hexsha string | size int64 | ext string | lang string | max_stars_repo_path string | max_stars_repo_name string | max_stars_repo_head_hexsha string | max_stars_repo_licenses list | max_stars_count int64 | max_stars_repo_stars_event_min_datetime string | max_stars_repo_stars_event_max_datetime string | max_issues_repo_path string | max_issues_repo_name string | max_issues_repo_head_hexsha string | max_issues_repo_licenses list | max_issues_count int64 | max_issues_repo_issues_event_min_datetime string | max_issues_repo_issues_event_max_datetime string | max_forks_repo_path string | max_forks_repo_name string | max_forks_repo_head_hexsha string | max_forks_repo_licenses list | max_forks_count int64 | max_forks_repo_forks_event_min_datetime string | max_forks_repo_forks_event_max_datetime string | content string | avg_line_length float64 | max_line_length int64 | alphanum_fraction float64 | qsc_code_num_words_quality_signal int64 | qsc_code_num_chars_quality_signal float64 | qsc_code_mean_word_length_quality_signal float64 | qsc_code_frac_words_unique_quality_signal float64 | qsc_code_frac_chars_top_2grams_quality_signal float64 | qsc_code_frac_chars_top_3grams_quality_signal float64 | qsc_code_frac_chars_top_4grams_quality_signal float64 | qsc_code_frac_chars_dupe_5grams_quality_signal float64 | qsc_code_frac_chars_dupe_6grams_quality_signal float64 | qsc_code_frac_chars_dupe_7grams_quality_signal float64 | qsc_code_frac_chars_dupe_8grams_quality_signal float64 | qsc_code_frac_chars_dupe_9grams_quality_signal float64 | qsc_code_frac_chars_dupe_10grams_quality_signal float64 | qsc_code_frac_chars_replacement_symbols_quality_signal float64 | qsc_code_frac_chars_digital_quality_signal float64 | qsc_code_frac_chars_whitespace_quality_signal float64 | qsc_code_size_file_byte_quality_signal float64 | qsc_code_num_lines_quality_signal float64 | qsc_code_num_chars_line_max_quality_signal float64 | qsc_code_num_chars_line_mean_quality_signal float64 | qsc_code_frac_chars_alphabet_quality_signal float64 | qsc_code_frac_chars_comments_quality_signal float64 | qsc_code_cate_xml_start_quality_signal float64 | qsc_code_frac_lines_dupe_lines_quality_signal float64 | qsc_code_cate_autogen_quality_signal float64 | qsc_code_frac_lines_long_string_quality_signal float64 | qsc_code_frac_chars_string_length_quality_signal float64 | qsc_code_frac_chars_long_word_length_quality_signal float64 | qsc_code_frac_lines_string_concat_quality_signal float64 | qsc_code_cate_encoded_data_quality_signal float64 | qsc_code_frac_chars_hex_words_quality_signal float64 | qsc_code_frac_lines_prompt_comments_quality_signal float64 | qsc_code_frac_lines_assert_quality_signal float64 | qsc_codepython_cate_ast_quality_signal float64 | qsc_codepython_frac_lines_func_ratio_quality_signal float64 | qsc_codepython_cate_var_zero_quality_signal bool | qsc_codepython_frac_lines_pass_quality_signal float64 | qsc_codepython_frac_lines_import_quality_signal float64 | qsc_codepython_frac_lines_simplefunc_quality_signal float64 | qsc_codepython_score_lines_no_logic_quality_signal float64 | qsc_codepython_frac_lines_print_quality_signal float64 | qsc_code_num_words int64 | qsc_code_num_chars int64 | qsc_code_mean_word_length int64 | qsc_code_frac_words_unique null | qsc_code_frac_chars_top_2grams int64 | qsc_code_frac_chars_top_3grams int64 | qsc_code_frac_chars_top_4grams int64 | qsc_code_frac_chars_dupe_5grams int64 | qsc_code_frac_chars_dupe_6grams int64 | qsc_code_frac_chars_dupe_7grams int64 | qsc_code_frac_chars_dupe_8grams int64 | qsc_code_frac_chars_dupe_9grams int64 | qsc_code_frac_chars_dupe_10grams int64 | qsc_code_frac_chars_replacement_symbols int64 | qsc_code_frac_chars_digital int64 | qsc_code_frac_chars_whitespace int64 | qsc_code_size_file_byte int64 | qsc_code_num_lines int64 | qsc_code_num_chars_line_max int64 | qsc_code_num_chars_line_mean int64 | qsc_code_frac_chars_alphabet int64 | qsc_code_frac_chars_comments int64 | qsc_code_cate_xml_start int64 | qsc_code_frac_lines_dupe_lines int64 | qsc_code_cate_autogen int64 | qsc_code_frac_lines_long_string int64 | qsc_code_frac_chars_string_length int64 | qsc_code_frac_chars_long_word_length int64 | qsc_code_frac_lines_string_concat null | qsc_code_cate_encoded_data int64 | qsc_code_frac_chars_hex_words int64 | qsc_code_frac_lines_prompt_comments int64 | qsc_code_frac_lines_assert int64 | qsc_codepython_cate_ast int64 | qsc_codepython_frac_lines_func_ratio int64 | qsc_codepython_cate_var_zero int64 | qsc_codepython_frac_lines_pass int64 | qsc_codepython_frac_lines_import int64 | qsc_codepython_frac_lines_simplefunc int64 | qsc_codepython_score_lines_no_logic int64 | qsc_codepython_frac_lines_print int64 | effective string | hits int64 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
98ba77ab9f451c91f92fb84353e252acde2bd977 | 1,490 | py | Python | sols/155.py | Paul11100/LeetCode | 9896c579dff1812c0c76964db8d60603ee715e35 | [
"MIT"
] | null | null | null | sols/155.py | Paul11100/LeetCode | 9896c579dff1812c0c76964db8d60603ee715e35 | [
"MIT"
] | null | null | null | sols/155.py | Paul11100/LeetCode | 9896c579dff1812c0c76964db8d60603ee715e35 | [
"MIT"
] | null | null | null | class MinStack:
# Update Min every pop (Accepted), O(1) push, pop, top, min
def __init__(self):
self.stack = []
self.min = None
def push(self, val: int) -> None:
if self.stack:
self.min = min(self.min, val)
self.stack.append((val, self.min))
else:
... | 23.650794 | 65 | 0.506711 | 207 | 1,490 | 3.594203 | 0.227053 | 0.108871 | 0.043011 | 0.064516 | 0.428763 | 0.352151 | 0.314516 | 0.314516 | 0.314516 | 0.22043 | 0 | 0.014493 | 0.351678 | 1,490 | 62 | 66 | 24.032258 | 0.755694 | 0.17651 | 0 | 0.595238 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.238095 | false | 0 | 0 | 0.02381 | 0.428571 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f256e49a9e179a8d8dbfc959deb8eeb4a300236 | 2,834 | py | Python | pluto/control/clock/clock.py | chalant/pluto | e7bfd35a2c1fc0e0753bd2f840b0a4385b5124fc | [
"Apache-2.0"
] | null | null | null | pluto/control/clock/clock.py | chalant/pluto | e7bfd35a2c1fc0e0753bd2f840b0a4385b5124fc | [
"Apache-2.0"
] | null | null | null | pluto/control/clock/clock.py | chalant/pluto | e7bfd35a2c1fc0e0753bd2f840b0a4385b5124fc | [
"Apache-2.0"
] | null | null | null | from datetime import time
import pandas as pd
from pluto.trading_calendars import calendar_utils as cu
from pluto.control.clock.utils import get_generator
from dev import events
events.add_event('clock.update')
class StopExecution(Exception):
pass
class FakeClock(object):
def update(self, dt):
r... | 30.804348 | 94 | 0.581863 | 347 | 2,834 | 4.504323 | 0.317003 | 0.046065 | 0.026871 | 0.03071 | 0.265515 | 0.21817 | 0.131798 | 0.131798 | 0.097249 | 0.097249 | 0 | 0.00213 | 0.337332 | 2,834 | 91 | 95 | 31.142857 | 0.830138 | 0.159845 | 0 | 0.40678 | 0 | 0 | 0.011809 | 0 | 0 | 0 | 0 | 0.010989 | 0 | 1 | 0.101695 | false | 0.016949 | 0.084746 | 0.033898 | 0.372881 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f297f9c8290fc911de995ab4e13d7d0bce62ba9 | 2,010 | py | Python | dgo/views.py | fga-eps-mds/2017.2-SiGI-Op_API | 4532019c15414fd17e06bb3aa78501886e00da1d | [
"BSD-3-Clause"
] | 6 | 2017-08-24T13:18:21.000Z | 2017-10-03T18:06:13.000Z | dgo/views.py | fga-gpp-mds/2017.2-Grupo9 | 4532019c15414fd17e06bb3aa78501886e00da1d | [
"BSD-3-Clause"
] | 173 | 2017-08-31T15:29:01.000Z | 2017-12-14T13:40:13.000Z | dgo/views.py | fga-gpp-mds/2017.2-SiGI-Op_API | 4532019c15414fd17e06bb3aa78501886e00da1d | [
"BSD-3-Clause"
] | 2 | 2018-11-19T10:33:00.000Z | 2019-06-19T22:35:43.000Z | # from django.shortcuts import get_object_or_404, render
from sigi_op.views import CustomViewSet
# from rest_framework.response import Response
from .serializers import GODSerializer, GODPortSerializer, JumperSerializer
from .serializers import GODPortConnectionTypeSerializer, AccessCableSerializer
from .serializers im... | 33.5 | 79 | 0.79005 | 202 | 2,010 | 7.623762 | 0.277228 | 0.081818 | 0.1 | 0.077273 | 0.187013 | 0.12987 | 0.093506 | 0.049351 | 0 | 0 | 0 | 0.00288 | 0.136318 | 2,010 | 59 | 80 | 34.067797 | 0.884217 | 0.061194 | 0 | 0.097561 | 0 | 0 | 0.039299 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.146341 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
7f2c123c7a0ec5329d641bf1e5fc9cb088f8997e | 3,542 | py | Python | Matplotlib.py | adityamahamiya/python-repo | 891b783eceed39cd990ec0617f931e3c7c223f65 | [
"Apache-2.0"
] | null | null | null | Matplotlib.py | adityamahamiya/python-repo | 891b783eceed39cd990ec0617f931e3c7c223f65 | [
"Apache-2.0"
] | null | null | null | Matplotlib.py | adityamahamiya/python-repo | 891b783eceed39cd990ec0617f931e3c7c223f65 | [
"Apache-2.0"
] | 1 | 2021-06-12T04:05:54.000Z | 2021-06-12T04:05:54.000Z | # Line Plot
import numpy as np
from matplotlib import pyplot as plt
x = np.arange(1, 11)
print(x)
print()
y = 2 * x
print(y)
print()
plt.plot(x, y)
plt.show()
print()
# Line Plot - 2 (adding titles and labels)
plt.plot(x, y)
plt.title("Line Plot")
plt.xlabel("x-label")
plt.ylabel("y-label")
plt.show()
print()
# Line P... | 24.769231 | 94 | 0.606719 | 676 | 3,542 | 3.174556 | 0.205621 | 0.0685 | 0.026095 | 0.022367 | 0.613234 | 0.536813 | 0.472507 | 0.426375 | 0.426375 | 0.426375 | 0 | 0.100034 | 0.161773 | 3,542 | 142 | 95 | 24.943662 | 0.622769 | 0.107566 | 0 | 0.720339 | 0 | 0 | 0.094298 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.042373 | 0 | 0.042373 | 0.059322 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f2d7b651f63e82b9bfba2e1f2724e124d5a5ba3 | 11,349 | py | Python | utils/generate_cli_commands.py | atsgen/tf-packages | 966332c85a8c2425833ef7e86b18a692ab280c81 | [
"Apache-2.0"
] | 3 | 2020-09-16T15:45:27.000Z | 2022-03-14T18:38:34.000Z | utils/generate_cli_commands.py | atsgen/tf-packages | 966332c85a8c2425833ef7e86b18a692ab280c81 | [
"Apache-2.0"
] | null | null | null | utils/generate_cli_commands.py | atsgen/tf-packages | 966332c85a8c2425833ef7e86b18a692ab280c81 | [
"Apache-2.0"
] | 4 | 2020-08-25T12:41:53.000Z | 2022-03-23T16:30:57.000Z | #!/usr/bin/env python
#
# Copyright (c) 2016 Juniper Networks, Inc. All rights reserved.
#
import os
import sys
import json
# License: Apache-2.0
# https://github.com/openstack/cliff/blob/master/cliff/complete.py
class CompleteDictionary:
"""dictionary for bash completion
"""
def __init__(self):
... | 37.83 | 140 | 0.570799 | 1,251 | 11,349 | 4.8753 | 0.185452 | 0.03394 | 0.027054 | 0.034268 | 0.246434 | 0.111002 | 0.091654 | 0.063289 | 0.04263 | 0.029185 | 0 | 0.004946 | 0.305225 | 11,349 | 299 | 141 | 37.956522 | 0.768548 | 0.030928 | 0 | 0.123967 | 0 | 0.004132 | 0.215764 | 0.047958 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.012397 | null | null | 0.004132 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f2dcb0ddd875cf733c905311aa06926b6c7cf56 | 5,635 | py | Python | dbaas/workflow/steps/mysql/deploy/init_database.py | jaeko44/python_dbaas | 4fafa4ad70200fec1436c326c751761922ec9fa8 | [
"BSD-3-Clause"
] | null | null | null | dbaas/workflow/steps/mysql/deploy/init_database.py | jaeko44/python_dbaas | 4fafa4ad70200fec1436c326c751761922ec9fa8 | [
"BSD-3-Clause"
] | null | null | null | dbaas/workflow/steps/mysql/deploy/init_database.py | jaeko44/python_dbaas | 4fafa4ad70200fec1436c326c751761922ec9fa8 | [
"BSD-3-Clause"
] | 1 | 2017-07-02T08:46:17.000Z | 2017-07-02T08:46:17.000Z | # -*- coding: utf-8 -*-
import logging
from dbaas_credentials.models import CredentialType
from dbaas_nfsaas.models import HostAttr
from dbaas_cloudstack.models import PlanAttr
from dbaas_cloudstack.models import HostAttr as CsHostAttr
from itertools import permutations
from util import check_ssh
from util import get_c... | 40.539568 | 107 | 0.528838 | 517 | 5,635 | 5.560928 | 0.266925 | 0.091826 | 0.047304 | 0.034783 | 0.397913 | 0.350609 | 0.294261 | 0.247652 | 0.247652 | 0.247652 | 0 | 0.012946 | 0.383141 | 5,635 | 138 | 108 | 40.833333 | 0.814154 | 0.003727 | 0 | 0.375 | 0 | 0 | 0.117783 | 0.015681 | 0 | 0 | 0 | 0 | 0 | 1 | 0.028846 | false | 0.057692 | 0.125 | 0.009615 | 0.240385 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
7f35c5c6a2fabffef8ac90b9810a3ab97f576632 | 782 | py | Python | fun/eduhub/migrations/0012_auto_20211004_1746.py | larryw3i/fun | e753ce6d448f7f6ec3169a4d1fa7e1c7bff70a27 | [
"MIT"
] | 1 | 2022-01-01T11:14:58.000Z | 2022-01-01T11:14:58.000Z | fun/eduhub/migrations/0012_auto_20211004_1746.py | larryw3i/osp | d9526a179876053a6b93e5a110d2de730376f511 | [
"MIT"
] | 4 | 2021-06-12T06:05:44.000Z | 2021-06-13T06:20:00.000Z | fun/eduhub/migrations/0012_auto_20211004_1746.py | larryw3i/osp | d9526a179876053a6b93e5a110d2de730376f511 | [
"MIT"
] | null | null | null | # Generated by Django 3.2.7 on 2021-10-04 09:46
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('eduhub', '0011_alter_classification_parent'),
]
operations = [
migrations.AlterField(
model_name='classification',
n... | 26.066667 | 76 | 0.547315 | 70 | 782 | 5.985714 | 0.6 | 0.171838 | 0.157518 | 0.138425 | 0.224344 | 0.224344 | 0 | 0 | 0 | 0 | 0 | 0.045365 | 0.351662 | 782 | 29 | 77 | 26.965517 | 0.781065 | 0.057545 | 0 | 0.434783 | 1 | 0 | 0.193197 | 0.043537 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.043478 | 0 | 0.173913 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f4691f8184f7e6f826de0703084638205e8ac83 | 2,203 | py | Python | src/robotkernel/builders_32.py | martinRenou/robotkernel | 827435dbaa5a201db4640f92ac2c4a7ead8f50cd | [
"BSD-3-Clause"
] | 56 | 2019-01-19T22:46:34.000Z | 2022-03-03T07:28:19.000Z | src/robotkernel/builders_32.py | martinRenou/robotkernel | 827435dbaa5a201db4640f92ac2c4a7ead8f50cd | [
"BSD-3-Clause"
] | 42 | 2019-01-09T18:16:32.000Z | 2022-03-29T20:18:41.000Z | src/robotkernel/builders_32.py | admariner/robotkernel | 6b0c3334a4aeb3f7e4f735613cf6be04cd950fd6 | [
"BSD-3-Clause"
] | 9 | 2019-01-25T03:54:49.000Z | 2021-12-05T11:20:59.000Z | # -*- coding: utf-8 -*-
from io import StringIO
from robot.api import get_model
from robot.errors import DataError
from robot.running.builder.parsers import ErrorReporter
from robot.running.builder.testsettings import TestDefaults
from robot.running.builder.transformers import SettingsBuilder
from robot.running.builder... | 31.471429 | 98 | 0.696777 | 265 | 2,203 | 5.716981 | 0.369811 | 0.041584 | 0.052805 | 0.060726 | 0.221782 | 0.221782 | 0.167657 | 0.167657 | 0.167657 | 0.10165 | 0 | 0.017534 | 0.197458 | 2,203 | 69 | 99 | 31.927536 | 0.839367 | 0.127099 | 0 | 0.130435 | 0 | 0 | 0.034519 | 0 | 0 | 0 | 0 | 0.014493 | 0 | 1 | 0.043478 | false | 0 | 0.217391 | 0 | 0.326087 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f53ce06d3d189d2324af2efb199f91da5b178f9 | 259 | py | Python | presets/pov/lamp/01_(5400K)_Direct_Sun.py | 1-MillionParanoidTterabytes/blender-addons-master | acc8fc23a38e6e89099c3e5079bea31ce85da06a | [
"Unlicense"
] | 1 | 2018-06-18T09:46:10.000Z | 2018-06-18T09:46:10.000Z | presets/pov/lamp/01_(5400K)_Direct_Sun.py | 1-MillionParanoidTterabytes/blender-addons-master | acc8fc23a38e6e89099c3e5079bea31ce85da06a | [
"Unlicense"
] | null | null | null | presets/pov/lamp/01_(5400K)_Direct_Sun.py | 1-MillionParanoidTterabytes/blender-addons-master | acc8fc23a38e6e89099c3e5079bea31ce85da06a | [
"Unlicense"
] | null | null | null | #Since the dawn of time
import bpy
bpy.context.object.data.type = 'SUN'
lampdata = bpy.context.object.data
lampdata.color = (1.0, 1.0, 0.9843137264251709)
lampdata.energy = 1.2 #100 000lux
#lampdata.distance = 0.001
#lampdata.falloff_type = 'INVERSE_SQUARE' | 25.9 | 47 | 0.752896 | 41 | 259 | 4.707317 | 0.634146 | 0.103627 | 0.165803 | 0.207254 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.144105 | 0.11583 | 259 | 10 | 48 | 25.9 | 0.69869 | 0.374517 | 0 | 0 | 0 | 0 | 0.018868 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.2 | 0 | 0.2 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f59176aef0e042869f9e368ba0ec96a20fdafed | 322 | py | Python | blog/migrations/0003_remove_blog_show_hide.py | ibnshayed/Advanced-Blog-Application | 27b38d569d5f883a0cd02b04d50162fa35de2388 | [
"MIT"
] | 21 | 2021-04-24T19:45:07.000Z | 2022-02-10T05:50:16.000Z | blog/migrations/0003_remove_blog_show_hide.py | ibnshayed/Advanced-Blog-Application | 27b38d569d5f883a0cd02b04d50162fa35de2388 | [
"MIT"
] | 3 | 2021-07-22T00:45:52.000Z | 2021-09-01T16:31:32.000Z | blog/migrations/0003_remove_blog_show_hide.py | ibnshayed/Advanced-Blog-Application | 27b38d569d5f883a0cd02b04d50162fa35de2388 | [
"MIT"
] | 14 | 2021-05-24T16:27:32.000Z | 2022-03-25T18:02:19.000Z | # Generated by Django 3.1.5 on 2021-04-26 13:28
from django.db import migrations
class Migration(migrations.Migration):
dependencies = [
('blog', '0002_blog_show_hide'),
]
operations = [
migrations.RemoveField(
model_name='blog',
name='show_hide',
),
... | 17.888889 | 47 | 0.583851 | 36 | 322 | 5.083333 | 0.75 | 0.087432 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.084444 | 0.301242 | 322 | 17 | 48 | 18.941176 | 0.728889 | 0.139752 | 0 | 0 | 1 | 0 | 0.130909 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.090909 | 0 | 0.363636 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f5c977e2be803c104d87698e2aec71b6faa7a9e | 6,197 | py | Python | pycamia/timing.py | Bertie97/PyZMyc | dcdd05099f215094f8da94b604ee8dde952654b4 | [
"MIT"
] | null | null | null | pycamia/timing.py | Bertie97/PyZMyc | dcdd05099f215094f8da94b604ee8dde952654b4 | [
"MIT"
] | null | null | null | pycamia/timing.py | Bertie97/PyZMyc | dcdd05099f215094f8da94b604ee8dde952654b4 | [
"MIT"
] | null | null | null |
from .manager import info_manager
__info__ = info_manager(
project = "PyCAMIA",
package = "<main>",
author = "Yuncheng Zhou",
create = "2021-12",
fileinfo = "File to record time."
