text stringlengths 8 5.77M |
|---|
Introduction
============
Acquired immune deficiency syndrome (AIDS), is caused by the human immunodeficiency virus type 1 (HIV-1) infection. The virus damages the cell mediated immune system in the infected individuals. The Joint United Nations Programme on HIV/AIDS (UNAIDS) reported that mortality due to AIDS is more than 40 million patients to date, and prevalence of the infection is 35 million worldwide ([@b1-etm-0-0-5119]). Although drugs have been developed to control the replication of the virus and the deterioration of the disease, but so far, no treatment strategy that can completely cure AIDS due to the high endurance and mutation rate of HIV-1 virus, other factors are changed cellular immune function after infection, and inhibited apoptosis of infected cells ([@b2-etm-0-0-5119],[@b3-etm-0-0-5119]). The main target of HIV-1 is the CD4^+^ T cells of the human immune system, that is, helper T cells (Th). These cells play a significant role in assisting humoral immunity and cellular immunity ([@b4-etm-0-0-5119]).
On invasion of the body by antigen T lymphocytes after perceiving the signal activate and proliferate into effector T cells, which can play roles in immune response by releasing lymphatic factors. T cell activation is a very complex process that requires two kinds of signals from the extracellular stimulus. The first signal is a specific binding of the T cell surface receptor (TCR) to the MHC-antigen peptide complex on the surface of the antigen presenting cell (APC), and the second signal is derived from the interactions between co-stimulatory molecules in APC and corresponding receptor molecules on the surface of T cells, the two signals are both essential. CD4^+^ T cells and CD8^+^ T cells (cytotoxic T cells, Tc) can combine with MHC-II and MHC class I molecules, respectively ([@b5-etm-0-0-5119]). CD4^+^ T cells can be activated into effector T cells and memory T cells, and the former can secrete cytokine to regulate or assist the immune response ([@b6-etm-0-0-5119]).
MicroRNA is a non-coding RNA with a length of \~22 nt. In recent years, microRNA has been reported to have a role in immune response elicited by pathogenic infection ([@b7-etm-0-0-5119]). MicroRNA binds to the 3′-untranslated region (3′-UTR) of the target genes by base pairing to silence the expression of target gene at the post-transcriptional level. MicroRNAs also play an important role in regulating metabolism, cell differentiation, necrosis and cancer formation ([@b8-etm-0-0-5119]). With the development of high-throughput sequencing and computational biology, up to hundreds of microRNA families have been identified and reported, among which the miR-124 family has been shown to be able to inhibit tumorigenesis, and one of the members of miR-124 family-miR-124a can promote the differentiation of specific tissues and inhibit the expression of target gene SIRT1 (histone deacetylase), thus indirectly control the transcription factor Foxp3, so as to regulate the development and functionalization of regulatory T cells (Tregs) ([@b9-etm-0-0-5119],[@b10-etm-0-0-5119]).
The aim of this study was to investigate the role of miR-124a in the regulation of T cell activation and immunity in patients with AIDS, and to provide new insights and therapeutic targets for the diagnosis, alleviation and treatment of AIDS.
Patients and methods
====================
### Patients
The study was conducted on 15 confirmed AIDS patients (12 males and 3 females), peripheral blood samples of 15 patients with confirmed AIDS were collected. Those patients include 12 males and 3 females with an average age of of 25±4.74 years. Out of the total, 11 cases were in pre-AIDS stage and 4 cases were in symptomatic HIV infection stage. In addition, peripheral blood samples were also collected from 15 healthy people, including 12 males and 3 females with an average age of 27±5.23 years. All the patients signed the informed consent. The Ethics Committee of Qingdao No. 6 People\'s Hospital approved this study. Confidentiality agreement was also signed. Informed consents were signed by the patients and/or guardians.
### Methods
#### Materials and suppliers
PRIR-REPORT luciferase reporter vector, miR-124a mimic/control and miR-124a inhibitor/control (Ambion, New York, NY, USA); lymphocyte isolation liquid (Solarbio, New York, NY, USA); Human T Cell Nuclear Transfection kit (Lonza, Bern, Switzerland); MACSRCD4 MicroBeads (Miltenyi Biotec, Bergisch Gladbach, Germany); QuickChange Lighting Mutagenesis kit (Stratagene, La Jolla, CA, USA); TRIzol reagent, PrimeScript^®^ RT reagent kit with gDNA Eraser and SYBR^®^ Premix Ex Taq™ II (Takara Biotechnology Co., Ltd., Dalian, China); protease inhibitors and PVDF membranes (Roche Diagnostics, Basel, Switzerland); Dual-Luciferase^®^ Reporter (DLR™) Assay kit (Promega, Madison, WI, USA); ELISA kit (R&D Systems, Minneapolis, MN, USA); SIRT1, β-actin mouse monoclonal antibody, goat anti-mouse HRP antibody (Cell Signaling Technology, Inc., Boston, MA, USA); modified BCA assay kit (Sangon, Shanghai, China). All the primers were synthesized by Sangon.
#### Separation of peripheral blood monocytes (PBMs) and CD4^+^ T cells of by magnetic microBeads
The peripheral blood samples (PBS) (30 ml, heparin was added for anticoagulation) of both groups were mixed with the same volume of PBS. After adding the lymphocyte isolation liquid, capillary was used to collect the monocyte layer cells. To the cell layer 7 times volume of PBS was added, the mixture was centrifuged at low-speed for 15 min, the supernatant was discarded and 1 ml PBS was added after washing the cells to resuspend the cells. According to the instruction of MACSRCD4 MicroBeads CD4^+^ T Cell Isolation kit, CD4^+^ T cells were isolated from the monocytes. The purity of the CD4^+^ T cells was detected by flow cytometry, after that, the cells were frozen and stored at −80°C.
#### RNA extraction, reverse transcription, and RT-qPCR
The total RNA in CD4^+^ T cells was extracted and checked according to the instructions of the kit. After reverse transcription, the cDNA was used to prepare the reaction system of qRT-qPCR. The PCR reaction was performed using the CFX-96 Real-Time PCR Detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The data were processed using 2^−ΔΔCt^ method. The healthy people were used as a control and β-actin was used as the endogenous control for the PCR reaction. The primer sequences are shown in [Table I](#tI-etm-0-0-5119){ref-type="table"}.
#### Construction and transfection of dual-luciferase reporter plasmids
The 3′-UTR of SIRT1 was amplified by primer SIRT1-3′UTR-F/R using the human CD4^+^ T cell genome as a template. This region contained a potential miR-124a binding site. After gel running, the amplified product was recovered. The pMIR-REPORT luciferase reporter vector was digested with *Hind*III and *Spe*I and the target fragment was also recovered after gel running. Those two fragments were ligated together according to the instruction of the kit. After the construction of plasmid pMIR-REPORT-WT, the recombinant plasmid was transfected and the recombinant plasmid was isolated from the transfected cells to verify the transfection. In order to verify that SIRT1 is the target gene of miR-124a, it is necessary to construct SIRT1-3′-UTR mutant reporter plasmid pMIR-REPORT-MU. To do this, the SIRT1-3′-UTR of the recombinant plasmid was mutated by QuikChange Lightning Mutagenesis kit. The primers used for plasmid construction are shown in [Table I](#tI-etm-0-0-5119){ref-type="table"}.
The combination of miR-124a mimic or its control with pMIR-REPORT-WT, and the combination of miR-124a mimic or its control with pMIR-REPORT-MU were co-transfected into Jurkat cells with the intraperitoneal luciferase endogenous control plasmid pRenilla-IR, respectively. After 48 h, the cells were collected and the luciferase activity was analyzed by the dual luciferase reporter assay kit according to the instructions.
#### Western blot analysis
The total protein was extracted from CD4^+^ T cells of study and the control group. After quantification by BCA method, 50 µg protein was subjected to SDS-PAGE gel running and then transferred to PVDF membrane. The membrane was bleached and rinsed in PBST solution, after that, the membrane was blocked in block solution for 1 h. Then mouse anti-human SIRT1 and β-actin primary antibody (1:1,000) were added respectively and incubated overnight at 4°C. After washing, HRP goat anti-mouse secondary antibody (1:5,000) was added and incubated for 1 h at room temperature. Chemiluminescence reaction was performed and gray scale analysis was performed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).
#### Transfection
Human CD4^+^ T cells were cultured in T cell culture medium (10% FBS, 5% streptomycin). After collection, the cells were resuspended in transfection solution. miR-124a mimic and its control were transfected into CD4^+^ T cells of the health people, respectively, and miR-124a inhibitor and its control were transfected into CD4^+^ T cells of patients with AIDS, respectively. After 48 h, the expression levels of SIRT1 protein and cytokines were detected. All the operations of transfection were performed according to the instructions of Lonza human T cell transfection kit.
#### ELISA to detect cytokine expression levels
The levels of interferon (IFN)-γ, interleukin (IL)-10, transforming growth factor (TGF)-β, IL-2, IL-4 and IL-6 secreted by Th cells after transfection with miR-124a mimic/inhibitor were detected using to ELISA kit according to the instructions.
Statistical analysis. Statistical analysis was performed using SPSS 17.0 statistical software (SPSS, Inc., Chicago, IL, USA). All experiments were repeated three times and the data were expressed as mean ± SD. Single factor analysis of variance (ANOVA) and two-tailed t-test were performed for the comparisons between groups. P\<0.05 was considered to indicate a statistically significant difference.
Results
=======
There was no significant difference in the distribution of age and sex between the patient group and the normal group (p\>0.05)
### miR-124a is upregulated in CD4^+^ T cells of patients with AIDS
As shown in [Fig. 1](#f1-etm-0-0-5119){ref-type="fig"}, quantitative and statistical analysis of the expression of miR-124a in peripheral CD4^+^ T cells of patients with AIDS and healthy people. It showed that miR-124a was significantly (p\<0.05) upregulated in CD4^+^ T cells of patients with AIDS compared with healthy people.
### SIRT1 is the target gene of miR-124a
Based on the prediction using MicroRNA target gene prediction software (TargetScan, <http://www.targetscan.org/>) and the findings in related studies, we initially identified SIRT1 as the target gene of miR-124a. To demonstrate the direct regulatory relationship between miR-124a and SIRT1, we constructed the dual-luciferase reporter vector pMIR-REPORT-WT containing SIRT1 3′-UTR (containing the predicted miR-124a binding site). This reporter vector was co-transfected with miR-124a mimics or its negative control into Jurkat cells to detect the relative activity of the firefly luciferase.
The results of luciferase activity test ([Fig. 2](#f2-etm-0-0-5119){ref-type="fig"}) showed that the luciferase activity after miR-124a mimic and pWT co-transfection were significantly lower than that after miR-124a negative control and pWT co-transfection (p\<0.05), while miR-124a mimic and pMu co-transfection caused no significant change in luciferase activity compared with the miR-124a negative control and pMu co-transfection (p\>0.05).
### miR-124a regulated the expression of target gene SIRT1
In order to investigate the regulatory relationship between miR-124a and target gene SIRT1, we analyzed the levels of SIRT1 mRNA and protein in CD4^+^ T cells in both groups of people. As shown in [Fig. 3A and B](#f3-etm-0-0-5119){ref-type="fig"}, RT-qPCR results showed that SIRT1 mRNA levels in CD4^+^ T cells of patients with AIDS were significantly reduced compared with the healthy people, western blot results also showed that SIRT1 protein levels in CD4^+^ T cells of patients with AIDS were also significantly reduced. Therefore, miR-124a can bind to 3′-UTR of SIRT1 and inhibit its expression. In order to verify the negative regulation relationship between them, the expression levels of miR-124a and SIRT1 in 15 AIDS patients and 15 healthy people were quantitatively analyzed, and the linear regression equation was constructed, as shown in [Fig. 3C](#f3-etm-0-0-5119){ref-type="fig"}, there is a significant negative relationship between miR-124a and SIRT1 (p\<0.0001).
### The effects of miR-124a overexpression on the expression of SIRT1 and cytokine
We transfected miR-124a mimics and its negative control into CD4^+^ T cells of healthy people, respectively. RT-qPCR, western blot analysis and ELISA were used to detect the expression of SIRT1 and related cytokines at 48 h after transfection, the results are shown in [Fig. 4](#f4-etm-0-0-5119){ref-type="fig"}. [Fig. 4A and B](#f4-etm-0-0-5119){ref-type="fig"} show that the expression levels of SIRT1 mRNA and protein were significantly reduced in human CD4^+^ T cells with miR-124a overexpression compared with the negative control, which is consistent with the above mentioned experimental results. [Fig. 4C](#f4-etm-0-0-5119){ref-type="fig"} shows that the level of cytokine IFN-γ protein secreted by Th1 type CD4^+^ T cells is significantly lower than that of the negative control, while the levels of cytokines IL-10 and TGF-β secreted by Th2 type CD4^+^ T cells were significantly increased compared with the negative control, no significant changes were found in other cytokines. Our data suggest that overexpression of miR-124a can activate Th2 type CD4^+^ T cells to secrete cytokines to assist or mediate immune responses.
### The effects of miR-124a expression inhibition on the levels of SIRT1 and related cytokines
We transfected miR-124a inhibitor and its negative control into CD4^+^ T cells of patients with AIDS. The indicators were detected using the same method as described in the section 'The effects of miR-124a overexpression on the expression of SIRT1 and cytokine'. The results are shown in [Fig. 5](#f5-etm-0-0-5119){ref-type="fig"}. [Fig. 5A and B](#f5-etm-0-0-5119){ref-type="fig"} show that the expression levels of SIRT1 mRNA and protein were significantly increased in CD4^+^ T cells of patients with AIDS compared with the negative control when the expression of miR-124a was inhibited. [Fig. 5C](#f5-etm-0-0-5119){ref-type="fig"} shows that the level of cytokine IFN-γ protein secreted by Th1-type CD4^+^ T cells is significantly higher than that of negative control, whereas the levels of cytokines IL-10 and TGF-β protein mainly secreted by Th2 type CD4^+^ T cells are significantly reduced compared with the negative control, no significant changes were found in other cytokines.
Discussion
==========
Most of the previous studies on microRNAs focused on their roles in the regulation of autoimmune diseases, such as systemic lupus erythematous ([@b11-etm-0-0-5119]) and psoriasis vulgaris ([@b12-etm-0-0-5119]). Many studies have reported upregulation of immune response event of a foreign body invasion. Despite this, the recognition of intrinsic or external antigens by body\'s immune system begins with the specific binding of the MHC-antigen peptide complex on the APC surface to TCR, thereby activating T cell proliferation and differentiation to generate effector T cells, thereby secreting lymphokines to assist the regulation of cellular and humoral immunity ([@b5-etm-0-0-5119],[@b6-etm-0-0-5119]).
miR-124a is mainly expressed in the central nervous system, but miR-124a can also be temporarily and spatially expression in a variety of cells. The abnormal regulation of miR-124a expression has been shown to participate in the regulation of a variety of neurological immune diseases ([@b13-etm-0-0-5119]). Recent studies have shown that miR-124a may be involved in macrophage polarization, which can affect the occurrence of a series of diseases ([@b14-etm-0-0-5119]). In addition, miR-124 has a role in the carcinogenesis and tumorigenesis. In the study of glioma and endometrial cancer, miR-124 was found to be able to improve T cell-mediated immune clearance and inhibit tumorigenesis by inhibiting STAT3 signaling ([@b15-etm-0-0-5119],[@b16-etm-0-0-5119]). With the rapid development of bioinformatics and the refinement of the microRNA database, the target genes that microRNAs can directly act on have been able to be accurately predicted ([@b17-etm-0-0-5119]). In a recent study of neuropathic pain and anti-inflammatory processes, miR-124a and miR-155 were found to be able to inhibit the expression of target gene SIRT1, thereby activating the expression of transcription factor Foxp3, which in turn enhance the differentiation of CD4^+^ T into Tregs cells, so SIRT1 and Foxp3 play important roles in the development, differentiation, and functionalization of Tregs cells ([@b18-etm-0-0-5119]).
AIDS virus attack the most important CD4^+^ T cells in the human immune system severely reducing levels of CD4^+^ T cells during the onset of the disease, which in turn damage the immune system. The replication of HIV is faster and the survivability is high, and the process of systemic infection of this virus is usually accompanied by the formation of malignant tumors ([@b2-etm-0-0-5119]). The above experimental findings have aroused our attention. We speculated that miR-124a also had a regulatory role in AIDS possibly by regulating the expression of target genes in the process of T cell activation. We also speculated that miR-124a was involved in the cellular immune response after HIV-1 infection. To test this hypothesis, we designed and performed experiments, resulting in the following: the expression of miR-124a in CD4^+^ T cells of patients with AIDS is abnormally upregulated compared with that of healthy individuals. The upregulated miR-124a can silence the expression of target gene SIRT1 to regulate the activation of Th2 type CD4^+^ T cells, and the activated Th2 type CD4^+^ T cells can secret IL-10 and TGF-β cytokines to participate in immune response, which in turn enhance the immunity of patients.
The level of CD4^+^ T cell and the load of HIV were the main indicators for the evaluation of the progression of AIDS, so T cell activation may also be related to the virus replication level, and T cell activation and virus replication can promote each other. On the one hand, the deterioration of the disease can increased the replication rate of virus, resulting in increased production of antigen, which will provide more and stronger stimulating signals for the activation of T cells. On the other hand, the abnormal activation of T cells also provides more host cells for viral replication, which in turn accelerate viral replication ([@b19-etm-0-0-5119]). The pathogenesis of AIDS and the *in vivo* immune response are both complex processes, and it is of great value to understand the pathogenesis of AIDS from the angle of microRNA. The microRNA based studies will provide new insights for the diagnosis, alleviation and treatment of AIDS, and microRNAs can potential to be used as a new target for drug design in future ([@b20-etm-0-0-5119]).
{#f1-etm-0-0-5119}
{#f2-etm-0-0-5119}
{#f3-etm-0-0-5119}
{#f4-etm-0-0-5119}
{#f5-etm-0-0-5119}
######
The sequence of the primers used for RT-qPCR and primers used for plasmid construction.
Primers Sequence (5′-3′)
------------- -----------------------------------
miR-124a F: GTGCAGGGGTCCGAGGT
miR-124a R: AAGGCACGCGGTGAATGC
ACTB F: CAGGGCGTGATGGTGGGCA
ACTB R: CAAACATCATCTGGGTCATCTTCTC
SIRT1-3′UTR F: AAGCTTCTGTGAAACAGGAAGTAACAGACA
SIRT1-3′UTR R: ACTAGTTGGCAGTAATGGTCCTAGCTG
F, forward; R, reverse.
[^1]: Contributed equally
|
How to Spend Five Days in Japan: Kyoto
Kyoto is almost as magical as Disney World. If you only have time for one city in Japan, I would choose Kyoto over Tokyo. Also, does anyone else find it really entertaining that Tokyo and Kyoto are anagrams of eachother? No, just me? Ok.
Anyway, how I got to Kyoto was almost as awesome as Kyoto. The incredibly fast bullet trains (aka shinkansens) were out of my budget, so I decided to take an overnight bus after two days in Tokyo – worked out well, since I also saved money on accommodation! I was expecting it to be a relatively sleepless night, as most overnight bus rides are.
BUT. This was the greatest overnight bus of all time, I talk about it constantly. The seats reclined so far back I was basically lying down, each chair had a little dome that you could pull over yourself to make it feel more private, and it was totally dark and silent the whole night. I slept for over eight hours, with zero interruptions, and woke up to the extraordinary view of the Kyoto river just as we pulled up, rubbing my eyes as I peered out the window slightly disoriented.
The first thing that I did in Kyoto was have a nap. I said it was because I really wanted to try out a capsule hotel, but if I am telling the truth it is because I was lazy and also needed a shower. Side benefit – I got to try out a capsule hotel! I think I paid about $20 for a 2.5 hour stretch of time at nine hours Kyoto. I truly think that being able to rent a place to nap is the greatest idea of all time. I got to shove all my stuff in a locker and use the included toiletries and toothbrush, AND A ROBE AND PAJAMAS. Then when I got in the capsule, I could set the alarm to wake me up gradually with light, for the exact time I needed. Truly the best nap of my life.
Anyway, I am realizing this entire post has been about sleeping. Let’s talk about the actual reason you’ve come to Kyoto – sightseeing!
I was in Kyoto at one of the two best times of year. It’s a great destination year-round, but if you want to be wowed, cherry blossom season and autumn are the best times. Autumn apparently comes later to Japan than Canada, so in mid-November the beautiful colours were in full swing. Everywhere I walked the trees were almost the best attraction, and the ancient temples and shrines looked even more beautiful with the vibrant red backdrop of nature. Let’s get into where I went and what I did!
Free Walking Tour
I love doing walking tours to orient myself to a city, and this was a great one. It was the first thing I did after the aforementioned nap, and was a great way to learn about some shrine etiquette AND spot some geishas. Our guide explained the history and culture of geishas to us (they are not prostitutes!) and we got SO lucky in the Gion district, seeing multiple geishas rushing to lessons or appointments.
It was so cool, and our guide said it was the most he had ever seen in one day. This area of town itself is so historic and beautiful, and I loved wandering through it.
Philosopher’s Path and Kyoto’s Temples
I actually missed out on some of the most famous temples in Kyoto – like the Golden Temple. I honestly just wasn’t too fussed about temple after temple, even though they look beautiful. I was more in the mood for hiking and nature! However, I certainly made time for the Philosopher’s Path, which is a gorgeous 2km path leading along a canal and between some of the city’s most famous temples.
It was quite busy when I walked along, but it was a really lovely stroll, especially with the fall leaves. I ended up at Ginkaku-ji and decided I wanted to go for a hike. I sat down at a restaurant, ate some amazing ramen, and googled a hike nearby.
Daimon-Ji
This was the best thing I did in Kyoto! When I hiked, I had some extremely vague directions, but fumbled my way through it – when I just googled the hike, though, I found this site. It even has pictures, so if you save this site in advance the hike will be a BREEZE.
Anyway, the hike itself was lovely – but the atmosphere at the top was the best part. I was the only foreigner that I could see, and there were tons of families picnicking, chatting, and just enjoying their days. I found a perch and read, journalled, and people-watched to my heart’s content. And of course, had a solo photo shoot!
Let’s end this post the way it started, by talking about sleeping:
Jam Hostel Kyoto Gion
I really liked my hostel. It’s owned by a lovely woman (who speaks great English and is happy to chat) who also owns the sake bar on the bottom floor. I love hostels attached to bars; it makes it so easy to make friends and it worked out perfectly here! I sat down for a sake tasting and ten minutes a lovely British girl named Jo sat down and we started talking. We ended up going out that night together for dinner, and meeting up the next night for dinner and drinks. We had a great time trying out lots of different restaurants and bars; the food in Japan was SO good. I somehow managed to leave the country without eating any sushi, which I’m still really confused by, but everything else I ate was amazing.
One of my favorite moments in Japan came as I was walking back to my hostel, full, happy, and maybe a bit tipsy. I took a random route and ended up walking down Pontocho Alley, which is apparently known as one of the most atmospheric dining areas in Kyoto. The lanterns were lit, every bar was buzzing, and I felt very content with my life and with Kyoto. |
According to emergency dispatch, a helicopter crashed in Sevier County on Monday afternoon.
The FAA says the helicopter was a Bell 206 sightseeing helicopter that crashed at 3:30 p.m. Officials say it was destroyed by fire.
The Pigeon Forge Police Department Chief Jack Baldwin says there's not much left in the wreck scene. A fire started at the crash scene and is spreading up the mountain.
He said this is the worst helicopter crash he's ever seen.
The owner of Smoky Mountain Helicopters says five people people died in the crash. The group was on a sight-seeing ride as part of a popular tourist activity. The crash happened on Rainbow Road in Sevierville.
The first call came in at 4:15 p.m.
Emergency responders from Pigeon Forge are working the scene.
According to the Smoky Mountains Helicopters' website, the company has been offering tours of the Great Smoky Mountains National Park, Cherokee, Gatlinburg, Pigeon Forge, Sevierville and surrounding areas since 1964. |
Perioperative Nursing/LPN
Perioperative Nursing/LPN is an advanced certificate program that provides licensed practical nurses with the specialized knowledge and skill development needed to work in an operating room, ambulatory surgery centre, free standing clinic or other perioperative settings. You will receive
training in applying the nursing process to perioperative nursing, the principles and practice of aseptic technique, basic technical skills for surgical procedures, legal and ethical issues and interpersonal aspects of perioperative nursing.
This program’s theory courses are available online through distance and/or part-time continuing education. For complete program information, check the program page.
Saskatchewan Polytechnic serves 27,000 distinct students through applied learning opportunities at campuses in Moose Jaw, Prince Albert, Regina and Saskatoon, and through extensive distance education opportunities. Programs serve every economic and public service sector. As a polytechnic, the organization provides the depth of learning appropriate to employer and student need, including certificate, diploma and degree programs, and apprenticeship training. Saskatchewan Polytechnic engages in applied research, drawing on faculty expertise to support innovation by employers, and providing students the opportunity to develop critical thinking skills. |
<html>
<head>
<link rel="stylesheet" type="text/css" href="../css/c3.css">
</head>
<body>
<div id="chart"></div>
<script src="https://d3js.org/d3.v5.min.js" charset="utf-8"></script>
<script src="../js/c3.js"></script>
<script>
var chart = c3.generate({
bindto: '#chart',
data: {
columns: [
generateData(100)
],
},
zoom: {
enabled: true,
initialRange: [30, 60],
onzoomstart: function (event) {
console.log("onzoomstart", event);
},
onzoom: function (domain) {
console.log("onzoom", domain);
},
onzoomend: function (domain) {
console.log("onzoomend", domain);
},
},
subchart: { show: true }
});
function generateData(n) {
var column = ['sample'];
for (var i = 0; i < n; i++) {
column.push(Math.random() * 500);
}
return column;
}
// with subchart
setTimeout(function () {
chart.zoom([45,75]);
}, 1000);
setTimeout(function () {
chart.zoom([25,90]);
}, 2000);
setTimeout(function () {
chart.unzoom();
}, 3000);
// without subchart
setTimeout(function () {
chart.internal.config.subchart_show = false;
chart.flush();
}, 4000);
setTimeout(function () {
chart.zoom([45,75]);
}, 5000);
setTimeout(function () {
chart.zoom([25,90]);
}, 6000);
setTimeout(function () {
chart.unzoom();
}, 7000);
</script>
</body>
</html>
|
A Guide to US Privacy Law
A Guide to US Privacy Law
In a technologically driven society, it is becoming increasingly easier for information to be transferred from computer to computer, and from person to person, so the concept of privacy is always being questioned. People upload their personal information to social media websites, to chat rooms and websites. All online information that is stored online runs the risk of being accessed by other people, regardless of how much security is protecting the information. Privacy is something that should be granted to everybody, but where does privacy end and a need for legal intervention begin? To what extent is data transparency there to protect people, and to what extent is it an infringement on their human rights? Here is the big legal debate that has been circulating the US over the past couple of years…
Big data vs. privacy:
Companies across the US will have an even greater obligation to protect the personal information that is in trusted to them, regardless of how it is processed after the US internet privacy law was repealed. This means that US internet providers do not need the consent of their users to share their browsing history with third parties, government officials and advertisers.
This decision has caused mass debate up and down the United States, with arguments claiming that this decision regarding the legislation is too intrusive. In the coming years, the US is expected to elaborate on their use of big data, and capitalise on the information they find. The data and volumes we have at our fingertips is now going to being processed and actioned with practical experimentations. By 2021, it’s been estimated that the big data market will reach $66.8 billion.
Security issues:
As internet browsers and third party businesses are looking to capitalize on this, consumers and internet users are becoming much more wary of how their browsing history and data is being used, as there has been an increasing number of high profile, damaging data breaches that have been brought to light and are continuing to make the headlines. In order to protect the privacy of the user, there needs to be a balance between profit and privacy.
The House of Representatives has voted to repeal the privacy law, which offered a level of protection and anonymity to internet users. Now that this legislation has been revoked, there is no protection against the protection of an individual’s online personal data, including the location of the user and Internet Service Providers (ISP) are free to share this information with third parties.
The revoking of this legislation means that ISPs will be able to share everything from the “precise Geo location, health and financial information, information regarding children, social security numbers, browsing history and the content of communications” without prior permission for the user. Critics have warned that this will have a chilling outcome.
Concerns have also been raised about this perspective, and an industry specialist has revealed that big data distributed systems only have a single level of protection from hackers. This could result in an unregulated and unwanted breach of data in the future, as non-relational databases are actively evolving, which makes it harder for security solutions to keep up with their advancement.
So, looking forward to the future, it will be interesting to see how this information is cultivated and how it is used. Will global data transparency help to keep the world a safer place, and how will security measures be intensified to ensure that data is being used in the right way, by the right people. Unfortunately, we are currently living in the speculatory stages and only time and actions will indicate whether this change in legislation has been a positive one. |
Mozilla 'accidentally' reveals developer emails and passwords
Around 76,000 users of Mozilla's developer network have had their email addresses posted to a publicly accessible server, with 4,000 users also having their salted and hashed passwords revealed as well.
Lasting for a month beginning on June 23, a failing data sanitiser job caused the disclosure of email addresses and encrypted passwords of members of the Mozilla Developer Network.
In a blog posted over the weekend, Mozilla director of developer relations, Stormy Peters, said that 76,000 users had their email address exposed via a database dump that was accessible to the wider internet. The dump also contained 4,000 encrypted user passwords.
"As soon as we learned of it, the database dump file was removed from the server immediately, and the process that generates the dump was disabled to prevent further disclosure," said Peters. "While we have not been able to detect malicious activity on that server, we cannot be sure there wasn’t any such access."
Peters said that affected users have been notified of the breach, and for those whose password hashes were disclosed, that any similar passwords on other services be changed.
In recent weeks, Mozilla added a file reputation service to its Firefox browser, that sends a SHA-256 hash to Google's Safe Browsing Service prior to downloading a file in an effort to cut down on malware downloads.
Mozilla is currently experiencing a drawn out decline in usage of its Firefox browser, with statistics from Net Applications revealed over the weekend showing that Chrome has displaced Firefox as the second most-popular desktop browser — 20.4 percent against 15.1 percent. |
Font Families - Serif, Sans-Serif, Monospace, Script, Fantasy
Revival Revival Shirt Mueller Rock T Rock One of the easiest ways to impact the design of a Web page is with the fonts that you use. This guide will help you find the font that works best for your situation.
Sans-serif Fonts are the Basis of Your Site Sans-serif fonts are those fonts that have no "serifs": the little hooks on the end of the letters. If you've taken any print design courses you've probably been told that you should only use sans-serif for headlines. This is not true for the Web. Web pages are intended to be viewed by Web browsers on computer monitors. And computer monitors don't have as good of resolution as paper. This means that when your readers view a page of serif font on the screen, the little serifs make the text harder to read.
Always use sans-serif fonts for your Web page main copy.
Some examples of sans-serif fonts are:
•Arial •GenevaRock Mueller Revival Revival Rock Shirt T •Helvetica •Lucida Sans •Trebuchet •Verdana Verdana is a font family that was actually invented for use on the Web.
Use Serif Fonts for Print While serif fonts are hard to read online, they are perfect for print. If you have print friendly versions of your site, this is the perfect place to use serif fonts. The serifs, in print, make it easier to read, as they allow people to differentiate the letters more clearly. And because print has a higher resolution, they can be seen more clearly and don't appear to blur together.
Some examples of serif fonts are:
•Garamond •GeorgiaRock Mueller Rock Shirt Revival T Revival •New York •Times •Times New Roman Monospace is for Code Examples Even if your site isn't about computing, you can use monospace to provide instructions, give examples, or imply typewritten text. Monospace letters have the same width for each character, so they always take up the same amount of space on the page. Typewriters typically used monospace fonts.
Some examples of monospace fonts are:
•Courier •Courier New •Lucida Console •Monaco Do Not Use Fantasy or Cursive for Body Text
Use fantasy and cursive fonts in images and as headlines. Some examples of fantasy fonts are:
•CopperplateRock T Shirt Mueller Rock Revival Revival •Desdemona •Impact •Kino Impact is the font family most likely to be on Mac, Windows, and Unix machines. |
[Maternal mortality in the IMSS: an analysis from the perspective of mortality and lethality].
To assess the incidence of hospital maternal mortality in the population covered by the Mexican Institute of Social Security (IMSS) from 2000 to 2003, utilizing the rates of the main causes of morbidity and lethality, in order to gain a better understanding of this epidemiological picture. We collected information from 3,357,346 hospital deliveries and 832 maternal deaths that occurred in the medical units of the IMSS during the above-mentioned years. For the specific analysis of mortality, morbidity and lethality, deliveries and deaths with diagnoses of mild preeclampsia, severe preeclampsia, eclampsia, placenta previa, postpartum hemorrhage, chorioamnionitis and puerperal sepsis were selected, based on the criteria of International Diseases Classification, Tenth Revision. For statistical differences we used the chi(2). Maternal mortality registered a reduction of 25.1% (39 x 100,000 live births in 2000 and 29.2% in 2003). Morbidity increased by 6.6%. Morbidity and lethality caused by preeclampsia, obstetrical hemorrhages and puerperal sepsis (56.7% of the total deaths) showed a significant decrease in most cases. Specific morbidity showed no changes. We observed a decrease in the rate of hospital maternal mortality during the years of the study, linked to a reduction in lethality of these three main causes. This epidemiological picture may demonstrate the optimal quality in obstetrical care, because no reported changes in morbidity levels were registered. |
Why you need a BUMBO wheelchair
Many of you have seen photos and videos of Simeon tooling around our house in his swanky blue BUMBO-on-wheels. Call it what you want–a BUMBO wheelchair, a baby wheelchair, a souped-up-Sim-speedster–when he puts the pedal to the metal (or the rubber to the road), that thing can really fly.
I’ve received a lot of questions regarding the BUMBO wheelchair, so I thought I would take a moment to answer a few of the big ones and (if you think your child might benefit) provide some info on how you can get started building your own.
BUMBO Wheelchair FAQs:
Where did you get that thing!?: We were very lucky to find Simeon’s BW through the Spina Bifida Kids page on BabyCenter.com (this group is fantastic for newly diagnosed SB parents, by the way– highly recommended). Our BW is a hand-me-down and was built by a family in Wisconsin whose daughter outgrew it. The mom only charged us for shipping and I’ll love her forever. Score!
How old was Simeon when he started using it?: 10 months old– not even kidding. He played around with the wheels for the first three weeks or so, by the second month he figured out how to move in a straight line. Learning to turn corners and avoid obstacles took a bit longer but I would say that by 14 months he was getting around just fine. Practice helped!
Simeon at about 10 months old. First day in his BUMBO wheelchair!
Where do you use it?: Mainly inside our home or in our driveway. We also take it to friends’ houses or when we visit the out-of-town grandparents. Most folks don’t have terribly accessible homes (e.g.: lots of carpets, area rugs, tight corners,etc.) and the BW actually does MUCH better in these situations than the wheelchair. It’s more compact so it can do small spaces and, unlike the wheelchair, the wider wheels work just fine on carpet!
My child crawls a little and/or might walk with assistance someday– so why do we need one of these?: I could talk for hours about this (literally– HOURS) but I’ll try to keep it short. Most children begin crawling at 7 to 10 months old, yes? This means they are exploring, they are getting a new perspective, they are being independent, they are moving– and moving is a big stinkin’ deal. Early mobility contributes to a child’s cognitive and social development. The gap in learning between typically mobile children and kids like Simeon, who take much longer to get moving, is not small. But kids with disabilities can get wheelchairs right? Wrong– at least for a while. Most children who qualify for a wheelchair will not get one until they are two-years-old or older. That means that while other kids are crawling, cruising, and eventually walking, children with mobility issues fall further and further behind. Simeon could crawl just fine but without wheels he would have spent a year and half army crawling on his belly and missing out on important cognitive and social developments. Not cool. Even if your child will eventually walk with assistance (bracing, crutches, etc), I would consider getting your hands on a BUMBO wheelchair to help close the gap. Especially if your child has mobility issues that limit exploration of their surroundings. This is the reason that Cole Galloway started the Go Baby Go project. Our kids need to move with purpose, curiosity, and independence. Carrying them everywhere or putting them in a stroller for two years just isn’t the same.
His legs are getting pretty long for this thing. Still fits alright everywhere else. We may try to extend that foot-board in the next few months!
How do I get one for my kid?: That’s the tricky part. You have a few options. OPTION A)You could buy one. The family who first started making these things is now manufacturing them. They’re called a ZipZac and they’re great. Only problem is, they’re pricey– around $900 for the baby/toddler size. Still, it’s a great product and you could look for funding. Check out the website and read about their pricing HERE. // OPTION B) Like I did, you can ask around in spina bifida groups on Facebook or BabyCenter.com since many SB families use a BUMBO wheelchair when their kids are small. You might get lucky and find someone who is looking to sell or gift theirs. // OPTION C) You can build one. Since I am not handy myself, this option is the most intimidating to me– BUT I know a ton of folks who have done it.
Here’s where I can try to help. If you want to attempt OPTION C, it can totally be done. I’ve taken a truck load of photos featuring Simeon’s BUMBO wheelchair from various angles and added my comments on what you’re seeing. Even better, the fantastic Alva Barney graciously shared his detailed plans for building one of these contraptions. You can find the PDF files below! Good luck and get moving!
VIDEO: Sim using the tipping feature to get an item from the ground (something he can’t do in his wheelchair since he’s still so little).
Anyone considering getting one of these? How have you helped your child with mobility issues during the baby/toddler years? If you build your own BUMBO wheelchair, I would LOVE for you to share pics with me on the WDYDD Facebook page! |
Modeling of Receptor Tyrosine Kinase Signaling: Computational and Experimental Protocols.
The advent of systems biology has convincingly demonstrated that the integration of experiments and dynamic modelling is a powerful approach to understand the cellular network biology. Here we present experimental and computational protocols that are necessary for applying this integrative approach to the quantitative studies of receptor tyrosine kinase (RTK) signaling networks. Signaling by RTKs controls multiple cellular processes, including the regulation of cell survival, motility, proliferation, differentiation, glucose metabolism, and apoptosis. We describe methods of model building and training on experimentally obtained quantitative datasets, as well as experimental methods of obtaining quantitative dose-response and temporal dependencies of protein phosphorylation and activities. The presented methods make possible (1) both the fine-grained modeling of complex signaling dynamics and identification of salient, course-grained network structures (such as feedback loops) that bring about intricate dynamics, and (2) experimental validation of dynamic models. |
214 F.Supp.2d 758 (2002)
GENERAL ELECTRIC COMPANY, et al., Plaintiffs,
v.
LATIN AMERICAN IMPORTS, S.A., d/b/a LATAM, et al., Defendants.
No. CIV.A.99-92.
United States District Court, W.D. Kentucky, Louisville Division.
July 16, 2002.
*759 MEMORANDUM OPINION AND ORDER
COFFMAN, District Judge.
This matter is before the court upon GE's motion (Record No. 139) for summary judgment on LATAM's counterclaims. The court, having reviewed the record and being otherwise sufficiently advised, will grant the motion in part with regard to some of LATAM's fraud counterclaims (Counts 1, 2, 4, and 5) and deny the motion in part with regard to Count 3 (GE-DAKO). Further, the motion will be granted with regard to Counts 8-10 (alleged continuous renewal promise and MABE contract claim), denied with regard to Count 11 (promissory estoppel as to MABE), and granted with regard to Counts 12 (unjust enrichment) and 13 (Florida Franchise and Distributorship Act).
Summary judgment is appropriate when there is no genuine issue of material fact and the movant is entitled to judgment as a matter of law. Fed.R.Civ.P. 56(c); Celotex Corp. v. Catrett, 477 U.S. 317, 106 S.Ct. 2548, 91 L.Ed.2d 265 (1986). In determining whether a genuine issue of material fact exists, the court must view the evidence in the light most favorable to the nonmoving party. Adickes v. S.H. Kress & Co., 398 U.S. 144, 158-59, 90 S.Ct. 1598, 26 L.Ed.2d 142 (1970). The plain language of Rule 56 "mandates the entry of summary judgment, after adequate time for *760 discovery and upon motion, against a party who fails to make a showing sufficient to establish the existence of an element essential to that party's case, and on which that party will bear the burden of proof." Betkerur, M.D. v. Aultman Hospital Assoc., 78 F.3d 1079, 1087 (6th Cir.1996).
FACTS
In 1992, LATAM was appointed GE's appliance distributor in Peru by virtue of a written agreement which, by its terms, was non-exclusive and would terminate after two years unless renewed. The agreement was personally guaranteed on August 7, 1992, by Guillermo Gonzalez Neumann ("Gonzalez"), a citizen of Peru and a party to this lawsuit, who owns and controls both LATAM and PERUSPHERE, S.A. ("Perusphere"), LATAM's affiliate. This agreement was renewed twice; the "1994 Agreement" spanned from May of 1994 to March 31, 1996, and the "1996 Agreement" was effective from April 1, 1996 until December 31, 1998. The 1996 Agreement was not renewed after its expiration. GE contends that its relationship with LATAM unraveled due to LATAM's failure to meet sales goals and to pay for the appliances it purchased. The latter contention spawned this litigation, which GE brought to recover $214,693.57 allegedly owed it by LATAM. Additionally, GE seeks a judgment declaring that the expiration of the 1996 Agreement was effective in accordance with its terms and applicable law, that GE is not liable under or in connection with the 1996 Agreement, and that GE had no obligation to sign a new distributorship agreement with LATAM.
LATAM paints a different picture of the facts, and has counterclaimed in several counts. It cites the breadth of its relationship with GE, which, it contends, had it serving as GE's representative or distributor for other divisions of the corporation, including GE Power Systems, GE Lighting, and GE Information Systems ("GEIS"). LATAM also disputes GE's proffered reasons for refusing to renew its distributorship agreement, citing deposition testimony from GE credit representatives indicating that they were not involved in the decision not to renew LATAM's distributorship contract (though acknowledging that LATAM was problematic as to credit issues). LATAM also discusses, in detail, documents which it contends reveal GE's long-standing plan to eliminate independent distributors and replace them with distribution through its affiliate, MABE. These documents include those relating to GE Appliances ("GEA") "Session I" meetings, which were held annually at GE's corporate headquarters in Connecticut. LATAM also cites the deposition testimony of former GEA vice-president Steven Riedel regarding the presentation, at these meetings, of the concept of GE's need to invest in entities and thereby acquire existing distribution mechanisms. (Riedel denied that this was synonymous with a plan or strategy to "do away" with independent distributors, such as LATAM.) LATAM cites other documents which, it argues, confirm that implementation of a plan to eliminate independent distributors began in Central America in 1994, and that GE studied (1) how to keep these independent distributors' profit margins, (2) the likelihood that various independent distributors would sue if terminated, and (3) the costs of terminating the independents.
LATAM also contends that, while GE was beginning to implement this alleged plan to eliminate independent distributors, it was intentionally deceptive in its dealings with them. LATAM cites a speech made by former GEA president Stonesifer in which he referred to the independent distributors as "partners" who held a "solid *761 relationship" with GE, which would be further strengthened. LATAM and Gonzalez also aver that, in August of 1995, Bob Reid (General Manager of GEA Affiliates) wrote to LATAM assuring Gonzalez that MABE would not be authorized to distribute GE products in Peru an assurance which was repeated by other GE representatives.[1] LATAM contends that, in reliance on these assurances, it renewed its distribution contract with GE on July 25, 1996 (the "1996 Agreement"). However, Gonzalez and LATAM argue, the assurances were false when given, as indicated by various documents LATAM contends reveal GE's intent, all along, to eliminate it as a distributor and replace it with GE's affiliate, MABE, as well as the progressive implementation of this plan. LATAM further alleges that, close in time to the expiration of (and refusal to renew) its distributorship agreement, GE set about terminating its other relationships with LATAM, and took other actions intended to cripple LATAM, which led to its various counterclaims. GE seeks summary judgment on all of these counter-claims.
COUNTS 1-5: THE FRAUD COUNTERCLAIMS
LATAM's fraud counterclaims are primarily based on two alleged misrepresentations: (1) that GE would continue its relationship with LATAM unless and until LATAM's conduct gave good cause for termination; and (2) that GE would not allow MABE to distribute GE products in Peru. Counts 1 and 2 are styled "Fraud in the Inducement" and claim that GE induced LATAM to enter the contracts embodying their distributorship relationship using the misrepresentation that LATAM would not be terminated (or its contract not renewed) except for cause.[2] Count 3 is styled "Fraud in the Inducement (GEDAKO)", and alleges that in July, 1997, GE misrepresented to Gonzalez and LATAM that LATAM would be awarded the exclusive long-term distributorship of GEDAKO[3] in Peru if LATAM agreed to invest monies for infrastructure and purchase a certain amount of merchandise. Count 4 charges fraud in a scheme to disable Gonzalez and LATAM economically (by GE's allegedly failing to disclose that it would not maintain its relationship with LATAM and taking steps to ensure that LATAM would be economically disabled when GE appropriated the market for MABE); Count 5 charges a conspiracy to defraud among GE, GEIS and MABE.
"To prevail on a claim of fraud under Florida law,[4] the plaintiff must establish the following elements: (1) a false representation as to a material fact, (2) the *762 defendant actually knew or should have known that the representation was false, or that the defendant made the representation recklessly without knowledge as to its truth or falsity, (3) the plaintiff reasonably and actually relied upon the representations, (4) the plaintiff incurred foreseeable damages, (5) caused by the defendant's representations." Tew v. Chase Manhattan Bank, N.A., 728 F.Supp. 1551, 1564 (S.D.Fla.1990). GE contends that a variety of basic legal tenets warrant summary judgment on LATAM's fraud claims, including: (1) the statute of frauds; (2) a lack of reasonable reliance (because the alleged misrepresentations contradict the subsequent written contract); (3) the economic loss rule; (4) the rule that promises of future performance are not actionable as fraud; and (5) principles of waiver, release and ratification. We find the economic loss rule to be dispositive as to all of the fraud claims except Count 3.
