) { ulong nn = n * n, r, tens = 1; if ((nn - n) % (base - 1)) return 0; while (tens < n) tens *= base; if (n == tens) return 1 == n; while ((r = nn % tens) < n) { if (nn / tens + r == n) return tens; tens *= base; } return 0; } void print_num(ulong n, int base) { ulong q, div = base; while (div < n) div *= base; while (n && (div /= base)) { q = n / div; if (q < 10) putchar(q + '0'); else putchar(q + 'a' - 10); n -= q * div; } } int main() { ulong i, tens; int cnt = 0; int base = 10; printf("base 10:\n"); for (i = 1; i < 1000000; i++) if (kaprekar(i, base)) printf("%3d: %llu\n", ++cnt, i); base = 17; printf("\nbase %d:\n 1: 1\n", base); for (i = 2, cnt = 1; i < 1000000; i++) if ((tens = kaprekar(i, base))) { printf("%3d: %llu", ++cnt, i); printf(" \t"); print_num(i, base); printf("\t"); print_num(i * i, base); printf("\t"); print_num(i * i / tens, base); printf(" + "); print_num(i * i % tens, base); printf("\n"); } return 0; }
Produce a language-to-language conversion: from VB to C, same semantics.
Option Explicit Const numchars=127 Function LZWCompress(si) Dim oDict, intMaxCode, i,z,ii,ss,strCurrent,strNext,j Set oDict = CreateObject("Scripting.Dictionary") ReDim a(Len(si)) intMaxCode = numchars For i = 0 To numchars oDict.Add Chr(i), i Next strCurrent = Left(si,1) j=0 For ii=2 To Len(si) strNext = Mid(si,ii,1) ss=strCurrent & strNext If oDict.Exists(ss) Then strCurrent = ss Else a(j)=oDict.Item(strCurrent) :j=j+1 intMaxCode = intMaxCode + 1 oDict.Add ss, intMaxCode strCurrent = strNext End If Next a(j)=oDict.Item(strCurrent) ReDim preserve a(j) LZWCompress=a Set oDict = Nothing End Function Function lzwUncompress(sc) Dim intNext, intCurrent, intMaxCode, i,ss,istr,s,j s="" reDim dict(1000) intMaxCode = numchars For i = 0 To numchars : dict(i)= Chr(i) : Next intCurrent=sc(0) For j=1 To UBound(sc) ss=dict(intCurrent) s= s & ss intMaxCode = intMaxCode + 1 intnext=sc(j) If intNext<intMaxCode Then dict(intMaxCode)=ss & Left(dict(intNext), 1) Else dict(intMaxCode)=ss & Left(ss, 1) End If intCurrent = intNext Next s= s & dict(intCurrent) lzwUncompress=s End function Sub printvec(a) Dim s,i,x s="(" For i=0 To UBound (a) s=s & x & a(i) x=", " Next WScript.echo s &")" End sub Dim a,b b="TOBEORNOTTOBEORTOBEORNOT" WScript.Echo b a=LZWCompress (b) printvec(a) WScript.echo lzwUncompress (a ) wscript.quit 1
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <stdint.h> #include <unistd.h> #include <fcntl.h> #include <sys/types.h> #include <sys/stat.h> void* mem_alloc(size_t item_size, size_t n_item) { size_t *x = calloc(1, sizeof(size_t)*2 + n_item * item_size); x[0] = item_size; x[1] = n_item; return x + 2; } void* mem_extend(void *m, size_t new_n) { size_t *x = (size_t*)m - 2; x = realloc(x, sizeof(size_t) * 2 + *x * new_n); if (new_n > x[1]) memset((char*)(x + 2) + x[0] * x[1], 0, x[0] * (new_n - x[1])); x[1] = new_n; return x + 2; } inline void _clear(void *m) { size_t *x = (size_t*)m - 2; memset(m, 0, x[0] * x[1]); } #define _new(type, n) mem_alloc(sizeof(type), n) #define _del(m) { free((size_t*)(m) - 2); m = 0; } #define _len(m) *((size_t*)m - 1) #define _setsize(m, n) m = mem_extend(m, n) #define _extend(m) m = mem_extend(m, _len(m) * 2) typedef uint8_t byte; typedef uint16_t ushort; #define M_CLR 256 #define M_EOD 257 #define M_NEW 258 typedef struct { ushort next[256]; } lzw_enc_t; typedef struct { ushort prev, back; byte c; } lzw_dec_t; byte* lzw_encode(byte *in, int max_bits) { int len = _len(in), bits = 9, next_shift = 512; ushort code, c, nc, next_code = M_NEW; lzw_enc_t *d = _new(lzw_enc_t, 512); if (max_bits > 15) max_bits = 15; if (max_bits < 9 ) max_bits = 12; byte *out = _new(ushort, 4); int out_len = 0, o_bits = 0; uint32_t tmp = 0; inline void write_bits(ushort x) { tmp = (tmp << bits) | x; o_bits += bits; if (_len(out) <= out_len) _extend(out); while (o_bits >= 8) { o_bits -= 8; out[out_len++] = tmp >> o_bits; tmp &= (1 << o_bits) - 1; } } for (code = *(in++); --len; ) { c = *(in++); if ((nc = d[code].next[c])) code = nc; else { write_bits(code); nc = d[code].next[c] = next_code++; code = c; } if (next_code == next_shift) { if (++bits > max_bits) { write_bits(M_CLR); bits = 9; next_shift = 512; next_code = M_NEW; _clear(d); } else _setsize(d, next_shift *= 2); } } write_bits(code); write_bits(M_EOD); if (tmp) write_bits(tmp); _del(d); _setsize(out, out_len); return out; } byte* lzw_decode(byte *in) { byte *out = _new(byte, 4); int out_len = 0; inline void write_out(byte c) { while (out_len >= _len(out)) _extend(out); out[out_len++] = c; } lzw_dec_t *d = _new(lzw_dec_t, 512); int len, j, next_shift = 512, bits = 9, n_bits = 0; ushort code, c, t, next_code = M_NEW; uint32_t tmp = 0; inline void get_code() { while(n_bits < bits) { if (len > 0) { len --; tmp = (tmp << 8) | *(in++); n_bits += 8; } else { tmp = tmp << (bits - n_bits); n_bits = bits; } } n_bits -= bits; code = tmp >> n_bits; tmp &= (1 << n_bits) - 1; } inline void clear_table() { _clear(d); for (j = 0; j < 256; j++) d[j].c = j; next_code = M_NEW; next_shift = 512; bits = 9; }; clear_table(); for (len = _len(in); len;) { get_code(); if (code == M_EOD) break; if (code == M_CLR) { clear_table(); continue; } if (code >= next_code) { fprintf(stderr, "Bad sequence\n"); _del(out); goto bail; } d[next_code].prev = c = code; while (c > 255) { t = d[c].prev; d[t].back = c; c = t; } d[next_code - 1].c = c; while (d[c].back) { write_out(d[c].c); t = d[c].back; d[c].back = 0; c = t; } write_out(d[c].c); if (++next_code >= next_shift) { if (++bits > 16) { fprintf(stderr, "Too many bits\n"); _del(out); goto bail; } _setsize(d, next_shift *= 2); } } if (code != M_EOD) fputs("Bits did not end in EOD\n", stderr); _setsize(out, out_len); bail: _del(d); return out; } int main() { int i, fd = open("unixdict.txt", O_RDONLY); if (fd == -1) { fprintf(stderr, "Can't read file\n"); return 1; }; struct stat st; fstat(fd, &st); byte *in = _new(char, st.st_size); read(fd, in, st.st_size); _setsize(in, st.st_size); close(fd); printf("input size: %d\n", _len(in)); byte *enc = lzw_encode(in, 9); printf("encoded size: %d\n", _len(enc)); byte *dec = lzw_decode(enc); printf("decoded size: %d\n", _len(dec)); for (i = 0; i < _len(dec); i++) if (dec[i] != in[i]) { printf("bad decode at %d\n", i); break; } if (i == _len(dec)) printf("Decoded ok\n"); _del(in); _del(enc); _del(dec); return 0; }
Maintain the same structure and functionality when rewriting this code in C.
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
#include <stdio.h> #include <stdlib.h> typedef unsigned long long xint; typedef struct { size_t len, alloc; xint *buf; } xarray; xarray rs, ss; void setsize(xarray *a, size_t size) { size_t n = a->alloc; if (!n) n = 1; while (n < size) n <<= 1; if (a->alloc < n) { a->buf = realloc(a->buf, sizeof(xint) * n); if (!a->buf) abort(); a->alloc = n; } } void push(xarray *a, xint v) { while (a->alloc <= a->len) setsize(a, a->alloc * 2); a->buf[a->len++] = v; } void RS_append(void); xint R(int n) { while (n > rs.len) RS_append(); return rs.buf[n - 1]; } xint S(int n) { while (n > ss.len) RS_append(); return ss.buf[n - 1]; } void RS_append() { int n = rs.len; xint r = R(n) + S(n); xint s = S(ss.len); push(&rs, r); while (++s < r) push(&ss, s); push(&ss, r + 1); } int main(void) { push(&rs, 1); push(&ss, 2); int i; printf("R(1 .. 10):"); for (i = 1; i <= 10; i++) printf(" %llu", R(i)); char seen[1001] = { 0 }; for (i = 1; i <= 40; i++) seen[ R(i) ] = 1; for (i = 1; i <= 960; i++) seen[ S(i) ] = 1; for (i = 1; i <= 1000 && seen[i]; i++); if (i <= 1000) { fprintf(stderr, "%d not seen\n", i); abort(); } puts("\nfirst 1000 ok"); return 0; }
Please provide an equivalent version of this VB code in C.
Private Function ffr(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j Next i ffr = R(n) Set R = Nothing Set S = Nothing End Function Private Function ffs(n As Long) As Long Dim R As New Collection Dim S As New Collection R.Add 1 S.Add 2 For i = 2 To n R.Add R(i - 1) + S(i - 1) For j = S(S.Count) + 1 To R(i) - 1 S.Add j Next j For j = R(i) + 1 To R(i) + S(i - 1) S.Add j Next j If S.Count >= n Then Exit For Next i ffs = S(n) Set R = Nothing Set S = Nothing End Function Public Sub main() Dim i As Long Debug.Print "The first ten values of R are:" For i = 1 To 10 Debug.Print ffr(i); Next i Debug.Print Dim x As New Collection For i = 1 To 1000 x.Add i, CStr(i) Next i For i = 1 To 40 x.Remove CStr(ffr(i)) Next i For i = 1 To 960 x.Remove CStr(ffs(i)) Next i Debug.Print "The first 40 values of ffr plus the first 960 values of ffs " Debug.Print "include all the integers from 1 to 1000 exactly once is "; Format(x.Count = 0) End Sub
#include <stdio.h> #include <stdlib.h> typedef unsigned long long xint; typedef struct { size_t len, alloc; xint *buf; } xarray; xarray rs, ss; void setsize(xarray *a, size_t size) { size_t n = a->alloc; if (!n) n = 1; while (n < size) n <<= 1; if (a->alloc < n) { a->buf = realloc(a->buf, sizeof(xint) * n); if (!a->buf) abort(); a->alloc = n; } } void push(xarray *a, xint v) { while (a->alloc <= a->len) setsize(a, a->alloc * 2); a->buf[a->len++] = v; } void RS_append(void); xint R(int n) { while (n > rs.len) RS_append(); return rs.buf[n - 1]; } xint S(int n) { while (n > ss.len) RS_append(); return ss.buf[n - 1]; } void RS_append() { int n = rs.len; xint r = R(n) + S(n); xint s = S(ss.len); push(&rs, r); while (++s < r) push(&ss, s); push(&ss, r + 1); } int main(void) { push(&rs, 1); push(&ss, 2); int i; printf("R(1 .. 10):"); for (i = 1; i <= 10; i++) printf(" %llu", R(i)); char seen[1001] = { 0 }; for (i = 1; i <= 40; i++) seen[ R(i) ] = 1; for (i = 1; i <= 960; i++) seen[ S(i) ] = 1; for (i = 1; i <= 1000 && seen[i]; i++); if (i <= 1000) { fprintf(stderr, "%d not seen\n", i); abort(); } puts("\nfirst 1000 ok"); return 0; }
Please provide an equivalent version of this VB code in C.
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
#include <stdio.h> #include <stdlib.h> int f(int n, int x, int y) { return (x + y*2 + 1)%n; } int main(int argc, char **argv) { int i, j, n; if(argc!=2) return 1; n = atoi(argv[1]); if (n < 3 || (n%2) == 0) return 2; for (i = 0; i < n; i++) { for (j = 0; j < n; j++) printf("% 4d", f(n, n - j - 1, i)*n + f(n, j, i) + 1); putchar('\n'); } printf("\n Magic Constant: %d.\n", (n*n+1)/2*n); return 0; }
Can you help me rewrite this code in C instead of VB, keeping it the same logically?
Sub magicsquare() Const n = 9 Dim i As Integer, j As Integer, v As Integer Debug.Print "The square order is: " & n For i = 1 To n For j = 1 To n Cells(i, j) = ((i * 2 - j + n - 1) Mod n) * n + ((i * 2 + j - 2) Mod n) + 1 Next j Next i Debug.Print "The magic number of"; n; "x"; n; "square is:"; n * (n * n + 1) \ 2 End Sub
#include <stdio.h> #include <stdlib.h> int f(int n, int x, int y) { return (x + y*2 + 1)%n; } int main(int argc, char **argv) { int i, j, n; if(argc!=2) return 1; n = atoi(argv[1]); if (n < 3 || (n%2) == 0) return 2; for (i = 0; i < n; i++) { for (j = 0; j < n; j++) printf("% 4d", f(n, n - j - 1, i)*n + f(n, j, i) + 1); putchar('\n'); } printf("\n Magic Constant: %d.\n", (n*n+1)/2*n); return 0; }
Write the same algorithm in C as shown in this VB implementation.
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
#include <stdio.h> #include <stdlib.h> #include <math.h> float *benford_distribution(void) { static float prob[9]; for (int i = 1; i < 10; i++) prob[i - 1] = log10f(1 + 1.0 / i); return prob; } float *get_actual_distribution(char *fn) { FILE *input = fopen(fn, "r"); if (!input) { perror("Can't open file"); exit(EXIT_FAILURE); } int tally[9] = { 0 }; char c; int total = 0; while ((c = getc(input)) != EOF) { while (c < '1' || c > '9') c = getc(input); tally[c - '1']++; total++; while ((c = getc(input)) != '\n' && c != EOF) ; } fclose(input); static float freq[9]; for (int i = 0; i < 9; i++) freq[i] = tally[i] / (float) total; return freq; } int main(int argc, char **argv) { if (argc != 2) { printf("Usage: benford <file>\n"); return EXIT_FAILURE; } float *actual = get_actual_distribution(argv[1]); float *expected = benford_distribution(); puts("digit\tactual\texpected"); for (int i = 0; i < 9; i++) printf("%d\t%.3f\t%.3f\n", i + 1, actual[i], expected[i]); return EXIT_SUCCESS; }
Translate this program into C but keep the logic exactly as in VB.
Sub BenfordLaw() Dim BenResult(1 To 9) As Long BENref = "30,1%|17,6%|12,5%|9,7%|7,9%|6,7%|5,8%|5,1%|4,6%" For Each c In Selection.Cells If InStr(1, "-0123456789", Left(c, 1)) > 0 Then For i = 1 To 9 If CInt(Left(Abs(c), 1)) = i Then BenResult(i) = BenResult(i) + 1: Exit For Next End If Next Total= Application.Sum(BenResult) biggest= Len(CStr(BenResult(1))) txt = "# | Values | Real | Expected " & vbCrLf For i = 1 To 9 If BenResult(i) > 0 Then txt = txt & "#" & i & " | " & vbTab txt = txt & String((biggest - Len(CStr(BenResult(i)))) * 2, " ") & Format(BenResult(i), "0") & " | " & vbTab txt = txt & String((Len(CStr(Format(BenResult(1) / Total, "##0.0%"))) - Len(CStr(Format(BenResult(i) / Total, "##0.0%")))) * 2, " ") & Format(BenResult(i) / Total, "##0.0%") & " | " & vbTab txt = txt & Format(Split(BENref, "|")(i - 1), " ##0.0%") & vbCrLf End If Next MsgBox txt, vbOKOnly, "Finish" End Sub }
#include <stdio.h> #include <stdlib.h> #include <math.h> float *benford_distribution(void) { static float prob[9]; for (int i = 1; i < 10; i++) prob[i - 1] = log10f(1 + 1.0 / i); return prob; } float *get_actual_distribution(char *fn) { FILE *input = fopen(fn, "r"); if (!input) { perror("Can't open file"); exit(EXIT_FAILURE); } int tally[9] = { 0 }; char c; int total = 0; while ((c = getc(input)) != EOF) { while (c < '1' || c > '9') c = getc(input); tally[c - '1']++; total++; while ((c = getc(input)) != '\n' && c != EOF) ; } fclose(input); static float freq[9]; for (int i = 0; i < 9; i++) freq[i] = tally[i] / (float) total; return freq; } int main(int argc, char **argv) { if (argc != 2) { printf("Usage: benford <file>\n"); return EXIT_FAILURE; } float *actual = get_actual_distribution(argv[1]); float *expected = benford_distribution(); puts("digit\tactual\texpected"); for (int i = 0; i < 9; i++) printf("%d\t%.3f\t%.3f\n", i + 1, actual[i], expected[i]); return EXIT_SUCCESS; }
Translate the given VB code snippet into C without altering its behavior.
Sub Main() Debug.Print F(-10) Debug.Print F(10) End Sub Private Function F(N As Long) As Variant If N < 0 Then F = "Error. Negative argument" ElseIf N <= 1 Then F = N Else F = F(N - 1) + F(N - 2) End If End Function
#include <stdio.h> long fib(long x) { long fib_i(long n) { return n < 2 ? n : fib_i(n - 2) + fib_i(n - 1); }; if (x < 0) { printf("Bad argument: fib(%ld)\n", x); return -1; } return fib_i(x); } long fib_i(long n) { printf("This is not the fib you are looking for\n"); return -1; } int main() { long x; for (x = -1; x < 4; x ++) printf("fib %ld = %ld\n", x, fib(x)); printf("calling fib_i from outside fib:\n"); fib_i(3); return 0; }
Port the following code from VB to C with equivalent syntax and logic.
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
#include <string.h> #include <stdlib.h> #include <stdio.h> int main( int argc, char ** argv ){ const char * str_a = "knight"; const char * str_b = "socks"; const char * str_c = "brooms"; char * new_a = malloc( strlen( str_a ) - 1 ); char * new_b = malloc( strlen( str_b ) - 1 ); char * new_c = malloc( strlen( str_c ) - 2 ); strcpy( new_a, str_a + 1 ); strncpy( new_b, str_b, strlen( str_b ) - 1 ); strncpy( new_c, str_c + 1, strlen( str_c ) - 2 ); printf( "%s\n%s\n%s\n", new_a, new_b, new_c ); free( new_a ); free( new_b ); free( new_c ); return 0; }
Rewrite the snippet below in C so it works the same as the original VB code.
string = "Small Basic" TextWindow.WriteLine(Text.GetSubTextToEnd(string, 2)) TextWindow.WriteLine(Text.GetSubText(string, 1, Text.GetLength(string) - 1)) TextWindow.WriteLine(Text.GetSubText(string, 2, Text.GetLength(string) - 2))
#include <string.h> #include <stdlib.h> #include <stdio.h> int main( int argc, char ** argv ){ const char * str_a = "knight"; const char * str_b = "socks"; const char * str_c = "brooms"; char * new_a = malloc( strlen( str_a ) - 1 ); char * new_b = malloc( strlen( str_b ) - 1 ); char * new_c = malloc( strlen( str_c ) - 2 ); strcpy( new_a, str_a + 1 ); strncpy( new_b, str_b, strlen( str_b ) - 1 ); strncpy( new_c, str_c + 1, strlen( str_c ) - 2 ); printf( "%s\n%s\n%s\n", new_a, new_b, new_c ); free( new_a ); free( new_b ); free( new_c ); return 0; }
Convert this VB snippet to C and keep its semantics consistent.
Set objfso = CreateObject("Scripting.FileSystemObject") Set objfile = objfso.OpenTextFile(objfso.GetParentFolderName(WScript.ScriptFullName) &_ "\input.txt",1) list = "" previous_line = "" l = Len(previous_line) Do Until objfile.AtEndOfStream current_line = objfile.ReadLine If Mid(current_line,l+1,1) <> "" Then list = current_line & vbCrLf previous_line = current_line l = Len(previous_line) ElseIf Mid(current_line,l,1) <> "" And Mid(current_line,(l+1),1) = "" Then list = list & current_line & vbCrLf End If Loop WScript.Echo list objfile.Close Set objfso = Nothing
#include <stdio.h> #include <string.h> int cmp(const char *p, const char *q) { while (*p && *q) p = &p[1], q = &q[1]; return *p; } int main() { char line[65536]; char buf[1000000] = {0}; char *last = buf; char *next = buf; while (gets(line)) { strcat(line, "\n"); if (cmp(last, line)) continue; if (cmp(line, last)) next = buf; last = next; strcpy(next, line); while (*next) next = &next[1]; } printf("%s", buf); return 0; }
Rewrite the snippet below in C so it works the same as the original VB code.