)
__all__ = """
time_this
Timer
Jump
scope
jump
Workflow
periodic
""".split()
with __inf... | 26.596567 | 93 | 0.560594 | 748 | 6,197 | 4.483957 | 0.256684 | 0.010435 | 0.010733 | 0.012522 | 0.091831 | 0.056052 | 0.03876 | 0.02266 | 0.02266 | 0 | 0 | 0.013796 | 0.298209 | 6,197 | 232 | 94 | 26.711207 | 0.757416 | 0.279329 | 0 | 0.111111 | 0 | 0 | 0.069829 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.240741 | false | 0.018519 | 0.037037 | 0.064815 | 0.388889 | 0.037037 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f72c6ea4793aafc19e580efc673819dad5c71fd | 604 | py | Python | src/main/python/trajectory/log.py | jrouly/trajectory | 1be2290e0d1c9158781281824c0e49bc1872f2b3 | [
"Apache-2.0"
] | 4 | 2015-03-19T13:05:38.000Z | 2019-11-15T21:46:16.000Z | src/main/python/trajectory/log.py | jrouly/trajectory | 1be2290e0d1c9158781281824c0e49bc1872f2b3 | [
"Apache-2.0"
] | null | null | null | src/main/python/trajectory/log.py | jrouly/trajectory | 1be2290e0d1c9158781281824c0e49bc1872f2b3 | [
"Apache-2.0"
] | 3 | 2015-02-18T15:38:20.000Z | 2021-07-10T23:52:51.000Z | """
trajectory/log.py
Author: Jean Michel Rouly
Configure a global logging system.
"""
import logging
def global_logger(name, debug=False):
"""
Generate a global logger object.
"""
#formatter = logging.Formatter(fmt='%(asctime)s - %(levelname)s - %(module)s - %(message)s')
formatter = logging.... | 21.571429 | 96 | 0.68543 | 71 | 604 | 5.816901 | 0.521127 | 0.033898 | 0.121065 | 0.135593 | 0.22276 | 0.22276 | 0.22276 | 0.22276 | 0 | 0 | 0 | 0 | 0.178808 | 604 | 27 | 97 | 22.37037 | 0.832661 | 0.337748 | 0 | 0 | 1 | 0 | 0.108753 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.111111 | false | 0 | 0.111111 | 0 | 0.333333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f78ad79c3acac8606ad63702cb127feabb832b5 | 870 | py | Python | tests/watson/framework/support/jinja2/test_filters.py | watsonpy/watson-framework | ffe157cb3fe24366ee55869d4260cce778012b4a | [
"BSD-3-Clause"
] | 68 | 2015-01-06T19:15:07.000Z | 2021-02-05T13:43:42.000Z | tests/watson/framework/support/jinja2/test_filters.py | watsonpy/watson-framework | ffe157cb3fe24366ee55869d4260cce778012b4a | [
"BSD-3-Clause"
] | 13 | 2015-02-14T12:08:28.000Z | 2021-03-29T20:44:50.000Z | tests/watson/framework/support/jinja2/test_filters.py | watsonpy/watson-framework | ffe157cb3fe24366ee55869d4260cce778012b4a | [
"BSD-3-Clause"
] | 8 | 2015-07-22T23:40:34.000Z | 2021-07-29T06:15:34.000Z | # -*- coding: utf-8 -*-
from datetime import datetime
from watson.framework.support.jinja2 import filters
from watson.form import fields
class TestFilters(object):
def test_qualified_name(self):
assert filters.get_qualified_name(self) == 'tests.watson.framework.support.jinja2.test_filters.TestFilters'
... | 36.25 | 115 | 0.658621 | 119 | 870 | 4.722689 | 0.428571 | 0.049822 | 0.078292 | 0.099644 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.030812 | 0.17931 | 870 | 23 | 116 | 37.826087 | 0.756303 | 0.024138 | 0 | 0 | 0 | 0.0625 | 0.262102 | 0.107438 | 0 | 0 | 0 | 0 | 0.3125 | 1 | 0.25 | false | 0 | 0.1875 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f7b4160e1acaa110171a6de7bf4d517bb13993b | 4,036 | py | Python | 08/src/tester.py | yairfine/nand-to-tetris | 97a0965d2bf0a77f57e8e9e0f43149475ddea620 | [
"MIT"
] | 1 | 2021-07-27T11:44:17.000Z | 2021-07-27T11:44:17.000Z | 08/src/tester.py | yairfine/nand-to-tetris | 97a0965d2bf0a77f57e8e9e0f43149475ddea620 | [
"MIT"
] | null | null | null | 08/src/tester.py | yairfine/nand-to-tetris | 97a0965d2bf0a77f57e8e9e0f43149475ddea620 | [
"MIT"
] | null | null | null | import os
# INSTRUCTIONS
# 1. Unzip the files (tester.py and tests must be in the same directory as VMtranslator)
# 2. Review/update the two constants if necessary
# Not necessary if running on Unix and you added VMtranslator as instructed (and run make before)
# 3. Run `python3 tester.py` on Unix or `python tester... | 31.779528 | 100 | 0.659316 | 570 | 4,036 | 4.517544 | 0.336842 | 0.043495 | 0.044272 | 0.022136 | 0.083884 | 0.030291 | 0.030291 | 0.030291 | 0 | 0 | 0 | 0.005207 | 0.238603 | 4,036 | 126 | 101 | 32.031746 | 0.832737 | 0.219277 | 0 | 0.205128 | 0 | 0 | 0.368135 | 0.012452 | 0 | 0 | 0 | 0 | 0 | 1 | 0.051282 | false | 0 | 0.025641 | 0 | 0.089744 | 0.423077 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 |
7f7bd98c7cbb0366af26f96ea173d5f4a1310512 | 1,466 | py | Python | examples/duplex.py | dfivesystems/pyminiaudio | 7d081fc1ca0d33285f11136d2b07b6017a821cdb | [
"MIT"
] | 91 | 2019-07-17T08:47:31.000Z | 2022-03-30T07:54:40.000Z | examples/duplex.py | dfivesystems/pyminiaudio | 7d081fc1ca0d33285f11136d2b07b6017a821cdb | [
"MIT"
] | 46 | 2019-07-02T23:47:17.000Z | 2022-03-14T20:10:20.000Z | examples/duplex.py | dfivesystems/pyminiaudio | 7d081fc1ca0d33285f11136d2b07b6017a821cdb | [
"MIT"
] | 11 | 2019-07-04T16:08:11.000Z | 2022-03-06T14:19:55.000Z | """
Duplex audio:
record from a source, play back on another output.
"""
import miniaudio
from time import sleep
backends = []
def choose_devices():
devices = miniaudio.Devices(backends=backends)
print("Available capture devices:")
captures = devices.get_captures()
for d in enumerate(captures, 1):
... | 29.32 | 111 | 0.632333 | 175 | 1,466 | 5.142857 | 0.428571 | 0.022222 | 0.013333 | 0.033333 | 0.075556 | 0.075556 | 0.075556 | 0.075556 | 0.075556 | 0.075556 | 0 | 0.012556 | 0.239427 | 1,466 | 49 | 112 | 29.918367 | 0.794619 | 0.043656 | 0 | 0.055556 | 0 | 0 | 0.142755 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.055556 | false | 0.055556 | 0.055556 | 0 | 0.138889 | 0.166667 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
7f829bf3e3f5a8b9471e33d93f77a2899c7ae0d7 | 4,203 | py | Python | Scripts/zAllSBStats.py | NottCurious/NottABot | a162da1cb937d58af1acc7532d72a0811cddfe6c | [
"CC0-1.0"
] | null | null | null | Scripts/zAllSBStats.py | NottCurious/NottABot | a162da1cb937d58af1acc7532d72a0811cddfe6c | [
"CC0-1.0"
] | null | null | null | Scripts/zAllSBStats.py | NottCurious/NottABot | a162da1cb937d58af1acc7532d72a0811cddfe6c | [
"CC0-1.0"
] | null | null | null | # Importing Libraries
from requests import get
print('[Scripts.zAllSBStats] - Imported requests.get')
from pathlib import Path
print('[Scripts.zAllSBStats] - Imported pathlib.Path')
import os
print('[Scripts.zAllSBStats] - Imported os')
from dotenv import load_dotenv
print('[Scripts.zAllSBStats] - Imported dotenv.lo... | 40.413462 | 208 | 0.763264 | 475 | 4,203 | 6.665263 | 0.227368 | 0.098547 | 0.188882 | 0.068541 | 0.267214 | 0.141503 | 0.141503 | 0.141503 | 0.141503 | 0.141503 | 0 | 0.001839 | 0.094218 | 4,203 | 104 | 209 | 40.413462 | 0.829787 | 0.026648 | 0 | 0.026667 | 0 | 0.013333 | 0.443602 | 0.191828 | 0 | 0 | 0 | 0 | 0 | 1 | 0.066667 | false | 0 | 0.16 | 0 | 0.306667 | 0.333333 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f86b81c6add5d3423e6acf02e2d1b8e79510631 | 1,611 | py | Python | benchmarks/fasta.py | codeclimate-testing/falcon | c2d0b9da4d4cffd39cd489ffa886ee745d06f063 | [
"Apache-2.0"
] | 115 | 2015-01-18T13:28:05.000Z | 2022-03-01T23:45:44.000Z | benchmarks/fasta.py | codeclimate-testing/falcon | c2d0b9da4d4cffd39cd489ffa886ee745d06f063 | [
"Apache-2.0"
] | null | null | null | benchmarks/fasta.py | codeclimate-testing/falcon | c2d0b9da4d4cffd39cd489ffa886ee745d06f063 | [
"Apache-2.0"
] | 8 | 2015-02-12T04:08:42.000Z | 2018-09-11T20:55:29.000Z | import bisect
import sys
alu = (
'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG'
'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA'
'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT'
'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA'
'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG'
'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACT... | 22.375 | 70 | 0.589075 | 188 | 1,611 | 5.005319 | 0.414894 | 0.05101 | 0.028693 | 0.044633 | 0.130712 | 0.110521 | 0.07864 | 0.07864 | 0.07864 | 0.07864 | 0 | 0.090598 | 0.273743 | 1,611 | 71 | 71 | 22.690141 | 0.713675 | 0.091868 | 0 | 0.163636 | 0 | 0 | 0.215216 | 0.19671 | 0 | 0 | 0 | 0 | 0 | 1 | 0.072727 | false | 0.054545 | 0.036364 | 0 | 0.127273 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
7f92ef02897ba73f0a55359c9b67a49d28794a49 | 1,560 | py | Python | pictures/models.py | ucynthy12/mygallery | 7085ce4e7b41908944baa6edf1c426f06f82ae55 | [
"Unlicense"
] | null | null | null | pictures/models.py | ucynthy12/mygallery | 7085ce4e7b41908944baa6edf1c426f06f82ae55 | [
"Unlicense"
] | null | null | null | pictures/models.py | ucynthy12/mygallery | 7085ce4e7b41908944baa6edf1c426f06f82ae55 | [
"Unlicense"
] | null | null | null | from django.db import models
# Create your models here.
class Category(models.Model):
name=models.CharField(max_length=50)
def __str__(self):
return self.name
def save_category(self):
self.save()
class Location(models.Model):
name= models.CharField(max_length=50)
def save_locati... | 24 | 75 | 0.669872 | 193 | 1,560 | 5.196891 | 0.316062 | 0.031904 | 0.053838 | 0.071785 | 0.192423 | 0.132602 | 0.087737 | 0.087737 | 0.087737 | 0 | 0 | 0.004967 | 0.225641 | 1,560 | 65 | 76 | 24 | 0.825331 | 0.015385 | 0 | 0.318182 | 0 | 0 | 0.009121 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.022727 | 0.068182 | 0.681818 | 0.022727 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f9309c3b2c630781bd4b704f7a1a1de5191a30b | 619 | py | Python | src/_repobee/ext/defaults/students_file_parser.py | DD2480-Group-18/repobee | 1dd79bb6ace3c00b920ef0b32664847cd5b12f84 | [
"MIT"
] | 39 | 2019-04-02T15:53:23.000Z | 2022-03-07T02:38:41.000Z | src/_repobee/ext/defaults/students_file_parser.py | DD2480-Group-18/repobee | 1dd79bb6ace3c00b920ef0b32664847cd5b12f84 | [
"MIT"
] | 788 | 2019-03-31T13:55:53.000Z | 2022-03-29T20:41:02.000Z | src/_repobee/ext/defaults/students_file_parser.py | slarse/repobee | 03fcf90dc0244e0274a890d2a897752889c70326 | [
"MIT"
] | 18 | 2020-06-15T11:49:50.000Z | 2022-03-06T19:05:53.000Z | """Plugin that provides the default students file parsing for RepoBee.
.. module:: students_file_parser
:synopsis: Default students file parsing for RepoBee.
"""
import os
import pathlib
import sys
from typing import Iterable
import repobee_plug as plug
@plug.repobee_hook
def parse_students_file(
students... | 22.925926 | 70 | 0.704362 | 79 | 619 | 5.405063 | 0.544304 | 0.168618 | 0.088993 | 0.12178 | 0.168618 | 0.168618 | 0 | 0 | 0 | 0 | 0 | 0 | 0.210016 | 619 | 26 | 71 | 23.807692 | 0.873211 | 0.285945 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.0625 | false | 0 | 0.3125 | 0.0625 | 0.4375 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
7f93cda9c2f9f05bf420d33115e6a85f314dce95 | 1,396 | py | Python | com/radityalabs/Python/tfidf/experiment/documentmodel.py | radityagumay/BenchmarkSentimentAnalysis_2 | e509a4e749271da701ce9da1d9f16cdd78dcdf40 | [
"Apache-2.0"
] | 3 | 2017-06-08T01:17:55.000Z | 2019-06-02T10:52:36.000Z | com/radityalabs/Python/tfidf/experiment/documentmodel.py | radityagumay/BenchmarkSentimentAnalysis_2 | e509a4e749271da701ce9da1d9f16cdd78dcdf40 | [
"Apache-2.0"
] | null | null | null | com/radityalabs/Python/tfidf/experiment/documentmodel.py | radityagumay/BenchmarkSentimentAnalysis_2 | e509a4e749271da701ce9da1d9f16cdd78dcdf40 | [
"Apache-2.0"
] | null | null | null |
class documentmodel:
def getDocuments(self):
document_tokens1 = "China has a strong economy that is growing at a rapid pace. However politically it differs greatly from the US Economy."