The economic loss rule provides that absent a tort independent of breach of contract, the remedy for a party's economic loss lies in contract law. In Hotels of Key Largo, Inc. v. RHI Hotels, Inc., 694 So.2d 74 (Fla.Dist.Ct.App.1997), hotel franchisees sued their franchisor, seeking rescission of the licensing agreements based upon allegedly fraudulent misrepresentations. The complaint alleged that the plaintiffs were fraudulently induced to enter the licensing agreements by virtue of three unfulfilled promises: (1) that they would benefit from becoming part of the Radisson Hotels family and would participate in a "worldwide reservation system listed with more than 4,500 travel agents"; (2) that their hotels would be the sole beneficiaries of the reservation system in the Florida Keys; and (3) that over 40% of their room reservations would come from this system and travel agents. Hotels, 694 So.2d at 76. The court considered "the scope of the economic loss doctrine as it relates to allegations of fraud," and held:
It makes sense that a truly independent cause of action for fraudulent misrepresentation, where the ability of one party to negotiate fair terms is undermined by the other's fraudulent behavior, is not barred by the economic loss rule. However, where the only alleged misrepresentation concerns the heart of the parties' agreement, simply applying the label of "fraudulent inducement" to a cause of action will not suffice to subvert the sound policy rationales underlying the economic loss doctrine....
. . . . .
Misrepresentations relating to the breaching party's performance of a contract do not give rise to an independent cause of action in tort, because such misrepresentations are interwoven and indistinct from the heart of the contractual agreement. Therefore, we clarify that where the alleged fraudulent misrepresentation is inseparable from the essence of the parties' agreement, the economic loss rule applies and the parties are limited to pursuing their rights in contract.
Id. at 77-78. The court found the plaintiffs' fraud claims were not independent of the contract and were therefore barred by the economic loss rule. In so holding, the court in Hotels noted an earlier holding that "a claim for fraudulent inducement is an independent tort and thus not barred by the economic loss rule," id. at 76 (citing HTP, Ltd. v. Lineas Aereas Costarricenses S.A., 661 So.2d 1221 (Fla.Dist.Ct.App. 1995), which had subsequently been upheld by the Florida Supreme Court in HTP, Ltd. v. Lineas Aereas Costarricenses, S.A., 685 So.2d 1238 (Fla.1996)). Nevertheless, the Hotels court "[a]ppl[ied] common sense to the supreme court's analysis" and rejected *763 the argument that "one can always avoid operation of the economic loss doctrine by merely pleading fraud in the inducement." Hotels, 694 So.2d at 77. The court looked beyond the label of "fraudulent inducement" and construed the true nature of the fraud claims alleged.
GE contends that LATAM's fraud claims, which allege that GE promised to maintain an exclusive, permanent business relationship with LATAM, go to the heart of the parties' agreement embodied in the 1996 Distributorship Agreement, are inseparable from this contract, and are barred by the economic loss rule. Further, GE argues that this contention is bolstered by the fact that the 1996 Agreement contained a disclaimer clause.[5]See Bates v. Rosique, 777 So.2d 980 (Fla.Dist. Ct.App.2001). In response, LATAM takes GE to task for failing to discuss HTP, supra, as only the state's highest court decisions are controlling when a federal court decides an issue under state law. See Talley v. State Farm Fire & Casualty Co., 223 F.3d 323, 326 (6th Cir.2000). Further, this court "may disregard an intermediate state court decision if it is convinced that the highest state court would decide otherwise." Grego v. Meijer, Inc., 187 F.Supp.2d 689, 691 (W.D.Ky.2001).
The difficulty with LATAM's argument is that it has not convinced this court that the Florida Supreme Court would decide otherwise with regard to LATAM's fraud claims. In Hotels, the plaintiff had pled fraudulent inducement, but the court held that this mere labeling was not enough to preclude, automatically, operation of the economic loss doctrine the court was obligated to look beyond the label and construe the claim. HTP, supra, is not to the contrary. In that case, the Florida Supreme Court resolved a split among the lower Florida courts by stating its disagreement with the reasoning in Woodson v. Martin, 663 So.2d 1327 (Fla.Dist.Ct. App.1995), which had held that "`the nature of the damages suffered determines whether the economic loss rule bars recovery based on tort theories. If the damages sought are economic losses only, the party seeking recovery for those damages must proceed on contract theories of liability.'" HTP, 685 So.2d at 1240 (quoting Woodson, 663 So.2d at 1329). HTP clarified that fraudulent inducement is an independent tort, with elements distinct from breach of contract, and thus was not a cause of action eliminated by the economic loss rule. See HTP, 685 So.2d at 1239. In so ruling, however, the court also cited favorably the reasoning in Huron Tool & Engineering Co. v. Precision Consulting Services, Inc., 209 Mich.App. 365, 532 N.W.2d 541 (1995), which noted:
The distinction between fraud in the inducement and other kinds of fraud is the same as the distinction...between fraud extraneous to the contract and fraud interwoven with the breach of contract. With respect to the latter kind of fraud, the misrepresentations relate to the breaching party's performance of the contract and do not give rise to an independent cause of action in tort.
HTP, 685 So.2d at 1240 (quoting Huron Tool, 532 N.W.2d at 545).
Thus, we must decide whether LATAM's fraud claims are extraneous to the contract or interwoven with the alleged breach of the contract. The economic loss doctrine "does not bar a cause of action for fraud in the inducement, where the fraud *764 alleged pertains to a term of the contract and is relied upon in inducing the completion of the agreement." Bankers Mutual Capital Corp. v. United States Fidelity and Guaranty Co., 784 So.2d 485, 489 (Fla. Dist.Ct.App.2001). The Bankers Mutual court held that claims for fraud in the inducement alleged in that case were independent from the breach of contract actions, because (1) the amended complaint alleged that the qualifying agent for the general contractor had misrepresented the percentage of work completed on the projects for which Bankers Mutual had purchased pay requisitions, and (2) each count of fraudulent inducement alleged that the qualifying agent and the general contractor had failed to list certain creditors, all of which fraudulently induced the plaintiff to enter joint check agreements. See id. at 489. The court reasoned:
To determine whether the economic loss rule bars recovery under fraud, the question is simply this: is the fraud alleged in an act of performance or in a term of the bargain? Where, as here, the representation is simply made and relied upon in inducing the completion of the transaction, then clearly it is a term of the bargain. Nothing further was required of the [sellers] in connection with this contract term after they made the representation that all [the company]'s taxes had been paid. If, however, the misrepresentation had been in connection with the seller's performance such as the ability to provide increased reservations and better hotel management services in Hotels of Key Largo, which required continuing action on the part of the seller, then the fraud is in the performance and the economic loss rule bars recovery sounding in tort.
Bankers Mutual, 784 So.2d at 489 (quoting Allen v. Stephan Co., 784 So.2d 456, 458 (Fla.Dist.Ct.App.2000)). Although LATAM apparently contends that the misrepresentations it alleges were merely terms of the bargain, they required continuing action on the part of GE to keep LATAM as a distributor except for cause and to prevent MABE from ever distributing GE products in Peru. The fraud alleged is an act of performance, is inseparable from the contractual claims, and is therefore barred by the economic loss rule.[6]
GE will thus be granted summary judgment on Counts 1,2, 4, and 5 of LATAM's Second Amended Counterclaim. Count 3, however, which relies on an alleged misrepresentation concerning GE-DAKO, must be discussed separately. The alleged misrepresentation on which this claim depends purportedly occurred in July, 1997, when "GE misrepresented to Gonzalez and LATAM that it would be awarded the exclusive long-term distributorship of GE-DAKO in Peru if LATAM agreed to invest monies for infrastructure and to purchase *765 a certain amount of merchandise," according to LATAM. Elsewhere in the Second Amended Counterclaim, LATAM contends that GE promised, through Don Fontaine, Salvador Batista, Robert Reid and Gabriel Pentada, that LATAM would be the exclusive distributor in Peru, provided that it opened an assembly plant in Peru and trained personnel (as the GE-DAKO units were shipped unassembled). LATAM further alleges that after its initial large purchases and capital expenditures, it learned that GE had lied, that GE-DAKO flooded the market with product sold to another distributor, and that GE informed LATAM that it would not be the exclusive distributor in July, 1998 leaving LATAM with a large volume of GE-DAKO product and losses which could not be recouped.
The only argument GE makes in its motion for summary judgment which explicitly applies to this fraud counterclaim is that DAKO and GE are separate corporate entities, and although GE has an ownership interest in DAKO, it is not controlling, so GE has no right to speak for DAKO or direct who should distribute its merchandise.[7] GE further contends that LATAM's decision not to name DAKO as a defendant to this lawsuit requires dismissal of this counterclaim. LATAM responds that record evidence abounds of GE's control over DAKO.[8] Neither GE nor LATAM, in the pleadings regarding Count 3, cite any authority. GE does not even mention Count 3 in its reply. Because of this lack of analysis, and bearing in mind the standard on summary judgment, this counterclaim will be allowed to proceed.
COUNTS 8-11: THE BREACH OF CONTRACT AND PROMISSORY ESTOPPEL COUNTERCLAIMS
LATAM makes a breach of contract and a promissory estoppel claim on each of the *766 two promises it alleges GE made: (1) that its relationship with GE was terminable only upon "good cause," and (2) that it would not use MABE to distribute GE products in Peru.[9] GE contends that summary judgment is warranted on LATAM's contract claims because the 1996 Distributor Agreement contained an integration clause[10] evidencing the parties' intent to make this written agreement their entire agreement, the alleged promises contradict the plain language of this written agreement, and Florida's parol evidence rule bars admission of extrinsic evidence which varies or contradicts the unambiguous language of a contract. GE argues for summary judgment on the promissory estoppel claims by citing Florida cases which provide that the doctrine of promissory estoppel cannot be used to avoid the statute of frauds, which, GE asserts, bars LATAM's alleged "umbrella" contract embodying the promises of a continually renewed relationship with GE and exclusivity (by not using MABE). LATAM's response to these arguments is the bare statement that "[a]s discussed above, GE [sic] promise not to use Mabe in Peru is in writing and incorporated into the contract, therefore it is not barred but [sic] the parol evidence rule."
Given the paucity of LATAM's response, we must, at this stage, review the nature of the proof offered by LATAM in support of GE's alleged promises. As to the alleged promise not to terminate LATAM or refuse to renew its relationship except for cause, LATAM offers the following evidence:
(1) The text of the 1994 speech by former GEA president Stonesifer, which referred to independent distributors as "partners" with a "solid relationship" with GE, see supra page 4.
(2) Written "GE/EXIN Guidelines for South American Expansion," dated May 14, 1996, which refers to "other pre-existing commitments" in Peru.[11]*767 LATAM contends that when these guidelines were signed, there was no written distribution contract in effect between GE and LATAM; the 1994 Agreement had expired on March 31, 1996, and the 1996 Agreement would not be signed until July 25, 1996 (though, on that date, it was made effective as of April 1, 1996). LATAM also argues that Bob Reid's deposition testimony confirms that the reference to a "pre-existing commitment[]" in Peru reflects an oral promise to renew LATAM's distributorship.[12]
(3) The text of a speech by Bob Seeley at a 1996 distributors' conference at Lake Tahoe, in which he confirmed the circumstances under which GE would refuse to renew a distributor. LATAM contends that this text was given to it, and is therefore a writing which satisfies the statute of frauds. LATAM further contends that Seeley testified, in deposition, that LATAM met the criteria outlined in the speech.[13]
As to the alleged promise not to use MABE to distribute GE products in Peru, LATAM offers the following evidence:
(1) A letter from Bob Reid to LATAM, dated August 21, 1995, assuring Gonzalez that MABE would not be authorized to distribute GE products in Peru, see supra page 4.[14]
(2) Deposition testimony by Bob Reid recounting his reassurance of Gonzalez in the presence of other GE representatives, see supra note 1.[15]
1. Contract Claims: Counts 8 and 10
Having reviewed the proof advanced by LATAM, this court concludes that the alleged promise not to terminate LATAM or fail to renew its distributorship *768 except for cause, if such a promise existed, was oral in nature, not written. The writings which LATAM has produced do not set forth such a promise. See First Guaranty Corp. v. Palmer Bank and Trust Co. of Fort Myers, 405 So.2d 186, 188 (Fla. Dist.Ct.App.1981) ("to comply with the statute [of frauds], the writing must contain the essential terms of the transaction").[16] Moreover, this promise contradicts the express, unambiguous terms of the written agreement, which clearly states that it is to operate for a term of two years. "[U]nder Florida law, the parol evidence rule bars admission of extrinsic evidence which would vary or contradict the unambiguous language of a contract.... This is especially true when the contract contains an integration clause indicating that the parties intended the written agreement to be the entire agreement." In re Yates Development, Inc., 256 F.3d 1285, 1289-90 (11th Cir.2001). Therefore, GE will be awarded summary judgment on Count 8, LATAM's contract counterclaim based on the alleged promise not to terminate LATAM except for cause.
As to the second alleged promise, that GE would not use MABE to distribute GE products in Peru, the writing on which LATAM relies is the letter from Bob Reid to Gonzalez, dated August 21, 1995. LATAM's contract counterclaim based on this alleged promise, however, alleges that "[o]n numerous occasions after April of 1996, Mr. Gonzalez and LATAM asked GE to agree that it would not use or allow MABE or any other distributor or representative to replace LATAM in the Peruvian appliance market....GE breached this contract by, among other things, using and allowing MABE to invade the Peruvian market..." (emphasis added). LATAM cannot use this 1995 writing to show breach of contract, when, by LATAM's allegations, the contract GE is alleged to have breached was created after April of 1996. Thus, with regard to this contract claim, LATAM is relegated to oral assurances, which likewise contradict the written contract (which is unambiguous in that it makes LATAM an authorized distributor, not the exclusive distributor). Pursuant to the same reasoning as above, GE will be awarded summary judgment on Count 10 of the counterclaims.
2. Promissory Estoppel Claims: Counts 9 and 11
With regard to the promissory estoppel counterclaims, the doctrine of promissory estoppel cannot be used to avoid the statute of frauds. See Tanenbaum v. Biscayne Osteopathic Hospital, Inc., 190 So.2d 777, 779 (Fla.1966). Therefore, Count 9 of LATAM's counterclaims, based on the alleged promise to renew LATAM's distributorship, fails as a matter of law. With regard to Count 11, however, which is based on the alleged promise not to use MABE in Peru, LATAM has produced a writing which appears to satisfy the statute of frauds the 1995 letter from Bob Reid to Gonzalez. Moreover, the promise embodied therein appears to meet the observation that "the doctrine of promissory estoppel is only available `where the promise is definite, of a substantial nature, and [is] established by clear and convincing evidence.'" Eclipse Medical, Inc. v. American Hydro-Surgical Instruments, Inc., 1999 WL 181412, *11 (S.D.Fla.1999) (quoting W.R. Grace & Co. v. Geodata *769 Serv., Inc., 547 So.2d 919, 920 (Fla.1989)). The reassurance provided in Reid's letter that the new MABE venture in Ecuador would not be allowed to distribute GE products outside Ecuador seems sufficiently definite (contrary to the alleged promise to renew LATAM's distributorship) to allow a promissory estoppel claim regarding the alleged promise not to use MABE in Peru to go forward. Summary judgment is not warranted on Count 11.
COUNT 12: UNJUST ENRICHMENT
GE also seeks summary judgment on LATAM's unjust enrichment counterclaim. Under Florida law, the elements of such a claim are as follows: "(1) a benefit conferred upon the defendant by the plaintiff, (2) appreciation by the defendant of such benefit, and (3) acceptance and retention of such benefit by the defendant under such circumstances that it would be inequitable for him to retain it without paying the value thereof." Henry M. Butler, Inc. v. Trizec Properties, Inc., 524 So.2d 710, 712 (Fla.Dist.Ct.App.1988). Unjust enrichment is an equitable claim which is precluded where payment has been made for the benefit conferred. Gene B. Glick Co., Inc. v. Sunshine Ready Concrete Co., Inc., 651 So.2d 190 (Fla.Dist. Ct.App.1995). LATAM cannot demonstrate unjust enrichment, in that it entered various business relationships with GE, from which it benefited and for which it was paid.[17] Given the above statements of law, and the fact that LATAM has not even responded to this argument in its pleadings on summary judgment, GE will be granted summary judgment on this counterclaim.
COUNT 13: VIOLATION OF FLORIDA FRANCHISE AND DISTRIBUTORSHIP ACT
Finally, GE seeks summary judgment on this counterclaim, which alleges that GE violated the Florida Franchise and Distributorship Act ("FFDA"), which makes it unlawful intentionally to misrepresent the prospects or chances for success of a proposed distributorship when selling or establishing such a distributorship. See Fla. Stat. § 817.416(2)(a). The misrepresentations LATAM alleges in connection with this counterclaim are discussed above. GE argues first that summary judgment is warranted here because the parties' relationship was premised on the 1996 Agreement, which selected New York law to govern, rather than Florida. See Davis v. McDonald's Corp., 44 F.Supp.2d 1251, 1261 (N.D.Fla.1998) (summary judgment granted for defendant on FFDA claim when parties chose Illinois law to govern their agreement). LATAM's response to this argument is that its alleged "umbrella" agreement with GE (embodying the promises not to terminate LATAM except for cause and not to use MABE) were broader than, and separate and apart from, any single agreement, including the 1996 Agreement, and that this separate agreement contained no provision choosing New York law. Given that this court has dismissed LATAM's contract claims based on the alleged "umbrella" agreement, the only contract which remains in issue is the 1996 Agreement; its selection of New York law precludes this counterclaim, and GE will be awarded summary judgment on Count 13. Accordingly,
*770 IT IS ORDERED that GE's motion for summary judgment is GRANTED with regard to Counts 1, 2, 4, 5, 8, 9, 10, 12, and 13 of the Second Amended Counterclaim.
IT IS FURTHER ORDERED that GE's motion for summary judgment is DENIED with regard to Counts 3 and 11 of the Second Amended Counterclaim.
NOTES
[1] LATAM also cites deposition testimony by Bob Reid, wherein he recounts that Gonzalez expressed concerns regarding rumors that MABE would be coming into Peru to distribute GE products, and Reid told Gonzalez that the rumors were not true and that GE had no intention of replacing Gonzalez with anyone. This exchange took place in 1996, at Lake Tahoe, with other GE representatives (Lopez and Seeley) allegedly present. Reid also testified, in deposition, that Gonzalez often related these rumors to him, and Reid "always" told Gonzalez that the rumors weren't true.
[2] Count 1 charges that GE embodied fraudulent intent from the outset of its relationship with LATAM, so that it fraudulently induced LATAM to enter each of its contracts with GE, from the first contract in 1992. Count 2 charges, in the alternative, that if GE did not harbor this fraudulent intent from the beginning, it developed the intent in late 1995 or early 1996.
[3] LATAM alleges that GE-DAKO is a GE-controlled Brazilian joint venture that manufactures appliances.
[4] The parties generally agree that Florida law governs the fraud counterclaims.
[5] This clause provides: "Any representation, understanding, proposal, agreement, warranty, course of dealing or trade usage not contained or referenced herein shall not be binding on the Company. No modification, amendment, rescission, waiver or other change shall be binding on Company unless assented to in writing by Company."
[6] LATAM also asserts another recent decision of the Florida Supreme Court, Moransais v. Heathman, 744 So.2d 973, 981 (Fla. 1999), which reaffirmed that court's "determination to limit the application and reach of the economic loss rule." The court discussed the origins of the economic loss rule, noting that it "was primarily intended to limit actions in the product liability context, and its application should generally be limited to those contexts or situations where the policy considerations are substantially identical to those underlying the product liability-type analysis." Id. at 983. Moransais held that the economic loss rule did not bar a negligence action where professional services were rendered (a pre-purchase house inspection) and there was no personal injury or property damage. While the court did affirm limitations on the economic loss rule in such cases as HTP, it focused primarily on the professional liability context, and the court does not glean anything from Moransais which repudiates Hotels of Key Largo, supra. Indeed, although Moransais issued more than two years after Hotels, it did not address or even mention that case.
[7] As support for these assertions, GE cites the deposition of Reynaldo Batista, noting that it has not yet been transcribed. In a recent pleading to this court, however, LATAM asserted that Batista was never even deposed.
[8] This evidence includes the following: (1) deposition testimony indicating that in 1996-1998, GE owned 73% of the stock of GE-DAKO; (2) a document purporting to show that, despite GE's transfer of 27.5% of this stock to MABE on September 1, 1998, GE maintained its 73% control by prohibiting MABE from voting its stock and taking any active role in GE-DAKO; and (3) a letter dated April 15, 1997 from Steve Riedel (former GEA vice-president) to David Cote, which purportedly shows GE "taking positions and undertaking obligations on behalf of, and directly affecting, GE-DAKO." With regard to the second piece of evidence, the document LATAM has now provided the court states that GEA "[c]urrently... [c]ontrols 73% of GE Dako's voting shares (45.5% directly and 27.5% indirectly from Mabe)," "[a]ppoints senior management," and "[a]ppoints 8 of 10 Board of Director members." Although the document is undated, it expresses the "[g]oal" to "deconsolidate GE Dako by end of 2000," and lists several "paths" to achieve this as follows: "Mabe buys Maracaju shares...Mabe controls; Maracaju agrees to revise shareholders' agreement ... GEA no longer controls; Mabe exercises its legal right to vote its shares ...GEA no longer controls." The method whereby LATAM discerned that this document shows GE maintaining a 73% control by prohibiting MABE from voting its stock and taking an active role in GE-DAKO is unrevealed to the court. The third piece of evidence, the letter from Riedel to Cote, is neither cited nor attached as an exhibit, although LATAM quotes from it in its response to the motion for summary judgment as follows: "As both GEA and GE-Dako distributor commitments in [Central America] lapse or can be terminated, GE and Dako brands would enter the Mabe subsidiaries...." And, under the heading "Argentina," "There is currently an opportunity to negotiate with our distributor... to achieve direct distribution of the GE brand in Argentina. We should set up a jointly owned direct distribution company with majority GEA equity, but allow Mabe to run the operation. The Dako brand could then be moved from the distributor at a later date."
[9] Count 8 of the Second Amended Counterclaim is styled "Breach of Contract Terminable Only Upon `Good Cause'" Count 9 is "Promissory Estoppel Terminable Only Upon `Good Cause'"; Count 10 is "Breach of Contract Will Not Use MABE"; and Count 11 is "Promissory Estoppel Will Not Use MABE."
[10] This clause, found in § V(M)(1), provides:
This Agreement contains the entire and only agreement between the parties respecting the sale to and the purchase, distribution and servicing by the Distributor of any Product(s). Any representations, terms or conditions relating to or in connection with the same and not incorporated herein shall not be binding upon either party. In the event of any discrepancy between the text of this Agreement and any Schedule(s) attached hereto, the terms of such Schedule(s) shall control and the rights and obligations of the parties shall be governed thereby. This Agreement wholly cancels, terminates, and supersedes any agreement heretofore entered into between the parties except as expressly otherwise provided below.
. . . . .
[And, at subsection (3):] No change, modification, extension, renewal, ratification, rescission, termination, notice of termination, discharge, abandonment, or waiver of this Agreement or any of the provisions hereof nor any representation, promise, or condition relating to this Agreement shall be binding upon the Company unless made in writing and signed by one of the aforementioned executives.
[11] To provide some context, this reference appeared under the heading "Extension of Non-Competition Agreement," and stated that the parties (presumably, GE and EXIN) were "to extend their current non-competition agreement... to those countries where the parties are co-shareholders...if entities engaged in the manufacture and/or distribution of products, but specifically not to Venezuela and Peru where other pre-existing commitments exist." The document further provides that "[i]n countries where there are no shared ownership or prior commitments, there are no restrictions upon Exin or GE for distribution of goods."
[12] The court's review of this deposition testimony does not convince it that this writing provides evidence of an alleged promise on the part of GE to renew LATAM's distributorship, in perpetuity, except for cause. Reid testified that he believed they had a written contract in place with LATAM at that time (in 1996); he stated "I believe LATAM's agreement was in place when this was written in the middle of the year, and it was renewed at the end of the year." (Reid deposition at 296). Further, when corrected about the gap between the expiration of the 1994 Agreement and the signing of the 1996 Agreement, he stated that "there were provisions that if an agreement lapsed and had not been signed for some reason... we could continue to operate on an ad hoc basis until a signed agreement. ..." (Reid deposition at 298).
[13] No citation or exhibit number has been provided for this text. Also, while LATAM provides pinpoint citations to Seeley's deposition in its most recent version of its response submitted to the court, the deposition itself has not yet been provided.
[14] Specifically, the letter states that:
...MABE has decided to distribute in Peru through Durex. MABE is also moving to join... in a joint venture in Ecuador. GE, of course, is a partner in MABE and will therefore be a part owner of the venture in Ecuador. However, the new venture in Ecuador will not have the authority to market the GE brand outside of Ecuador. GE Appliances will continue to sell GE brands in Peru through LATAM.
. . . . .
I will attempt to make sure that Durex sales people do not falsely claim that their products are GE units or GE made. I hope this answers your questions, Guillermo.
(Emphasis in original).
[15] LATAM also contends that the last of these assurances was given in response to a memo from Gonzalez to Manny Lopez on July 8, 1996. While LATAM has cited and attached the memo from Gonzalez, it has provided no evidence of the alleged assurance, nor even the content thereof.
[16] LATAM argued, in relation to its fraud claims, that Kentucky's statute of frauds, rather than Florida's, applies. The court does not find this argument persuasive. Arsham v. Banci, 511 F.2d 1108, 1114 (6th Cir.1975) (despite fact that Ohio treats its own statute of frauds as procedural, court applied statute of frauds of New York, where contract was made).
[17] GE also asserts that LATAM, in fact, owes GE more than $214,693.57 because LATAM failed to make payment to GE as required by the 1996 Agreement. Indeed, LATAM has admitted in answers to interrogatories that it is indebted to GE, but maintains that GE owes LATAM much more.
|
Q:
How to split an ArrayList into ArrayList>?
I'm pretty new to java and trying to create an ArrayList<ArrayList<Integer>> from ArrayList<Integer> (splitting 28800 data points into pieces of 300).
public static ArrayList<ArrayList<Integer>> createListOfArrays(ArrayList<Integer> list) {
ArrayList<ArrayList<Integer>> listOfArrays = new ArrayList<ArrayList<Integer>>();
ArrayList<Integer> temp = new ArrayList<Integer>();
for (int i = 0; i < list.size(); i++) {
int arrayInt = list.get(i);
temp.add(arrayInt);
if (temp.size() % 300 == 0) {
listOfArrays.add(temp);
temp.clear();
}
}
return listOfArrays;
System.out.println(listOfArrays.size());
System.out.println(listOfArrays.get(0).size());
}
My print statements give me the right size of 96 ArrayLists but they are all empty. If I remove temp.clear() they all consist of 28800 Integers.
I need 96 * 300 different ArrayLists in an Arraylist.
A:
for (int i = 0; i < list.size(); i++) {
Integer arrayInt = list.get(i);
temp.add(arrayInt);
if (temp.size() % 300 == 0) {
listOfArrays.add(temp);
temp = new ArrayList<>();
}
}
Dont use primitive int while retrieving element from list. Because it will unnecessarily cause unboxing and then autoboxing again.
Rather than relying on list.size() % 300 == 0, You should change your logic also.
You can even use arraylist method subList.
|
At least 15 Haitians were killed when a vessel carrying the migrants capsized in shark-infested waters off the Turks and Caicos Islands on Sunday, officials said.
The U.S. Coast Guard suspended the search for additional survivors late Sunday, hours after the boat carrying at least two dozen migrants from Haiti sank off West Caicos, an uninhabited island in the Turks and Caicos archipelago.
At least 14 people survived and four others remain unaccounted for, the Coast Guard said.
The Coast Guard joined Royal Turks and Caicos police after officials received reports of a capsized vessel just after 8 a.m. Sunday.
“Today, March 31st, 2019 we have seen the heroic efforts of my Police Officers, Immigration Officials, Emergency Medical Response teams and private citizens, after a boat carrying suspected illegal migrants capsized off West Caicos,” Acting Turks and Caicos Police Commissioner Trevor Botting said in a statement. “This has indeed been a difficult day, and I would like to express thanks and appreciation to all of you that responded. Your service today is invaluable and appreciated.”
STATE DEPARTMENT REACTS TO REPORTED ARRESTS OF AMERICANS IN HAITI
Botting said it’s unclear how many people were on the vessel when it sank. Authorities are investigating the incident to identify what caused the boat to sink.
Authorities have been warning Haitians about making dangerous trips by boat. At least 28 Haitians were killed in February after a boat sank off the northern Bahamas, the Miami Herald reported.
“No journey is worth risking lives on the dangerous seas in these small vessels,” Botting said.
HAITI OPPOSITION CALLS NEW PROTESTS IN BID TO OUST PRESIDENT
Haiti has been dealing with a deteriorating economy and political instability. The country has also seen an increase in gang violence.
Haiti's largest opposition groups launched protests on Friday in a campaign to push U.S.-backed President Jovenel Moise from office.
CLICK HERE TO GET THE FOX NEWS APP
Newly named Prime Minister Jean Michel Lapin said Wednesday he encouraged peaceful protests, but the government would not allow violence on the streets.
The Associated Press contributed to this report. |
What does Hemoglobin Mean?
Hemoglobin is the protein molecule in the red blood cells that are responsible for carrying the oxygen from the lungs to your bodies tissue and returns the carbon dioxide waste from the tissue to the lungs. |
Everyone knows C++ includes are expensive, but how expensive are they? I tested it in Windows 10 on a 2.53Ghz machine using Visual Studio’s CL.exe (msbuild 14.0) and clang 7.0.1. The test was done with the source code and includes on a regular hard drive, not an SSD. A comparison of SSD versus HDD will be done later.
The test was performed by compiling the source code below 128 times, calculating the average time.
int test_function() { return 0; } 1 int test_function ( ) { return 0 ; }
Each include was then individually added and the compilation was run another 128 times with this command line for cl.exe:
cl.exe /nologo /EHsc /I"C:\Program Files (x86)\Microsoft Visual Studio 14.0\VC\include" /I"C:\Program Files (x86)\Microsoft Visual Studio 14.0\VC\atlmfc\include" /I"C:\Program Files (x86)\Windows Kits\10\Include\10.0.10240.0\ucrt" /I"C:\Program Files (x86)\Windows Kits\8.1\Include\um" /I"C:\Program Files (x86)\Windows Kits\8.1\Include\shared" /I"C:\Program Files (x86)\Windows Kits\8.1\Include\winrt" /c __test_source.cpp > __test_buildoutput.txt 1 cl . exe / nologo / EHsc / I "C:\Program Files (x86)\Microsoft Visual Studio 14.0\VC\include" / I "C:\Program Files (x86)\Microsoft Visual Studio 14.0\VC\atlmfc\include" / I "C:\Program Files (x86)\Windows Kits\10\Include\10.0.10240.0\ucrt" / I "C:\Program Files (x86)\Windows Kits\8.1\Include\um" / I "C:\Program Files (x86)\Windows Kits\8.1\Include\shared" / I "C:\Program Files (x86)\Windows Kits\8.1\Include\winrt" / c __test_source . cpp > __test_buildoutput . txt
and this command line for clang:
"C:\Program Files\LLVM\bin\clang.exe" -I"C:\Program Files\LLVM\lib\clang\7.0.1\include" -std=c++17 -c __test_source.cpp > __test_buildoutput.txt 1 "C:\Program Files\LLVM\bin\clang.exe" - I "C:\Program Files\LLVM\lib\clang\7.0.1\include" - std = c ++ 17 - c __test_source . cpp > __test_buildoutput . txt
C headers were gathered from: https://en.cppreference.com/w/c/header while C++ headers came from: https://en.cppreference.com/w/cpp/header.
The average of the base time was then subtracted, giving these compilation times, in seconds.
header cl.exe clang.exe algorithm 0.192 0.327 any 0.027 0.332 array 0.362 0.547 assert.h 0.01 0.007 atomic 0.353 0.702 bit 0.019 ¯\_(ツ)_/¯ bitset 0.356 0.601 cassert 0.014 0.005 cctype 0.018 0.01 cerrno 0.016 0.008 cfenv 0.012 0.018 cfloat 0.014 0.006 charconv 0.024 ¯\_(ツ)_/¯ chrono 0.174 0.312 cinttypes 0.016 0.017 climits 0.011 0.004 clocale 0.011 0.007 cmath 0.044 0.07 codecvt 0.368 0.628 compare 0.02 ¯\_(ツ)_/¯ complex 0.39 0.608 concepts 0.023 ¯\_(ツ)_/¯ condition_variable 0.308 0.595 contract 0.023 ¯\_(ツ)_/¯ csetjmp 0.011 0.009 csignal 0.016 0.005 cstdarg 0.011 0.005 cstddef 0.011 0.011 cstdint 0.017 0.005 cstdio 0.048 0.068 cstdlib 0.019 0.056 cstring 0.024 0.024 ctime 0.014 0.012 ctype.h 0.01 0.01 cuchar 0.017 0.005 cwchar 0.061 0.078 cwctype 0.018 0.009 deque 0.232 0.368 errno.h 0.015 0.009 exception 0.076 0.1 execution 0.019 ¯\_(ツ)_/¯ experimental/algorithm 0 ¯\_(ツ)_/¯ experimental/algorithm 0 ¯\_(ツ)_/¯ experimental/algorithm 0 ¯\_(ツ)_/¯ experimental/any 0 ¯\_(ツ)_/¯ experimental/array 0 ¯\_(ツ)_/¯ experimental/atomic 0 ¯\_(ツ)_/¯ experimental/barrier 0 ¯\_(ツ)_/¯ experimental/chrono 0 ¯\_(ツ)_/¯ experimental/deque 0.213 ¯\_(ツ)_/¯ experimental/deque 0.209 ¯\_(ツ)_/¯ experimental/exception_list 0 ¯\_(ツ)_/¯ experimental/execution_policy 0 ¯\_(ツ)_/¯ experimental/filesystem 0.612 ¯\_(ツ)_/¯ experimental/forward_list 0.206 ¯\_(ツ)_/¯ experimental/forward_list 0.2 ¯\_(ツ)_/¯ experimental/functional 0 ¯\_(ツ)_/¯ experimental/functional 0 ¯\_(ツ)_/¯ experimental/future 0 ¯\_(ツ)_/¯ experimental/future 0 ¯\_(ツ)_/¯ experimental/iterator 0 ¯\_(ツ)_/¯ experimental/latch 0 ¯\_(ツ)_/¯ experimental/list 0.203 ¯\_(ツ)_/¯ experimental/list 0.202 ¯\_(ツ)_/¯ experimental/map 0.225 ¯\_(ツ)_/¯ experimental/map 0.221 ¯\_(ツ)_/¯ experimental/memory 0 ¯\_(ツ)_/¯ experimental/memory 0 ¯\_(ツ)_/¯ experimental/memory_resource 0 ¯\_(ツ)_/¯ experimental/numeric 0 ¯\_(ツ)_/¯ experimental/numeric 0 ¯\_(ツ)_/¯ experimental/optional 0 ¯\_(ツ)_/¯ experimental/propagate_const 0 ¯\_(ツ)_/¯ experimental/random 0 ¯\_(ツ)_/¯ experimental/ranges/algorithm 0 ¯\_(ツ)_/¯ experimental/ranges/concepts 0 ¯\_(ツ)_/¯ experimental/ranges/functional 0 ¯\_(ツ)_/¯ experimental/ranges/iterator 0 ¯\_(ツ)_/¯ experimental/ranges/random 0 ¯\_(ツ)_/¯ experimental/ranges/range 0 ¯\_(ツ)_/¯ experimental/ranges/tuple 0 ¯\_(ツ)_/¯ experimental/ranges/type_traits 0 ¯\_(ツ)_/¯ experimental/ranges/utility 0 ¯\_(ツ)_/¯ experimental/ratio 0 ¯\_(ツ)_/¯ experimental/regex 0 ¯\_(ツ)_/¯ experimental/set 0.211 ¯\_(ツ)_/¯ experimental/set 0.21 ¯\_(ツ)_/¯ experimental/source_location 0 ¯\_(ツ)_/¯ experimental/string 0.366 ¯\_(ツ)_/¯ experimental/string 0.365 ¯\_(ツ)_/¯ experimental/string_view 0 ¯\_(ツ)_/¯ experimental/system_error 0 ¯\_(ツ)_/¯ experimental/tuple 0 ¯\_(ツ)_/¯ experimental/type_traits 0 ¯\_(ツ)_/¯ experimental/type_traits 0 ¯\_(ツ)_/¯ experimental/unordered_map 0.234 ¯\_(ツ)_/¯ experimental/unordered_map 0.231 ¯\_(ツ)_/¯ experimental/unordered_set 0.223 ¯\_(ツ)_/¯ experimental/unordered_set 0.221 ¯\_(ツ)_/¯ experimental/utility 0 ¯\_(ツ)_/¯ experimental/vector 0.211 ¯\_(ツ)_/¯ experimental/vector 0.208 ¯\_(ツ)_/¯ fenv.h 0.008 0.009 filesystem 0.594 0.92 float.h 0.01 0.006 forward_list 0.232 0.365 fstream 0.294 0.537 functional 0.206 0.48 future 1.12 1.57 initializer_list 0.013 0.009 inttypes.h 0.01 0.008 iomanip 0.298 0.535 ios 0.288 0.537 iosfwd 0.096 0.178 iostream 0.291 0.541 istream 0.298 0.538 iterator 0.302 0.507 limits 0.11 0.163 limits.h 0 0.004 list 0.223 0.368 locale 0.371 0.641 locale.h 0.015 0.01 map 0.243 0.393 math.h 0.021 0.022 memory 0.196 0.337 memory_resource 0.019 ¯\_(ツ)_/¯ mutex 0.303 0.59 new 0.063 0.101 numeric 0.128 0.272 optional 0.02 0.333 ostream 0.288 0.533 queue 0.223 0.403 random 0.343 0.641 ranges 0.02 ¯\_(ツ)_/¯ ratio 0.046 0.105 regex 0.426 0.698 scoped_allocator 0.201 0.337 set 0.229 0.369 setjmp.h 0.004 0.007 shared_mutex 0.312 0.602 signal.h 0.008 0.005 span 0.02 ¯\_(ツ)_/¯ sstream 0.36 0.582 stack 0.207 0.37 stdarg.h 0.004 0 stddef.h 0.013 0 stdexcept 0.226 0.359 stdint.h 0.003 0.004 stdio.h 0.046 0.068 stdlib.h 0.018 0.032 streambuf 0.285 0.501 string 0.4 0.567 string_view 0.026 0.502 string.h 0.017 0.026 strstream 0.311 0.545 syncstream 0.017 ¯\_(ツ)_/¯ system_error 0.263 0.409 thread 0.254 0.539 time.h 0.013 0.016 tuple 0.144 0.276 type_traits 0.046 0.096 typeindex 0.065 0.114 typeinfo 0.062 0.114 uchar.h 0.01 0.007 unordered_map 0.235 0.418 unordered_set 0.234 0.396 utility 0.12 0.217 valarray 0.2 0.331 variant 0.021 0.385 vector 0.228 0.374 version 0.022 ¯\_(ツ)_/¯ wchar.h 0.048 0.078 wctype.h 0.01 0.008
The top 5 header times for cl.exe:
future 1.12 experimental/filesystem 0.612 filesystem 0.594 regex 0.426 string 0.4
The top 5 header times for clang.exe:
future 1.57 filesystem 0.92 atomic 0.702 regex 0.698 locale 0.641
edit: added clang info, reorganized tables, added some specifics on testing |
Q:
Random Forest: IncNodePurity and Feature Selection for Binary Logistic Regression
After creating a Random Forest object using randomForest with around 500 candidate variables, I used importance(object) to display IncNodePurity for each of the candidate variables in relation to the binary outcome of interest (Payment/No Payment).
I am aware that IncNodePurity is the total decrease in node impurities, measured by the Gini Index from splitting on the variable, averaged over all trees. What I don't know is what should be the cutoff for candidate variables to be retained after making use of randomForest for feature selection in regards to binary logistic regression models. For example, the smallest IncNodePurity among my 498 variables is 0.03, whereas the largest IncNodePurity is 96.68.
In summary, I have one main question:
Is there a cutoff for IncNodePurity? If yes, what is it?
If no, how do you determine the cutoff? Do you simply take 10 candidate variables with the largest IncNodePurity if you want a model with only 10 predictor variables?
Any thoughts or references are greatly appreciated. Thanks!
A:
I don't believe such a cutoff exists, although the variable importance plots can be informative. Carry out two experiments. Rerun the random forest and see how the list changes. Delete an observation and also observe. In my experience, the answer relates to what is the goal of feature selection. For example, why not use every variable to make predictions. The random forest can easily do that. We usually use feature selection for a reason, for example, seeking a rule using just a small number of features that can easily be measured in the future. In my case, the number was set by the technology I plan to use the diagnostic on. More importantly, if you are using feature selection, this has to be repeated at each iteration of cross-validation. Searching this site for "cross-validation", "feature selection", and "stepwise regression" will give you a start.
|
package com.sqisland.espresso.idling_resource.dialog_fragment
import android.app.Dialog
import android.os.Bundle
import android.os.Handler
import android.os.Message
import android.text.format.DateUtils
import androidx.appcompat.app.AlertDialog
import androidx.fragment.app.DialogFragment
import java.lang.ref.WeakReference
class LoadingDialogFragment : DialogFragment() {
private val handler = LoadingHandler(this)
override fun onCreateDialog(savedInstanceState: Bundle?): Dialog {
handler.sendEmptyMessageDelayed(LoadingHandler.MSG_DISMISS, DELAY)
return AlertDialog.Builder(activity!!)
.setTitle(R.string.loading)
.setMessage(R.string.please_wait)
.create()
}
override fun onDestroyView() {
handler.removeMessages(LoadingHandler.MSG_DISMISS)
super.onDestroyView()
}
private class LoadingHandler(fragment: DialogFragment) : Handler() {
private val ref = WeakReference(fragment)
override fun handleMessage(msg: Message) {
ref.get()?.let { fragment ->
fragment.dismiss()
val activity = fragment.activity
if (activity is MainActivity) {
activity.onLoadingFinished()
}
}
}
companion object {
const val MSG_DISMISS = 0
}
}
companion object {
const val TAG = "Loading"
private const val DELAY = DateUtils.SECOND_IN_MILLIS * 3
}
} |
Africa needs $90bn per year to meet energy needs
Africa requires investment of between $60bn and $90bn per year to address its energy needs but innovative new technologies can help make up the shortfall, according to research.
The Economist Intelligence Unit’s report said Africa needs roughly four times the investment recorded in 2014 to meet the goals set by the African Renewable Energy Initiative of 300 gigawatts (GW) of renewable energy capacity by 2030.
The report, commissioned by engineering group IHS Towers, said meeting this would goal would require a 680% increase in current deployment rates.
Renewable power generation capacity in sub-Saharan Africa is currently just below 30 GW, around 25-30% of total energy production.
However, hydroelectric power accounts for the majority of this figure, with other renewables, such as solar and wind power, accounting for between 4% and 5%.
The report identifies solar and wind energy as most technically feasible and also the renewable sources attracting the majority of investment.
Positive experiences in key markets like South Africa and Kenya should provide a lead in terms of the best strategies to adopt, it said.
However, the report identified how a large pool of African consumers are able to buy power but don’t have access to appropriately priced and designed options.
“In rural regions, off-grid power generation could create an entirely new type of ‘bottom-up’ network as island grids gradually become interconnected. As with mobile in Africa, the key will be smart business models, not just a reliance on cheapening technology,” the report said.
Government-backed procurement programmes are more likely to attract long-term investment than one-off investments, it said.
South Africa, Uganda and Zambia are leading in this approach, the report added. |
Get ready. Beginning in November, electronic pay stubs will be available to all employees who have their paychecks direct deposited into their bank account. Electronic pay stubs are an easy, fast, and efficient way for you to get your payroll information. They will also help Enron to realize a considerable savings in time and dollars spent over traditional printed pay stubs.
If you prefer to receive a hardcopy of your pay stub, click on the link below to complete a request form. This form must be submitted to Payroll by October 15, 2001. Unless you submit a form your pay stub information will default to electronic viewing.
Please click on the link below.
Name: THERESA STAAB
Personnel number: P00503481
Phone: 3035756485
If you have questions about electronic pay stubs, please contact Janice Priddy (Payroll) 713-853-7839 or Marie Newhouse (ClickAtHome) at 713-345-4185 or send an email to Enron.Payroll@enron.com (Enron Payroll in Outlook).
Stay tuned for more details in the coming weeks.
http://etcsurvey.corp.enron.com/wi/p0810709/i.asp?r=21013&s=QEIEJFRC&l=9 |
Juddha Paolo
Juddha Paolo is a Filipino actor.
Biography
Juddha grew up in the States. He came to the Philippines to join the Philippine amateur boxing team. Instead, he found his way to show business. He became a Star Magic talent. He was launched later under Star Magic Batch 9. He then appeared in Coca-Cola's Hottah Hottah Summer Ad with Paolo Paraiso and Brian Tan.
In 2003, he, along with Paolo Paraiso and Brian Tan, was cast in Tabing Ilog.
He later joined in Studio 23's first VJ search. He was picked along with Kat Alano, Beau Canlas and Ayanna Oliva.
In 2007, he portrayed a small role in Rounin and at the same time appeared in Pinoy Mano-Mano: The Celebrity Boxing Challenge, a boxing reality show featuring celebrities. He had to leave the show due to a joint injury in one of the undercard bouts.
He also works with the ABS-CBN Foundation's "Kapit-Bisig Para Sa Ilog Pasig," a campaign to help rehabilitate the Pasig River.