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
#include <stdio.h> #include <stdarg.h> #include <stdlib.h> #include <string.h> enum { LEFT, RIGHT, STAY }; typedef struct { int state1; int symbol1; int symbol2; int dir; int state2; } transition_t; typedef struct tape_t tape_t; struct tape_t { int symbol; tape_t *left; tape_t *right; }; typedef struct { int states_len; char **states; int final_states_len; int *final_states; int symbols_len; char *symbols; int blank; int state; int tape_len; tape_t *tape; int transitions_len; transition_t ***transitions; } turing_t; int state_index (turing_t *t, char *state) { int i; for (i = 0; i < t->states_len; i++) { if (!strcmp(t->states[i], state)) { return i; } } return 0; } int symbol_index (turing_t *t, char symbol) { int i; for (i = 0; i < t->symbols_len; i++) { if (t->symbols[i] == symbol) { return i; } } return 0; } void move (turing_t *t, int dir) { tape_t *orig = t->tape; if (dir == RIGHT) { if (orig && orig->right) { t->tape = orig->right; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->left = orig; orig->right = t->tape; } } } else if (dir == LEFT) { if (orig && orig->left) { t->tape = orig->left; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->right = orig; orig->left = t->tape; } } } } turing_t *create (int states_len, ...) { va_list args; va_start(args, states_len); turing_t *t = malloc(sizeof (turing_t)); t->states_len = states_len; t->states = malloc(states_len * sizeof (char *)); int i; for (i = 0; i < states_len; i++) { t->states[i] = va_arg(args, char *); } t->final_states_len = va_arg(args, int); t->final_states = malloc(t->final_states_len * sizeof (int)); for (i = 0; i < t->final_states_len; i++) { t->final_states[i] = state_index(t, va_arg(args, char *)); } t->symbols_len = va_arg(args, int); t->symbols = malloc(t->symbols_len); for (i = 0; i < t->symbols_len; i++) { t->symbols[i] = va_arg(args, int); } t->blank = symbol_index(t, va_arg(args, int)); t->state = state_index(t, va_arg(args, char *)); t->tape_len = va_arg(args, int); t->tape = NULL; for (i = 0; i < t->tape_len; i++) { move(t, RIGHT); t->tape->symbol = symbol_index(t, va_arg(args, int)); } if (!t->tape_len) { move(t, RIGHT); } while (t->tape->left) { t->tape = t->tape->left; } t->transitions_len = va_arg(args, int); t->transitions = malloc(t->states_len * sizeof (transition_t **)); for (i = 0; i < t->states_len; i++) { t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *)); } for (i = 0; i < t->transitions_len; i++) { transition_t *tran = malloc(sizeof (transition_t)); tran->state1 = state_index(t, va_arg(args, char *)); tran->symbol1 = symbol_index(t, va_arg(args, int)); tran->symbol2 = symbol_index(t, va_arg(args, int)); tran->dir = va_arg(args, int); tran->state2 = state_index(t, va_arg(args, char *)); t->transitions[tran->state1][tran->symbol1] = tran; } va_end(args); return t; } void print_state (turing_t *t) { printf("%-10s ", t->states[t->state]); tape_t *tape = t->tape; while (tape->left) { tape = tape->left; } while (tape) { if (tape == t->tape) { printf("[%c]", t->symbols[tape->symbol]); } else { printf(" %c ", t->symbols[tape->symbol]); } tape = tape->right; } printf("\n"); } void run (turing_t *t) { int i; while (1) { print_state(t); for (i = 0; i < t->final_states_len; i++) { if (t->final_states[i] == t->state) { return; } } transition_t *tran = t->transitions[t->state][t->tape->symbol]; t->tape->symbol = tran->symbol2; move(t, tran->dir); t->state = tran->state2; } } int main () { printf("Simple incrementer\n"); turing_t *t = create( 2, "q0", "qf", 1, "qf", 2, 'B', '1', 'B', "q0", 3, '1', '1', '1', 2, "q0", '1', '1', RIGHT, "q0", "q0", 'B', '1', STAY, "qf" ); run(t); printf("\nThree-state busy beaver\n"); t = create( 4, "a", "b", "c", "halt", 1, "halt", 2, '0', '1', '0', "a", 0, 6, "a", '0', '1', RIGHT, "b", "a", '1', '1', LEFT, "c", "b", '0', '1', LEFT, "a", "b", '1', '1', RIGHT, "b", "c", '0', '1', LEFT, "b", "c", '1', '1', STAY, "halt" ); run(t); return 0; printf("\nFive-state two-symbol probable busy beaver\n"); t = create( 6, "A", "B", "C", "D", "E", "H", 1, "H", 2, '0', '1', '0', "A", 0, 10, "A", '0', '1', RIGHT, "B", "A", '1', '1', LEFT, "C", "B", '0', '1', RIGHT, "C", "B", '1', '1', RIGHT, "B", "C", '0', '1', RIGHT, "D", "C", '1', '0', LEFT, "E", "D", '0', '1', LEFT, "A", "D", '1', '1', LEFT, "D", "E", '0', '1', STAY, "H", "E", '1', '0', LEFT, "A" ); run(t); }
Rewrite the snippet below in C so it works the same as the original VB code.
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
#include <stdio.h> #include <stdarg.h> #include <stdlib.h> #include <string.h> enum { LEFT, RIGHT, STAY }; typedef struct { int state1; int symbol1; int symbol2; int dir; int state2; } transition_t; typedef struct tape_t tape_t; struct tape_t { int symbol; tape_t *left; tape_t *right; }; typedef struct { int states_len; char **states; int final_states_len; int *final_states; int symbols_len; char *symbols; int blank; int state; int tape_len; tape_t *tape; int transitions_len; transition_t ***transitions; } turing_t; int state_index (turing_t *t, char *state) { int i; for (i = 0; i < t->states_len; i++) { if (!strcmp(t->states[i], state)) { return i; } } return 0; } int symbol_index (turing_t *t, char symbol) { int i; for (i = 0; i < t->symbols_len; i++) { if (t->symbols[i] == symbol) { return i; } } return 0; } void move (turing_t *t, int dir) { tape_t *orig = t->tape; if (dir == RIGHT) { if (orig && orig->right) { t->tape = orig->right; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->left = orig; orig->right = t->tape; } } } else if (dir == LEFT) { if (orig && orig->left) { t->tape = orig->left; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->right = orig; orig->left = t->tape; } } } } turing_t *create (int states_len, ...) { va_list args; va_start(args, states_len); turing_t *t = malloc(sizeof (turing_t)); t->states_len = states_len; t->states = malloc(states_len * sizeof (char *)); int i; for (i = 0; i < states_len; i++) { t->states[i] = va_arg(args, char *); } t->final_states_len = va_arg(args, int); t->final_states = malloc(t->final_states_len * sizeof (int)); for (i = 0; i < t->final_states_len; i++) { t->final_states[i] = state_index(t, va_arg(args, char *)); } t->symbols_len = va_arg(args, int); t->symbols = malloc(t->symbols_len); for (i = 0; i < t->symbols_len; i++) { t->symbols[i] = va_arg(args, int); } t->blank = symbol_index(t, va_arg(args, int)); t->state = state_index(t, va_arg(args, char *)); t->tape_len = va_arg(args, int); t->tape = NULL; for (i = 0; i < t->tape_len; i++) { move(t, RIGHT); t->tape->symbol = symbol_index(t, va_arg(args, int)); } if (!t->tape_len) { move(t, RIGHT); } while (t->tape->left) { t->tape = t->tape->left; } t->transitions_len = va_arg(args, int); t->transitions = malloc(t->states_len * sizeof (transition_t **)); for (i = 0; i < t->states_len; i++) { t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *)); } for (i = 0; i < t->transitions_len; i++) { transition_t *tran = malloc(sizeof (transition_t)); tran->state1 = state_index(t, va_arg(args, char *)); tran->symbol1 = symbol_index(t, va_arg(args, int)); tran->symbol2 = symbol_index(t, va_arg(args, int)); tran->dir = va_arg(args, int); tran->state2 = state_index(t, va_arg(args, char *)); t->transitions[tran->state1][tran->symbol1] = tran; } va_end(args); return t; } void print_state (turing_t *t) { printf("%-10s ", t->states[t->state]); tape_t *tape = t->tape; while (tape->left) { tape = tape->left; } while (tape) { if (tape == t->tape) { printf("[%c]", t->symbols[tape->symbol]); } else { printf(" %c ", t->symbols[tape->symbol]); } tape = tape->right; } printf("\n"); } void run (turing_t *t) { int i; while (1) { print_state(t); for (i = 0; i < t->final_states_len; i++) { if (t->final_states[i] == t->state) { return; } } transition_t *tran = t->transitions[t->state][t->tape->symbol]; t->tape->symbol = tran->symbol2; move(t, tran->dir); t->state = tran->state2; } } int main () { printf("Simple incrementer\n"); turing_t *t = create( 2, "q0", "qf", 1, "qf", 2, 'B', '1', 'B', "q0", 3, '1', '1', '1', 2, "q0", '1', '1', RIGHT, "q0", "q0", 'B', '1', STAY, "qf" ); run(t); printf("\nThree-state busy beaver\n"); t = create( 4, "a", "b", "c", "halt", 1, "halt", 2, '0', '1', '0', "a", 0, 6, "a", '0', '1', RIGHT, "b", "a", '1', '1', LEFT, "c", "b", '0', '1', LEFT, "a", "b", '1', '1', RIGHT, "b", "c", '0', '1', LEFT, "b", "c", '1', '1', STAY, "halt" ); run(t); return 0; printf("\nFive-state two-symbol probable busy beaver\n"); t = create( 6, "A", "B", "C", "D", "E", "H", 1, "H", 2, '0', '1', '0', "A", 0, 10, "A", '0', '1', RIGHT, "B", "A", '1', '1', LEFT, "C", "B", '0', '1', RIGHT, "C", "B", '1', '1', RIGHT, "B", "C", '0', '1', RIGHT, "D", "C", '1', '0', LEFT, "E", "D", '0', '1', LEFT, "A", "D", '1', '1', LEFT, "D", "E", '0', '1', STAY, "H", "E", '1', '0', LEFT, "A" ); run(t); }
Preserve the algorithm and functionality while converting the code from VB to C.
Option Base 1 Public Enum sett name_ = 1 initState endState blank rules End Enum Public incrementer As Variant, threeStateBB As Variant, fiveStateBB As Variant Private Sub init() incrementer = Array("Simple incrementer", _ "q0", _ "qf", _ "B", _ Array( _ Array("q0", "1", "1", "right", "q0"), _ Array("q0", "B", "1", "stay", "qf"))) threeStateBB = Array("Three-state busy beaver", _ "a", _ "halt", _ "0", _ Array( _ Array("a", "0", "1", "right", "b"), _ Array("a", "1", "1", "left", "c"), _ Array("b", "0", "1", "left", "a"), _ Array("b", "1", "1", "right", "b"), _ Array("c", "0", "1", "left", "b"), _ Array("c", "1", "1", "stay", "halt"))) fiveStateBB = Array("Five-state busy beaver", _ "A", _ "H", _ "0", _ Array( _ Array("A", "0", "1", "right", "B"), _ Array("A", "1", "1", "left", "C"), _ Array("B", "0", "1", "right", "C"), _ Array("B", "1", "1", "right", "B"), _ Array("C", "0", "1", "right", "D"), _ Array("C", "1", "0", "left", "E"), _ Array("D", "0", "1", "left", "A"), _ Array("D", "1", "1", "left", "D"), _ Array("E", "0", "1", "stay", "H"), _ Array("E", "1", "0", "left", "A"))) End Sub Private Sub show(state As String, headpos As Long, tape As Collection) Debug.Print " "; state; String$(7 - Len(state), " "); "| "; For p = 1 To tape.Count Debug.Print IIf(p = headpos, "[" & tape(p) & "]", " " & tape(p) & " "); Next p Debug.Print End Sub Private Sub UTM(machine As Variant, tape As Collection, Optional countOnly As Long = 0) Dim state As String: state = machine(initState) Dim headpos As Long: headpos = 1 Dim counter As Long, rule As Variant Debug.Print machine(name_); vbCrLf; String$(Len(machine(name_)), "=") If Not countOnly Then Debug.Print " State | Tape [head]" & vbCrLf & "---------------------" Do While True If headpos > tape.Count Then tape.Add machine(blank) Else If headpos < 1 Then tape.Add machine(blank), Before:=1 headpos = 1 End If End If If Not countOnly Then show state, headpos, tape For i = LBound(machine(rules)) To UBound(machine(rules)) rule = machine(rules)(i) If rule(1) = state And rule(2) = tape(headpos) Then tape.Remove headpos If headpos > tape.Count Then tape.Add rule(3) Else tape.Add rule(3), Before:=headpos End If If rule(4) = "left" Then headpos = headpos - 1 If rule(4) = "right" Then headpos = headpos + 1 state = rule(5) Exit For End If Next i counter = counter + 1 If counter Mod 100000 = 0 Then Debug.Print counter DoEvents DoEvents End If If state = machine(endState) Then Exit Do Loop DoEvents If countOnly Then Debug.Print "Steps taken: ", counter Else show state, headpos, tape Debug.Print End If End Sub Public Sub main() init Dim tap As New Collection tap.Add "1": tap.Add "1": tap.Add "1" UTM incrementer, tap Set tap = New Collection UTM threeStateBB, tap Set tap = New Collection UTM fiveStateBB, tap, countOnly:=-1 End Sub
#include <stdio.h> #include <stdarg.h> #include <stdlib.h> #include <string.h> enum { LEFT, RIGHT, STAY }; typedef struct { int state1; int symbol1; int symbol2; int dir; int state2; } transition_t; typedef struct tape_t tape_t; struct tape_t { int symbol; tape_t *left; tape_t *right; }; typedef struct { int states_len; char **states; int final_states_len; int *final_states; int symbols_len; char *symbols; int blank; int state; int tape_len; tape_t *tape; int transitions_len; transition_t ***transitions; } turing_t; int state_index (turing_t *t, char *state) { int i; for (i = 0; i < t->states_len; i++) { if (!strcmp(t->states[i], state)) { return i; } } return 0; } int symbol_index (turing_t *t, char symbol) { int i; for (i = 0; i < t->symbols_len; i++) { if (t->symbols[i] == symbol) { return i; } } return 0; } void move (turing_t *t, int dir) { tape_t *orig = t->tape; if (dir == RIGHT) { if (orig && orig->right) { t->tape = orig->right; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->left = orig; orig->right = t->tape; } } } else if (dir == LEFT) { if (orig && orig->left) { t->tape = orig->left; } else { t->tape = calloc(1, sizeof (tape_t)); t->tape->symbol = t->blank; if (orig) { t->tape->right = orig; orig->left = t->tape; } } } } turing_t *create (int states_len, ...) { va_list args; va_start(args, states_len); turing_t *t = malloc(sizeof (turing_t)); t->states_len = states_len; t->states = malloc(states_len * sizeof (char *)); int i; for (i = 0; i < states_len; i++) { t->states[i] = va_arg(args, char *); } t->final_states_len = va_arg(args, int); t->final_states = malloc(t->final_states_len * sizeof (int)); for (i = 0; i < t->final_states_len; i++) { t->final_states[i] = state_index(t, va_arg(args, char *)); } t->symbols_len = va_arg(args, int); t->symbols = malloc(t->symbols_len); for (i = 0; i < t->symbols_len; i++) { t->symbols[i] = va_arg(args, int); } t->blank = symbol_index(t, va_arg(args, int)); t->state = state_index(t, va_arg(args, char *)); t->tape_len = va_arg(args, int); t->tape = NULL; for (i = 0; i < t->tape_len; i++) { move(t, RIGHT); t->tape->symbol = symbol_index(t, va_arg(args, int)); } if (!t->tape_len) { move(t, RIGHT); } while (t->tape->left) { t->tape = t->tape->left; } t->transitions_len = va_arg(args, int); t->transitions = malloc(t->states_len * sizeof (transition_t **)); for (i = 0; i < t->states_len; i++) { t->transitions[i] = malloc(t->symbols_len * sizeof (transition_t *)); } for (i = 0; i < t->transitions_len; i++) { transition_t *tran = malloc(sizeof (transition_t)); tran->state1 = state_index(t, va_arg(args, char *)); tran->symbol1 = symbol_index(t, va_arg(args, int)); tran->symbol2 = symbol_index(t, va_arg(args, int)); tran->dir = va_arg(args, int); tran->state2 = state_index(t, va_arg(args, char *)); t->transitions[tran->state1][tran->symbol1] = tran; } va_end(args); return t; } void print_state (turing_t *t) { printf("%-10s ", t->states[t->state]); tape_t *tape = t->tape; while (tape->left) { tape = tape->left; } while (tape) { if (tape == t->tape) { printf("[%c]", t->symbols[tape->symbol]); } else { printf(" %c ", t->symbols[tape->symbol]); } tape = tape->right; } printf("\n"); } void run (turing_t *t) { int i; while (1) { print_state(t); for (i = 0; i < t->final_states_len; i++) { if (t->final_states[i] == t->state) { return; } } transition_t *tran = t->transitions[t->state][t->tape->symbol]; t->tape->symbol = tran->symbol2; move(t, tran->dir); t->state = tran->state2; } } int main () { printf("Simple incrementer\n"); turing_t *t = create( 2, "q0", "qf", 1, "qf", 2, 'B', '1', 'B', "q0", 3, '1', '1', '1', 2, "q0", '1', '1', RIGHT, "q0", "q0", 'B', '1', STAY, "qf" ); run(t); printf("\nThree-state busy beaver\n"); t = create( 4, "a", "b", "c", "halt", 1, "halt", 2, '0', '1', '0', "a", 0, 6, "a", '0', '1', RIGHT, "b", "a", '1', '1', LEFT, "c", "b", '0', '1', LEFT, "a", "b", '1', '1', RIGHT, "b", "c", '0', '1', LEFT, "b", "c", '1', '1', STAY, "halt" ); run(t); return 0; printf("\nFive-state two-symbol probable busy beaver\n"); t = create( 6, "A", "B", "C", "D", "E", "H", 1, "H", 2, '0', '1', '0', "A", 0, 10, "A", '0', '1', RIGHT, "B", "A", '1', '1', LEFT, "C", "B", '0', '1', RIGHT, "C", "B", '1', '1', RIGHT, "B", "C", '0', '1', RIGHT, "D", "C", '1', '0', LEFT, "E", "D", '0', '1', LEFT, "A", "D", '1', '1', LEFT, "D", "E", '0', '1', STAY, "H", "E", '1', '0', LEFT, "A" ); run(t); }
Translate the given VB code snippet into C without altering its behavior.
Public Sub create_file() Dim FileNumber As Integer FileNumber = FreeFile MkDir "docs" Open "docs\output.txt" For Output As #FreeFile Close #FreeFile MkDir "C:\docs" Open "C:\docs\output.txt" For Output As #FreeFile Close #FreeFile End Sub
#include <stdio.h> int main() { FILE *fh = fopen("output.txt", "w"); fclose(fh); return 0; }
Preserve the algorithm and functionality while converting the code from VB to C.
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
#include<string.h> #include<stdlib.h> #include<stdio.h> typedef struct genome{ char* strand; int length; struct genome* next; }genome; genome* genomeData; int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0; int numDigits(int num){ int len = 1; while(num>10){ num = num/10; len++; } return len; } void buildGenome(char str[100]){ int len = strlen(str),i; genome *genomeIterator, *newGenome; totalLength += len; for(i=0;i<len;i++){ switch(str[i]){ case 'A': Adenine++; break; case 'T': Thymine++; break; case 'C': Cytosine++; break; case 'G': Guanine++; break; }; } if(genomeData==NULL){ genomeData = (genome*)malloc(sizeof(genome)); genomeData->strand = (char*)malloc(len*sizeof(char)); strcpy(genomeData->strand,str); genomeData->length = len; genomeData->next = NULL; } else{ genomeIterator = genomeData; while(genomeIterator->next!=NULL) genomeIterator = genomeIterator->next; newGenome = (genome*)malloc(sizeof(genome)); newGenome->strand = (char*)malloc(len*sizeof(char)); strcpy(newGenome->strand,str); newGenome->length = len; newGenome->next = NULL; genomeIterator->next = newGenome; } } void printGenome(){ genome* genomeIterator = genomeData; int width = numDigits(totalLength), len = 0; printf("Sequence:\n"); while(genomeIterator!=NULL){ printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand); len += genomeIterator->length; genomeIterator = genomeIterator->next; } printf("\n\nBase Count\n----------\n\n"); printf("%3c%3s%*d\n",'A',":",width+1,Adenine); printf("%3c%3s%*d\n",'T',":",width+1,Thymine); printf("%3c%3s%*d\n",'C',":",width+1,Cytosine); printf("%3c%3s%*d\n",'G',":",width+1,Guanine); printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine); free(genomeData); } int main(int argc,char** argv) { char str[100]; int counter = 0, len; if(argc!=2){ printf("Usage : %s <Gene file name>\n",argv[0]); return 0; } FILE *fp = fopen(argv[1],"r"); while(fscanf(fp,"%s",str)!=EOF) buildGenome(str); fclose(fp); printGenome(); return 0; }
Generate an equivalent C version of this VB code.
b=_ "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &_ "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &_ "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &_ "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &_ "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &_ "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &_ "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &_ "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &_ "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &_ "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT" s="SEQUENCE:" acnt=0:ccnt=0:gcnt=0:tcnt=0 for i=0 to len(b)-1 if (i mod 30)=0 then s = s & vbcrlf & right(" "& i+1,3)&": " if (i mod 5)=0 then s=s& " " m=mid(b,i+1,1) s=s & m select case m case "A":acnt=acnt+1 case "C":ccnt=ccnt+1 case "G":gcnt=gcnt+1 case "T":tcnt=tcnt+1 case else wscript.echo "error at ",i+1, m end select next wscript.echo s & vbcrlf wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt
#include<string.h> #include<stdlib.h> #include<stdio.h> typedef struct genome{ char* strand; int length; struct genome* next; }genome; genome* genomeData; int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0; int numDigits(int num){ int len = 1; while(num>10){ num = num/10; len++; } return len; } void buildGenome(char str[100]){ int len = strlen(str),i; genome *genomeIterator, *newGenome; totalLength += len; for(i=0;i<len;i++){ switch(str[i]){ case 'A': Adenine++; break; case 'T': Thymine++; break; case 'C': Cytosine++; break; case 'G': Guanine++; break; }; } if(genomeData==NULL){ genomeData = (genome*)malloc(sizeof(genome)); genomeData->strand = (char*)malloc(len*sizeof(char)); strcpy(genomeData->strand,str); genomeData->length = len; genomeData->next = NULL; } else{ genomeIterator = genomeData; while(genomeIterator->next!=NULL) genomeIterator = genomeIterator->next; newGenome = (genome*)malloc(sizeof(genome)); newGenome->strand = (char*)malloc(len*sizeof(char)); strcpy(newGenome->strand,str); newGenome->length = len; newGenome->next = NULL; genomeIterator->next = newGenome; } } void printGenome(){ genome* genomeIterator = genomeData; int width = numDigits(totalLength), len = 0; printf("Sequence:\n"); while(genomeIterator!=NULL){ printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand); len += genomeIterator->length; genomeIterator = genomeIterator->next; } printf("\n\nBase Count\n----------\n\n"); printf("%3c%3s%*d\n",'A',":",width+1,Adenine); printf("%3c%3s%*d\n",'T',":",width+1,Thymine); printf("%3c%3s%*d\n",'C',":",width+1,Cytosine); printf("%3c%3s%*d\n",'G',":",width+1,Guanine); printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine); free(genomeData); } int main(int argc,char** argv) { char str[100]; int counter = 0, len; if(argc!=2){ printf("Usage : %s <Gene file name>\n",argv[0]); return 0; } FILE *fp = fopen(argv[1],"r"); while(fscanf(fp,"%s",str)!=EOF) buildGenome(str); fclose(fp); printGenome(); return 0; }
Convert the following code from VB to C, ensuring the logic remains intact.