document_tokens2 = "At last, China seems serious about confronting an endemic problem: domestic violence and corr... | 63.454545 | 173 | 0.737822 | 185 | 1,396 | 5.491892 | 0.572973 | 0.103346 | 0.158465 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.01275 | 0.213467 | 1,396 | 21 | 174 | 66.47619 | 0.912568 | 0 | 0 | 0 | 0 | 0.222222 | 0.563128 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.055556 | false | 0 | 0 | 0 | 0.166667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7f96c2dcab4f154fbcf34343baa201232fc13a59 | 479 | py | Python | psmate/apps/usercabinet/adapter.py | vgrivtsov/psmate | 10e0279b995d36518e0867e8c5d5125c355a2f00 | [
"MIT"
] | null | null | null | psmate/apps/usercabinet/adapter.py | vgrivtsov/psmate | 10e0279b995d36518e0867e8c5d5125c355a2f00 | [
"MIT"
] | null | null | null | psmate/apps/usercabinet/adapter.py | vgrivtsov/psmate | 10e0279b995d36518e0867e8c5d5125c355a2f00 | [
"MIT"
] | null | null | null | from allauth.account.adapter import DefaultAccountAdapter
class AccountAdapter(DefaultAccountAdapter):
def save_user(self, request, user, form, commit=False):
data = form.cleaned_data
user.email = data['email']
if 'password1' in data:
user.set_password(data['password1'])
... | 29.9375 | 59 | 0.636743 | 51 | 479 | 5.862745 | 0.568627 | 0.073579 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005731 | 0.271399 | 479 | 16 | 60 | 29.9375 | 0.851003 | 0.077244 | 0 | 0 | 0 | 0 | 0.052036 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.083333 | false | 0.25 | 0.083333 | 0 | 0.333333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
7f99d6fad84f221206c26de64604e605122eac08 | 3,161 | py | Python | tools/loginzmp.py | jAchillus/pythontools | 518d72a46dada6c62db94cd3d49e848f11129442 | [
"Apache-2.0"
] | null | null | null | tools/loginzmp.py | jAchillus/pythontools | 518d72a46dada6c62db94cd3d49e848f11129442 | [
"Apache-2.0"
] | null | null | null | tools/loginzmp.py | jAchillus/pythontools | 518d72a46dada6c62db94cd3d49e848f11129442 | [
"Apache-2.0"
] | null | null | null | # -*- coding:utf-8 -*-
# -*- coding=utf-8 -*-
# coding=utf-8
# python version 3.5
import urllib
import urllib.request
import json
import logging
import traceback
import time
import os
url = "http://10.45.62.250/ac_portal/login.php"
url = url.encode('utf-8').decode('utf-8')
print(url)
oridata = {"opr": "pwdLogin",
... | 24.315385 | 66 | 0.537804 | 359 | 3,161 | 4.70195 | 0.35376 | 0.018957 | 0.017773 | 0.021327 | 0.131517 | 0.017773 | 0 | 0 | 0 | 0 | 0 | 0.026748 | 0.325846 | 3,161 | 129 | 67 | 24.503876 | 0.765368 | 0.115153 | 0 | 0.311828 | 0 | 0 | 0.097739 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.032258 | false | 0.075269 | 0.107527 | 0 | 0.172043 | 0.129032 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
7f9e207337cf135178a663c3133dd62fbdfe09c0 | 2,482 | py | Python | core/views.py | alanmsant2/sapo-alimenticio | ba03f28694611c7b22c6c1cb608361ded3922712 | [
"MIT"
] | null | null | null | core/views.py | alanmsant2/sapo-alimenticio | ba03f28694611c7b22c6c1cb608361ded3922712 | [
"MIT"
] | null | null | null | core/views.py | alanmsant2/sapo-alimenticio | ba03f28694611c7b22c6c1cb608361ded3922712 | [
"MIT"
] | 1 | 2020-11-24T18:11:17.000Z | 2020-11-24T18:11:17.000Z | from django.shortcuts import render
from rest_framework import viewsets
from .models import Alimento, Arquivo
from .serializers import AlimentoSerializer, ArquivoSerializer
from rest_framework.response import Response
from rest_framework.decorators import action
from helpers import limpar_arquivos, limpar_tabelas
from... | 40.688525 | 99 | 0.7361 | 258 | 2,482 | 6.988372 | 0.317829 | 0.073211 | 0.103161 | 0.053245 | 0.43594 | 0.297837 | 0.297837 | 0.297837 | 0.297837 | 0.297837 | 0 | 0.002951 | 0.180903 | 2,482 | 60 | 100 | 41.366667 | 0.883915 | 0.063255 | 0 | 0.295455 | 0 | 0 | 0.387321 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.045455 | false | 0 | 0.181818 | 0 | 0.613636 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
7fa12544d7a4223c9243af8d736db228cf605cb4 | 1,069 | py | Python | tests/test_simple_que.py | drewverlee/prims-algorithm | 2d3e14dbf45b211e77d3e7aab6b5b9c5ccdc1e4c | [
"MIT"
] | null | null | null | tests/test_simple_que.py | drewverlee/prims-algorithm | 2d3e14dbf45b211e77d3e7aab6b5b9c5ccdc1e4c | [
"MIT"
] | null | null | null | tests/test_simple_que.py | drewverlee/prims-algorithm | 2d3e14dbf45b211e77d3e7aab6b5b9c5ccdc1e4c | [
"MIT"
] | null | null | null | from que import SimpleQue
from mocks import A_B, A, B, C, D, A_B_COST
def test_simple_que_should_be_simple_que(simple_que):
assert isinstance(simple_que, SimpleQue)
def test_simple_que_should_find_cheapest_spanning_egde(simple_que, mock_abcd):
vertice_not_in_mst, _, _, _ = \
simple_que.cheapest_span... | 32.393939 | 83 | 0.772685 | 163 | 1,069 | 4.472393 | 0.202454 | 0.197531 | 0.089163 | 0.109739 | 0.603567 | 0.573388 | 0.573388 | 0.534979 | 0.477366 | 0.351166 | 0 | 0 | 0.148737 | 1,069 | 32 | 84 | 33.40625 | 0.801099 | 0 | 0 | 0.2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.25 | 1 | 0.25 | false | 0 | 0.1 | 0 | 0.35 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7fa13ad500e16c1cef8511d15808cea34c3edfe8 | 531 | py | Python | irrexplorer/commands/import_data.py | dashcare/irrexplorer | 70977f745769b9d0c761f4d1a92091ec2ae84984 | [
"BSD-2-Clause"
] | 17 | 2021-02-12T14:18:16.000Z | 2021-08-02T13:20:18.000Z | irrexplorer/commands/import_data.py | dashcare/irrexplorer | 70977f745769b9d0c761f4d1a92091ec2ae84984 | [
"BSD-2-Clause"
] | 76 | 2021-02-12T13:08:25.000Z | 2021-08-19T15:17:14.000Z | irrexplorer/commands/import_data.py | dashcare/irrexplorer | 70977f745769b9d0c761f4d1a92091ec2ae84984 | [
"BSD-2-Clause"
] | 2 | 2021-06-09T12:44:54.000Z | 2021-06-17T14:32:35.000Z | import asyncio
from irrexplorer.backends.bgp import BGPImporter
from irrexplorer.backends.rirstats import RIRStatsImporter
from irrexplorer.state import RIR
async def main():
"""
Run an import for all backends with local data.
All imports are run "simultaneously" (one CPU, but async)
"""
tasks = ... | 24.136364 | 61 | 0.706215 | 66 | 531 | 5.530303 | 0.515152 | 0.123288 | 0.126027 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.19209 | 531 | 21 | 62 | 25.285714 | 0.850816 | 0 | 0 | 0 | 0 | 0 | 0.019704 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
7fa25788e87ce7c841f4a23b74bc12f2f674dcbe | 1,006 | py | Python | sharp_memory_display/sharpikeebo_lcd/startup_logo.py | hra1129/ShaRPIKeebo-customize-for-japanese | 8bff846c94760b49020fe74b6dcce30ac16745cf | [
"MIT"
] | 2 | 2022-03-23T14:01:44.000Z | 2022-03-29T21:55:51.000Z | sharp_memory_display/sharpikeebo_lcd/startup_logo.py | hra1129/ShaRPIKeebo-customize-for-japanese | 8bff846c94760b49020fe74b6dcce30ac16745cf | [
"MIT"
] | null | null | null | sharp_memory_display/sharpikeebo_lcd/startup_logo.py | hra1129/ShaRPIKeebo-customize-for-japanese | 8bff846c94760b49020fe74b6dcce30ac16745cf | [
"MIT"
] | 1 | 2022-03-27T03:10:55.000Z | 2022-03-27T03:10:55.000Z | #!/usr/bin/python3
# -----------------------------------------------------------------------------
# Start up logo image converter
#
# require:
# pip3 install Pillow
# sudo apt-get install libopenjp2-7
# -----------------------------------------------------------------------------
from PIL import Image
# ---------... | 26.473684 | 79 | 0.367793 | 114 | 1,006 | 3.114035 | 0.526316 | 0.126761 | 0.067606 | 0.061972 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.03625 | 0.204771 | 1,006 | 37 | 80 | 27.189189 | 0.4075 | 0.422465 | 0 | 0.086957 | 0 | 0 | 0.101576 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.043478 | false | 0 | 0.043478 | 0 | 0.086957 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7fa38525300e7ce5f14078d8844a4443f5b547ec | 1,993 | py | Python | ausgsteckt/buschenschank/migrations/0005_region.py | kelvan/ausgsteckt | 8a1063ff065cdb167648e75f1cdbdc6fce897992 | [
"MIT"
] | 2 | 2018-01-30T15:59:21.000Z | 2018-07-25T04:56:40.000Z | ausgsteckt/buschenschank/migrations/0005_region.py | kelvan/ausgsteckt | 8a1063ff065cdb167648e75f1cdbdc6fce897992 | [
"MIT"
] | null | null | null | ausgsteckt/buschenschank/migrations/0005_region.py | kelvan/ausgsteckt | 8a1063ff065cdb167648e75f1cdbdc6fce897992 | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
# Generated by Django 1.10.3 on 2016-11-17 00:02
from __future__ import unicode_literals
import django.contrib.gis.db.models.fields
from django.db import migrations, models
import django.utils.timezone
import easy_thumbnails.fields
import model_utils.fields
class Migration(migrations.Migratio... | 48.609756 | 192 | 0.646262 | 214 | 1,993 | 5.878505 | 0.439252 | 0.052464 | 0.04531 | 0.040541 | 0.243243 | 0.243243 | 0.144674 | 0.084261 | 0.084261 | 0 | 0 | 0.026975 | 0.218766 | 1,993 | 40 | 193 | 49.825 | 0.780989 | 0.034119 | 0 | 0 | 1 | 0 | 0.150364 | 0.011967 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.181818 | 0 | 0.272727 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7fa403d68a730c4f262319f5790bb21fdad0b384 | 16,424 | py | Python | com.ibm.streamsx.topology/opt/python/packages/streamsx/rest.py | natashadsilva/streamsx.topology | c23f2cb98ca8b77b658c322b11226b9960c35df4 | [
"Apache-2.0"
] | null | null | null | com.ibm.streamsx.topology/opt/python/packages/streamsx/rest.py | natashadsilva/streamsx.topology | c23f2cb98ca8b77b658c322b11226b9960c35df4 | [
"Apache-2.0"
] | null | null | null | com.ibm.streamsx.topology/opt/python/packages/streamsx/rest.py | natashadsilva/streamsx.topology | c23f2cb98ca8b77b658c322b11226b9960c35df4 | [
"Apache-2.0"
] | null | null | null | # coding=utf-8
# Licensed Materials - Property of IBM
# Copyright IBM Corp. 2016,2017
"""
REST API bindings for IBM® Streams & Streaming Analytics service.
****************
Streams REST API
****************
The Streams REST API provides programmatic access to configuration and status information for IBM Streams obje... | 44.389189 | 472 | 0.694411 | 2,016 | 16,424 | 5.502976 | 0.173611 | 0.047593 | 0.016405 | 0.018929 | 0.281233 | 0.197765 | 0.16901 | 0.118623 | 0.086894 | 0.063638 | 0 | 0.002421 | 0.220227 | 16,424 | 369 | 473 | 44.509485 | 0.863746 | 0.549805 | 0 | 0.165414 | 0 | 0 | 0.116829 | 0.009574 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0.067669 | 0.067669 | 0.007519 | 0.360902 | 0.007519 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
7faa598b375773ad03351f6baab21a0474123709 | 3,550 | py | Python | mapping/efo_doid_mappings.py | dhimmel/serg-pycode | 075de0ba470e4fbda5e33dfc23cb9ecd86ec53b7 | [
"BSD-2-Clause-Patent"
] | null | null | null | mapping/efo_doid_mappings.py | dhimmel/serg-pycode | 075de0ba470e4fbda5e33dfc23cb9ecd86ec53b7 | [
"BSD-2-Clause-Patent"
] | null | null | null | mapping/efo_doid_mappings.py | dhimmel/serg-pycode | 075de0ba470e4fbda5e33dfc23cb9ecd86ec53b7 | [
"BSD-2-Clause-Patent"
] | null | null | null | import csv
import bioparser.data
import mapping.bioportal
efo = bioparser.data.Data().efo
doid = bioparser.data.Data().doid
efo_ontology = efo.get_nx_ontology()
doid_ontology = doid.get_nx_ontology()
efo_graph = efo_ontology.graph
doid_graph = doid_ontology.graph
"""
biopartal_mapping_path = '/home/dhimmels/Docume... | 38.172043 | 111 | 0.753239 | 561 | 3,550 | 4.402852 | 0.149733 | 0.048583 | 0.025911 | 0.026721 | 0.495142 | 0.467611 | 0.453846 | 0.453846 | 0.449798 | 0.449798 | 0 | 0.004243 | 0.136901 | 3,550 | 92 | 112 | 38.586957 | 0.801893 | 0 | 0 | 0 | 0 | 0.058824 | 0.15493 | 0.126761 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.176471 | null | null | 0.058824 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7fb0bff1df8433bbfb8654439f7adfa9bd2e3dc7 | 6,083 | py | Python | cmskit/articles/models.py | ozgurgunes/django-cmskit | 19d14fbb57702a6c56b6b3a5d859c93533ff1535 | [
"MIT"
] | 1 | 2015-09-28T10:10:34.000Z | 2015-09-28T10:10:34.000Z | cmskit/articles/models.py | ozgurgunes/django-cmskit | 19d14fbb57702a6c56b6b3a5d859c93533ff1535 | [
"MIT"
] | null | null | null | cmskit/articles/models.py | ozgurgunes/django-cmskit | 19d14fbb57702a6c56b6b3a5d859c93533ff1535 | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
import re
from datetime import datetime
from django.db import models
from django.core.urlresolvers import reverse
from django.utils.translation import ugettext_lazy as _
from django.template.defaultfilters import slugify
from cms.models import CMSPlugin, Page
from cms.models.fields import Place... | 38.99359 | 90 | 0.589019 | 623 | 6,083 | 5.540931 | 0.223114 | 0.032445 | 0.045191 | 0.049247 | 0.474218 | 0.434531 | 0.353418 | 0.265353 | 0.213789 | 0.18482 | 0 | 0.004447 | 0.297551 | 6,083 | 156 | 91 | 38.99359 | 0.803417 | 0.003452 | 0 | 0.324786 | 0 | 0 | 0.111038 | 0.021614 | 0 | 0 | 0 | 0 | 0 | 1 | 0.102564 | false | 0 | 0.076923 | 0.059829 | 0.598291 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
7fb3bda4eaf586a225fdfe744c6f0f97fd05e36c | 2,989 | py | Python | brightApp.py | gsalaman/GridBoard | adecb482256198e27bfedf3e0e1d0d0595357614 | [
"MIT"
] | 1 | 2021-09-15T16:49:43.000Z | 2021-09-15T16:49:43.000Z | brightApp.py | jlefkoff/GridBoard | 9ceb6f99f72110dccf1b8a6ac9765df02c21049d | [
"MIT"
] | 22 | 2021-03-19T17:04:42.000Z | 2021-04-18T04:45:57.000Z | brightApp.py | gsalaman/GridBoard | adecb482256198e27bfedf3e0e1d0d0595357614 | [
"MIT"
] | 1 | 2021-09-15T16:01:05.000Z | 2021-09-15T16:01:05.000Z | ##############################################
# brightApp
#
# This app is used to set the screen brightness
#############################################
from PIL import Image, ImageDraw, ImageFont
from get_buttons import read
from datetime import datetime
import time
class brightApp():
def __init__(self,rgbmatr... | 35.583333 | 72 | 0.501171 | 372 | 2,989 | 3.895161 | 0.239247 | 0.132505 | 0.062112 | 0.082816 | 0.430642 | 0.394755 | 0.334023 | 0.334023 | 0.31608 | 0.085576 | 0 | 0.101134 | 0.292071 | 2,989 | 83 | 73 | 36.012048 | 0.583648 | 0.043158 | 0 | 0.107143 | 0 | 0 | 0.011624 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.071429 | null | null | 0.017857 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7fb707b7d879a05830f0a2e5bb23fffd3de54b6d | 1,156 | py | Python | backend/cart/serializers.py | harizMunawar/La-Virtuele | 051d11a281620b36638b6be50e71d3c893ce1568 | [
"MIT"
] | 2 | 2021-02-23T16:30:27.000Z | 2021-03-21T08:12:39.000Z | backend/cart/serializers.py | harizMunawar/La-Virtuele | 051d11a281620b36638b6be50e71d3c893ce1568 | [
"MIT"
] | 9 | 2021-02-23T09:05:32.000Z | 2021-07-02T11:41:55.000Z | backend/cart/serializers.py | harizMunawar/La-Virtuele | 051d11a281620b36638b6be50e71d3c893ce1568 | [
"MIT"
] | 1 | 2021-02-23T07:42:17.000Z | 2021-02-23T07:42:17.000Z | from rest_framework import serializers
from drf_yasg.utils import swagger_serializer_method
from cart.models import ProductCart, Cart
from product.serializers import ProductSerializer
from product.models import Product
class ProductCartSerializer(serializers.ModelSerializer):
product = serializers.SerializerMethod... | 38.533333 | 84 | 0.749135 | 125 | 1,156 | 6.776 | 0.4 | 0.060213 | 0.081464 | 0.115702 | 0.269185 | 0.170012 | 0.170012 | 0.170012 | 0 | 0 | 0 | 0 | 0.154844 | 1,156 | 29 | 85 | 39.862069 | 0.86694 | 0 | 0 | 0.086957 | 0 | 0 | 0.057958 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.086957 | false | 0 | 0.217391 | 0 | 0.652174 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
7fbe1aecf07982a9c8d92dc1a179b1474425aae6 | 1,766 | py | Python | SimpleHttpd.py | dinosoft/aliyun-authcode-recognizer | 4796cb60b1e651b21c4b8876aad169283abc2a69 | [
"MIT"
] | null | null | null | SimpleHttpd.py | dinosoft/aliyun-authcode-recognizer | 4796cb60b1e651b21c4b8876aad169283abc2a69 | [
"MIT"
] | null | null | null | SimpleHttpd.py | dinosoft/aliyun-authcode-recognizer | 4796cb60b1e651b21c4b8876aad169283abc2a69 | [
"MIT"
] | null | null | null | import sys
import BaseHTTPServer
from SimpleHTTPServer import SimpleHTTPRequestHandler
import ssl
from camera import camare_authcode_capture
class AuthCodeRequestHandler(SimpleHTTPRequestHandler):
def do_GET(self):
print self.path;
if self.path.startswith('/get_authcode'):
self.send_res... | 38.391304 | 160 | 0.679502 | 212 | 1,766 | 5.561321 | 0.490566 | 0.06531 | 0.035623 | 0.045802 | 0.135708 | 0.135708 | 0.135708 | 0.135708 | 0.135708 | 0.098388 | 0 | 0.025535 | 0.179502 | 1,766 | 46 | 161 | 38.391304 | 0.78813 | 0.168743 | 0 | 0 | 0 | 0 | 0.133106 | 0.03413 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.138889 | null | null | 0.083333 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7fbf89320519a0ba308adf9b66f0a3388b7abd9b | 251 | py | Python | 04-list-del-repeat2.py | jpch89/dwm-advanced-py | 64e44e19e32221ffaf7c3974493d138cd96be29d | [
"MIT"
] | null | null | null | 04-list-del-repeat2.py | jpch89/dwm-advanced-py | 64e44e19e32221ffaf7c3974493d138cd96be29d | [
"MIT"
] | null | null | null | 04-list-del-repeat2.py | jpch89/dwm-advanced-py | 64e44e19e32221ffaf7c3974493d138cd96be29d | [
"MIT"
] | null | null | null | l = [1, 2, 4, 7, 2, 1, 8, 6, 1]
# 字典取键法可以保证原列表元素顺序
print(list(dict.fromkeys(l).keys()))
# 集合法则不可以
print(list(set(l)))
# 还有一种方法:有序字典取键法
# 其实在 Python 3.6 及后续版本这个方法等价于字典取键法
from collections import OrderedDict
print(list(OrderedDict.fromkeys(l).keys()))
| 22.818182 | 43 | 0.709163 | 39 | 251 | 4.564103 | 0.641026 | 0.151685 | 0.146067 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.049774 | 0.119522 | 251 | 10 | 44 | 25.1 | 0.755656 | 0.286853 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.2 | 0 | 0.2 | 0.6 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 |
f68076e2ad5c1fc7cc378820aeecfb196c18977e | 2,812 | py | Python | avaxpython/wallet/BIP32.py | jgeofil/avax-python | b09e78e3d7e1c35db5ae42e3918e960e775f2d45 | [
"MIT"
] | 25 | 2021-05-16T23:43:47.000Z | 2022-03-29T03:08:30.000Z | avaxpython/wallet/BIP32.py | zefonseca/ava-python | 9c72af7c720edfab9c73379a102cf6a11d864ebd | [
"MIT"
] | 2 | 2021-04-26T11:43:22.000Z | 2021-06-04T07:55:22.000Z | avaxpython/wallet/BIP32.py | jgeofil/avax-python | b09e78e3d7e1c35db5ae42e3918e960e775f2d45 | [
"MIT"
] | 4 | 2021-08-06T10:55:58.000Z | 2022-03-29T08:03:05.000Z | # avax-python : Python tools for the exploration of the Avalanche AVAX network.