Filmography
Television
Film
References
Category:Living people
Category:Star Magic
Category:Star Magic Batch 11
Category:Year of birth missing (living people) |
The focus of this studio is the design development and fabrication of a biomimetic research pavilion which will be constructed between the K1 and K2 university buildings. The pavilion will be based on design principles that have been developed from biological role models in the context of the Architectural Biomimetics seminar course in the WS 2013/14 semester. Particular attention was directed towards biological examples consisting of fiber-composite and membrane structures. The studio involves the transfer of principles from the biomimetic investigation into a technical system for a prototypical fiber-composite structure. This will focus on a multi-layered, geometrically differentiated fiber-composite structure, which allows for geometric variability in terms of fiber differentiation and adaptability, as well as the development of an integrated pneumatic formwork and enclosure system. The integration of the technical production parameters in automated robotic manufacturing represents a further focus for the studio.
A team of students and academic staff will create a computational design tool, which incorporates material, fabrication, structural and design constraints. In parallel, the students will participate in the corequisite research seminar Computational Design and Digital Fabrication, dealing with the robotic production.
The project offers the opportunity to apply computer-based design, planning, calculation and production methods in an integrated design process on a real project and develop experience on all phases of project development: from digital planning, planning application through to robotic manufacturing and assembly on site. Requirements include: the participation in the design integrated seminar Computational Design and Digital Fabrication. |
Cefonicid in a once-daily regimen for treatment of osteomyelitis in an ambulatory setting.
Fifteen patients with bone joint infections were treated with 1.0 g of cefonicid administered intravenously or intramuscularly once daily. Single organisms isolated included Staphylococcus aureus (from six patients), Staphylococcus epidermidis (three), and Peptococcus species (one). For four patients infection was polymicrobial, and for one patient no organism was isolated. The mean duration of therapy was 40.4 days, only 10.9 days of which were spent in the hospital. The remainder of therapy was administered intramuscularly in an ambulatory setting. Therapy was successful in all 12 assessable patients. No clinical or bacteriologic relapse occurred in the follow-up period of three to 13 months. The occurrence of adverse effects prompted discontinuation of cefonicid therapy in three patients. Minimum savings in hospital-bed costs alone were $64,350, with 390 hospital days avoided. The minimum savings in work income were $10,010, with 182 days of absenteeism avoided. These data are preliminary but suggest efficacy of cefonicid in a mode of therapy that could have profound cost benefits. |
Q:
Call Object based off of string
I am trying to call an object from my node backend through react, but I am trying to do so based off of a string. So if the string is 'Cat', I am wanting to access the Cat object and any other key/values under it.
Example of what the code looks like:
componentDidMount() {
let catName = 'Cat' //this string is actually passed in
this.callApi()
.then(res => this.setState({ catsName: res.catName.name }))
//catsName: res.Cat.name works
.catch(err => console.log(err));
}
callApi = async () => {
//lets say this example route has all animals in the world as objects
const response = await fetch('/animals');
const body = await response.json();
if (response.status !== 200) throw Error(body.message);
return body;
};
I know that it isn't working because it's a string, but trying to convert both the string or the object hasn't been working either. I'm limited in my node knowledge, any advice or clues? Or is this not even possible and I'm calling it wrong? Thanks ahead of time.
Example of what the node backend looks like for this example if helps. All animals would have key values in their api files (name, age, herbivore, etc..):
app.get('/animals', (req, res) => {
res.send({ Cat, Dog, Cougar, Wolf, etc.... });
});
A:
You need to use the brackets syntax when you want to access a dynamic keys within an object.
catsName: res[catName].name
Check this documentation of Property accessors
|
Dryclean Depot’s History
We’ve been in the business for more than 20 years
At Dryclean Depot, we know the dry cleaning business. The Dryclean Depot concept began in 1979 in the State of California. Over the years, we have significantly refined our business process to give our consumers the state-of-the-art stores that we have today.
Message from our CEO
What is "Any Garment"?
When we say any garment, we mean anything you wear, except suede and leather. All pants, shirts, sport coats, ties, etc. are just $2.99 any garment drycleaned and $1.29 laundered shirts (in most stores), cleaned and pressed.
Hear from our customers
“This letter is to compliment you about the level of service we continue to receive from your firm. We find that we live a very rushed and busy lifestyle. When we receive products and or services such as yours which offers the level of quality and professionalism, we enjoy taking the time to say "thank you" for going beyond the normal to ensure that we, your customer, are satisfied. We continue to inform our friends and family about this experience.” |
--
-- CREATE_TYPE
--
CREATE TYPE widget (
internallength = 24,
input = widget_in,
output = widget_out,
alignment = double
);
CREATE TYPE city_budget (
internallength = 16,
input = int44in,
output = int44out,
element = int4
);
-- Test type-related default values (broken in releases before PG 7.2)
-- Make dummy I/O routines using the existing internal support for int4, text
CREATE FUNCTION int42_in(cstring)
RETURNS int42
AS 'int4in'
LANGUAGE 'internal' WITH (isStrict);
NOTICE: type "int42" is not yet defined
DETAIL: Creating a shell type definition.
CREATE FUNCTION int42_out(int42)
RETURNS cstring
AS 'int4out'
LANGUAGE 'internal' WITH (isStrict);
NOTICE: argument type int42 is only a shell
CREATE FUNCTION text_w_default_in(cstring)
RETURNS text_w_default
AS 'textin'
LANGUAGE 'internal' WITH (isStrict);
NOTICE: type "text_w_default" is not yet defined
DETAIL: Creating a shell type definition.
CREATE FUNCTION text_w_default_out(text_w_default)
RETURNS cstring
AS 'textout'
LANGUAGE 'internal' WITH (isStrict);
NOTICE: argument type text_w_default is only a shell
CREATE TYPE int42 (
internallength = 4,
input = int42_in,
output = int42_out,
alignment = int4,
default = 42,
passedbyvalue
);
CREATE TYPE text_w_default (
internallength = variable,
input = text_w_default_in,
output = text_w_default_out,
alignment = int4,
default = 'zippo'
);
CREATE TABLE default_test (f1 text_w_default, f2 int42);
INSERT INTO default_test DEFAULT VALUES;
SELECT * FROM default_test;
f1 | f2
-------+----
zippo | 42
(1 row)
-- Test stand-alone composite type
CREATE TYPE default_test_row AS (f1 text_w_default, f2 int42);
CREATE FUNCTION get_default_test() RETURNS SETOF default_test_row AS '
SELECT * FROM default_test;
' LANGUAGE SQL;
SELECT * FROM get_default_test();
f1 | f2
-------+----
zippo | 42
(1 row)
-- Test comments
COMMENT ON TYPE bad IS 'bad comment';
ERROR: type "bad" does not exist
COMMENT ON TYPE default_test_row IS 'good comment';
COMMENT ON TYPE default_test_row IS NULL;
DROP TYPE default_test_row CASCADE;
NOTICE: drop cascades to function get_default_test()
DROP TABLE default_test;
|
Mississauga-Malton MP Navdeep Bains has been named Minister of Innovation, Science and Economic Development as newly-elected Prime Minister Justin Trudeau and his new cabinet were sworn into office today at Rideau Hall in Ottawa.
Having served as the MP for Mississauga-Brampton South from 2004 to 2011, Bains, 38, a long-time Trudeau friend and advisor, gained extensive experience as the Parliamentary Secretary to the Prime Minister and as the Liberal Critic in a number of portfolios.
Bains, a former Brampton resident and Turner Fenton Secondary School graduate, was the first MP for Mississauga-Brampton South when that riding was created in 2004 and, after last month’s election, he returns to Ottawa to serve as the first MP for Mississauga-Malton 11 years later.
Bains, an accountant/financial analyst and visiting professor at Ryerson University, said in a tweet he’s “honoured” to be Canada's next Minister of Innovation, Science and Economic Development. |
U.S. taxpayers have provided the Israeli military that invaded Gaza on Thursday night with more than $121 billion since the state’s founding, subsidizing about 25 percent of the tiny country’s annual defense budget in recent years.
That subsidy has increased even as Israel’s economy has experienced a growth spurt and the country has discovered stores of natural gas. Indeed, President Obama last year pledged to begin early negotiations to extend the annual military subsidy to Israel for another decade and has sold Israel powerful bunker buster bombs and helped finance the Iron Dome missile defense system that has protected Israelis from Hamas rockets and missiles in the current war.
One would think with that kind of record, pro-Israel conservatives would find a rare bit of common ground with a president they have criticized for being hostile to the Jewish state. But at least for some, the military aid is part of the problem.
“The experience of the Obama years has sharpened the perception among pro-Israel Americans that aid can cut against Israel by giving presidents with bad ideas more leverage than they would otherwise have,” said Noah Pollak, the executive director of the Emergency Committee for Israel (ECI). Pollak’s group has been one of Obama’s toughest critics, running television advertisements in 2012 that blamed Obama for dithering as Iran continued to enrich uranium.
It goes without saying that ECI is not the sole voice of the pro-Israel community. The emergency committee does not match the influence in Congress of the much larger American Israel Public Affairs Committee (AIPAC), which has shown no signs of ending its efforts to push Congress to pass the annual military aid bill.
But getting legislators to support aid to Israel in recent years has not required much effort at all. The committee votes are rarely contested and the money for Israel is rolled into the larger bill for foreign aid.
For Pollak and others, this is part of the problem. “Aid to Israel is a low bar for politicians to claim they’re pro-Israel, and it’d be better if there were more substantive things one had to do to earn that title,” he said. “And aid provides easy fodder for critics to claim that the alliance is a burden on the United States or that it’s a one-way street of America giving and Israel receiving. All things being equal, why not remove these falsehoods from the debate?”
Pollak is not alone. Elliott Abrams—a former deputy national security adviser to President George W. Bush and a leading pro-Israel writer and policy analyst—told The Daily Beast, “My view is over time it would be healthy for the relationship if the aid diminished. Israel should be less dependent on American financial assistance and should become the kind of ally that we have in Australia, Canada, or the United Kingdom: an intimate military relationship and alliance, but no military aid.”
That is also the view expressed by leading Israeli politicians. Naftali Bennett, Israel’s minister of economics and the leader of the right-wing Israel Home party, said in 2013, “Today, U.S. military aid is roughly 1 percent of Israel’s economy. I think, generally, we need to free ourselves from it. We have to do it responsibly, since I’m not aware of all the aspects of the budget. I don’t want to say, ‘Let’s just give it up,’ but our situation today is very different from what it was 20 and 30 years ago.”
Today Israel is prosperous. In 2000, the country’s Gross Domestic Product (GDP) was $124.9 billion. In 2013, the Israeli GDP was $291.3 billion. And that is before Israel has seen any real revenue from the fields of natural gas it recently discovered. The country has become so prosperous that legislation is now before the country’s Knesset to create a sovereign wealth fund, a state-owned investment vehicle designed to invest the surplus revenue Israel collects from selling its natural gas.
“I have heard discussions of a sovereign wealth fund, by which the Israelis mean they want to handle the revenues carefully the way Norway does and not waste them,” Abrams said. “But I do not believe a country that has a sovereign wealth fund can be an aid recipient.”
Abrams was careful to say he did not favor cutting the military aid while Obama was still president. “Were there a reduction now, it would be attributed to administration hostility to Israel and be seen as a weakening of U.S. support,” he said. “It should be done only in a context of robust American political support and close relations between American and Israeli leaders.”
Michael Oren, who served as Israel’s ambassador to Washington until 2013, said it was a mistake to view the aid to Israel as something exceptional. While it’s true the aid to Israel represents more than half of the total U.S. annual budget for foreign military financing, Oren said that statistic can be misleading.
He pointed to how the United States spends considerable money on stationing troops in, for example, Germany and on other defense obligations with NATO and non-NATO allies. “South Korea, Germany, and other allies receive military assistance but not in the form of aid,” he said in a phone interview from a Tel Aviv bomb shelter. “How much does it cost to keep the American army in Germany?”
For Oren, the most important element of the U.S. aid is not the dollar figure but what it represents politically. “The aid has a meaning that exceeds its dollar amount,” he said. “Because Israel does not have a defense treaty with the United States, the aid is a message to the region about the nature of the U.S.-Israel alliance. I see the message as more important than the aid.”
Cutting aid to Israel is not a new idea on the political right. Libertarians such as Sen. Rand Paul have at times flirted with the idea, but so have neoconservatives. The 1996 “Clean Break Memo” urged Prime Minister Benjamin Netanyahu to propose ending U.S. economic aid to Israel.
David Wurmser, one of the authors of the 1996 memo, said the idea at the time was for Israel to graduate from being a “tenuous project” to a “real country.”
“The aid both implied a lack of feasibility of the state as well as tying the state’s hands and reducing its freedom to maneuver,” said Wurmser, who went on to become an adviser to Vice President Dick Cheney and is now a consultant for American energy companies looking to invest in Israel’s hydrocarbon sector. “Both of which are inappropriate for a truly independent country, which it had become in this period.”
Wurmser today is sympathetic to phasing out military aid to Israel, but he said there should be a few exceptions. He said he favors continuing important joint U.S.-Israeli defense projects such as funding for the Iron Dome and also subsidizing Israel to purchase some military equipment from the United States, to keep elements of the U.S. defense sector economically viable.
But Wurmser added, “If this is aid in the form of a public works project for the United States, or it allows the Israelis not to make tough budget choices, then one has to question whether this is inertia, habit, or a strange dynamic to avoid the responsibility of independence.”
Ironically, the United States may ultimately want to give Israel the military aid more than the Israelis want it themselves. Oren said Obama’s policy since 2009 has been “no daylight on the security field and daylight on the diplomatic field.” In practice, that policy meant that as Obama lavished the Jewish state with high-tech radars, missile defense batteries, and bunker buster bombs, he also asked Israel publicly to end settlement construction in East Jerusalem and the West Bank as an inducement to bring the Palestinian Authority to the negotiating table. Put another way, the subsidy gives the United States leverage over the decision-making of an important ally.
“Some of this is long-standing policy that can be traced back to Richard Nixon,” Oren said of Obama’s approach. “He believed the more you aided Israel militarily, the more flexible they would be diplomatically.”
As Israeli tanks roll into Gaza, that theory may soon be put to the test. |
BANGOR, Maine — The new Bangor arena won’t be finished until early fall of next year, but it already has a name.
Thanks to a $3 million, 15-year agreement with the city of Bangor, the arena will officially be known as the Cross Insurance Center.
“We were initially approached by Steve Rex of Front Row Marketing July 5 and made an offer July 9,” said Brent Cross, vice president of the Bangor-based Cross Insurance Agency. “We haven’t signed a contract yet, but we have signed a solid letter of intent.”
The deal calls for quarterly payments of $50,000 by Cross for naming rights, as well as an exclusive 12-month renegotiation period that kicks in 12 years into the deal that allows Cross to extend its contract by as many as 10 years.
“We would love to see our name stay on the building for a long time,” Cross said. “First and foremost, we were looking to support the arena and the city, even before Steve called us.
“It took a lot of courage for the city to tackle something of this size. We’d not considered having our name on the side of the building, but we’re excited about it.”
Based on their public statements, so are city officials.
“What an amazing day for Bangor. A hearty thank you to the Cross family and Cross Insurance for their belief in not only this project but in the future of Bangor,” said Bangor City Councilor and Mayor Cary Weston. “The energy and support we have seen throughout this project from our business community, starting with the amazing effort of the Friends [of the Arena] group, has been tremendous. And for a family-owned business with longstanding Bangor roots to step forward like this makes it even more special.”
Cross said the deal brings instant local, regional and national visibility to his 58-year-old family business.
“This brings a lot of exposure to this company,” said Cross. “People have this impression of our business being my father and my brother and I with our desks pushed together in one office.”
While the company is still family-based with three generations currently employed, it also has grown into a regional insurance presence with 450 employees, 27 locations across New England and clients that include the New England Patriots and Boston Red Sox.
“That’s probably the main reason why we’re doing this,” said Cross, whose 95-year-old father, Woodrow Cross, started the agency in 1954 and still works 5½ days a week at the Bangor headquarters on Gilman Road. “It gives us more of a regional and national branding.”
Five employees currently represent three generations of the Cross family: Brent Cross, his father, brother Royce, son Woody and nephew Jonathan.
The deal also provides an opt-out option for Cross Insurance that includes financial penalties, but Cross couldn’t provide specifics because the contract language is still being worked out.
The $65 million arena and events center — featuring 5,800 fixed seats with a total capacity of about 8,050, seated and standing — is on schedule and expected to officially open Labor Day weekend 2013.
Front Row Marketing Services, a company specializing in generating ancillary income for sports and entertainment venues, completed the naming rights agreement on Bangor’s behalf. Global Spectrum, an international public assembly facilities management company, was hired by Bangor to operate Cross Insurance Center. Both Front Row and Global Spectrum are subsidiaries of Comcast-Spectacor, an international sports and entertainment provider.
Correction:An early version of this story said Woodrow Cross works one day a week. He works five and a half. |
Lung cancer cell lines harboring MET gene amplification are dependent on Met for growth and survival.
Recent clinical successes of small-molecule epidermal growth factor receptor (EGFR) inhibitors in treating advanced non-small cell lung cancer (NSCLC) have raised hopes that the identification of other deregulated growth factor pathways in NSCLC will lead to new therapeutic options for NSCLC. Met, the receptor for hepatocyte growth factor, has been implicated in growth, invasion, and metastasis of many tumors including NSCLC. To assess the functional role for Met in NSCLC, we evaluated a panel of nine lung cancer cell lines for Met gene amplification, Met expression, Met pathway activation, and the sensitivity of the cell lines to short hairpin RNA (shRNA)-mediated Met knockdown. Two cell lines, EBC-1 and H1993, showed significant Met gene amplification and overexpressed Met receptors which were constitutively phosphorylated. The other seven lines did not exhibit Met amplification and expressed much lower levels of Met, which was phosphorylated only on addition of hepatocyte growth factor. We also found a strong up-regulation of tyrosine phosphorylation in beta-catenin and p120/delta-catenin in the Met-amplified EBC-1 and H1993 cell lines. ShRNA-mediated Met knockdown induced significant growth inhibition, G(1)-S arrest, and apoptosis in EBC-1 and H1993 cells, whereas it had little or no effect on the cell lines that do not have Met amplification. These results strongly suggest that Met amplification identifies a subset of NSCLC likely to respond to new molecular therapies targeting Met. |
Q:
Plotting temporal data over multiple months using a standardized x-axis
Date_Time Temp...C. Anglers.Names Water.Body
7/17/2016 8:05:00 24 Jones & Bishop Lake 1
7/17/2016 9:05:00 25 Jones & Bishop Lake 1
7/17/2016 10:05:00 26 Jones & Bishop Lake 1
8/15/2016 8:00:00 26 Smith & Nelson Lake 2
8/15/2016 9:00:00 26 Smith & Nelson Lake 2
8/15/2016 10:00:00 27 Smith & Nelson Lake 2
9/12/2016 8:02:00 25 Militello & Culberson Lake 3
9/12/2016 11:02:00 26 Militello & Culberson Lake 3
9/12/2016 14:02:00 26 Militello & Culberson Lake 3
I have a dataset from a bass live well study where I monitored temperatures in angler's live wells by placing a temp logger in their live wells throughout a tournament day. My question is, is there a way to plot the temperature over time, faceted by the water body and then color coded by the unique angler's name. I'm not sure if the quickest way is to subset out by water body (I have 14 water bodies that I worked), creating 14 new individual datasets, make a plot for that individual water body, and then once I'm done arrange them using something like grid.arrange. When trying to make a single faceted plot for all water bodies, the problem I'm trying to work around is getting the x-axis limits to just be a standard range of hours, regardless of date (for me on my real data probably something like 7 AM - 3 PM since that's about how long most tournaments lasted). But since the study occurred over multiple months, R wants to use the entire 3 months as the x-axis limits.
LivewellTemp <- ggplot(HOBO.Data, aes(Date_Time, Temp...C.,colour=Anglers.Names))+
facet_wrap(~Water.Body)+
geom_line(linetype=2)
A:
Is this what you're after?
LivewellTemp <- ggplot(HOBO.Data, aes(Date_Time, Temp...C.,colour=Anglers.Names))+
facet_wrap(~Water.Body)+geom_line(linetype=2)+
scale_x_discrete(labels=c("7am", "8am", "9am", "10am", "11am", "12pm", "1pm", "2pm", "3pm"))
|
Less than 24 hours after Gawker.com was killed by billionaire Peter Thiel’s legal crusade against it, another billionaire couple – Donald and Melania Trump – is already using the same law firm Thiel did to threaten more media organizations into silence. And this time, it could have a direct effect on the presidential election.
The Guardian reported late on Monday night that Melania Trump’s lawyers have sent threatening letters and are considering filing lawsuits against a variety of media organizations – including the Daily Mail, Politico and the Week – for reporting on rumors of Melania Trump’s past, including her alleged immigration status when she came to the United States.
This is the quintessential example of the disturbing precedent Peter Thiel has just set by creating a blueprint for billionaires to destroy news organizations they do not like. He has shown that all they need is a little persistence. And in a media landscape that is increasingly dominated by the rich and powerful, that should give even Gawker’s most ardent critics pause.
We know Donald Trump and others have gone down this path before. Trump has openly bragged about the fact that he sued a former New York Times reporter in the early aughts for the purpose of trying to hit the reporter involved financially. Trump did lose that lawsuit, but not until after litigation that undoubtedly cost hundreds of thousands of dollars in legal fees for the winning party.
And if you think the Trumps are litigious now, just wait until after November. Peter Scheer, director of the First Amendment coalition, explained the consequences of the Gawker case succinctly:
Say five years from now, if Trump loses and people are writing critical postmortems, will they have to worry that Trump will turn around and sue them? Because of the Gawker trial, I fear that many journalists will wonder, “Could that happen to me, even in writing about Trump?” They will be censoring themselves. That is the worst outcome here, and it’s quite likely.
But Trump is not the only culprit. In yet another ominous example, Mother Jones, the liberal nonprofit magazine known for its investigative journalism, spent millions of dollars in legal fees when another billionaire, Frank VanderSloot, sued the company and its reporters over a critical story and some tweets from its editors. Mother Jones won the case last year, relatively early in the process, but still faced an existential financial crisis because of the enormous legal costs associated with the lawsuit. VanderSloot then announced a million-dollar fund to be used for suing Mother Jones and additional members of the “liberal press” in other cases.
Even in the Hulk Hogan case, though many people rightly found the story and sex tape offensive and argued it shouldn’t have been published to begin with, a federal judge and an appeals court panel both ruled Gawker was protected by the first amendment before the trial, and they were prevented from having an appeals court rule on the judgment before they filed for bankruptcy.
But we shouldn’t forget that Gawker was not just getting sued over the Hulk Hogan sex tape case. They were the recipient of a half-dozen other lawsuits or legal threats involving many stories of an investigative or critical nature that virtually any first-year law student could tell you are clearly protected by the first amendment.
In the end, even if you think Gawker deserved punishment, media organizations should not face the financial death penalty for a mistake, even a deplorable and egregious one. After all, there is probably one billionaire or another who hates pretty much every news organization in the world worth their salt. If they all decide to go down the path Thiel took, how many publications will be left when they’re done? |
All last month, the positive sentiment surrounding Bitcoin, crypto, and even Facebook Libra turned negative after United States President Donald Trump made some negative tweets about the digital asset class and its illicit use in criminal activities such as money laundering, cybercrime, drug trade, and more.
And while many Trump-appointed policymakers came out of the woodwork ready to kick crypto while it was down, a former Trump advisor is coming out in support of Bitcoin and crypto, saying it has a “big future” and will play an important role in the “global populist revolt” that’s underway across the world.
Turning on Trump: Former Chief White House Strategist Supports Bitcoin and Crypto
While speaking on a segment of CNBC Squawk Box, recent Bitcoin skeptic turned believer Joe Kernen, who has vehemently defended the crypto asset against chief financial regulators, and other guests he has debated – asks former White House chief strategist Steve Bannon what his thoughts are about Bitcoin and the entire asset class.
Related Reading | CNBC Host Pushes Bitcoin, Cites Halving and Scarcity As Catalyst for $55K BTC
Kernen jokingly asks “Bitcoin Bannon” if he was buying the crypto asset at recent bear market lows, to which he said he did indeed have the “foresight” and “courage” to buy as it crashed. From there Bannon expands on his beliefs around Bitcoin, suggesting that the asset class has a “big future” given the current political and economic climate.
"I think cryptocurrencies have a big future," says Steve Bannon. "I think they could be a very important part going forward particularly in this global populist revolt." pic.twitter.com/lYce7qzrIY — Squawk Box (@SquawkCNBC) August 2, 2019
Bitcoin itself he thinks will play a “very important” role in the “global populist revolt” underway across the world. Populism is a political orientation that focuses on the idea that the people and the government or ruling “elite” are at odds with one another. This idea is at the very core of crypto, and Bitcoin was designed to put power over money back in the hands of the people, and away from the control the current “elite” have over people due to it.
The United States first popularized the themes around populism alongside democracy in the 19th century. To this day, populism runs deep in American politics and some argue none more so ever than the current administration.
Bitcoin was also designed to be a replacement for fiat currencies and was hard-coded to have attributes that make it a strong hedge in a struggling economy, once it reaches its full potential.
Related Reading | United States Regulators Begin Crack Down on Crypto and Bitcoin Crime
Bannon is a believer in crypto and Bitcoin, and recently news broke of the former White House chief strategist working on a cryptocurrency project that rewards political activism and standing up against the same global populist movement that Bannon thinks Bitcoin will play an important role in.
Featured image from Shutterstock |
Outstanding quality, transparent business deals, and rock bottom prices, these are the main aspects that enable Lux Collection to become the first and foremost priority amongst its competitors. The company is showcasing an exquisite collection of Translucent Panels that is well designed and developed by skilled designers who possess immense experience in this domain. Extensively used for interior as well as exterior application, these beautiful panels completely add an elegant touch to the entire decor of the place. Well acknowledged for vibrant colors, unique designs, appealing look, customized sizes, unmatched shades, elegant patterns, easy to clean, simple to install, crack/ scratch free, and durability, the intact collection is extremely pleased and highly demanded not only in Australia but all across the worldwide markets.
Apart from translucent panels, if you are looking for beautiful tiles for your Kitchen Renovations, Perth is only place you could find it. The tiles of your kitchen are very important to match the aesthetic of the space. Prominent name in the Perth, Luxe Colection helps you in transforming your kitchen by offering world class range of tiles that is fabricated using finest quality natural stones. To acquire complete satisfaction, every single tile is manufactured as per specifications laid down by the clients and also rigorously checks on certain parameters to make sure best product to be deliver at the client doorstep within decided timeline.
Further, in Perth, Hardware Stores are so many but Luxe Collections is a one stop shop for all kind of hardware products such as Bathware, Chandeliers, Designer Tiles, Mosaics, Semi-Precious Stone, Art Glass, and Stone & Tile. In order to ensure unmatched quality, all these products are crafted by experienced designers as per latest trend prevailing in the market. Perfectly suit to both residential as well as commercial areas, the entire range has set a benchmark not only in Perth but all across the national as well as international market. Moreover, the wonderful collection of Luxe Collections is the perfect blend of beautiful designs, latest styles, and highly affordable price. |
The present invention relates to pressure monitoring devices for externally monitoring the pressure within a disposable pumping cassette used to pump intravenous fluids.
In administering intravenous fluids to patients, it is becoming increasingly common to use inexpensive disposable pumping cassettes made of plastics, which are operated by non disposable driver mechanisms external to the cassette. Such systems have replaced the time honored gravity flow fluid administration systems to a large extent due to their greater accuracy and labor saving features.
Monitoring the pressure of the fluid being discharged from the cassette can provide useful information. As disclosed in U.S. Pat. No. 4,457,753, monitoring discharge pressure permits the detection of occlusions or plugged filters in the cassette outlet line leading to the patient. As disclosed in copending U.S. application Ser. No. 045,958 entitled Disposable Fluid Infusion Pumping Chamber Cassette and Drive Mechanism thereby John Pastrone (the disclosure of which is incorporated herein by reference), monitoring discharge pressure also permits the cassette and its valves to be checked for leakage. Also, the patient's blood pressure can be followed by monitoring discharge line pressure at certain times during the cassette pumping cycle as disclosed in the aforementioned patient application.
However, there should also be a pressure transducer which can detect occlusions in the cassette inlet line from the solution container to the cassette. Furthermore, there is a need for pressure transducers which can make the pressure measurements described above accurately. |
Curious what I find enjoyable that isn't Garry's Mod? Well...youve come to the right place!
Chilled's Games reviews
"I'm interested in Unique and curious games that push and pave the way of interactivity. But I am also a fan of your Standard Triple A titles as well."
Here are a few recent reviews by Chilled's Games |
# This file is under the MIT License by authors
Enabled=Enged\u00E9lyezve
Environment\ Variables=K\u00F6rnyezeti V\u00E1ltoz\u00F3k
Name=N\u00E9v
Plugins=Be\u00E9p\u00FCl\u0151k
System\ Properties=Rendszer Tulajdons\u00E1gok
Version=Verzi\u00F3
|
Hi! I have a question about a guy, help pls?
so I have a guy friend, we were not too close at first, but suddenly he's been showing a lot of signs that shows he likes me (hug me, hold my hand, mock strangling, leaning on my shoulder, and many more). but he told me that he isn't interested in dating as long as he's in college, but whenever we're alone he's always trying to hug me etc, but its clear that he's keeping his distance when everybody else is around. why is that? does he like me? does he even interested in dating me? |
PREHOOK: query: select
cast('abc' as varchar(10)) = cast('abc' as varchar(10)),
cast('abc' as varchar(10)) <= cast('abc' as varchar(10)),
cast('abc' as varchar(10)) >= cast('abc' as varchar(10)),
cast('abc' as varchar(10)) < cast('abd' as varchar(10)),
cast('abc' as varchar(10)) > cast('abb' as varchar(10)),
cast('abc' as varchar(10)) <> cast('abb' as varchar(10))
from src limit 1
PREHOOK: type: QUERY
PREHOOK: Input: default@src
#### A masked pattern was here ####
POSTHOOK: query: select
cast('abc' as varchar(10)) = cast('abc' as varchar(10)),
cast('abc' as varchar(10)) <= cast('abc' as varchar(10)),
cast('abc' as varchar(10)) >= cast('abc' as varchar(10)),
cast('abc' as varchar(10)) < cast('abd' as varchar(10)),
cast('abc' as varchar(10)) > cast('abb' as varchar(10)),
cast('abc' as varchar(10)) <> cast('abb' as varchar(10))
from src limit 1
POSTHOOK: type: QUERY
POSTHOOK: Input: default@src
#### A masked pattern was here ####
true true true true true true
PREHOOK: query: select
cast('abc' as varchar(10)) = cast('abc' as varchar(3)),
cast('abc' as varchar(10)) <= cast('abc' as varchar(3)),
cast('abc' as varchar(10)) >= cast('abc' as varchar(3)),
cast('abc' as varchar(10)) < cast('abd' as varchar(3)),
cast('abc' as varchar(10)) > cast('abb' as varchar(3)),
cast('abc' as varchar(10)) <> cast('abb' as varchar(3))
from src limit 1
PREHOOK: type: QUERY
PREHOOK: Input: default@src
#### A masked pattern was here ####
POSTHOOK: query: select
cast('abc' as varchar(10)) = cast('abc' as varchar(3)),
cast('abc' as varchar(10)) <= cast('abc' as varchar(3)),
cast('abc' as varchar(10)) >= cast('abc' as varchar(3)),
cast('abc' as varchar(10)) < cast('abd' as varchar(3)),
cast('abc' as varchar(10)) > cast('abb' as varchar(3)),
cast('abc' as varchar(10)) <> cast('abb' as varchar(3))
from src limit 1
POSTHOOK: type: QUERY
POSTHOOK: Input: default@src
#### A masked pattern was here ####
true true true true true true
PREHOOK: query: select
cast('abc' as varchar(10)) = 'abc',
cast('abc' as varchar(10)) <= 'abc',
cast('abc' as varchar(10)) >= 'abc',
cast('abc' as varchar(10)) < 'abd',
cast('abc' as varchar(10)) > 'abb',
cast('abc' as varchar(10)) <> 'abb'
from src limit 1
PREHOOK: type: QUERY
PREHOOK: Input: default@src
#### A masked pattern was here ####
POSTHOOK: query: select
cast('abc' as varchar(10)) = 'abc',
cast('abc' as varchar(10)) <= 'abc',
cast('abc' as varchar(10)) >= 'abc',
cast('abc' as varchar(10)) < 'abd',
cast('abc' as varchar(10)) > 'abb',
cast('abc' as varchar(10)) <> 'abb'
from src limit 1
POSTHOOK: type: QUERY
POSTHOOK: Input: default@src
#### A masked pattern was here ####
true true true true true true
PREHOOK: query: select
cast(' abc' as varchar(10)) <> cast('abc' as varchar(10))
from src limit 1
PREHOOK: type: QUERY
PREHOOK: Input: default@src
#### A masked pattern was here ####
POSTHOOK: query: select
cast(' abc' as varchar(10)) <> cast('abc' as varchar(10))
from src limit 1
POSTHOOK: type: QUERY
POSTHOOK: Input: default@src
#### A masked pattern was here ####
true
PREHOOK: query: select
cast('abc ' as varchar(10)) <> cast('abc' as varchar(10))
from src limit 1
PREHOOK: type: QUERY
PREHOOK: Input: default@src
#### A masked pattern was here ####
POSTHOOK: query: select
cast('abc ' as varchar(10)) <> cast('abc' as varchar(10))
from src limit 1
POSTHOOK: type: QUERY
POSTHOOK: Input: default@src
#### A masked pattern was here ####
true
|
1. Field of the Invention
The present invention relates generally to patio umbrellas and specifically to improved patio umbrellas with integral lighting systems and other modular electronic systems and components.
2. Description of Related Art
There has been a recent increase in the interest in entertaining in a lawn and garden environment. Patio furniture is quite popular and useful for outdoor entertaining, especially in portions of the country that have warmer climates. However, the sun often presents an impediment to such outdoor entertaining. Consequently, sales have increased for relatively large patio and table umbrellas for use in shielding or shading table areas and people sitting around the tables from direct exposure to the sunlight. Given the relatively high degree of interest in patio umbrellas, it is likely that improved umbrellas, or umbrellas with enhanced functions, will be well received in the marketplace. |
Personal tools
Pennsylvania OHH Regulation
The final Pennsylvania DEP outdoor wood-fired boiler (OWB) regulation was published in the PA Bulletin on October 2, 2010. The provisions of the regulation became effective on 10/2/2010. There is a sell-through provision for non-Phase 2 OWBs until May 31, 2011. However, any non-Phase 2 OWB sold between 10/2/2010 and 5/31/2011, must have a setback of 150 feet from the property line and have a permenently attached stack that is 10 feet above the ground and is installed according to manufacturer's specifications.
Here is the link to the PA DEP outdoor wood-fired boiler regulation as published on October 2, 2010, in the PA Bulletin publication. The actual regulation is toward the end of this document. |
#/** @file
#
# Copyright (c) 2017-2018, Andrei Warkentin <andrey.warkentin@gmail.com>
# Copyright (c) 2016, Linaro Ltd. All rights reserved.
# Copyright (c) 2015-2016, Red Hat, Inc.
# Copyright (c) 2014, ARM Ltd. All rights reserved.
# Copyright (c) 2007-2014, Intel Corporation. All rights reserved.
#
# SPDX-License-Identifier: BSD-2-Clause-Patent
#
#**/
[Defines]
INF_VERSION = 0x0001001A
BASE_NAME = PlatformBootManagerLib
FILE_GUID = 92FD2DE3-B9CB-4B35-8141-42AD34D73C9F
MODULE_TYPE = DXE_DRIVER
VERSION_STRING = 1.0
LIBRARY_CLASS = PlatformBootManagerLib|DXE_DRIVER
#
# The following information is for reference only and not required by the build tools.
#
# VALID_ARCHITECTURES = AARCH64
#
[Sources]
PlatformBm.h
PlatformBm.c
[Packages]
MdeModulePkg/MdeModulePkg.dec
MdePkg/MdePkg.dec
ShellPkg/ShellPkg.dec
Platform/RaspberryPi/RaspberryPi.dec
[LibraryClasses]
BaseLib
BaseMemoryLib
BootLogoLib
CapsuleLib
DebugLib
DevicePathLib
DxeServicesLib
HobLib
MemoryAllocationLib
PcdLib
PrintLib
UefiBootManagerLib
UefiBootServicesTableLib
UefiLib
[FeaturePcd]
gEfiMdePkgTokenSpaceGuid.PcdUgaConsumeSupport
[FixedPcd]
gEfiMdePkgTokenSpaceGuid.PcdUartDefaultBaudRate
gEfiMdePkgTokenSpaceGuid.PcdUartDefaultDataBits
gEfiMdePkgTokenSpaceGuid.PcdUartDefaultParity
gEfiMdePkgTokenSpaceGuid.PcdUartDefaultStopBits
gEfiMdePkgTokenSpaceGuid.PcdDefaultTerminalType
[Pcd]
gEfiMdePkgTokenSpaceGuid.PcdPlatformBootTimeOut
gRaspberryPiTokenSpaceGuid.PcdSdIsArasan
[Guids]
gEfiFileInfoGuid
gEfiFileSystemInfoGuid
gEfiFileSystemVolumeLabelInfoIdGuid
gEfiEndOfDxeEventGroupGuid
gEfiTtyTermGuid
gUefiShellFileGuid
gEfiEventExitBootServicesGuid
[Protocols]
gEfiDevicePathProtocolGuid
gEfiGraphicsOutputProtocolGuid
gEfiLoadedImageProtocolGuid
gEfiPciRootBridgeIoProtocolGuid
gEfiSimpleFileSystemProtocolGuid
gEsrtManagementProtocolGuid
gEfiUsb2HcProtocolGuid
|
Newly renovated, bright and quiet 3-room apartment in old, converted barn. The apartment is on the 1st floor. There are 2 bedrooms each with 2 beds (2 x 80 x 200cm and 2 x 80 x 210cm), a bathroom and a separate toilet. The modern, fully equipped kitchen has a direct exit to the terrace with a view of the beautiful, secluded garden, directly at the little brook.
Free, private parking, right in front of the house. Basel and Airport Basel / Mulhouse can be reached in 30 minutes by car.
It was a very nice place, the garden was just perfect to lay down and chill out. The house was in perfect conditions, it had all the necessary things we need and more. The town is really quiet and perfect to go walking everywhere. I would definitely recomend this house and the good hosters. Just tu say something, the tv shouldn't be Just behind the kitchen wall because it was difficult to watch it.
First class accommodation, a great secluded home to relax and enjoy the undisturbed tranquility of the countryside. Annick and her husband were perfect kind hosts to make our stay unique and comfortable. There was fresh homemade jam waiting for us and they also kindly left their coffee machine available to use which was very convenient. They lived nearby and made sure we were settled - especially very grateful when they helped us when we got lost one night! The town is not so far from Basel - as we travelled to see the fair, it was nice to relax their after an entire day walking around the art booths.
Billy2015-06-19T00:00:00Z
Værelsestype
Helt hjem/lejlighed
Ejendomstype
Lejlighed
Med plads til
6
Soveværelser
Small studio in calm
In an Alsatian village with bakery and supermarket
with wifi FREE parking in front of the studio with washing machine and dryer kitchen any team in the three borders Switzerland Germany France 20 minutes from the Basel - Mulhouse airport
To come HERE transport transit www vialsace fr
We highly recommend this accommodation, peaceful and very comfortable. We were there to visit Basel which is located nearby. We enjoyed the comfort, cleanliness, functionality of housing and the constant attention of Madeleine and her husband generous reception with local products, their warm welcome. A big thank you to them, a place to discover!
Agnes2017-04-23T00:00:00Z
Værelsestype
Helt hjem/lejlighed
Ejendomstype
Lejlighed
Med plads til
6
Soveværelser
COMFY AND SERENE recently renovated studio in a beautiful quiet neighbourhood
Great location! Only 15' drive to Basel city or 30' by public transport to chill at the terrace, surrounded by trees and flowers perfume, hearing birds singing; filling up your lungs with fresh air at the breath-taking hill views
Gorgeous area for hiking, biking; a combination of little pleasant quarter with some nice restaurants surrounded by forest and farm
Separate entrance, parking and terrace with garden furniture
- Grocery store near the studio open until 20:00
- Fresh products can be bought in nearby farms
- The neighbourhood is surrounded by forest and farm, with horses, llamas, cows; where you can buy fresh milk 24x7
- The street is quiet and safe
- Playground for children 7’ walking
The Nathalie housing is entirely consistent with the descriptions. It is very comfortable and very friendly. Bedding is very good. The studio is very well equipped. The hamlet is very quiet for a relaxing stay. Nathalie welcomes occupants with great kindness.
Jacques2017-04-20T00:00:00Z
trés bon accueil ! top
pauline2017-05-17T00:00:00Z
Natalie's place is gorgeous! About 10 - 15 minute drive out of Basel, it is in it own little village. Local groccey shops, and restaurants are closeby. Nathalie was very nice, and as helpful as you need her to be. We really enjoyed our stay at hers.
This Appart'Hotel, well furnished and freshly renovated with kitchen, bathroom and very comfortable beds (twin or king size) will make you feel at home. The possibility to have a breakfast, the free fitness area will assure you a nice stay. You can reach a five minutes walk the swiss public transport to Basel. For a short or long stay, wether business or tourism trip, our team stays at your entire disposal for any requires. Hope to welcome you soon !
Sebastian met us at the airport and we followed him to his apartment which was great to have an escort. The apartment was relatively new and Sebastian and his partner made us feel extremely welcome. a fully stocked fridge and fruit on the table was left for us. |
Saying Goodbye is Hard for All
Most people have read my previous post about Raising the Parting Glass and how hard I find it to be saying goodbye all the time. But I have to admit that I didn’t think that the implications of saying goodbye were as widely felt by Malians and International folks alike. The truth is no one likes saying goodbye. It’s hard for everyone. I just had never thought about how the wider community would be impacted. I know that when my colleagues leave, our local staff feel sadness and that sense of loss. But yesterday I saw how people who come and go also have an effect on the wider community as well.
I have a vegetable lady – her name is Héléne. She has a small vegetable stand near to my house and sets up shop every day from about 4:30pm- 11pm. She’s the go-to Loblaws or Sobeys (Walgreens? for my american friends and Carrefour? for my European friends) equivalent, when you run out of veggies and just have to have salad for supper or made a whole recipe and realized you’re out of garlic and onions. She has been nothing but kind to me, and is always quick to throw in a “gift” every now and again to show appreciation for customer loyalty. There is not the same sense of market forces here in Mali, and so prices are pretty standardized from one vendor to another. You return to one specific person because you have a relationship with that vendor, not necessarily because you save more or get different varieties.
The other day though, I went to buy some salad and other supplies for the week and Héléne was deep in conversation with someone. I waited patiently as they held hands, the way you would if you lost someone, and they finished their conversation. Héléne proceeded to greet me as she wiped tears from her eyes, and the man walked hurriedly away. I asked her what was going on and what was making her so upset? She explained that the man she was speaking with has been in Bamako for four years and has been a kind and loyal customer since he first arrived. The time has come now though, that he has decided to leave Mali and go back to Europe.
The fact is, that when we come to a new country to work, we create a life in that place. We grow to have relationships not only with our colleagues but also with people in the world around us. The contract to contract life adds levels of excitement for those who are moving on, but it can be hard for those people who are left behind – whether they be host country nationals or international workers. We form bonds and it’s not easy to say goodbye. I guess the solace is that bonds are formed and are hard to break, even through the distance and the years. |
Liber Diurnus Romanorum Pontificum
A miscellaneous collection of ecclesiastical formularies used in the papal chancery until the eleventh century. It contains models of the important official documents usually prepared by the chancery ; particularly of letters and official documents in connexion with the death, the election, and the consecration of the pope ; the installation of newly elected bishops, especially of the suburbicarian bishops ; also models for the profession of faith, the conferring of the pallium on archbishops, for the granting of privileges and dispensations, the founding of monasteries, the confirmation of acts by which the Church acquired property, the establishment of private chapels, and in general for all the many decrees called for by the extensive papal administration. The collection opens with the superscriptions and closing formulæ used in writing to the emperor and empress at Constantinople, the Patricius, the Exarch and the Bishop of Ravenna, a king, a consul; to patriarchs, metropolitans, priests, and other clerics. The collection is important both for the history of law and for church history, particularly for the history of the Roman Church. The formularies and models set down are taken from earlier papal documents, especially those of Gelasius I (492-6) and Gregory I (590-604).