Public Const HOLDON = False Public Const DIJKSTRASOLUTION = True Public Const X = 10 Public Const GETS = 0 Public Const PUTS = 1 Public Const EATS = 2 Public Const THKS = 5 Public Const FRSTFORK = 0 Public Const SCNDFORK = 1 Public Const SPAGHETI = 0 Public Const UNIVERSE = 1 Public Const MAXCOUNT = 100000 Public Const PHILOSOPHERS = 5 Public semaphore(PHILOSOPHERS - 1) As Integer Public positi0n(1, PHILOSOPHERS - 1) As Integer Public programcounter(PHILOSOPHERS - 1) As Long Public statistics(PHILOSOPHERS - 1, 5, 1) As Long Public names As Variant Private Sub init() names = [{"Aquinas","Babbage","Carroll","Derrida","Erasmus"}] For j = 0 To PHILOSOPHERS - 2 positi0n(0, j) = j + 1 positi0n(1, j) = j Next j If DIJKSTRASOLUTION Then positi0n(0, PHILOSOPHERS - 1) = j positi0n(1, PHILOSOPHERS - 1) = 0 Else positi0n(0, PHILOSOPHERS - 1) = 0 positi0n(1, PHILOSOPHERS - 1) = j End If End Sub Private Sub philosopher(subject As Integer, verb As Integer, objekt As Integer) statistics(subject, verb, objekt) = statistics(subject, verb, objekt) + 1 If verb < 2 Then If semaphore(positi0n(objekt, subject)) <> verb Then If Not HOLDON Then semaphore(positi0n(FRSTFORK, subject)) = 1 - objekt programcounter(subject) = 0 End If Else semaphore(positi0n(objekt, subject)) = 1 - verb programcounter(subject) = (programcounter(subject) + 1) Mod 6 End If Else programcounter(subject) = IIf(X * Rnd > 1, verb, verb + 1) Mod 6 End If End Sub Private Sub dine() Dim ph As Integer Do While TC < MAXCOUNT For ph = 0 To PHILOSOPHERS - 1 Select Case programcounter(ph) Case 0: philosopher ph, GETS, FRSTFORK Case 1: philosopher ph, GETS, SCNDFORK Case 2: philosopher ph, EATS, SPAGHETI Case 3: philosopher ph, PUTS, FRSTFORK Case 4: philosopher ph, PUTS, SCNDFORK Case 5: philosopher ph, THKS, UNIVERSE End Select TC = TC + 1 Next ph Loop End Sub Private Sub show() Debug.Print "Stats", "Gets", "Gets", "Eats", "Puts", "Puts", "Thinks" Debug.Print "", "First", "Second", "Spag-", "First", "Second", "About" Debug.Print "", "Fork", "Fork", "hetti", "Fork", "Fork", "Universe" For subject = 0 To PHILOSOPHERS - 1 Debug.Print names(subject + 1), For objekt = 0 To 1 Debug.Print statistics(subject, GETS, objekt), Next objekt Debug.Print statistics(subject, EATS, SPAGHETI), For objekt = 0 To 1 Debug.Print statistics(subject, PUTS, objekt), Next objekt Debug.Print statistics(subject, THKS, UNIVERSE) Next subject End Sub Public Sub main() init dine show End Sub
#include <pthread.h> #include <stdio.h> #include <stdlib.h> #include <unistd.h> #include <stdarg.h> #define N 5 const char *names[N] = { "Aristotle", "Kant", "Spinoza", "Marx", "Russell" }; pthread_mutex_t forks[N]; #define M 5 const char *topic[M] = { "Spaghetti!", "Life", "Universe", "Everything", "Bathroom" }; #define lock pthread_mutex_lock #define unlock pthread_mutex_unlock #define xy(x, y) printf("\033[%d;%dH", x, y) #define clear_eol(x) print(x, 12, "\033[K") void print(int y, int x, const char *fmt, ...) { static pthread_mutex_t screen = PTHREAD_MUTEX_INITIALIZER; va_list ap; va_start(ap, fmt); lock(&screen); xy(y + 1, x), vprintf(fmt, ap); xy(N + 1, 1), fflush(stdout); unlock(&screen); } void eat(int id) { int f[2], ration, i; f[0] = f[1] = id; f[id & 1] = (id + 1) % N; clear_eol(id); print(id, 12, "..oO (forks, need forks)"); for (i = 0; i < 2; i++) { lock(forks + f[i]); if (!i) clear_eol(id); print(id, 12 + (f[i] != id) * 6, "fork%d", f[i]); sleep(1); } for (i = 0, ration = 3 + rand() % 8; i < ration; i++) print(id, 24 + i * 4, "nom"), sleep(1); for (i = 0; i < 2; i++) unlock(forks + f[i]); } void think(int id) { int i, t; char buf[64] = {0}; do { clear_eol(id); sprintf(buf, "..oO (%s)", topic[t = rand() % M]); for (i = 0; buf[i]; i++) { print(id, i+12, "%c", buf[i]); if (i < 5) usleep(200000); } usleep(500000 + rand() % 1000000); } while (t); } void* philosophize(void *a) { int id = *(int*)a; print(id, 1, "%10s", names[id]); while(1) think(id), eat(id); } int main() { int i, id[N]; pthread_t tid[N]; for (i = 0; i < N; i++) pthread_mutex_init(forks + (id[i] = i), 0); for (i = 0; i < N; i++) pthread_create(tid + i, 0, philosophize, id + i); return pthread_join(tid[0], 0); }
Generate an equivalent C version of this VB code.
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
#include <stdio.h> int main() { int n, b, d; unsigned long long i, j, sum, fact[12]; fact[0] = 1; for (n = 1; n < 12; ++n) { fact[n] = fact[n-1] * n; } for (b = 9; b <= 12; ++b) { printf("The factorions for base %d are:\n", b); for (i = 1; i < 1500000; ++i) { sum = 0; j = i; while (j > 0) { d = j % b; sum += fact[d]; j /= b; } if (sum == i) printf("%llu ", i); } printf("\n\n"); } return 0; }
Port the following code from VB to C with equivalent syntax and logic.
Dim fact() nn1=9 : nn2=12 lim=1499999 ReDim fact(nn2) fact(0)=1 For i=1 To nn2 fact(i)=fact(i-1)*i Next For base=nn1 To nn2 list="" For i=1 To lim s=0 t=i Do While t<>0 d=t Mod base s=s+fact(d) t=t\base Loop If s=i Then list=list &" "& i Next Wscript.Echo "the factorions for base "& right(" "& base,2) &" are: "& list Next
#include <stdio.h> int main() { int n, b, d; unsigned long long i, j, sum, fact[12]; fact[0] = 1; for (n = 1; n < 12; ++n) { fact[n] = fact[n-1] * n; } for (b = 9; b <= 12; ++b) { printf("The factorions for base %d are:\n", b); for (i = 1; i < 1500000; ++i) { sum = 0; j = i; while (j > 0) { d = j % b; sum += fact[d]; j /= b; } if (sum == i) printf("%llu ", i); } printf("\n\n"); } return 0; }
Ensure the translated C code behaves exactly like the original VB snippet.
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } size_t get_min_length(const char* str, size_t n) { size_t len = 0; while (len < n && isupper((unsigned char)str[len])) ++len; return len; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = get_min_length(word, word_len); new_cmd->cmd = uppercase(word, word_len); new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
Produce a functionally identical C code for the snippet given in VB.
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } size_t get_min_length(const char* str, size_t n) { size_t len = 0; while (len < n && isupper((unsigned char)str[len])) ++len; return len; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = get_min_length(word, word_len); new_cmd->cmd = uppercase(word, word_len); new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
Maintain the same structure and functionality when rewriting this code in C.
Private Function ValidateUserWords(userstring As String) As String Dim s As String Dim user_words() As String Dim command_table As Scripting.Dictionary Set command_table = New Scripting.Dictionary Dim abbreviations As Scripting.Dictionary Set abbreviations = New Scripting.Dictionary abbreviations.CompareMode = TextCompare Dim commandtable() As String Dim commands As String s = s & "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " s = s & "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " s = s & "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " s = s & "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " s = s & "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " s = s & "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " s = s & "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up " commandtable = Split(s, " ") Dim i As Integer For Each word In commandtable If Len(word) > 0 Then i = 1 Do While Mid(word, i, 1) >= "A" And Mid(word, i, 1) <= "Z" i = i + 1 Loop command_table.Add Key:=word, Item:=i - 1 End If Next word For Each word In command_table For i = command_table(word) To Len(word) On Error Resume Next abbreviations.Add Key:=Left(word, i), Item:=UCase(word) Next i Next word user_words() = Split(userstring, " ") For Each word In user_words If Len(word) > 0 Then If abbreviations.exists(word) Then commands = commands & abbreviations(word) & " " Else commands = commands & "*error* " End If End If Next word ValidateUserWords = commands End Function Public Sub program() Dim guserstring As String guserstring = "riG rePEAT copies put mo rest types fup. 6 poweRin" Debug.Print "user words:", guserstring Debug.Print "full words:", ValidateUserWords(guserstring) End Sub
#include <ctype.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> const char* command_table = "Add ALTer BAckup Bottom CAppend Change SCHANGE CInsert CLAst COMPress COpy " "COUnt COVerlay CURsor DELete CDelete Down DUPlicate Xedit EXPand EXTract Find " "NFind NFINDUp NFUp CFind FINdup FUp FOrward GET Help HEXType Input POWerinput " "Join SPlit SPLTJOIN LOAD Locate CLocate LOWercase UPPercase LPrefix MACRO " "MErge MODify MOve MSG Next Overlay PARSE PREServe PURge PUT PUTD Query QUIT " "READ RECover REFRESH RENum REPeat Replace CReplace RESet RESTore RGTLEFT " "RIght LEft SAVE SET SHift SI SORT SOS STAck STATus TOP TRAnsfer Type Up"; typedef struct command_tag { char* cmd; size_t length; size_t min_len; struct command_tag* next; } command_t; bool command_match(const command_t* command, const char* str) { size_t olen = strlen(str); return olen >= command->min_len && olen <= command->length && strncmp(str, command->cmd, olen) == 0; } char* uppercase(char* str, size_t n) { for (size_t i = 0; i < n; ++i) str[i] = toupper((unsigned char)str[i]); return str; } size_t get_min_length(const char* str, size_t n) { size_t len = 0; while (len < n && isupper((unsigned char)str[len])) ++len; return len; } void fatal(const char* message) { fprintf(stderr, "%s\n", message); exit(1); } void* xmalloc(size_t n) { void* ptr = malloc(n); if (ptr == NULL) fatal("Out of memory"); return ptr; } void* xrealloc(void* p, size_t n) { void* ptr = realloc(p, n); if (ptr == NULL) fatal("Out of memory"); return ptr; } char** split_into_words(const char* str, size_t* count) { size_t size = 0; size_t capacity = 16; char** words = xmalloc(capacity * sizeof(char*)); size_t len = strlen(str); for (size_t begin = 0; begin < len; ) { size_t i = begin; for (; i < len && isspace((unsigned char)str[i]); ++i) {} begin = i; for (; i < len && !isspace((unsigned char)str[i]); ++i) {} size_t word_len = i - begin; if (word_len == 0) break; char* word = xmalloc(word_len + 1); memcpy(word, str + begin, word_len); word[word_len] = 0; begin += word_len; if (capacity == size) { capacity *= 2; words = xrealloc(words, capacity * sizeof(char*)); } words[size++] = word; } *count = size; return words; } command_t* make_command_list(const char* table) { command_t* cmd = NULL; size_t count = 0; char** words = split_into_words(table, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; command_t* new_cmd = xmalloc(sizeof(command_t)); size_t word_len = strlen(word); new_cmd->length = word_len; new_cmd->min_len = get_min_length(word, word_len); new_cmd->cmd = uppercase(word, word_len); new_cmd->next = cmd; cmd = new_cmd; } free(words); return cmd; } void free_command_list(command_t* cmd) { while (cmd != NULL) { command_t* next = cmd->next; free(cmd->cmd); free(cmd); cmd = next; } } const command_t* find_command(const command_t* commands, const char* word) { for (const command_t* cmd = commands; cmd != NULL; cmd = cmd->next) { if (command_match(cmd, word)) return cmd; } return NULL; } void test(const command_t* commands, const char* input) { printf(" input: %s\n", input); printf("output:"); size_t count = 0; char** words = split_into_words(input, &count); for (size_t i = 0; i < count; ++i) { char* word = words[i]; uppercase(word, strlen(word)); const command_t* cmd_ptr = find_command(commands, word); printf(" %s", cmd_ptr ? cmd_ptr->cmd : "*error*"); free(word); } free(words); printf("\n"); } int main() { command_t* commands = make_command_list(command_table); const char* input = "riG rePEAT copies put mo rest types fup. 6 poweRin"; test(commands, input); free_command_list(commands); return 0; }
Convert the following code from VB to C, ensuring the logic remains intact.
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
#include <stdio.h> #include <string.h> #include <stdlib.h> char *codes[] = { "AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA", "AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB", "ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA", "ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB", "BABAA", "BABAB", "BABBA", "BABBB", "BBAAA", "BBAAB", "BBBAA" }; char *get_code(const char c) { if (c >= 97 && c <= 122) return codes[c - 97]; return codes[26]; } char get_char(const char *code) { int i; if (!strcmp(codes[26], code)) return ' '; for (i = 0; i < 26; ++i) { if (strcmp(codes[i], code) == 0) return 97 + i; } printf("\nCode \"%s\" is invalid\n", code); exit(1); } void str_tolower(char s[]) { int i; for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]); } char *bacon_encode(char plain_text[], char message[]) { int i, count; int plen = strlen(plain_text), mlen = strlen(message); int elen = 5 * plen; char c; char *p, *et, *mt; et = malloc(elen + 1); str_tolower(plain_text); for (i = 0, p = et; i < plen; ++i, p += 5) { c = plain_text[i]; strncpy(p, get_code(c), 5); } *++p = '\0'; str_tolower(message); mt = calloc(mlen + 1, 1); for (i = 0, count = 0; i < mlen; ++i) { c = message[i]; if (c >= 'a' && c <= 'z') { if (et[count] == 'A') mt[i] = c; else mt[i] = c - 32; if (++count == elen) break; } else mt[i] = c; } free(et); return mt; } char *bacon_decode(char cipher_text[]) { int i, count, clen = strlen(cipher_text); int plen; char *p, *ct, *pt; char c, quintet[6]; ct = calloc(clen + 1, 1); for (i = 0, count = 0; i < clen; ++i) { c = cipher_text[i]; if (c >= 'a' && c <= 'z') ct[count++] = 'A'; else if (c >= 'A' && c <= 'Z') ct[count++] = 'B'; } plen = strlen(ct) / 5; pt = malloc(plen + 1); for (i = 0, p = ct; i < plen; ++i, p += 5) { strncpy(quintet, p, 5); quintet[5] = '\0'; pt[i] = get_char(quintet); } pt[plen] = '\0'; free(ct); return pt; } int main() { char plain_text[] = "the quick brown fox jumps over the lazy dog"; char message[] = "bacon's cipher is a method of steganography created by francis bacon." "this task is to implement a program for encryption and decryption of " "plaintext using the simple alphabet of the baconian cipher or some " "other kind of representation of this alphabet (make anything signify anything). " "the baconian alphabet may optionally be extended to encode all lower " "case characters individually and/or adding a few punctuation characters " "such as the space."; char *cipher_text, *hidden_text; cipher_text = bacon_encode(plain_text, message); printf("Cipher text ->\n\n%s\n", cipher_text); hidden_text = bacon_decode(cipher_text); printf("\nHidden text ->\n\n%s\n", hidden_text); free(cipher_text); free(hidden_text); return 0; }
Produce a language-to-language conversion: from VB to C, same semantics.
Imports System.Text Module Module1 ReadOnly CODES As New Dictionary(Of Char, String) From { {"a", "AAAAA"}, {"b", "AAAAB"}, {"c", "AAABA"}, {"d", "AAABB"}, {"e", "AABAA"}, {"f", "AABAB"}, {"g", "AABBA"}, {"h", "AABBB"}, {"i", "ABAAA"}, {"j", "ABAAB"}, {"k", "ABABA"}, {"l", "ABABB"}, {"m", "ABBAA"}, {"n", "ABBAB"}, {"o", "ABBBA"}, {"p", "ABBBB"}, {"q", "BAAAA"}, {"r", "BAAAB"}, {"s", "BAABA"}, {"t", "BAABB"}, {"u", "BABAA"}, {"v", "BABAB"}, {"w", "BABBA"}, {"x", "BABBB"}, {"y", "BBAAA"}, {"z", "BBAAB"}, {" ", "BBBAA"} } Function Encode(plainText As String, message As String) As String Dim pt = plainText.ToLower() Dim sb As New StringBuilder() For Each c In pt If "a" <= c AndAlso c <= "z" Then sb.Append(CODES(c)) Else sb.Append(CODES(" ")) End If Next Dim et = sb.ToString() Dim mg = message.ToLower() sb.Length = 0 Dim count = 0 For Each c In mg If "a" <= c AndAlso c <= "z" Then If et(count) = "A" Then sb.Append(c) Else sb.Append(Chr(Asc(c) - 32)) End If count += 1 If count = et.Length Then Exit For End If Else sb.Append(c) End If Next Return sb.ToString() End Function Function Decode(message As String) As String Dim sb As New StringBuilder For Each c In message If "a" <= c AndAlso c <= "z" Then sb.Append("A") ElseIf "A" <= c AndAlso c <= "Z" Then sb.Append("B") End If Next Dim et = sb.ToString() sb.Length = 0 For index = 0 To et.Length - 1 Step 5 Dim quintet = et.Substring(index, 5) Dim key = CODES.Where(Function(a) a.Value = quintet).First().Key sb.Append(key) Next Return sb.ToString() End Function Sub Main() Dim plainText = "the quick brown fox jumps over the lazy dog" Dim message = "bacon "this task is to implement a program for encryption and decryption of " + "plaintext using the simple alphabet of the baconian cipher or some " + "other kind of representation of this alphabet (make anything signify anything). " + "the baconian alphabet may optionally be extended to encode all lower " + "case characters individually and/or adding a few punctuation characters " + "such as the space." Dim cipherText = Encode(plainText, message) Console.WriteLine("Cipher text ->" & Environment.NewLine & "{0}", cipherText) Dim decodedText = Decode(cipherText) Console.WriteLine(Environment.NewLine & "Hidden text ->" & Environment.NewLine & "{0}", decodedText) End Sub End Module
#include <stdio.h> #include <string.h> #include <stdlib.h> char *codes[] = { "AAAAA", "AAAAB", "AAABA", "AAABB", "AABAA", "AABAB", "AABBA", "AABBB", "ABAAA", "ABAAB", "ABABA", "ABABB", "ABBAA", "ABBAB", "ABBBA", "ABBBB", "BAAAA", "BAAAB", "BAABA", "BAABB", "BABAA", "BABAB", "BABBA", "BABBB", "BBAAA", "BBAAB", "BBBAA" }; char *get_code(const char c) { if (c >= 97 && c <= 122) return codes[c - 97]; return codes[26]; } char get_char(const char *code) { int i; if (!strcmp(codes[26], code)) return ' '; for (i = 0; i < 26; ++i) { if (strcmp(codes[i], code) == 0) return 97 + i; } printf("\nCode \"%s\" is invalid\n", code); exit(1); } void str_tolower(char s[]) { int i; for (i = 0; i < strlen(s); ++i) s[i] = tolower(s[i]); } char *bacon_encode(char plain_text[], char message[]) { int i, count; int plen = strlen(plain_text), mlen = strlen(message); int elen = 5 * plen; char c; char *p, *et, *mt; et = malloc(elen + 1); str_tolower(plain_text); for (i = 0, p = et; i < plen; ++i, p += 5) { c = plain_text[i]; strncpy(p, get_code(c), 5); } *++p = '\0'; str_tolower(message); mt = calloc(mlen + 1, 1); for (i = 0, count = 0; i < mlen; ++i) { c = message[i]; if (c >= 'a' && c <= 'z') { if (et[count] == 'A') mt[i] = c; else mt[i] = c - 32; if (++count == elen) break; } else mt[i] = c; } free(et); return mt; } char *bacon_decode(char cipher_text[]) { int i, count, clen = strlen(cipher_text); int plen; char *p, *ct, *pt; char c, quintet[6]; ct = calloc(clen + 1, 1); for (i = 0, count = 0; i < clen; ++i) { c = cipher_text[i]; if (c >= 'a' && c <= 'z') ct[count++] = 'A'; else if (c >= 'A' && c <= 'Z') ct[count++] = 'B'; } plen = strlen(ct) / 5; pt = malloc(plen + 1); for (i = 0, p = ct; i < plen; ++i, p += 5) { strncpy(quintet, p, 5); quintet[5] = '\0'; pt[i] = get_char(quintet); } pt[plen] = '\0'; free(ct); return pt; } int main() { char plain_text[] = "the quick brown fox jumps over the lazy dog"; char message[] = "bacon's cipher is a method of steganography created by francis bacon." "this task is to implement a program for encryption and decryption of " "plaintext using the simple alphabet of the baconian cipher or some " "other kind of representation of this alphabet (make anything signify anything). " "the baconian alphabet may optionally be extended to encode all lower " "case characters individually and/or adding a few punctuation characters " "such as the space."; char *cipher_text, *hidden_text; cipher_text = bacon_encode(plain_text, message); printf("Cipher text ->\n\n%s\n", cipher_text); hidden_text = bacon_decode(cipher_text); printf("\nHidden text ->\n\n%s\n", hidden_text); free(cipher_text); free(hidden_text); return 0; }
Can you help me rewrite this code in C instead of VB, keeping it the same logically?