#
# Find tutorials and use cases at https://crypto.bi
"""
Copyright (C) 2021 - crypto.bi
Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), t... | 34.292683 | 463 | 0.754267 | 391 | 2,812 | 5.335038 | 0.468031 | 0.042186 | 0.038351 | 0.022052 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.026518 | 0.168563 | 2,812 | 81 | 464 | 34.716049 | 0.865697 | 0.490398 | 0 | 0.057143 | 0 | 0 | 0.026931 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0 | 0.2 | 0.057143 | 0.6 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
f68373af612b0172bb25ec751e0c9440a0743b03 | 222 | py | Python | SinhalaEmbed.py | NisansaDdS/graph2vec | 819625207848b4dfe85ad3f3907349cd5426fc21 | [
"Apache-2.0"
] | null | null | null | SinhalaEmbed.py | NisansaDdS/graph2vec | 819625207848b4dfe85ad3f3907349cd5426fc21 | [
"Apache-2.0"
] | null | null | null | SinhalaEmbed.py | NisansaDdS/graph2vec | 819625207848b4dfe85ad3f3907349cd5426fc21 | [
"Apache-2.0"
] | null | null | null | import trainer
graph2vec = Graph2Vec(vector_dimensions=128)
graph2vec.parse_graph('data/edge.data', extend_paths=2)
graph2vec.fit(batch_size=1000, max_epochs=1000)
node2vec.model.save_to_file("data/case_embeddings.pkl") | 27.75 | 55 | 0.824324 | 33 | 222 | 5.30303 | 0.818182 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.080952 | 0.054054 | 222 | 8 | 56 | 27.75 | 0.752381 | 0 | 0 | 0 | 0 | 0 | 0.170404 | 0.107623 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.2 | 0 | 0.2 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f684335df9fe2ea344521bf0a2ece4d0c52c1e10 | 759 | py | Python | server/processes/serializers/base_execution_method_capability_serializer.py | CloudReactor/task_manager | 464ca74371064fabb9a21b1f5bacba30360932ab | [
"Fair"
] | null | null | null | server/processes/serializers/base_execution_method_capability_serializer.py | CloudReactor/task_manager | 464ca74371064fabb9a21b1f5bacba30360932ab | [
"Fair"
] | 6 | 2021-11-01T01:35:40.000Z | 2022-02-11T03:33:06.000Z | server/processes/serializers/base_execution_method_capability_serializer.py | CloudReactor/task_manager | 464ca74371064fabb9a21b1f5bacba30360932ab | [
"Fair"
] | null | null | null | from rest_framework import serializers
from rest_framework.fields import empty
from .base_execution_method_serializer import BaseExecutionMethodSerializer
class BaseExecutionMethodCapabilitySerializer(BaseExecutionMethodSerializer):
def __init__(self, instance=None, data=empty, omit_details=False, **kwarg... | 37.95 | 81 | 0.694335 | 73 | 759 | 6.90411 | 0.534247 | 0.031746 | 0.06746 | 0.083333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.213439 | 759 | 19 | 82 | 39.947368 | 0.844221 | 0 | 0 | 0 | 0 | 0 | 0.043243 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0.214286 | 0.071429 | 0.571429 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
f6851b542497b7c9f401e3282ab11c13962a88de | 433 | py | Python | 02.py | sqldan/advent-of-code-2020 | 17c5240da16dec81d84859061fdb5d3a3174c860 | [
"MIT"
] | null | null | null | 02.py | sqldan/advent-of-code-2020 | 17c5240da16dec81d84859061fdb5d3a3174c860 | [
"MIT"
] | null | null | null | 02.py | sqldan/advent-of-code-2020 | 17c5240da16dec81d84859061fdb5d3a3174c860 | [
"MIT"
] | null | null | null | import re
rule1 = rule2 = 0
policy = re.compile("^(\d+)-(\d+)\s([a-z]):\s(.*)$")
with open("input02.txt") as f:
for line in f:
m = policy.match(line)
nr1, nr2, char, password = m.groups()
nr1, nr2 = int(nr1), int(nr2)
if nr1 <= password.count(char) <= nr2:
rule1 += 1
... | 24.055556 | 69 | 0.498845 | 62 | 433 | 3.483871 | 0.516129 | 0.092593 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.075908 | 0.300231 | 433 | 17 | 70 | 25.470588 | 0.636964 | 0 | 0 | 0 | 0 | 0 | 0.092379 | 0.066975 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.230769 | 0.076923 | 0 | 0.076923 | 0.076923 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
f6914bd9a767998bc1523788177afca107ea2512 | 1,200 | py | Python | python/AlgoritmosPython/raizAlgarismos.py | jonfisik/Projects | 7847f32c9e333cfca31cc127db175d9b4080ed0f | [
"MIT"
] | 2 | 2020-09-05T22:25:37.000Z | 2021-06-01T21:34:54.000Z | python/AlgoritmosPython/raizAlgarismos.py | jonfisik/Projects | 7847f32c9e333cfca31cc127db175d9b4080ed0f | [
"MIT"
] | null | null | null | python/AlgoritmosPython/raizAlgarismos.py | jonfisik/Projects | 7847f32c9e333cfca31cc127db175d9b4080ed0f | [
"MIT"
] | null | null | null | __author__ = 'JPaschoal'
__version__ = '1.0.1'
__email__ = 'jonfisik@hotmail.com'
__date__ = '08/05/2021'
'''
Qualquer número natural de quatro algarismos pode ser dividido
em duas dezenas formadas pelos seus dois primeiros e dois
últimos dígitos.
Exemplos:
1297: 12 e 97
5314: 53 e 14
Escreva um programa que i... | 23.529412 | 156 | 0.578333 | 173 | 1,200 | 3.895954 | 0.554913 | 0.017804 | 0.04451 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.183921 | 0.243333 | 1,200 | 51 | 157 | 23.529412 | 0.55837 | 0.256667 | 0 | 0.2 | 0 | 0 | 0.196347 | 0 | 0 | 0 | 0 | 0.019608 | 0 | 1 | 0.05 | false | 0 | 0 | 0.05 | 0.1 | 0.25 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f6940e688deeafa4349fe82ad06d2fab51c6f0bc | 313 | py | Python | summary/html/dom.py | after12am/summary | 47981f6d61227b4e8674c895ddf8fec28cb2af77 | [
"MIT"
] | 14 | 2015-08-24T13:18:12.000Z | 2021-12-04T20:09:20.000Z | summary/html/dom.py | after12am/summary | 47981f6d61227b4e8674c895ddf8fec28cb2af77 | [
"MIT"
] | 9 | 2015-02-05T04:02:29.000Z | 2015-03-13T06:47:31.000Z | summary/html/dom.py | after12am/summary | 47981f6d61227b4e8674c895ddf8fec28cb2af77 | [
"MIT"
] | 6 | 2015-10-29T18:22:23.000Z | 2020-01-30T08:45:30.000Z | # encoding: utf-8
import defs
# removes element from the tree, including its children and text
def drop_tree(dom, tag):
for e in dom.xpath('%s' % tag):
e.drop_tree()
# removes ignore elements with drop_tree()
def drop_ignore_trees(dom):
for tag in defs.ignore_tags:
drop_tree(dom, tag)
| 22.357143 | 64 | 0.686901 | 51 | 313 | 4.078431 | 0.568627 | 0.153846 | 0.105769 | 0.134615 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.004065 | 0.214058 | 313 | 13 | 65 | 24.076923 | 0.841463 | 0.380192 | 0 | 0 | 0 | 0 | 0.010526 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.285714 | false | 0 | 0.142857 | 0 | 0.428571 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f695724b54f2b403383c8a2ad121683d49fd3cec | 13,155 | py | Python | aaem/community_data.py | gina-alaska/alaska_affordable_energy_model | 96fed0137152985ce280ea37e0affec131e3087f | [
"MIT-feh"
] | 1 | 2022-01-23T07:18:36.000Z | 2022-01-23T07:18:36.000Z | aaem/community_data.py | gina-alaska/alaska_affordable_energy_model | 96fed0137152985ce280ea37e0affec131e3087f | [
"MIT-feh"
] | 5 | 2017-07-14T21:56:46.000Z | 2017-07-14T21:59:15.000Z | aaem/community_data.py | gina-alaska/alaska_affordable_energy_model | 96fed0137152985ce280ea37e0affec131e3087f | [
"MIT-feh"
] | 2 | 2020-04-28T18:12:55.000Z | 2021-01-13T01:56:57.000Z | """
Community Data
--------------
Module for managing Input data for AAEM
"""
from pandas import read_csv, DataFrame
import yaml
import os.path
import numpy as np
from importlib import import_module
from aaem.defaults import base_order
from defaults import base_structure, base_comments
from diagnostics import Di... | 33.992248 | 96 | 0.544812 | 1,392 | 13,155 | 5.03592 | 0.201149 | 0.027389 | 0.024251 | 0.015692 | 0.300285 | 0.219258 | 0.184879 | 0.177461 | 0.13923 | 0.122967 | 0 | 0.002691 | 0.378563 | 13,155 | 386 | 97 | 34.080311 | 0.854801 | 0.103231 | 0 | 0.214286 | 0 | 0 | 0.110956 | 0 | 0 | 0 | 0 | 0.002591 | 0 | 0 | null | null | 0.02381 | 0.089286 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f695edd1b8fb0baaa47a5ad9e63209b8f7b09072 | 1,446 | py | Python | tests/conftest.py | costrouc/dftfit | a00354f8f0d611bf57c6925f920c749d8628cf98 | [
"MIT"
] | 27 | 2016-08-10T18:55:40.000Z | 2021-08-03T08:43:21.000Z | tests/conftest.py | costrouc/dftfit | a00354f8f0d611bf57c6925f920c749d8628cf98 | [
"MIT"
] | null | null | null | tests/conftest.py | costrouc/dftfit | a00354f8f0d611bf57c6925f920c749d8628cf98 | [
"MIT"
] | 9 | 2018-08-26T14:40:14.000Z | 2021-09-19T06:12:56.000Z | import pathlib
import pytest
import pymatgen as pmg
from pymatgen.io.cif import CifParser
from dftfit.potential import Potential
from dftfit.training import Training
@pytest.fixture
def structure():
def f(filename, conventional=True, oxidized=False):
filename = pathlib.Path(filename)
if not file... | 27.283019 | 92 | 0.669433 | 188 | 1,446 | 5.085106 | 0.367021 | 0.054393 | 0.066946 | 0.062762 | 0.176778 | 0 | 0 | 0 | 0 | 0 | 0 | 0.023979 | 0.2213 | 1,446 | 52 | 93 | 27.807692 | 0.825044 | 0 | 0 | 0.179487 | 0 | 0 | 0.078147 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.179487 | false | 0 | 0.153846 | 0.051282 | 0.512821 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
f69a10000600baaad3b78ec6a130f836b09d1333 | 7,678 | py | Python | src/wheezy/validation/tests/test_model.py | akornatskyy/wheezy.validation | 73b8e1887afd367dc83d3face923fb42755ff6e8 | [
"MIT"
] | null | null | null | src/wheezy/validation/tests/test_model.py | akornatskyy/wheezy.validation | 73b8e1887afd367dc83d3face923fb42755ff6e8 | [
"MIT"
] | 21 | 2020-07-18T04:33:44.000Z | 2021-07-06T09:42:35.000Z | src/wheezy/validation/tests/test_model.py | akornatskyy/wheezy.validation | 73b8e1887afd367dc83d3face923fb42755ff6e8 | [
"MIT"
] | null | null | null | """ Unit tests for ``wheezy.validation.model``.
"""
import unittest
from datetime import date, datetime, time
from decimal import Decimal
from wheezy.validation.model import (
bool_value_provider,
boolean_true_values,
bytes_value_provider,
date_value_provider,
datetime_value_provider,
float_va... | 28.973585 | 79 | 0.561995 | 985 | 7,678 | 4.259898 | 0.137056 | 0.114633 | 0.042898 | 0.046711 | 0.481649 | 0.413489 | 0.36511 | 0.303623 | 0.287417 | 0.253098 | 0 | 0.069416 | 0.302032 | 7,678 | 264 | 80 | 29.083333 | 0.713566 | 0.127377 | 0 | 0.259669 | 0 | 0 | 0.073174 | 0.005432 | 0 | 0 | 0 | 0 | 0.513812 | 1 | 0.127072 | false | 0 | 0.027624 | 0.049724 | 0.259669 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f69ac81bcb255de38cad8c6f5b568d23cf710106 | 5,009 | py | Python | source/pydwf/core/auxiliary/typespec_ctypes.py | sidneycadot/pydwf | cd9eba8b45d990f09095bec62b20115f0757baba | [
"MIT"
] | 14 | 2021-05-10T16:19:45.000Z | 2022-03-13T08:30:12.000Z | source/pydwf/core/auxiliary/typespec_ctypes.py | sidneycadot/pydwf | cd9eba8b45d990f09095bec62b20115f0757baba | [
"MIT"
] | 22 | 2021-05-01T09:51:09.000Z | 2021-11-13T12:35:36.000Z | source/pydwf/core/auxiliary/typespec_ctypes.py | sidneycadot/pydwf | cd9eba8b45d990f09095bec62b20115f0757baba | [
"MIT"
] | 2 | 2021-05-02T12:13:16.000Z | 2022-03-11T21:15:07.000Z | """This module provides the :py:class:`typespec_ctypes` class.
It is used to map the C types found in the 'dwf.h' header file to specific *ctypes* types.
"""
import ctypes
class typespec_ctypes:
"""Map the type specifications from :py:mod:`pydwf.core.auxiliary.dwf_function_signatures` to *ctypes* types."""
... | 39.753968 | 116 | 0.548014 | 444 | 5,009 | 5.878378 | 0.247748 | 0.103448 | 0.171648 | 0.052107 | 0.06705 | 0 | 0 | 0 | 0 | 0 | 0 | 0.006727 | 0.406468 | 5,009 | 125 | 117 | 40.072 | 0.871174 | 0.113596 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.014286 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
f69c3a51af898f4e22123310c8bc23902722176b | 1,491 | py | Python | src/sound.py | bramvonk/blind-dialer | 1f093b550eff54b3e453919e93618959aa40ebfb | [
"MIT"
] | null | null | null | src/sound.py | bramvonk/blind-dialer | 1f093b550eff54b3e453919e93618959aa40ebfb | [
"MIT"
] | null | null | null | src/sound.py | bramvonk/blind-dialer | 1f093b550eff54b3e453919e93618959aa40ebfb | [
"MIT"
] | null | null | null | import sys
import pygame.mixer
from pygame.mixer import Sound
if sys.platform == "win32":
# workaround in windows: windows won't play sounds if pygame.init() has been called (which we need for joystick to
# work), but you can work around this bug by opening a window...
# see http://stackoverflow.com/quest... | 33.886364 | 118 | 0.668008 | 199 | 1,491 | 4.819095 | 0.417085 | 0.081335 | 0.12513 | 0.156413 | 0.275287 | 0.164755 | 0.10219 | 0.10219 | 0.10219 | 0.10219 | 0 | 0.022867 | 0.237425 | 1,491 | 43 | 119 | 34.674419 | 0.82058 | 0.16499 | 0 | 0.125 | 0 | 0 | 0.091861 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.09375 | null | null | 0.09375 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f6ad4cad79a5ed93e745ef695c2648996c5e8e18 | 222 | py | Python | schimpy/bound_linear.py | CADWRDeltaModeling/schimpy | 55b4cda524205dce64d5cfa0c86e9edd8cfacaa5 | [
"MIT"
] | 4 | 2020-09-23T14:09:50.000Z | 2022-01-07T21:29:25.000Z | schimpy/bound_linear.py | CADWRDeltaModeling/schimpy | 55b4cda524205dce64d5cfa0c86e9edd8cfacaa5 | [
"MIT"
] | null | null | null | schimpy/bound_linear.py | CADWRDeltaModeling/schimpy | 55b4cda524205dce64d5cfa0c86e9edd8cfacaa5 | [
"MIT"
] | 4 | 2020-10-29T23:32:16.000Z | 2021-11-01T18:21:34.000Z | import numpy as np
def bound_linear(z,z_low,z_high,val_low,val_high):
z0 = val_low + (val_high - val_low) * (z - z_low) / (z_high - z_low)
z0 = np.maximum(z0,val_low)
z0 = np.minimum(z0,val_high)
return z0 | 37 | 72 | 0.662162 | 44 | 222 | 3.045455 | 0.340909 | 0.179104 | 0.074627 | 0.089552 | 0.149254 | 0 | 0 | 0 | 0 | 0 | 0 | 0.033898 | 0.202703 | 222 | 6 | 73 | 37 | 0.723164 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | false | 0 | 0.166667 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f6b5d5a9eff46b642398be59da1e7463c3f5bd86 | 5,304 | py | Python | src/python/pants/base/hash_utils_test.py | rcuza/pants | 0429258b181986eed856ae45af93b776727774a0 | [
"Apache-2.0"
] | 1 | 2021-02-22T18:11:26.000Z | 2021-02-22T18:11:26.000Z | src/python/pants/base/hash_utils_test.py | rcuza/pants | 0429258b181986eed856ae45af93b776727774a0 | [
"Apache-2.0"
] | 13 | 2022-02-18T22:52:57.000Z | 2022-03-30T10:11:29.000Z | src/python/pants/base/hash_utils_test.py | rcuza/pants | 0429258b181986eed856ae45af93b776727774a0 | [
"Apache-2.0"
] | 4 | 2021-06-18T09:11:27.000Z | 2021-09-30T08:38:43.000Z | # Copyright 2014 Pants project contributors (see CONTRIBUTORS.md).
# Licensed under the Apache License, Version 2.0 (see LICENSE).
import hashlib
import json
import re
import unittest
from collections import OrderedDict
from enum import Enum
from pants.base.hash_utils import CoercingEncoder, hash_all, json_hash
from ... | 45.333333 | 99 | 0.665158 | 580 | 5,304 | 5.851724 | 0.217241 | 0.159104 | 0.10607 | 0.123159 | 0.510607 | 0.464054 | 0.406305 | 0.38244 | 0.358574 | 0.296111 | 0 | 0.109753 | 0.182315 | 5,304 | 116 | 100 | 45.724138 | 0.672815 | 0.062971 | 0 | 0.147727 | 0 | 0 | 0.215067 | 0.137708 | 0 | 0 | 0 | 0 | 0.443182 | 1 | 0.170455 | false | 0 | 0.090909 | 0.011364 | 0.318182 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f6c506759d4e56ef08c9ab2b66b99df6fd3b4e69 | 1,124 | py | Python | tests/fixtures/user.py | ascii-dev/flight-booking | 3a64951f91d0254402bc5c14e5ef6d1bd2cf372e | [
"MIT"
] | null | null | null | tests/fixtures/user.py | ascii-dev/flight-booking | 3a64951f91d0254402bc5c14e5ef6d1bd2cf372e | [
"MIT"
] | 30 | 2019-05-26T09:39:12.000Z | 2021-06-02T00:16:58.000Z | tests/fixtures/user.py | ascii-dev/flight-booking | 3a64951f91d0254402bc5c14e5ef6d1bd2cf372e | [
"MIT"
] | null | null | null | import pytest
from faker import Faker
from api.models import User
fake = Faker()
@pytest.fixture(scope='module')
def new_user(app, init_db):
"""
Fixture to create a new user
:param app: app instance
:param init_db: fixture to initialize the db
:return: a new user instance
"""
params = {... | 22.938776 | 51 | 0.588968 | 127 | 1,124 | 5.102362 | 0.370079 | 0.037037 | 0.080247 | 0.092593 | 0.530864 | 0.530864 | 0.438272 | 0.438272 | 0.351852 | 0.197531 | 0 | 0 | 0.281139 | 1,124 | 48 | 52 | 23.416667 | 0.80198 | 0.228648 | 0 | 0.344828 | 0 | 0 | 0.323892 | 0.071429 | 0 | 0 | 0 | 0 | 0 | 1 | 0.068966 | false | 0.137931 | 0.103448 | 0 | 0.241379 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
f6d11d7b81f982dbe52ec3312366cbc4e7ac2e9d | 17,449 | py | Python | ececompiler/optimizer.py | ajalt/eece6083-compiler | 32d58b17a18f201ac0160fd60a8bd032905f46e1 | [
"MIT"
] | 1 | 2019-02-16T21:42:12.000Z | 2019-02-16T21:42:12.000Z | ececompiler/optimizer.py | ajalt/eece6083-compiler | 32d58b17a18f201ac0160fd60a8bd032905f46e1 | [
"MIT"
] | null | null | null | ececompiler/optimizer.py | ajalt/eece6083-compiler | 32d58b17a18f201ac0160fd60a8bd032905f46e1 | [
"MIT"
] | 2 | 2017-10-25T14:20:01.000Z | 2021-04-12T15:20:37.000Z | '''Perform optimizations on an AST.