This collection was certainly compiled in the chancery of the Roman Church, but probably a comparatively small number of the formularies contained in the extant manuscripts were included at first, the remainder being added from time to time. There is no systematic arrangement of the formularies in the manuscripts. In its final form, as seen in the two existing manuscripts (one codex in the Vatican Archives, and another, originally from Bobbio, in the Ambrosian Library at Milan ), the Liber Diurnus dates back to the eighth century. Concerning the more exact determination of the date of its compilation, there is even a still great diversity of opinion. Garnier gives in his edition the year 715. Zaccaria, in his "Dissertationes" (P. L., CV, 119 sqq.), attributes the compilation to the ninth century; Rozière, to whom we owe the first good edition (see below), decides for the period 685 to 751 — the former date, because Emperor Constantine Pogonatus (died 685) is mentioned as dead, and the latter, because in 751 Northern Italy was conquered by the Lombards and the Byzantine administration at Ravenna came to an end (see Introduction, pp. 25 sqq.). Sickel, however in his "Prolegomena" and in his researches on the Liber Diurnus (see below), has shown that the work possesses by no means a uniform character. He recognizes in it three divisions, the first of which he ascribes to the time of Honorius I (625-38), the second to the end of the seventh century, and the third to the time of Hadrian I (772-95). Duchesne (Bibliothèque de l'Ecole des Chartes, LII, 1891, pp. 7 sqq.) differs from Sickel, and maintains that the original version of most of the formularies, and among them the most important, must be referred to the years after 682, and that only the last formularies (nn. lxxxvi-xcix) were added in the time of Hadrian I, though some few of these may have existed at an earlier date. Hartmann defends the views of Sickel (Mitteilungen des Instituts für österreich. Gesch., XIII, 1892, pp. 239 sqq.). Friederich (Sitzungsberichte der bayer. Akademie der Wiss. zu München, Phil.-hist. Kl., I, 1890, pp. 58 sqq.) investigated more closely the case of some of the formularies attributed by Sickel to one of the aforesaid periods, and attempted to indicate more nearly the occasions and pontificates to which they belonged. These investigations have established beyond doubt that the collection had already attained its present form towards the end of the eighth century, though no insignificant portion had been compiled during the seventh century. The Liber Diurnus was used officially in the papal chancery until the eleventh century, after which time, as it no longer corresponded to the needs of papal administration, it gave way to other collections. Twelfth century canonists, like Ivo of Chartres and Gratian, continued to use the Liber Diurnus, but subsequently it ceased to be consulted, and was finally completely forgotten.
Lucas Holstenius was the first who undertook to edit the Liber Diurnus. He had found one manuscript of it in the monastery of Santa Croce in Gerusalemme at Rome, and obtained another from the Jesuit Collège de Clermont at Paris ; but as Holstenius died in the meantime and his notes could not be found, this edition printed at Rome in 1650 was withheld from publication, by advice of the ecclesiastical censors, and the copies put away in a room at the Vatican. The reason for so doing was apparently formula lxxxiv, which contained the profession of faith of the newly elected pope, in which the latter recognized the Sixth General Council and its anathemas against Pope Honorius for his (alleged) Monothelism. The edition of Holstenius was reprinted at Rome in 1658; but was again withdrawn in 1662 by papal authority, though in 1725 Benedict XIII permitted the issue of some copies. From the Clermont manuscript, which has since disappeared, Garnier prepared a new edition of the Liber Diurnus (Paris, 1680), but it is very inaccurate, and contains arbitrary alterations of the text. In his "Museum Italicum" (I, II, 32 sqq.) Mabillon issued a supplement to this edition of Garnier. From these materials, the Liber Diurnus was reprinted at Basle (1741), at Vienna (1762), and by Migne (P. L., CV, Paris, 1851). The first good edition, as stated above, we owe to Eug. de Rozière (Liber Diurnus ou Recueil des formules usitées par la Chancellerie pontificale du V e au XI e siècle, Paris, 1869). In the interest of this edition Daremberg and Renan compared Garnier's text with the Vatican manuscript, then regarded as the only authentic one. From this manuscript Th. von Sickel prepared a critical edition of the text: "Liber Diurnus Rom. Pont. ex unico codice Vaticano denuo ed." (Vienna, 1889). Just after the appearance of this work, however, Ceriani announced the discovery of a new manuscript, originally from Bobbio, in the Ambrosian Library at Milan ; towards the end this was more complete than the Vatican manuscript. This text was published by Achille Ratti (Milan, 1891).
More Encyclopedia
The Catholic Encyclopedia is the most comprehensive resource on Catholic teaching, history, and information ever gathered in all of human history. This easy-to-search online version was originally printed between 1907 and 1912 in fifteen hard copy volumes.
Designed to present its readers with the full body of Catholic teaching, the Encyclopedia contains not only precise statements of what the Church has defined, but also an impartial record of different views of acknowledged authority on all disputed questions, national, political or factional. In the determination of the truth the most recent and acknowledged scientific methods are employed, and the results of the latest research in theology, philosophy, history, apologetics, archaeology, and other sciences are given careful consideration.
No one who is interested in human history, past and present, can ignore the Catholic Church, either as an institution which has been the central figure in the civilized world for nearly two thousand years, decisively affecting its destinies, religious, literary, scientific, social and political, or as an existing power whose influence and activity extend to every part of the globe. In the past century the Church has grown both extensively and intensively among English-speaking peoples. Their living interests demand that they should have the means of informing themselves about this vast institution, which, whether they are Catholics or not, affects their fortunes and their destiny. |
Editors Note: Welcome to our newest bi-weekly column, Classing Up Cannabis. Consider this your go-to spot for fluid, applicable advice regarding the image, design, marketing, and branding of your cannabis business. Right now, most of the content in the cannabis zeitgeist neglects to highlight or speak to the minds behind businesses—you know, those fueling the industry. Whether you’re just launching a brand or your long-time business has weathered the transitional storm of complex regulation, we dedicate this column to you.
When medical cannabis was first legalized in California in 1996, the concept of cannabis branding was essentially non-existent. Dispensaries looked less like retail stores and more like back-alley speakeasies with bars on the window and a generally uninviting atmosphere, accented by packaging products in Ziplock baggies.
Fast-forward twenty years, and the landscape is drastically different. Instead of being sketchy holes in the wall, most dispensaries resemble Apple stores. So, what happened? How did cannabis dispensaries change, and what are the design elements that prospective dispensary owners can implement in their stores? If you’ve ever asked yourself these questions, we’ve got answers for you.
Great Lighting
Good dispensary design starts with good lighting. When the first handful of cannabis dispensaries opened their doors in the late ‘90s, most were illuminated with harsh fluorescent lights that glared in customers’ eyes and made everything feel and look dingy. Most contemporary dispensaries have done away with hospital lighting in favor of a more pleasant experience.
In order to create a more pleasant lighting experience in your cannabis dispensary, try and utilize the three types of lighting: ambient, accent, and task lighting. Ambient lighting is used to illuminate the room, usually in the form of recessed lighting. Task lighting, on the other hand, performs a specific purpose and often appears in the form of direction light fixtures, pendant lighting, or a simple desk lamp. Accent lighting is used for aesthetic purposes, such as a chandelier, although it may also serve a functional purpose as well.
By understanding how the three types of lighting interact, you can help give your cannabis dispensary an inviting atmosphere. Start with your ambient lighting to get a general feel for your store, and then move on to accent lighting. Is there a place in the store that you want people to focus on? Try placing some accent lighting to draw in their attention.
One dispensary that does a good job with lighting is Good Chemistry. This dispensary has been able to create a warm and inviting storefront that would make any shop owner jealous. They use a combination of task and accent lighting to draw customers to the kiosks in the middle of the store. Notice how the ambient lighting illuminates the store, but doesn’t overpower the senses? You don’t have to copy this lighting scheme yourself. Do take note of how the three types of lighting interact, however, and use that to your advantage.
Customer Education
Not everyone is well-versed in what constitutes good cannabis. And for those people, walking into a 420 retail store can be intimidating. What’s the difference between Blueberry Kush and Lemon Kush? Is it the flavor? Will I get too high? These are the kinds of questions customers and patients will ask, and consequently, dispensary owners need to dedicate some of their resources to customer education.
Naturally, this involves having a team of educated budtenders. But it also goes deeper than that. To start, cannabis products need to be displayed in such a way that customers can easily identify and inspect them. For example, MedMen has clear plastic containers that have dry flower in them and vents so customers can get a whiff of the herb. In front of those containers are tablets that contain information about the strain, including: name, potency, and a detailed breakdown of its cannabinoids. Though many customers don’t particularly care about the percentage of THC-A in their cannabis, being able to see and smell what the product will go a long way in terms of improving customer experience.
Another way to improve customers education is to place educational pamphlets in a convenient location. While having great budtenders and hi-tech tablets is great, some people feel uncomfortable asking questions and would rather find out what each cannabinoid does on their own. Simple, easy to read pamphlets are a great way to ensure this customer isn’t left out of an educational experience.
An Open Floor Plan
Going back to the dispensaries of yesterday, one of the most unpleasant parts about old dispensaries is how crowded they felt– they almost felt like pawn shops. Nowadays, strict regulations limit where a dispensary is located. However, no matter the location of your dispensary, the goal should be to give your customers as much space as possible. The best way to do this is by going with an open floor plan.
The term “open floor plan” generally refers to spaces which make use of large and open spaces, and minimizes the use of small rooms. An open floor plan free of clutter can help put your customers at ease and make them feel more comfortable browsing. When considering an open floor plan, keep these things in mind
Keep it clockwise: Most people, at least in North America, look at things and move from left to right. Try arranging your store in such a way that customers move through your store in a clockwise direction. Not only will it make the purchasing processing flow more naturally, but it will help customers relax.
Slow it Down:As much as you would like to have customers coming in and out as fast as possible, great design doesn’t always work that way. Sometimes, retailers will strategically place specials or popular items in certain places to help slow down the customer and give them the opportunity to make an impulse purchase. Just make sure that your “speed bumps” don’t end up blocking the customer’s movement through the store.
Use Creative Displays: If you’ve ever been in a grocery store, then the odds are pretty high that you’ve seen creative displays where products (usually soda packs) are put together to create a visually pleasing tiered formation. You don’t necessarily have to create a gigantic pyramid of all your best-selling products, but you should at least experiment with blocking together some of your products (or at least their packaging) and putting them in visually pleasing geometric shapes.
Manage Your Customer Flow
When it comes to owning a dispensary, good days are busy days. Every business owner wants as many customers as possible in their store at all times. But if you don’t have a way to manage all of those customers, it could be a disaster. That’s why it’s critical to design a store that takes customer lines into consideration.
You may find yourself torn over how much space to dedicate to customer lines and browsing, and honestly, there is no simple solution. However, if you’ve adopted an open floor plan you should be able to relieve some of the tension that comes with customer queuing. Here are a few things to keep in mind when designing a space for customer lines.
Keep Them Busy: One way to reduce the stress of your customers waiting in line is to find ways of keeping them busy. MedMen, for instance, has a budtender relay a customer’s order, which allows a customer to continue browsing the store while they wait. Not only does this make the wait seem shorter, but it also gives them an opportunity to make any last-minute impulse purchases.
Keep it Fair: Large lines can turn nasty in a flash, and one of the largest contributors to this turn is perceived unfairness. Maybe someone cut someone in line or darted over to another shorter line. Either way, people can become disgruntled quickly. If you can, try implementing a single line or a ticketing system to give everyone waiting for service a sense of fairness and order.
Encourage Customer Feedback: The easiest way to improve your customer flow is by asking your customers about their experience. At the end of the purchasing process, ask your customers to participate in a short survey and find out about their experience. To increase the number of people taking your survey, try offering discounts or free items in exchange for their participation.
Crafting a well-designed dispensary can be difficult, but it is not impossible. You don’t need to be the trendiest or the coolest person on the planet in order to come up with a good dispensary design. Just follow the fundamentals. Make sure your shop is properly lit and gives off an inviting atmosphere, keep educational resources on hand so customers feel comfortable shopping, and make sure you keep your dispensary open and free of clutter.
Most of all, design your dispensary with the customer in mind. Taking their feelings into account will help you achieve a beautiful and well-designed cannabis dispensary. |
An embodiment relates generally to dual stator electric machines.
Electric machines are typically designed to achieve a specific operating characteristic. For example, electric machines with drag cup rotors have very low inertia properties. Induction machines typically exhibit torque ripple free properties, whereas conventional permanent magnet synchronous machines exhibit high torque to ampere ratios. However, achieving a respective specific operating characteristic typically results in the sacrifice of other operating characteristics. While each of the above examples achieve one of the desired operating characteristics, this is often done at the expense of not obtaining one of the other respective desired operating characteristics. That is, none of the devices described above are capable of exhibiting all of the desired operating characteristics in a single electric machine. |
Contents
Chapter 310
Naruto and Sakura cry for failing once again to retrieve Sasuke. Sai cheers them up by pointing out that they still have time before Orochimaru can take Sasuke's body and adds that he will help them in the future. They return to Konoha. Sai reports to Danzō and, despite not killing Sasuke as he was instructed, asks to remain with Team 7. Danzō agrees, but warns him about growing attached to others. Later, Sai begins to work on a new painting, but decides to stop so he can spend time with his new friends.
Chapter 311
Sai visits the library to learn about how to make friends. After reading about nicknames, Sai tries to put the concept into practice by calling Sakura "ugly". He and Naruto, who tries to keep Sakura at bay, are injured in her wrath. The three meet with Kakashi in the hospital and tell them about their encounter with Sasuke. Because Sasuke has become so much stronger than them, Naruto worries that they will only fail again the next time they try to retrieve him. Kakashi replies that Naruto will merely need to get stronger, and proposes a training method that only Naruto can undertake.
Chapter 312
Kakashi says that Naruto will need to create a new technique, something he will be able to do in a very short period of time thanks to the training regiment Kakashi has come up with. Before Kakashi can elaborate they are interrupted by Team 10, who offers to take Team 7 out to lunch. Kakashi and Asuma stay behind while the others go out to mingle. Sai tries once again to use nicknames to make friends. He begins to call Chōji fat, but is advised against it by Naruto. Turning his attention to Ino, and remembering that Sakura did not like hearing how she actually appeared, Sai concludes that women prefer hearing the opposite of what is true. He therefore calls Ino "beautiful". Sakura becomes angry, having expected him to insult Ino. Elsewhere, Akatsuki members Hidan and Kakuzu attack Yugito Nii.
Chapter 313
Yugito, having lured Hidan and Kakuzu into a trap, seals the exits to prevent them from escaping. She transforms into the Two-Tails and attacks them, but they are not concerned. In Konoha, Asuma begins to speak with Kakashi about something when they are interrupted by Kurenai. Asuma leaves with her, saying he'll talk to Kakashi later. Hidan and Kakuzu manage to defeat Yugito, though quickly bicker over why it took so long to do so. They then prepare to go to the Land of Fire.
Chapter 315
Kakashi explains that, although combining shape transformation and nature transformation usually takes years, Naruto will be able to do so in a fraction of the time by training with shadow clones. Kakashi then demonstrates how shadow clones transfer what they learn during their existence back to the originator when they disperse. Having never noticed this before, Naruto asks if training with hundreds of clones to learn things a hundred times faster is how Kakashi became so strong. Kakashi replies that only Naruto can do this sort of training because he has access to the Nine-Tailed Demon Fox's chakra. Yamato joins them to help Naruto keep the fox in control. Before Naruto can start on his new technique, they must first determine his nature affinity; it is Wind Release.
Chapter 316
Kakashi and Yamato explain the different nature transformations to Naruto and how his nature, Wind Release, has the greatest offensive capabilities. In order to master wind, Naruto and hundreds of shadow clones must learn how to slice leaves with chakra, something they slowly begin to progress with. Meanwhile, Asuma plays shōgi with Shikamaru and they begin relating the various pieces to positions within Konoha. After Asuma makes an uncharacteristic move, sacrificing a knight to protect the king, Shikamaru suggests that the knight represents ninja like them while the king represent the Hokage. Asuma tells him that he has the identity of the king wrong, and that he'll learn someday.
Chapter 317
Deidara and his new partner, Tobi, confront the Three-Tails. Although it is his assignment, Tobi runs away in fright, forcing Deidara to intervene. In Konoha, Naruto makes steady progress with his Wind Release training. He nevertheless asks if there is someone else in Konoha who can use wind and could give him pointers. Kakashi directs him to Asuma. Asuma explains to one of Naruto's shadow clones that wind has great piercing potential. Naruto suggests that ordinary weapons would be better for such a purpose, so Asuma demonstrates how superior wind is to every other possible weapon. The clone disperses and passes what it has learned to the others. Meanwhile, word reaches Tsunade of Akatsuki's attack on the Fire Temple. She orders the Nijū Shōtai be gathered.
Chapter 318
Deidara and Tobi defeated the Three-Tails and started towing it to the nearest Akatsuki base. Tobi insisted that he did all the work, which Deidara disagreed with. Tobi fell asleep while he's arguing his case, prompting Deidara to attack him. In Konoha, Naruto was finally able to cut a leaf in two, completing the first phase of his Wind Release training. For the second step, Naruto must use wind to halt the flow of a waterfall that Yamato created. Meanwhile, Tsunade instructs the Nijū Shōtai to capture or eliminate Akatsuki members Hidan and Kakuzu before they leave the Land of Fire. When Asuma hears how they killed Chiriku, he decides to take his team to the Fire Temple.
Chapter 319
As Asuma and his team depart for the Fire Temple, they take a detour passed Kurenai's apartment, who sees them go. Meanwhile, Naruto and his small group of shadow clones are unable to affect the waterfall they are training with. Naruto says he needs to use more shadow clones and thus a larger waterfall if he is to make any progress, but Kakashi advises against it. Naruto insists that he needs to catch up to Sasuke, so Kakashi instructs Yamato to make the waterfall bigger. Naruto trains through the night, motivated by Sasuke, and is eventually able to stop the waterfall with his Wind Release. |
If you haven’t noticed yet, there is a feature that allows you to use an avatar. An avatar is the small picture that appears on the left side of all of your posts above your username, and in your profile page. Here at TheParrotForm.com, we would really like it if you posted an avatar of yourself with your bird or birds. We allow larger avatars than typical forums. A typical forum allows for an image sized 90x90 but our avatars can be up to 150x150 here. We are trying to encourage everyone to show themselves and their birds. We want to be able to see the bird so the avatar size has to be big or a bird may not look like a bird (especially the smaller birds that might look like a speck).
We recommend using a photo where you hold the bird(s) right up next to your face because that's what everyone really wants to see. To whom they are talking and about which birds. If you have several birds you can put them on a perch or several perches near each other and sit between them. Once again try to focus on the face and birds and cut out any extraneous background.
Custom Avatar
If you are going to create your own custom avatar, start this by opening the program “Paint” from your start menu. Once paint is opened, click “File” at the top and then click “Open”. Find a picture on your computer and then click “Open” and the picture should appear in the program. To first find out how large this image is, click “Image” and then “Attributes”.
You want your image to be 150x150 or smaller. To resize this image, first you need to make sure your image is cropped the way you would want it. Try to eliminate the sides of the picture that don’t show anything, you need this avatar to be small and you don’t want the important stuff to be unnoticed. Click the dotted box icon, click your picture and select in a box what you want your picture to be like. Then hold this and drag your picture to the top left corner and resize the picture window by holding your mouse over the corner of the image until you get a double arrow which you can then click and drag to crop.
Once you have your image at the desired size, click “Image” and then “Stretch/Skew” at the top. If you cropped the image, be sure to check the attributes one more time. Again, you will need to know how large this image is before you do this. You need to Stretch the image by typing in different percents. This requires a little math and may take a few tries. For example, if you have an image that is 300x300, you’ll need it to be half that size and you should type 50 in both of the stretch boxes. You’ll need to create an avatar that is 150x150 or smaller on your computer to be used on this forum.
Here is a simple formula for calculating what percent to shrink your image in order to fit the avatar specs. Take the largest dimension of your photo (as discovered in the attributes) and divide it by 150. For example if the image is 648x472 after cropping, 648 is the largest dimension. 648 divided by 150 is 0.23. Therefore in the "Stretch/Skew" box, input 23 for both the width and height and the image will be proportionately downsized to 23 percent of its current size. Then if you check the attributes again, you can double check that it is 150px or less on each dimension.
Click “File” and then “Save As” and select where you want this image to be saved to and what you would want it to be called. When you do this, you will have to compress the image so that it will fit our 7kb restriction. In the top box, type in the file name you want the picture to be called (e.g. bird_avatar) and below this file name box, there is a second box. Click on the arrow next to this box and select “JPEG” from the drop down menu that appears. This will compress the picture. Click save and remember where it is on your computer (My Documents, My Pictures, Desktop, etc.)
Then, you can go about adding the avatar you created by following these steps. At the top of this page is a link that says “User Control Panel”; right click on this link and open it into a new tab so you can refer back to this page. Don’t be overwhelmed. On the new tab in your User Control Panel, click where it says “Profile”. Look on the left for the link that says “Edit Avatar” and click this.
Once you have gotten to the Edit Avatar page, you’ll see some new information. You will want to click on the button that says “Browse” next to “Upload from your machine:” and this will open a new window. Find an image on your computer’s files and click “Open”. Then edit the Avatar dimensions section by typing in the size of what your avatar image will be (hopefully 150x 150) and click submit. Now you’re done!
Avatar Gallery
If you cannot make your own avatar, you can choose one of the ones we provide in our avatar gallery. In order to encourage users to provide their own custom avatars, these images are smaller and lower quality than the avatars you could submit yourself. The generic avatars we provide cover a moderate selection of parrots categories. You can choose a picture of the bird that most closely resembles yours or your favorite. Of course if you have different species of parrots, it's best you provide your own avatar so they could be included!
At the top of the page is a link that says “User Control Panel”; right click on this link and open it into a new tab so you can refer back to this page. Don’t be overwhelmed. On the new tab in your User Control Panel, click where it says “Profile”. Look on the left for the link that says “Edit Avatar” and click this. Look down a little for the button that says “Display Gallery” and click on it. This will open a new page for you. Select one of the default gallery avatars by clicking on the empty circle below the avatar you wish to use and then click “Submit”. Now you’re done!
Unless you upload it as an attachment, the photo has to reside someplace on the web and have a URL. If you have your own website or use photobucket/flickr you can paste the URL to the photo into your text. Then you hilight it and click the "Img" button above the text box
No. You have to paste the URL of the photo into the text box. Then you hilight it and click the "Img" button on top and it will put IMG and /IMG in brackets around your URL and it will insert it once you submit. Use the preview to be able to see if it worked prior to posting. Bye. |
Jan Perner
Jan Perner (7 September 1815 in Bratčice near Čáslav – 10 September 1845 in Pardubice) was a Czech railway engineer. During 1842–1845 Perner was responsible for construction of several railways in the Austrian Empire.
Career
Perner was born to a water-mill owner and his wife. During 1830–33 he studied at an engineering school in Prague led by František Josef Gerstner. When Gerstner looked for engineers for construction of railways in Sankt Petersburg area of Imperial Russia, Perner joined the project (1836). Due to problems in communication with Gerstner he left in the same year. In 1837 Perner began work at the state railway company and was gradually promoted to take responsibility for construction works. In 1842 he started to design and oversee construction of important railways Prague – Pardubice – Olomouc and Prague – Dresden.
The railway from Prague to Pardubice (over 100 km) was finished in 1845. On 9 September 1845, while Perner was returning from an inspection trip he looked out of the window of a moving train (near Choceň). His head hit a pole, and he was severely injured and died the next day. He has the dubious fame of being the first person to die in a railway accident in Bohemia. Today one of the faculties of University of Pardubice is named after him: Jan Perner Transport Faculty (Dopravní fakulta Jana Pernera) . An InterCity class train of railway operator České dráhy bears the name Jan Perner.
External links
Detailed biography (in Czech)
Biography on website of his birth village (in Czech)
Category:1815 births
Category:1845 deaths
Category:Civil engineers
Category:Czech engineers
Category:Czech mechanical engineers
Category:Czech railway mechanical engineers
Category:Railway accident deaths in the Czech Republic
Category:Czech civil engineers |
McHenry County community offers support to those affected by Marengo house explosion
By DANIELLE GEHR -
dgehr@shawmedia.com
June 13, 2017
Sarah Nader
Caption
Sarah Nader - snader@shawmedia.com
Austin Keefer (left) and his sister, Hailey Keefer, 17,
hold donations after attending a special town hall meeting for affected residents in Marengo Monday, June 12, 2017.
The Keefers family home was destroyed when their next door neighbors home exploded last Sunday. The family is currently staying in a hotel.
The explosion that leveled the house next door and caused other neighboring houses to catch fire left more than 50 homes damaged. Eighteen homes were uninhabitable and two have been destroyed.
Marengo High School offered itself as the immediate relief by opening its doors to those in need of shelter. No one needed to use the school overnight. Many of the first donations were brought to the Zion Lutheran Church in Marengo, where a dinner also was held for affected families. Seven or eight families showed up, while most of the others were settled with their relatives, Pastor Glen Bohart said.
To create a more organized donation process, Marengo officals asked that donations be directed to the Marengo area Outreach Enterprises Center, which will be accepting food, clothing, small appliances and financial donations from 9 a.m. to noon Tuesday through Friday, according to the city’s website.
Checks should be made out to M.O.R.E Center with the memo stating it is for the Marengo disaster fund. The M.O.R.E. Center is located at 829 Greenlee St. in Marengo, and can be reached at 815-568-7950.
For those affected who do not have homeowners’ insurance and those who were renting their home, the McHenry County Housing Authority can offer a night in a motel and a bed for each person living in the home, said Sue Rose, the authority’s community service director.
Affected people who were renting their home also are offered first month’s rent and coverage of their security deposit, Rose said.
How to help
What: All donations to help those affected by the home explosion in Marengo are going through the nonprofit M.O.R.E. Center
Where: The M.O.R.E. Center, 829 Greenlee St., Marengo
Send checks to: Checks must be written out to M.O.R.E. Center and have “Marengo Disaster Fund” in the memo line. Checks should be mailed to M.O.R.E. Center, 829 Greenlee St., Marengo, IL 60152
Other donations: Non-perishable food, clothing and small appliances can be dropped of the M.O.R.E. Center from 9 a.m. to noon Tuesday through Friday.
Website: www.marengomorecenter.org/
Phone: 815-568-7950 |
Paean to the People
"Paean to the People" is the seventh-season finale of the American television drama series Homeland, and the 84th episode overall. It premiered on Showtime on April 29, 2018.
Plot
Saul (Mandy Patinkin) and his team arrive at the embassy, ready to fly Simone (Sandrine Holt) to the United States. Meanwhile, Yevgeny Gromov (Costa Ronin) tracks the disguised Carrie (Claire Danes), still believing she is Simone. Carrie's car is cornered, so she runs away on foot in an effort to extend the chase until Saul's plane has taken off. Saul's vehicle is stopped at a checkpoint due to an outstanding warrant for Bennet's (Ari Fliakos) arrest; Saul calls Vice President Warner (Beau Bridges) for assistance. Senator Paley (Dylan Baker), who is in the room with Warner, advises against this, as a successful retrieval of Simone would lead to Keane being reinstated as President. Warner angrily rebukes Paley and intervenes on Saul's behalf. The plane takes flight as Yevgeny captures Carrie.
Three days later
Saul's attempts to negotiate Carrie's release with Viktor (Elya Baskin) go nowhere. Simone's testimony confirms a GRU conspiracy to undermine President Keane. Paley is arrested as a conspirator. Keane (Elizabeth Marvel) is triumphantly sworn in as President once again, but in her first public address, she resigns. She explains that Russia was able to exploit partisan discord in the U.S. that must be addressed, and that events of her administration have left her as someone the American people as a whole will be unable to trust. Yevgeny wants Carrie to film a confession video stating that Simone was a CIA operative and that the U.S. orchestrated everything, while threatening to withhold Carrie's medication if she doesn't cooperate. Carrie refuses.
Seven months later
Carrie's release is finally secured in exchange for several Russian prisoners. Saul and Jim (Damian Young) oversee the prisoner exchange at the Estonia–Russia border. After seven months of receiving no medication, Carrie is barely lucid and seems to not even recognize Saul.
Production
The episode was directed by executive producer Lesli Linka Glatter and written by showrunner Alex Gansa.
Reception
Reviews
The episode received an approval rating of 100% on the review aggregator Rotten Tomatoes based on 10 reviews. The website's critial consensus is, "'Paean to the People' demonstrates all that Homeland does best, delivering intelligent closure to the season's overarching plot while fleshing out the terrible cost of victory for Carrie Mathison."
The A.V. Clubs Scott Von Doviak gave the episode a "B+" grade, concluding that it was "a mostly satisfying end to a bounce-back season", and that the "first twenty-five minutes or so is executed almost flawlessly, though, with the series’ steadiest hand, Lesli Linka Glatter, at the helm". Ben Travers of IndieWire's rated the finale "A", writing "Homeland delivered a cliffhanger ending without sacrificing closure in a finale that sets up an intriguing end-run".
Ratings
The original broadcast was watched by 1.3 million viewers.
Accolades
Alex Gansa won the Writers Guild of America Award for Television: Episodic Drama for the 71st Writers Guild of America Awards. Lesli Linka Glatter was nominated for Outstanding Directing – Drama Series at the 71st Directors Guild of America Awards.
References
External links
"Paean to the People" at Showtime
Category:2018 American television episodes
Category:Homeland (season 7) episodes |
Infectious diseases have wrecked continents, treatment-resistant superbugs are increasing, and social stigma inhibits treatment of crippling psychiatric conditions. At times, the state of international health might appear hopeless and worrying. But in reality, a variety of advances, from drug development to disease tracking, are helping people live longer at a scale that was formerly unthinkable.
In the past decade, one technology, in specific, has had an outsized impact on global health: the smart phone. By transforming the way we interact with each other, even the simplest cell phone has enabled epidemiologists to track disease outbreaks with higher accuracy than in the past. Understanding how a disease spreads and where it spreads out is crucial if scientists are to find a way to fight and, hopefully, beat it.
Smart phones do even more to improve global health. The hardware has democratized health technologies that used to be too costly or too physically far for many people to access. With smart phones, doctors can perform sophisticated medical tests or procedures without setting foot in a laboratory; patients can better comprehend their own health and control their info.
Here are 5 ways that smartphone or cell phones have had a fundamental impact on worldwide health.
Emergency Care
In case of a medical emergency, dialing 911 is the most reliable way to get assistance in a rush in the US (it’s 999 in the UK). But for folks who live in rural areas, particularly in underdeveloped countries, rapid emergency care is far from a guarantee. The app ‘MUrgency‘ promises to streamline that procedure. Depending on the kind of emergency, it can link patients to ambulances faster, or even provide users with a qualified nurse to help them right at home.
The app is intended to compensate when governments cannot do the job. Depending on where you live in the United States, it can take between 6 and 35 minutes for an ambulance to show up in a medical emergency. MUrgency is designed to offer timely emergency care, whether a patient resides in a rural location or an urban city. This is only possible thanks to the ubiquity of smart phones.
The service was launched in 2016 in Punjab, India with a network of 36 hospital emergency rooms, over 40 ambulances and 350 physicians. It won 1st Prize in Health & Wearables at the 2016 SXSW Festival in Austin, Texas. Now, patients can access responder services in Punjab; those services are expected to become available in other cities such as Dubai by the end of 2018.
Screening for Pancreatic Cancer
To detect pancreatic cancer, all you have to do is take a selfie. That’s possible thanks to scientists at the University of Washington who developed a smart phone app that can screen for pancreatic cancer. The cutting-edge technology utilizes computer vision algorithms and artificial intelligence to identify jaundice in the whites of patients’ eyes. Jaundice is caused by high levels of bilirubin, a yellow substance that can indicate the early stages of pancreatic cancer.
In a research study of 70 individuals, the app had a success rate of about 90 percent, about the same precision as the blood tests that are the existing standard.
“The hope is that if people can do this simple test once a month — in the privacy of their own houses — some might catch the disease early enough to undergo treatment that could save their lives,” Alex Mariakakis, a doctoral student at the Paul G. Allen School of Computer Science & Engineering told the University of Washington News.
Detecting Pathogens In The Blood
Physicians use test patients’ blood to look for a number of elements of health, from finding cholesterol levels to diagnosing rare tropical diseases. Most blood tests need a lab for analysis, however sophisticated laboratories and equipment are not always readily available, depending on where the patient is located. For remote clinics, dispatching the samples and awaiting the results can take days or weeks, and during this time, a patient obviously is not getting treatment. To accelerate that procedure, scientists from 2 universities have miniaturized a blood lab into a handheld gadget that works with a smartphone.
A single drop of blood is all it takes to check for dengue, Zika, and other infectious diseases.
The gadget itself (without the smart phone) is just the size of a visiting card. Grooves in the chip suck in small amounts of blood that are illuminated by the phone’s LED. A group of sensors analyze how light traves through the blood, which the system compares with the results of tests found to be positive. The whole procedure takes 10 minutes. “Labs-on-a-chip” are inexpensive and fast, and diagnostics can be performed in practically any environment.
The scientists hope their gadget can detect a lot more pathogens in the future. A similar lab-on-a-chip, developed by researchers at the Fraunhofer Institute for Cell Therapy & Immunology in Leipzig, Germany, can identify E. coli and salmonella pathogens in the blood.
Similarly, scientists at Columbia University have developed a smart phone dongle that can identify syphilis and HIV in just 15 minutes “Coupling microfluidics with recent advances in electronics can make certain laboratory-based diagnostics accessible to almost any population with access to smart phones. This kind of capability can transform how health care services are delivered around the globe,” Samuel Sia, an associate professor of biomedical engineering at Columbia University, stated in a 2015 article published on the university’s website.
Tracking the Spread of Disease
Epidemiology is a deceptively complex field. Researchers have to pinpoint the origin and reason for an outbreak, often as it continues to spread out. Collecting information can be difficult in rural areas; infrastructure (or lcack of it) can restrict communication. Even if researchers have a good understanding of the signs of the disease and the way it is transmitted to human beings, they might still have a hard time to keep track of those who are contaminated.
Mobile phones have changed that. Now scientists are able to track the malaria parasite across Kenya. By overlaying maps of the prevalence of malaria over call or text data that tracked individual callers’ movements, researchers at the Harvard School of Public Health have assisted authorities strategically deploy mosquito nets, control task forces, and medications in Nairobi and surrounding locations to prevent malaria from spreading out there.
Healthcare workers themselves communicate a lot more efficiently through short messaging services (SMS), according to a 2010 review. In South Africa, SMS allowed HIV-positive patients to notify or trace partners, track physician’s appointments, and utilize prevention methods.
Foster Communication
Smartphones have also assisted health care professionals share expertise, collected data, and other insights, no matter where they live. Social networks such as doximity enable over half a million physicians to connect online to share details and to peer-review each other’s work while still keeping identifying patient information private.
It likewise helps medical professionals streamline their workload — physicians can now gain access to patient records directly on the app, or they can even call patients seamlessly. The patient can opt to either log in online, utilizing their email and password, or call their health care expert directly through the app.
As chronic diseases such as hypertension and diabetes become more widespread, smart phones allow physicians to remotely monitor patients’ health. Health care professionals can provide guidance based on information that the patient collects. |
package us.ihmc.robotics.trajectories.providers;
import us.ihmc.mecano.multiBodySystem.interfaces.OneDoFJointBasics;
import us.ihmc.yoVariables.providers.DoubleProvider;
public class CurrentJointValueProvider implements DoubleProvider
{
OneDoFJointBasics joint;
public CurrentJointValueProvider(OneDoFJointBasics joint)
{
this.joint = joint;
}
public double getValue()
{
return joint.getQ();
}
}
|
War/Dance
War/Dance is a 2007 American documentary film written and directed by Sean Fine and Andrea Nix Fine and produced by Shine Global's Susan MacLaury, a professor at Kean University, and Albie Hecht. It was nominated for the 2008 Academy Award for Best Documentary Feature and received the Emmy Award for Best Documentary and Best Cinematography in 2010.
Synopsis
The film centers on three children – Nancy, a 13-year-old choir singer; Rose, a 14-year-old dancer; and Dominic, a 14-year-old xylophone player. They are members of the Acholi ethnic group, living in the remote northern Uganda refugee camp of Patongo, which is under military protection from the Lord's Resistance Army, a terrorist group that has been rebelling against the government for the past two decades. In 2005, the camp's primary school won its regional music competition and headed to Kampala to participate in the annual National Music Competition. War/Dance focuses on three of the eight categories: Western choral performance, instrumental music, and traditional dance, where the students perform the Bwola, the dance of the Acholi. Over the course of three months, the film's creative team observes the three youngsters as they prepare for the event and gain their confidence enough to have them discuss the horrors they have experienced and express their individual fears, hopes, and dreams.
Release
The film debuted at the 2007 Sundance Film Festival, where it won the Documentary Directing Award and was nominated for the Grand Jury Prize for Best Documentary. It was shown at the Cleveland International Film Festival, the Wisconsin Film Festival, the Cannes Film Festival, the Austin Film Festival, and the Tokyo International Film Festival, among others, before going into limited release in the United States in November 2007.
Critical reception
War/Dance received generally positive reviews from critics. The review aggregator Rotten Tomatoes reported that 86% of critics gave the film positive reviews, based on 43 reviews — with the consensus that the film "is beautifully filmed, and effectively captures the heartbreaking and uplifting experiences of its subjects." Metacritic reported the film had an average score of 68 out of 100, based on 20 reviews.
In his review in The New York Times, Stephen Holden called the film "visually ravishing" and added, "[it] is so gorgeous that its beauty distracts from the anguish it reveals ... Every shot ... has the polish of a richly hued, impeccably composed illustration ... When individual children, some in tears, tell their stories while gazing directly into the camera, the shots seem posed and their remarks possibly rehearsed. The production notes explain that the children felt more comfortable telling their stories directly to the camera than to an interviewer, but you still have an uneasy sense of being manipulated ... Having voiced these qualms, let me say that War/Dance, in spite of its slickness, is an honorable, sometimes inspiring exploration of the primal healing power of music and dance in an African tribal culture ... The film draws out the suspense as best it can until the inevitable African-style American Idol moment. If that finale is genuinely exhilarating, you are still uncomfortably aware that this ecstatic conclusion doesn't mean the end of the strife or the refugees' troubles. It is a blip of light on a dark canvas."
Kenneth Turan of the Los Angeles Times wrote, "To make a memorable documentary ... that can't be forgotten once seen, you have to be more than gifted, you need an instinct for an unusual story and, frankly, you must have luck on your side. War/Dance ... has all that and more ... [it] is as irresistible as the rhythms of African music on its soundtrack."
In Variety, John Anderson called the film "well-intentioned but a victim of its own high cinematic values" and added, "The young black faces are too beautiful, the landscapes too pretty, and the personal stories of slaughter too scripted ... The formal devices of the film, and the lack of spontaneity in the children's words, do little to sell the message of the movie ... While the pic may be targeting Westerners who want to feel less awful about genocide and global negligence, it's hard to imagine War/Dance appealing to that crowd – or any other."
Rachel Howard of the San Francisco Chronicle wrote, "Visually, the film is anything but gritty, and some might say the cinematic beauty – and the children's controlled, likely coached interviews – glosses reality. But the tension of a brutality that can hardly be imagined let alone depicted, and the dignity of these precociously adult children as they must press on with their lives with little room for mourning or self-pity, is the point. The climactic trip to the competition offers an uplift that feels more like relief than triumph after the film's most disturbing tales."
In The Village Voice, Jim Ridley wrote, "The movie comes across as desperately, even irritatingly contrived, but I'd be lying if I didn't say it overcame my naturally complacent instincts — which would be to watch something (anything) else, to not get haunted by that closing litany of websites for global action."
Additional awards
Emmy Award for Best Documentary and Best Cinematography (winner)
Aspen Filmfest Audience Award for Best Documentary (winner)
Jackson Hole Film Festival Cowboy Award for Best Cinematography (winner)
Wisconsin Film Festival Audience Award for Best Documentary (winner)
Woodstock Film Festival Audience Award for Best Documentary Feature (winner)
Woodstock Film Festival Haskell Wexler Award for Best Cinematography (winner)
ZagrebDox Film Festival Veliki pečat international competition award (winner)
Outreach and non-profit work
War Dance was produced by the 501(c)(3) non-profit film production company Shine Global. Founded in 2005 by Susan MacLaury and Albie Hecht, it is dedicated to ending the exploitation and abuse of children through films and other media that raise awareness and inspire change. Profits from their productions go back to local advocacy organizations that help the children that Shine documents. Shine Global partnered with AMREF during the production of War/Dance to aid the people of Uganda on the ground. When they returned to Uganda in 2008 to film WAR DANCE RETURNS, the filmmakers donated video equipment to the new Health Education Center that Shine Global helped to fund, and also established the Patongo Scholarship Fund.
References
External links
Category:2007 films
Category:2000s documentary films
Category:American films
Category:American documentary films
Category:Lord's Resistance Army
Fine Nix
Category:Documentary films about Uganda |
Two-Thirds of Canadians Approve of Marijuana Decriminalization
Sixty-six percent of Canadians polled by Ipsos Reid for Postmedia News are in favor of decriminalizing the possession and use of small amounts of marijuana.
This overwhelming support directly contrasts Prime Minister Stephen Harper’s position, which is that illegal drugs should be battled by law enforcement, regardless of amount. At this year’s Summit of the Americas, Harper stated of marijuana and other drugs, “No amount of law — whether it’s having the approach in the Muslim world to execution, all the way to full legalization, nothing is going to prevent the reality that this is a trade, people attempting to make rich by destroying people’s lives. It’s that simple.”
The poll found that more people living in households without children were in favor of decriminalization than those with children in their homes. It was also discovered that 75% of people who make over $100,000 are in favor of decriminalization.
The online survey was conducted June 18-25. The margin of error is 3.1 percentage points. |
Background {#Sec1}
==========
Flexible bronchoscopy remains the gold standard for numerous diagnostic and therapeutic interventions and has become an integral part of pulmonary medicine \[[@CR1]\]. Given its widespread use, it is important to select appropriate sedation to relieve the anxiety and pain of patients undergoing bronchoscopy \[[@CR2]--[@CR4]\]. The type of sedation may also be helpful for the bronchoscopist to facilitate the procedure \[[@CR4]\].
Although the current guidelines recommend the combined use of an opioid and midazolam for bronchoscopy sedation \[[@CR3]\], physicians often use a single drug, or a combination of benzodiazepines, propofol, and opioids in this setting \[[@CR5], [@CR6]\]. In addition, with the development of new drugs, remifentanil and dexmedetomidine have been introduced as options for analgosedation for flexible bronchoscopy in adults \[[@CR7]--[@CR10]\]. Accordingly, the combination of new drugs and conventional drugs has enabled a wide variety of combinations of drugs to be used for analgosedation for flexible bronchoscopy. Several studies have demonstrated the safety and efficacy of the addition of remifentanil or dexmedetomidine (to conventional drugs) in adult patients who underwent flexible bronchoscopy \[[@CR7]--[@CR10]\]. However, the best-standardized practice for the use of sedation during bronchoscopy has yet to be determined.
Remifentanil is an ultra short-acting new opioid analgesic drug that is commonly used to relieve pain during the surgery and as adjunctive to an anesthetic \[[@CR11]\]. The ultrafast offset and short half-life also make it an ideal drug for analgosedation in intensive care unit (ICU) patients \[[@CR12]\]. Considering that remifentanil has excellent analgosedation effects with an advantage of the short half-life, remifentanil could become an alternative to conventional treatments (including the combination of a benzodiazepine and propofol) for sedation in bronchoscopy. However, few studies have compared the effectiveness and safety profile of remifentanil versus a combination of midazolam and propofol. Therefore, the aim of this study was to compare the effectiveness and safety of analgosedation using remifentanil versus the combination of midazolam and propofol during flexible bronchoscopy.
Methods {#Sec2}
=======
Study design and population {#Sec3}
---------------------------
This retrospective observational study was conducted at a tertiary university-affiliated hospital from May 2015 to September 2017. It was approved by the local Institutional Review Board (IRB no. CUH 2019--06-028). The patients were stratified into the remifentanil group and midazolam/propofol group according to the drugs used during flexible bronchoscopy.
Flexible bronchoscopy {#Sec4}
---------------------
Flexible fiberoptic bronchoscopy was performed with standard fiberscopes by two professional pulmonologists. A flexible bronchoscope (BF-F260, BF-6C260, 1 T260, BF-Q290, 1TQ290, Olympus, Tokyo, Japan) was inserted via the nasal approach with subjects in the supine position.
All consecutive patients who were spontaneously breathing were eligible. All patients had fasted for at least 8 hours prior to the start of the procedure and had an intravenous catheter. Topical anesthesia was performed using 4% lidocaine spray in the oral cavity. While the vocal cords and carina were visualized, 4 ml of 2% lidocaine was delivered through the bronchoscope channel to suppress cough. Additional topical anesthesia was applied to the major bronchi as needed (at the bronchoscopists' discretion) for a maximum total lidocaine dose of 7 mg/kg.
Sedation {#Sec5}
--------
### Midazolam/propofol group {#Sec6}
Pretreatment with 1--2 mg midazolam (Midazolam®, Bukwang, Seoul, Republic of Korea) was used to relieve significant preprocedural anxiety. Patients were treated with an additional 1 mg of midazolam if necessary. Next, propofol (Anepol®, Hana Pharmaceutical Co., Seoul, Republic of Korea) was administered according to our hospital's protocol. Table 1Baseline characteristicsRemifentanil group\
(*n* = 111)Midazolam / propofol group (*n* = 75)*p*Age, years59.0 (51.0--70.5)58.0 (42.0--71.5)0.158Sex, male51 (45.9)29 (38.7)0.405Body mass index, kg/m^2^22.0 (20.0--24.0)22.0 (20.0--24.5)0.630Comorbidities Hypertension33 (29.7)17 (22.7)0.370 Diabetes mellitus12 (10.8)4 (5.3)0.298 Asthma1 (0.9)2 (2.7)0.730 Chronic obstructive pulmonary disease2 (1.8)2 (2.7)1.000 Chronic heart disease6 (5.4)4 (5.3)1.000Pulmonary function FVC, L2.9 (2.4--3.5)3.1 (2.6--3.7)0.129 FVC, % predicted94.0 (85.0--102.0)99.0 (88.5--107.5)0.076 FEV~1~, L2.3 (1.8--2.7)2.4 (1.9--2.8)0.538 FEV~1~, % predicted99.0 (90.0--111.0)102.5 (91.0--111.0)0.691 FEV~1~/FVC78.0 (73.0--82.5)76.0 (71.0--82.5)0.726Data are present as number (%) or median (interquartile range)*FVC* Forced expiratory volume, *FEV*~*1*~ Forced expiratory volume in 1 s
### Remifentanil group {#Sec7}
Patients received no premedication in the remifentanil group. Remifentanil (Ultiva®, GlaxoSmithKline, Seoul, Republic of Korea) was initially administered with a bolus dose of the study drug (0.5--1 mcg/kg), followed by a 0.02--0.04mcg/kg/min continuous infusion at the discretion of the bronchoscopist. A bolus dose of the study drug in proportional volumes was administered slowly (over a period of 60 s) to minimize known adverse effects, such as respiratory depression, hypotension, and bradycardia. The fiberscope was inserted into the patient 3--5 min after the remifentanil initial onset time. The remifentanil infusion was immediately stopped if bradypnea/apnea or hemodynamic collapse occurred.