Function build_spiral(n) botcol = 0 : topcol = n - 1 botrow = 0 : toprow = n - 1 Dim matrix() ReDim matrix(topcol,toprow) dir = 0 : col = 0 : row = 0 For i = 0 To n*n-1 matrix(col,row) = i Select Case dir Case 0 If col < topcol Then col = col + 1 Else dir = 1 : row = row + 1 : botrow = botrow + 1 End If Case 1 If row < toprow Then row = row + 1 Else dir = 2 : col = col - 1 : topcol = topcol - 1 End If Case 2 If col > botcol Then col = col - 1 Else dir = 3 : row = row - 1 : toprow = toprow - 1 End If Case 3 If row > botrow Then row = row - 1 Else dir = 0 : col = col + 1 : botcol = botcol + 1 End If End Select Next For y = 0 To n-1 For x = 0 To n-1 WScript.StdOut.Write matrix(x,y) & vbTab Next WScript.StdOut.WriteLine Next End Function build_spiral(CInt(WScript.Arguments(0)))
#include <stdio.h> #include <stdlib.h> #define valid(i, j) 0 <= i && i < m && 0 <= j && j < n && !s[i][j] int main(int c, char **v) { int i, j, m = 0, n = 0; if (c >= 2) m = atoi(v[1]); if (c >= 3) n = atoi(v[2]); if (m <= 0) m = 5; if (n <= 0) n = m; int **s = calloc(1, sizeof(int *) * m + sizeof(int) * m * n); s[0] = (int*)(s + m); for (i = 1; i < m; i++) s[i] = s[i - 1] + n; int dx = 1, dy = 0, val = 0, t; for (i = j = 0; valid(i, j); i += dy, j += dx ) { for (; valid(i, j); j += dx, i += dy) s[i][j] = ++val; j -= dx; i -= dy; t = dy; dy = dx; dx = -t; } for (t = 2; val /= 10; t++); for(i = 0; i < m; i++) for(j = 0; j < n || !putchar('\n'); j++) printf("%*d", t, s[i][j]); return 0; }
Write the same code in C as shown below in VB.
Function build_spiral(n) botcol = 0 : topcol = n - 1 botrow = 0 : toprow = n - 1 Dim matrix() ReDim matrix(topcol,toprow) dir = 0 : col = 0 : row = 0 For i = 0 To n*n-1 matrix(col,row) = i Select Case dir Case 0 If col < topcol Then col = col + 1 Else dir = 1 : row = row + 1 : botrow = botrow + 1 End If Case 1 If row < toprow Then row = row + 1 Else dir = 2 : col = col - 1 : topcol = topcol - 1 End If Case 2 If col > botcol Then col = col - 1 Else dir = 3 : row = row - 1 : toprow = toprow - 1 End If Case 3 If row > botrow Then row = row - 1 Else dir = 0 : col = col + 1 : botcol = botcol + 1 End If End Select Next For y = 0 To n-1 For x = 0 To n-1 WScript.StdOut.Write matrix(x,y) & vbTab Next WScript.StdOut.WriteLine Next End Function build_spiral(CInt(WScript.Arguments(0)))
#include <stdio.h> #include <stdlib.h> #define valid(i, j) 0 <= i && i < m && 0 <= j && j < n && !s[i][j] int main(int c, char **v) { int i, j, m = 0, n = 0; if (c >= 2) m = atoi(v[1]); if (c >= 3) n = atoi(v[2]); if (m <= 0) m = 5; if (n <= 0) n = m; int **s = calloc(1, sizeof(int *) * m + sizeof(int) * m * n); s[0] = (int*)(s + m); for (i = 1; i < m; i++) s[i] = s[i - 1] + n; int dx = 1, dy = 0, val = 0, t; for (i = j = 0; valid(i, j); i += dy, j += dx ) { for (; valid(i, j); j += dx, i += dy) s[i][j] = ++val; j -= dx; i -= dy; t = dy; dy = dx; dx = -t; } for (t = 2; val /= 10; t++); for(i = 0; i < m; i++) for(j = 0; j < n || !putchar('\n'); j++) printf("%*d", t, s[i][j]); return 0; }
Translate this program into C but keep the logic exactly as in VB.
Private Sub optional_parameters(theRange As String, _ Optional ordering As Integer = 0, _ Optional column As Integer = 1, _ Optional reverse As Integer = 1) ActiveSheet.Sort.SortFields.Clear ActiveSheet.Sort.SortFields.Add _ Key:=Range(theRange).Columns(column), _ SortOn:=SortOnValues, _ Order:=reverse, _ DataOption:=ordering With ActiveSheet.Sort .SetRange Range(theRange) .Header = xlGuess .MatchCase = False .Orientation = xlTopToBottom .SortMethod = xlPinYin .Apply End With End Sub Public Sub main() optional_parameters theRange:="A1:C4", ordering:=1, column:=2, reverse:=1 End Sub
#include <stdlib.h> #include <stdarg.h> #include <stdio.h> #include <ctype.h> #include <string.h> typedef const char * String; typedef struct sTable { String * *rows; int n_rows,n_cols; } *Table; typedef int (*CompareFctn)(String a, String b); struct { CompareFctn compare; int column; int reversed; } sortSpec; int CmprRows( const void *aa, const void *bb) { String *rA = *(String *const *)aa; String *rB = *(String *const *)bb; int sortCol = sortSpec.column; String left = sortSpec.reversed ? rB[sortCol] : rA[sortCol]; String right = sortSpec.reversed ? rA[sortCol] : rB[sortCol]; return sortSpec.compare( left, right ); } int sortTable(Table tbl, const char* argSpec,... ) { va_list vl; const char *p; int c; sortSpec.compare = &strcmp; sortSpec.column = 0; sortSpec.reversed = 0; va_start(vl, argSpec); if (argSpec) for (p=argSpec; *p; p++) { switch (*p) { case 'o': sortSpec.compare = va_arg(vl,CompareFctn); break; case 'c': c = va_arg(vl,int); if ( 0<=c && c<tbl->n_cols) sortSpec.column = c; break; case 'r': sortSpec.reversed = (0!=va_arg(vl,int)); break; } } va_end(vl); qsort( tbl->rows, tbl->n_rows, sizeof(String *), CmprRows); return 0; } void printTable( Table tbl, FILE *fout, const char *colFmts[]) { int row, col; for (row=0; row<tbl->n_rows; row++) { fprintf(fout, " "); for(col=0; col<tbl->n_cols; col++) { fprintf(fout, colFmts[col], tbl->rows[row][col]); } fprintf(fout, "\n"); } fprintf(fout, "\n"); } int ord(char v) { return v-'0'; } int cmprStrgs(String s1, String s2) { const char *p1 = s1; const char *p2 = s2; const char *mrk1, *mrk2; while ((tolower(*p1) == tolower(*p2)) && *p1) { p1++; p2++; } if (isdigit(*p1) && isdigit(*p2)) { long v1, v2; if ((*p1 == '0') ||(*p2 == '0')) { while (p1 > s1) { p1--; p2--; if (*p1 != '0') break; } if (!isdigit(*p1)) { p1++; p2++; } } mrk1 = p1; mrk2 = p2; v1 = 0; while(isdigit(*p1)) { v1 = 10*v1+ord(*p1); p1++; } v2 = 0; while(isdigit(*p2)) { v2 = 10*v2+ord(*p2); p2++; } if (v1 == v2) return(p2-mrk2)-(p1-mrk1); return v1 - v2; } if (tolower(*p1) != tolower(*p2)) return (tolower(*p1) - tolower(*p2)); for(p1=s1, p2=s2; (*p1 == *p2) && *p1; p1++, p2++); return (*p1 -*p2); } int main() { const char *colFmts[] = {" %-5.5s"," %-5.5s"," %-9.9s"}; String r1[] = { "a101", "red", "Java" }; String r2[] = { "ab40", "gren", "Smalltalk" }; String r3[] = { "ab9", "blue", "Fortran" }; String r4[] = { "ab09", "ylow", "Python" }; String r5[] = { "ab1a", "blak", "Factor" }; String r6[] = { "ab1b", "brwn", "C Sharp" }; String r7[] = { "Ab1b", "pink", "Ruby" }; String r8[] = { "ab1", "orng", "Scheme" }; String *rows[] = { r1, r2, r3, r4, r5, r6, r7, r8 }; struct sTable table; table.rows = rows; table.n_rows = 8; table.n_cols = 3; sortTable(&table, ""); printf("sort on col 0, ascending\n"); printTable(&table, stdout, colFmts); sortTable(&table, "ro", 1, &cmprStrgs); printf("sort on col 0, reverse.special\n"); printTable(&table, stdout, colFmts); sortTable(&table, "c", 1); printf("sort on col 1, ascending\n"); printTable(&table, stdout, colFmts); sortTable(&table, "cr", 2, 1); printf("sort on col 2, reverse\n"); printTable(&table, stdout, colFmts); return 0; }
Port the provided VB code into C while preserving the original functionality.
Declare Function CreateFileW Lib "Kernel32" (FileName As WString, DesiredAccess As Integer, ShareMode As Integer, SecurityAttributes As Integer, _ CreateDisposition As Integer, Flags As Integer, Template As Integer) As Integer Declare Function WriteFile Lib "Kernel32" (fHandle As Integer, writeData As Ptr, numOfBytes As Integer, ByRef numOfBytesWritten As Integer, _ overlapped As Ptr) As Boolean Declare Function GetLastError Lib "Kernel32" () As Integer Declare Function CloseHandle Lib "kernel32" (hObject As Integer) As Boolean Const FILE_SHARE_READ = &h00000001 Const FILE_SHARE_WRITE = &h00000002 Const OPEN_EXISTING = 3 Dim fHandle As Integer = CreateFileW("C:\foo.txt", 0, FILE_SHARE_READ Or FILE_SHARE_WRITE, 0, OPEN_EXISTING, 0, 0) If fHandle > 0 Then Dim mb As MemoryBlock = "Hello, World!" Dim bytesWritten As Integer If Not WriteFile(fHandle, mb, mb.Size, bytesWritten, Nil) Then MsgBox("Error Number: " + Str(GetLastError)) End If Call CloseHandle(fHandle) Else MsgBox("Error Number: " + Str(GetLastError)) End If
#include <stdio.h> void sayHello(char* name){ printf("Hello %s!\n", name); } int doubleNum(int num){ return num * 2; }
Translate the given VB code snippet into C without altering its behavior.
Module Module1 Class Frac Private ReadOnly num As Long Private ReadOnly denom As Long Public Shared ReadOnly ZERO = New Frac(0, 1) Public Shared ReadOnly ONE = New Frac(1, 1) Public Sub New(n As Long, d As Long) If d = 0 Then Throw New ArgumentException("d must not be zero") End If Dim nn = n Dim dd = d If nn = 0 Then dd = 1 ElseIf dd < 0 Then nn = -nn dd = -dd End If Dim g = Math.Abs(Gcd(nn, dd)) If g > 1 Then nn /= g dd /= g End If num = nn denom = dd End Sub Private Shared Function Gcd(a As Long, b As Long) As Long If b = 0 Then Return a Else Return Gcd(b, a Mod b) End If End Function Public Shared Operator -(self As Frac) As Frac Return New Frac(-self.num, self.denom) End Operator Public Shared Operator +(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.denom + lhs.denom * rhs.num, rhs.denom * lhs.denom) End Operator Public Shared Operator -(lhs As Frac, rhs As Frac) As Frac Return lhs + -rhs End Operator Public Shared Operator *(lhs As Frac, rhs As Frac) As Frac Return New Frac(lhs.num * rhs.num, lhs.denom * rhs.denom) End Operator Public Shared Operator <(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x < y End Operator Public Shared Operator >(lhs As Frac, rhs As Frac) As Boolean Dim x = lhs.num / lhs.denom Dim y = rhs.num / rhs.denom Return x > y End Operator Public Shared Operator =(lhs As Frac, rhs As Frac) As Boolean Return lhs.num = rhs.num AndAlso lhs.denom = rhs.denom End Operator Public Shared Operator <>(lhs As Frac, rhs As Frac) As Boolean Return lhs.num <> rhs.num OrElse lhs.denom <> rhs.denom End Operator Public Overrides Function ToString() As String If denom = 1 Then Return num.ToString Else Return String.Format("{0}/{1}", num, denom) End If End Function Public Overrides Function Equals(obj As Object) As Boolean Dim frac = CType(obj, Frac) Return Not IsNothing(frac) AndAlso num = frac.num AndAlso denom = frac.denom End Function End Class Function Bernoulli(n As Integer) As Frac If n < 0 Then Throw New ArgumentException("n may not be negative or zero") End If Dim a(n + 1) As Frac For m = 0 To n a(m) = New Frac(1, m + 1) For j = m To 1 Step -1 a(j - 1) = (a(j - 1) - a(j)) * New Frac(j, 1) Next Next If n <> 1 Then Return a(0) Else Return -a(0) End If End Function Function Binomial(n As Integer, k As Integer) As Integer If n < 0 OrElse k < 0 OrElse n < k Then Throw New ArgumentException() End If If n = 0 OrElse k = 0 Then Return 1 End If Dim num = 1 For i = k + 1 To n num *= i Next Dim denom = 1 For i = 2 To n - k denom *= i Next Return num \ denom End Function Function FaulhaberTriangle(p As Integer) As Frac() Dim coeffs(p + 1) As Frac For i = 1 To p + 1 coeffs(i - 1) = Frac.ZERO Next Dim q As New Frac(1, p + 1) Dim sign = -1 For j = 0 To p sign *= -1 coeffs(p - j) = q * New Frac(sign, 1) * New Frac(Binomial(p + 1, j), 1) * Bernoulli(j) Next Return coeffs End Function Sub Main() For i = 1 To 10 Dim coeffs = FaulhaberTriangle(i - 1) For Each coeff In coeffs Console.Write("{0,5} ", coeff) Next Console.WriteLine() Next End Sub End Module
#include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> int binomial(int n, int k) { int num, denom, i; if (n < 0 || k < 0 || n < k) return -1; if (n == 0 || k == 0) return 1; num = 1; for (i = k + 1; i <= n; ++i) { num = num * i; } denom = 1; for (i = 2; i <= n - k; ++i) { denom *= i; } return num / denom; } int gcd(int a, int b) { int temp; while (b != 0) { temp = a % b; a = b; b = temp; } return a; } typedef struct tFrac { int num, denom; } Frac; Frac makeFrac(int n, int d) { Frac result; int g; if (d == 0) { result.num = 0; result.denom = 0; return result; } if (n == 0) { d = 1; } else if (d < 0) { n = -n; d = -d; } g = abs(gcd(n, d)); if (g > 1) { n = n / g; d = d / g; } result.num = n; result.denom = d; return result; } Frac negateFrac(Frac f) { return makeFrac(-f.num, f.denom); } Frac subFrac(Frac lhs, Frac rhs) { return makeFrac(lhs.num * rhs.denom - lhs.denom * rhs.num, rhs.denom * lhs.denom); } Frac multFrac(Frac lhs, Frac rhs) { return makeFrac(lhs.num * rhs.num, lhs.denom * rhs.denom); } bool equalFrac(Frac lhs, Frac rhs) { return (lhs.num == rhs.num) && (lhs.denom == rhs.denom); } bool lessFrac(Frac lhs, Frac rhs) { return (lhs.num * rhs.denom) < (rhs.num * lhs.denom); } void printFrac(Frac f) { char buffer[7]; int len; if (f.denom != 1) { snprintf(buffer, 7, "%d/%d", f.num, f.denom); } else { snprintf(buffer, 7, "%d", f.num); } len = 7 - strlen(buffer); while (len-- > 0) { putc(' ', stdout); } printf(buffer); } Frac bernoulli(int n) { Frac a[16]; int j, m; if (n < 0) { a[0].num = 0; a[0].denom = 0; return a[0]; } for (m = 0; m <= n; ++m) { a[m] = makeFrac(1, m + 1); for (j = m; j >= 1; --j) { a[j - 1] = multFrac(subFrac(a[j - 1], a[j]), makeFrac(j, 1)); } } if (n != 1) { return a[0]; } return negateFrac(a[0]); } void faulhaber(int p) { Frac q, *coeffs; int j, sign; coeffs = malloc(sizeof(Frac)*(p + 1)); q = makeFrac(1, p + 1); sign = -1; for (j = 0; j <= p; ++j) { sign = -1 * sign; coeffs[p - j] = multFrac(multFrac(multFrac(q, makeFrac(sign, 1)), makeFrac(binomial(p + 1, j), 1)), bernoulli(j)); } for (j = 0; j <= p; ++j) { printFrac(coeffs[j]); } printf("\n"); free(coeffs); } int main() { int i; for (i = 0; i < 10; ++i) { faulhaber(i); } return 0; }
Port the provided VB code into C while preserving the original functionality.
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
#include <stdlib.h> #include <stdio.h> int main(int argc, char* argv[]) { int i; (void) printf("This program is named %s.\n", argv[0]); for (i = 1; i < argc; ++i) (void) printf("the argument #%d is %s\n", i, argv[i]); return EXIT_SUCCESS; }
Produce a language-to-language conversion: from VB to C, same semantics.
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
#include <stdlib.h> #include <stdio.h> int main(int argc, char* argv[]) { int i; (void) printf("This program is named %s.\n", argv[0]); for (i = 1; i < argc; ++i) (void) printf("the argument #%d is %s\n", i, argv[i]); return EXIT_SUCCESS; }
Keep all operations the same but rewrite the snippet in C.
Function Run(args() as String) As Integer For each arg As String In args Stdout.WriteLine(arg) Next End Function
#include <stdlib.h> #include <stdio.h> int main(int argc, char* argv[]) { int i; (void) printf("This program is named %s.\n", argv[0]); for (i = 1; i < argc; ++i) (void) printf("the argument #%d is %s\n", i, argv[i]); return EXIT_SUCCESS; }
Rewrite this program in C while keeping its functionality equivalent to the VB version.
Const wheel="ndeokgelw" Sub print(s): On Error Resume Next WScript.stdout.WriteLine (s) If err= &h80070006& Then WScript.Echo " Please run this script with CScript": WScript.quit End Sub Dim oDic Set oDic = WScript.CreateObject("scripting.dictionary") Dim cnt(127) Dim fso Set fso = WScript.CreateObject("Scripting.Filesystemobject") Set ff=fso.OpenTextFile("unixdict.txt") i=0 print "reading words of 3 or more letters" While Not ff.AtEndOfStream x=LCase(ff.ReadLine) If Len(x)>=3 Then If Not odic.exists(x) Then oDic.Add x,0 End If Wend print "remaining words: "& oDic.Count & vbcrlf ff.Close Set ff=Nothing Set fso=Nothing Set re=New RegExp print "removing words with chars not in the wheel" re.pattern="[^"& wheel &"]" For Each w In oDic.Keys If re.test(w) Then oDic.remove(w) Next print "remaining words: "& oDic.Count & vbcrlf print "ensuring the mandatory letter "& Mid(wheel,5,1) & " is present" re.Pattern=Mid(wheel,5,1) For Each w In oDic.Keys If Not re.test(w) Then oDic.remove(w) Next print "remaining words: "& oDic.Count & vbcrlf print "checking number of chars" Dim nDic Set nDic = WScript.CreateObject("scripting.dictionary") For i=1 To Len(wheel) x=Mid(wheel,i,1) If nDic.Exists(x) Then a=nDic(x) nDic(x)=Array(a(0)+1,0) Else nDic.add x,Array(1,0) End If Next For Each w In oDic.Keys For Each c In nDic.Keys ndic(c)=Array(nDic(c)(0),0) Next For ii = 1 To len(w) c=Mid(w,ii,1) a=nDic(c) If (a(0)=a(1)) Then oDic.Remove(w):Exit For End If nDic(c)=Array(a(0),a(1)+1) Next Next print "Remaining words "& oDic.count For Each w In oDic.Keys print w Next
#include <stdbool.h> #include <stdio.h> #define MAX_WORD 80 #define LETTERS 26 bool is_letter(char c) { return c >= 'a' && c <= 'z'; } int index(char c) { return c - 'a'; } void word_wheel(const char* letters, char central, int min_length, FILE* dict) { int max_count[LETTERS] = { 0 }; for (const char* p = letters; *p; ++p) { char c = *p; if (is_letter(c)) ++max_count[index(c)]; } char word[MAX_WORD + 1] = { 0 }; while (fgets(word, MAX_WORD, dict)) { int count[LETTERS] = { 0 }; for (const char* p = word; *p; ++p) { char c = *p; if (c == '\n') { if (p >= word + min_length && count[index(central)] > 0) printf("%s", word); } else if (is_letter(c)) { int i = index(c); if (++count[i] > max_count[i]) { break; } } else { break; } } } } int main(int argc, char** argv) { const char* dict = argc == 2 ? argv[1] : "unixdict.txt"; FILE* in = fopen(dict, "r"); if (in == NULL) { perror(dict); return 1; } word_wheel("ndeokgelw", 'k', 3, in); fclose(in); return 0; }
Change the following VB code into C without altering its purpose.