The optimize_tree function is the main interface to the optimizer, which will
optimize an AST in place. The function can optimize at two different levels.
Level 1: Minimal optimization is performed.
Level 2: More extensive optimization is performed that may produce code tha... | 38.603982 | 117 | 0.56519 | 2,022 | 17,449 | 4.788328 | 0.186449 | 0.028816 | 0.01477 | 0.018591 | 0.297356 | 0.201198 | 0.173001 | 0.138504 | 0.138504 | 0.127556 | 0 | 0.00268 | 0.358359 | 17,449 | 451 | 118 | 38.689579 | 0.862094 | 0.115594 | 0 | 0.461039 | 0 | 0 | 0.022851 | 0 | 0 | 0 | 0.000767 | 0 | 0 | 0 | null | null | 0.003247 | 0.022727 | null | null | 0.022727 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f6e08d887e456ba17010a7f45bf1609d0c1bed49 | 548 | py | Python | setup.py | matthewdowney/bip32utils | dd9c541767a2a8ff60c7868c9f4b03277fabb8ba | [
"MIT"
] | 1 | 2019-01-05T12:19:14.000Z | 2019-01-05T12:19:14.000Z | setup.py | matthewdowney/bip32utils | dd9c541767a2a8ff60c7868c9f4b03277fabb8ba | [
"MIT"
] | null | null | null | setup.py | matthewdowney/bip32utils | dd9c541767a2a8ff60c7868c9f4b03277fabb8ba | [
"MIT"
] | 3 | 2021-04-10T21:59:48.000Z | 2021-11-05T18:34:09.000Z | #!/usr/bin/env python
from setuptools import setup
setup(
name = 'bip32utils',
version = '0.3-3',
author = 'Johnathan Corgan, Corgan Labs',
author_email = 'johnathan@corganlabs.com',
maintainer = 'Pavol Rusnak',
maintainer_email = 'stick@gk2.sk',
url = 'http://github.com/prusnak/bip32utils... | 28.842105 | 109 | 0.666058 | 59 | 548 | 6.135593 | 0.830508 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.036281 | 0.195255 | 548 | 18 | 110 | 30.444444 | 0.784581 | 0.036496 | 0 | 0 | 0 | 0 | 0.459203 | 0.045541 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.066667 | 0 | 0.066667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f6e374ef0955d22def63bfc0fae7757f50ca75be | 5,767 | py | Python | pyedgeconnect/orch/_action_log.py | SPOpenSource/edgeconnect-python | 158aad220f8cacfa029df41b0ac2a37f7dac943f | [
"MIT"
] | 15 | 2021-07-02T17:09:13.000Z | 2022-02-08T17:06:51.000Z | pyedgeconnect/orch/_action_log.py | SPOpenSource/edgeconnect-python | 158aad220f8cacfa029df41b0ac2a37f7dac943f | [
"MIT"
] | null | null | null | pyedgeconnect/orch/_action_log.py | SPOpenSource/edgeconnect-python | 158aad220f8cacfa029df41b0ac2a37f7dac943f | [
"MIT"
] | 4 | 2021-07-16T00:05:24.000Z | 2022-03-26T02:04:17.000Z | # MIT License
# (C) Copyright 2021 Hewlett Packard Enterprise Development LP.
#
# actionLog : Get Action/Audit Logs
def get_audit_log(
self,
start_time: int,
end_time: int,
limit: int,
log_level: int = 1,
ne_pk: str = None,
username: str = None,
) -> list:
"""Get audit log details filt... | 36.04375 | 73 | 0.596844 | 697 | 5,767 | 4.885222 | 0.238164 | 0.032305 | 0.05815 | 0.052863 | 0.700441 | 0.690455 | 0.690455 | 0.672247 | 0.672247 | 0.64699 | 0 | 0.004212 | 0.300156 | 5,767 | 159 | 74 | 36.27044 | 0.839445 | 0.784984 | 0 | 0.259259 | 0 | 0 | 0.15198 | 0.120051 | 0 | 0 | 0 | 0 | 0 | 1 | 0.111111 | false | 0 | 0 | 0 | 0.222222 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f6e4b9b7d60aa2487a0e7f2eb4b4ce6389246746 | 1,480 | py | Python | app/__init__.py | zyt4321/EdgeDeepLearning | feeeff2c37358f64676187f0ee36b7e1c353458c | [
"MIT"
] | null | null | null | app/__init__.py | zyt4321/EdgeDeepLearning | feeeff2c37358f64676187f0ee36b7e1c353458c | [
"MIT"
] | null | null | null | app/__init__.py | zyt4321/EdgeDeepLearning | feeeff2c37358f64676187f0ee36b7e1c353458c | [
"MIT"
] | null | null | null | import os
from flask import Flask, current_app, send_file, request, current_app, session, abort
from flask_sqlalchemy import SQLAlchemy
from sqlalchemy import create_engine
from sqlalchemy_utils import database_exists, create_database
from flask_socketio import SocketIO
from flask_cors import CORS
import hashlib
impor... | 28.461538 | 113 | 0.783784 | 211 | 1,480 | 5.2891 | 0.42654 | 0.032258 | 0.016129 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.000751 | 0.1 | 1,480 | 51 | 114 | 29.019608 | 0.837087 | 0.031081 | 0 | 0 | 0 | 0.027027 | 0.10077 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.027027 | false | 0.027027 | 0.324324 | 0 | 0.378378 | 0.027027 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
f6e4da1651d93964d76d8398c2dcb82984d4f64e | 1,288 | py | Python | trees/python/inorder.py | amit-upadhyay-IT/proton | 5a817cc12bfb26277b6542342a9f10bf629d34e9 | [
"Apache-2.0"
] | null | null | null | trees/python/inorder.py | amit-upadhyay-IT/proton | 5a817cc12bfb26277b6542342a9f10bf629d34e9 | [
"Apache-2.0"
] | null | null | null | trees/python/inorder.py | amit-upadhyay-IT/proton | 5a817cc12bfb26277b6542342a9f10bf629d34e9 | [
"Apache-2.0"
] | null | null | null | import bst
# here I am using list as stack
'''
the idea here is about printing the left most node first, i.e. we can store the
root.left node in the stack until we are finding the root.left in not None.Then
the last node which got inserted needs to be printed, so we just need a pop for
that. Next we can print the pa... | 23.418182 | 79 | 0.608696 | 188 | 1,288 | 4.085106 | 0.462766 | 0.085938 | 0.104167 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.001135 | 0.315994 | 1,288 | 54 | 80 | 23.851852 | 0.870602 | 0.031056 | 0 | 0.117647 | 0 | 0 | 0.093394 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.029412 | null | null | 0.176471 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f6ece6eabefa0c1c02ecefe82c05d9bc22960a0f | 807 | py | Python | crear_base.py | taw-desarrollo-plataformas-web/EjemploSqlAlchemy-02 | 316764ea6e57b88f3ace6b69aa1ec2414161c989 | [
"MIT"
] | null | null | null | crear_base.py | taw-desarrollo-plataformas-web/EjemploSqlAlchemy-02 | 316764ea6e57b88f3ace6b69aa1ec2414161c989 | [
"MIT"
] | null | null | null | crear_base.py | taw-desarrollo-plataformas-web/EjemploSqlAlchemy-02 | 316764ea6e57b88f3ace6b69aa1ec2414161c989 | [
"MIT"
] | null | null | null | from sqlalchemy import create_engine
# se genera en enlace al gestor de base de
# datos
# para el ejemplo se usa la base de datos
# sqlite
engine = create_engine('sqlite:///demobase.db')
from sqlalchemy.ext.declarative import declarative_base
Base = declarative_base()
from sqlalchemy import Column, Integer, String
... | 23.735294 | 77 | 0.649318 | 97 | 807 | 5.257732 | 0.546392 | 0.082353 | 0.078431 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.266419 | 807 | 33 | 78 | 24.454545 | 0.861486 | 0.154895 | 0 | 0 | 0 | 0 | 0.102374 | 0.031157 | 0 | 0 | 0 | 0 | 0 | 1 | 0.058824 | false | 0 | 0.176471 | 0.058824 | 0.647059 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
f6f18cfca1f5bcc29d0783ec562d698d486cbc7f | 2,048 | py | Python | train.py | bonny2016/keras-text-generation | 1e6213b31df4c42f65eeaaf40e734baacf884467 | [
"MIT"
] | null | null | null | train.py | bonny2016/keras-text-generation | 1e6213b31df4c42f65eeaaf40e734baacf884467 | [
"MIT"
] | null | null | null | train.py | bonny2016/keras-text-generation | 1e6213b31df4c42f65eeaaf40e734baacf884467 | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
from argparse import ArgumentParser, ArgumentDefaultsHelpFormatter
from model import MetaModel, save
def main():
parser = ArgumentParser(formatter_class=ArgumentDefaultsHelpFormatter)
parser.add_argument('--data-dir', type=str, default='data/corona',
help='dat... | 45.511111 | 87 | 0.608887 | 243 | 2,048 | 5.016461 | 0.382716 | 0.09598 | 0.181296 | 0.062346 | 0.07219 | 0.039377 | 0 | 0 | 0 | 0 | 0 | 0.009927 | 0.262207 | 2,048 | 44 | 88 | 46.545455 | 0.796823 | 0.010254 | 0 | 0 | 0 | 0 | 0.32 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.027778 | false | 0 | 0.055556 | 0 | 0.083333 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f6f437bbb416dd8d72c65e4a2ed3b36a3c0d1536 | 2,358 | py | Python | NanoCount/__main__.py | a-slide/nano_count | 40080e0d199b3f4b5616c338eddefdd028e4cfe3 | [
"MIT"
] | 21 | 2018-08-01T09:08:29.000Z | 2022-03-17T07:05:03.000Z | NanoCount/__main__.py | a-slide/nano_count | 40080e0d199b3f4b5616c338eddefdd028e4cfe3 | [
"MIT"
] | 9 | 2018-09-04T15:32:46.000Z | 2021-12-06T03:38:01.000Z | NanoCount/__main__.py | a-slide/nano_count | 40080e0d199b3f4b5616c338eddefdd028e4cfe3 | [
"MIT"
] | 4 | 2019-02-07T17:38:32.000Z | 2021-05-15T03:37:41.000Z | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
# ~~~~~~~~~~~~~~IMPORTS~~~~~~~~~~~~~~ #
# Standard library imports
import argparse
# Local imports
import NanoCount as pkg
from NanoCount.NanoCount import NanoCount as nc
from NanoCount.common import *
# ~~~~~~~~~~~~~~MAIN PARSER ENTRY POINT~~~~~~~~~~~~~~ #
def main(... | 44.490566 | 110 | 0.731552 | 359 | 2,358 | 4.423398 | 0.295265 | 0.128463 | 0.130982 | 0.191436 | 0.443325 | 0.443325 | 0.430101 | 0.430101 | 0.430101 | 0.430101 | 0 | 0.001917 | 0.114928 | 2,358 | 52 | 111 | 45.346154 | 0.758984 | 0.106446 | 0 | 0 | 0 | 0 | 0.159828 | 0.022424 | 0 | 0 | 0 | 0 | 0 | 1 | 0.033333 | false | 0 | 0.133333 | 0 | 0.166667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f6f97aecba849386953f2c7746b639ede745ed56 | 2,344 | py | Python | Backend/src/SBKGatewayPopulator/sbk_gateway_populator.py | TensorIoT/sbk | 0ec176a1a459686d79a74af1c5aded6d9c20c881 | [
"MIT"
] | null | null | null | Backend/src/SBKGatewayPopulator/sbk_gateway_populator.py | TensorIoT/sbk | 0ec176a1a459686d79a74af1c5aded6d9c20c881 | [
"MIT"
] | null | null | null | Backend/src/SBKGatewayPopulator/sbk_gateway_populator.py | TensorIoT/sbk | 0ec176a1a459686d79a74af1c5aded6d9c20c881 | [
"MIT"
] | null | null | null | import boto3
from botocore.exceptions import ClientError
import time
import json
import os
import decimal
from boto3.dynamodb.conditions import Key, Attr
from datetime import datetime
from datetime import timedelta
dynamodb = boto3.resource('dynamodb')
sbk_device_list_table = dynamodb.Table(os.environ['SBKDeviceListT... | 37.806452 | 119 | 0.642065 | 270 | 2,344 | 5.374074 | 0.318519 | 0.055134 | 0.049621 | 0.055134 | 0.326671 | 0.272226 | 0.228119 | 0.15162 | 0.15162 | 0.088215 | 0 | 0.005068 | 0.242321 | 2,344 | 62 | 120 | 37.806452 | 0.811937 | 0.005973 | 0 | 0.188679 | 0 | 0 | 0.174324 | 0.042508 | 0 | 0 | 0 | 0.016129 | 0 | 1 | 0.018868 | false | 0 | 0.169811 | 0 | 0.226415 | 0.113208 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
f6fa17687ec0a8efa18a70a8d826492a9e49f6ad | 292 | py | Python | src/attack_surface_pypy/core/exceptions/timeout.py | ccrvs/attack_surface_pypy | f2bc9998cf42f4764f1c495e6243d970e01bd176 | [
"CC0-1.0"
] | null | null | null | src/attack_surface_pypy/core/exceptions/timeout.py | ccrvs/attack_surface_pypy | f2bc9998cf42f4764f1c495e6243d970e01bd176 | [
"CC0-1.0"
] | null | null | null | src/attack_surface_pypy/core/exceptions/timeout.py | ccrvs/attack_surface_pypy | f2bc9998cf42f4764f1c495e6243d970e01bd176 | [
"CC0-1.0"
] | null | null | null | import typing
from attack_surface_pypy.core import exceptions
class TimeoutExceededError(exceptions.BaseError):
_template = "The timeout has exceeded in %s seconds."