Outcome variables {#Sec8}
-----------------
The primary outcomes included the incidences of oxygen desaturation and oxygen saturation trend between the two groups. Oxygen desaturation was defined as an oxygen saturation \< 90% for more than 10s. In the event of oxygen desaturation, oxygen delivery was increased from 4 to 10 L/min. Additional assistance (including reservoir bag-mask, high flow nasal cannula, and intubation followed by bag valve mask ventilation) was performed in a stepwise manner as needed. Secondary outcomes included hemodynamic variables, the incidence of hemodynamic adverse events, and recovery time.
Vital signs were continuously monitored before, during, and after the procedure by the bronchoscopist and nurses. Bradycardia (defined by a heart rate \< 60 beats/min or a decrease of \> 15 beats/min from baseline) was treated with intravenous atropine 0.5 mg. Hypotension (defined by a systolic blood pressure \< 90 mmHg or a decrease of \> 20 mmHg from baseline) was treated with intravenous epinephrine 5 mg. Bradypnea (defined by a respiratory rate \< 12/min or apnea \>10s), and other adverse reactions were noted throughout the procedure.
After the bronchoscopy, the patient was moved to the recovery room. In the recovery room, the recovery of the patient was assessed using the modified Aldrete score \[[@CR13]\] every 3--5 min by the attending nurses. Recovery time was defined as the time taken after the end of bronchoscopy until the recovery, which was defined ≥9 for the modified Aldrete score \[[@CR13]\]. Recovery time was classified as fast and delayed according to the median value of recovery time.
Statistical analysis {#Sec9}
--------------------
Continuous variables are presented as mean (standard deviation \[SD\]) or median (interquartile range, \[IQR\]). Categorical variables are presented as counts (%). Continuous variables were compared using the Mann-Whitney U test or T-test for continuous variables. Categorical variables were compared using the chi-square test or Fischer's exact test, as appropriate. In order to evaluate the factors associated with fast recovery time, we performed univariable and multivariable logistic regression analyses. The following factors were included in the multivariable model: age, sex, body mass index, chronic obstructive pulmonary disease or asthma, chronic heart disease, bronchoscopy indication, procedure, and type of sedative drugs. Two-sided *p* values \< 0.05 were considered significant. All statistical analyses were performed using R (ver. 3.2.3; R Foundation for Statistical Computing, Vienna, Austria) and STATA version 15 (StataCorp LP, College Station, TX, USA).
Results {#Sec10}
=======
Patients {#Sec11}
--------
The baseline characteristics are summarized in Table [1](#Tab1){ref-type="table"}. There were no significant differences between the two groups with regard to age, sex, body mass index, comorbidities such as hypertension, diabetes mellitus, asthma, chronic obstructive pulmonary disease, and chronic heart disease, or pulmonary function.
Indication for bronchoscopy and use of sedative drugs {#Sec12}
-----------------------------------------------------
Infection, lung cancer, and hemoptysis were common indications of bronchoscopy in the remifentanil group in order of frequency. In comparison, infection, hemoptysis, and lung cancer were common indications of bronchoscopy in the midazolam/propofol group (Table [2](#Tab2){ref-type="table"}). Patients in the remifentanil group were more likely to undergo invasive procedures during the bronchoscopy (beyond inspection alone) than were those in the midazolam/propofol group. The median procedure time was 9 min (IQR, 8--10 min) in the remifentanil group vs. 11 min (IQR, 10--13 min) in the midazolam/propofol group (*p* \< 0.001). The remifentanil group received a median of 0.2 μg/kg/min (IQR, 0.18--0.33 μg/kg/min) of remifentanil. The midazolam/propofol group received a median of 2 mg of midazolam (IQR, 0--4 mg) and 50.2 µg/kg/min (39.0--64.3 μg/kg/min) of propofol. Table 2Indication for bronchoscopy and the use of sedative drugsRemifentanil group (*n* = 111)Midazolam / propofol group (*n* = 75)*p*Indication for bronchoscopy0.137 Infection45 (40.5)40 (53.3) Lung cancer19 (17.1)6 (8.0) Hemoptysis13 (11.7)12 (16.0) Interstitial lung disease2 (1.8)0 (0) Others32 (28.8)17 (22.7)Procedure0.005 Endobronchial inspection only81 (73.0)70 (93.3) Endobronchial inspection with bronchoscopic biopsy20 (18.0)1 (1.3) Endobronchial inspection with BAL and TBLB2 (1.8)0 (0.0) Endobronchial inspection with BAL8 (7.2)4 (5.3)Procedure duration, min9 (8--10)11 (10--13)\< 0.001Sedative drugs Midazolam dose, mg--2 (0--4) Propofol dose rate, ug/kg/min--50.2 (39.0--64.3) Remifentanil dose rate, ug/kg/min0.2 (0.2--0.3)Data are present as number (%) or median (interquartile range)*BAL* Bronchoalveolar lavage, *TBLB* Transbronchial lung biopsy
Comparing the adverse events and recovery time between groups {#Sec13}
-------------------------------------------------------------
There were no significant differences in oxygen desaturation, lowest peripheral capillary oxygen saturation, heart rate, antidote use, or sedation discontinuation between the remifentanil group and midazolam/propofol group. However, hypertension, defined by a blood pressure \> 150/90 mmHg was significantly more common in the remifentanil group than it was in the propofol/midazolam group (52.3% vs. 30.7%; *p* = 0.008). In contrast, the recovery time was significantly lower in the remifentanil group than in the midazolam/propofol group (mean ± SD, 6.4 ± 3.0 min vs. 11.6 ± 4.0 min, *p* \< 0.001) (Table [3](#Tab3){ref-type="table"}). Table 3Comparing adverse events and recovery time across groupsRemifentanil group\
(*n* = 111)Midazolam / propofol group (*n* = 75)*p*Desaturation9 (8.1)6 (8.0)1.000Lowest SpO~2~73.2 ± 12.381.8 ± 6.00.174Heart rate0.294 Tachycardia18 (16.2)17 (22.7) Bradycardia5 (4.5)1 (1.3)Blood pressure0.008 Highest BP \> 150/90 mmHg58 (52.3)23 (30.7) Lowest BP \< 90/60 mmHg0 (0)1 (1.3)Recovery time, min6.4 ± 3.011.6 ± 4.0\< 0.001Antidote use2 (1.8)1 (1.3)1.0Sedation medication discontinuation7 (6.3)5 (6.7)1.0Data are present as number (%) or mean (standard deviation)Tachycardia and bradycardia were defined as HR \> 100/min and HR \< 60/min, respectively*SpO*~*2*~ Peripheral capillary oxygen saturation, *HR* Heart rate
The relationship between remifentanil use and recovery time {#Sec14}
-----------------------------------------------------------
In both univariable and multivariable analyses, the use of remifentanil was associated with more rapid recovery than was the use of midazolam/propofol (unadjusted odds ratio = 7.70, 95% confidence interval = 2.74--21.65; adjusted odds ratio = 15.88, 95% confidence interval = 4.14--60.90) (Table [4](#Tab4){ref-type="table"}). Table 4Factors associated with rapid recovery in patients undergoing sedative bronchoscopyUnivariable analysisMultivariable analysisUnadjusted OR (95% CI)*p*Adjusted OR (95% CI)*p*Age, yr0.98 (0.95--1.01)0.1310.97 (0.93--1.001)0.059Female0.71 (0.30--1.71)0.4480.53 (0.18--1.54)0.241Body mass index, kg/m^2^0.93 (0.93--1.11)0.7720.92 (0.82--1.04)0.195COPD or asthma0.37 (0.07--2.01)0.2490.93(0.11--7.76)0.946Chronic heart disease2.74 (0.76--9.91)0.1230.62 (0.09--4.32)0.628Indication OthersRefRef Lung cancer0.53 (0.15--1.95)0.3430.69 (0.13--3.66)0.665 Infection0.90 (0.31--2.59)0.8411.43 (0.40--5.05)0.581 Interstitial lung disease0.98 (0.22--4.28)0.9761.72 (0.29--10.06)0.548Procedure Inspection onlyRefRef Inspection with bronchoscopic biopsy0.92 (0.25--3.39)0.8960.27 (0.04--1.64)0.154 Inspection with BAL and/or TBLB0.92 (0.19--4.40)0.9130.67 (0.10--4.55)0.684Sedative drug Midazolam/propofolRefRef Remifentanyl7.70 (2.74--21.65)\< 0.00115.88 (4.14--60.90)\< 0.001Data are present as a ratio (95% CI)*OR* Odds ratio, *CI* Confidence interval, *COPD* Chronic obstructive pulmonary disease, *BAL* Bronchoalveolar lavage, *TBLB* Transbronchial lung biopsy, *Ref* Reference
Discussion {#Sec15}
==========
We evaluated 186 subjects who underwent flexible bronchoscopy under sedation. Approximately 60% of these patients received remifentanil, while the remaining 40% received a combination of midazolam and propofol for procedural sedation. The patients in the remifentanil group were more likely to undergo invasive procedures during bronchoscopy (such as bronchoscopic biopsy, bronchoalveolar lavage, or transbronchial lung biopsy) than those in the midazolam/propofol group. Despite this finding, there was no significant difference between the groups in the occurrence of adverse safety events, including oxygen desaturation, hypotension, and arrhythmia. In addition, the recovery time was significantly shorter in the remifentanil group than in the midazolam/propofol group.
Ideal drugs for procedural sedation and analgesia (PSA), or "conscious sedation," have a rapid onset and short duration of action, and maintain hemodynamic stability with no major side effects \[[@CR14]\]. The classically used sedative drugs include the single or combined use of benzodiazepines, propofol, and opioids. A 2003 United Kingdom survey found that 78% of bronchoscopists routinely use midazolam sedation alone and that midazolam plus fentanyl/alfentanil was the most frequently combined regimen \[[@CR15]\]. Another study found that the most commonly used drugs in Switzerland were midazolam (46%) and propofol (77%) \[[@CR5]\]. However, unfortunately, there are no clear recommendations favoring one sedation regimen over another. The introduction of new sedative drugs, such as remifentanil and dexmedetomidine, has added to the complexity of combining sedative regimens \[[@CR7]--[@CR10]\].
Analgosedation refers to the use of an analgesic drug (usually an opioid) before a sedative is used to reach the sedative goal \[[@CR16]\]. Analgosedation is preferred over the sedative-hypnotic approach in critically ill patients, for whom the primary goal is to address pain and discomfort before adding hypnotic agents \[[@CR16]\]. The use of analgosedation has increased substantially over time and is accepted as a common protocol in the management of ICU patients in many hospitals \[[@CR16]\]. Accumulating data have suggested that analgosedation is safe and effective for the management of very vulnerable ICU patients. Although these data also suggest that analgosedation is safe for use during fiberoptic bronchoscopy, there is little evidence supporting this practice.
Remifentanil is a potent, selective µ-opioid receptor agonist that is metabolized by blood and tissue esterases independent of organ function \[[@CR17]\]. Remifentanil has a rapid onset and a short duration of action (half-life \< 10 min) with no tissue accumulation. The advantage of this drug is that its effect does not last long after it is stopped. Thus, one of the most important advantages of this drug is that it can be safely used in patients with organ impairment such as acute kidney injury and severe liver disease \[[@CR18]--[@CR20]\]. It also provides good hemodynamic stability \[[@CR21]\]. Another advantage of remifentanil is that it effectively suppresses cough \[[@CR22]\], which seems suitable for PSA during fiberoptic bronchoscopy.
Interestingly, despite several advantages of remifentanil, its utility for PSA in patients undergoing fiberoptic bronchoscopy has not been well elucidated. Two studies showed that the use of remifentanil alone is safe in ICU patients \[[@CR9], [@CR10]\]. Another study showed that remifentanil attenuates the hemodynamic response to rigid bronchoscopy without an increase of hypotension or bradycardia \[[@CR23]\]. However, most other studies regarding remifentanil studied its use in combination with other drugs \[[@CR7], [@CR24], [@CR25]\]. For example, Ryu and colleagues showed that the use of remifentanil plus propofol was associated with a shorter recovery time than was that of dexmedetomidine. However, the combination of remifentanil and propofol during bronchoscopy led to a higher incidence of desaturation and a need for oral cavity suctioning than did dexmedetomidine use \[[@CR7]\]. Therefore, it is unclear whether remifentanil can be safely and effectively used alone for PSA during fiberoptic bronchoscopy. From this perspective, our study provides important evidence that remifentanil can be used alone for PSA during fiberoptic bronchoscopy including cases that require complex procedures. In addition, we found that remifentanil use was associated with faster recovery time and comparable adverse events to those of midazolam/propofol use. The reasons for shorter procedure duration with remifentanil relative to midazolam/propofol are not fully explainable. Given the shorter half-life and stability of remifentanil compared to those of midazolam/propofol, the attending physicians might have given enough remifentanil to allow patients to be sufficiently sedated during bronchoscopy. On the other hand, patients receiving midazolam/propofol with relatively long half-lives may have been less sedated than those receiving remifentanil. However, since we did not compare the depth of sedation between the two groups, further studies are needed to confirm this suggestion.
One strength of our study is that it raises important questions regarding the clinical usefulness of remifentanil use alone for analgosedation during fiberoptic bronchoscopy. To the best of our knowledge, this is the first study to comprehensively evaluate the clinical utility and safety of remifentanil use in fiberoptic bronchoscopy in comparison with those of midazolam/propofol. Another strength of our study is that we employed a larger study population than did prior studies that evaluated the use of remifentanil alone during fiberoptic bronchoscopy. Regardless, this study also has several limitations. First, it has an inherent bias due to its retrospective design. It was also performed in a single university hospital. The second limitation is that the analgosedation drugs used in each patient were chosen at the discretion of the attending physicians. Therefore, this discretion may have resulted in the more frequent use of remifentanil (over conventional drugs) in vulnerable patients or in those who required more complex procedures. Therefore, the remifentanil group was more prone to include patients with disadvantageous clinical characteristics than was the midazolam/propofol group. Despite this limitation, we found that there were no significant differences between the groups with regard to adverse events. Third, we were unable to assess patient satisfaction scores and the level of sedation, which are important measures. Fourth, we could not assess the total dose of topical lidocaine used during the procedures.
Conclusions {#Sec16}
===========
Despite a higher proportion of patients who underwent more invasive procedures in the remifentanil group than in the midazolam/propofol group, there was no significant difference in the occurrence of safety events between the groups. Furthermore, the recovery time was faster in the remifentanil group than it was in the midazolam/propofol group. Our findings suggest that remifentanil alone may be safely and effectively used for PSA during fiberoptic bronchoscopy. Further prospective comparative evaluation is required to establish its superiority and cost-effectiveness over other contemporary drugs.
CI
: Confidence interval
ICU
: Intensive care unit
IQR
: Interquartile range
PSA
: Procedural sedation and analgesia
SD
: Standard deviation
**Publisher's Note**
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Hyun Lee and Yeong Hun Choe contributed equally to this work.
Not applicable.
Conception and design: HL, YHC, SP; Data analysis: HL, SP; Data interpretation and manuscript writing: HL, YHC, SP; Revision of the manuscript and contribution to intellectual content: HL, YHC, SP; SP is the guarantor of the manuscript. All authors have read and approved the manuscript.
This paper was supported by the Fund of Biomedical Research Institute, Chonbuk National University Hospital. Chonbuk National University Hospital played no role in the design of this study and collection, analysis, and interpretation of data, and writing of the manuscript.
All data extracted in this study are included in this article.
The study protocol has been approved by the Institutional Review Board of Chonbuk National University Hospital (CUH 2019--05-083). Given the retrospective nature of the study and the use of anonymized patient data, the requirement for informed consent was waived.
Not applicable.
The authors declare that they have no competing interests.
|
Q:
How to show a corresponding element from child Component at onClick event in main Component in React?
I'm building my first React project. I have a list that drops down on-hover on my main homepage, inside the drop-down, I'm trying to show specific list details with my child Component. I got the click-to-show function to work, but can't seem to make it work with showing the right corresponding detail (black&white parent should show black&white text description). My current code below:
class Style extends React.Component {
constructor(props) {
super(props);
this.state = { showDetail: false };
this.handleClick = this.handleClick.bind(this);
}
handleClick() {
this.setState((state) => ({
showDetail: !state.showDetail,
}));
}
render() {
return (
<section className="style">
<div className="style-list">
<p onClick={this.handleClick}>
Black & White</p>
<p onClick={this.handleClick}>
Modern</p>
<p onClick={this.handleClick}>
Old School</p>
</div>
<div className="style-description">
{this.state.showDetail ? <StyleDetail /> : null}
</div>
</section>
class StyleDetail extends React.Component {
render() {
return (
<div>
<p id="blackwhite">black&white description text</p>
<p id="modern">modern description text</p>
<p id="oldschool">oldschool description text</p>
</div>
);
}
}
Do I need key values to make this work? Or do I need to declare my corresponding elements as variables? Can't seem to wrap my head around it. Thanks in advance for any help!
From a newbie developer xx
A:
Create a new state to store current style and pass it to the StyleDetail component.
import React from "react";
class Style extends React.Component {
constructor(props) {
super(props);
this.state = {
showDetail: false,
currentStyle: ""
};
this.changeStyle= this.changeStyle.bind(this);
}
changeStyle(clickedStyle) {
let newState = {
currentStyle: clickedStyle
};
if (clickedStyle === this.state.currentStyle) {
newState.showDetail = !this.state.showDetail;
}
this.setState(newState);
}
render() {
return (
<section className="style">
<div className="style-list">
<p onClick={e => this.changeStyle("B&W")}>Black & White</p>
<p onClick={e => this.changeStyle("modern")}>Modern</p>
<p onClick={e => this.changeStyle("old-school")}>Old School</p>
</div>
<div className="style-description">
{this.state.showDetail && (
<StyleDetail currentStyle={this.state.currentStyle} />
)}
</div>
</section>
);
}
}
export default Style;
import React from "react";
class StyleDetail extends React.Component {
render() {
return (
<div>
{this.props.currentStyle === "B&W" && (
<p id="blackwhite">black&white description text</p>
)}
{this.props.currentStyle === "modern" && (
<p id="modern">modern description text</p>
)}
{this.props.currentStyle === "old-school" && (
<p id="oldschool">oldschool description text</p>
)}
</div>
);
}
}
export default StyleDetail;
Hope it helps :)
|
Set Default Regional Edition
Note: When you select a default region you will be directed to the MiningWeekly.com home page of your choice whenever you visit miningweekly.com. This setting is controlled by cookies and should your cookies be re-set you will then be directed to the regional edition associated with the geographic location of our IP address. Should your cookies be reset then you may again use the drop-down menu to select a default region.
Note: Search is limited to the most recent 250 articles. To access earlier articles, click Advanced Search and set an earlier date range.To search for a term containing the '&' symbol, click Advanced Search and use the 'search headings' and/or 'in first paragraph' options.
TORONTO (miningweekly.com) – Endemic mistrust between private sector miners and African jurisdictions belies the spirit and objectives set out in the African Union's African Mining Vision, an audience attending the eighth MineAfrica panel discussion at the Prospectors and Developers Association of Canada conference heard on Sunday.
"The biggest problem is mistrust between governments and the private sector. We are currently grappling with this issue," technical adviser to the Association Chamber of Mines and other Mining Associations of Africa and CEO of the Namibia Chamber of Mines Veston Malango said.
Advertisement
"As long as this mistrust is perpetuated, we will not make progress. The African Mining Vision will be difficult to pursue if we cannot solve this fundamental problem of instilling a higher level of trust."
According to him, the strategy is simple – the mining industry will have to undertake introspection and look at the perception governments have towards the mining industry.
Advertisement
He believes transparency is key, since it forms the foundation of trust.
However, this goes both ways; while far too often miners do not play open cards with their host governments, not fully disclosing production figures to avoid full taxation, conversely, miners fear governments want to "kill the golden goose" by taxing the life out of an industry during commodity boom times.
"We are working to implement the African Mining Vision. We want to make it work without killing the industry. We have to create the linkages to facilitate the goals of the African Mining Vision to create shared prosperity for all stakeholders," Malango said.
POLICIES FOR GROWTH
Governments understand that miners do not come to their countries for humanitarian missions, but are there to produce minerals in the pursuit of profit. However, the minerals beneath African people's feet belong to them and it is incumbent on the industry to ensure that communities and host jurisdictions share in the economic benefit of their minerals, Ethiopia's Mines, Petroleum and Natural Gas Minster Ato Motuma Mekassa stressed.
"We started late with mining policy development. But while we are formulating our policies, we aim to create political stability to enhance mining investment, while taking a 'best-lessons approach' for the long term. We know companies are coming for the profit, not only to leave a social benefit," he said, adding that to further mining investment in the country, the State is facilitating geomapping and focusing on creating supporting infrastructure.
"We have untapped resources in Ethiopia, but we want to make sure our communities benefit from investment. We try to establish accountability and transparency as key to mining development."
The African Mining Vision was adopted in 2009 as a framework to translate several outcomes focused around economic development to the benefit of Africans. The African Mineral Development Centre was created to assist in this process and it is currently actively working with 30 African jurisdictions to stimulate investment, United Nations Economic Commission for Africa's Africa Minerals Development Centre economic affairs office for mineral governance Paul Msoma noted.
"These frameworks are instruments to support the private sector, to the benefit of locals. We've created a compact to establish win-win situations with the private sector. The vision calls for the creation of strong linkages within the minerals sector, that encompass skills training, industrialisation and open business involvement."
Similar to Ethiopia's economic development, Sudan is late to the party, following years of political instability, civil war and international sanctions.
"Sudan has untapped natural resource opportunities. We have water, land and 40 minerals, while we are extracting only 13, led by gold," Sudan's Mining Minister Hashim Salim advised. So successful has the country's emerging gold sector been, that it produced 107 t of gold in 2017, ranking it as the second biggest gold producer in Africa and ninth largest in the world.
He noted that minerals were largely ignored in the past. "We've cleared out the old and made way for new ideas – we have new ideas and bold projects. A paradigm shift is needed in the West about Sudan. Our presence here confirms that we are ready for business."
He appealed to the private sector for help and assistance to meet the country's development goals, but investment had been stymied by years of international sanctions that had kept the country from accessing new technologies.
"We do not need magic to change Sudan, we already have the power within ourselves. We've built a new foundation for a new Sudan. You are welcome. We've already relaxed our investment regime to attract investment."
LAND REDISTRIBUTION
South Africa's Deputy Mining Minster Godfrey Oliphant echoed Salim's sentiments, noting that South Africa is working to restore confidence in the mining administration, following years of attrition under the inept administration of Jacob Zuma. Recently installed President Cyril Ramaphosa has vowed to usher in a "new dawn" for South Africa, and has given the Mining Ministry new marching orders to fix the system and stamp out corruption.
According to Oliphant, incoming Mining Minster Gwede Mantashe has been given three months to sort out mining policy problems, especially relating to industry concern about the latest iteration of the Mining Charter, which was, up until last month, being challenged in court on the basis of inadequate consultation.
However, the celebratory atmosphere in South Africa has been dimmed by the ruling African National Congress last week voting in support of a motion by opposition party, the Economic Freedom Fighters, for a constitutional review that would enable land to be expropriated without compensation.
Oliphant pointed out that despite South Africa, Australia and New Zealand's mining histories starting at roughly the same time, South Africa introduced Apartheid policies that saw swathes of land being taken from indigenous communities.
"The Mining Charter wants to repair this. Seventy per cent of the land belongs to 10% of the population. We've tried since 1994 to correct this, but in the 23 years since the new dispensation, only 8% of land has been redistributed.
"We now feel it's better to expropriate land painlessly. We will start with our vast State-owned lands. And there is a lot of goodwill from the private sector and farmers. Disowning land from people is last on the list," Oliphant said in response to questions about the market uncertainty the new policy has created.
He explained that policy stability is guaranteed in South Africa for periods of at least ten years at a time.
"We want to say our attitude has changed with the new regime. There are no issues of constitutionality. There is no regulatory vacuum in the country. We still have a very stable regime in place. We have environmental legacy challenges, but we are dealing with the ills of the past, correcting the present and looking forward to the future.
"We are looking forward to benefitting from a lot of taxes from you," he quipped.
Msoma noted that a populist agenda can be reconciled with what is best for a country. Governments are there to create policy, and policies are usually established to address problems.
"The issue of land redistribution needs a conversation, in order to find balance. Industry needs to know there are winds of change happening. But industry refuses to move with changes. There is no government that wants to kill the mining industry. But there are more than 3 200 miners active in Africa, and they have to start conceding to government demands in a constructive way. Dialogue and social agreements among all stakeholders are essential," he stressed.
Salima said land ownership is a shared issue in Africa. In Sudan, the land is owned by the government, but this does not necessarily work.
"We make it incumbent on companies to share their profits to give money back to people to build infrastructure. We also take a 7% royalty, of which 2% is given to the State to distribute to the people through whatever means. We want to stress that companies belong to the people, because they help them live better lives."
BENEFICIATION
One of the enduring themes of mining in Africa has been the paradox of plenty. Countries with an abundance of natural resources, tend to have less economic growth, less democracy, and worse development outcomes than countries with fewer natural resources.
The African Mining Vision aims to address this issue by stimulating regional manufacturing nodes. However, Malango noted that there is a common misconception among governments that miners are manufacturers and should contribute more to add downstream value to the minerals they produce.
"A miner can, at best, produce a pure metal. But that's where it stops. Governments should realise that proper policy formulation should stimulate manufacturing investment to get value-addition going.
"Africa is sitting with a significant young population and natural resources offer a great opportunity to uplift them. The mistrust between government and industry is exemplified by what is happening in Tanzania, and it is just the tip of the iceberg that will spread if trust issues are not sorted out soon," Msoma cautioned. |
Report: Reckless doctor prescriptions common in California
LOS ANGELES — An investigation finds California patients are at risk from reckless prescribing by doctors because of a lack of oversight at the state Medical Board.
The Los Angeles Times (http://lat.ms/SWhvgp) reports regulators seldom try to suspend the prescribing privileges of physicians under investigation for overprescribing.
At least 30 patients in Southern California have died of drug overdoses or related causes while their doctors were under investigation. The board ultimately sanctioned all but one of those 12 doctors, and some were criminally charged.
The newspaper says even when the board sanctions doctors for abusing their prescribing powers, in most cases it allows them to continue practicing and writing prescriptions.
In response to the Times' findings, officials have asked the Legislature to require county coroners to report all prescription drug deaths to the board. |
How we treat addiction to Amphetamine in Lincoln
We run a network of treatment plans to help those suffering by giving them a chance at sobriety and life. The road from addiction into recovery is difficult to face. With assistance from our trained professional team, our clients will have the opportunity to heal themselves together with our comprehensive programs. Each of our professionals is dedicated to following tendencies to stay up-to- date with advancements in technologies and information regarding issues of addiction and addiction treatment.
Lincoln AL Amphetamine Dependence
We treat dependence with different clinical approaches, including cognitive behavioral therapy, drug detoxification, and after-treatment alumni groups. Fixing dependence, however, is only part of the healing procedure. We're fundamentally committed to the prevention of alcohol and drug misuse.
Lincoln Amphetamine Recovery Facilities
Our centers are made to help individuals and provide them a fresh slate for life. Addiction is a disease that can be handled, especially with relapse prevention education and therapy. In our mission of treating dependence, our seasoned professionals are dedicated to providing exceptional service.
Our Amphetamine Treatment Programs in Zipcodes: 35096
Addiction is a complicated and extremely destructive disease. Therefore, to fight it, Recovery Helpline uses strategies to create the most effective applications for each client.
Recovery Facilities for Amphetamine in Alabama: 35096
We provide a family of different facilities where we provide individuals that are truly seeking an escape out of their dependence the tools they need for turning their lives around and beginning their journey to healing. With our dependence experts, we provide a variety of residences and holistic programs that are made to inspire relaxation, harmony, and peace in those who are trusted with all our care.
Our Mission
We provide individualized care in a safe and supportive environment for our clients to recover.
Drug and Alcohol Recovery Program Lincoln AL 35096
Physicians can pick on the grounds of a patient's particular medical conditions and other things. That's the reason doctors administer a remedy for Suboxone dependence Providence to allow an individual dependent on opioids to escape it and lead a normal and healthier life in strategy of time. It isn't likely to damage the person and it's challenging to abuse it. Nonetheless this is just the initial step in therapy. Medications have also become a critical section of a continuing treatment program enabling individuals to recover constraint of the health and their lives. You might find some stress. Thus it is essential that we strive to accomplish a balanced strategy to make certain that individuals afflicted by chronic pain can obtain the relief. If people use anxiety to be simply controlled by narcotics, they are not likely to become hooked on these drugs. Opioids are also stress relievers. Opiates could be sought. Suboxone has the antagonist Naloxone and buprenorphine. Subutex isn't designed for injection usage. Subutex has the exact attributes of opioids in a significantly flatter degree. Subutex was formulated to alleviate the withdrawal symptoms. I strongly encourage it, if you're in a place to help. That caused a push by drug businesses and the federal government to expand with opioids. While things might appear bleak, these changes are beginning to have a really significant positive effect. Chewing or ingesting Subutex is going to have no result. Several elements will have contributed to the seriousness of this prescription medication abuse issue that is present. It might have negative consequences. "This crisis wasn't an incident, this was engineered." You also ought to think about offering articles on the subject of opiate addiction detoxification, step one. After the investigation is finished and the person becomes began on Suboxone, there is looking back. Remember to do your homework before selecting a treatment centre that is appropriate. But we still don't have sufficient clinical advice if this is an appropriate treatment strategy to understand. Some users may substitute 1 medication for a different There are a lot of drugs that are distinct that may ease pain. Plus, the comprises any kind of source, for example transportation, that empowers an addict to keep the lifestyle up. Most opiate addicts don't realize they do not get as they're not accustomed to feeling bad. It's the ideal time to provide the chance to change when the addict receives financial support from friends and family members. To start with, I would like to help it become very obvious that substance abusers aren't the only people trying to escape life. Opioid dependence is among the drug dependencies that are hardest to remove without the assistance that is appropriate. Without the help of friends and family members, many individuals with addiction wouldn't have the chance. Celebrity Rehab using Dr. Drew, which a lot of people see for example of the greatest care available, as an example used a strategy that's not known to work for opioid addiction. It's similarly the sole medically-proved technique to cause continuing, quality sobriety. |
Introduction
============
Sialic acids are the most prevalent monosaccharides that are found at the nonreducing ends of glycans, and they are involved in many biologically important ligand--receptor interactions \[[@R1]\]. *N*-Acetylneuraminic acid (Neu5Ac) is the most studied monosaccharide from the 50 derivatives of sialic acid that are found in nature. The most common glycosidic linkages of Neu5Ac in glycoconjugates are α(2→3) and α(2→6) to galactose, α(2→8) and α(2→9) in polysialic acids \[[@R2]--[@R3]\], fucosyl and galactosyl α(1→4) to Neu5Ac, and intramolecularly C-7-to-C-2-linked (via oxygen), forming 2,7-anhydro-Neu5Ac \[[@R4]--[@R6]\]. Owing to the substantial role of sialic acids in biological systems, numerous synthetic methods have been described in the literature \[[@R7]--[@R16]\]. 2,7-Anhydro-Neu5Ac is the main prebiotic, which is utilized as a sole carbon source for human gut commensal anaerobic bacterium and plays a key biological role in body fluids and secretion \[[@R17]--[@R19]\].
Upon cleaving the internal ketal ring and protection of the OH-4 group, further modifications at carbon C-7 and sialylations at the C-2 position can be conducted. To study substrate specificity of bacterial and human sialidases using the library of position C-7-modified Neu5Ac, Chen and co-workers have described the systematic substitution of the OH-7 moiety of Neu5Ac by F, OMe, H, and N~3~ substituents \[[@R20]\]. Additionally, De Meo and co-workers have reported the significant effect of *O*-substituents on atom C-7 on the reactivity of thiosialoside donors and on the anomeric stereoselectivity of chemical sialylations \[[@R21]\]. Thus, 2,7-anhydro-Neu5Ac can serve as a promising building block for the chemical synthesis of gangliosides and other Neu5Ac-containing glycans after its 2,7-anhydro backbone has been opened. Representative structures of bacterial glycans containing sialic acid, which can be chemically synthesized from sialyl donors, are illustrated in [Fig. 1](#F1){ref-type="fig"} \[[@R2]--[@R5] [@R22]--[@R24]\].
{#F1}
One way to obtain Neu5Ac-containing oligosaccharides with the desired regioselectivity is to regioselectively protect the Neu5Ac acceptor. Although Neu5Ac with a free primary OH-9 function is easy to obtain, there are only limited ways to distinguish the secondary OH-4 and OH-7 group ([Fig. 1](#F1){ref-type="fig"}). In our previous report, we easily distinguished these alcohols by selective protection of the OH-7 functionality as 2,7-anhydro-Neu5Ac, leaving position OH-4 free for glycosylation upon protection of the vicinal OH-8 and OH-9 substituents as benzylidene or acetonide rings \[[@R6]\]. The formation of the bicyclo\[3.2.1\] backbone of 2,7-anhydro-Neu5Ac prevented not only the installation of protection groups at the C-2 and C-7 position, but also circumvented the tedious purification of anomeric isomers, as this gave only the α-isomer. Besides, the configuration of the alcohol OH-4 and the NHAc group in position C-5 changed from equatorial to axial after 2,7-anhydro backbone formation, which resulted in alleviation of hydrogen bonding, and thus enhancing the reactivity of the OH-4 group as an acceptor ([Fig. 1](#F1){ref-type="fig"}) \[[@R6]\].
Several chemical and enzymatic syntheses of 2,7-anhydro-Neu5Ac are currently being developed \[[@R6],[@R25]--[@R28]\]. However, only few synthetic applications of 2,7-anhydro-Neu5Ac are available in the literature. Previously, we successfully constructed the fucosyl α(1→4) to Neu5Ac linkage of ganglioside HPG-7 using 2,7-anhydro-Neu5Ac derivatives as acceptors \[[@R6]\]. For utilization as selective sialidase inhibitors, Chen's and Juge's groups have reported one-pot multienzyme synthetic protocols for 2,7-anhydro-Neu5Ac \[[@R17]--[@R19]\].
Our group has developed one-pot syntheses of several anhydro sugars via microwave (MW)-assisted intramolecular anomeric protection (iMAP) of silylated sugars as well as ring-opening protocols for their 1,6-anhydro bridges \[[@R29]--[@R31]\]. Accordingly, ᴅ-galactosamine and ᴅ‑allosamine derivatives were synthesized via scandium(III) triflate-catalyzed ring opening of 1,6-anhydroglucosamine derivatives \[[@R29],[@R32]\]. However, there is a paucity of reports on the Lewis acid-catalyzed acetolysis of the 2,7-anhydro backbone of Neu5Ac. Thus, the aim of this study was to cleave the ring of the 2,7-anhydro derivatives with a choice of suitable Lewis acids as catalysts in order to utilize the acetolysis products as building blocks for the chemical synthesis of Neu5Ac-containing glycans.
Results and Discussion
======================
It is known that Sc(OTf)~3~ \[[@R29],[@R32]\] and trimethylsilyl trifluoromethanesulfonate \[[@R33]\] in the presence of acetic anhydride act as acetolysis agents to cleave the 1,6-anhydro ring. In these reactions, Ac~2~O is used as both reactant and solvent, which can be easily removed in vacuo. Envisioned on these precedents, we applied an acetolysis procedure as a way to introduce acetate to the C-2 and C-7 position of Neu5Ac in order to prepare regioselectively protected glycosyl donors.
Our investigations began with the synthesis of 2,7-anhydro derivatives **2** and **3** following our previously published procedure \[[@R6]\]. In order to characterize the formation of the 2,7-anhydro skeleton, triols **2** and **3** were treated with 2,2-dimethoxypropane in the presence of a catalytic amount of camphorsulfonic acid (CSA) in acetonitrile to afford compound **4** in 63% and azide acceptor **4a** in quantitative yield ([Scheme 1](#C1){ref-type="fig"}).
![Concise synthesis of 2,7-anhydrosialic acid derivatives **2**--**6**. Conditions for the preparation of **2** and **3**, respectively, from **1** have been reported previously \[[@R6]\].](Beilstein_J_Org_Chem-15-2990-g005){#C1}
The crystal structure of **4** clearly showed that the NHAc group in position C-5 and the OH-4 group were oriented in a *trans-*diaxial configuration ([Fig. 2](#F2){ref-type="fig"}). This enhanced the nucleophilicity of the OH-4 group due to the absence of hydrogen bonding between these moieties. After confirming the structure of **4** by single crystal X-ray crystallography, compounds **2** and **3** were acetylated with Ac~2~O in the presence of a catalytic amount of 4-(dimethylamino)pyridine (DMAP) in pyridine to give **5** \[[@R6]\] and **6** in 75 and 77% yield, respectively ([Scheme 1](#C1){ref-type="fig"}), and the compatibility of acetyl protecting groups with the Lewis acids during acetolysis reactions was tested. The structure of compound **6** was confirmed by NMR analysis. The HMBC spectrum of **6** showed downfield shift of the atom H-4. Hydrogen H-7 illustrated a correlation separated by three bonds with atom C-2, like that with hydrogens H-4 and H-6 ([Fig. 2](#F2){ref-type="fig"}).
{#F2}
Furthermore, the C-1 and C-5 positions of compound **2** were functionalized in certain steps to open the 2,7-anhydro bridge. Accordingly, an additional *N*-acetyl moiety was introduced to **5** following the protocol developed by Boons and Demchenko by using isopropenyl acetate and *p*-TSA, which afforded **7** in 67% yield. On the other hand, per-*O*-benzoylation of **2** with benzoyl chloride in pyridine produced compound **9** in a moderate yield of 57% ([Scheme 2](#C2){ref-type="fig"}) \[[@R34]\].
{#C2}
Wong and co-workers reported the major effects of the carboxy group on the anomeric reactivity of sialic acid compared with the side chain protecting groups. Hence, we converted **2** into *O*-acetyl-protected hydroxymethyl group-substituted compound **11** in order to increase its reactivity by reducing the steric hinderance and destabilizing effect of the electron-withdrawing carboxy group at the anomeric center ([Scheme 2](#C2){ref-type="fig"}) \[[@R35]\]. This included a LiBH~4~ reduction in MeOH and THF, followed by acetylation of the hydroxymethyl group in **10** to furnish **11** in 82% yield.
After having obtained the 2,7-anhydrosialic acid derivatives **5**--**11**, they were subjected to various Lewis acid-catalyzed ring-opening reactions. In line with this, Sc(OTf)~3~-, copper(II) triflate-, and SnCl~4~-catalyzed acetolysis of diacetylamino and acetyl(benzyl)amino derivatives (**7** and **9**) did not afford the desired acetolysis products. In the course of these reactions, the functional diacetylamino and acetyl(benzyl)amino groups in **7** and **9**, respectively, were hydrolyzed to NHAc functionalities, giving **5** and **8**, respectively, but with compound **8** only affording an unidentifiable mixture of compounds. Similarly, the 2,7-anhydro backbone of **11** was not cleaved under the above conditions and results in either recovered starting material or unidentifiable mixtures. Differently, ring-opening reactions of **6** with BF~3~⋅OEt~2~, TMSOTf, and Sc(OTf)~3~ in Ac~2~O afforded glycal **13** ([Table 1](#T1){ref-type="table"}, entries 1--4). None of these conditions were successful for the acetolysis of these 2,7-anhydro derivatives, although they worked for the 1,6-anhydro sugars \[[@R29],[@R32]--[@R33]\]. Adding 10 equiv of acetic acid to suppress the 2,3-elimination reaction failed to give the desired compound **12**. Due to the absence of a hydrogen bond, azido-protected glycal **13** could be used as acceptor for reactions at its OH-4 and OH-8 group \[[@R36]--[@R37]\]. Moreover, it was used as sialyl donor in α-selective glycosylation reactions \[[@R35]\].
######
Optimization of the ring-opening reaction of **6**.
-------------------------------------------- --------------------------- ------------ --------- ---------------- --------

entry conditions *T* (^o^C) *t* (h) product, yield
**12** **13**
1 BF~3~⋅OEt~2~ (50 mol %),\ 100 19 -- 15%^a^
Ac~2~O (30 equiv)
2 TMSOTf (50 mol %),\ 70 20 -- 13%^a^
Ac~2~O (30 equiv)
3 TMSOTf (50 mol %),\ 70 11 -- 20%^a^
Ac~2~O (10 equiv)
4 Sc(OTf)~3~ (50 mol %),\ 100 2 -- 7%^a^
Ac~2~O (30 equiv)
5 SnCl~4~ (50 mol %),\ rt 20 54% 34%
Ac~2~O (30 equiv)
-------------------------------------------- --------------------------- ------------ --------- ---------------- --------
^a^Incomplete consumption of starting material.
Next, acetolysis of 2,7-anhydro derivative **6** was examined with SnCl~4~ as catalyst under neat conditions, which provided the expected β-ring-opened product **12** in a moderate yield ([Table 1](#T1){ref-type="table"}, entry 5). This acetolysis reaction resulted in regioselective acetylation of positions O*-*7 and O-2 in line with the principles of green chemistry.
It is known that anomeric acetates can be transformed smoothly into thioglycoside \[[@R15]--[@R16] [@R35]\] and sialyl halide \[[@R38]--[@R39]\] donors when treated with a thiol in the presence of triflic acid, BF~3~⋅OEt~2~, and HCl, respectively.
Through comparison with the reported mechanism of Sc(OTf)~3~-catalyzed acetolysis of 1,6-anhydro-β-hexopyranoses \[[@R32]\], we propose a plausible mechanism for the acetolysis of 2,7-anhydro-Neu5N~3~ derivatives **15** ([Scheme 3](#C3){ref-type="fig"}): First, Ac~2~O is activated with SnCl~4~ forming a polarized complex **14**. Next, the O-7 atom of **15** reacts with the acylium group in **14** to afford an unstable species **17** and its counter ion **16**. The C-2--O-7 bond of the positively charged intermediate **17** rapidly undergoes bond cleavage to generate the sialyl cation **18**, which is then attacked by nucleophile **16** from the β-face to provide the desired acetolysis product **20** and the original SnCl~4~ species. On the other hand, abstraction of hydrogen H-3 by the nucleophile **16** affords the 2,3-elimination product **19**.
{#C3}
To substantiate the reaction mechanism and expand the substrate scope, we synthesized derivatives **21** and **25** through alkylation of **3** with MeI/NaH and BnBr/NaH, respectively, in DMF, following the reported procedures \[[@R35]\], which afforded the trimethylated species **21** (40%) and the tribenzylated compound **25** (50%), respectively ([Scheme 4](#C4){ref-type="fig"}). Thus, the reactive 2,7-anhydro compounds **21** and **25**, which carried electron-donating groups, were examined under the established optimized ring-opening conditions.
{#C4}
As expected, the acetolysis proceeded well under the optimized conditions and gave the desired acetolysis products **22** and **26**. While ring opening of the triacetylated **6** and trimethylated **21** were accompanied by competitive 2,3-elimination, yielding products **13** (34%) and **23** (27%), respectively ([Table 2](#T2){ref-type="table"}, entries 1 and 2), the formation of glycal **28** from substate **25** was suppressed under the same conditions ([Table 2](#T2){ref-type="table"}, entry 3). The SnCl~4~-catalyzed acetolysis of tribenzylated **25** offered the acetolysis product **26** in a low yield (27%) and occurred faster than with **6** and **21**. The fast ring-opening reaction of **25** might have been attributed to the presence of three highly electron-donating benzyl groups. The low yield of **26** occurred because the more reactive primary benzyl group of **25** was cleaved \[[@R40]\] and replaced with an acetyl protecting group, resulting in **27** in 52% yield.
######
Substantiation of the reaction mechanism.
-------------------------------------------- --------------------------------------------- --------------------------------------------- ---------------------------------------------

entry donor ring-opening product glycal
1 \ \ \
**6** **12** (54%) **13** (34%)
2 \ \ \
**21** **22** (66%) **23** (27)
3 \ \ --
**25** **26** (27%)
4 \ -- \
**5** **24** (44%)
-------------------------------------------- --------------------------------------------- --------------------------------------------- ---------------------------------------------
Cleavage of the intramolecular glycosidic bond in **5**, **21**, and **25** was confirmed by NMR spectroscopic analysis. For example, position H-7 of compound **22** shifted downfield due to the presence of an acetyl group on oxygen atom O-7, which was introduced after cleavage of the 2,7-anhydro skeleton. NMR also showed no correlation with position C-2, but exhibited a correlation separated by three bonds with the quaternary carbon atom of the acetyl group in position O-7 ([Fig. 3](#F3){ref-type="fig"}). The anomeric configuration of the acetolysis products was identified by the coupling constant for the correlation C-1--C-2--C-3--H-3~ax~ ( = 1.6--2.2 Hz, see [Supporting Information File 1](#SD1){ref-type="supplementary-material"}) and indicated the β-anomer \[[@R12]--[@R16]\]. Moreover, the similar chemical shifts of positions H-3~eq~ and H-3~ax~ in the ^1^H NMR spectra of α-sialosides **6**, **21**, and **25** became much more different for the ring-opening products **12**, **22**, and **26**, again representative of the β-configuration.