DEFINT A(1 to 4) = {1, 2, 3, 4} DEFINT B(1 to 4) = {10, 20, 30, 40} Redim A(1 to 8) as integer MEMCPY(varptr(A(5)), varptr(B(1)), Sizeof(integer)*4)
#include <stdlib.h> #include <stdio.h> #include <string.h> #define ARRAY_CONCAT(TYPE, A, An, B, Bn) \ (TYPE *)array_concat((const void *)(A), (An), (const void *)(B), (Bn), sizeof(TYPE)); void *array_concat(const void *a, size_t an, const void *b, size_t bn, size_t s) { char *p = malloc(s * (an + bn)); memcpy(p, a, an*s); memcpy(p + an*s, b, bn*s); return p; } const int a[] = { 1, 2, 3, 4, 5 }; const int b[] = { 6, 7, 8, 9, 0 }; int main(void) { unsigned int i; int *c = ARRAY_CONCAT(int, a, 5, b, 5); for(i = 0; i < 10; i++) printf("%d\n", c[i]); free(c); return EXIT_SUCCCESS; }
Port the provided VB code into C while preserving the original functionality.
Public Sub text() Debug.Print InputBox("Input a string") Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long") End Sub
#include <stdio.h> #include <stdlib.h> int main(void) { char str[BUFSIZ]; puts("Enter a string: "); fgets(str, sizeof(str), stdin); long num; char buf[BUFSIZ]; do { puts("Enter 75000: "); fgets(buf, sizeof(buf), stdin); num = strtol(buf, NULL, 10); } while (num != 75000); return EXIT_SUCCESS; }
Keep all operations the same but rewrite the snippet in C.
Public Sub text() Debug.Print InputBox("Input a string") Debug.Print InputBox("Input the integer 75000", "Input an integer", 75000, Context = "Long") End Sub
#include <stdio.h> #include <stdlib.h> int main(void) { char str[BUFSIZ]; puts("Enter a string: "); fgets(str, sizeof(str), stdin); long num; char buf[BUFSIZ]; do { puts("Enter 75000: "); fgets(buf, sizeof(buf), stdin); num = strtol(buf, NULL, 10); } while (num != 75000); return EXIT_SUCCESS; }
Can you help me rewrite this code in C instead of VB, keeping it the same logically?
Option Explicit Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long Sub Musical_Scale() Dim Fqs, i As Integer Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528) For i = LBound(Fqs) To UBound(Fqs) Beep Fqs(i), 500 Next End Sub
#include<stdio.h> #include<conio.h> #include<math.h> #include<dos.h> typedef struct{ char str[3]; int key; }note; note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}}; int main(void) { int i=0; while(!kbhit()) { printf("\t%s",sequence[i].str); sound(261.63*pow(2,sequence[i].key/12.0)); delay(sequence[i].key%12==0?500:1000); i = (i+1)%8; i==0?printf("\n"):printf(""); } nosound(); return 0; }
Translate this program into C but keep the logic exactly as in VB.
Option Explicit Declare Function Beep Lib "kernel32" (ByVal Freq As Long, ByVal Dur As Long) As Long Sub Musical_Scale() Dim Fqs, i As Integer Fqs = Array(264, 297, 330, 352, 396, 440, 495, 528) For i = LBound(Fqs) To UBound(Fqs) Beep Fqs(i), 500 Next End Sub
#include<stdio.h> #include<conio.h> #include<math.h> #include<dos.h> typedef struct{ char str[3]; int key; }note; note sequence[] = {{"Do",0},{"Re",2},{"Mi",4},{"Fa",5},{"So",7},{"La",9},{"Ti",11},{"Do",12}}; int main(void) { int i=0; while(!kbhit()) { printf("\t%s",sequence[i].str); sound(261.63*pow(2,sequence[i].key/12.0)); delay(sequence[i].key%12==0?500:1000); i = (i+1)%8; i==0?printf("\n"):printf(""); } nosound(); return 0; }
Port the provided VB code into C while preserving the original functionality.
Option Explicit Const maxWeight = 400 Dim DataList As Variant Dim xList(64, 3) As Variant Dim nItems As Integer Dim s As String, xss As String Dim xwei As Integer, xval As Integer, nn As Integer Sub Main() Dim i As Integer, j As Integer DataList = Array("map", 9, 150, "compass", 13, 35, "water", 153, 200, "sandwich", 50, 160, _ "glucose", 15, 60, "tin", 68, 45, "banana", 27, 60, "apple", 39, 40, _ "cheese", 23, 30, "beer", 52, 10, "suntan cream", 11, 70, "camera", 32, 30, _ "T-shirt", 24, 15, "trousers", 48, 10, "umbrella", 73, 40, "book", 30, 10, _ "waterproof trousers", 42, 70, "waterproof overclothes", 43, 75, _ "note-case", 22, 80, "sunglasses", 7, 20, "towel", 18, 12, "socks", 4, 50) nItems = (UBound(DataList) + 1) / 3 j = 0 For i = 1 To nItems xList(i, 1) = DataList(j) xList(i, 2) = DataList(j + 1) xList(i, 3) = DataList(j + 2) j = j + 3 Next i s = "" For i = 1 To nItems s = s & Chr(i) Next nn = 0 Call ChoiceBin(1, "") For i = 1 To Len(xss) j = Asc(Mid(xss, i, 1)) Debug.Print xList(j, 1) Next i Debug.Print "count=" & Len(xss), "weight=" & xwei, "value=" & xval End Sub Private Sub ChoiceBin(n As String, ss As String) Dim r As String Dim i As Integer, j As Integer, iwei As Integer, ival As Integer Dim ipct As Integer If n = Len(s) + 1 Then iwei = 0: ival = 0 For i = 1 To Len(ss) j = Asc(Mid(ss, i, 1)) iwei = iwei + xList(j, 2) ival = ival + xList(j, 3) Next If iwei <= maxWeight And ival > xval Then xss = ss: xwei = iwei: xval = ival End If Else r = Mid(s, n, 1) Call ChoiceBin(n + 1, ss & r) Call ChoiceBin(n + 1, ss) End If End Sub
#include <stdio.h> #include <stdlib.h> typedef struct { char *name; int weight; int value; } item_t; item_t items[] = { {"map", 9, 150}, {"compass", 13, 35}, {"water", 153, 200}, {"sandwich", 50, 160}, {"glucose", 15, 60}, {"tin", 68, 45}, {"banana", 27, 60}, {"apple", 39, 40}, {"cheese", 23, 30}, {"beer", 52, 10}, {"suntan cream", 11, 70}, {"camera", 32, 30}, {"T-shirt", 24, 15}, {"trousers", 48, 10}, {"umbrella", 73, 40}, {"waterproof trousers", 42, 70}, {"waterproof overclothes", 43, 75}, {"note-case", 22, 80}, {"sunglasses", 7, 20}, {"towel", 18, 12}, {"socks", 4, 50}, {"book", 30, 10}, }; int *knapsack (item_t *items, int n, int w) { int i, j, a, b, *mm, **m, *s; mm = calloc((n + 1) * (w + 1), sizeof (int)); m = malloc((n + 1) * sizeof (int *)); m[0] = mm; for (i = 1; i <= n; i++) { m[i] = &mm[i * (w + 1)]; for (j = 0; j <= w; j++) { if (items[i - 1].weight > j) { m[i][j] = m[i - 1][j]; } else { a = m[i - 1][j]; b = m[i - 1][j - items[i - 1].weight] + items[i - 1].value; m[i][j] = a > b ? a : b; } } } s = calloc(n, sizeof (int)); for (i = n, j = w; i > 0; i--) { if (m[i][j] > m[i - 1][j]) { s[i - 1] = 1; j -= items[i - 1].weight; } } free(mm); free(m); return s; } int main () { int i, n, tw = 0, tv = 0, *s; n = sizeof (items) / sizeof (item_t); s = knapsack(items, n, 400); for (i = 0; i < n; i++) { if (s[i]) { printf("%-22s %5d %5d\n", items[i].name, items[i].weight, items[i].value); tw += items[i].weight; tv += items[i].value; } } printf("%-22s %5d %5d\n", "totals:", tw, tv); return 0; }
Generate a C translation of this VB snippet without changing its computational steps.
Imports System.Math Module Module1 Const MAXPRIME = 99 Const MAXPARENT = 99 Const NBRCHILDREN = 547100 Public Primes As New Collection() Public PrimesR As New Collection() Public Ancestors As New Collection() Public Parents(MAXPARENT + 1) As Integer Public CptDescendants(MAXPARENT + 1) As Integer Public Children(NBRCHILDREN) As ChildStruct Public iChildren As Integer Public Delimiter As String = ", " Public Structure ChildStruct Public Child As Long Public pLower As Integer Public pHigher As Integer End Structure Sub Main() Dim Parent As Short Dim Sum As Short Dim i As Short Dim TotDesc As Integer = 0 Dim MidPrime As Integer If GetPrimes(Primes, MAXPRIME) = vbFalse Then Return End If For i = Primes.Count To 1 Step -1 PrimesR.Add(Primes.Item(i)) Next MidPrime = PrimesR.Item(1) / 2 For Each Prime In PrimesR Parents(Prime) = InsertChild(Parents(Prime), Prime) CptDescendants(Prime) += 1 If Prime > MidPrime Then Continue For End If For Parent = 1 To MAXPARENT Sum = Parent + Prime If Sum > MAXPARENT Then Exit For End If If Parents(Parent) Then InsertPreorder(Parents(Parent), Sum, Prime) CptDescendants(Sum) += CptDescendants(Parent) End If Next Next RemoveFalseChildren() If MAXPARENT > MAXPRIME Then If GetPrimes(Primes, MAXPARENT) = vbFalse Then Return End If End If FileOpen(1, "Ancestors.txt", OpenMode.Output) For Parent = 1 To MAXPARENT GetAncestors(Parent) PrintLine(1, "[" & Parent.ToString & "] Level: " & Ancestors.Count.ToString) If Ancestors.Count Then Print(1, "Ancestors: " & Ancestors.Item(1).ToString) For i = 2 To Ancestors.Count Print(1, ", " & Ancestors.Item(i).ToString) Next PrintLine(1) Ancestors.Clear() Else PrintLine(1, "Ancestors: None") End If If CptDescendants(Parent) Then PrintLine(1, "Descendants: " & CptDescendants(Parent).ToString) Delimiter = "" PrintDescendants(Parents(Parent)) PrintLine(1) TotDesc += CptDescendants(Parent) Else PrintLine(1, "Descendants: None") End If PrintLine(1) Next Primes.Clear() PrimesR.Clear() PrintLine(1, "Total descendants " & TotDesc.ToString) PrintLine(1) FileClose(1) End Sub Function InsertPreorder(_index As Integer, _sum As Short, _prime As Short) Parents(_sum) = InsertChild(Parents(_sum), Children(_index).Child * _prime) If Children(_index).pLower Then InsertPreorder(Children(_index).pLower, _sum, _prime) End If If Children(_index).pHigher Then InsertPreorder(Children(_index).pHigher, _sum, _prime) End If Return Nothing End Function Function InsertChild(_index As Integer, _child As Long) As Integer If _index Then If _child <= Children(_index).Child Then Children(_index).pLower = InsertChild(Children(_index).pLower, _child) Else Children(_index).pHigher = InsertChild(Children(_index).pHigher, _child) End If Else iChildren += 1 _index = iChildren Children(_index).Child = _child Children(_index).pLower = 0 Children(_index).pHigher = 0 End If Return _index End Function Function RemoveFalseChildren() Dim Exclusions As New Collection Exclusions.Add(4) For Each Prime In Primes Exclusions.Add(Prime) Next For Each ex In Exclusions Parents(ex) = Children(Parents(ex)).pHigher CptDescendants(ex) -= 1 Next Exclusions.Clear() Return Nothing End Function Function GetAncestors(_child As Short) Dim Child As Short = _child Dim Parent As Short = 0 For Each Prime In Primes If Child = 1 Then Exit For End If While Child Mod Prime = 0 Child /= Prime Parent += Prime End While Next If Parent = _child Or _child = 1 Then Return Nothing End If GetAncestors(Parent) Ancestors.Add(Parent) Return Nothing End Function Function PrintDescendants(_index As Integer) If Children(_index).pLower Then PrintDescendants(Children(_index).pLower) End If Print(1, Delimiter.ToString & Children(_index).Child.ToString) Delimiter = ", " If Children(_index).pHigher Then PrintDescendants(Children(_index).pHigher) End If Return Nothing End Function Function GetPrimes(ByRef _primes As Object, Optional _maxPrime As Integer = 2) As Boolean Dim Value As Integer = 3 Dim Max As Integer Dim Prime As Integer If _maxPrime < 2 Then Return vbFalse End If _primes.Add(2) While Value <= _maxPrime Max = Floor(Sqrt(Value)) For Each Prime In _primes If Prime > Max Then _primes.Add(Value) Exit For End If If Value Mod Prime = 0 Then Exit For End If Next Value += 2 End While Return vbTrue End Function End Module
#include <math.h> #include <stdio.h> #include <stdlib.h> #include <string.h> #define MAXPRIME 99 #define MAXPARENT 99 #define NBRPRIMES 30 #define NBRANCESTORS 10 FILE *FileOut; char format[] = ", %lld"; int Primes[NBRPRIMES]; int iPrimes; short Ancestors[NBRANCESTORS]; struct Children { long long Child; struct Children *pNext; }; struct Children *Parents[MAXPARENT+1][2]; int CptDescendants[MAXPARENT+1]; long long MaxDescendant = (long long) pow(3.0, 33.0); short GetParent(long long child); struct Children *AppendChild(struct Children *node, long long child); short GetAncestors(short child); void PrintDescendants(struct Children *node); int GetPrimes(int primes[], int maxPrime); int main() { long long Child; short i, Parent, Level; int TotDesc = 0; if ((iPrimes = GetPrimes(Primes, MAXPRIME)) < 0) return 1; for (Child = 1; Child <= MaxDescendant; Child++) { if (Parent = GetParent(Child)) { Parents[Parent][1] = AppendChild(Parents[Parent][1], Child); if (Parents[Parent][0] == NULL) Parents[Parent][0] = Parents[Parent][1]; CptDescendants[Parent]++; } } if (MAXPARENT > MAXPRIME) if (GetPrimes(Primes, MAXPARENT) < 0) return 1; if (fopen_s(&FileOut, "Ancestors.txt", "w")) return 1; for (Parent = 1; Parent <= MAXPARENT; Parent++) { Level = GetAncestors(Parent); fprintf(FileOut, "[%d] Level: %d\n", Parent, Level); if (Level) { fprintf(FileOut, "Ancestors: %d", Ancestors[0]); for (i = 1; i < Level; i++) fprintf(FileOut, ", %d", Ancestors[i]); } else fprintf(FileOut, "Ancestors: None"); if (CptDescendants[Parent]) { fprintf(FileOut, "\nDescendants: %d\n", CptDescendants[Parent]); strcpy_s(format, "%lld"); PrintDescendants(Parents[Parent][0]); fprintf(FileOut, "\n"); } else fprintf(FileOut, "\nDescendants: None\n"); fprintf(FileOut, "\n"); TotDesc += CptDescendants[Parent]; } fprintf(FileOut, "Total descendants %d\n\n", TotDesc); if (fclose(FileOut)) return 1; return 0; } short GetParent(long long child) { long long Child = child; short Parent = 0; short Index = 0; while (Child > 1 && Parent <= MAXPARENT) { if (Index > iPrimes) return 0; while (Child % Primes[Index] == 0) { Child /= Primes[Index]; Parent += Primes[Index]; } Index++; } if (Parent == child || Parent > MAXPARENT || child == 1) return 0; return Parent; } struct Children *AppendChild(struct Children *node, long long child) { static struct Children *NodeNew; if (NodeNew = (struct Children *) malloc(sizeof(struct Children))) { NodeNew->Child = child; NodeNew->pNext = NULL; if (node != NULL) node->pNext = NodeNew; } return NodeNew; } short GetAncestors(short child) { short Child = child; short Parent = 0; short Index = 0; while (Child > 1) { while (Child % Primes[Index] == 0) { Child /= Primes[Index]; Parent += Primes[Index]; } Index++; } if (Parent == child || child == 1) return 0; Index = GetAncestors(Parent); Ancestors[Index] = Parent; return ++Index; } void PrintDescendants(struct Children *node) { static struct Children *NodeCurr; static struct Children *NodePrev; NodeCurr = node; NodePrev = NULL; while (NodeCurr) { fprintf(FileOut, format, NodeCurr->Child); strcpy_s(format, ", %lld"); NodePrev = NodeCurr; NodeCurr = NodeCurr->pNext; free(NodePrev); } return; } int GetPrimes(int primes[], int maxPrime) { if (maxPrime < 2) return -1; int Index = 0, Value = 1; int Max, i; primes[0] = 2; while ((Value += 2) <= maxPrime) { Max = (int) floor(sqrt((double) Value)); for (i = 0; i <= Index; i++) { if (primes[i] > Max) { if (++Index >= NBRPRIMES) return -1; primes[Index] = Value; break; } if (Value % primes[i] == 0) break; } } return Index; }
Generate a C translation of this VB snippet without changing its computational steps.
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
#include<string.h> #include<stdlib.h> #include<stdio.h> void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){ int i,j; if(times==numSets){ printf("("); for(i=0;i<times;i++){ printf("%d,",currentSet[i]); } printf("\b),"); } else{ for(j=0;j<setLengths[times];j++){ currentSet[times] = sets[times][j]; cartesianProduct(sets,setLengths,currentSet,numSets,times+1); } } } void printSets(int** sets, int* setLengths, int numSets){ int i,j; printf("\nNumber of sets : %d",numSets); for(i=0;i<numSets+1;i++){ printf("\nSet %d : ",i+1); for(j=0;j<setLengths[i];j++){ printf(" %d ",sets[i][j]); } } } void processInputString(char* str){ int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0; char *token,*holder,*holderToken; for(i=0;str[i]!=00;i++) if(str[i]=='x') numSets++; if(numSets==0){ printf("\n%s",str); return; } currentSet = (int*)calloc(sizeof(int),numSets + 1); setLengths = (int*)calloc(sizeof(int),numSets + 1); sets = (int**)malloc((numSets + 1)*sizeof(int*)); token = strtok(str,"x"); while(token!=NULL){ holder = (char*)malloc(strlen(token)*sizeof(char)); j = 0; for(i=0;token[i]!=00;i++){ if(token[i]>='0' && token[i]<='9') holder[j++] = token[i]; else if(token[i]==',') holder[j++] = ' '; } holder[j] = 00; setLength = 0; for(i=0;holder[i]!=00;i++) if(holder[i]==' ') setLength++; if(setLength==0 && strlen(holder)==0){ printf("\n{}"); return; } setLengths[counter] = setLength+1; sets[counter] = (int*)malloc((1+setLength)*sizeof(int)); k = 0; start = 0; for(l=0;holder[l]!=00;l++){ if(holder[l+1]==' '||holder[l+1]==00){ holderToken = (char*)malloc((l+1-start)*sizeof(char)); strncpy(holderToken,holder + start,l+1-start); sets[counter][k++] = atoi(holderToken); start = l+2; } } counter++; token = strtok(NULL,"x"); } printf("\n{"); cartesianProduct(sets,setLengths,currentSet,numSets + 1,0); printf("\b}"); } int main(int argC,char* argV[]) { if(argC!=2) printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]); else processInputString(argV[1]); return 0; }
Write the same code in C as shown below in VB.
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
#include<string.h> #include<stdlib.h> #include<stdio.h> void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){ int i,j; if(times==numSets){ printf("("); for(i=0;i<times;i++){ printf("%d,",currentSet[i]); } printf("\b),"); } else{ for(j=0;j<setLengths[times];j++){ currentSet[times] = sets[times][j]; cartesianProduct(sets,setLengths,currentSet,numSets,times+1); } } } void printSets(int** sets, int* setLengths, int numSets){ int i,j; printf("\nNumber of sets : %d",numSets); for(i=0;i<numSets+1;i++){ printf("\nSet %d : ",i+1); for(j=0;j<setLengths[i];j++){ printf(" %d ",sets[i][j]); } } } void processInputString(char* str){ int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0; char *token,*holder,*holderToken; for(i=0;str[i]!=00;i++) if(str[i]=='x') numSets++; if(numSets==0){ printf("\n%s",str); return; } currentSet = (int*)calloc(sizeof(int),numSets + 1); setLengths = (int*)calloc(sizeof(int),numSets + 1); sets = (int**)malloc((numSets + 1)*sizeof(int*)); token = strtok(str,"x"); while(token!=NULL){ holder = (char*)malloc(strlen(token)*sizeof(char)); j = 0; for(i=0;token[i]!=00;i++){ if(token[i]>='0' && token[i]<='9') holder[j++] = token[i]; else if(token[i]==',') holder[j++] = ' '; } holder[j] = 00; setLength = 0; for(i=0;holder[i]!=00;i++) if(holder[i]==' ') setLength++; if(setLength==0 && strlen(holder)==0){ printf("\n{}"); return; } setLengths[counter] = setLength+1; sets[counter] = (int*)malloc((1+setLength)*sizeof(int)); k = 0; start = 0; for(l=0;holder[l]!=00;l++){ if(holder[l+1]==' '||holder[l+1]==00){ holderToken = (char*)malloc((l+1-start)*sizeof(char)); strncpy(holderToken,holder + start,l+1-start); sets[counter][k++] = atoi(holderToken); start = l+2; } } counter++; token = strtok(NULL,"x"); } printf("\n{"); cartesianProduct(sets,setLengths,currentSet,numSets + 1,0); printf("\b}"); } int main(int argC,char* argV[]) { if(argC!=2) printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]); else processInputString(argV[1]); return 0; }
Translate this program into C but keep the logic exactly as in VB.