def __init__(self, message: typing.Union[int, float]) -> None:
super().__init__(self._template % message)
| 26.545455 | 66 | 0.743151 | 35 | 292 | 5.857143 | 0.8 | 0.078049 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.160959 | 292 | 10 | 67 | 29.2 | 0.836735 | 0 | 0 | 0 | 0 | 0 | 0.133562 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | false | 0 | 0.333333 | 0 | 0.833333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
f6fcc8caf48450d0203191ffd87f7bc05cc8bfea | 541 | py | Python | Lesson1/readjsonyaml.py | petereh/pyneteng | 3dd548ca699be857a8ceb89cb5ddf8349411c0ef | [
"Apache-2.0"
] | null | null | null | Lesson1/readjsonyaml.py | petereh/pyneteng | 3dd548ca699be857a8ceb89cb5ddf8349411c0ef | [
"Apache-2.0"
] | null | null | null | Lesson1/readjsonyaml.py | petereh/pyneteng | 3dd548ca699be857a8ceb89cb5ddf8349411c0ef | [
"Apache-2.0"
] | null | null | null | #! /usr/bin/env python
import yaml
import json
from pprint import pprint
def output_format(my_list, my_str):
'''
Make the output format easier to read
'''
print '\n\n'
print '#' * 3
print '#' * 3 + my_str
print '#' * 3
pprint(my_list)
def main() :
with open ('myyaml.yaml') as f ... | 18.033333 | 41 | 0.561922 | 74 | 541 | 3.905405 | 0.472973 | 0.16609 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.018519 | 0.301294 | 541 | 29 | 42 | 18.655172 | 0.746032 | 0.038817 | 0 | 0.111111 | 0 | 0 | 0.096774 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.166667 | null | null | 0.333333 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1000aab98fc1240832217603ded38b97ca5686a2 | 680 | py | Python | tests/selenium_site/forms.py | Aviah/django-selenium-page-objects | 21c45f4a578f7714fd9accc86c7fa0657570125f | [
"MIT"
] | null | null | null | tests/selenium_site/forms.py | Aviah/django-selenium-page-objects | 21c45f4a578f7714fd9accc86c7fa0657570125f | [
"MIT"
] | null | null | null | tests/selenium_site/forms.py | Aviah/django-selenium-page-objects | 21c45f4a578f7714fd9accc86c7fa0657570125f | [
"MIT"
] | null | null | null | from ..selenium_page_objects import forms_base,forms_html
class ExampleForm(forms_base.WebFormById):
"""define forms by site context: sign-in form, sign-up form, edit item form, etc
use WebFormById or WebFormByClass"""
def __init__(self,*args,**kwargs):
"""call super with the form element_id a... | 26.153846 | 84 | 0.595588 | 80 | 680 | 4.825 | 0.5875 | 0.11658 | 0.067358 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.311765 | 680 | 26 | 85 | 26.153846 | 0.824786 | 0.313235 | 0 | 0 | 0 | 0 | 0.033482 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.125 | 0 | 0.625 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
100184ef361a089a3b63fe06c7de785f8ce0bc69 | 21,507 | py | Python | gelato/gelato/views.py | forfrt/Gelato | fde9cde624658d7168ce56e3606ee9749ad84ac2 | [
"Apache-2.0"
] | null | null | null | gelato/gelato/views.py | forfrt/Gelato | fde9cde624658d7168ce56e3606ee9749ad84ac2 | [
"Apache-2.0"
] | null | null | null | gelato/gelato/views.py | forfrt/Gelato | fde9cde624658d7168ce56e3606ee9749ad84ac2 | [
"Apache-2.0"
] | null | null | null | import json
import random
import string
from gelato import models
from gelato.forms import *
from django.views import View
from django.template import loader
from django.shortcuts import render
from django.shortcuts import HttpResponse
from django.views.generic.edit import FormView
from django.core.mail import EmailMu... | 44.43595 | 272 | 0.641326 | 2,410 | 21,507 | 5.56971 | 0.104979 | 0.041123 | 0.065112 | 0.019817 | 0.684646 | 0.623855 | 0.575803 | 0.526261 | 0.434627 | 0.393355 | 0 | 0.007756 | 0.23862 | 21,507 | 483 | 273 | 44.52795 | 0.811969 | 0.078254 | 0 | 0.454802 | 0 | 0 | 0.114218 | 0.015017 | 0 | 0 | 0 | 0.00207 | 0 | 1 | 0.079096 | false | 0.110169 | 0.031073 | 0.00565 | 0.268362 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
1003c385a22b3a4b775b5e479c95061bfab72646 | 2,362 | py | Python | flask_python_arango/__init__.py | zvfvrv/flask-python-arango | f682d6c27641858b3c8d41b36e30d1e5094f6f78 | [
"Apache-2.0"
] | 1 | 2020-08-06T17:46:44.000Z | 2020-08-06T17:46:44.000Z | flask_python_arango/__init__.py | zvfvrv/flask-python-arango | f682d6c27641858b3c8d41b36e30d1e5094f6f78 | [
"Apache-2.0"
] | null | null | null | flask_python_arango/__init__.py | zvfvrv/flask-python-arango | f682d6c27641858b3c8d41b36e30d1e5094f6f78 | [
"Apache-2.0"
] | null | null | null | # Copyright 2020 Francesco Lombardo <franclombardo@gmail.com>
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
# http://www.apache.org/licenses/LICENSE-2.0
# Unless requ... | 33.742857 | 84 | 0.650296 | 313 | 2,362 | 4.779553 | 0.405751 | 0.032754 | 0.036765 | 0.042781 | 0.135027 | 0.070856 | 0.045455 | 0.045455 | 0 | 0 | 0 | 0.00464 | 0.27011 | 2,362 | 69 | 85 | 34.231884 | 0.863109 | 0.383997 | 0 | 0.108108 | 0 | 0 | 0.128079 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.135135 | false | 0.054054 | 0.054054 | 0 | 0.27027 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
1003ff7fb904268dcf8fb6a6dd985f21a3da9cbd | 423 | py | Python | spritesheet.py | dom-k/make-moose-move-out | 3c9b98b6e23c8801e90c8b2fe82e128a6f305cf2 | [
"MIT"
] | null | null | null | spritesheet.py | dom-k/make-moose-move-out | 3c9b98b6e23c8801e90c8b2fe82e128a6f305cf2 | [
"MIT"
] | null | null | null | spritesheet.py | dom-k/make-moose-move-out | 3c9b98b6e23c8801e90c8b2fe82e128a6f305cf2 | [
"MIT"
] | null | null | null | import pygame as pg
from settings import BLACK
vec2 = pg.math.Vector2
class Spritesheet:
def __init__(self, filename):
self.spritesheet = pg.image.load(filename).convert()
def get_image(self, pos, size):
""" Grab an image out of the spritesheet. """
image = pg.Surface(size)
ima... | 28.2 | 60 | 0.64539 | 56 | 423 | 4.767857 | 0.589286 | 0.11236 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.012461 | 0.241135 | 423 | 14 | 61 | 30.214286 | 0.819315 | 0.08747 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.181818 | false | 0 | 0.181818 | 0 | 0.545455 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
1004e2593234319646346f1655f0c97d19932539 | 1,441 | py | Python | courses/python/mflac/tests/test_functional.py | tank1st99/securitygym | 2e4fbdf8002afbe51648706906f0db2c294362a6 | [
"MIT"
] | 49 | 2021-05-20T12:49:28.000Z | 2022-03-13T11:35:03.000Z | courses/python/mflac/tests/test_functional.py | tank1st99/securitygym | 2e4fbdf8002afbe51648706906f0db2c294362a6 | [
"MIT"
] | null | null | null | courses/python/mflac/tests/test_functional.py | tank1st99/securitygym | 2e4fbdf8002afbe51648706906f0db2c294362a6 | [
"MIT"
] | 5 | 2021-05-20T12:58:34.000Z | 2021-12-05T19:08:13.000Z | import pytest
from mflac.tests.base_mflac import BaseMFLACTest
import uuid
from random import randint
class TestAdminPanelFunctional(BaseMFLACTest):
def admin_users_list(self, app, client, auth):
for _ in range(randint(1, 3)):
admin_username = str(uuid.uuid4())
admin_password = st... | 46.483871 | 99 | 0.675226 | 182 | 1,441 | 5.087912 | 0.296703 | 0.064795 | 0.090713 | 0.058315 | 0.406048 | 0.406048 | 0.153348 | 0.153348 | 0 | 0 | 0 | 0.008189 | 0.237335 | 1,441 | 30 | 100 | 48.033333 | 0.834395 | 0 | 0 | 0.08 | 0 | 0 | 0.121443 | 0 | 0 | 0 | 0 | 0 | 0.08 | 1 | 0.12 | false | 0.2 | 0.16 | 0 | 0.4 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
1009152719c09da858fe42e502093a036899eeb4 | 4,785 | py | Python | tests/description/match_counter_test.py | centre-for-humanities-computing/danish-foundation-models | 1cc0950fab55650fd92f56b4bad0b13a5be73061 | [
"MIT"
] | 8 | 2021-12-10T08:37:55.000Z | 2022-02-08T14:42:01.000Z | tests/description/match_counter_test.py | centre-for-humanities-computing/danish-foundation-models | 1cc0950fab55650fd92f56b4bad0b13a5be73061 | [
"MIT"
] | 47 | 2021-12-12T14:41:31.000Z | 2022-03-31T08:57:56.000Z | tests/description/match_counter_test.py | centre-for-humanities-computing/danish-foundation-models | 1cc0950fab55650fd92f56b4bad0b13a5be73061 | [
"MIT"
] | null | null | null | import pytest
import spacy
from dfm.description import MatchCounter
class TestMatchCounter:
@pytest.fixture(scope="class")
def texts(self):
texts = [
"Der kom en soldat marcherende hen ad landevejen: én, to! én, to! Han havde sit tornyster på ryggen og en sabel ved siden, for han havde vær... | 33.697183 | 189 | 0.617764 | 595 | 4,785 | 4.751261 | 0.280672 | 0.03219 | 0.038203 | 0.048815 | 0.22745 | 0.124867 | 0.124867 | 0.114255 | 0.10329 | 0.032543 | 0 | 0.008664 | 0.252247 | 4,785 | 141 | 190 | 33.93617 | 0.781442 | 0.032184 | 0 | 0.117021 | 0 | 0.031915 | 0.209252 | 0 | 0 | 0 | 0 | 0 | 0.138298 | 1 | 0.202128 | false | 0 | 0.042553 | 0.042553 | 0.319149 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
100cada11270b558d4e10efaa33a05b3308ed025 | 3,360 | py | Python | TransferLearningGame.py | LotusWhu/tradaboost | 788382ff1ec6ebe87e2713b2c28b6ee5fcdc5cf0 | [
"MIT"
] | 5 | 2019-01-17T11:38:03.000Z | 2019-01-17T11:38:14.000Z | TransferLearningGame.py | LotusWhu/tradaboost | 788382ff1ec6ebe87e2713b2c28b6ee5fcdc5cf0 | [
"MIT"
] | null | null | null | TransferLearningGame.py | LotusWhu/tradaboost | 788382ff1ec6ebe87e2713b2c28b6ee5fcdc5cf0 | [
"MIT"
] | 1 | 2021-07-22T06:32:24.000Z | 2021-07-22T06:32:24.000Z | # cody by chenchiwei
# -*- coding: UTF-8 -*-
import pandas as pd
from sklearn import preprocessing
from sklearn import decomposition
import TrAdaBoost as tr
from sklearn.ensemble import AdaBoostClassifier
from sklearn.tree import DecisionTreeClassifier
from sklearn import svm
from sklearn import feature_selection
from ... | 33.939394 | 118 | 0.750298 | 579 | 3,360 | 4.055268 | 0.195164 | 0.042589 | 0.057496 | 0.020443 | 0.420358 | 0.303663 | 0.261073 | 0.261073 | 0.221891 | 0.199744 | 0 | 0.020318 | 0.121131 | 3,360 | 98 | 119 | 34.285714 | 0.774805 | 0.274702 | 0 | 0.037736 | 0 | 0 | 0.091663 | 0.058067 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.207547 | null | null | 0.075472 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
100daf002828f9e63dfded1067095d51f4c0a4a2 | 616 | py | Python | chatty/sessions/echo.py | hosford42/Chatty | e69bd922038367968d46fbef6f2fa5218d19e3d4 | [
"MIT"
] | null | null | null | chatty/sessions/echo.py | hosford42/Chatty | e69bd922038367968d46fbef6f2fa5218d19e3d4 | [
"MIT"
] | null | null | null | chatty/sessions/echo.py | hosford42/Chatty | e69bd922038367968d46fbef6f2fa5218d19e3d4 | [
"MIT"
] | 1 | 2022-01-08T19:50:38.000Z | 2022-01-08T19:50:38.000Z | import time
from chatty.sessions.interface import Session
from chatty.signals.interface import Signal
class EchoSession(Session):
"""
A session which simply echos any signal it is asked to send back to its own bots.
"""
def __init__(self):
super().__init__()
self._alive = True
d... | 22 | 85 | 0.607143 | 77 | 616 | 4.714286 | 0.545455 | 0.07438 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.002326 | 0.301948 | 616 | 27 | 86 | 22.814815 | 0.84186 | 0.131494 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.235294 | false | 0 | 0.176471 | 0 | 0.470588 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
10117385e576b70f3d52efb73968bc21c13f410c | 833 | py | Python | arcproject/scripts/load_data_bulk/add_manual_wqp.py | ucd-cws/arcproject-wq-processing | 8bc4df31420f1a37f66e40f1867bf4082c4871c0 | [
"MIT"
] | 2 | 2018-07-11T19:45:59.000Z | 2018-07-11T19:47:00.000Z | arcproject/scripts/load_data_bulk/add_manual_wqp.py | ucd-cws/arcproject-wq-processing | 8bc4df31420f1a37f66e40f1867bf4082c4871c0 | [
"MIT"
] | 55 | 2016-08-09T00:35:22.000Z | 2017-04-22T05:21:22.000Z | arcproject/scripts/load_data_bulk/add_manual_wqp.py | ucd-cws/arcproject-wq-processing | 8bc4df31420f1a37f66e40f1867bf4082c4871c0 | [
"MIT"
] | 1 | 2021-11-12T20:22:44.000Z | 2021-11-12T20:22:44.000Z | from arcproject.waterquality import classes
import os
import csv
# path to csv file
path = csv_path = os.path.join(os.path.dirname(os.path.abspath(__file__)), 'wqp_avgs.csv')
# # loop through rows of csv and add row to new remap objects
# f = open(csv_path)
# csv_f = csv.reader(f)
# header = next(csv_f, None)... | 33.32 | 104 | 0.683073 | 132 | 833 | 4.068182 | 0.515152 | 0.052142 | 0.055866 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.007485 | 0.198079 | 833 | 25 | 104 | 33.32 | 0.796407 | 0.414166 | 0 | 0 | 0 | 0 | 0.058166 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
1015a5d7dbe3fbe3ca472e3217a76cc7d1895393 | 2,497 | py | Python | kb_learning/kernel/_distances.py | gregorgebhardt/kb_learning | 41e18c1238e0ea891d48aff63588366dae64e4c8 | [
"BSD-3-Clause"
] | null | null | null | kb_learning/kernel/_distances.py | gregorgebhardt/kb_learning | 41e18c1238e0ea891d48aff63588366dae64e4c8 | [
"BSD-3-Clause"
] | null | null | null | kb_learning/kernel/_distances.py | gregorgebhardt/kb_learning | 41e18c1238e0ea891d48aff63588366dae64e4c8 | [
"BSD-3-Clause"
] | null | null | null | import numpy as np
from sklearn.metrics.pairwise import pairwise_distances
class MahaDist:
def __init__(self, bandwidth_factor=1.0):
self.bandwidth = 1.
if type(bandwidth_factor) in [float, int]:
self.bandwidth_factor = bandwidth_factor
elif type(bandwidth_factor) in [list, tu... | 27.744444 | 98 | 0.622747 | 296 | 2,497 | 5.006757 | 0.243243 | 0.166667 | 0.076923 | 0.075574 | 0.580972 | 0.403509 | 0.403509 | 0.403509 | 0.403509 | 0.403509 | 0 | 0.007731 | 0.27473 | 2,497 | 89 | 99 | 28.05618 | 0.810602 | 0 | 0 | 0.461538 | 0 | 0 | 0.00841 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.215385 | false | 0 | 0.061538 | 0.076923 | 0.476923 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
101a8058bfea37907dd79c2b0ab31c6c02d23751 | 1,622 | py | Python | saas/multischema/management/commands/generatedata.py | allanlei/django-saas | 4540ae57c6ad57020f24ba8e1f6c91d90f2dd7ca | [
"BSD-3-Clause"
] | 1 | 2016-04-13T07:48:11.000Z | 2016-04-13T07:48:11.000Z | saas/multischema/management/commands/generatedata.py | allanlei/django-saas | 4540ae57c6ad57020f24ba8e1f6c91d90f2dd7ca | [
"BSD-3-Clause"
] | null | null | null | saas/multischema/management/commands/generatedata.py | allanlei/django-saas | 4540ae57c6ad57020f24ba8e1f6c91d90f2dd7ca | [
"BSD-3-Clause"
] | null | null | null | from optparse import make_option
from django.core.management.base import BaseCommand
from django.conf import settings
from appschema.models import Schema
try:
from dilla.management.commands import run_dilla
except ImportError, err:
print 'Dilla not found. (Hint: you need to be running development settings)'
... | 42.684211 | 139 | 0.648582 | 186 | 1,622 | 5.586022 | 0.424731 | 0.038499 | 0.043311 | 0.040423 | 0.119346 | 0.071222 | 0 | 0 | 0 | 0 | 0 | 0 | 0.247842 | 1,622 | 37 | 140 | 43.837838 | 0.851639 | 0 | 0 | 0 | 0 | 0 | 0.181874 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.181818 | null | null | 0.030303 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
63d7b58750869ce679d012172932a4439b1ebc20 | 8,580 | py | Python | usaspending_api/recipient/migrations/0001_initial.py | g4brielvs/usaspending-api | bae7da2c204937ec1cdf75c052405b13145728d5 | [
"CC0-1.0"
] | 217 | 2016-11-03T17:09:53.000Z | 2022-03-10T04:17:54.000Z | usaspending_api/recipient/migrations/0001_initial.py | g4brielvs/usaspending-api | bae7da2c204937ec1cdf75c052405b13145728d5 | [
"CC0-1.0"
] | 622 | 2016-09-02T19:18:23.000Z | 2022-03-29T17:11:01.000Z | usaspending_api/recipient/migrations/0001_initial.py | g4brielvs/usaspending-api | bae7da2c204937ec1cdf75c052405b13145728d5 | [
"CC0-1.0"
] | 93 | 2016-09-07T20:28:57.000Z | 2022-02-25T00:25:27.000Z | # -*- coding: utf-8 -*-
# Generated by Django 1.11.4 on 2018-05-11 00:51
from __future__ import unicode_literals
import django.contrib.postgres.fields
import django.contrib.postgres.indexes
import partial_index
from django.contrib.postgres.operations import TrigramExtension
from django.db import migrations, models
... | 51.686747 | 177 | 0.594755 | 861 | 8,580 | 5.702671 | 0.196283 | 0.137475 | 0.063544 | 0.069246 | 0.601629 | 0.548473 | 0.459674 | 0.359267 | 0.329124 | 0.297352 | 0 | 0.015028 | 0.270979 | 8,580 | 165 | 178 | 52 | 0.769944 | 0.007925 | 0 | 0.378205 | 1 | 0 | 0.197203 | 0.065813 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.038462 | 0 | 0.064103 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
63dd5f55f68e498ee007420eafce19dbc03fb5c6 | 8,192 | py | Python | pyfluminus/tests/test_module.py | Vantablack/pyfluminus | e9c4a1897fd98da7b94d11f2a30ca195fac3621b | [
"MIT"
] | 7 | 2020-02-05T17:13:31.000Z | 2022-01-08T07:37:13.000Z | pyfluminus/tests/test_module.py | Vantablack/pyfluminus | e9c4a1897fd98da7b94d11f2a30ca195fac3621b | [
"MIT"
] | 9 | 2020-01-24T16:13:27.000Z | 2022-01-10T04:26:28.000Z | pyfluminus/tests/test_module.py | Vantablack/pyfluminus | e9c4a1897fd98da7b94d11f2a30ca195fac3621b | [
"MIT"
] | 5 | 2020-01-23T23:02:14.000Z | 2022-01-14T11:57:31.000Z | import unittest
from unittest.mock import patch
import os, shutil
from dateutil.parser import parse
from nose.tools import assert_dict_contains_subset, assert_list_equal, assert_true
from pyfluminus.tests.mock_server import MOCK_CONSTANTS
from pyfluminus.structs import Module, File, Lesson
from pyfluminus import api
... | 55.351351 | 1,677 | 0.657593 | 864 | 8,192 | 6.15162 | 0.436343 | 0.005644 | 0.024083 | 0.030103 | 0.152775 | 0.152775 | 0.132079 | 0.117027 | 0.100847 | 0.04666 | 0 | 0.106268 | 0.252197 | 8,192 | 147 | 1,678 | 55.727891 | 0.761345 | 0.015137 | 0 | 0.218045 | 0 | 0.022556 | 0.531498 | 0.233011 | 0 | 0 | 0 | 0 | 0.075188 | 1 | 0.030075 | false | 0 | 0.067669 | 0 | 0.105263 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
63df611ddef88a899fd36b77df791082c13c0a00 | 2,930 | py | Python | src/examples/mip_test_sound.py | xtofl/mip | d1d3544e276cd9fd462ade3bf15933b3f2d6166e | [
"MIT"
] | 14 | 2015-02-05T19:30:46.000Z | 2020-12-16T21:21:00.000Z | src/examples/mip_test_sound.py | xtofl/mip | d1d3544e276cd9fd462ade3bf15933b3f2d6166e | [
"MIT"
] | 3 | 2015-02-28T11:40:35.000Z | 2018-11-16T04:46:13.000Z | src/examples/mip_test_sound.py | xtofl/mip | d1d3544e276cd9fd462ade3bf15933b3f2d6166e | [
"MIT"
] | 12 | 2015-01-09T15:02:05.000Z | 2021-05-08T15:16:57.000Z | #!/usr/bin/env python
"""
MiP Sound tester.
To Use:
mip_test_sound.py -i hci0 -b D0:39:72:C4:7A:01 -s <n>
<n> 1 - 106
1 = beep
2 = burp
3 = ewwp - ah
4 = la la la la (lower)
5 = small raspberry?