{#F3}
Next, SnCl~4~-catalyzed acetolysis was evaluated with 2,7-anhydro derivative **5**; however, the reaction did not take place. On the other hand, only a known glycal **24** was obtained in a moderate yield of 44% by Sn(OTf)~2~ catalysis ([Table 2](#T2){ref-type="table"}, entry 4). The driving force for the formation of a 2,3-dehydro derivative **24** might have been attributed to the presence of a destabilizing electron-withdrawing carboxy group flanking atom C-2 and the lack of a participating auxiliary in position C-3 of **5**. Glycal **24** is widely used for α-sialylation by utilizing neighboring group participation and site-selective fluorination at C-3 \[[@R12]--[@R14] [@R41]\]. Moreover, it is the main precursor in the synthesis of inhibitors for *N-*acetylneuraminidases from different sources \[[@R42]\]. The ring opening of **5** was not trivial since the substrate had a sterically hindered quaternary anomeric center, unlike the tertiary anomeric center C-1 of 1,6-anhydro sugars \[[@R29]--[@R33] [@R43]\]. Furthermore, SnCl~4~ and Sn(OTf)~2~ might have formed a coordination bond with the carbonyl oxygen atom of the C-5 NHAc group and the O-6 position of the glucose glucopyranosyl ring. In turn, this retarded the ring-opening reaction. The anchimeric participation of the NHAc group in stabilizing the axial conformation of the sialyl cation could also have affected cleavage of the ring \[[@R12]--[@R14]\].
To further test the scope of the optimized ring-opening conditions, disaccharides **29**, **33**, and **37**, bearing a 2,7-anhydro-Neu5N~3~ unit, have been synthesized based on our reported procedure \[[@R6]\] and were examined as substrates ([Scheme 5](#C5){ref-type="fig"}). However, the desired acetolysis products **30**, **34**, and **38** were not obtained. Replacing the more reactive fucose moiety and the benzylidene acetal ring of **29**, i.e., using the less reactive complement **33**, was also unsuccessful. The branched fucose, benzylidene, and isopropylidene rings of the disaccharides were cleaved and acetylated, as shown in [Scheme 5](#C5){ref-type="fig"}. The difficulty of these reactions might have been attributed to the more liable nature of the tertiary acetal center C-1 of fucose as compared to the sterically hindered quaternary ketal functionality C-2 of the 2,7-anhydro skeleton. To our disappointment, an attempted acetolysis upon changing the fucose-containing disaccharides **29** and **33** with substrate **37** did not provide the desired ring-opening product **38** albeit it bore a robust N-5/O-4-oxazolidinone-based sialyl group ([Scheme 5](#C5){ref-type="fig"}). Furthermore, 8,9-di-*O*-acetylated disaccharide **39** was subjected to SnCl~4~-catalyzed acetolysis, but the reaction did not proceed even under prolonged reaction time, which might have been attributed to the bulkier anomeric center C-2 in the 2,7-anhydro bridge.
{#C5}
Conclusion
==========
In conclusion, an acetolysis reaction was carried out by considering various parameters, such as Lewis acid type and amount (both catalytic and stoichiometric), solvent, acetolysis agent, reaction time, and temperature. However, these conditions were unsuccessful using 2,7-anhydro-based monosaccharide derivatives bearing NHAc, NAc~2~, and NAcBz functionalities and the disaccharides containing a 2,7-anhydro-Neu5N~3~ unit. Meanwhile, we successfully developed a convenient route to conduct the SnCl~4~-catalyzed acetolysis of 2,7-anhydro-Neu5N~3~ monosaccharide derivatives functionalized with a variety of protecting groups. The acetolysis products could further be transformed into regioselectively protected thiosialoside and sialyl halide donors in order to serve as alternative building blocks for the synthesis of sialic acid-containing glycans.
Supporting Information
======================
######
Experimental section and spectroscopic data for compounds described herein.
######
X-ray crystallographic data for compound **4**.
We thank Dr. Sarah Lam for providing language editing and proofreading of the manuscript. We also thank Dr. Su-Ching Lin, Ms. Yi-Ping Huang, and Ms. Mei-Man Chen for their help with NMR experiments, Dr. Yuh-Sheng Wen for the X-ray crystallography experiment, and Ms. Ping-Yu Lin for conducting mass spectrometry experiments.
Funding
=======
This work was supported by the Ministry of Science and Technology, Taiwan (MOST 108-2133-M-001-019-; 106-2113-M-001-009-MY2) and Academia Sinica (MOST 108-3114-Y-001-002; ASSUMMIT-108).
|
.gg-corner-up-right {
box-sizing: border-box;
position: relative;
display: block;
transform: scale(var(--ggs, 1));
width: 22px;
height: 22px;
&::after, &::before {
content: "";
display: block;
box-sizing: border-box;
position: absolute;
right: 3px;
}
&::after {
width: 8px;
height: 8px;
border-top: 2px solid;
border-right: 2px solid;
transform: rotate(45deg);
top: 3px;
}
&::before {
width: 16px;
height: 12px;
border-top-left-radius: 4px;
border-top: 2px solid;
border-left: 2px solid;
top: 6px;
}
} |
Put Safety First When Winter Weather Strikes
11/08/2016 00:32
● By Family Features
Sponsored Content
Severe winter weather and dangerously low temperatures can pose a serious threat to family safety, particularly when the power supply is threatened. Many families rely on portable generators as part of their emergency plan, which can provide peace of mind and protection when used properly.
Preparation is the best defense against the dangers of cold winter weather, as inclement weather can arise suddenly and bring power outages and restricted mobility. In addition to assembling an emergency kit, including basics like battery-operated flashlights, non-perishable food items and a first aid kit, many families also have a portable generator available for emergency use. Portable generators provide safety, while helping avoid food spoilage, providing access to radio or television for important news and weather updates, and delivering energy necessary to run lights, heaters, hot water or appliances necessary for cooking.
However, portable generators can pose serious health risks when used improperly. Most notable is carbon monoxide poisoning, which can cause extreme illness and even death. Because you cannot smell, see or taste carbon monoxide, which is emitted in the exhaust from the generator, it is essential to exercise precautions when using the machine.
The Portable Generator Manufacturers’ Association recommends taking time to reacquaint yourself with your generator’s features and safe operating instructions, as well as keeping these safety tips in mind:
Keep the operator’s manual in a safe place so you can refer to it easily for further information about safe operation and potential hazards.
To avoid dangerous carbon monoxide accumulation from a portable generator, always “Take It Outside.” Never run a portable generator indoors, in areas such as garages, basements, crawl spaces, breezeways, sheds or other partially enclosed spaces.
Always place a portable generator downwind and point the engine exhaust away from occupied spaces.
Avoid placing a portable generator near windows, doors or vents, as carbon monoxide gas can accumulate and potentially be drawn indoors.
To power indoor items, install a manual transfer switch to avoid running dangerous cords through windows, doorways, holes in walls or ceilings.
Install battery-operated carbon monoxide alarms according to manufacturer’s instructions. Replace batteries and test the alarm regularly to ensure it is in good working condition.
If you feel sick, dizzy or weak while using your portable generator, get to fresh air immediately and call 911 for emergency medical attention.
Before temperatures drop and winter arrives in full force, now is the perfect time to brush up on how to safely use your generator. Learn more about operating a portable generator during severe weather at pgmaonline.com and takeyourgeneratoroutside.com. |
1. Field of the Invention
The present invention relates to a magnetic field generator and a method of driving the same and, more particularly, to a magnetic field generator suitably used as a biasing magnetic field generating means of an optomagnetic data (information) recorder and capable of switching the direction of a magnetic field at a high speed and to a method of driving the magnetic field generator.
2. Description of the Prior Art
An electromagnetic converter using an electromagnet is conventionally known as a device for generating a magnetic field.
Such a magnetic field generating means is used as a magnetic head of a tape recorder and the like. In this case, since the magnetic head and a tape are brought into contact with each other to record/reproduce data, a high magnetic flux density need only to be obtained near the magnetic head. Therefore, the device can be made small in size, and a good response of the electromagnet can be obtained. In addition, since magnetic fluxes can be concentrated by adjusting a gap and the like between both right and left poles of the magnetic head, a high magnetic flux density can be obtained even if the device is made small in size.
On the other hand, in an optomagnetic recorder which has been recently noted as a large capacity data memory, the above magnetic field generator is used to obtain a biasing magnetic field during recording or erasing of data. For example, U.S. Pat. No. 4,597,018 describes an optomagnetic recorder including a magnetic field generating means. In addition, U.S. application Ser. No. 866,314 filed May 23, 1986 assigned to the same assignee describes a process of data recording by applying a biasing magnetic field. Furthermore, U.S. application Ser. No. 620,808 filed June 14, 1984 (now U.S. Pat. No. 4,686,661), Ser. No. 904,453 filed Sept. 8, 1986, and Ser. No. 907,749 filed Sept. 16, 1986, all assigned to the same assignee as the present invention, describe an example of a magnetic field generator using an electromagnet.
In such a magnetic field generator used in an optomagnetic data recorder, a magnetic flux density having a magnetic field of several hundreds to several kOe is required even at a position apart from an electromagnet by several mm. This is because it is difficult to move a magnetizing medium within a range of about 2 mm to the electromagnet since the magnetizing medium is located inside of the magnetic disk surface by about 1.2 mm and when the disk is rotated, the disk surface is vertically moved by about 1 mm due to vibration.
Therefore, in the optomagnetic data recorder, a relatively large electromagnet must be used to obtain a predetermined magnetic flux density.
In addition, in the optomagnetic data recorder, the direction of a biasing magnetic field must be switched between data recording/reproducing operations. If this recording/reproducing switching operation is not performed rapidly, a data transfer speed is undesirably decreased. For this reason, according to a conventional driving method, a high voltage is applied across a coil of an electromagnet to cause a magnetic field to rise, and then the voltage is decreased to hold a constant magnetic field.
In such an electromagnet, in order to switch a magnetic field at a high speed, a coil having a large diameter wire with a small number of turns must be used, and a large current must be flowed therethrough. On the other hand, a large ampere-turn is necessary to hold a large magnetic flux. When a small current is flowed to suppress heat generation, the number of turns of the coil must be increased. However, according to the above-mentioned electromagnet, the magnetic field is switched and held by a single coil. Therefore, when the number of turns of the coil is increased, a high voltage power source is required, thereby increasing a power consumption at a driving stage. On the contrary, when the number of turns of the coil is decreased, a power consumption of the electromagnet is increased, thereby increasing the amount of generated heat. |
Q:
is there any tool to create a wsdl?
I am new to webServices. I want to develop a webservice in Java. So far I came to know, WSDL is needed to kickstart with WebServices. So, How do I create a WSDL? Is there any tool which makes this easy?
Thanks in advance.
A:
If you use JAX-WS (ships with Java 6, separate download for Java 5) and you expose a @WebMethod properly the WSDL can be automatically generated by the JAX-WS stack at runtime.
|
Our View: Obama’s limits on surveillance not strong enough
The limits on the massive surveillance of Americans that President Barack Obama announced Friday are significant and necessary. His plan, however, should be only the start to striking the right balance between national security and civil liberties.
The limits on the massive surveillance of Americans that President Barack Obama announced Friday are significant and necessary. His plan, however, should be only the start to striking the right balance between national security and civil liberties.
Obama is seeking a middle path on a controversial, fundamental issue, and he is far more eloquent describing the challenges than prescribing solutions. He is not dismantling the National Security Agency’s dragnet, and he left key details of his proposals unresolved and left their implementation largely up to Congress and intelligence agencies.
Obama said he will require the NSA, except in true emergencies, to get permission from a secret intelligence court before searching a vast repository filled daily with phone records from hundreds of millions of Americans. He also directed that the metadata – numbers called and received, and time and length of calls, but not the content – be taken out of government hands, though it’s yet to be determined who will keep the information. We have to ask, are we better off having companies warehousing that data than the government?
The president also proposed a panel of outside privacy experts who would appear before the intelligence court in significant cases. But he didn’t say who would decide which cases qualify, or what role the advocates would play.
Obama is rejecting some key recommendations of his own handpicked review panel. For instance, the panel said the NSA should not undermine commercial software and exploit flaws to conduct surveillance and launch cyberattacks. Executives at Google, Yahoo and other Silicon Valley companies are very concerned – and told Obama so last month.
The president also turned aside the panel’s advice that a judge’s approval should be required for national security letters, used some 20,000 times a year to obtain customer information from banks, communications companies and other businesses.
With the president’s plan finally in hand, the responsibility now falls even more on Congress to enact reforms. They should not feel constrained by the president’s limitations.
A major bipartisan bill has been introduced by the primary authors of the USA Patriot Act, which passed after the 9/11 attacks and which authorized the phone data collection. The lawmakers now say that surveillance has gone too far and must be curtailed. T he USA Freedom Act has 124 co-sponsors in the House, 64 Democrats and 60 Republicans.
Obama declared that, absent a compelling national security purpose, the United States won’t eavesdrop on allied leaders. He is also extending some privacy protections to ordinary citizens in foreign countries.
For Americans, however, he seemed more intent on changing perceptions and rebuilding public confidence. He spent much of his long-awaited speech justifying the unprecedented surveillance of Americans’ daily communications, even though there is scant proof that such sweeping programs have stopped any terrorist attacks. He took pains to reassure NSA employees, downplaying their “mistakes” despite documents declassified by his administration showing that the agency repeatedly violated court orders and its own rules.
Obama chose to speak at the Department of Justice instead of the NSA headquarters, signaling the importance he puts on the rule of law.
His speech’s unintentional timing may be more telling, however. Friday was the anniversary of former President Dwight D. Eisenhower’s 1961 Cold War warning that a powerful “military-industrial complex” posed a threat to our democracy. In the post-9/11 world, we now have a “security-industrial complex” of 16 intelligence agencies, 100,000 employees and $50 billion black budgets.
“What’s really at stake,” Obama said, “is how we remain true to who we are in a world that is remaking itself at dizzying speed.”
To meet that challenge, we’ll have go much further than the president did on Friday. |
Q:
Find words, that are substrings of other words efficiently
I have an Ispell list of english words (nearly 50 000 words), my homework in Perl is to get quickly (like under one minute) list of all strings, that are substrings of some other word. I have tried solution with two foreach cycles comparing all words, but even with some optimalizations, its still too slow. I think, that right solution could be some clever use of regular expressions on array of words. Do you know how to solve this problem quicky (in Perl)?
A:
I have found fast solution, which can find some all these substrings in about 15 seconds on my computer, using just one thread. Basically, for each word, I have created array of every possible substrings (eliminating substrings which differs only in "s" or "'s" endings):
#take word and return list of all valid substrings
sub split_to_all_valid_subwords {
my $word = $_[0];
my @split_list;
my ($i, $j);
for ($i = 0; $i < length($word); ++$i){
for ($j = 1; $j <= length($word) - $i; ++$j){
unless
(
($j == length($word)) or
($word =~ m/s$/ and $i == 0 and $j == length($word) - 1) or
($word =~ m/\'s$/ and $i == 0 and $j == length($word) - 2)
)
{
push(@split_list, substr($word, $i, $j));
}
}
}
return @split_list;
}
Then I just create list of all candidates for substrings and make intersection with words:
my @substring_candidates;
foreach my $word (@words) {
push( @substring_candidates, split_to_all_valid_subwords($word));
}
#make intersection between substring candidates and words
my %substring_candidates=map{$_ =>1} @substring_candidates;
my %words=map{$_=>1} @words;
my @substrings = grep( $substring_candidates{$_}, @words );
Now in substrings I have array of all words, that are substrings of some other words.
|
This section is intended to introduce the reader to various aspects of art, which may be related to various aspects of the present disclosure that are described and/or claimed below. This discussion is believed to be helpful in providing the reader with background information to facilitate a better understanding of the various aspects of the present disclosure. Accordingly, it should be understood that these statements are to be read in this light, and not as admissions of prior art.
In spite of the numerous improvements made recently in this technological field, 3D rendering remains as the object of intensive researches, with many issues still unsolved. Acquisition systems of background art are usually composed of 3D camera rigs where the cameras are aligned horizontally (or considered as equivalent through the implementation of mirrors). As a consequence, only the horizontal disparity between the 3D views can be evaluated.
Some algorithms of view interpolation have been developed, especially to adjust the level of 3D. This interpolation is performed exclusively in the horizontal direction, as illustrated by FIG. 1. The input format required to perform this operation must include the horizontal disparity (or depth) of the view. This format can be for instance multi-view+depth: the left and right 3D views, and the disparity map coding the disparity per pixel between these views.
Philips/Dimenco proposed a format named “Layered Depth video—LDV” (cf. FIG. 2). This format includes a video view corresponding to a central camera, a depth map associated to this view, an occlusion layer and its depth map. This format is one of the input format of the Dimenco multi-view monitors. Thanks to this information, the monitor can interpolate peripheral views around the central view. These peripheral views correspond to the views, as they would be acquired by peripheral cameras, horizontally shifted (dotted line cameras in FIG. 2).
Some areas behind the foreground objects are occluded in the central view. These areas will be disoccluded by the peripheral view interpolation. These background areas are reconstructed thanks to the occlusion layer and its depth map. For instance, the view corresponding to the virtual left dotted line camera will be reconstructed with the background information at the left of the horse (FIG. 3).
The position range of the interpolated view (corresponding to a distance of the virtual camera from the central camera) depends on the amount of information in the occlusion layer. The more information available behind the foreground object, the further the interpolated view from the central view can be.
In this example of prior art, since only horizontal information are available, only horizontal view interpolation can be performed. Therefore, the 3D effect can only be satisfactory rendered if the eyes axis is horizontal.
It would hence be desirable to provide a method for 3D rendering, which shows improvements over the background art. |
In the
United States Court of Appeals
For the Seventh Circuit
____________
No. 02-3657
DONNA RADASZEWSKI, Guardian,
on behalf of ERIC RADASZEWSKI,
Plaintiff-Appellant,
v.
BARRY S. MARAM,* Director,
Illinois Department of Public Aid,
Defendant-Appellee.
____________
Appeal from the United States District Court
for the Northern District of Illinois, Eastern Division.
No. 01 C 9551—John W. Darrah, Judge.
____________
ARGUED SEPTEMBER 8, 2003—DECIDED SEPTEMBER 8, 2004
____________
Before KANNE, ROVNER, and DIANE P. WOOD, Circuit
Judges.
ROVNER, Circuit Judge. As a consequence of brain
cancer and a stroke that he suffered at the age of 13, Eric
*
Barry S. Maram, the current director of the Illinois Department of
Public Aid, is substituted as the defendant in lieu of the named
defendant, Jackie Garner. Fed. R. App. P. 43(c)(2).
2 No. 02-3657
Radaszewski requires around-the-clock medical care in
order to survive. Until he reached the age of 21, the Illinois
Department of Public Aid (“IDPA” or the “Department”)
provided funding through a Medicaid program for children
that enabled Eric to receive 16 hours of private-duty nurs-
ing at home each day. After he turned 21, Eric was no
longer eligible to participate in that program. Illinois has a
separate program providing at-home care for adults who
would otherwise have to be cared for in institutions. How-
ever, funding under that program is capped at a level that
is insufficient to pay for the extent of private-duty nursing
that Eric would need in order to remain at home. Conse-
quently, Eric faces the prospect of entering a long-term care
facility in order to receive the intensive medical care that he
needs. Eric’s mother, Donna Radaszewski, filed this suit
against the Director of the IDPA (the “Director”) on Eric’s
behalf, contending that the IDPA’s failure to fully fund at-
home, private-duty nursing for Eric amounts to disability
discrimination in violation of section 504 of the Rehabilita-
tion Act of 1973, 29 U.S.C. § 794 (the “Rehabilitation Act”),
and Title II of the Americans with Disabilities Act of 1990,
42 U.S.C. § 12132 (the “ADA”), in that Illinois is refusing to
provide the medical services that Eric requires in order to
remain in the most community-integrated setting appropri-
ate for his needs, which is his home. The district court
entered judgment on the pleadings in favor of the Director,
reasoning that the ADA claim against the Director was
barred by the Eleventh Amendment and that the Rehabili-
tation Act claim failed as a matter of law because in-home
nursing care is not a service that Illinois currently provides
to any adult individual. We reverse and remand for further
proceedings.
I.
As this case was resolved on the basis of the pleadings, we
accept the facts alleged in Radaszewski’s supplemental
No. 02-3657 3
complaint as true. E.g., Midwest Gas Servs., Inc. v. Indiana
Gas Co., 317 F.3d 703, 709 (7th Cir.), cert. denied, 124 S. Ct.
82 (2003). We also take judicial notice of the contents of
certain matters in the public record, including administra-
tive findings about Eric’s medical status and needs. See,
e.g., Menominee Indian Tribe of Wisconsin v. Thompson, 161
F.3d 449, 456 (7th Cir. 1998).
Eric was diagnosed with medulloblastoma, a form of brain
cancer, in 1992. After undergoing surgery, radiation, and
chemotherapy to treat the cancer, Eric suffered a mid-brain
stroke in 1993. The cancer, stroke, and medical treatment
have impaired Eric’s physical and mental functions and left
him medically fragile. In the opinion of his physician, Eric
requires one-on-one care by a registered nurse 24 hours per
day in order to survive.
Since July 1994, Eric has received around-the-clock care
at his parents’ home. In August 1995, when his family had
exhausted its medical insurance benefits, Eric began to
receive at-home nursing care through the Illinois Medicaid
program.
Medicaid, a program funded jointly by the States and the
federal government, provides medical assistance both to dis-
abled individuals and to families with dependent children
whose income and resources are otherwise insufficient to
pay for the cost of the medical care that they require. See 42
U.S.C. § 1396; 305 Ill. Comp. Stat. Ann. 5/5-1. Each State
participating in the Medicaid program must submit for
approval to the U.S. Secretary of Health and Human
Services (“HHS”) a plan setting forth the services that the
State will provide in its Medicaid program. 42 U.S.C.
§§ 1396, 1396a(a)(10), 1396d(a), 42 C.F.R. § 440.230(a).
“Private-duty nursing,” defined as nursing services pro-
vided to a person who requires more individualized and
continuous care than would routinely be provided by a
visiting nurse or by the nursing staff of a hospital or skilled
4 No. 02-3657
nursing facility, 42 C.F.R. § 440.80, is one of the services
that a State may elect to include in its Medicaid plan. 42
U.S.C. §§ 1396d(a)(8), 1396a(a)(10)(C); 42 C.F.R. § 440.225.
A State may choose to provide private-duty nursing services
at the recipient’s home, at a hospital, or at a skilled nursing
facility. 42 C.F.R. § 440.80(c). Prior to this litigation, the
Illinois Medicaid plan included coverage for private-duty
nursing, provided that such nursing was recommended by
a physician, prior approval was obtained from the appropri-
ate State agency, and the care was provided by someone
other than the recipient’s relative; the plan imposed no
limitation on the cost of such care, nor did it limit where
private-duty nursing could be provided to the Medicaid
recipient. See Radaszewski ex rel. Radaszewski v. Garner, 805
N.E.2d 620, 623-24 (Ill. App. Ct. 2003), supplemented on
denial of reh’g (March 25, 2004). In the course of this litiga-
tion, however, Illinois drafted an amendment to its
Medicaid plan to delete all references to private-duty
nursing and submitted the amendment to HHS for clear-
ance; the Secretary approved that amendment on February
2, 2001. Id. at 622-23; Radaszewski Reply Br. Addendum
12-13. The State then initiated rulemaking under the
Illinois Administrative Procedure Act to implement the
change; that process was completed as of September 1,
2001. See Radaszewski, 805 N.E.2d at 622-23.
In addition to the services outlined in their basic Medicaid
plans, States may seek HHS approval to provide home and
community-based services to individuals who would other-
wise require institutional care. The HHS Secretary may
approve these services in the exercise of his “waiver” au-
thority, so labeled because it empowers the Secretary to
waive certain Medicaid requirements that would otherwise
constrain a State’s ability to offer these services—e.g.,
service limitations and financial eligibility criteria. See 42
U.S.C. § 1396n(b)-(h); 42 C.F.R. § 430.25(d). This power is
often used to authorize innovative and experimental
No. 02-3657 5
programs. As relevant here, it facilitates state programs
designed to provide home- and community-based services to
persons who would otherwise have to be cared for in nursing
homes or other institutions: specifically, the Secretary may
issue waivers permitting a State to offer these services only
to individuals who need them in order to avoid
institutionalization, rather than to every State citizen who
qualifies for Medicaid. See 42 U.S.C. § 1396n(c)(1). In seeking
approval for a waiver program offering home and commu-
nity care, however, the State must certify that it is cost-
neutral in the sense that the average per-person cost of the
care offered through the waiver program does not exceed
the average cost of providing that care in an institutional
setting. See § 1396n(c)(2)(D); 42 C.F.R. § 441.302(e).
Pursuant to this waiver authority, HHS has approved
Illinois’s Medicaid program for Medically Fragile, Technology
Dependent Children (the “MFTDC program”). This program
offers a variety of home- and community-based services and
equipment to medically fragile persons under the age of 21
who would otherwise have to be cared for in a skilled
pediatric facility or a hospital. See 89 Ill. Admin. Code §
140.645. The services offered by this program include
private-duty shift nursing and respite care in the recipient’s
home. The amount of services that a person may receive
under this program is determined with reference to the cost
of the care that he or she alternatively would require in a
skilled pediatric facility or a hospital. 89 Ill. Admin. Code
§ 140.645(c)(3).1
1
The Director points out that Congress has required each State
to provide comprehensive medical screening, diagnostic, and
treatment to persons under the age of 21, even if such care
involves services not otherwise covered under the State’s basic
Medicaid plan. See 42 U.S.C. §§ 1396d(a)(4)(B), 1396d(r); see also
305 Ill. Comp. Stat. Ann. 5/5-19(a) (outlining Illinois’s Healthy
(continued...)
6 No. 02-3657
Eric was found eligible for the MFTDC program and be-
gan receiving services in 1995. Based on the estimated cost
of the level of care that Eric would require in a medical
institution, the IDPA approved a care plan for Eric that
called for 16 hours per day of in-home nursing services
provided by registered nurses. Eric’s parents, who were
given special training so that they could provide the nec-
essary care for Eric, tended to him the remaining eight
hours of each day. In order to provide them with periodic
relief from that responsibility, the IDPA also provided Eric
an additional 336 hours of respite nursing services per year.
The IDPA approved this care plan annually until Eric
reached the age of 21 when, by virtue of his age, he became
ineligible for continued participation in the MFTDC
program.
Illinois has a separate HHS-approved waiver program for
disabled adults—the Home Services Program (“HSP”)—
which, like the MFTDC program, offers services not other-
wise covered by the State’s basic Medicaid program and
which enables such adults to continue living at home in lieu
of being cared for in an institution, provided that the cost of
at-home care does not exceed the cost of institutional care.
See 89 Ill. Admin. Code §§ 676.10(a), 676.30(j), 682.100.
However, the services provided pursuant to the HSP are
limited by a Service Cost Maximum (“SCM”) established by
the IDPA. 89 Ill. Admin. Code § 679.50(a). The SCM is
determined with reference to what it would cost to provide
nursing care to the recipient in an institutional setting, e.g.,
a hospital or a nursing facility. See id.; see also 42 C.F.R. §
441.302(c). Based on his degree of impairment and his need
for medical care, an individual who seeks to participate in
1
(...continued)
Kids Program). By virtue of that mandate, States may in practice
offer more Medicaid services to persons under the age of 21 than
they do to adults.
No. 02-3657 7
the HSP is assigned a Determination of Need (“DON”) score
reflecting his risk of institutionalization. See 89 Ill. Admin.
Code §§ 676.30(d), 679.10-679.50. Eric received a DON score
of 70, and at that time, the standard SCM for an individual
with that DON score was $1,857.00 per month. See 89 Ill.
Admin. Code § 679.50 (b) (setting forth current SCMs for
participants in HSP). A higher “exceptional care rate” may
be approved for an individual with a “complex medical
diagnosis.” See 305 Ill. Comp. Stat. Ann. 5/5-5.8a; 89 Ill.
Admin. Code § 140.569(a); In re Appeal of Eric
Radaszewski, Appeal No. 00-019688-HSP, Findings of Fact
of the Hearing Officer ¶ F (IDPA Aug. 18, 2000) (hereinafter,
“IDPA Hearing Officer Findings”).2 A counselor with the
IDPA’s Office of Rehabilitation Service (“ORS”), after
reviewing Eric’s situation, requested and obtained approval
of an exceptional care rate for Eric in the amount of $4,593
per month. However, in the assessment of Eric’s physician,
that amount would only be sufficient to cover four to five
hours per day of at-home nursing services for Eric. The
estimated cost of maintaining Eric’s at-home care 24 hours
per day3 is between $15,000 and $20,000 per month.
2
The exceptional care rate corresponds to what the IDPA would
pay a skilled nursing facility to provide “exceptional medical care” to
the individual. See 305 Ill. Comp. Stat. Ann. 5/5-5.8a; 89 Ill. Admin.
Code § 140.569(a)(1). “Exceptional medical care” is defined as “the
level of medical care required by persons who are medically stable for
discharge from a hospital but who require acute intensity hospital
level care for physician, nurse, and ancillary specialist services .
. . .” 305 Ill. Comp. Stat. Ann. 5/5-1.1(i); see also 89 Ill. Admin.
Code § 140.569(a)(2). Persons eligible for such care, and for
reimbursement at the exceptional care rate, include (but are not
limited to) individuals with head injuries, ventilator-dependent
persons, and persons with HIV/AIDS. Id.
3
Although Eric’s parents historically have provided eight hours
of care to Eric each day, the record indicates that they are now
seeking to have the State fund 24-hour-per-day care to Eric, as the
(continued...)
8 No. 02-3657
However, the ORS contended that it was not authorized to
pay for at-home medical care in excess of what it would cost
to provide exceptional care for Eric at a skilled nursing
facility. The IDPA took the position that if funding at the
exceptional care rate was insufficient to provide for Eric’s
care at home, then he would to have to move to an institu-
tional setting in order to receive care. It determined that
Eric could be adequately cared for in a nursing home
facility.
Eric filed an administrative grievance with the IDPA,
contending that the Department should be required to pay
more than the exceptional care rate so that he could con-
tinue receiving the care he requires at home rather than in
a nursing home. At the conclusion of an evidentiary hearing
conducted in July 2000, a hearing officer made a number of
factual determinations, including the following findings as
to the level of care that Eric requires:
H. The uncontradicted evidence submitted by Grievant
[Eric] is that the Grievant would be at risk of danger if
he should be placed in a nursing home. Grievant’s
doctor testified that Grievant needs substantial one on
one nursing care to survive. He is medically fragile, prone
to infections, immobilized, catheterized and relies on
oxygen. A registered nurse is required to look for prob-
lems before they become “full blown and he crashes,”
according to Grievant’s doctor. His immunological re-
sponses were severely compromised due to earlier radi-
ation and chemotherapy, so skilled nursing care is a
3
(...continued)
state of their own health has diminished their ability to care for
Eric themselves. Eric’s father has suffered a stroke and can no
longer drive or help move Eric. Eric’s mother was diagnosed with
a brain tumor, and as a result of the tumor and the treatment for
it, she cannot tolerate heat and suffers from dizzy spells. IDPA
Hearing Officer Findings ¶ G.
No. 02-3657 9
“question of survival, not a question of doing well.” The
physician strongly urged that Grievant be given the
funds to support 24 hours per day of skilled nursing
care. Placing Grievant in a nursing home facility of the
type suggested by the State, according to the physician,
would result in Grievant being seriously medically com-
promised, which would lead to many hospitalizations.
I. Grievant’s physician’s opinion was supported by the
registered nurse in charge of Grievant’s care. He
described Grievant’s medical needs in detail. Grievant
has no sense of thirst, so his hydration must be care-
fully monitored in order to avoid serious medical com-
plications. Although Grievant has difficulty swallowing,
he can be given soft food, but only under careful condi-
tions. His nutrition must be carefully monitored.
Grievant cannot protect his airway by turning his head;
any aspiration of food, liquid or medicine can become a
medical emergency. Chronic sinus infections lead to
sepsis, which can be rapid and acute. Grievant also has
osteoporosis and is in danger of breaking bones. His
risk of injury is high because he sometimes forgets he
cannot walk. His short-term memory is not good and he
is often confused. He also has difficulty with urination
and elimination, which if left untreated, can result in
medical emergencies. Grievant has to be under constant
surveillance.
J. According to the expert witness offered by Grievant,
Grievant could not get the level of required nursing care
in a nursing home facility, including the facility sug-
gested by the State (Alden Lincoln Park Nursing
Facility). In her assessment for this hearing, the expert
contacted several nursing homes (including Alden) and
asked about the level of care provided. According to this
witness, none would provide the level of care need by
Grievant: 24 hour[s] per day by skilled clinical nurses.
She based her assessment on the Grievant’s medical
10 No. 02-3657
file, her observation of Grievant, and her 20 years of
experience as a skilled nursing professional.
IDPA Hearing Officer Findings ¶¶ H-J. Presented with the
hearing officer’s factual findings and Eric’s grievance, IDPA
Director Ann Patla concluded that the sole issue that she
had the authority to resolve was whether the IDPA’s own
rules permit the HSP to pay for an individual’s medical care
at a level greater than the exceptional care rate. She
concluded that they do not. In a decision issued in August
18, 2000, she stated: “I find that the Rules set forth do not
allow the HSP program to pay greater than the SCM at the
exceptional care rate in any case.” In re Appeal of Eric
Radaszewski, Appeal No. 00-019688-HSP, Final Adminis-
trative Decision (IDPA Aug. 18, 2000).
On September 1, 2000, Radaszewski filed a complaint for
declaratory and injunctive relief against the IDPA director
in federal court, asserting that a reduction in the level of
private-duty nursing provided to her son at home would
constitute a violation of the federal Medicaid statute as well
as a deprivation of due process in violation of the Four-
teenth Amendment. She sought and obtained a temporary
restraining order obligating the IDPA to continue funding
Eric’s at-home care. However, the district court subse-
quently denied Radaszewski’s request for a preliminary
injunction, concluding that Radaszewski’s complaint alleged
no viable federal claim and that the court consequently
lacked authority to award her preliminary injunctive relief.
Radaszewski v. Patla, No. 00 C 5931, Order (N.D. Ill. Nov.
7, 2000). Radaszewski appealed the preliminary injunction
ruling to this court. While that appeal was pending, HHS on
February 2, 2001, approved the amendment to Illinois’ basic
Medicaid plan eliminating private-duty nursing as a service
provided under that plan. Both parties agreed that the
amendment rendered Radaszewski’s lawsuit moot. On that
basis, we dismissed her appeal in an unpublished order.
No. 02-3657 11
Radaszewski v. Patla, No. 00-3929, 2 Fed. Appx. 565, 2001
WL 242169 (7th Cir. March 8, 2001) (unpublished) (text
available in Westlaw).
Meanwhile, in December 2000, after the district court had
denied her motion for a preliminary injunction, Radaszewski
filed suit against the IDPA Director in Illinois court—
seeking injunctive relief compelling the IDPA to fully fund
the cost of the private-duty nursing care that Eric required
in order to remain at home. Each of the theories that
Radaszewski asserted in support of this relief was premised
on state law. The state court entered a temporary injunc-
tion requiring the IDPA to restore funding to the
Radaszewski family sufficient to pay for 16 hours of private-
duty nursing per day. That injunction, we are told, remains
in effect today. Nearly one year later, the state court
granted Radaszewski leave to file a supplemental complaint
which added, inter alia, claims under Title II of the ADA, 42
U.S.C. § 12132, and Section 504 of the Rehabilitation Act,
29 U.S.C. § 794. Radaszewski contended that the IDPA’s
refusal to pay for full-time private-duty nursing for Eric at
his home was inconsistent with the State’s duty, pursuant
to regulations promulgated under both the ADA and Rehabil-
itation Act, to provide care for a disabled person in the most
community-integrated setting appropriate for that person.
Based on the newly alleged violations of federal law, the
Director removed the action to federal court. Radaszewski
asked the district court to remand the case to state court.
The district court remanded the state-law claims alone,
reasoning that it lacked supplemental jurisdiction over
those claims under Pennhurst State School & Hosp. v.
Halderman, 465 U.S. 89, 104 S. Ct. 900 (1984).
Radaszewski v. Garner, No. 01 C 9551, 2002 WL 31430325,
at *6 (N.D. Ill. Oct. 21, 2002). The state circuit court
subsequently granted judgment on the pleadings in favor of
the Director. However, the Illinois Appellate Court reversed
that judgment and remanded for further proceedings,
12 No. 02-3657
concluding there were questions concerning the propriety of
the rulemaking vis-à-vis the elimination of private-duty
nursing services from the State’s Medicaid plan that could
not be resolved on the pleadings. Radaszewski ex rel.
Radaszewski v. Garner, supra, 805 N.E.2d at 627.
The district court dismissed Radaszewski’s ADA claim
and entered judgment on the pleadings in favor of the
Director on the Rehabilitation Act claim. Radaszewski v.
Garner, No. 01 C 9551, 2002 WL 31045384, 24 Nat’l
Disability L. Rep. ¶ 187 (N.D. Ill. Sept. 11, 2002). Relying
on this court’s opinion in Walker v. Snyder, 213 F.3d 344
(7th Cir. 2000), the court determined that Radaszewski
could not sue the Director in her official capacity in federal
court for relief under Title II of the ADA. Walker held that
the doctrine of Ex Parte Young, 209 U.S. 123, 28 S. Ct. 441
(1908), which permits private suits against state officials in
federal court for injunctive relief, is unavailable in Title II
cases; in Walker’s view, the proper defendant in such a case
was the state agency itself, which, in light of the Eleventh
Amendment, could only be sued in state court. 213 F.3d at
347. Although the district court agreed that case law post-
dating Walker (including the Supreme Court’s decision in
Board of Trustees of Univ. of Alabama v. Garrett, 531 U.S.
356, 374 n.9, 121 S. Ct. 955, 968 n.9 (2001)) had called into
question the validity of Walker’s holding, the court felt
constrained to follow Walker until such time as either this
court or the Supreme Court overruled it. The court therefore
dismissed the ADA claim. 2002 WL 31045384, at *2.
As for the Rehabilitation Act claim, the court reasoned
that neither the Rehabilitation Act nor the ADA “require[s]
that the State create and fund a program that does not al-
ready exist” in order to enable a disabled person to be cared
for in the most integrated community setting possible; rather,
what the statutes require is even-handed treatment as be-
tween able and disabled individuals. Id., at *3. In the
court’s view, it was clear that the IDPA had not discrim-
No. 02-3657 13
inated against disabled individuals: although the State
makes at-home, private-duty nursing services available to
disabled individuals under the age of 21, no one over the
age of 21—disabled or not—receives such services through
the Illinois Medicaid program. Id.4 In essence, Radaszewski
was seeking to compel the State to provide services to her
son at home that it did not otherwise provide, and this
exceeded the scope of the State’s duty under the Rehabilitation
Act and the ADA. “[T]he IDPA is not required to provide the
handicapped more coverage than the non-handicapped
individual to assure ‘adequate health care.’ ” Id. For that
reason the court concluded that the Director was entitled to
judgment on the pleadings on the Rehabilitation Act claim.
Id.
II.
We review de novo the district court’s decision to enter
judgment on the pleadings pursuant to Federal Rule of Civil
Procedure 12(c). R.J. Corman Derailment Servs., LLC v.
Int’l Union of Operating Engineers, Local 150, AFL-CIO,
335 F.3d 643, 647 (7th Cir. 2003). In the course of that re-
view, we accept the truth of the allegations in Radaszewski’s
4
In fact, as the IDPA concedes, the HSP makes it possible for a
disabled person over the age of 21 to receive at least some private-
duty nursing services at home. Although private-duty nursing
services have been removed from Illinois’s basic Medicaid plan, a
disabled individual can still access such services through the HSP
waiver program. However, the SCM or exceptional care rate
approved for the individual HSP participant operates to limit the
amount of nursing care that he or she may receive. As we have
noted, the exceptional care rate approved for Eric would enable
him to receive only four or five hours of nursing per day, far less
than the 16 hours of daily care he received under the MFTDC
program and the 24 hours per day that he and his parents cur-
rently seek.
14 No. 02-3657
complaint. Id. Only if Radaszewski could prove no set of
facts consistent with those allegations that might support
her claim for relief may we sustain the judgment entered in
the Director’s favor. Id.
A.
The district court concluded on the strength of this court’s
holding in Walker, 213 F.3d 344, that Radaszewski could
not sue the Director for injunctive relief under the ADA.
However, Bruggeman ex rel. Bruggeman v. Blagojevich, 324
F.3d 906, 912-13 (7th Cir. 2003), issued after the district
court’s decision, recognized that Walker did not survive the
Supreme Court’s decision in Garrett. Garrett explicitly
recognized the right of a private plaintiff to assert an ADA
claim for injunctive relief against a state official in federal
court. 531 U.S. at 374 n.9, 121 S. Ct. at 968 n.9. The State
concedes, in view of Bruggeman, that Radaszewski may
seek injunctive relief from the Director consistent with the
doctrine of Ex Parte Young. Bruggeman, 324 F.3d at 912-13.
We therefore proceed to the merits of Radaszewski’s ADA
claim as well as her Rehabilitation Act claim.
B.
Title II of the ADA prohibits discrimination against
disabled persons by any public entity:
[N]o qualified individual with a disability shall, by rea-
son of such disability, be excluded from participation in
or be denied the benefits of the services, programs, or
activities of a public entity, or be subjected to discrimi-
nation by any such entity.
42 U.S.C. § 12132. The statute defines a “qualified individ-
ual with a disability” as one who, “with or without reason-
able modifications to rules, policies, or practices . . . meets
the essential eligibility requirements for the receipt of ser-
No. 02-3657 15
vices or the participation in programs or activities provided
by a public entity.” 42 U.S.C. § 12131(2). The term “public
entity” is defined to include “any State or local govern-
ment,” as well as “any department, agency, special purpose
district or other instrumentality of a State . . . or local
government.” § 12131(1)(a)(A), (B).
Pursuant to Title II, the Attorney General has promul-
gated a regulation providing that “[a] public entity shall
administer services, programs, and activities in the most
integrated setting appropriate to the needs of qualified
individuals with disabilities.” 28 C.F.R. § 35.130(d). The
“most integrated setting appropriate” is in turn defined as
“a setting that enables individuals with disabilities to
interact with nondisabled persons to the fullest extent
possible.” 28 C.F.R. pt. 35, App. A, p. 450. This integration
mandate does not impose an unqualified obligation on a
public agency, however. Although an agency must make
such modifications as are “reasonable” in order to avoid un-
duly segregating the disabled, it is relieved of that obli-
gation if it can show “that making the modifications would
fundamentally alter the nature of the service, program, or
activity.” 28 C.F.R. § 35.130(b)(7).
The Rehabilitation Act, which applies to programs receiv-
ing federal financial assistance, contains a similar
antidiscrimination provision, 29 U.S.C. § 794(a), and a
corresponding regulation requiring that an agency adminis-
ter its programs and activities “in the most integrated
setting appropriate to the needs of qualified handicapped
persons,” 28 C.F.R. § 41.51(d). The ADA’s integration
regulation is modeled after that regulation. See Olmstead v.
L.C. ex rel. Zimring, 527 U.S. 581, 592, 119 S. Ct. 2176,
2183 (1999). And consistent with the ADA’s regulatory
scheme, that integration mandate is limited by regulatory
provisions indicating that a recipient of federal funding
need not accommodate a disabled person when the proposed
16 No. 02-3657
accommodation would impose an “undue hardship” on the
recipient. 28 C.F.R. §§ 41.53, 42.511(c); 45 C.F.R. § 84.12(c).
In view of the similarities between the relevant provisions
of the ADA and the Rehabilitation Act and their implement-
ing regulations, courts construe and apply them in a
consistent manner. Frederick L. v. Dep’t of Public Welfare of
Pennsylvania, 364 F.3d 487, 491 (3d Cir. 2004); Fisher v.
Oklahoma Health Care Auth., 335 F.3d 1175, 1179 n.3 (10th
Cir. 2003); see also Bruggeman, supra, 324 F.3d at 912
(noting that the statutory and regulatory provisions
concerning integrated care are “materially identical”). Al-
though our analysis shall focus on the ADA, that analysis
applies with equal force to Radaszewski’s Rehabilitation Act
claim.
In Olmstead, the Supreme Court, looking to the terms
and legislative history of the ADA’s Title II, along with the
integration mandate reflected in its implementing regula-
tions, held that the “unjustified institutional isolation” of a
disabled individual receiving medical care from a State
amounts to an actionable form of discrimination under Title
II. 527 U.S. at 597-603, 119 S. Ct. at 2185-88. That is so,
the Court concluded, even in the absence of traditional
proof that the disabled person is being treated differently
from a nondisabled person who is otherwise similarly situ-
ated. Id. at 598, 119 S. Ct. at 2186.
Recognition that unjustified institutional isolation of
persons with disabilities is a form of discrimination
reflects two evident judgments. First, institutional place-
ment of persons who can handle and benefit from com-
munity settings perpetuates unwarranted assumptions
that persons so isolated are incapable or unworthy of
participating in community life. Second, confinement in
an institution severely diminishes the everyday life
activities of individuals, including family relations,
social contacts, work options, economic independence,
No. 02-3657 17
educational advancement, and cultural enrichment.
Dissimilar treatment correspondingly exists in this key
respect: In order to received needed medical services,
persons with . . . disabilities must, because of those
disabilities, relinquish participation in community life
they could enjoy given reasonable accommodations,
while persons without [such] disabilities can receive the
medical services they need without similar sacrifice.
Id. at 600-01, 119 S. Ct. at 2187 (citations omitted). The
plaintiffs in Olmstead were individuals with mental dis-
abilities who had been institutionalized in state facilities.