Imports System.Runtime.CompilerServices Module Module1 <Extension()> Function CartesianProduct(Of T)(sequences As IEnumerable(Of IEnumerable(Of T))) As IEnumerable(Of IEnumerable(Of T)) Dim emptyProduct As IEnumerable(Of IEnumerable(Of T)) = {Enumerable.Empty(Of T)} Return sequences.Aggregate(emptyProduct, Function(accumulator, sequence) From acc In accumulator From item In sequence Select acc.Concat({item})) End Function Sub Main() Dim empty(-1) As Integer Dim list1 = {1, 2} Dim list2 = {3, 4} Dim list3 = {1776, 1789} Dim list4 = {7, 12} Dim list5 = {4, 14, 23} Dim list6 = {0, 1} Dim list7 = {1, 2, 3} Dim list8 = {30} Dim list9 = {500, 100} For Each sequnceList As Integer()() In { ({list1, list2}), ({list2, list1}), ({list1, empty}), ({empty, list1}), ({list3, list4, list5, list6}), ({list7, list8, list9}), ({list7, empty, list9}) } Dim cart = sequnceList.CartesianProduct().Select(Function(tuple) $"({String.Join(", ", tuple)})") Console.WriteLine($"{{{String.Join(", ", cart)}}}") Next End Sub End Module
#include<string.h> #include<stdlib.h> #include<stdio.h> void cartesianProduct(int** sets, int* setLengths, int* currentSet, int numSets, int times){ int i,j; if(times==numSets){ printf("("); for(i=0;i<times;i++){ printf("%d,",currentSet[i]); } printf("\b),"); } else{ for(j=0;j<setLengths[times];j++){ currentSet[times] = sets[times][j]; cartesianProduct(sets,setLengths,currentSet,numSets,times+1); } } } void printSets(int** sets, int* setLengths, int numSets){ int i,j; printf("\nNumber of sets : %d",numSets); for(i=0;i<numSets+1;i++){ printf("\nSet %d : ",i+1); for(j=0;j<setLengths[i];j++){ printf(" %d ",sets[i][j]); } } } void processInputString(char* str){ int **sets, *currentSet, *setLengths, setLength, numSets = 0, i,j,k,l,start,counter=0; char *token,*holder,*holderToken; for(i=0;str[i]!=00;i++) if(str[i]=='x') numSets++; if(numSets==0){ printf("\n%s",str); return; } currentSet = (int*)calloc(sizeof(int),numSets + 1); setLengths = (int*)calloc(sizeof(int),numSets + 1); sets = (int**)malloc((numSets + 1)*sizeof(int*)); token = strtok(str,"x"); while(token!=NULL){ holder = (char*)malloc(strlen(token)*sizeof(char)); j = 0; for(i=0;token[i]!=00;i++){ if(token[i]>='0' && token[i]<='9') holder[j++] = token[i]; else if(token[i]==',') holder[j++] = ' '; } holder[j] = 00; setLength = 0; for(i=0;holder[i]!=00;i++) if(holder[i]==' ') setLength++; if(setLength==0 && strlen(holder)==0){ printf("\n{}"); return; } setLengths[counter] = setLength+1; sets[counter] = (int*)malloc((1+setLength)*sizeof(int)); k = 0; start = 0; for(l=0;holder[l]!=00;l++){ if(holder[l+1]==' '||holder[l+1]==00){ holderToken = (char*)malloc((l+1-start)*sizeof(char)); strncpy(holderToken,holder + start,l+1-start); sets[counter][k++] = atoi(holderToken); start = l+2; } } counter++; token = strtok(NULL,"x"); } printf("\n{"); cartesianProduct(sets,setLengths,currentSet,numSets + 1,0); printf("\b}"); } int main(int argC,char* argV[]) { if(argC!=2) printf("Usage : %s <Set product expression enclosed in double quotes>",argV[0]); else processInputString(argV[1]); return 0; }
Write the same algorithm in C as shown in this VB implementation.
dim _proper_divisors(100) sub proper_divisors(n) dim i dim _proper_divisors_count = 0 if n <> 1 then for i = 1 to (n \ 2) if n %% i = 0 then _proper_divisors_count = _proper_divisors_count + 1 _proper_divisors(_proper_divisors_count) = i end if next end if return _proper_divisors_count end sub sub show_proper_divisors(n, tabbed) dim cnt = proper_divisors(n) print str$(n) + ":"; tab(4);"(" + str$(cnt) + " items) "; dim j for j = 1 to cnt if tabbed then print str$(_proper_divisors(j)), else print str$(_proper_divisors(j)); end if if (j < cnt) then print ","; next print end sub dim i for i = 1 to 10 show_proper_divisors(i, false) next dim c dim maxindex = 0 dim maxlength = 0 for t = 1 to 20000 c = proper_divisors(t) if c > maxlength then maxindex = t maxlength = c end if next print "A maximum at "; show_proper_divisors(maxindex, false)
#include <stdio.h> #include <stdbool.h> int proper_divisors(const int n, bool print_flag) { int count = 0; for (int i = 1; i < n; ++i) { if (n % i == 0) { count++; if (print_flag) printf("%d ", i); } } if (print_flag) printf("\n"); return count; } int main(void) { for (int i = 1; i <= 10; ++i) { printf("%d: ", i); proper_divisors(i, true); } int max = 0; int max_i = 1; for (int i = 1; i <= 20000; ++i) { int v = proper_divisors(i, false); if (v >= max) { max = v; max_i = i; } } printf("%d with %d divisors\n", max_i, max); return 0; }
Preserve the algorithm and functionality while converting the code from VB to C.
Module XMLOutput Sub Main() Dim charRemarks As New Dictionary(Of String, String) charRemarks.Add("April", "Bubbly: I charRemarks.Add("Tam O charRemarks.Add("Emily", "Short & shrift") Dim xml = <CharacterRemarks> <%= From cr In charRemarks Select <Character name=<%= cr.Key %>><%= cr.Value %></Character> %> </CharacterRemarks> Console.WriteLine(xml) End Sub End Module
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <libxml/parser.h> #include <libxml/tree.h> const char *names[] = { "April", "Tam O'Shanter", "Emily", NULL }; const char *remarks[] = { "Bubbly: I'm > Tam and <= Emily", "Burns: \"When chapman billies leave the street ...\"", "Short & shrift", NULL }; int main() { xmlDoc *doc = NULL; xmlNode *root = NULL, *node; const char **next; int a; doc = xmlNewDoc("1.0"); root = xmlNewNode(NULL, "CharacterRemarks"); xmlDocSetRootElement(doc, root); for(next = names, a = 0; *next != NULL; next++, a++) { node = xmlNewNode(NULL, "Character"); (void)xmlNewProp(node, "name", *next); xmlAddChild(node, xmlNewText(remarks[a])); xmlAddChild(root, node); } xmlElemDump(stdout, doc, root); xmlFreeDoc(doc); xmlCleanupParser(); return EXIT_SUCCESS; }
Produce a functionally identical C code for the snippet given in VB.
Private Sub plot_coordinate_pairs(x As Variant, y As Variant) Dim chrt As Chart Set chrt = ActiveSheet.Shapes.AddChart.Chart With chrt .ChartType = xlLine .HasLegend = False .HasTitle = True .ChartTitle.Text = "Time" .SeriesCollection.NewSeries .SeriesCollection.Item(1).XValues = x .SeriesCollection.Item(1).Values = y .Axes(xlValue, xlPrimary).HasTitle = True .Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds" End With End Sub Public Sub main() x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}] y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}] plot_coordinate_pairs x, y End Sub
#include <stdio.h> #include <stdlib.h> #include <math.h> #include <plot.h> #define NP 10 double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}; void minmax(double *x, double *y, double *minx, double *maxx, double *miny, double *maxy, int n) { int i; *minx = *maxx = x[0]; *miny = *maxy = y[0]; for(i=1; i < n; i++) { if ( x[i] < *minx ) *minx = x[i]; if ( x[i] > *maxx ) *maxx = x[i]; if ( y[i] < *miny ) *miny = y[i]; if ( y[i] > *maxy ) *maxy = y[i]; } } #define YLAB_HEIGHT_F 0.1 #define XLAB_WIDTH_F 0.2 #define XDIV (NP*1.0) #define YDIV (NP*1.0) #define EXTRA_W 0.01 #define EXTRA_H 0.01 #define DOTSCALE (1.0/150.0) #define MAXLABLEN 32 #define PUSHSCALE(X,Y) pl_fscale((X),(Y)) #define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y)) #define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy) int main() { int plotter, i; double minx, miny, maxx, maxy; double lx, ly; double xticstep, yticstep, nx, ny; double sx, sy; char labs[MAXLABLEN+1]; plotter = pl_newpl("png", NULL, stdout, NULL); if ( plotter < 0 ) exit(1); pl_selectpl(plotter); if ( pl_openpl() < 0 ) exit(1); minmax(x, y, &minx, &maxx, &miny, &maxy, NP); lx = maxx - minx; ly = maxy - miny; pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly, ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly); xticstep = (ceil(maxx) - floor(minx)) / XDIV; yticstep = (ceil(maxy) - floor(miny)) / YDIV; pl_flinewidth(0.25); if ( lx < ly ) { sx = lx/ly; sy = 1.0; } else { sx = 1.0; sy = ly/lx; } pl_erase(); pl_fbox(floor(minx), floor(miny), ceil(maxx), ceil(maxy)); pl_fontname("HersheySerif"); for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) { pl_fline(floor(minx), ny, ceil(maxx), ny); snprintf(labs, MAXLABLEN, "%6.2lf", ny); FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny); PUSHSCALE(sx,sy); pl_label(labs); POPSCALE(sx,sy); } for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) { pl_fline(nx, floor(miny), nx, ceil(maxy)); snprintf(labs, MAXLABLEN, "%6.2lf", nx); FMOVESCALE(nx, floor(miny)); PUSHSCALE(sx,sy); pl_ftextangle(-90); pl_alabel('l', 'b', labs); POPSCALE(sx,sy); } pl_fillcolorname("red"); pl_filltype(1); for(i=0; i < NP; i++) { pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE, x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE); } pl_flushpl(); pl_closepl(); }
Convert the following code from VB to C, ensuring the logic remains intact.
Private Sub plot_coordinate_pairs(x As Variant, y As Variant) Dim chrt As Chart Set chrt = ActiveSheet.Shapes.AddChart.Chart With chrt .ChartType = xlLine .HasLegend = False .HasTitle = True .ChartTitle.Text = "Time" .SeriesCollection.NewSeries .SeriesCollection.Item(1).XValues = x .SeriesCollection.Item(1).Values = y .Axes(xlValue, xlPrimary).HasTitle = True .Axes(xlValue, xlPrimary).AxisTitle.Characters.Text = "microseconds" End With End Sub Public Sub main() x = [{0, 1, 2, 3, 4, 5, 6, 7, 8, 9}] y = [{2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}] plot_coordinate_pairs x, y End Sub
#include <stdio.h> #include <stdlib.h> #include <math.h> #include <plot.h> #define NP 10 double x[NP] = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}; double y[NP] = {2.7, 2.8, 31.4, 38.1, 58.0, 76.2, 100.5, 130.0, 149.3, 180.0}; void minmax(double *x, double *y, double *minx, double *maxx, double *miny, double *maxy, int n) { int i; *minx = *maxx = x[0]; *miny = *maxy = y[0]; for(i=1; i < n; i++) { if ( x[i] < *minx ) *minx = x[i]; if ( x[i] > *maxx ) *maxx = x[i]; if ( y[i] < *miny ) *miny = y[i]; if ( y[i] > *maxy ) *maxy = y[i]; } } #define YLAB_HEIGHT_F 0.1 #define XLAB_WIDTH_F 0.2 #define XDIV (NP*1.0) #define YDIV (NP*1.0) #define EXTRA_W 0.01 #define EXTRA_H 0.01 #define DOTSCALE (1.0/150.0) #define MAXLABLEN 32 #define PUSHSCALE(X,Y) pl_fscale((X),(Y)) #define POPSCALE(X,Y) pl_fscale(1.0/(X), 1.0/(Y)) #define FMOVESCALE(X,Y) pl_fmove((X)/sx, (Y)/sy) int main() { int plotter, i; double minx, miny, maxx, maxy; double lx, ly; double xticstep, yticstep, nx, ny; double sx, sy; char labs[MAXLABLEN+1]; plotter = pl_newpl("png", NULL, stdout, NULL); if ( plotter < 0 ) exit(1); pl_selectpl(plotter); if ( pl_openpl() < 0 ) exit(1); minmax(x, y, &minx, &maxx, &miny, &maxy, NP); lx = maxx - minx; ly = maxy - miny; pl_fspace(floor(minx) - XLAB_WIDTH_F * lx, floor(miny) - YLAB_HEIGHT_F * ly, ceil(maxx) + EXTRA_W * lx, ceil(maxy) + EXTRA_H * ly); xticstep = (ceil(maxx) - floor(minx)) / XDIV; yticstep = (ceil(maxy) - floor(miny)) / YDIV; pl_flinewidth(0.25); if ( lx < ly ) { sx = lx/ly; sy = 1.0; } else { sx = 1.0; sy = ly/lx; } pl_erase(); pl_fbox(floor(minx), floor(miny), ceil(maxx), ceil(maxy)); pl_fontname("HersheySerif"); for(ny=floor(miny); ny < ceil(maxy); ny += yticstep) { pl_fline(floor(minx), ny, ceil(maxx), ny); snprintf(labs, MAXLABLEN, "%6.2lf", ny); FMOVESCALE(floor(minx) - XLAB_WIDTH_F * lx, ny); PUSHSCALE(sx,sy); pl_label(labs); POPSCALE(sx,sy); } for(nx=floor(minx); nx < ceil(maxx); nx += xticstep) { pl_fline(nx, floor(miny), nx, ceil(maxy)); snprintf(labs, MAXLABLEN, "%6.2lf", nx); FMOVESCALE(nx, floor(miny)); PUSHSCALE(sx,sy); pl_ftextangle(-90); pl_alabel('l', 'b', labs); POPSCALE(sx,sy); } pl_fillcolorname("red"); pl_filltype(1); for(i=0; i < NP; i++) { pl_fbox(x[i] - lx * DOTSCALE, y[i] - ly * DOTSCALE, x[i] + lx * DOTSCALE, y[i] + ly * DOTSCALE); } pl_flushpl(); pl_closepl(); }
Please provide an equivalent version of this VB code in C.
text = "I need more coffee!!!" Set regex = New RegExp regex.Global = True regex.Pattern = "\s" If regex.Test(text) Then WScript.StdOut.Write regex.Replace(text,vbCrLf) Else WScript.StdOut.Write "No matching pattern" End If
#include <stdio.h> #include <stdlib.h> #include <sys/types.h> #include <regex.h> #include <string.h> int main() { regex_t preg; regmatch_t substmatch[1]; const char *tp = "string$"; const char *t1 = "this is a matching string"; const char *t2 = "this is not a matching string!"; const char *ss = "istyfied"; regcomp(&preg, "string$", REG_EXTENDED); printf("'%s' %smatched with '%s'\n", t1, (regexec(&preg, t1, 0, NULL, 0)==0) ? "" : "did not ", tp); printf("'%s' %smatched with '%s'\n", t2, (regexec(&preg, t2, 0, NULL, 0)==0) ? "" : "did not ", tp); regfree(&preg); regcomp(&preg, "a[a-z]+", REG_EXTENDED); if ( regexec(&preg, t1, 1, substmatch, 0) == 0 ) { char *ns = malloc(substmatch[0].rm_so + 1 + strlen(ss) + (strlen(t1) - substmatch[0].rm_eo) + 2); memcpy(ns, t1, substmatch[0].rm_so+1); memcpy(&ns[substmatch[0].rm_so], ss, strlen(ss)); memcpy(&ns[substmatch[0].rm_so+strlen(ss)], &t1[substmatch[0].rm_eo], strlen(&t1[substmatch[0].rm_eo])); ns[ substmatch[0].rm_so + strlen(ss) + strlen(&t1[substmatch[0].rm_eo]) ] = 0; printf("mod string: '%s'\n", ns); free(ns); } else { printf("the string '%s' is the same: no matching!\n", t1); } regfree(&preg); return 0; }
Ensure the translated C code behaves exactly like the original VB snippet.
Set dict = CreateObject("Scripting.Dictionary") os = Array("Windows", "Linux", "MacOS") owner = Array("Microsoft", "Linus Torvalds", "Apple") For n = 0 To 2 dict.Add os(n), owner(n) Next MsgBox dict.Item("Linux") MsgBox dict.Item("MacOS") MsgBox dict.Item("Windows")
#include <stdio.h> #include <stdlib.h> #include <string.h> #define KeyType const char * #define ValType int #define HASH_SIZE 4096 unsigned strhashkey( const char * key, int max) { unsigned h=0; unsigned hl, hr; while(*key) { h += *key; hl= 0x5C5 ^ (h&0xfff00000 )>>18; hr =(h&0x000fffff ); h = hl ^ hr ^ *key++; } return h % max; } typedef struct sHme { KeyType key; ValType value; struct sHme *link; } *MapEntry; typedef struct he { MapEntry first, last; } HashElement; HashElement hash[HASH_SIZE]; typedef void (*KeyCopyF)(KeyType *kdest, KeyType ksrc); typedef void (*ValCopyF)(ValType *vdest, ValType vsrc); typedef unsigned (*KeyHashF)( KeyType key, int upperBound ); typedef int (*KeyCmprF)(KeyType key1, KeyType key2); void HashAddH( KeyType key, ValType value, KeyCopyF copyKey, ValCopyF copyVal, KeyHashF hashKey, KeyCmprF keySame ) { unsigned hix = (*hashKey)(key, HASH_SIZE); MapEntry m_ent; for (m_ent= hash[hix].first; m_ent && !(*keySame)(m_ent->key,key); m_ent=m_ent->link); if (m_ent) { (*copyVal)(&m_ent->value, value); } else { MapEntry last; MapEntry hme = malloc(sizeof(struct sHme)); (*copyKey)(&hme->key, key); (*copyVal)(&hme->value, value); hme->link = NULL; last = hash[hix].last; if (last) { last->link = hme; } else hash[hix].first = hme; hash[hix].last = hme; } } int HashGetH(ValType *val, KeyType key, KeyHashF hashKey, KeyCmprF keySame ) { unsigned hix = (*hashKey)(key, HASH_SIZE); MapEntry m_ent; for (m_ent= hash[hix].first; m_ent && !(*keySame)(m_ent->key,key); m_ent=m_ent->link); if (m_ent) { *val = m_ent->value; } return (m_ent != NULL); } void copyStr(const char**dest, const char *src) { *dest = strdup(src); } void copyInt( int *dest, int src) { *dest = src; } int strCompare( const char *key1, const char *key2) { return strcmp(key1, key2) == 0; } void HashAdd( KeyType key, ValType value ) { HashAddH( key, value, &copyStr, &copyInt, &strhashkey, &strCompare); } int HashGet(ValType *val, KeyType key) { return HashGetH( val, key, &strhashkey, &strCompare); } int main() { static const char * keyList[] = {"red","orange","yellow","green", "blue", "violet" }; static int valuList[] = {1,43,640, 747, 42, 42}; int ix; for (ix=0; ix<6; ix++) { HashAdd(keyList[ix], valuList[ix]); } return 0; }
Port the following code from VB to C with equivalent syntax and logic.
Public Class Main Inherits System.Windows.Forms.Form Public Sub New() Me.FormBorderStyle = FormBorderStyle.None Me.WindowState = FormWindowState.Maximized End Sub Private Sub Main_Load(sender As Object, e As EventArgs) Handles Me.Load Dim Index As Integer Dim Colors() As Color = {Color.Black, Color.Red, Color.Green, Color.Magenta, Color.Cyan, Color.Yellow, Color.White} Dim Height = (Me.ClientSize.Height / 4) + 1 For y = 1 To 4 Dim Top = Me.ClientSize.Height / 4 * (y - 1) For x = 0 To Me.ClientSize.Width Step y If Index = 6 Then Index = 0 Else Index += 1 Me.Controls.Add(New Panel With {.Top = Top, .Height = Height, .Left = x, .Width = y, .BackColor = Colors(Index)}) Next Next End Sub End Class
#include<graphics.h> #include<conio.h> #define sections 4 int main() { int d=DETECT,m,maxX,maxY,x,y,colour=0,increment=1; initgraph(&d,&m,"c:/turboc3/bgi"); maxX = getmaxx(); maxY = getmaxy(); for(y=0;y<maxY;y+=maxY/sections) { for(x=0;x<maxX;x+=increment) { setfillstyle(SOLID_FILL,(colour++)%16); bar(x,y,x+increment,y+maxY/sections); } increment++; colour = 0; } getch(); closegraph(); return 0; }
Write the same algorithm in C as shown in this VB implementation.