6 = rerrr
7 = punching sound
8 = punching sound
9 = harder punching sound
10 = lep
11 = lep
12 = lep
13 = lep
14 = ahhh! (in... | 21.703704 | 71 | 0.664846 | 513 | 2,930 | 3.77193 | 0.588694 | 0.020672 | 0.021705 | 0.016537 | 0.111628 | 0.102326 | 0.070284 | 0.032041 | 0.032041 | 0.032041 | 0 | 0.10322 | 0.22628 | 2,930 | 134 | 72 | 21.865672 | 0.750331 | 0.84198 | 0 | 0 | 0 | 0 | 0.171806 | 0 | 0 | 0 | 0.008811 | 0 | 0 | 1 | 0 | false | 0 | 0.142857 | 0 | 0.142857 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
63e4f323646ed59ca64b26ff465c87092e7a19e0 | 1,718 | py | Python | 33_Search_in_rotated_sorted_array.py | SreenathMopuri/LeetcodeProblemSolutionsInPython | 8268d55224e6865a5e423f2315d64d84a94bdac6 | [
"MIT"
] | null | null | null | 33_Search_in_rotated_sorted_array.py | SreenathMopuri/LeetcodeProblemSolutionsInPython | 8268d55224e6865a5e423f2315d64d84a94bdac6 | [
"MIT"
] | null | null | null | 33_Search_in_rotated_sorted_array.py | SreenathMopuri/LeetcodeProblemSolutionsInPython | 8268d55224e6865a5e423f2315d64d84a94bdac6 | [
"MIT"
] | null | null | null | # Search in rotated sorted array
"""
at most two sorted halfs, mid will be apart of left sorted or right sorted, if target is in range of sorted portion then search it, otherwise search other half
leetcode link: https://leetcode.com/problems/search-in-rotated-sorted-array/
"""
C++
---
class Solution {
public:
int s... | 28.163934 | 159 | 0.413271 | 197 | 1,718 | 3.604061 | 0.269036 | 0.140845 | 0.101408 | 0.126761 | 0.560563 | 0.487324 | 0.487324 | 0.48169 | 0.48169 | 0.48169 | 0 | 0.017857 | 0.478463 | 1,718 | 60 | 160 | 28.633333 | 0.774554 | 0.041327 | 0 | 0.297872 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
63e9950b63b79bd40287dd03739d1e928fbd9279 | 363 | py | Python | src/snippets/Condition tree/Python/condTree.py | Matej-Chmel/syntax-comparison | 532ee6b97912164067d9fbfa5510b72ab9894913 | [
"CC0-1.0"
] | null | null | null | src/snippets/Condition tree/Python/condTree.py | Matej-Chmel/syntax-comparison | 532ee6b97912164067d9fbfa5510b72ab9894913 | [
"CC0-1.0"
] | null | null | null | src/snippets/Condition tree/Python/condTree.py | Matej-Chmel/syntax-comparison | 532ee6b97912164067d9fbfa5510b72ab9894913 | [
"CC0-1.0"
] | null | null | null | def compare(a: int, b: int):
printNums(a, b)
if a > b:
msg = "a > b"
a += 1
elif a < b:
msg = "a < b"
b += 1
else:
msg = "a == b"
a += 1
b += 1
print(msg)
printNums(a, b)
print()
def printNums(a, b):
print(f"{a = }, {b = }")
def main():
for a in range(1, 4):
for b in range(1, 4):
compare... | 12.517241 | 28 | 0.484848 | 68 | 363 | 2.470588 | 0.279412 | 0.119048 | 0.196429 | 0.071429 | 0.136905 | 0 | 0 | 0 | 0 | 0 | 0 | 0.031496 | 0.300275 | 363 | 28 | 29 | 12.964286 | 0.629921 | 0 | 0 | 0.26087 | 0 | 0 | 0.104683 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.130435 | false | 0 | 0 | 0 | 0.130435 | 0.26087 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
63eba4b446b533df0ca36a4f6932f44f65ebaa51 | 616 | py | Python | scripts/create_db_revision.py | lexicalunit/spellbot | 17a4999d5e1def06246727ac5481230aa4a4557d | [
"MIT"
] | 13 | 2020-07-03T01:20:54.000Z | 2021-11-22T06:06:21.000Z | scripts/create_db_revision.py | lexicalunit/spellbot | 17a4999d5e1def06246727ac5481230aa4a4557d | [
"MIT"
] | 660 | 2020-06-26T02:52:18.000Z | 2022-03-31T14:14:02.000Z | scripts/create_db_revision.py | lexicalunit/spellbot | 17a4999d5e1def06246727ac5481230aa4a4557d | [
"MIT"
] | 3 | 2020-07-12T06:18:39.000Z | 2021-06-22T06:54:47.000Z | #!/usr/bin/env python3
import sys
from os.path import dirname, realpath
from pathlib import Path
import alembic
import alembic.command
import alembic.config
SRC_ROOT = Path(dirname(realpath(__file__))).parent
SPELLBOT_DIR = SRC_ROOT / "src" / "spellbot"
MIGRATIONS_DIR = SPELLBOT_DIR / "migrations"
ALEMBIC_INI = MIGR... | 26.782609 | 68 | 0.787338 | 87 | 616 | 5.367816 | 0.436782 | 0.083512 | 0.055675 | 0.08137 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005396 | 0.097403 | 616 | 22 | 69 | 28 | 0.834532 | 0.034091 | 0 | 0 | 0 | 0 | 0.102694 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.375 | 0 | 0.375 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
63f2c1c4830288d7bf102bb3362e1559fad1fd96 | 519 | py | Python | 1_PythonDataProcessing/7_22_casestudy_part1.py | hnwarid/DQLabAcademy | e03d82f97536ae103b6abc65db0ae16520fb68c7 | [
"MIT"
] | null | null | null | 1_PythonDataProcessing/7_22_casestudy_part1.py | hnwarid/DQLabAcademy | e03d82f97536ae103b6abc65db0ae16520fb68c7 | [
"MIT"
] | null | null | null | 1_PythonDataProcessing/7_22_casestudy_part1.py | hnwarid/DQLabAcademy | e03d82f97536ae103b6abc65db0ae16520fb68c7 | [
"MIT"
] | null | null | null | #import library
import pandas as pd
# Baca data 'ecommerce_banner_promo.csv'
data = pd.read_csv('https://storage.googleapis.com/dqlab-dataset/pythonTutorial/ecommerce_banner_promo.csv')
#1. Data eksplorasi dengan head(), info(), describe(), shape
print("\n[1] Data eksplorasi dengan head(), info(), describe(), shape")... | 32.4375 | 108 | 0.749518 | 71 | 519 | 5.408451 | 0.478873 | 0.09375 | 0.125 | 0.119792 | 0.244792 | 0.244792 | 0.244792 | 0.244792 | 0.244792 | 0 | 0 | 0.004211 | 0.084778 | 519 | 16 | 109 | 32.4375 | 0.804211 | 0.2158 | 0 | 0 | 0 | 0 | 0.562963 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.090909 | 0 | 0.090909 | 0.818182 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 |
63f580c89e0698ccc46b613818248abe1a3e36d3 | 901 | py | Python | discovery-provider/src/utils/redis_constants.py | atticwip/audius-protocol | 9758e849fae01508fa1d27675741228b11533e6e | [
"Apache-2.0"
] | 429 | 2019-08-14T01:34:07.000Z | 2022-03-30T06:31:38.000Z | discovery-provider/src/utils/redis_constants.py | SNOmad1/audius-protocol | 3d5fc2bf688265eb529060f1f3234ef2b95ed231 | [
"Apache-2.0"
] | 998 | 2019-08-14T01:52:37.000Z | 2022-03-31T23:17:22.000Z | discovery-provider/src/utils/redis_constants.py | SNOmad1/audius-protocol | 3d5fc2bf688265eb529060f1f3234ef2b95ed231 | [
"Apache-2.0"
] | 73 | 2019-10-04T04:24:16.000Z | 2022-03-24T16:27:30.000Z | latest_block_redis_key = "latest_block_from_chain"
latest_block_hash_redis_key = "latest_blockhash_from_chain"
most_recent_indexed_block_redis_key = "most_recently_indexed_block_from_db"
most_recent_indexed_block_hash_redis_key = "most_recently_indexed_block_hash_from_db"
most_recent_indexed_ipld_block_redis_key = "mos... | 60.066667 | 85 | 0.896781 | 134 | 901 | 5.30597 | 0.223881 | 0.146273 | 0.14346 | 0.09564 | 0.594937 | 0.38256 | 0.202532 | 0.202532 | 0.202532 | 0.202532 | 0 | 0 | 0.046615 | 901 | 14 | 86 | 64.357143 | 0.827707 | 0 | 0 | 0 | 0 | 0 | 0.423973 | 0.423973 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
63fab513a9804e8d863e533e863a0bb09bd829d3 | 1,390 | py | Python | tests/test_fa.py | lewiuberg/visual-automata | 60f50adcf3ec1da51fed0c2be692ee75233a6f55 | [
"MIT"
] | 45 | 2021-03-19T14:14:16.000Z | 2022-03-29T11:20:53.000Z | tests/test_fa.py | lewiuberg/visual-automata | 60f50adcf3ec1da51fed0c2be692ee75233a6f55 | [
"MIT"
] | 2 | 2021-04-16T15:11:08.000Z | 2021-04-16T15:23:31.000Z | tests/test_fa.py | lewiuberg/visual-automata | 60f50adcf3ec1da51fed0c2be692ee75233a6f55 | [
"MIT"
] | 2 | 2021-03-24T11:01:54.000Z | 2021-04-24T03:10:49.000Z | """Classes and functions for testing the behavior of both and VisualNFAs."""
from visual_automata.fa.nfa import VisualNFA
class TestFA(object):
"""A test class for testing all finite automata."""
def setup(self):
"""Reset test automata before every test function."""
# NFA which matches stri... | 37.567568 | 76 | 0.58705 | 165 | 1,390 | 4.848485 | 0.363636 | 0.075 | 0.065 | 0.06 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.01194 | 0.276978 | 1,390 | 36 | 77 | 38.611111 | 0.78408 | 0.228777 | 0 | 0 | 0 | 0 | 0.027619 | 0 | 0 | 0 | 0 | 0 | 0.416667 | 1 | 0.083333 | false | 0 | 0.041667 | 0 | 0.166667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1209dd9f9cdaec415c0deff3e31b2b974555d9bd | 2,468 | py | Python | hypernets/tests/discriminators/percentile.py | BochenLv/Hypernets | 87f142804c9b56b89223fce8b641aac0d1e3c287 | [
"Apache-2.0"
] | 1 | 2021-06-05T11:10:19.000Z | 2021-06-05T11:10:19.000Z | hypernets/tests/discriminators/percentile.py | BochenLv/Hypernets | 87f142804c9b56b89223fce8b641aac0d1e3c287 | [
"Apache-2.0"
] | null | null | null | hypernets/tests/discriminators/percentile.py | BochenLv/Hypernets | 87f142804c9b56b89223fce8b641aac0d1e3c287 | [
"Apache-2.0"
] | null | null | null | # -*- coding:utf-8 -*-
__author__ = 'yangjian'
"""
"""
from hypernets.discriminators import PercentileDiscriminator, ProgressivePercentileDiscriminator
from . import history, group_id
class Test_PercentileDiscriminator():
def test_percentile(self):
d = PercentileDiscriminator(50, min_trials=5, min_step... | 37.393939 | 120 | 0.558752 | 427 | 2,468 | 3.105386 | 0.128806 | 0.072398 | 0.099548 | 0.120664 | 0.702112 | 0.653846 | 0.653846 | 0.653846 | 0.653846 | 0.653846 | 0 | 0.147962 | 0.274311 | 2,468 | 65 | 121 | 37.969231 | 0.592406 | 0.008104 | 0 | 0.340909 | 0 | 0 | 0.008203 | 0 | 0 | 0 | 0 | 0 | 0.363636 | 1 | 0.045455 | false | 0 | 0.045455 | 0 | 0.113636 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
120a65c594ca2aece198c7c8aa7f8159510cd252 | 459 | py | Python | uni_ticket/migrations/0157_auto_20201127_1106.py | biotech2021/uniTicket | 8c441eac18e67a983e158326b1c4b82f00f1f1ef | [
"Apache-2.0"
] | 15 | 2019-09-06T06:47:08.000Z | 2022-01-17T06:39:54.000Z | uni_ticket/migrations/0157_auto_20201127_1106.py | biotech2021/uniTicket | 8c441eac18e67a983e158326b1c4b82f00f1f1ef | [
"Apache-2.0"
] | 69 | 2019-09-06T12:03:19.000Z | 2022-03-26T14:30:53.000Z | uni_ticket/migrations/0157_auto_20201127_1106.py | biotech2021/uniTicket | 8c441eac18e67a983e158326b1c4b82f00f1f1ef | [
"Apache-2.0"
] | 13 | 2019-09-11T10:54:20.000Z | 2021-11-23T09:09:19.000Z | # Generated by Django 3.1.2 on 2020-11-27 10:06
from django.db import migrations
class Migration(migrations.Migration):
dependencies = [
('uni_ticket', '0156_auto_20201127_0855'),
]
operations = [
migrations.AlterModelOptions(
name='ticketcategorydefaultreply',
o... | 25.5 | 134 | 0.649237 | 45 | 459 | 6.466667 | 0.844444 | 0.075601 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.087324 | 0.22658 | 459 | 17 | 135 | 27 | 0.732394 | 0.098039 | 0 | 0 | 1 | 0 | 0.354369 | 0.118932 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.090909 | 0 | 0.363636 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
120e998ea9829158f82502c2426f4140a95b9bc0 | 1,018 | py | Python | server/app/api/auth.py | oliverepper/logbuch | 3542e8e84b5544d7a1da35411750434b373d2f6c | [
"MIT"
] | null | null | null | server/app/api/auth.py | oliverepper/logbuch | 3542e8e84b5544d7a1da35411750434b373d2f6c | [
"MIT"
] | 1 | 2021-03-09T23:49:32.000Z | 2021-03-09T23:49:32.000Z | server/app/api/auth.py | oliverepper/logbuch | 3542e8e84b5544d7a1da35411750434b373d2f6c | [
"MIT"
] | null | null | null | from flask import g
from flask_httpauth import HTTPBasicAuth, HTTPTokenAuth
from app import ApiException
from app.models import ApiToken, User
basic_auth = HTTPBasicAuth()
token_auth = HTTPTokenAuth()
@basic_auth.verify_password
def verify_password(email, password):
user = User.query.filter_by(email=email).firs... | 27.513514 | 88 | 0.760314 | 148 | 1,018 | 5.02027 | 0.331081 | 0.053836 | 0.080754 | 0.051144 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.01049 | 0.157171 | 1,018 | 36 | 89 | 28.277778 | 0.855478 | 0 | 0 | 0 | 0 | 0 | 0.108055 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.153846 | false | 0.115385 | 0.153846 | 0 | 0.423077 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
12115c1bb2aa63f84f0e40f05473910be6c7c07c | 349 | py | Python | tests/test_runner.py | akamaus/picograd | fe3a377806d3abd389a59d48981123c569c0e545 | [
"MIT"
] | null | null | null | tests/test_runner.py | akamaus/picograd | fe3a377806d3abd389a59d48981123c569c0e545 | [
"MIT"
] | null | null | null | tests/test_runner.py | akamaus/picograd | fe3a377806d3abd389a59d48981123c569c0e545 | [
"MIT"
] | null | null | null | import os.path as osp
import pytest
from run import load_config
def test_runner():
dir = osp.dirname(__file__)
cfg_path = osp.join(dir, 'configs', 'config_for_test.py')
with pytest.raises(ValueError):
load_config(cfg_path, [])
cfg = load_config(cfg_path, ['--b', "123"])
assert cfg.a ==... | 19.388889 | 61 | 0.644699 | 52 | 349 | 4.076923 | 0.557692 | 0.141509 | 0.122642 | 0.160377 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.025547 | 0.2149 | 349 | 17 | 62 | 20.529412 | 0.748175 | 0 | 0 | 0 | 0 | 0 | 0.097421 | 0 | 0 | 0 | 0 | 0 | 0.181818 | 1 | 0.090909 | false | 0 | 0.272727 | 0 | 0.363636 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
12125eb053c13d811dc4ffd9dabb600ef87c38ea | 5,232 | py | Python | tests/runtimes/local/agent_runtime_test.py | bbhunter/ostorlab | 968fe4e5b927c0cd159594c13b73f95b71150154 | [
"Apache-2.0"
] | 113 | 2022-02-21T09:30:14.000Z | 2022-03-31T21:54:26.000Z | tests/runtimes/local/agent_runtime_test.py | bbhunter/ostorlab | 968fe4e5b927c0cd159594c13b73f95b71150154 | [
"Apache-2.0"
] | 2 | 2022-02-25T10:56:55.000Z | 2022-03-24T13:08:06.000Z | tests/runtimes/local/agent_runtime_test.py | bbhunter/ostorlab | 968fe4e5b927c0cd159594c13b73f95b71150154 | [
"Apache-2.0"
] | 20 | 2022-02-28T14:25:04.000Z | 2022-03-30T23:01:11.000Z | """Unittest for agent runtime."""
import docker
from ostorlab.runtimes import definitions
from ostorlab.utils import defintions as utils_defintions
from ostorlab.agent import definitions as agent_definitions
from ostorlab.runtimes.local import agent_runtime
import ostorlab
def container_name_mock(name):
del name... | 59.454545 | 118 | 0.668769 | 525 | 5,232 | 6.409524 | 0.215238 | 0.042793 | 0.071322 | 0.06419 | 0.726895 | 0.676969 | 0.665082 | 0.639525 | 0.608618 | 0.608618 | 0 | 0.028909 | 0.239679 | 5,232 | 87 | 119 | 60.137931 | 0.816993 | 0.081422 | 0 | 0.53125 | 0 | 0 | 0.234332 | 0.147558 | 0 | 0 | 0 | 0 | 0.125 | 1 | 0.046875 | false | 0 | 0.09375 | 0 | 0.15625 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1214581b5273d3c0d088ad4070ce8663b6ffdc8e | 5,013 | py | Python | hushed_hyenas/news_list.py | RohanJnr/code-jam-5 | 40e4552b57b09ed3d81cbd47533c2483f8de3bc4 | [
"MIT"
] | 2 | 2019-07-03T18:08:24.000Z | 2019-07-03T18:27:18.000Z | hushed_hyenas/news_list.py | RohanJnr/code-jam-5 | 40e4552b57b09ed3d81cbd47533c2483f8de3bc4 | [
"MIT"
] | null | null | null | hushed_hyenas/news_list.py | RohanJnr/code-jam-5 | 40e4552b57b09ed3d81cbd47533c2483f8de3bc4 | [
"MIT"
] | null | null | null | def get_level_1_news():
news1 = 'Stars Wars movie filming is canceled due to high electrical energy used. Turns out' \
'those lasers don\'t power themselves'
news2 = 'Pink Floyd Tour canceled after first show used up the whole energy city had for' \
'the whole month. The band says they\... | 38.267176 | 100 | 0.621783 | 686 | 5,013 | 4.51895 | 0.463557 | 0.029032 | 0.017742 | 0.024516 | 0.096129 | 0.082581 | 0.075806 | 0.045806 | 0.029032 | 0.029032 | 0 | 0.039542 | 0.30381 | 5,013 | 130 | 101 | 38.561538 | 0.848711 | 0 | 0 | 0.171429 | 0 | 0 | 0.628167 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.047619 | false | 0 | 0 | 0 | 0.095238 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
121c28facdae74be0418c15f069df13139fe9ebe | 4,950 | py | Python | python/basics/enf-point-policy.py | kgbhat/nsx-t | 0b8ad23649d87fddcc4c4dd4b56fd3cdcb3fd453 | [
"BSD-2-Clause"
] | 32 | 2019-04-25T11:06:27.000Z | 2022-03-23T02:50:30.000Z | python/basics/enf-point-policy.py | kgbhat/nsx-t | 0b8ad23649d87fddcc4c4dd4b56fd3cdcb3fd453 | [
"BSD-2-Clause"
] | 14 | 2019-05-03T17:41:15.000Z | 2022-03-20T11:20:35.000Z | python/basics/enf-point-policy.py | kgbhat/nsx-t | 0b8ad23649d87fddcc4c4dd4b56fd3cdcb3fd453 | [
"BSD-2-Clause"
] | 17 | 2019-04-08T20:37:05.000Z | 2022-02-25T11:00:55.000Z | #!/usr/bin/env python
"""
NSX-T SDK Sample Code
Copyright 2017-2019 VMware, Inc. All rights reserved
The BSD-2 license (the "License") set forth below applies to all
parts of the NSX-T SDK Sample Code project. You may not use this
file except in compliance with the License.