Although their treatment providers had concluded that
their needs could be met in community-based programs,
their placement into such programs had been delayed, and
the plaintiffs filed suit under Title II, seeking to compel the
State to transfer them into a community setting. In view of
the integration mandate, the Court agreed with the plain-
tiffs that a State is obliged to provide community-based
treatment for individuals with disabilities, so long as the
State’s treatment professionals find that such treatment is
appropriate, the affected individuals do not oppose
community-based treatment, and placement in the commu-
nity can be reasonably accommodated, taking into account
the State’s resources and the needs of others with similar
disabilities. Id. at 607, 119 S. Ct. at 2190. In a footnote, the
Court disavowed any intent to hold that the ADA imposes on
the States either a particular standard of care or a require-
ment that they provide a particular level of benefits to
disabled persons. Id. at 603 n.14, 119 S. Ct. at 2188 n.14.
“We do hold, however, that States must adhere to the ADA’s
nondiscrimination requirement with regard to the services
they in fact provide.” Ibid.
Radaszewski contends that Illinois’s unwillingness to
continue funding private-duty nursing care for Eric at home
portends precisely the type of “unjustified institutional
isolation” for him that Olmstead described as form of
18 No. 02-3657
discrimination prohibited by the ADA. She asserts that Eric
satisfies each of the three conditions that the Court in
Olmstead cited as prerequisites to the State’s obligation to
provide community-based treatment. Indeed, it appears
that two of these conditions—the propriety of community-
based care for Eric, and the consent of Eric and his affected
family members—are undisputed. There is little doubt that
Eric can be cared for appropriately at home; he has been
receiving care at home since 1994, and according to the
complaint, he benefits from the support of and interaction
with his parents in that environment. And obviously, neither
he nor his family oppose the prospect of him remaining at
home; that is the point of Radaszewski’s complaint. As for
the third condition—the State’s ability to reasonably accom-
modate community-based care for the disabled individual—
Radaszewski asserts that the cost of at-home, private-duty
nursing for Eric is actually less than what the State would
spend if Eric were transferred to an institution. Thus,
Radaszewski believes that the State reasonably can accom-
modate continued at-home care for Eric without jeopardiz-
ing its resources or interfering with the State’s obligation to
care for other disabled individuals. One of the ways that it
might do this, Radaszewski suggests, is by increasing the
cap on the amount that the HSP will pay for the services
that disabled individuals need in order to remain at home.
The Director, on the other hand, construes Radaszewski’s
complaint to require a substantive change in the services
IDPA currently provides. Picking up on footnote 14 of the
Olmstead opinion, the State emphasizes that the ADA does
not guarantee that each recipient of state medical benefits
will get care precisely tailored to his needs; instead, the
statute requires the State not to discriminate vis-à-vis
services that it has chosen to provide. 527 U.S. at 603 n.14,
119 S. Ct. at 2188 n.14. Thus, post-Olmstead, courts have
recognized that a State may violate Title II when it refuses
to provide an existing benefit to a disabled person that
No. 02-3657 19
would enable that individual to live in a more community-
integrated setting. E.g., Fisher v. Oklahoma Health Care
Auth., supra, 335 F.3d at 1182-84 (State may violate Title
II when it caps the number of drug prescriptions it will fund
through Medicaid for participants in community-based care
programs, but not for persons who live in nursing homes);
Townsend v. Quasim, 328 F.3d 511, 516-20 (9th Cir. 2003)
(community-based long-term care offered to categorically
needy must be offered to medically needy as well, unless
doing so would fundamentally alter the State’s Medicaid
programs). On the other hand, courts have also held that a
State is not obligated to create new services in order to
enable an institutionalized individual to live in a more
integrated setting. E.g., Rodriguez v. City of New York, 197
F.3d 611, 615-16 (2d Cir. 1999) (neither ADA nor Rehabili-
tation Act compelled State to offer safety monitoring to
persons with mental disabilities so that such individuals
could remain at home, where safety monitoring was not an
existing personal care service that city offered through its
Medicaid program).
Here, IDPA argues, the State’s basic Medicaid plan (by
virtue of the amendment approved in 2001) does not include
private-duty nursing services. Of course, nursing generally
is a service provided, but the particular service that Eric
requires is one-on-one, private-duty nursing. The only
individuals to whom that type of nursing is offered at the
level that Eric requires are persons under the age of 21, who
may receive such services under the MFTDC waiver program.
See n.1, supra. Funding for private-duty nursing is avail-
able through the HSP program, but at a level no higher
than the exceptional care rate—which in this case would
permit no more than five hours of nursing per day. Thus, in
order for Radaszewski to obtain the relief she seeks for Eric,
the IDPA either would have to raise the age limit for
participation in the MFTDC program or raise the level of
care covered by the HSP by substantially increasing the
20 No. 02-3657
exceptional care rate for individuals with disabilities akin
to Eric’s. In the State’s view, neither modification is a
reasonable one, and either one would compel the IDPA to
alter the substance of the services it provides to Medicaid
recipients and thus to offer a new service that does not
currently exist.
A key premise of the State’s argument is that private-
duty nursing would not be provided to Eric in the institu-
tional setting that the IDPA believes is appropriate to his
level of need—i.e., in a nursing home facility. However,
from the face of the complaint, the documents in the public
record relating to Eric’s IDPA grievance, and the briefing in
this appeal, there appear to be at least two important
factual questions relating to this premise that cannot be
resolved on the pleadings.
The first of these questions is whether a nursing home
facility actually could meet Eric’s medical needs, as the
Director supposes. As we noted earlier, the IDPA calculated
the level of benefits for which Eric was eligible under the
HSP with reference to the cost of care at a nursing home
facility; and the IDPA took the position that Eric would
have to seek care in that type of facility if HSP funding at
the exceptional care rate was insufficient to pay for his care
at home. However, the Radaszewskis have consistently
challenged the notion that Eric could receive adequate care
at a nursing home facility. When Eric filed a grievance with
the IDPA challenging the exceptional care rate that the
Department had established for Eric, his parents put on
evidence that Eric could not properly be cared for in a
nursing home facility as the State contended, because such
a facility could not provide the constant, one-on-one care
that he needs in order to survive. Based on that evidence,
which apparently was uncontradicted, the hearing officer
whose findings we quoted above specifically found that Eric
“would be at risk of danger if he should be placed in a
nursing home.” IDPA Hearing Officer findings ¶ H. In view
No. 02-3657 21
of that finding, we must assume that Radaszewski will be
able to prove in this litigation that Eric, if institutionalized,
would require a more care-intensive setting than a nursing
home—a hospital, for example—in order to survive. That
possibility in turn suggests that the type and cost of
medical care that Eric would receive at a nursing home
facility are not the appropriate reference points for assess-
ing whether the private-duty nursing that Eric seeks to
receive at home is a service that would be provided to Eric
in an institutional setting.
The second question concerns the level of care that Eric
would require in an institutional setting—whether it be a
nursing home facility, a hospital, or another type of care
facility. The State posits that Eric would not receive private
nursing care in any institutional setting, even a hospital, so
that there is no institutional precedent that would support
his demand under Title II for private-duty nursing at home.
Cf. Fisher, 335 F.3d at 1183 (“Plaintiffs are simply request-
ing that a service for which they would be eligible under an
existing state program, unlimited medically necessary
prescriptions, be provided in a community-based setting
rather than a nursing home. They are not demanding a
separate service or one not already offered by the state.”);
Townsend, 328 F.3d at 517 (“Mr. Townsend simply requests
that the services he is already eligible to receive under an
existing state program . . . be provided in the community-
based adult home where he lives, rather than the nursing
home setting the state requires.”). Here again, however, the
evidence presented to the IDPA hearing officer, and that
officer’s findings, suggest that Eric might well require
continuous one-on-one nursing care if he were cared for in
an institutional setting. The hearing officer’s summary of
the testimony provided by Eric’s caretakers, most if not all
of which was undisputed, makes it plausible to suppose that
Eric cannot be left unattended—or attended only by a
person lacking significant medical skills— for any amount
22 No. 02-3657
of time. It appears from that summary that he requires
skilled assistance in order to safely accomplish many of the
bodily functions necessary to remain alive—drinking,
eating, eliminating waste, moving about, even breathing.
Radaszewski may thus be able to show that if institutional-
ized, Eric would require the equivalent of the private-duty
nursing care that, until now, he has received at home.
The Director concedes that if Eric were placed in an
institution, the IDPA would obliged to provide him with the
level of care that he needs in order to survive. So if, as the
evidence presented to the IDPA hearing officer strongly
suggests, Eric requires constant monitoring and continuous
skilled assistance in accomplishing basic bodily functions,
then the State will have to provide those services to Eric in
an institutional setting. It may well be, as the Director
represents, that an institutional facility would not assign
private-duty nurses, as such, to provide the care that Eric
requires. In lieu of one nurse assigned only to Eric, for
example, a hospital might be able to rely on a variety of
monitors to keep Eric’s life signs under surveillance, while
a pool of immediately available skilled professionals tending
to multiple patients in a care-intensive unit might be able
to provide the frequent, immediate assistance Eric requires
in order to eat, drink, and so on and to head off any of the
medical crises (e.g., choking or infections) to which he is
vulnerable. But if what that level of care adds up to is the
equivalent of around-the-clock, private-duty nursing care,
then Radaszewski may yet have a viable claim that Eric is
entitled to receive private-duty nursing care at home.
Nothing in the regulations promulgated under the ADA
or the Rehabilitation Act or in the Court’s decision in
Olmstead conditions the viability of a Title II or section 504
claim on proof that the services a plaintiff wishes to receive
in a community-integrated setting already exist in exactly
the same form in the institutional setting. Although a State
is not obliged to create entirely new services or to otherwise
No. 02-3657 23
alter the substance of the care that it provides to Medicaid
recipients in order to accommodate an individual’s desire to
be cared for at home, the integration mandate may well
require the State to make reasonable modifications to the
form of existing services in order to adapt them to com-
munity-integrated settings. Some forms of medical treat-
ment—for example, prescription medications—might be
virtually the same whether provided to the recipient in an
institution or at home. See Fisher, 335 F.3d at 1183. But
particularly when the treatment involves services provided
by medical professionals, the care might vary in format
depending on whether it is provided to the individual in an
institution or a community-based setting. If variations in
the way services are delivered in different settings were
enough to defeat a demand for more community-integrated
care, then the integration mandate of the ADA and the
Rehabilitation Act would mean very little. Of course, the
State always has the opportunity to show that adapting
existing institution-based services to a community-based
setting would impose unreasonable burdens or fundamen-
tally alter the nature of its programs and services, and for
that reason it should not be required to accommodate the
plaintiff. 28 C.F.R. § 35.130(b)(7); see Olmstead, 527 U.S. at
603-06, 119 S. Ct. at 2188-90. But so long as it is possible for
the plaintiff to show that the services he seeks to receive at
home are, in substance, already provided in the institu-
tional setting, then the State is not entitled to judgment on
the pleadings based on the argument that the services
would take on a different form or method if provided in a
community setting.
Also relevant to the question of whether continuous
private-duty nursing is a service that Illinois does not
presently offer in any setting is the fact that IDPA can and
does make available a limited amount of funding for pri-
vate-duty nursing to adults participating in the HSP. Recall
that the purpose of a waiver program like HSP is to enable
medically needy individuals to avoid institutionalization by
24 No. 02-3657
making services available to them that are otherwise not
part of the State’s basic Medicaid program. At-home
nursing care, which has now been removed from Illinois’s
Medicaid plan, would constitute such a service. The cap on
the level of funding that HSP would provide to Eric and his
family prevents him from receiving the level of private-duty
nursing services that he needs—recall that the exceptional
care rate approved for Eric would pay for only four or five
hours of private-duty nursing per day rather than the 24
hours per day that his family seeks. But the fact that the
State already provides for some private-duty nursing tends
to belie the notion that providing such care to Eric so that
he may remain at home would require the State to alter the
substance of its Medicaid programs by creating an entirely
“new”service.
Insofar as the HSP is concerned, the State contends that
Eric is ineligible for that program (and that Radaszewski
cannot plead or prove otherwise) because the cost of the
continuous care that he needs admittedly exceeds the cost
of exceptional care in a nursing facility, the latter figure
being the most that IDPA, under its current rules, will pay
for Eric’s at-home care. That point is not dispositive of the
federal claims that Radaszewski has made here. It is true,
as the Director points out, that the ADA only prohibits
discrimination against “qualified individuals with disabili-
ties,” whom (as we noted earlier) the statute describes as
disabled individuals who “with or without reasonable modi-
fications to rules, policies, or practices . . . mee[t] the essential
eligibility requirements for the receipt of services or the
participation in programs or activities provided by a public
entity.” 42 U.S.C. § 12131(2); see Olmstead, 527 U.S. at 601-
02, 119 S. Ct. at 2187-88. For present purposes, it appears
undisputed that Eric is qualified for the receipt of home
services through the HSP in the sense that he has severe,
long-term disabilities, he is eligible for Medicaid, and he is
at risk of placement in an institutional health care facility.
See 89 Ill. Admin. Code § 682.100 (setting forth HSP
No. 02-3657 25
eligibility requirements). It is also undisputed that his
home is an appropriate care setting for Eric—he has lived
there since the onset of his disabilities with the support of
the at-home services that he received through the MFTDC
waiver program until he reached the age of 21—the very
same services that he seeks to continue receiving as an
adult.
By no means is Eric an “unqualified” disabled person in
the sense that Olmstead emphasized—he is not someone
who is “unable to handle or benefit from community set-
tings,” 527 U.S. at 601-02; 119 S. Ct. at 2187, whom the
State’s medical professionals believe is not able to live in a
community-integrated setting, id. at 602, 119 S. Ct. at 2188,
or who does not want to live in a such a setting, ibid. On the
contrary, Radaszewski’s complaint, together with the IDPA
grievance records, suggest that with appropriate care Eric
can live at home (he has in fact done so for a number of
years), that he wishes to continue doing so, and that he
profits in that environment from the daily interaction with
and nurturing by his parents and the access to on-line
learning that he has at home. Supplemental Complaint Count
I ¶ 11, Count VI ¶¶ 40-46, Count VII ¶¶ 42-45; IDPA Hear-
ing Officer Findings ¶ A (“[Eric] has been cared [for] at
home for the past 5 years through funding from the Illinois
Division of Specialized Care for Children (DSCC). This care,
plus the admirable efforts of his parents, has allowed
Grievant to be cared for in his home. Grievant wishes to be
maintained in his home with his family; this is also his
parents’ wish[ ].”). Eric thus appears to meet these “essential”
requirements for at-home care. See Townsend, 328 F.3d at
516 (plaintiff was a “qualified individual with a disability”
for purposes of Title II because he was eligible to receive
services through State’s Medicaid program, he preferred to
receive such services in a community-based setting, and
community-based services were appropriate for his needs).
Accepting the allegations of the complaint as true, Eric is
also qualified for the HSP program in the sense that the
26 No. 02-3657
cost of his continued care at home would not exceed the
anticipated cost of caring for him in an institutional setting.
As we have noted, approval for Medicaid waiver programs
offering community-based care is conditioned on certifica-
tion that the average per-capita cost of at-home or other
community-based care does not exceed the average per-
capita cost of institutional care. See 42 U.S.C. § 1396n(c)(2)(D);
42 C.F.R. § 441.302(e). In view of that federal requirement,
one of the eligibility requirements that Illinois has specified
for participation in the HSP program is that an individual
does not require in-home services that are expected to cost
more than what the State would pay to provide institutional
care to an individual with a similar DON score. 89 Ill.
Admin. Code § 682.100(h). As we have noted, Radaszewski
asserts that the cost of providing private-duty nursing care
to Eric at home, although it exceeds the exceptional care
rate approved for Eric by several multiples, is nonetheless
no greater and perhaps less than what it would cost the
State to care for Eric in an appropriate institution. We
assume, as we must, that Radaszewski will be able to prove
the truth of that assertion. Her assertion is plausible,
particularly in view of the fact that the MFTDC program,
through which Eric received funding for private-duty
nursing until he turned 21, has a similar requirement of
cost-neutrality. See 89 Ill. Admin. Code § 140.645(c)(3).
Consequently, we discern no impediment concerning Eric’s
status as a “qualified individual with a disability” that
would preclude the relief his mother seeks under Title II.
The cost of around-the-clock private-duty nursing care no
doubt is relevant to the separate question of whether re-
quiring the State to continue providing that care for Eric at
home would entail reasonable modifications to IDPA’s rules
and practices or would result in a fundamental alteration of
the services and programs that Illinois provides to similarly
No. 02-3657 27
situated individuals.5 As we have noted, the cost of provid-
ing 24-hour private-duty nursing care to Eric at home is
estimated at between $15,000 and $20,000 per month, an
amount three to four times greater than the exceptional
care rate approved for Eric. So in that respect, the State
would have to substantially increase the level of expendi-
tures it would otherwise make on Eric’s behalf under the
HSP in order to continue Eric’s at-home care. That alone
does not defeat his Title II claim. See Fisher, 335 F.3d at
1183 (“If every alteration in a program or service that
required the outlay of funds were tantamount to a funda-
5
The plaintiffs in Olmstead were, as we have indicated, persons
with mental disabilities. When it addressed the fundamental-
alteration defense in that case, the Supreme Court spoke of the
need to consider the State’s obligations to other persons with the
same broad type of disabilities, i.e., other persons with mental
disabilities. See 527 U.S. at 604, 119 S. Ct. at 2189 (“Sensibly con-
strued, the fundamental-alteration component of the reasonable-
modifications regulation would allow the State to show that, in
the allocation of available resources, immediate relief for the
plaintiffs would be inequitable, given the responsibility the State
has undertaken for the care and treatment of a large and diverse
population of persons with mental disabilities.”) (emphasis ours);
id. at 607, 119 S. Ct. at 2190 (“[W]e conclude that, under Title II
of the ADA, States are required to provide community-based treat-
ment for persons with mental disabilities when the State’s treatment
professionals determine that such placement is appropriate, the
affected persons do not oppose such treatment, and the placement
can be reasonably accommodated, taking into account the resources
available to the State and the needs of others with mental disabili-
ties.”) (emphasis ours). It is not immediately apparent here what
the relevant group of disabled persons should be for purposes of
the fundamental-alteration defense, and this is not a matter that
the parties themselves have addressed in the briefing. For present
purposes, we will refer simply to other persons with disabilities
similar to Eric’s. If and when the fundamental-alteration defense
is reached in further proceedings, the parties and the district court
will want to consider how to more precisely define and describe
that group.
28 No. 02-3657
mental alteration, the ADA’s integration mandate would be
hollow indeed.”). Once again, however, if, as Radaszewski
represents, it would cost the State no more and possibly less
to care for Eric at home than it would to care for him in an
institution, this would be highly relevant to whether the
State is obliged under Title II to provide him with full-time,
at-home care.
Olmstead did note that because a State is obliged to
maintain a full range of facilities in order to provide care for
its disabled citizens, it may not always be able to fully
realize the cost savings of placing an individual person in a
community setting rather than an institution. 527 U.S. at
604, 119 S. Ct. at 2189. Moving one resident of a state-
funded institution into the community does not necessarily
mean that the State immediately could close or reduce the
size of that institution; in the short run, the State might
incur greater costs by funding a community placement for
the individual who can be cared for there while continuing
to provide institutional services for those who cannot be
cared for in a community setting. Ibid. A court must
therefore take care to consider the cost of a plaintiff’s care
not in isolation, but in the context of the care it must
provide to all individuals with disabilities comparable to
those of the plaintiff.
This is not an assessment that can be made on the
pleadings in this case. The State may be able to show that
in view of the obligations it has not just to Eric but to all
individuals with similar disabilities, it cannot fund a home
placement for Eric without fundamentally altering the care
it provides to others with similar needs. But the evidence
might also show something different to be true. If the State
would have to pay a private facility to care for Eric, for
example, and the cost of that placement equaled or ex-
ceeded the cost of caring for him at home, then it would be
difficult to see how requiring the State to pay for at-home
care would amount to an unreasonable, fundamental
No. 02-3657 29
alteration of its programs and services. Indeed, Radaszewski
represents that this is precisely the case in Illinois, and
that, as a result, if Eric were to be cared for in an institu-
tion, the State would be paying a private contractor to pro-
vide that care. In any event, what matters at present is that
a much more developed record will be required in order to
assess whether the injunctive relief that Radaszewski seeks
would require a fundamental alteration of the State’s pro-
grams and services.
The district court therefore erred in entering judgment on
the pleadings in the Director’s favor. The allegations of
Radaszewski’s complaint permit the inference that a home
placement remains appropriate for Eric, that he and his
family do not oppose such a placement, and that such a
placement can be reasonably accommodated, taking into
account the resources available to the State and the needs
of others with comparable disabilities. See Olmstead, 527
U.S. at 607, 119 S. Ct. at 2190. At the same time, the plead-
ings do not permit a finding that the injunctive relief that
Radaszewski seeks either is unreasonable or would require
a fundamental alteration of the State’s programs and ser-
vices for similarly-situated disabled persons. Radaszewski
is entitled to proceed on her complaint.
III.
For the reasons discussed, we REVERSE the judgment on
the pleadings entered in favor of the IDPA Director and
REMAND for further proceedings consistent with this opinion.
30 No. 02-3657
A true Copy:
Teste:
________________________________
Clerk of the United States Court of
Appeals for the Seventh Circuit
USCA-02-C-0072—9-8-04
|
Q:
Compile maven projects with JDK 1.6 in Eclipse Mars
I need older version of m2e because I need to use older maven version (I have to compile some projects with JDK 1.6).
Here the exception when launch any build (with java 1.6) in Mars:
Exception in thread "main" java.lang.UnsupportedClassVersionError: org/apache/maven/cli/MavenCli : Unsupported major.minor version 51.0
at java.lang.ClassLoader.defineClass1(Native Method)
at java.lang.ClassLoader.defineClassCond(ClassLoader.java:631)
at java.lang.ClassLoader.defineClass(ClassLoader.java:615)
at java.security.SecureClassLoader.defineClass(SecureClassLoader.java:141)
at java.net.URLClassLoader.defineClass(URLClassLoader.java:283)
at java.net.URLClassLoader.access$000(URLClassLoader.java:58)
at java.net.URLClassLoader$1.run(URLClassLoader.java:197)
at java.security.AccessController.doPrivileged(Native Method)
at java.net.URLClassLoader.findClass(URLClassLoader.java:190)
at org.codehaus.plexus.classworlds.realm.ClassRealm.loadClassFromSelf(ClassRealm.java:401)
at org.codehaus.plexus.classworlds.strategy.SelfFirstStrategy.loadClass(SelfFirstStrategy.java:42)
at org.codehaus.plexus.classworlds.realm.ClassRealm.unsynchronizedLoadClass(ClassRealm.java:271)
at org.codehaus.plexus.classworlds.realm.ClassRealm.loadClass(ClassRealm.java:254)
at org.codehaus.plexus.classworlds.realm.ClassRealm.loadClass(ClassRealm.java:239)
at org.codehaus.plexus.classworlds.launcher.Launcher.getMainClass(Launcher.java:144)
at org.codehaus.plexus.classworlds.launcher.Launcher.launchEnhanced(Launcher.java:266)
at org.codehaus.plexus.classworlds.launcher.Launcher.launch(Launcher.java:229)
at org.codehaus.plexus.classworlds.launcher.Launcher.mainWithExitCode(Launcher.java:415)
at org.codehaus.plexus.classworlds.launcher.Launcher.main(Launcher.java:356)
Same problem if install external maven component, because the problem should be the new m2e plugin, compiled with JDK 1.7.
Any suggestions?
Here a related problem.
Regards.
A:
Download an version of Maven which support JDK 6 or hight, you can see in Maven Release History. I downloaded version 3.2.5.
After that open Eclipse Mars > Window > Preferences > Maven > Installations and add Maven 3.2.5, that click Apply then OK
|
Japanese destroyer Yoizuki
was an destroyer of the Imperial Japanese Navy. Her name means "Moon Visible as Day Joins Evening". She was commissioned too late to see action in World War II. Following the war, the ship was handed over to the Republic of China and renamed Fen Yang.
Design and description
The Akizuki-class ships were originally designed as anti-aircraft escorts for carrier battle groups, but were modified with torpedo tubes and depth charges to meet the need for more general-purpose destroyer. Her crew numbered 300 officers and enlisted men. The ships measured overall, with a beam of and a draft of . They displaced at standard load and at deep load.
The ship had two Kampon geared steam turbines, each driving one propeller shaft, using steam provided by three Kampon water-tube boilers. The turbines were rated at a total of for a designed speed of . The ship carried up to of fuel oil which gave them a range of at a speed of .
The main armament of the Akizuki class consisted of eight Type 98 dual purpose guns in four twin-gun turrets, two superfiring pairs fore and aft of the superstructure. They carried four Type 96 anti-aircraft guns in two twin-gun mounts. The ships were also armed with four torpedo tubes in a single quadruple traversing mount; one reload was carried for each tube. Their anti-submarine weapons comprised six depth charge throwers for which 72 depth charges were carried.
Construction and career
In March, 1946, Yoizuki was used to transport over 1,000 Formosans, Filipinos and Japanese prisoners of war from Sydney, Australia. The conditions aboard ship and the obvious distress of the repatriates prompted controversy in Australia. On 29 August 1947, Yoizuki was turned over to the Republic of China. Renamed CNS Fen Yang, she was scrapped in 1963.
Notes
References
External links
CombinedFleet.com: Akizuki-class destroyers
CombinedFleet.com: Yoizuki history
Category:Akizuki-class destroyers (1942)
Category:World War II destroyers of Japan
Category:1944 ships
Category:Destroyers of the Republic of China Navy |
94 B.R. 172 (1988)
In re Chile B. LEE, and Hae Sook Lee, Debtors.
Bankruptcy No. LA 88-17899 SB.
United States Bankruptcy Court, C.D. California.
November 22, 1988.
As Amended February 8, 1989.
*173 *174 Jang W. Lee, Los Angeles, Cal., for applicant Lee, Scott & Young.
*175 AMENDED OPINION DENYING APPOINTMENT OF COUNSEL
SAMUEL L. BUFFORD, Bankruptcy Judge.
I. FACTS
Debtors Chile B. Lee and Hae Sook Lee filed this voluntary Chapter 11 bankruptcy case on August 23, 1988. They are apparently the sole shareholders of Seoul Corporation, whose Chapter 11 bankruptcy case was filed in this Court on August 16, 1988. Seoul Corporation is engaged in the sale of general merchandise and costume jewelry at wholesale. Chile Lee is the president and Hae Sook Lee is the secretary of Seoul Corporation. Presumably the debtors are also the only directors of Seoul Corporation, although this is not disclosed in the papers filed with the Court. Both of the petitions were signed by Jang W. Lee, as counsel for debtors.
A brief review of the schedules filed by the Lees and Seoul Corporation discloses that there is a substantial overlap of creditors for the individuals and for the corporation. However, it appears that a number of creditors are not shared.
The debtors in each case have filed an application for the appointment of the law firm Lee, Scott & Young ("LSY"), in which Jang W. Lee is a partner, as general counsel for the debtors, pursuant to Bankruptcy Code § 327, 11 U.S.C. § 327 (1979 & Supp. 1988).
Jang W. Lee states that he has received a retainer of $2,500 to represent Chile B. Lee and his wife in this case, and that he has received no retainer for representing Seoul Corporation. However, the retainer is not disclosed in the employment application in this case.
The employment applications also make no disclosure whatever of the relationship between these two cases, or that LSY is seeking employment in both of them, notwithstanding the conflicts that such employment could raise. The declaration of Jang W. Lee in the employment application in each case states:
1. To the best of my knowledge, I am not connected with the debtors, their creditors, or any other party in interest except that I am the attorney for the debtors in this Chapter 11 case. . . .
2. No member or associate of this law firm represents any interest in this estate, adverse or otherwise, except the interest of the applicants.
The parallel applications for appointment as legal counsel came to the Court's attention because they arrived in chambers and were reviewed on the same day. If this had not occurred, the problem would likely not have come to the Court's attention.
After noting the similar employment applications in the two cases, the Court obtained and reviewed the respective bankruptcy case files and thus learned of the conflicting interests that LSY seeks to represent. The Court then issued an order to show cause why LSY should not be disqualified in both cases because of its failure to disclose the parallel employment applications. In response to the order to show cause, LSY disclosed for the first time its retainer in this case.
II. ANALYSIS
This is not an isolated instance of a potential conflict in interest by prospective counsel for related debtors. This Court has received similar applications for appointment as counsel for related debtors from many law firms in Los Angeles that represent bankruptcy debtors.
The failure to disclose the potential conflict is also not an isolated instance. In this Court's experience, prospective counsel infrequently discloses that appointment is sought in a related case.
This is also not an isolated instance of the failure to disclose in an employment application the amount or source of a retainer. Many applications for employment do not disclose the receipt of a retainer, and few disclose the source of such funds. However, the Court has reason to believe that retainers are quite common in bankruptcy cases in this district.
*176 A. Retainer
The obligation to disclose a retainer is based on Bankruptcy Rule 2014(a), which requires an application for employment to state:
[T]he specific facts showing the necessity for the employment, the name of the person to be employed, the reason for the selection, the professional services to be rendered, any proposed arrangement for compensation, and, to the best of the applicant's knowledge, all the person's connections with the debtor, creditors, or any other party in interest, their respective attorneys and accountants. The application shall be accompanied by a verified statement of the person to be employed setting forth the person's connections with the debtor, creditors, or any other party in interest, their respective attorneys and accountants.
The application in this case clearly does not comply with Rule 2014, because it does not disclose the retainer of $2,500. Thus it fails to set forth part of applicant's proposed arrangement for compensation.
The requirement to disclose "any proposed arrangement for compensation" includes a requirement to disclose any retainer received by or promised to the applicant. In In re Arlan's Department Stores, Inc., 615 F.2d 925, 935-36, 938 (2d Cir.1979), the Second Circuit held that General Order 44, the second generation ancestor of Rule 2014,[1] required the disclosure of a $125,000 retainer paid to counsel for the debtor. Although General Order 44 lacked any language requiring the disclosure of "any proposed arrangement for compensation", the Court found that such disclosure was required as part of the law firm's "connections with the debtor", for which disclosure was (and remains) required.
The language requiring the disclosure of "any proposed arrangement for compensation" was added to Rule 2014(a) to make explicit the disclosure requirement that the Second Circuit found under General Order 44. An employment application must include a statement of all payments already received or promised and the source of the payments.
LSY's application is totally silent as to the retainer agreement. Thus it fails altogether to make the required disclosure. The retainer agreement was disclosed only in response to the order to show cause.
B. Parallel Employment Applications
LSY's parallel employment applications in this case and in the Seoul Corporation case raise two problems. First, the failure to disclose the parallel applications is a violation of Rule 2014(a). Second, appointment of LSY in both cases would result in its representation of conflicting interests, which is prohibited.
1. Non-Disclosure
LSY's failure to disclose its application to represent Seoul Corporation is also a violation of Rule 2014(a). Rule 2014(a) requires the disclosure in an application for employment of "all the [applicant's] connections with . . . any other party in interest. . . ." Disclosure is required of any application to represent more than one related party, including the representation of debtors in related cases. All facts that may be relevant to a determination of whether an attorney is disinterested or holds or represents an interest adverse to the debtor's estate must be disclosed. See, e.g., Diamond Lumber v. Unsecured Creditors' Committee, 88 B.R. 773, 777 (N.D. Tex.1988); In re Roberts, 75 B.R. 402, 411 (D.Utah 1987). The purpose of such disclosure is to permit the Court and parties in interest to determine whether the connection disqualifies the applicant from the employment sought, or whether further inquiry should be made before deciding whether to approve the employment. This decision should not be left to counsel, whose judgment may be clouded by the benefits of the potential employment.
*177 It appears to the Court that such nondisclosure usually results from an intentional effort to prevent the Court from noticing that counsel is seeking appointment in related cases that may raise conflicts of interest. Thus in most if not all such cases the deception is deliberate.
The failure to disclose the employment application in a related case is alone a sufficient basis for disqualifying counsel in both cases. See, e.g., Diamond Lumber, supra, 88 B.R. at 777; In re Roberts, supra, 75 B.R. at 412 (Bankr.D.Utah 1988). While the Court does not impose total disqualification in this case, it will not hesitate to disqualify counsel in the future in all related cases, or to impose other appropriate sanctions, for similar nondisclosure.
2. LSY's Adverse Interests
LSY does not meet the requirements of Bankruptcy Code § 327(a), 11 U.S.C. § 327(a) (1979), for the appointment of attorneys in both of these cases. Section 327(a) authorizes a trustee to employ "one or more attorneys . . . that do not hold or represent an interest adverse to the estate, and that are disinterested persons . . ." Section 1107(a) gives a debtor in possession the rights and powers of a trustee (with certain exceptions not material here), including the power to employ attorneys.
Section 327 requires the application of a two-pronged test for the employment of professional persons. A debtor in possession or trustee may employ attorneys with court approval only if (1) they do not hold or represent an interest adverse to the estate, and (2) they are disinterested persons. See e.g., Diamond Lumber, supra, 88 B.R. at 776; In re Star Broadcasting, Inc., 81 B.R. 835, 838 (Bankr.D.N.J.1988). Both prongs of this test must be met. LSY fails to meet the first of these requirements.
The term "adverse interest" is not specifically defined in the Bankruptcy Code. The reported cases have defined what it means to hold an adverse interest as follows:
(1) to possess or assert any economic interest that would tend to lessen the value of the bankrupt estate or that would create either an actual or potential dispute in which the estate is a rival claimant; or
(2) to possess a predisposition under circumstances that render such a bias against the estate.
See, e.g., In re Glenn Electric Sales Corp., 89 B.R. 410, 413 (Bankr.D.N.J.1988); Star Broadcasting, supra, 81 B.R. at 838; In re Roberts, 46 B.R. 815, 826-27 (Bankr.Utah 1985), aff'd in relevant part, 75 B.R. 402 (D.Utah 1987). To "represent an adverse interest" means to serve as agent or attorney for entities holding such adverse interests. Star Broadcasting, supra, 81 B.R. at 838; In re Roberts, supra, 46 B.R. at 827.
Several reported opinions have disqualified a law firm that has represented both a corporate debtor and a shareholder. See, e.g., Parker v. Frazier (In re Freedom Solar Center), 776 F.2d 14, 17 (1st Cir. 1985); Star Broadcasting, supra; Roger J. Au & Sons v. Aetna Insurance Co. (In re Roger J. Au), 64 B.R. 600 (N.D.Ohio 1986). In addition, courts have denied fees because of conflicts resulting from the representation of a corporate debtor and its shareholders. See, e.g., In re Roberts, 75 B.R. 402, 410; In re Chou-Chen Chemicals, Inc., 31 B.R. 842 (Bankr.W.D.Ky. 1983). If there is any doubt as to the existence of a conflict, that doubt should be resolved in favor of disqualification. See, e.g., In re Michigan General Corp., 78 B.R. 479, 484 (Bankr.N.D.Tex.1987), aff'd in relevant part sub nom. Diamond Lumber v. Unsecured Creditors' Committee, 88 B.R. 773 (N.D.Tex.1988); In re Johore Investment Co. (U.S.A.), 49 B.R. 710, 713 (Bankr.D.Ha.1985). Negligence does not excuse the failure to disclose a possible conflict of interest. Michigan General, supra, 78 B.R. at 482; In re Coastal Equities, 39 B.R. 304, 308 (Bankr.S.D.Cal.1984).
In addition, the representation of conflicting interests is prohibited by Rule 5-102(B) of the California Rules of Professional Conduct, which provides, "A member of the State Bar shall not represent conflicting interests, except upon the written *178 consent of all parties concerned." This rule applies to LSY by virtue of Local Bankruptcy Rule 102(5), which incorporates by reference Local District Court Rule 2.5, which provides:
2.5.1 Rules of Professional Conduct of the State Bar of California State Bar Act. Each attorney shall become familiar with and comply with the standards of professional conduct required of members of the State Bar of California and contained in the State Bar Act, the Rules of Professional Conduct of the State Bar of California, and the decisions of any court applicable thereto. Those statutes, rules and decisions are hereby adopted as the standards of professional conduct of this Court.
2.5.2 Other Standards. No attorney shall engage in any conduct which degrades or impugns the integrity of the Court or in any manner interferes with the administration of justice therein.
The purpose of the rules, mandating that counsel be disinterested and prohibiting the holding or representation of conflicting interests, is to assure that counsel devote undivided loyalty to the debtor. See comment to Rule 1.7, ABA Model Rules of Professional Conduct. Conflicting loyalties produce inadequate representation, which threatens the interests of both the debtor and the creditors, and compromises the ability of the court to mete out justice in the case. The unsanctioned representation of conflicting interests is one of the most serious sins that a lawyer can commit.
Seoul Corporation has an interest adverse to the estate of the debtors in this case because, according to the schedules filed in the respective cases, there is joint liability on many of the debts owing by the respective estates. Thus it is in the interest of Seoul Corporation, as debtor in possession, to have these debts paid by the estate of the Lees. In contrast, it is in the interest of the debtors in this case to have Seoul Corporation's estate pay these debts. If LSY is appointed to represent the debtors in both cases, it will be representing these conflicting interests. Accord, In re Star Broadcasting, Inc., 81 B.R. 835, 841 (Bankr.D.N.J.1988); Roger J. Au & Son, Inc. v. Aetna Insurance Co. (In re Roger J. Au & Son, Inc.), 64 B.R. 600 (N.D.Ohio 1986). Indeed, this is a typical case of the representation of adverse interests that is prohibited by section 327(a). See, e.g., Andrew v. Coopersmith (In re Downtown Investment Club III), 89 B.R. 59, 65 (Bankr. 9th Cir.1988) (representation of general partner and limited partnership).
Thus this is not a case where the dual representation raises only a potential for conflicting interests. In this case the interests of Seoul Corporation and the Lees, as debtors in possession in their respective cases, are in actual conflict. Representation of both estates by the law firm would involve it in the representation of actual conflicting interests. Star Broadcasting, Inc., supra, 81 B.R. at 841. This is specifically prohibited by section 327(a).
3. Counsel's Response
Jang W. Lee contends that the representation of the debtors in the two cases does not involve the representation of conflicting interests, because Seoul Corporation is not a creditor of Chile B. Lee, and Lee is willing to waive any claims he has against the corporation. In support of his position, he relies on In re O'Connor, 52 B.R. 892 (Bankr.W.D.Okla.1985). This response is inadequate in several respects.
First, Chile B. Lee does not have the power unilaterally to waive a claim of his estate against the corporation. The filing of a bankruptcy case creates an estate, which includes all legal and equitable interests of the debtor in property as of the commencement of the case. Bankruptcy Code § 541, 11 U.S.C. § 541 (1979 & Supp. 1988).[2] This property includes all causes of *179 action that belong to the debtor on the date of filing. H.R.Rep. No. 595, 95th Cong., 1st Sess. 367, reprinted in 1978 U.S.Code Cong. & Admin.News 5963, 6323-24; S.Rep. No. 989, 95th Cong., 2d Sess. 82, reprinted in 1978 U.S.Code Cong. & Admin.News 5787, 5868. Thus any claim available to Chile B. Lee against the Seoul Corporation belongs to his estate, and presumptively to his creditors. As a debtor in possession he has a fiduciary duty to assert any such claim on their behalf. The filing of the bankruptcy case terminated his power unilaterally to waive claims, including any claims that he may have against Seoul Corporation.
Second, it is too early to determine whether Seoul Corporation has any claim against Chile B. Lee, its shareholder and president (and presumably also a director). Careful scrutiny of Chile B. Lee's actions as a shareholder, director and officer is necessary before such a determination can be made. The financial status of the corporation makes it quite likely that such a claim may be available to the corporation.
Third, inter-debtor claims are not the only grounds for conflicts of interest. Substantive consolidation, for example, which is a possibility in this case, is another issue where the lack of separate counsel for related debtors may cause substantial harm because of conflicts of interest. See, Gill v. Pacific Construction, Inc. (In re Parkway Calabasas, Ltd.), 89 B.R. 832, 834 n. 3 (Bankr.C.D.Cal.1988). LSY simply ignores the many other ways in which conflicting interests may arise, including those in this case, that preclude multiple representation.
Fourth, and most important, counsel in O'Connor disclosed the potential conflict. In contrast, in this case LSY has been dishonest and has hidden the conflict from the Court. This fact alone justifies the disqualification of LSY as counsel in both cases.
In addition, O'Connor provides no support for LSY's position. The court in O'Connor permitted counsel to represent both a corporation and its shareholder in parallel bankruptcy cases. However, the court found that, unlike this case, there were no actual conflicts of interest between the debtors. Furthermore, the court in O'Connor clearly stated, "Disqualification should be mandated when an actual, as opposed to hypothetical or theoretical, conflict is present." Id., at 897. The court added, "This in no way precludes disqualification for a potential conflict" (emphasis in original). Id. To assure the avoidance of conflicts of interest in O'Connor, the court appointed separate special counsel to handle inter-debtor claims. No such provision is available in this case to deal with the actual conflicts.
LSY also pleads that the debtors in these two cases cannot afford separate counsel. This rationale has often been used in the past to justify the appointment of counsel to represent related debtors. However, lack of financial resources is no justification for representing conflicting interests.
Lack of financial resources is often a reason for waiving a conflict of interest. Rule 5-102 permits an attorney to represent conflicting interests upon the written consent of all parties concerned. An attorney who desires to represent a debtor in possession and a conflicting interest must obtain a written waiver from the debtor, all creditors and the United States trustee. No such waiver has been offered in this case.
C. Remedy
As a penalty for the representation of conflicting interests, the Court has the power to reduce the compensation awarded to professionals, or to deny it altogether. See, e.g., Diamond Lumber v. Unsecured Creditors' Committee, 88 B.R. 773, 776 (N.D.Tex.1988); In re McKinney Ranch Associates, 62 B.R. 249 (Bankr.C.D. Cal.1986). However, this does not solve the problem of the inadequate representation of parties with differing interests. It is also not fair to the professionals or to the estates to appoint them in circumstances where the diligent prosecution of their duties will embroil them in such conflicts *180 and expose them to a loss of fees. It appears to the Court that the best solution to this problem is is to nip it in the bud, if possible, at the outset of a case, when the professionals are appointed. Accord, In re Roberts, 75 B.R. 402, 406 (D.Utah 1987).
Accordingly, this Court adopts a presumption for two or more related cases, that it is improper to appoint (1) a single trustee, (2) a single creditors' committee, or (3) the same counsel for the trustees, for the creditors' committee or for the debtors in possession under any of the following circumstances:
(a) Where creditors of the debtors have dealt with such debtors as an economic unit (which may be reflected in guaranties and subordination agreements);
(b) Where there is a substantial overlap of creditors;
(c) Where the affairs of the respective debtors (as reflected in inter-debtor accounts, jointly owned assets, guarantees, subordination agreements, or shared officers, directors or owners) appear to be substantially entangled;
(d) Where assets have been transferred from one debtor to another in transactions that are not at arms length;
(e) Where piercing of the corporate veil of one of the debtors is necessary or advisable to protect the rights of creditors of another debtor.
Cf. Gill v. Sierra Pacific Construction (In re Parkway Calabasas, Ltd.), 89 B.R. 832, 835 n. 3 (Bankr.C.D.Cal.1988).
Professionals seeking appointment under section 327 are required to disclose any such factors in their applications for appointment. Any professional seeking to rebut the presumption may do so only at a hearing on notice to all creditors in each of the related cases, at which time the professional must show the propriety of his or her appointment in more than one of the related cases. The notice must be adequate to inform all creditors that the appointment may result in conflicts of interest and a lack of adequate representation of the interests of the respective bodies of creditors. In re Glenn Electric Sales Corp., 89 Bankr. 410, 418 (Bankr.D. N.J.1988).
IV. CONCLUSION
The Court has the power to disqualify counsel in both of these cases, on each of the following grounds: (1) failure to disclose the retainer; (2) failure to disclose the parallel employment applications; (3) the attempt to represent debtors with interests in actual conflict. However, because the transgressions in this case are commonly shared by the bar in this district, the Court declines to impose this drastic remedy on LSY. Instead, the Court exercises its discretion in this case to deny appointment in one case, and to permit LSY to represent the other debtor. However, the Court will not hesitate to impose stiffer sanctions in the future for the violation of these standards.
Counsel has informed the Court that LSY prefers that employment be authorized in the Seoul Corporation case, if it is not authorized for both cases. The Court will so order.
NOTES
[1] General Order 44 was superseded by Bankruptcy Rule 215 in 1973, when the first set of bankruptcy rules took effect. Rule 215 was superseded in turn by Rule 2014 in 1983, when the present bankruptcy rules took effect.
[2] Section 541 provides in relevant part:
(a) The commencement of a [bankruptcy] case . . . creates an estate. Such estate is comprised of all the following property, wherever located and by whomever held:
. . . . .
(1) All legal or equitable interests of the debtor in property as of the commencement of the case.
|
TORONTO — It was as smooth as silk watching Alphonso Davies and Jonathan David, both born in the same year (2000) of the Canadian men’s national team’s last major title, connect for the opening goal.
WATCH: A slick pass from Alphonso Davies sets up Jonathan David for the first goal of the night! 1-0 #CANMNT #CNL pic.twitter.com/jTJBsM2MXm — Canada Soccer (@CanadaSoccerEN) October 16, 2018
It was that sort of precision and cutting-edge movement that allowed Canada to coast to a 5-0 victory over Dominica on a chilly Tuesday night. And while Davies technically lined up as a left-back at kickoff, he was essentially a second winger. David, meanwhile, partnered with Lucas Cavallini and caused fits for the Dominican defence all evening. Both teenagers were involved in four of the five goals for Les Rouges.
No, there aren’t many significant takeaways from a match in which Canada was expected to cruise to victory. However, as these Concacaf Nations League qualifiers go by, Canadian coach John Herdman’s selection headache grows stronger.
Canada’s formation varied throughout the 90 minutes. It went from a straight 4-3-3 to a 2-3-5 and even a 2-1-7 with Dominica parking 10 players behind the ball. Eventually, Ballou Tabla and Cyle Larin were thrown into the match, which further exemplified the team’s depth in quality.