Function cocktailShakerSort(ByVal A As Variant) As Variant beginIdx = LBound(A) endIdx = UBound(A) - 1 Do While beginIdx <= endIdx newBeginIdx = endIdx newEndIdx = beginIdx For ii = beginIdx To endIdx If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newEndIdx = ii End If Next ii endIdx = newEndIdx - 1 For ii = endIdx To beginIdx Step -1 If A(ii) > A(ii + 1) Then tmp = A(ii): A(ii) = A(ii + 1): A(ii + 1) = tmp newBeginIdx = ii End If Next ii beginIdx = newBeginIdx + 1 Loop cocktailShakerSort = A End Function Public Sub main() Dim B(20) As Variant For i = LBound(B) To UBound(B) B(i) = Int(Rnd() * 100) Next i Debug.Print Join(B, ", ") Debug.Print Join(cocktailShakerSort(B), ", ") End Sub
#include <stdio.h> #include <string.h> void swap(char* p1, char* p2, size_t size) { for (; size-- > 0; ++p1, ++p2) { char tmp = *p1; *p1 = *p2; *p2 = tmp; } } void cocktail_shaker_sort(void* base, size_t count, size_t size, int (*cmp)(const void*, const void*)) { char* begin = base; char* end = base + size * count; if (end == begin) return; for (end -= size; begin < end; ) { char* new_begin = end; char* new_end = begin; for (char* p = begin; p < end; p += size) { char* q = p + size; if (cmp(p, q) > 0) { swap(p, q, size); new_end = p; } } end = new_end; for (char* p = end; p > begin; p -= size) { char* q = p - size; if (cmp(q, p) > 0) { swap(p, q, size); new_begin = p; } } begin = new_begin; } } int string_compare(const void* p1, const void* p2) { const char* const* s1 = p1; const char* const* s2 = p2; return strcmp(*s1, *s2); } void print(const char** a, size_t len) { for (size_t i = 0; i < len; ++i) printf("%s ", a[i]); printf("\n"); } int main() { const char* a[] = { "one", "two", "three", "four", "five", "six", "seven", "eight" }; const size_t len = sizeof(a)/sizeof(a[0]); printf("before: "); print(a, len); cocktail_shaker_sort(a, len, sizeof(char*), string_compare); printf("after: "); print(a, len); return 0; }
Generate an equivalent C version of this VB code.
option explicit const dt = 0.15 const length=23 dim ans0:ans0=chr(27)&"[" dim Veloc,Accel,angle,olr,olc,r,c const r0=1 const c0=40 cls angle=0.7 while 1 wscript.sleep(50) Accel = -.9 * sin(Angle) Veloc = Veloc + Accel * dt Angle = Angle + Veloc * dt r = r0 + int(cos(Angle) * Length) c = c0+ int(2*sin(Angle) * Length) cls draw_line r,c,r0,c0 toxy r,c,"O" olr=r :olc=c wend sub cls() wscript.StdOut.Write ans0 &"2J"&ans0 &"?25l":end sub sub toxy(r,c,s) wscript.StdOut.Write ans0 & r & ";" & c & "f" & s :end sub Sub draw_line(r1,c1, r2,c2) Dim x,y,xf,yf,dx,dy,sx,sy,err,err2 x =r1 : y =c1 xf=r2 : yf=c2 dx=Abs(xf-x) : dy=Abs(yf-y) If x<xf Then sx=+1: Else sx=-1 If y<yf Then sy=+1: Else sy=-1 err=dx-dy Do toxy x,y,"." If x=xf And y=yf Then Exit Do err2=err+err If err2>-dy Then err=err-dy: x=x+sx If err2< dx Then err=err+dx: y=y+sy Loop End Sub
#include <stdlib.h> #include <math.h> #include <GL/glut.h> #include <GL/gl.h> #include <sys/time.h> #define length 5 #define g 9.8 double alpha, accl, omega = 0, E; struct timeval tv; double elappsed() { struct timeval now; gettimeofday(&now, 0); int ret = (now.tv_sec - tv.tv_sec) * 1000000 + now.tv_usec - tv.tv_usec; tv = now; return ret / 1.e6; } void resize(int w, int h) { glViewport(0, 0, w, h); glMatrixMode(GL_PROJECTION); glLoadIdentity(); glMatrixMode(GL_MODELVIEW); glLoadIdentity(); glOrtho(0, w, h, 0, -1, 1); } void render() { double x = 320 + 300 * sin(alpha), y = 300 * cos(alpha); resize(640, 320); glClear(GL_COLOR_BUFFER_BIT); glBegin(GL_LINES); glVertex2d(320, 0); glVertex2d(x, y); glEnd(); glFlush(); double us = elappsed(); alpha += (omega + us * accl / 2) * us; omega += accl * us; if (length * g * (1 - cos(alpha)) >= E) { alpha = (alpha < 0 ? -1 : 1) * acos(1 - E / length / g); omega = 0; } accl = -g / length * sin(alpha); } void init_gfx(int *c, char **v) { glutInit(c, v); glutInitDisplayMode(GLUT_RGB); glutInitWindowSize(640, 320); glutIdleFunc(render); glutCreateWindow("Pendulum"); } int main(int c, char **v) { alpha = 4 * atan2(1, 1) / 2.1; E = length * g * (1 - cos(alpha)); accl = -g / length * sin(alpha); omega = 0; gettimeofday(&tv, 0); init_gfx(&c, v); glutMainLoop(); return 0; }
Generate an equivalent C version of this VB code.
Function Encoder(ByVal n) Encoder = n Xor (n \ 2) End Function Function Decoder(ByVal n) Dim g : g = 0 Do While n > 0 g = g Xor n n = n \ 2 Loop Decoder = g End Function Function Dec2bin(ByVal n, ByVal length) Dim i, strbin : strbin = "" For i = 1 to 5 strbin = (n Mod 2) & strbin n = n \ 2 Next Dec2Bin = strbin End Function WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary") For i = 0 to 31 encoded = Encoder(i) decoded = Decoder(encoded) WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5)) Next
int gray_encode(int n) { return n ^ (n >> 1); } int gray_decode(int n) { int p = n; while (n >>= 1) p ^= n; return p; }
Write a version of this VB function in C with identical behavior.
Function Encoder(ByVal n) Encoder = n Xor (n \ 2) End Function Function Decoder(ByVal n) Dim g : g = 0 Do While n > 0 g = g Xor n n = n \ 2 Loop Decoder = g End Function Function Dec2bin(ByVal n, ByVal length) Dim i, strbin : strbin = "" For i = 1 to 5 strbin = (n Mod 2) & strbin n = n \ 2 Next Dec2Bin = strbin End Function WScript.StdOut.WriteLine("Binary -> Gray Code -> Binary") For i = 0 to 31 encoded = Encoder(i) decoded = Decoder(encoded) WScript.StdOut.WriteLine(Dec2Bin(i, 5) & " -> " & Dec2Bin(encoded, 5) & " -> " & Dec2Bin(decoded, 5)) Next
int gray_encode(int n) { return n ^ (n >> 1); } int gray_decode(int n) { int p = n; while (n >>= 1) p ^= n; return p; }
Port the provided VB code into C while preserving the original functionality.
class playingcard dim suit dim pips end class class carddeck private suitnames private pipnames private cardno private deck(52) private nTop sub class_initialize dim suit dim pips suitnames = split("H,D,C,S",",") pipnames = split("A,2,3,4,5,6,7,8,9,10,J,Q,K",",") cardno = 0 for suit = 1 to 4 for pips = 1 to 13 set deck(cardno) = new playingcard deck(cardno).suit = suitnames(suit-1) deck(cardno).pips = pipnames(pips-1) cardno = cardno + 1 next next nTop = 0 end sub public sub showdeck dim a redim a(51-nTop) for i = nTop to 51 a(i) = deck(i).pips & deck(i).suit next wscript.echo join( a, ", ") end sub public sub shuffle dim r randomize timer for i = nTop to 51 r = int( rnd * ( 52 - nTop ) ) if r <> i then objswap deck(i),deck(r) end if next end sub public function deal() set deal = deck( nTop ) nTop = nTop + 1 end function public property get cardsRemaining cardsRemaining = 52 - nTop end property private sub objswap( a, b ) dim tmp set tmp = a set a = b set b = tmp end sub end class
#include <stdio.h> #include <stdlib.h> #include <locale.h> int locale_ok = 0; wchar_t s_suits[] = L"♠♥♦♣"; const char *s_suits_ascii[] = { "S", "H", "D", "C" }; const char *s_nums[] = { "WHAT", "A", "2", "3", "4", "5", "6", "7", "8", "9", "10", "J", "Q", "K", "OVERFLOW" }; typedef struct { int suit, number, _s; } card_t, *card; typedef struct { int n; card_t cards[52]; } deck_t, *deck; void show_card(card c) { if (locale_ok) printf(" %lc%s", s_suits[c->suit], s_nums[c->number]); else printf(" %s%s", s_suits_ascii[c->suit], s_nums[c->number]); } deck new_deck() { int i, j, k; deck d = malloc(sizeof(deck_t)); d->n = 52; for (i = k = 0; i < 4; i++) for (j = 1; j <= 13; j++, k++) { d->cards[k].suit = i; d->cards[k].number = j; } return d; } void show_deck(deck d) { int i; printf("%d cards:", d->n); for (i = 0; i < d->n; i++) show_card(d->cards + i); printf("\n"); } int cmp_card(const void *a, const void *b) { int x = ((card)a)->_s, y = ((card)b)->_s; return x < y ? -1 : x > y; } card deal_card(deck d) { if (!d->n) return 0; return d->cards + --d->n; } void shuffle_deck(deck d) { int i; for (i = 0; i < d->n; i++) d->cards[i]._s = rand(); qsort(d->cards, d->n, sizeof(card_t), cmp_card); } int main() { int i, j; deck d = new_deck(); locale_ok = (0 != setlocale(LC_CTYPE, "")); printf("New deck, "); show_deck(d); printf("\nShuffle and deal to three players:\n"); shuffle_deck(d); for (i = 0; i < 3; i++) { for (j = 0; j < 5; j++) show_card(deal_card(d)); printf("\n"); } printf("Left in deck "); show_deck(d); return 0; }
Write the same code in C as shown below in VB.
Option Base {0|1}
char foo() { char array[5] = {3,6,9,12,15}; return array[2]; }
Change the programming language of this snippet from VB to C without modifying what it does.
Const Order = 4 Function InCarpet(ByVal x As Integer, ByVal y As Integer) Do While x <> 0 And y <> 0 If x Mod 3 = 1 And y Mod 3 = 1 Then InCarpet = " " Exit Function End If x = x \ 3 y = y \ 3 Loop InCarpet = "#" End Function Public Sub sierpinski_carpet() Dim i As Integer, j As Integer For i = 0 To 3 ^ Order - 1 For j = 0 To 3 ^ Order - 1 Debug.Print InCarpet(i, j); Next j Debug.Print Next i End Sub
#include <stdio.h> int main() { int i, j, dim, d; int depth = 3; for (i = 0, dim = 1; i < depth; i++, dim *= 3); for (i = 0; i < dim; i++) { for (j = 0; j < dim; j++) { for (d = dim / 3; d; d /= 3) if ((i % (d * 3)) / d == 1 && (j % (d * 3)) / d == 1) break; printf(d ? " " : "##"); } printf("\n"); } return 0; }
Translate the given VB code snippet into C without altering its behavior.
Private Function Knuth(a As Variant) As Variant Dim t As Variant, i As Integer If Not IsMissing(a) Then For i = UBound(a) To LBound(a) + 1 Step -1 j = Int((UBound(a) - LBound(a) + 1) * Rnd + LBound(a)) t = a(i) a(i) = a(j) a(j) = t Next i End If Knuth = a End Function Private Function inOrder(s As Variant) i = 2 Do While i <= UBound(s) If s(i) < s(i - 1) Then inOrder = False Exit Function End If i = i + 1 Loop inOrder = True End Function Private Function bogosort(ByVal s As Variant) As Variant Do While Not inOrder(s) Debug.Print Join(s, ", ") s = Knuth(s) Loop bogosort = s End Function Public Sub main() Debug.Print Join(bogosort(Knuth([{1,2,3,4,5,6}])), ", ") End Sub
#include <stdio.h> #include <stdlib.h> #include <stdbool.h> bool is_sorted(int *a, int n) { while ( --n >= 1 ) { if ( a[n] < a[n-1] ) return false; } return true; } void shuffle(int *a, int n) { int i, t, r; for(i=0; i < n; i++) { t = a[i]; r = rand() % n; a[i] = a[r]; a[r] = t; } } void bogosort(int *a, int n) { while ( !is_sorted(a, n) ) shuffle(a, n); } int main() { int numbers[] = { 1, 10, 9, 7, 3, 0 }; int i; bogosort(numbers, 6); for (i=0; i < 6; i++) printf("%d ", numbers[i]); printf("\n"); }
Keep all operations the same but rewrite the snippet in C.
Private Sub ivp_euler(f As String, y As Double, step As Integer, end_t As Integer) Dim t As Integer Debug.Print " Step "; step; ": ", Do While t <= end_t If t Mod 10 = 0 Then Debug.Print Format(y, "0.000"), y = y + step * Application.Run(f, y) t = t + step Loop Debug.Print End Sub Sub analytic() Debug.Print " Time: ", For t = 0 To 100 Step 10 Debug.Print " "; t, Next t Debug.Print Debug.Print "Analytic: ", For t = 0 To 100 Step 10 Debug.Print Format(20 + 80 * Exp(-0.07 * t), "0.000"), Next t Debug.Print End Sub Private Function cooling(temp As Double) As Double cooling = -0.07 * (temp - 20) End Function Public Sub euler_method() Dim r_cooling As String r_cooling = "cooling" analytic ivp_euler r_cooling, 100, 2, 100 ivp_euler r_cooling, 100, 5, 100 ivp_euler r_cooling, 100, 10, 100 End Sub
#include <stdio.h> #include <math.h> typedef double (*deriv_f)(double, double); #define FMT " %7.3f" void ivp_euler(deriv_f f, double y, int step, int end_t) { int t = 0; printf(" Step %2d: ", (int)step); do { if (t % 10 == 0) printf(FMT, y); y += step * f(t, y); } while ((t += step) <= end_t); printf("\n"); } void analytic() { double t; printf(" Time: "); for (t = 0; t <= 100; t += 10) printf(" %7g", t); printf("\nAnalytic: "); for (t = 0; t <= 100; t += 10) printf(FMT, 20 + 80 * exp(-0.07 * t)); printf("\n"); } double cooling(double t, double temp) { return -0.07 * (temp - 20); } int main() { analytic(); ivp_euler(cooling, 100, 2, 100); ivp_euler(cooling, 100, 5, 100); ivp_euler(cooling, 100, 10, 100); return 0; }
Change the following VB code into C without altering its purpose.
Sub Main() Dim i&, c&, j#, s$ Const N& = 1000000 s = "values for n in the range 1 to 22 : " For i = 1 To 22 s = s & ns(i) & ", " Next For i = 1 To N j = Sqr(ns(i)) If j = CInt(j) Then c = c + 1 Next Debug.Print s Debug.Print c & " squares less than " & N End Sub Private Function ns(l As Long) As Long ns = l + Int(1 / 2 + Sqr(l)) End Function
#include <math.h> #include <stdio.h> #include <assert.h> int nonsqr(int n) { return n + (int)(0.5 + sqrt(n)); } int main() { int i; for (i = 1; i < 23; i++) printf("%d ", nonsqr(i)); printf("\n"); for (i = 1; i < 1000000; i++) { double j = sqrt(nonsqr(i)); assert(j != floor(j)); } return 0; }
Convert this VB snippet to C and keep its semantics consistent.
Sub Main() Dim i&, c&, j#, s$ Const N& = 1000000 s = "values for n in the range 1 to 22 : " For i = 1 To 22 s = s & ns(i) & ", " Next For i = 1 To N j = Sqr(ns(i)) If j = CInt(j) Then c = c + 1 Next Debug.Print s Debug.Print c & " squares less than " & N End Sub Private Function ns(l As Long) As Long ns = l + Int(1 / 2 + Sqr(l)) End Function
#include <math.h> #include <stdio.h> #include <assert.h> int nonsqr(int n) { return n + (int)(0.5 + sqrt(n)); } int main() { int i; for (i = 1; i < 23; i++) printf("%d ", nonsqr(i)); printf("\n"); for (i = 1; i < 1000000; i++) { double j = sqrt(nonsqr(i)); assert(j != floor(j)); } return 0; }
Translate the given VB code snippet into C without altering its behavior.
Public Sub substring() sentence = "the last thing the man said was the" n = 10: m = 5 Debug.Print Mid(sentence, n, 5) Debug.Print Right(sentence, Len(sentence) - n + 1) Debug.Print Left(sentence, Len(sentence) - 1) k = InStr(1, sentence, "m") Debug.Print Mid(sentence, k, 5) k = InStr(1, sentence, "aid") Debug.Print Mid(sentence, k, 5) End Sub
#define _CRT_SECURE_NO_WARNINGS #include <stdio.h> #include <stdlib.h> #include <string.h> void putm(char* string, size_t m) { while(*string && m--) putchar(*string++); } int main(void) { char string[] = "Programs for other encodings (such as 8-bit ASCII, or EUC-JP)." int n = 3; int m = 4; char knownCharacter = '('; char knownSubstring[] = "encodings"; putm(string+n-1, m ); putchar('\n'); puts(string+n+1); putchar('\n'); putm(string, strlen(string)-1); putchar('\n'); putm(strchr(string, knownCharacter), m ); putchar('\n'); putm(strstr(string, knownSubstring), m ); putchar('\n'); return EXIT_SUCCESS; }
Transform the following VB implementation into C, maintaining the same output and logic.
Function JortSort(s) JortSort = True arrPreSort = Split(s,",") Set arrSorted = CreateObject("System.Collections.ArrayList") For i = 0 To UBound(arrPreSort) arrSorted.Add(arrPreSort(i)) Next arrSorted.Sort() For j = 0 To UBound(arrPreSort) If arrPreSort(j) <> arrSorted(j) Then JortSort = False Exit For End If Next End Function WScript.StdOut.Write JortSort("1,2,3,4,5") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("1,2,3,5,4") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("a,b,c") WScript.StdOut.WriteLine WScript.StdOut.Write JortSort("a,c,b")
#include <stdio.h> #include <stdlib.h> int number_of_digits(int x){ int NumberOfDigits; for(NumberOfDigits=0;x!=0;NumberOfDigits++){ x=x/10; } return NumberOfDigits; } int* convert_array(char array[], int NumberOfElements) { int *convertedArray=malloc(NumberOfElements*sizeof(int)); int originalElement, convertedElement; for(convertedElement=0, originalElement=0; convertedElement<NumberOfElements; convertedElement++) { convertedArray[convertedElement]=atoi(&array[originalElement]); originalElement+=number_of_digits(convertedArray[convertedElement])+1; } return convertedArray; } int isSorted(int array[], int numberOfElements){ int sorted=1; for(int counter=0;counter<numberOfElements;counter++){ if(counter!=0 && array[counter-1]>array[counter]) sorted--; } return sorted; } int main(int argc, char* argv[]) { int* convertedArray; convertedArray=convert_array(*(argv+1), argc-1); if(isSorted(convertedArray, argc-1)==1) printf("Did you forgot to turn on your brain?! This array is already sorted!\n"); else if(argc-1<=10) printf("Am I really supposed to sort this? Sort it by yourself!\n"); else printf("Am I really supposed to sort this? Bhahahaha!\n"); free(convertedArray); return 0; }
Port the provided VB code into C while preserving the original functionality.
Public Function Leap_year(year As Integer) As Boolean Leap_year = (Month(DateSerial(year, 2, 29)) = 2) End Function
#include <stdio.h> int is_leap_year(unsigned year) { return !(year & (year % 100 ? 3 : 15)); } int main(void) { const unsigned test_case[] = { 1900, 1994, 1996, 1997, 2000, 2024, 2025, 2026, 2100 }; const unsigned n = sizeof test_case / sizeof test_case[0]; for (unsigned i = 0; i != n; ++i) { unsigned year = test_case[i]; printf("%u is %sa leap year.\n", year, is_leap_year(year) ? "" : "not "); } return 0; }
Port the following code from VB to C with equivalent syntax and logic.
dim i,j Wscript.StdOut.WriteLine "-- Long Integer - Permutations - from 1 to 12" for i=1 to 12 for j=1 to i Wscript.StdOut.Write "P(" & i & "," & j & ")=" & perm(i,j) & " " next Wscript.StdOut.WriteLine "" next Wscript.StdOut.WriteLine "-- Float integer - Combinations from 10 to 60" for i=10 to 60 step 10 for j=1 to i step i\5 Wscript.StdOut.Write "C(" & i & "," & j & ")=" & comb(i,j) & " " next Wscript.StdOut.WriteLine "" next Wscript.StdOut.WriteLine "-- Float integer - Permutations from 5000 to 15000" for i=5000 to 15000 step 5000 for j=10 to 70 step 20 Wscript.StdOut.Write "C(" & i & "," & j & ")=" & perm(i,j) & " " next Wscript.StdOut.WriteLine "" next Wscript.StdOut.WriteLine "-- Float integer - Combinations from 200 to 1000" for i=200 to 1000 step 200 for j=20 to 100 step 20 Wscript.StdOut.Write "P(" & i & "," & j & ")=" & comb(i,j) & " " next Wscript.StdOut.WriteLine "" next function perm(x,y) dim i,z z=1 for i=x-y+1 to x z=z*i next perm=z end function function fact(x) dim i,z z=1 for i=2 to x z=z*i next fact=z end function function comb(byval x,byval y) if y>x then comb=0 elseif x=y then comb=1 else if x-y<y then y=x-y comb=perm(x,y)/fact(y) end if end function
#include <gmp.h> void perm(mpz_t out, int n, int k) { mpz_set_ui(out, 1); k = n - k; while (n > k) mpz_mul_ui(out, out, n--); } void comb(mpz_t out, int n, int k) { perm(out, n, k); while (k) mpz_divexact_ui(out, out, k--); } int main(void) { mpz_t x; mpz_init(x); perm(x, 1000, 969); gmp_printf("P(1000,969) = %Zd\n", x); comb(x, 1000, 969); gmp_printf("C(1000,969) = %Zd\n", x); return 0; }
Produce a language-to-language conversion: from VB to C, same semantics.
Public Function sortlexicographically(N As Integer) Dim arrList As Object Set arrList = CreateObject("System.Collections.ArrayList") For i = 1 To N arrList.Add CStr(i) Next i arrList.Sort Dim item As Variant For Each item In arrList Debug.Print item & ", "; Next End Function Public Sub main() Call sortlexicographically(13) End Sub
#include <math.h> #include <stdio.h> #include <stdlib.h> #include <string.h> int compareStrings(const void *a, const void *b) { const char **aa = (const char **)a; const char **bb = (const char **)b; return strcmp(*aa, *bb); } void lexOrder(int n, int *ints) { char **strs; int i, first = 1, last = n, k = n, len; if (n < 1) { first = n; last = 1; k = 2 - n; } strs = malloc(k * sizeof(char *)); for (i = first; i <= last; ++i) { if (i >= 1) len = (int)log10(i) + 2; else if (i == 0) len = 2; else len = (int)log10(-i) + 3; strs[i-first] = malloc(len); sprintf(strs[i-first], "%d", i); } qsort(strs, k, sizeof(char *), compareStrings); for (i = 0; i < k; ++i) { ints[i] = atoi(strs[i]); free(strs[i]); } free(strs); } int main() { int i, j, k, n, *ints; int numbers[5] = {0, 5, 13, 21, -22}; printf("In lexicographical order:\n\n"); for (i = 0; i < 5; ++i) { k = n = numbers[i]; if (k < 1) k = 2 - k; ints = malloc(k * sizeof(int)); lexOrder(n, ints); printf("%3d: [", n); for (j = 0; j < k; ++j) { printf("%d ", ints[j]); } printf("\b]\n"); free(ints); } return 0; }
Change the programming language of this snippet from VB to C without modifying what it does.