BSD-2 License
Redistribution and use i... | 36.397059 | 105 | 0.73596 | 671 | 4,950 | 5.299553 | 0.369598 | 0.044994 | 0.029246 | 0.026997 | 0.18982 | 0.160574 | 0.111642 | 0.09252 | 0.038245 | 0.038245 | 0 | 0.004259 | 0.193535 | 4,950 | 135 | 106 | 36.666667 | 0.886523 | 0.349495 | 0 | 0.033898 | 0 | 0 | 0.168933 | 0.02577 | 0 | 0 | 0 | 0 | 0 | 1 | 0.016949 | false | 0.067797 | 0.20339 | 0 | 0.220339 | 0.169492 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
121c71a4ccbbe7db46b1139d804f2b5d4b81619c | 597 | py | Python | app/api/services/domain_criteria.py | ArenaNetworks/dto-digitalmarketplace-api | d0d58924719d889503ed112b0d5801b528b0398c | [
"MIT"
] | 6 | 2017-06-09T03:38:53.000Z | 2021-12-22T02:42:15.000Z | app/api/services/domain_criteria.py | ArenaNetworks/dto-digitalmarketplace-api | d0d58924719d889503ed112b0d5801b528b0398c | [
"MIT"
] | 47 | 2016-08-02T05:21:31.000Z | 2022-03-28T01:14:17.000Z | app/api/services/domain_criteria.py | AusDTO/dto-digitalmarketplace-api | 937843c9c01a71518cf4688b4daa55bbe7df1965 | [
"MIT"
] | 7 | 2016-09-13T13:07:18.000Z | 2021-02-17T10:16:21.000Z | from app.api.helpers import Service
from app.models import DomainCriteria
from app import db
from sqlalchemy.orm import raiseload
class DomainCriteriaService(Service):
__model__ = DomainCriteria
def __init__(self, *args, **kwargs):
super(DomainCriteriaService, self).__init__(*args, **kwargs)
def... | 27.136364 | 68 | 0.643216 | 63 | 597 | 5.777778 | 0.52381 | 0.087912 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.261307 | 597 | 21 | 69 | 28.428571 | 0.825397 | 0 | 0 | 0 | 0 | 0 | 0.001675 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.117647 | false | 0 | 0.235294 | 0 | 0.529412 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
121d1003805ecd2f0c94735af19d19a9db2edbf4 | 755 | py | Python | VisualizeApp/migrations/0003_auto_20200308_1652.py | KnownAsNob/SOStimate | 852ce9264013540af96bd95fdf6a072f35c7895c | [
"MIT"
] | null | null | null | VisualizeApp/migrations/0003_auto_20200308_1652.py | KnownAsNob/SOStimate | 852ce9264013540af96bd95fdf6a072f35c7895c | [
"MIT"
] | null | null | null | VisualizeApp/migrations/0003_auto_20200308_1652.py | KnownAsNob/SOStimate | 852ce9264013540af96bd95fdf6a072f35c7895c | [
"MIT"
] | null | null | null | # Generated by Django 3.0.3 on 2020-03-08 16:52
import django.contrib.postgres.fields.jsonb
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('VisualizeApp', '0002_auto_20200128_1845'),
]
operations = [
migrations.CreateModel(
... | 27.962963 | 114 | 0.590728 | 74 | 755 | 5.918919 | 0.675676 | 0.059361 | 0.09589 | 0.123288 | 0.146119 | 0 | 0 | 0 | 0 | 0 | 0 | 0.060998 | 0.283444 | 755 | 26 | 115 | 29.038462 | 0.748614 | 0.059603 | 0 | 0.1 | 1 | 0 | 0.112994 | 0.032486 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.1 | 0 | 0.25 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
121d8b193703358f8b42de12d7e0a0a7ccd8ad90 | 11,505 | py | Python | sympycore/calculus/algebra.py | radovankavicky/pymaclab | 21da758f64ed0b62969c9289576f677e977cfd98 | [
"Apache-2.0"
] | 96 | 2015-01-25T05:59:56.000Z | 2021-12-29T14:05:22.000Z | sympycore/calculus/algebra.py | 1zinnur9/pymaclab | 21da758f64ed0b62969c9289576f677e977cfd98 | [
"Apache-2.0"
] | 3 | 2015-12-17T19:25:46.000Z | 2018-06-19T07:05:20.000Z | sympycore/calculus/algebra.py | 1zinnur9/pymaclab | 21da758f64ed0b62969c9289576f677e977cfd98 | [
"Apache-2.0"
] | 36 | 2016-01-31T15:22:01.000Z | 2021-03-29T07:03:07.000Z | #
# Created January 2008 by Pearu Peterson
#
""" Provides Calculus class.
"""
__docformat__ = "restructuredtext"
__all__ = ['Calculus', 'I']
from ..core import classes, defined_functions
from ..utils import TERMS, str_PRODUCT, SYMBOL, NUMBER
from ..heads import APPLY, CALLABLE, TERM_COEFF, TERM_COEFF_DICT
from ..heads... | 32.684659 | 84 | 0.545937 | 1,351 | 11,505 | 4.527757 | 0.1547 | 0.02256 | 0.03008 | 0.017656 | 0.349354 | 0.295406 | 0.235246 | 0.188164 | 0.168874 | 0.150564 | 0 | 0.003392 | 0.359322 | 11,505 | 351 | 85 | 32.777778 | 0.826482 | 0.01947 | 0 | 0.338078 | 0 | 0 | 0.033619 | 0.00219 | 0 | 0 | 0 | 0.002849 | 0.007117 | 0 | null | null | 0 | 0.042705 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
12215c50800c548cf15543c096a9edb809a7432a | 200 | py | Python | 6 semester/Computer graphics/lab6.9.py | vladtsap/study | 87bc1aae4db67fdc18d5203f4e2af1dee1220ec5 | [
"MIT"
] | 1 | 2021-07-13T14:35:21.000Z | 2021-07-13T14:35:21.000Z | 6 semester/Computer graphics/lab6.9.py | vladtsap/study | 87bc1aae4db67fdc18d5203f4e2af1dee1220ec5 | [
"MIT"
] | null | null | null | 6 semester/Computer graphics/lab6.9.py | vladtsap/study | 87bc1aae4db67fdc18d5203f4e2af1dee1220ec5 | [
"MIT"
] | null | null | null | show_process = False
iterations = 500
import turtle
if not show_process:
turtle.tracer(0)
for i in range(500):
turtle.forward(i)
turtle.left(91)
turtle.update()
turtle.exitonclick()
| 11.764706 | 21 | 0.705 | 29 | 200 | 4.793103 | 0.689655 | 0.158273 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.055556 | 0.19 | 200 | 16 | 22 | 12.5 | 0.802469 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.1 | 0 | 0.1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1222164615236660376fda3342a49e4499e02d09 | 2,486 | py | Python | tests/test_client_utils.py | ServiceStack/servicestack-python | 57577d94e9c32334c9604e5881f9f96b93a0fddb | [
"BSD-3-Clause"
] | 3 | 2021-07-03T17:50:05.000Z | 2021-07-12T17:08:33.000Z | tests/test_client_utils.py | ServiceStack/servicestack-python | 57577d94e9c32334c9604e5881f9f96b93a0fddb | [
"BSD-3-Clause"
] | null | null | null | tests/test_client_utils.py | ServiceStack/servicestack-python | 57577d94e9c32334c9604e5881f9f96b93a0fddb | [
"BSD-3-Clause"
] | null | null | null | """ Test Client Utils
"""
import unittest
import re
from .dtos import *
from servicestack import to_json, qsvalue, resolve_httpmethod
@dataclass_json(letter_case=LetterCase.CAMEL, undefined=Undefined.EXCLUDE)
@dataclass
class GetLocationsResponse:
locations: Optional[List[str]] = None
# @Route("/locations")
@d... | 38.84375 | 159 | 0.619469 | 316 | 2,486 | 4.756329 | 0.287975 | 0.189621 | 0.063872 | 0.083832 | 0.27678 | 0.222222 | 0.170326 | 0.170326 | 0.170326 | 0.170326 | 0 | 0.010742 | 0.176187 | 2,486 | 63 | 160 | 39.460317 | 0.723145 | 0.015688 | 0 | 0.086957 | 0 | 0.065217 | 0.187782 | 0.117671 | 0 | 0 | 0 | 0 | 0.413043 | 1 | 0.130435 | false | 0.021739 | 0.086957 | 0.021739 | 0.304348 | 0.043478 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
122435835ff0626a4d75ae15240fe20a4ce9c30f | 550 | py | Python | desafio000.py | Darlingcris/Desafios-Python | 43dd1c9ee336482834007c515e7cf327a7c84d44 | [
"MIT"
] | null | null | null | desafio000.py | Darlingcris/Desafios-Python | 43dd1c9ee336482834007c515e7cf327a7c84d44 | [
"MIT"
] | null | null | null | desafio000.py | Darlingcris/Desafios-Python | 43dd1c9ee336482834007c515e7cf327a7c84d44 | [
"MIT"
] | null | null | null | import os
print (7+4)
print("Ola" , 5 , "!" ) # a virgula concatena texto e numero
# se usar a virgula para concatenar deve usar
# sempre a virgula dentro da funçao
print("Ola Mundo!" , "\n")
nome="Cristiane"
idade=40
peso=62.0
print("Seu nome e:",nome, "\nSua id... | 22.916667 | 78 | 0.583636 | 85 | 550 | 3.776471 | 0.447059 | 0.074766 | 0.074766 | 0.080997 | 0.286604 | 0.286604 | 0.286604 | 0.286604 | 0.286604 | 0.286604 | 0 | 0.01937 | 0.249091 | 550 | 23 | 79 | 23.913043 | 0.757869 | 0.205455 | 0 | 0.166667 | 0 | 0 | 0.37819 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.083333 | 0 | 0.083333 | 0.416667 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 |
122915a77ca1f69df5c86c9c8d817c611352d365 | 275 | py | Python | trim.py | dyuwan/SongSuggester | 835958fac1aab7fdf4329d6d4de9d85432a6e31e | [
"CC0-1.0"
] | null | null | null | trim.py | dyuwan/SongSuggester | 835958fac1aab7fdf4329d6d4de9d85432a6e31e | [
"CC0-1.0"
] | null | null | null | trim.py | dyuwan/SongSuggester | 835958fac1aab7fdf4329d6d4de9d85432a6e31e | [
"CC0-1.0"
] | null | null | null | import pandas as pd
df = pd.read_csv('/Users/dyuwan/Desktop/ARDOS Datasets/songdata.csv')
check= df['mood']==0
df_0=df[check]
df_0.to_csv('/Users/dyuwan/Downloads/happysongs.csv')
def song():
k=df.sample(1)[['artist','song', 'link']]
s=k.to_dict('list')
return s
| 27.5 | 69 | 0.68 | 48 | 275 | 3.791667 | 0.625 | 0.087912 | 0.153846 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.016393 | 0.112727 | 275 | 9 | 70 | 30.555556 | 0.729508 | 0 | 0 | 0 | 0 | 0 | 0.396364 | 0.312727 | 0 | 0 | 0 | 0 | 0 | 1 | 0.111111 | false | 0 | 0.111111 | 0 | 0.333333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
122b542bdf5e714639406d88559c25234a3c0da9 | 850 | py | Python | pyqtsocius/utilities_and_vendored/exceptions.py | Giddius/PyQt_Socius | 6d0ee2fe65e5ca181677fbcbae7f59a5c1952b74 | [
"MIT"
] | null | null | null | pyqtsocius/utilities_and_vendored/exceptions.py | Giddius/PyQt_Socius | 6d0ee2fe65e5ca181677fbcbae7f59a5c1952b74 | [
"MIT"
] | null | null | null | pyqtsocius/utilities_and_vendored/exceptions.py | Giddius/PyQt_Socius | 6d0ee2fe65e5ca181677fbcbae7f59a5c1952b74 | [
"MIT"
] | 1 | 2021-01-19T17:24:32.000Z | 2021-01-19T17:24:32.000Z |
class PyQtSociusError(Exception):
pass
class WrongInputFileTypeError(PyQtSociusError):
__module__ = 'pyqtsocius'
def __init__(self, input_file: str, expected_file_extension: str, extra_message: str = None):
self.file = input_file
self.file_ext = '.' + input_file.split('.')[-1]
s... | 34 | 146 | 0.695294 | 97 | 850 | 5.680412 | 0.391753 | 0.058076 | 0.112523 | 0.123412 | 0.15245 | 0.15245 | 0 | 0 | 0 | 0 | 0 | 0.00146 | 0.194118 | 850 | 24 | 147 | 35.416667 | 0.80292 | 0 | 0 | 0.125 | 0 | 0.0625 | 0.245283 | 0.051887 | 0 | 0 | 0 | 0 | 0 | 1 | 0.125 | false | 0.0625 | 0 | 0 | 0.4375 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
122d897d08ece1d26831d286557127ef4dffb653 | 552 | py | Python | setup.py | fiskio/icml18-jtnn | 9c6fb6c9d8170640923b830f85af7f84ac006d57 | [
"MIT"
] | null | null | null | setup.py | fiskio/icml18-jtnn | 9c6fb6c9d8170640923b830f85af7f84ac006d57 | [
"MIT"
] | null | null | null | setup.py | fiskio/icml18-jtnn | 9c6fb6c9d8170640923b830f85af7f84ac006d57 | [
"MIT"
] | 1 | 2018-11-11T14:51:28.000Z | 2018-11-11T14:51:28.000Z | from setuptools import setup
setup(name='jtnn',
version='0.1.1',
url='https://github.com/maxmed/icml18-jtnn',
license='MIT',
packages=['jtnn', 'jtnn.bo', 'jtnn.jtnn', 'jtnn.molvae', 'jtnn.molopt'],
install_requires=[
'joblib==0.12.5',
'numpy==1.15.2',
'torch=... | 25.090909 | 78 | 0.483696 | 70 | 552 | 3.757143 | 0.657143 | 0.091255 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.090439 | 0.298913 | 552 | 21 | 79 | 26.285714 | 0.589147 | 0 | 0 | 0 | 0 | 0 | 0.353261 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.05 | 0 | 0.05 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
123051bb6450958bacc1cc337eabdb00298732cc | 441 | py | Python | blogger101/app_extensions.py | kethan1/Blogger101 | 268fcb4a06b3a379a43746f494516d5032160824 | [
"MIT"
] | null | null | null | blogger101/app_extensions.py | kethan1/Blogger101 | 268fcb4a06b3a379a43746f494516d5032160824 | [
"MIT"
] | null | null | null | blogger101/app_extensions.py | kethan1/Blogger101 | 268fcb4a06b3a379a43746f494516d5032160824 | [
"MIT"
] | null | null | null | from flask_pymongo import PyMongo
from flask_compress import Compress
from flask_cors import CORS
from flask_bcrypt import Bcrypt
from itsdangerous import URLSafeTimedSerializer
mongo = PyMongo()
flask_bcrypt = Bcrypt()
flask_compress = Compress()
flask_cors = CORS(resources={"/api/*": {"origins": "*"}})
RECAPTCHA_SI... | 25.941176 | 58 | 0.800454 | 51 | 441 | 6.686275 | 0.411765 | 0.105572 | 0.111437 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.111111 | 441 | 16 | 59 | 27.5625 | 0.869898 | 0 | 0 | 0 | 0 | 0 | 0.031746 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.384615 | 0 | 0.384615 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
1233ff174d78a80f734dd30afb8fb4d848a3a4f1 | 283 | py | Python | src/big_muddy/setup.py | orwonthe/big_muddy_pi | 981e3fa5d096d93be8451beb03220be7e63751da | [
"MIT"
] | null | null | null | src/big_muddy/setup.py | orwonthe/big_muddy_pi | 981e3fa5d096d93be8451beb03220be7e63751da | [
"MIT"
] | null | null | null | src/big_muddy/setup.py | orwonthe/big_muddy_pi | 981e3fa5d096d93be8451beb03220be7e63751da | [
"MIT"
] | null | null | null | from setuptools import setup
setup(
name='bigmuddy',
version='0.1',
description='Big Muddy Railroad IO Utilities',
author='Willy Mills',
# packages=['bigmuddy'],
include_package_data=True,
install_requires=[
'click',
'RPi.GPIO',
],
)
| 18.866667 | 50 | 0.611307 | 30 | 283 | 5.666667 | 0.933333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.009434 | 0.250883 | 283 | 14 | 51 | 20.214286 | 0.792453 | 0.077739 | 0 | 0 | 0 | 0 | 0.254826 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.083333 | 0 | 0.083333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1235ad17953dc246242107280e035d215108c742 | 2,303 | py | Python | server/app/schema/analysis.py | Raphaeljunior/crux | 22ec0c19e8d416e6d0bdae6f51d33ea159a098cb | [
"BSD-3-Clause"
] | 1 | 2018-03-29T17:30:42.000Z | 2018-03-29T17:30:42.000Z | server/app/schema/analysis.py | Raphaeljunior/crux | 22ec0c19e8d416e6d0bdae6f51d33ea159a098cb | [
"BSD-3-Clause"
] | 4 | 2021-03-08T18:03:09.000Z | 2022-02-26T02:49:54.000Z | server/app/schema/analysis.py | Raphaeljunior/crux | 22ec0c19e8d416e6d0bdae6f51d33ea159a098cb | [
"BSD-3-Clause"
] | 2 | 2018-02-01T21:43:31.000Z | 2018-10-02T16:38:42.000Z | import graphene
from django.contrib.auth import get_user_model
from graphene_django import DjangoObjectType
from graphql_extensions.auth.decorators import (login_required,
staff_member_required)
from ..models import Analysis, Dataset, File, User
from .dataset import Data... | 33.376812 | 76 | 0.664351 | 244 | 2,303 | 6.172131 | 0.282787 | 0.02656 | 0.02988 | 0.02656 | 0.084993 | 0.053121 | 0.053121 | 0 | 0 | 0 | 0 | 0 | 0.242293 | 2,303 | 68 | 77 | 33.867647 | 0.863037 | 0 | 0 | 0.078431 | 0 | 0 | 0.002171 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.098039 | false | 0 | 0.137255 | 0.039216 | 0.588235 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
123eb2dcb42fe643ee9d2686a962cca26991bc2f | 1,251 | py | Python | python/aocrecs/context.py | Rotzbua/aocrecs.com | 2f03ece75e7367a99e5f36874727cd5bb90508f7 | [
"MIT"
] | 7 | 2019-10-08T09:04:48.000Z | 2021-02-06T00:05:53.000Z | python/aocrecs/context.py | happyleavesaoc/aocrecs.com | 2f03ece75e7367a99e5f36874727cd5bb90508f7 | [
"MIT"
] | 10 | 2020-01-18T22:14:09.000Z | 2021-07-31T21:43:05.000Z | python/aocrecs/context.py | happyleavesaoc/aocrecs.com | 2f03ece75e7367a99e5f36874727cd5bb90508f7 | [
"MIT"
] | 5 | 2020-05-08T11:35:14.000Z | 2022-01-16T12:41:57.000Z | """GraphQL Context."""
from aiodataloader import DataLoader
class ContextLoader(DataLoader):
"""Dataloader that provides GraphQL context."""
def __init__(self, context, func):
"""Create an instance."""
super(ContextLoader, self).__init__()
self.context = context
self.func = f... | 28.431818 | 72 | 0.620304 | 142 | 1,251 | 5.197183 | 0.359155 | 0.065041 | 0.052846 | 0.069106 | 0.138211 | 0.138211 | 0.138211 | 0.138211 | 0.138211 | 0.138211 | 0 | 0 | 0.2494 | 1,251 | 43 | 73 | 29.093023 | 0.785942 | 0.169464 | 0 | 0.086957 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.217391 | false | 0 | 0.043478 | 0 | 0.478261 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
124ca15a1cd62ace71cb52a331ee5402f3ae578a | 483 | py | Python | classroom/management/commands/create_issues.py | pizzapanther/codacation | b1c48aee0305fb55cad7fca17cf0ab63168dd9d4 | [
"MIT"
] | null | null | null | classroom/management/commands/create_issues.py | pizzapanther/codacation | b1c48aee0305fb55cad7fca17cf0ab63168dd9d4 | [
"MIT"
] | 5 | 2017-12-14T16:02:23.000Z | 2017-12-15T14:58:37.000Z | classroom/management/commands/create_issues.py | pizzapanther/codacation | b1c48aee0305fb55cad7fca17cf0ab63168dd9d4 | [
"MIT"
] | null | null | null | import logging
from django.core.management.base import BaseCommand, CommandError
from classroom.tasks import create_issues
class Command (BaseCommand):
help = 'Create Github Issues for Assignment'
def add_arguments(self, parser):
parser.add_argument('ass_id', nargs='+', type=int)
def handle(self, *args,... | 26.833333 | 65 | 0.728778 | 63 | 483 | 5.428571 | 0.619048 | 0.05848 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.163561 | 483 | 17 | 66 | 28.411765 | 0.846535 | 0 | 0 | 0 | 0 | 0 | 0.099379 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | false | 0 | 0.25 | 0 | 0.583333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.