Public twenties As Variant Public decades As Variant Public orders As Variant Private Sub init() twenties = [{"zero","one","two","three","four","five","six","seven","eight","nine","ten", "eleven","twelve","thirteen","fourteen","fifteen","sixteen","seventeen","eighteen","nineteen"}] decades = [{"twenty","thirty","forty","fifty","sixty","seventy","eighty","ninety"}] orders = [{1E15,"quadrillion"; 1E12,"trillion"; 1E9,"billion"; 1E6,"million"; 1E3,"thousand"}] End Sub Private Function Twenty(N As Variant) Twenty = twenties(N Mod 20 + 1) End Function Private Function Decade(N As Variant) Decade = decades(N Mod 10 - 1) End Function Private Function Hundred(N As Variant) If N < 20 Then Hundred = Twenty(N) Exit Function Else If N Mod 10 = 0 Then Hundred = Decade((N \ 10) Mod 10) Exit Function End If End If Hundred = Decade(N \ 10) & "-" & Twenty(N Mod 10) End Function Private Function Thousand(N As Variant, withand As String) If N < 100 Then Thousand = withand & Hundred(N) Exit Function Else If N Mod 100 = 0 Then Thousand = withand & Twenty(WorksheetFunction.Floor_Precise(N / 100)) & " hundred" Exit Function End If End If Thousand = Twenty(N \ 100) & " hundred and " & Hundred(N Mod 100) End Function Private Function Triplet(N As Variant) Dim Order, High As Variant, Low As Variant Dim Name As String, res As String For i = 1 To UBound(orders) Order = orders(i, 1) Name = orders(i, 2) High = WorksheetFunction.Floor_Precise(N / Order) Low = N - High * Order If High <> 0 Then res = res & Thousand(High, "") & " " & Name End If N = Low If Low = 0 Then Exit For If Len(res) And High <> 0 Then res = res & ", " End If Next i If N <> 0 Or res = "" Then res = res & Thousand(WorksheetFunction.Floor_Precise(N), IIf(res = "", "", "and ")) N = N - Int(N) If N > 0.000001 Then res = res & " point" For i = 1 To 10 n_ = WorksheetFunction.Floor_Precise(N * 10.0000001) res = res & " " & twenties(n_ + 1) N = N * 10 - n_ If Abs(N) < 0.000001 Then Exit For Next i End If End If Triplet = res End Function Private Function spell(N As Variant) Dim res As String If N < 0 Then res = "minus " N = -N End If res = res & Triplet(N) spell = res End Function Private Function smartp(N As Variant) Dim res As String If N = WorksheetFunction.Floor_Precise(N) Then smartp = CStr(N) Exit Function End If res = CStr(N) If InStr(1, res, ".") Then res = Left(res, InStr(1, res, ".")) End If smartp = res End Function Sub Main() Dim si As Variant init Samples1 = [{99, 300, 310, 417, 1501, 12609, 200000000000100, 999999999999999, -123456787654321,102003000400005,1020030004,102003,102,1,0,-1,-99, -1501,1234,12.34}] Samples2 = [{10000001.2,1E-3,-2.7182818, 201021002001,-20102100200,2010210020,-201021002,20102100,-2010210, 201021,-20102,2010,-201,20,-2}] For i = 1 To UBound(Samples1) si = Samples1(i) Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si) Next i For i = 1 To UBound(Samples2) si = Samples2(i) Debug.Print Format(smartp(si), "@@@@@@@@@@@@@@@@"); " "; spell(si) Next i End Sub
#include <stdio.h> #include <string.h> const char *ones[] = { 0, "one", "two", "three", "four", "five", "six", "seven", "eight", "nine", "ten", "eleven", "twelve", "thirteen", "fourteen", "fifteen", "sixteen", "seventeen", "eighteen", "nineteen" }; const char *tens[] = { 0, "ten", "twenty", "thirty", "forty", "fifty", "sixty", "seventy", "eighty", "ninety" }; const char *llions[] = { 0, "thousand", "million", "billion", "trillion", }; const int maxillion = sizeof(llions) / sizeof(llions[0]) * 3 - 3; int say_hundred(const char *s, int len, int depth, int has_lead) { int c[3], i; for (i = -3; i < 0; i++) { if (len + i >= 0) c[i + 3] = s[len + i] - '0'; else c[i + 3] = 0; } if (!(c[0] + c[1] + c[2])) return 0; if (c[0]) { printf("%s hundred", ones[c[0]]); has_lead = 1; } if (has_lead && (c[1] || c[2])) printf((!depth || c[0]) && (!c[0] || !c[1]) ? "and " : c[0] ? " " : ""); if (c[1] < 2) { if (c[1] || c[2]) printf("%s", ones[c[1] * 10 + c[2]]); } else { if (c[1]) { printf("%s", tens[c[1]]); if (c[2]) putchar('-'); } if (c[2]) printf("%s", ones[c[2]]); } return 1; } int say_maxillion(const char *s, int len, int depth, int has_lead) { int n = len / 3, r = len % 3; if (!r) { n--; r = 3; } const char *e = s + r; do { if (say_hundred(s, r, n, has_lead) && n) { has_lead = 1; printf(" %s", llions[n]); if (!depth) printf(", "); else printf(" "); } s = e; e += 3; } while (r = 3, n--); return 1; } void say_number(const char *s) { int len, i, got_sign = 0; while (*s == ' ') s++; if (*s < '0' || *s > '9') { if (*s == '-') got_sign = -1; else if (*s == '+') got_sign = 1; else goto nan; s++; } else got_sign = 1; while (*s == '0') { s++; if (*s == '\0') { printf("zero\n"); return; } } len = strlen(s); if (!len) goto nan; for (i = 0; i < len; i++) { if (s[i] < '0' || s[i] > '9') { printf("(not a number)"); return; } } if (got_sign == -1) printf("minus "); int n = len / maxillion; int r = len % maxillion; if (!r) { r = maxillion; n--; } const char *end = s + len - n * maxillion; int has_lead = 0; do { if ((has_lead = say_maxillion(s, r, n, has_lead))) { for (i = 0; i < n; i++) printf(" %s", llions[maxillion / 3]); if (n) printf(", "); } n--; r = maxillion; s = end; end += r; } while (n >= 0); printf("\n"); return; nan: printf("not a number\n"); return; } int main() { say_number("-42"); say_number("1984"); say_number("10000"); say_number("1024"); say_number("1001001001001"); say_number("123456789012345678901234567890123456789012345678900000001"); return 0; }
Preserve the algorithm and functionality while converting the code from VB to C.
Sub arrShellSort(ByVal arrData As Variant) Dim lngHold, lngGap As Long Dim lngCount, lngMin, lngMax As Long Dim varItem As Variant lngMin = LBound(arrData) lngMax = UBound(arrData) lngGap = lngMin Do While (lngGap < lngMax) lngGap = 3 * lngGap + 1 Loop Do While (lngGap > 1) lngGap = lngGap \ 3 For lngCount = lngGap + lngMin To lngMax varItem = arrData(lngCount) lngHold = lngCount Do While ((arrData(lngHold - lngGap) > varItem)) arrData(lngHold) = arrData(lngHold - lngGap) lngHold = lngHold - lngGap If (lngHold < lngMin + lngGap) Then Exit Do Loop arrData(lngHold) = varItem Next Loop arrShellSort = arrData End Sub
#include <stdio.h> void shell_sort (int *a, int n) { int h, i, j, t; for (h = n; h /= 2;) { for (i = h; i < n; i++) { t = a[i]; for (j = i; j >= h && t < a[j - h]; j -= h) { a[j] = a[j - h]; } a[j] = t; } } } int main (int ac, char **av) { int a[] = {4, 65, 2, -31, 0, 99, 2, 83, 782, 1}; int n = sizeof a / sizeof a[0]; int i; for (i = 0; i < n; i++) printf("%d%s", a[i], i == n - 1 ? "\n" : " "); shell_sort(a, n); for (i = 0; i < n; i++) printf("%d%s", a[i], i == n - 1 ? "\n" : " "); return 0; }
Produce a functionally identical C code for the snippet given in VB.
Public Class DoubleLinkList(Of T) Private m_Head As Node(Of T) Private m_Tail As Node(Of T) Public Sub AddHead(ByVal value As T) Dim node As New Node(Of T)(Me, value) If m_Head Is Nothing Then m_Head = Node m_Tail = m_Head Else node.Next = m_Head m_Head = node End If End Sub Public Sub AddTail(ByVal value As T) Dim node As New Node(Of T)(Me, value) If m_Tail Is Nothing Then m_Head = node m_Tail = m_Head Else node.Previous = m_Tail m_Tail = node End If End Sub Public ReadOnly Property Head() As Node(Of T) Get Return m_Head End Get End Property Public ReadOnly Property Tail() As Node(Of T) Get Return m_Tail End Get End Property Public Sub RemoveTail() If m_Tail Is Nothing Then Return If m_Tail.Previous Is Nothing Then m_Head = Nothing m_Tail = Nothing Else m_Tail = m_Tail.Previous m_Tail.Next = Nothing End If End Sub Public Sub RemoveHead() If m_Head Is Nothing Then Return If m_Head.Next Is Nothing Then m_Head = Nothing m_Tail = Nothing Else m_Head = m_Head.Next m_Head.Previous = Nothing End If End Sub End Class Public Class Node(Of T) Private ReadOnly m_Value As T Private m_Next As Node(Of T) Private m_Previous As Node(Of T) Private ReadOnly m_Parent As DoubleLinkList(Of T) Public Sub New(ByVal parent As DoubleLinkList(Of T), ByVal value As T) m_Parent = parent m_Value = value End Sub Public Property [Next]() As Node(Of T) Get Return m_Next End Get Friend Set(ByVal value As Node(Of T)) m_Next = value End Set End Property Public Property Previous() As Node(Of T) Get Return m_Previous End Get Friend Set(ByVal value As Node(Of T)) m_Previous = value End Set End Property Public ReadOnly Property Value() As T Get Return m_Value End Get End Property Public Sub InsertAfter(ByVal value As T) If m_Next Is Nothing Then m_Parent.AddTail(value) ElseIf m_Previous Is Nothing Then m_Parent.AddHead(value) Else Dim node As New Node(Of T)(m_Parent, value) node.Previous = Me node.Next = Me.Next Me.Next.Previous = node Me.Next = node End If End Sub Public Sub Remove() If m_Next Is Nothing Then m_Parent.RemoveTail() ElseIf m_Previous Is Nothing Then m_Parent.RemoveHead() Else m_Previous.Next = Me.Next m_Next.Previous = Me.Previous End If End Sub End Class
#include <stdio.h> #include <stdlib.h> struct List { struct MNode *head; struct MNode *tail; struct MNode *tail_pred; }; struct MNode { struct MNode *succ; struct MNode *pred; }; typedef struct MNode *NODE; typedef struct List *LIST; LIST newList(void); int isEmpty(LIST); NODE getTail(LIST); NODE getHead(LIST); NODE addTail(LIST, NODE); NODE addHead(LIST, NODE); NODE remHead(LIST); NODE remTail(LIST); NODE insertAfter(LIST, NODE, NODE); NODE removeNode(LIST, NODE); LIST newList(void) { LIST tl = malloc(sizeof(struct List)); if ( tl != NULL ) { tl->tail_pred = (NODE)&tl->head; tl->tail = NULL; tl->head = (NODE)&tl->tail; return tl; } return NULL; } int isEmpty(LIST l) { return (l->head->succ == 0); } NODE getHead(LIST l) { return l->head; } NODE getTail(LIST l) { return l->tail_pred; } NODE addTail(LIST l, NODE n) { n->succ = (NODE)&l->tail; n->pred = l->tail_pred; l->tail_pred->succ = n; l->tail_pred = n; return n; } NODE addHead(LIST l, NODE n) { n->succ = l->head; n->pred = (NODE)&l->head; l->head->pred = n; l->head = n; return n; } NODE remHead(LIST l) { NODE h; h = l->head; l->head = l->head->succ; l->head->pred = (NODE)&l->head; return h; } NODE remTail(LIST l) { NODE t; t = l->tail_pred; l->tail_pred = l->tail_pred->pred; l->tail_pred->succ = (NODE)&l->tail; return t; } NODE insertAfter(LIST l, NODE r, NODE n) { n->pred = r; n->succ = r->succ; n->succ->pred = n; r->succ = n; return n; } NODE removeNode(LIST l, NODE n) { n->pred->succ = n->succ; n->succ->pred = n->pred; return n; }
Rewrite the snippet below in C so it works the same as the original VB code.
TYPE regChar Character AS STRING * 3 Count AS LONG END TYPE DIM iChar AS INTEGER DIM iCL AS INTEGER DIM iCountChars AS INTEGER DIM iFile AS INTEGER DIM i AS INTEGER DIM lMUC AS LONG DIM iMUI AS INTEGER DIM lLUC AS LONG DIM iLUI AS INTEGER DIM iMaxIdx AS INTEGER DIM iP AS INTEGER DIM iPause AS INTEGER DIM iPMI AS INTEGER DIM iPrint AS INTEGER DIM lHowMany AS LONG DIM lTotChars AS LONG DIM sTime AS SINGLE DIM strFile AS STRING DIM strTxt AS STRING DIM strDate AS STRING DIM strTime AS STRING DIM strKey AS STRING CONST LngReg = 256 CONST Letters = 1 CONST FALSE = 0 CONST TRUE = NOT FALSE strDate = DATE$ strTime = TIME$ iFile = FREEFILE DO CLS PRINT "This program counts letters or characters in a text file." PRINT INPUT "File to open: ", strFile OPEN strFile FOR BINARY AS #iFile IF LOF(iFile) > 0 THEN PRINT "Count: 1) Letters 2) Characters (1 or 2)"; DO strKey = INKEY$ LOOP UNTIL strKey = "1" OR strKey = "2" PRINT ". Option selected: "; strKey iCL = VAL(strKey) sTime = TIMER iP = POS(0) lHowMany = LOF(iFile) strTxt = SPACE$(LngReg) IF iCL = Letters THEN iMaxIdx = 26 ELSE iMaxIdx = 255 END IF IF iMaxIdx <> iPMI THEN iPMI = iMaxIdx REDIM rChar(0 TO iMaxIdx) AS regChar FOR i = 0 TO iMaxIdx IF iCL = Letters THEN strTxt = CHR$(i + 65) IF i = 26 THEN strTxt = CHR$(165) ELSE SELECT CASE i CASE 0: strTxt = "nul" CASE 7: strTxt = "bel" CASE 9: strTxt = "tab" CASE 10: strTxt = "lf" CASE 11: strTxt = "vt" CASE 12: strTxt = "ff" CASE 13: strTxt = "cr" CASE 28: strTxt = "fs" CASE 29: strTxt = "gs" CASE 30: strTxt = "rs" CASE 31: strTxt = "us" CASE 32: strTxt = "sp" CASE ELSE: strTxt = CHR$(i) END SELECT END IF rChar(i).Character = strTxt NEXT i ELSE FOR i = 0 TO iMaxIdx rChar(i).Count = 0 NEXT i END IF PRINT "Looking for "; IF iCL = Letters THEN PRINT "letters."; ELSE PRINT "characters."; PRINT " File is"; STR$(lHowMany); " in size. Working"; : COLOR 23: PRINT "..."; : COLOR (7) DO WHILE LOC(iFile) < LOF(iFile) IF LOC(iFile) + LngReg > LOF(iFile) THEN strTxt = SPACE$(LOF(iFile) - LOC(iFile)) END IF GET #iFile, , strTxt FOR i = 1 TO LEN(strTxt) IF iCL = Letters THEN iChar = ASC(UCASE$(MID$(strTxt, i, 1))) SELECT CASE iChar CASE 164: iChar = 165 CASE 160: iChar = 65 CASE 130, 144: iChar = 69 CASE 161: iChar = 73 CASE 162: iChar = 79 CASE 163, 129: iChar = 85 END SELECT iChar = iChar - 65 IF iChar >= 0 AND iChar <= 25 THEN rChar(iChar).Count = rChar(iChar).Count + 1 ELSEIF iChar = 100 THEN rChar(iMaxIdx).Count = rChar(iMaxIdx).Count + 1 END IF ELSE iChar = ASC(MID$(strTxt, i, 1)) rChar(iChar).Count = rChar(iChar).Count + 1 END IF NEXT i LOOP CLOSE #iFile lMUC = 0 iMUI = 0 lLUC = 2147483647 iLUI = 0 iPrint = FALSE lTotChars = 0 iCountChars = 0 iPause = FALSE CLS IF iCL = Letters THEN PRINT "Letters found: "; ELSE PRINT "Characters found: "; FOR i = 0 TO iMaxIdx IF lMUC < rChar(i).Count THEN lMUC = rChar(i).Count iMUI = i END IF IF rChar(i).Count > 0 THEN strTxt = "" IF iPrint THEN strTxt = ", " ELSE iPrint = TRUE strTxt = strTxt + LTRIM$(RTRIM$(rChar(i).Character)) strTxt = strTxt + "=" + LTRIM$(STR$(rChar(i).Count)) iP = POS(0) IF iP + LEN(strTxt) + 1 >= 80 AND iPrint THEN PRINT "," IF CSRLIN >= 23 AND NOT iPause THEN iPause = TRUE PRINT "Press a key to continue..." DO strKey = INKEY$ LOOP UNTIL strKey <> "" END IF strTxt = MID$(strTxt, 3) END IF PRINT strTxt; lTotChars = lTotChars + rChar(i).Count iCountChars = iCountChars + 1 IF lLUC > rChar(i).Count THEN lLUC = rChar(i).Count iLUI = i END IF END IF NEXT i PRINT "." PRINT PRINT "File analyzed....................: "; strFile PRINT "Looked for.......................: "; : IF iCL = Letters THEN PRINT "Letters" ELSE PRINT "Characters" PRINT "Total characters in file.........:"; lHowMany PRINT "Total characters counted.........:"; lTotChars IF iCL = Letters THEN PRINT "Characters discarded on count....:"; lHowMany - lTotChars PRINT "Distinct characters found in file:"; iCountChars; "of"; iMaxIdx + 1 PRINT "Most used character was..........: "; iPrint = FALSE FOR i = 0 TO iMaxIdx IF rChar(i).Count = lMUC THEN IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE PRINT RTRIM$(LTRIM$(rChar(i).Character)); END IF NEXT i PRINT " ("; LTRIM$(STR$(rChar(iMUI).Count)); " times)" PRINT "Least used character was.........: "; iPrint = FALSE FOR i = 0 TO iMaxIdx IF rChar(i).Count = lLUC THEN IF iPrint THEN PRINT ", "; ELSE iPrint = TRUE PRINT RTRIM$(LTRIM$(rChar(i).Character)); END IF NEXT i PRINT " ("; LTRIM$(STR$(rChar(iLUI).Count)); " times)" PRINT "Time spent in the process........:"; TIMER - sTime; "seconds" ELSE CLOSE #iFile KILL strFile PRINT PRINT "File does not exist." END IF PRINT PRINT "Again? (Y/n)" DO strTxt = UCASE$(INKEY$) LOOP UNTIL strTxt = "N" OR strTxt = "Y" OR strTxt = CHR$(13) OR strTxt = CHR$(27) LOOP UNTIL strTxt = "N" OR strTxt = CHR$(27) CLS PRINT "End of execution." PRINT "Start time: "; strDate; " "; strTime; ", end time: "; DATE$; " "; TIME$; "." END
int frequency[26]; int ch; FILE* txt_file = fopen ("a_text_file.txt", "rt"); for (ch = 0; ch < 26; ch++) frequency[ch] = 0; while (1) { ch = fgetc(txt_file); if (ch == EOF) break; if ('a' <= ch && ch <= 'z') frequency[ch-'a']++; else if ('A' <= ch && ch <= 'Z') frequency[ch-'A']++; }
Change the following VB code into C without altering its purpose.
Dim s As String = "123" s = CStr(CInt("123") + 1) s = (CInt("123") + 1).ToString
#include <stdio.h> #include <string.h> #include <stdlib.h> char * incr(char *s) { int i, begin, tail, len; int neg = (*s == '-'); char tgt = neg ? '0' : '9'; if (!strcmp(s, "-1")) { s[0] = '0', s[1] = '\0'; return s; } len = strlen(s); begin = (*s == '-' || *s == '+') ? 1 : 0; for (tail = len - 1; tail >= begin && s[tail] == tgt; tail--); if (tail < begin && !neg) { if (!begin) s = realloc(s, len + 2); s[0] = '1'; for (i = 1; i <= len - begin; i++) s[i] = '0'; s[len + 1] = '\0'; } else if (tail == begin && neg && s[1] == '1') { for (i = 1; i < len - begin; i++) s[i] = '9'; s[len - 1] = '\0'; } else { for (i = len - 1; i > tail; i--) s[i] = neg ? '9' : '0'; s[tail] += neg ? -1 : 1; } return s; } void string_test(const char *s) { char *ret = malloc(strlen(s)); strcpy(ret, s); printf("text: %s\n", ret); printf(" ->: %s\n", ret = incr(ret)); free(ret); } int main() { string_test("+0"); string_test("-1"); string_test("-41"); string_test("+41"); string_test("999"); string_test("+999"); string_test("109999999999999999999999999999999999999999"); string_test("-100000000000000000000000000000000000000000000"); return 0; }