However, Herdman won’t have the luxury of starting several attackers in the Gold Cup, Nations League and World Cup qualifiers. He’ll also need to settle on a back four, which he claims is still in an assessment period. But the English tactician knows how he’ll be able to determine his starters up front.
“I think you have to be really, really clear about the identity of the team and looking at players who will be committed to that,” Herdman explained. “Playing this type of game tonight, the options were different. We knew the type of style Dominica was going to come out with, which meant certain players – those attacking players – could go into other areas of the field. There is no way you’re going to do that against Mexico, and therefore, the competition is going to be immense.
“I’m challenging them in one-on-one meetings to keep pushing to the next level because selections are going to get tougher. Those players that can live above the line and own those moments of our identity, they’re the players who will play consistently.”
Many coaches would love to experience Herdman’s so-called dilemma. He definitely seems buoyed by the prospect of having different options with the Concacaf Gold Cup looming as well. But for now, Canada has attacking verve and bravery on the ball, two characteristics that have seldom been associated with the men’s program.
Even the veterans have noticed the changing of the team’s identity.
“The movement on the pitch, in the attacking third, the way we get into dangerous positions so quickly, our movement off the ball, our movement off the ball, everybody is locked in,” said captain Atiba Hutchinson. “That’s what we’ve been really stressing. We’re very direct in our play, and at the same time, we want to keep it patient when it’s not on so that the confidence is there … There’s just a real presence in the team. We feel good, we feel confident and there is a good mix in the group.”
“I think a lot of the guys trust each other on the team and they want to show each other that fearlessness that a lot of the young guys have,” said Larin. “Now we get a lot of guys forward and we’re not afraid to play against other teams and to just play with confidence.”
The poster boy behind this new wave of Canadian talent has been Davies, who assisted two of Canada’s five goals on the night. Larin latched onto one of the teenager’s low crosses into the box and finished with aplomb to round off the victory.
WATCH: Alphonso Davies swings a ball in from the left side of the box and Cyle Larin puts it in the back of the net 5-0 #CANMNT #CNL pic.twitter.com/Qw6lMOZLmC — Canada Soccer (@CanadaSoccerEN) October 17, 2018
“[Davies] is a special player and to have him on our team and to play with him, it’s great,” Larin boasted. “When you get a lot of chances in the game, it’s a good for me and I like it. In the next coming games, we’ll do well and obviously we want to make the Gold Cup and I think we’ll do well there, too.”
“In my opinion, I think he’s probably going 50 per cent out there,” defender Derek Cornelius suggested when speaking about Davies. “He’s fast, he can take a guy one-on-one, he can make a pass. Even defensively, we’re seeing him playing full-back in these games, and he’s aware of the situations. A great player … Great player.”
There is an incentive for Canada to play proactively and push forward. The top six sides in the Nations League qualifiers book a spot in next summer’s Gold Cup and are drawn into League A for the main tournament, which features the likes of Mexico, Costa Rica and the United States.
Because there are only four games, goal difference becomes crucial in tie-breaking scenarios. Canada is currently second place on a plus-13 goal differential, with Curacao topping the group on plus-15. Therefore, the Canadians can’t afford to pump the breaks in the final third.
It’s easy to recall a time when most attacking players, such as Larin, were automatic starters. Now he has David, Lucas Cavallini and Tosaint Ricketts battling for the No. 9 role. Davies, Tabla, Liam Millar, Junior Hoilett and many others are fighting for places out wide.
“You can see Alphonso’s injection in the Gold Cup was a game-changer for Canada,” Herdman proclaimed. “The big x-factor for me, watching from afar, was what Alphonso brought to the team … All across the team, I wanted to add that youth. I wanted to add that spirit, that fearlessness. When you’ve got leaders like Atiba and Scott around the team, you’ve got good people. They are seasoned pros that aren’t going to try and pull the rug out from underneath these kids, and sort of beat them up and bully them mentally. They’re not those type of guys. You could see that young kids could flourish in that environment.”
Herdman definitely has the talent. Now the next step is to manage that depth heading into 2019 and beyond. |
Between 20 and 50 people wounded in shooting at cinema complex in town of Viernheim. Shooter barricades himself in. |
That was a pretty good read- thanks for the link. The only problem I have with all of these changes is- what makes the Xbox One different than an upgraded (graphics wise) 360? It's the same problem I have with the PS4. They are just more powerful systems as the previous. I want the innovation and features that are special for a new system. There are still plenty with the Xbox One, but they are getting less and less, and I'm not sure how the developers will be "enticed" to use them if they are not necessary and they are doing cross-platform games.
~mrmiller
_________________We are a brotherhood bound by honor, our strength is in our numbers, we are S7!*General Disclaimer- I can't type or spellClan Founder
S7 mrmiller wrote:That was a pretty good read- thanks for the link. The only problem I have with all of these changes is- what makes the Xbox One different than an upgraded (graphics wise) 360? It's the same problem I have with the PS4. They are just more powerful systems as the previous. I want the innovation and features that are special for a new system. There are still plenty with the Xbox One, but they are getting less and less, and I'm not sure how the developers will be "enticed" to use them if they are not necessary and they are doing cross-platform games.
~mrmiller
I agree 100%. Some of the back tracking has been ok, but they need to stop at some point. Like you said, all it's turning out to be is a 360 with better graphics. In and of itself that's not a terrible thing, but it seems to me they are trying to be a MS version of the PS4, which is NOT what I want it to be. If I wanted a PS4 I'd buy one. There are still enough differences to matter, but they keep taking away things that separated them from Sony because the "internet" is upset.
I guess the main thing that gets to me is that some of the things that made me excited about the XB1 being different are now being taken away. I was looking forward to seeing how it would all go down with such a large difference between the consoles. Now not so much.
I still think the biggest difference between the two will be the online experience. The XB1 still have the PS4 beat by a huge marging on that one IMO. Hopefully that won't change (I don't see how that would).
We don't even really know what the online experience is on the XB1 or the PS4 yet. Are you basing this more from Xbox 360 vs PS3? I've been dissapointed with the big change that microsoft made to set itself apart from PS4, which is the whole 'no used games' fiasco that had trolls everywhere trolling. Now for the Kinect not being needed, I feel like I'm paying $100 for something that's optional that I probably won't be using a ton. Maybe that was to give the people who were afraid that Microsoft was watching them some comfort? IDK. Microsoft needs to get their story straight because they've been all over the place ever since E3.
_________________Current PS4 Game(s): The Last of Us RMCurrent 3DS Game(s): Pokemon Sun
Another reason not to buy a xb1 at launch. If it doesn't have to have a kinect then they might put out one that doesnt come with one and it would be cheaper. MS is stripping away stuff that makes it different which blows imo which I think is a bad move if the 2 systems are gonna be the same then MS isn't going to convert too many ps4 people, why would current ps3 owners change, all their friends are on psn and no big feature to sway them unless they're really into TV I'll be getting the titan fall xb1 edition that will be gray and have mech sh1t all over it
That's the same thing I feel about the Kinect. Now if it is truly optional, why would a multi-platform developer sink much into anything Kinect specific, when that can make a vanilla game that plays exactly the same on both the PS4 and the One? I like the TV stuff Xbox is doing, and that's a main reason for me getting one along with the friends list and controller. Still, at the start I couldn't help but feel the PS4 was just a suped-up PS3, and the Xbox One was a signifant upgrade from the 360 with many more features- now it's not so much. I don't care the price point- why get in a rush to spend any signafant amount of money if it's just for some upgraded graphics as most of the early games will be for both generations of systems?
~mrmiller
_________________We are a brotherhood bound by honor, our strength is in our numbers, we are S7!*General Disclaimer- I can't type or spellClan Founder
The problem is that the people that are badmouthing this whole thing aren't getting an Xbox One anyways.
So far I've still seen nothing but hate and vitriol, even after this. It's a bunch of "Now take out the Kinect and sell it at $349" and "Now it's just a PS4 with slower hardware for $100 more". There will always be an excuse for people to not get the XB1. That's why all this backtracking is bugging me. They are catering to the people that aren't going to get the XB1 regardless of what they do, short of getting rid of the Kinect completely and charging less than the PS4.
OneBadHuskerFan wrote:The problem is that the people that are badmouthing this whole thing aren't getting an Xbox One anyways.
So far I've still seen nothing but hate and vitriol, even after this. It's a bunch of "Now take out the Kinect and sell it at $349" and "Now it's just a PS4 with slower hardware for $100 more". There will always be an excuse for people to not get the XB1. That's why all this backtracking is bugging me. They are catering to the people that aren't going to get the XB1 regardless of what they do, short of getting rid of the Kinect completely and charging less than the PS4.
This. The people who complain and continue to complain no matter what Microsoft feeds them are not going to be buying the Xbox One. I do like how the system will come with a headset now, but that's just about the only change they've made that I like. All these 'changed policies' and whatnot is ruining Microsoft's credibility. Pesonally, I'm not as excited to be getting the XB1 now that they keep changing it up. It sort of feels like I'll have no idea what I'll truely be getting from the system until 'Day One' arrives.
_________________Current PS4 Game(s): The Last of Us RMCurrent 3DS Game(s): Pokemon Sun
The author of that article lost 100% credibility when he listed Cloud gaming as something he doesn't see how it would make gaming better. He clearly hasn't been keeping up with the news or technology. Cloud Computing is the future, and the XBO has a very impressive looking cloud environment.
I was a Sony guy but now I'm a Xbox guy And with that said I have still to find anyone to make a good argument for cloud computing at all! It may sound nice but I need an example The Forza five drivatar doesn't even Appeal to me in the least. The cloud just seems like another gimmick to me just like the kinect for Xbox and move for PS3
Joe Rogan wrote:I was a Sony guy but now I'm a Xbox guy And with that said I have still to find anyone to make a good argument for cloud computing at all! It may sound nice but I need an example The Forza five drivatar doesn't even Appeal to me in the least. The cloud just seems like another gimmick to me just like the kinect for Xbox and move for PS3
Well just as a starter how about dedicates servers for CoD on the Xbox One? I haven't heard anything from Sony regarding ANYTHING about supporting dedicated servers. I see that as a very large first step.
Joe Rogan wrote:I was a Sony guy but now I'm a Xbox guy And with that said I have still to find anyone to make a good argument for cloud computing at all! It may sound nice but I need an example The Forza five drivatar doesn't even Appeal to me in the least. The cloud just seems like another gimmick to me just like the kinect for Xbox and move for PS3
There are a TON of applications of it. I work on networks and with servers all day, just for reference.
The primary thing I'm excited about with the Xbox Cloud:
Offloading non-critical processes to the cloud. Players/weapons/etc will still be rendered on your machine, however things like extended draw distances, detailed graphical processes (water animations, etc) and even AI can be processed on the cloud. How does this effect you? Your Xbox just got WAY more powerful. Those 'little' effects take up a lot of power from the machine, using the cloud to render them will make a massive difference. It'll also make huge amounts of players possible where before the console could only handle so many.
There are other things as well, but this is something EVERYONE should be excited about. If PS4 doesn't implement this they'll be a ways behind on their games. The 2 consoles (ignoring fan bois) are actually extremely close in performance throughput. The XBO having a massive virtual resource that can handle processing tasks will give them a very significant edge in detail they can use, features they can implement, and general latency of users.
The PS4 has both Cloud Computing and Cloud Gaming ( < something the XB1 does not) and always has. It's just not as full force as M$ right now but they are actually adding more cloud computing as we speak. M$ has spent a sh1t ton of $$$ on cloud computing so they will probably always be a little ahead of Sony in this respect but the functionality is there on both systems.
I also think that Cloud Gaming is being overlooked by most people. Cloud gaming will allow for the system to play well beyond the capabilities of the hardware. Not to mention access to older games from the PS1, PS2 and PS3 eras. A sort of backwards compatibility.
_________________"Console A sucks! Console B is way better and never has problems! I don't know how to build a cheap PC that out performs both! Rabble rabble!!"
S7 Interseptor wrote:The PS4 has both Cloud Computing and Cloud Gaming ( < something the XB1 does not) and always has. It's just not as full force as M$ right now but they are actually adding more cloud computing as we speak. M$ has spent a sh1t ton of $$$ on cloud computing so they will probably always be a little ahead of Sony in this respect but the functionality is there on both systems.
I also think that Cloud Gaming is being overlooked by most people. Cloud gaming will allow for the system to play well beyond the capabilities of the hardware. Not to mention access to older games from the PS1, PS2 and PS3 eras. A sort of backwards compatibility.
Regarding the cloud gaming I guess to each their own. Having Gaikai is cool and all for those that will use it but not having the ability to stream old console games has zero effect on me. If I want backwards compatibility (which I can't see me wanting) I'll still have my Xbox 360. But yes, it is a feature that MS won't have so it's better than not having it I suppose.
I think the gap in "cloud computing" is a large one and will only get larger as even Mark Cerny from Sony has said he doesn't believe in cloud computing beyond the normal matchmaking and things that are already being currently done. I think MS has a vision here, and while I'm not versed enough to tell you what that vision is or how it will be implemented, I think in the end MS will take the cake as far as all of this "cloud computing" stuff. I readily admit I'm just going on faith on this one. Sony just seems to want no part of it...at least until they are forced to do so.
Hell, the Titanfall devs have already stated how the "cloud" has been really cool to work with and how some of the AI can be offloaded and not use up precious console resources. I'm really looking forward to seeing what MS can do, even if it's little improvements here and there. It all matters.
Yeah, but the Titanfall developers are making the same game for PC too. I think all the hype they are giving the cloud is just BS. I do admit that cloud computing could be a game changer down the road but it's not going to make any difference in the first round of games. Hell, even the current gen is capable of running some of these "next gen" titles.
I have said all along that the best games to make use of the "cloud" for M$ are their 1st party exclusive games. Any multi-system game is just going to make their game to work best on all system and not bother with figuring out how to make one better by using the cloud. Lowest common denominator.
@Atrum, you were talking about the DL and Play functionality, not Cloud Gaming. Cloud Gaming is offloading 100% for the computing to the cloud and playing a game hosted on a powerful computer somewhere on the magical cloud.
The DL and Play functionality is NOT cloud gaming. It is completely separate technology that allows you to play the game while the rest of the game is DL'd in the background. And I am not sure about your connection but for me 6gb takes a few hours to DL. That is a pretty common size for most games. Being able to DL for a few minutes and start playing is HUGE for me or anyone looking to go fully digital in the next gen.
_________________"Console A sucks! Console B is way better and never has problems! I don't know how to build a cheap PC that out performs both! Rabble rabble!!"
S7 Interseptor wrote:@Atrum, you were talking about the DL and Play functionality, not Cloud Gaming. Cloud Gaming is offloading 100% for the computing to the cloud and playing a game hosted on a powerful computer somewhere on the magical cloud.
The DL and Play functionality is NOT cloud gaming. It is completely separate technology that allows you to play the game while the rest of the game is DL'd in the background. And I am not sure about your connection but for me 6gb takes a few hours to DL. That is a pretty common size for most games. Being able to DL for a few minutes and start playing is HUGE for me or anyone looking to go fully digital in the next gen.
Actually it's the same technology. Just a different implementation. And DL times aren't a big deal for me.
As for the 'Cloud Gaming' in the sense that Sony is using it, it's nothing impressive. Look at OnLive, that's been using cloud gaming exclusively for years now and no one is impressed. Sony using the same thing for old games isn't anything impressive. Is it cool to be able to play old games? Definitely. I think it's a very smart way to get around system issues with backwards compatibility.
Playing digital games faster is always a good thing. So for you, instead of minutes, you could be playing in seconds. I also think it is a big step in making full digital a reality. The easier you make it to DL and play a game, the more likely people are to support it. This is part of how I think the PS4 is actually supporting full digital better than the XB1.
You can also play any of your digital games at your friends house with the PS4 as well. Technically, you can do this now with the PS3 and 360 too fyi. But what is stopping you? Perhaps several hours of DL to the new console? Or minutes if you are Atrum with a T1 connection? With the PS4, you can be up an running, playing co-op in minutes.
EDIT: Sorry we seemed to have hi-jacked the thread.
_________________"Console A sucks! Console B is way better and never has problems! I don't know how to build a cheap PC that out performs both! Rabble rabble!!"
It's definitely a neat technology. I'm just so used to frequent updates on my PC games that I get home from work, run any downloads I need, then by the time I can actually game (hours later) everything is ready to go.
Very good point on the friends house thing. That will be pretty critical in me going fully digital since I still LAN fairly often. |
Goths
The Goths (; ) were an early Germanic people who played a major role in the fall of the Western Roman Empire and the emergence of Medieval Europe. They were first definitely reported by Graeco-Roman authors in the third century, living north of the Danube in what is now Ukraine, Moldova and Romania. Later, many moved into the Roman empire, or settled west of the Carpathians near what is now Hungary.
A people called the Gutones—possibly early Goths—are documented living near the lower Vistula in the 1st century AD, where they are associated with the archaeological Wielbark culture. In his book Getica, the Gothic historian Jordanes claimed that the Goths originated in southern Scandinavia more than 1000 years earlier, but his reliability is disputed. The Wielbark culture expanded southwards towards the Black Sea, where by the late 3rd century AD it contributed to the formation of the Chernyakhov culture, which is associated with the Goths who were in frequent conflict and contact with the Roman Empire. By the 4th century AD at the latest, several groups were distinguishable, among whom the Thervingi and Greuthungi were the most powerful. During this time, Ulfilas began the conversion of Goths to Arianism.
In the late 4th century, the lands of the Goths were invaded from the east by the Huns. In the aftermath of this event, several groups of Goths fell under Hunnic rule, while others migrated into the Roman Empire, where they inflicted a devastating defeat upon the Romans at the Battle of Adrianople in 378. These Goths became known as the Visigoths, and under their king Alaric I they began a long migration, which culminated in them establishing a Visigothic Kingdom in Spain at Toledo. Meanwhile, Goths under Hunnic rule regained their freedom in the 5th century AD, and eventually became known as the Ostrogoths. Under their king Theodoric the Great, these Goths established an Ostrogothic Kingdom in Italy at Ravenna.
The Ostrogothic Kingdom was destroyed by the Eastern Roman Empire in the 6th century AD, while the Visigothic Kingdom was conquered by the Umayyad Caliphate in the early 8th century AD. Remnants of Gothic communities in the Crimea, known as the Crimean Goths, lingered on for several centuries, although Goths would eventually cease to exist as a distinct people.
Name
The name "Goths" means "men" or "the people". In the Gothic language of the Ostrogothic Kingdom in Italy, the Goths were called the *Gut-þiuda "Gothic people" (attested as dative singular Gut-þiudai). The simplex variant of this name, *Gutans, or possibly *Gutôs, is inferred from a presumed genitive plural form gutani in the Pietroassa inscription. The Demonym is also attested in Greek as γόθοι, γότθοι, γόθθοι and in Latin as Gothi.
The word "Goths" derives from the stem Gutan-. This stem produces the singular *Gutô, plural *Gutaniz in Proto-Germanic. It survives in the modern Scandinavian tribal name Gutes, which is what the inhabitants of the present-day Swedish island Gotland in Baltic Sea call themselves (In Gutnish - Gutar, in Swedish "Gotlänningar"). Another modern Scandinavian tribal name, Geats (in Swedish "Götar"), which is what the (original) inhabitants of present-day Götaland call themselves, derives from a related Proto-Germanic word, *Gautaz (plural *Gautôz). Both *Gautaz and *Gutô relate to the Proto-Germanic verb *geutaną, meaning "to pour". The Proto-Indo-European root of the word "geutan" and its cognates in other language is . This same root may be connected to the name of a river that flows through Västergötland in Sweden, the Göta älv, which drains Lake Vänern into the Kattegat at the city of Gothenburg. It is plausible that a flowing river would be given a name that describes it as "pouring", and that, if the original home of the Goths was near that river, they would choose an ethnonym that described them as living by the river. Another possibility is that the name of the "Geats" developed independently from that of the Gutar/Goths.
The name "Goths" would eventually come to be applied to a large number of non-Gothic peoples, including Burgundians, Vandals, Gepids, Rugii, Scirii and even the non-Germanic Iranian Alans. On the basis of linguistics, these peoples, with the exception of the Alans, are often referred to as East Germanic peoples.
Classification
The Goths and other East Germanic-speaking groups, such as the Vandals and Gepids, eventually came to live outside of Germania, and were thereafter never considered Germani by ancient Roman authors, who consistently categorized them among the "Scythians" or other peoples who had historically inhabited the area.
The Goths were Germanic-speaking. They are classified as a Germanic people by modern scholars. They are today sometimes referred to as being Germani.
History
Origins and early history
The exact origins of the Goths are unclear and disputed. They are believed to have either originated in southern Scandinavia, in the lower Vistula area, or north of the Danube at a later date.
According to Jordanes, 6th-century, the Goths migrated from southern Scandinavia to the lower Vistula, seizing the lands of the Rugii. Such a migration is controversial, and has not been confirmed archaeologically. Rather than a wholesale migration, Herwig Wolfram considers it entirely plausible that at the Gothic elite was indeed descended from southern Scandinavia. Recent genetic studies has lent support to the Scandianvian theory.
The earliest possible mentions of the Goths are Roman sources of the 1st century AD, who refer to a people called the "Gutones" living along the lower Vistula. The Gutones are generally considered ancestral or even identical to the later Goths, but not everyone accepts this. The Gutones are associated with the Wielbark culture, which flourished in the area at the time, having succeeded the Oksywie culture.
Roman historians write that the Gutones were in close contact with the Lugii and Vandals, and that they were at times in conflict with the Suebi. A people of Scandza called the Gutae, possibly identical to the later Geats, are also mentioned, and it's possible that this people had close relations or even shared origins with the Gutones. Evidence from etymology and the Gutasaga suggests connections with Gotland and the Gutes.
During the early centuries AD, the Wielbark culture expands southward at the expense of the Przeworsk culture, which is associated with the Lugii and Vandals. By the 3rd century AD, this southward expansion to the areas north of the Danube is believed to have contributed to the formation of the Chernyakhov culture. It is in the 3rd century that the name "Goths" are first mentioned, and a minority of scholars therefore suggest that the Goths originated north of the Black Sea in the 3rd century.
Jordanes and Getica
The traditional account of the Goths' early history depends on the work Getica, written by the Goth Jordanes 551 AD. Getica is based on an earlier lost work by Cassiodorus, which was in turn based upon an even earlier work by the Gothic historian Ablabius.
According to Jordanes the earliest migrating Goths sailed from Scandza (Scandinavia) under King Berig in three ships and named their settlement Gothiscandza, after themselves. Although the exact location of Gothiscandza is unclear, it is generally believed to have somewhere near Gdańsk. Jordanes tells us that one shipload "dwelled in the province of Spesis on an island surrounded by the shallow waters of the Vistula." From Gothiscandza, the Goths then moved into an area along the southern coast of the Baltic Sea which was inhabited by the "Ulmerugi" (Rugii), expelled them, and also subdued the neighboring Vandals.
Jordanes' account is controversial, and certainly contains many inaccuracies. It has not been possible to confirm archaeologically his account of a Gothic origin in Scandinavia. Walter Goffart claims that the Getica is an entirely fabricated propaganda piece produced as part of a political conspiracy, with no foundation in oral tradition. Critics of Jordanes typically argue that since his work contains certain obvious errors, it must be entirely unreliable. Because he considers Jordanes completely unreliable, Goffart further charges that all archaeological evidence on the early Goths is unreliable, as this evidence is connected to Jordanes. Goffart's theories on Getica has by Peter Heather been rejected as a "flawed" and "unconvincing" conspiracy theory. Herwig Wolfram considers Getica to be a work of indispensable value to Gothic history. He considers it a relic of Gothic oral tradition, and believes that the Gothic elite originated in Scandinavia. Heather also suggests that Getica is partially based on authentic Gothic tradition. Jordanes' account of Gothic settlement in modern-day Poland is considered accurate by most historians. His account of an early Gothic migration from Scandinavia enjoys large support, particularly among experts in Germanic philology.
Evidence from classical sources
Pliny the Elder wrote that Pytheas, an explorer who visited Northern Europe in the 4th century BC, reported that the "Guiones" already inhabited the shores of an estuary of at least 6,000 stadia called Mentonomon where amber is cast up by the waves. Pliny believed this was in Germania and notes that these "Guiones" sold this amber to their neighbors, the Teutones. To fit with other evidence, some modern commentators believe these "Guiones" should be corrected to "Gutones" and that the Mentonomon is on the Baltic shore, although this is disputed by for example Christensen, who believes that the reference to a geographical "Germania" was added by Pliny. Other authors believe, for example, that the Guiones are the Ingvaeones and the Mentonomon is the North Sea coast. In an earlier chapter, describing the peoples of Germania, Pliny stated that the Gutones, along with the Burgundiones, Varini and Carini, belong to the Vandili. Pliny considers the Vandili one of the five principal "German races", along with the coastal Ingvaeones, the Rhineland Istvaeones, the Irminones and the Peucini.
Strabo mentioned "Butones" together with the Lugians and Semnones and others as one of a large group of people who came under the dominance of Maroboduus of the Marcomanni, and again many modern authors argue this name should be correct to "Gutones". The Vandals and Lugians are often equated with one another.
In a later work, Germania, Tacitus wrote that the Gotones/Gothones and the neighboring Rugii and Lemovii were "Germani" who carried round shields and short swords, and lived near the Ocean, beyond the Vandals. He described them as "ruled by kings, a little more strictly than the other German tribes". In his other notable work, The Annals, Tacitus writes that the Gotones had assisted Catualda, a young Macomannic exile, in overthrowing the rule of Maroboduus. The Gotones of Tacitus are usually treated as the same as the later Goths, although this has been disputed by some.
Ptolemy, in the second century, mentions a people called the Gutae/Gautae, probably the same as the later Gauti mentioned by Procopius, living in southern Scandia. In a later chapter, he mentions the Gutones/Gythones east of the Vistula in Sarmatia, between the Veneti and the Fenni. Wolfram and many other scholars on the Goths considers it likely that there were close connections between then Gutones and Gutae, and that they were possibly two branches of the same people.
Ancient authors do not equate the Gutones with the Goths. The equation is nevertheless supported by Herwig Wolfram, Peter Heather, and among scholars in general. Philologists and linguists have no doubts and consider it indisputable that these are the same names. Historian Arne Søby Christensen has argued that the Gutones and similarly named peoples mentioned by early Roman authors were possibly not identical to the Goths, but concedes that such an equation is generally accepted and is chronologically a "realistic possibility". Christensen's theories have rejected as "based on dubious reasoning" and "surely too extreme" by other historians such as Michael Whitby, who considers them "little more than a long footnote" to what has already been published on the subject by Peter Heather and others.
Other literary evidence
The 5th century Hispano-Roman historian Orosius wrote that the Goths were of the same stock as the Suiones (Swedes), the Vandals, and the other Scandinavian (North Germanic) tribes. Procopius noted that the Goths, Gepids and Vandals were physically and culturally identical, suggesting a common origin. According to Isidore of Seville, the Goths were descended from Gog and Magog, and of the same race as the Getae.
Archaeological evidence
The early Goths are associated with the Wielbark culture. The Swedish archaeologist Anders Kaliff believes that this culture largely developed from earlier cultures in Pomerania. According to the Polish archaeologist Andrzej Kokowski however, it replaced the local Oksywie culture in the 1st century AD, when a Scandinavian settlement developed in a buffer zone between the Oksywie culture and the Przeworsk culture.
Sometime around the 1st century AD, there may have been a large migration out of Scandinavia. Early archaeological evidence in the traditional Swedish province of Östergötland suggests a general depopulation during this period. However, there is no archaeological evidence for a substantial emigration from Scandinavia, A Scandinavian origin of the Goths can therefore not be confirmed archaeologically. Frederik Kortlandt has suggested that they originated in continental Europe.
Archaeological finds show close contacts between southern Sweden and the Baltic coastal area on the continent, and further towards the south-east, evidenced by pottery, house types and graves. Rather than a massive migration, similarities in the material cultures may be products of long-term regular contacts. However, the archaeological record could indicate that while his work is thought to be unreliable, Jordanes' story was based on an oral tradition with some basis in fact. The settlement in today's Poland may correspond to the introduction of Scandinavian burial traditions, such as the stone circles and the stelae especially common on the island of Gotland and other parts of southern Sweden.
The Chernyakhov culture, which emerged on the Pontic steppe in the 3rd century AD, displays close similarities with the Wielbark culture, and it thought to have been largely derived through a southward expansion of Wielbark. The Chernyakhov culture is universally believed to have been dominated by the Goths and related Germanic peoples.
Certain scholars, such as Walter Goffart, completely ignore archaeological evidence on the Goths. They contend that archaeological evidence on the Goths is largely derived from Jordanes, and because they consider Jordanes unreliable, this makes archaeological evidence on the Goths unreliable as well.
Genetic evidence
A 2019 genetic study published in Scientific Reports examined the remains of individuals identified with the Wielbark culture and the Goths. Close genetic relations to populations of Iron Age Scandinavia and modern Norwegians and Swedes were detected, The authors of the study cited this as supporting the theory of a Scandinavian origin of the Goths.
In 2019, a genetic study of various cultures of the Eurasian Steppe was published in Current Biology. Samples from three individuals thought to belong to the Gothic component of the Chernyakhov culture were analyzed. The results appeared to confirm the theory that the Chernyakhov culture emerged as a result of a Gothic migration from the north.
Evidence from historical parallels
The Goths were neither the first nor the only Germanic people who migrated south-eastward towards the Black Sea from a probable northern homeland. Several centuries earlier, the Bastarnae had made a similar migration, only to be overwhelmed by the Sarmatians in the 1st century AD. Contemporary with the suggested Gothic migration, there was also confirmed migrations of Rugii, Vandals, Burgundians and other Germanic tribes towards the south-east. These historical parallels gives credit to the theory that the Goths also emerged on the Danube through a migration from further north.
Linguistic evidence
Gothic is part of the East Germanic branch of the Germanic languages, and through the Gothic Bible of the 4th century AD it is the oldest Germanic language attested. The fact that the Goths were Germanic-speaking and carried Germanic names suggests an origin far to the northwest of the Black Sea. The fact that their language was maintained through centuries of migration suggests these migrations involved not only elite males, but also women and children.
Evidence from the sagas
In medieval Scandinavia, the area of the lower Vistula were remembered as Gothic lands.
Both the Goths and the Gutes were called Gotar in Old West Norse, and Gutar in Old East Norse (for example in the Gutasaga and in runic inscription on the Rökstone). In contrast, the other tribe, the Geats, were clearly differentiated from the Goths / Gutes. Since Old Norse literature does not distinguish between the Goths and the Gutes, but does clearly distinguish between the Goths or Gutes on the one hand, and the Geats on the other (as does Old English literature), it is plausible that the Goths supposed to have migrated out of Scandinavia were members of the Gutes tribe. The Gotlanders themselves have oral traditions of a mass migration towards southern Europe, recorded in the Gutasaga. If the facts are related, this would be a unique case of a tradition that endured for more than a thousand years and that actually pre-dates most of the major splits in the Germanic language family.
Migration to the Black Sea and the formation of the Chernyakhov culture
Beginning in the middle 2nd century, the Gothic Wielbark culture shifted to the southeast, towards the Black Sea. The part of the Wielbark culture that moved was the oldest portion, located west of the Vistula and still practicing Scandinavian burial traditions. It has been suggested that the Goths maintained contact with southern Sweden during their migration.
Around 160 AD, in Central Europe, the first movements of the Migration Period were occurring, as several Germanic tribes, such as the Rugii, Goths, Gepids, Vandals and Burgundians, began moving south-east from their ancestral lands, putting pressure on their southern neighboors. As a result, other Germanic tribes were pushed towards the Roman Empire, leading to the Marcomannic Wars. This conflict resulted in widespread destruction and the first invasion of what is now Italy in the Roman Empire period. The source of the turmoil occurring in Germania at the time has been ascribed to population growth. During this time the Gothic Wielbark culture is believed to have ejected and partially absorbed the people of the Przeworsk culture, who are connected to the Vandals. By 200 AD, Wielbark Goths were probably being recruited into the Roman army.
According to Jordanes, the Goths entered Oium, part of Scythia, under their king Filimer, where they subdued the Spali (Sarmatians).
On the Pontic Steppe, the Goths installed themselves as the rulers of the local Zarubintsy culture, forming the new Chernyakhov culture (c. 250 – c. 400). This strikingly uniform culture came to be stretch from the Danube in the west to the Don in the east. The Chernyakhov culture is believed to have been dominated by the Goths and other Germanic groups such as the Heruli. It nevertheless also included Iranian, Dacian, Roman and probably Slavic elements as well. The Germanic Bastarnae had made a similar migration as the Goths centuries earlier, only to be defeated by Sarmatians in the 1st century. The replacement of the Sarmatians by a new Germanic elite thus constituted another major cultural shift in the area.
The first Greek references to the Goths call them Scythians, since this area, known as Scythia, had historically had been occupied by an unrelated people of that name. The application of that designation to the Goths appears to be not ethnological but rather geographical and cultural - Greeks regarded both the ethnic Scythians and the Goths as "barbarians". A minority of scholars insist that the Goths did not exist until being mentioned by the Romans in the 3rd century AD.
Upon their arrival on the Pontic Steppe, the Goths quickly adopted several nomadic customs from the Sarmatians. They came to excel at horsemanship, archery and falconry, and were also accomplished agriculturalists and seafarers. J. B. Bury describes the Gothic period as "the only non-nomadic episode in the history of the steppe." William H. McNeill compares the migration of the Goths to that of the early Mongols, who migrated southward from the forests and came to dominate the eastern Eurasian steppe around the same time as the Goths in the west.
Early raids on the Roman Empire
In the first attested incursion in Thrace, the Goths were mentioned as Boranoi by Zosimus, and then as Boradoi by Gregory Thaumaturgus. The first incursion of the Roman Empire that can be attributed to Goths is the sack of Histria in 238. Several such raids followed in subsequent decades, in particular the Battle of Abrittus in 251, led by Cniva, in which the Roman Emperor Decius was killed. This was one of the most disastrious defeats in the history of the Roman army. By this time, there were at least two groups of Goths, who were separated by the Dniester River: the Thervingi and the Greuthungi. Goths were at the time heavily recruited into the Roman Army to fight in the Roman-Persian Wars, notably participating at the Battle of Misiche in 242.
The first seaborne raids took place in three subsequent years, probably 255-257. An unsuccessful attack on Pityus was followed in the second year by another, which sacked Pityus and Trabzon and ravaged large areas in the Pontus. In the third year, a much larger force devastated large areas of Bithynia and the Propontis, including the cities of Chalcedon, Nicomedia, Nicaea, Apamea Myrlea, Cius and Bursa. By the end of the raids, the Goths had seized control over Crimea and the Bosporus and captured several cities on the Euxine coast, including Olbia and Tyras, which enabled them to engage in widespread naval activities.
After a 10-year gap, the Goths, along with the Heruli, raiding on 500 ships, sacked Heraclea Pontica, Cyzicus and Byzantium. They were defeated by the Roman navy but managed to escape into the Aegean Sea, where they ravaged the islands of Lemnos and Scyros, broke through Thermopylae and sacked several cities of southern Greece (province of Achaea) including Athens, Corinth, Argos, Olympia and Sparta. Then an Athenian militia, led by the historian Dexippus, pushed the invaders to the north where they were intercepted by the Roman army under Gallienus. He won an important victory near the Nessos (Nestos) river, on the boundary between Macedonia and Thrace, the Dalmatian cavalry of the Roman army earning a reputation as good fighters. Reported barbarian casualties were 3,000 men. Subsequently, the Heruli leader Naulobatus came to terms with the Romans.
After Gallienus was assassinated outside Milan in the summer of 268 in a plot led by high officers in his army, Claudius was proclaimed emperor and headed to Rome to establish his rule. Claudius' immediate concerns were with the Alamanni, who had invaded Raetia and Italy. After he defeated them in the Battle of Lake Benacus, he was finally able to take care of the invasions in the Balkan provinces.
In the meantime, a second and larger sea-borne invasion had started. An enormous coalition consisting of Goths (Greuthungi and Thervingi), Gepids and Peucini, led again by the Heruli, assembled at the mouth of river Tyras (Dniester). The Augustan History and Zosimus claim a total number of 2,000–6,000 ships and 325,000 men. This is probably a gross exaggeration but remains indicative of the scale of the invasion. After failing to storm some towns on the coasts of the western Black Sea and the Danube (Tomi, Marcianopolis), the invaders attacked Byzantium and Chrysopolis. Part of their fleet was wrecked, either because of the Gothic inexperience in sailing through the violent currents of the Propontis or because it was defeated by the Roman navy. Then they entered the Aegean Sea and a detachment ravaged the Aegean islands as far as Crete, Rhodes and Cyprus. The fleet probably also sacked Troy and Ephesus, destroying the Temple of Artemis, one of the Seven Wonders of the Ancient World. While their main force had constructed siege works and was close to taking the cities of Thessalonica and Cassandreia, it retreated to the Balkan interior at the news that the emperor was advancing.
Learning of the approach of Claudius, the Goths first attempt to directly invade Italy. They are engaged near Naissus by a Roman army led by Claudius advancing from the north. The battle most likely took place in 269, and was fiercely contested. Large numbers on both sides were killed but, at the critical point, the Romans tricked the Goths into an ambush by pretended flight. Some 50,000 Goths were allegedly killed or taken captive and their base at Thessalonika destroyed. It seems that Aurelian who was in charge of all Roman cavalry during Claudius' reign, led the decisive attack in the battle. Some survivors were resettled within the empire, while others were incorporated into the Roman army. The battle ensured the survival of the Roman Empire for another two centuries.
In 270, after the death of Claudius, Goths under the leadership of Cannabaudes again launched an invasion on the Roman Empire, but were defeated by Aurelian, who however surrendered Dacia beyond the Danube.
Around 275 the Goths launched a last major assault on Asia Minor, where piracy by Black Sea Goths was causing great trouble in Colchis, Pontus, Cappadocia, Galatia and even Cilicia. They were defeated sometime in 276 by Emperor Marcus Claudius Tacitus.
In the late 3rd century, as recorded by Jordanes, the Gepids, under their king Fastida, utterly defeated the Burgundians, and then attacked the Goths and their king Ostrogotha. Out of this conflict, Ostrogotha and the Goths emerged victorious. In the last decades of the 3rd century AD, large number of Capri are recored as fleeing Dacia for the Roman Empire, having probably been evicted from the area by Goths.
Co-existence with the Roman Empire
In 332, Constantine helped the Sarmatians to settle on the north banks of the Danube to defend against the Goths' attacks and thereby enforce the Roman border. Around 100,000 Goths were reportedly killed in battle, and Aoric, son of the Thervingian king Ariaric, was captured. Eusebius, an historian who wrote in Greek in the third century, wrote that in 334, Constantine evacuated approximately 300,000 Sarmatians from the north bank of the Danube after a revolt of the Sarmatians' slaves. From 335 to 336, Constantine, continuing his Danube campaign, defeated many Gothic tribes.
Having been driven from the Danube by the Romans, the Thervingi invaded the territoy of the Sarmatians of the Tisza. In this conflict, the Thervingi were led by Vidigoia, "the bravest of the Goths" and were victorious, although Vidigoia was killed. Jordanes states that Aoric was succeeded by Geberic, "a man renowned for his valor and noble birth", who waged war on the Hasdingi Vandals and their king Visimar, forcing them to settle in Pannonia under Roman protection.
Both the Greuthungi and Thervingi became heavily Romanized during the 4th Century. This came about through trade with the Romans, as well as through Gothic membership of a military covenant, which was based in Byzantium and involved pledges of military assistance. Reportedly, 40,000 Goths were brought by Constantine to defend Constantinople in his later reign, and the Palace Guard was thereafter mostly composed of Germanic warriors, as Roman soldiers by this time had largely lost military value. The Goths increasingly became soldiers in the Roman armies in the 4th Century AD leading to a significant Germanization of the Roman Army. Without the recruitment of Germanic warriors in the Roman Army, the Roman Empire would not have survived for as long as it did. Goths who gained prominent positions in the Roman military include Gainas, Tribigild, Fravitta and Aspar. Mardonius, a Gothic eunuch, was the childhood tutor and later adviser of Roman emperor Julian, on whom he had an immense influence.
The Gothic penchant for wearing skins became fashion in Constantinople, which was heavily denounced by conservatives. The 4th century Greek historian Eunapius described the Goths' powerful build in a pejorative way: "Their bodies provoked contempt in all who saw them, for they were far too big and far too heavy for their feet to carry them, and they were pinched in at the waist – just like those insects Aristotle writes of." The 4th century Greek bishop Synesius compared the Goths to wolves among sheep, mocked them for wearing skins and questioned their loyalty towards Rome: A man in skins leading warriors who wear the chlamys, exchanging his sheepskins for the toga to debate with Roman magistrates and perhaps even sit next to a Roman consul, while law-abiding men sit behind. Then these same men, once they have gone a little way from the senate house, put on their sheepskins again, and when they have rejoined their fellows they mock the toga, saying that they cannot comfortably draw their swords in it.
In the 4th century, the Gothic missionary Wulfila devised the Gothic alphabet to translate the Wulfila Bible and converted many of the Goths from Germanic paganism to Arian Christianity.
In the 4th century, Geberic was succeeded by the Greuthungian king Ermanaric, who embarked on a large-scale expansion. Jordanes states that Ermanaric conquered a large number of warlike tribes, including the Heruli (who were led by Alaric), the Aesti and the Vistula Veneti, who, although militarily weak, were very numerous, and took up a strong fight. Jordanes compares the conquests of Ermanaric to those of Alexander the Great, and states that he "ruled all the nations of Scythia and Germany by his own prowess alone." Interpreting Jordanes, Herwig Wolfram estimates that Ermanaric dominated a vast area of the Pontic Steppe stretching from the Baltic Sea to the Black Sea as far eastwards as the Ural Mountains, encompassing not only Greuthungi, but also Finnic peoples, Slavs (such as the Antes), Rosomoni (Roxolani), Alans, Huns, Sarmatians and probably Aestii (Balts). According to Wolfram, it is certainly possible that the sphere of influence of the Chernyakhov culture could have extended well beyond its archaeological extent. Chernyakhov finds have indeed been found far to the north in the forest steppe, suggesting Gothic domination of this area. Peter Heather on the other hand, contends that the extent of Ermanaric's power is exaggerated. Ermanaric's possible dominance of the Volga-Don trade routes has made historian Gottfried Schramm consider his realm as a forerunner of the Viking founded state of Kievan Rus'. In the western part of Gothic territories, dominated by the Thervingi, there were also populations of Taifali, Sarmatians and other Iranian peoples, Dacians, Daco-Romans and other Romanized populations.
According to Hervarar saga ok Heiðreks (The Saga of Hervör and Heidrek), a 13th-century legendary saga, Árheimar was the capital of Reidgotaland, the land of the Goths. The saga states that it was located on the Dnieper river. Jordanes refers to the region as Oium.
In the 360s, Athanaric, son of Aoric and leader of the Thervingi, supported the usurper Procopius against the Eastern Roman Emperor Valens. In retaliation, Valens invaded the territories of Athanaric and defeated him, but was unable to achieve a decisive victory. Athanaric and Valens thereupon negotiated a peace treaty, favorable to the Thervingi, on a boat at the Danube river, as Athanaric refused to set his feet within the Roman Empire. Soon afterwards, Fritigern, a rival of Athanaric, converted to Arianism, gaining the favor of Valens. Athanaric and Fritigern thereafter fought a civil war in which Athanaric appears to have been victorious. Athanaric thereafter carried out a crackdown on Christianity in his realm.
Arrival of the Huns
Around 375 AD the Huns overran the Alans, an Iranian people living to the east of the Goths, and then, along with Alans, invaded the Goths themselves. A source for this period is Ammianus Marcellinus. He wrote that Hunnic domination of the Gothic kingdoms in Scythia began in the 370s. It is possible that the Hunnic attack came as a response to the Gothic eastwards expansion.
Upon the suicide of Ermanaric, the Greuthungi gradually fell under Hunnic dominance. Christopher I. Beckwith suggests that the Hunnic thrust into Europe and the Roman Empire was an attempt to subdue independent Goths in the west. The Huns fell upon the Thervingi, and Athanaric sought refuge in the mountains (referred to as Caucaland in the sagas). Ambrose makes a passing reference to Athanaric's royal titles before 376 in his De Spiritu Sancto (On the Holy Ghost)
Battles between the Goths and the Huns are described in the Hlöðskviða (The Battle of the Goths and Huns), a medieval Icelandic saga. The sagas recall that Gizur, king of the Geats, came to the aid of the Goths in an epic conflict with the Huns, although this saga might derive from a later Gothic-Hunnic conflict.
Although the Huns successfully subdued many of the Goths, who joined their ranks, Fritigern approached the Eastern Roman emperor Valens in 376 with a portion of his people and asked to be allowed to settle on the south bank of the Danube. Valens permitted this, and even assisted the Goths in their crossing of the river (probably at the fortress of Durostorum). The Gothic evacuation across the Danube was probably not spontaneous, but rather a carefully planned operation initated after long debate among leading members of the community. Upon arrival, the Goths were to be disarmed as according to their agreement with the Romans, although many of them still managed to keep their arms. The Moesogoths settled in Thrace and Moesia.
The Gothic War
Mistreated by corrupt local Roman officials, the Gothic refugees were soon experiencing a famine; some are recorded having being forced to sell their children to Roman slave traders in return for rotten dog meat. Enraged by this treachery, Fritigern unleashed a widescale rebellion in Thrace, in which he was joined not only by Gothic refugees and slaves, but also by disgruntled Roman workers and peasants, and Gothic deserters from the Roman Army. The ensuing conflict, known as the Gothic War, lasted for several years. Meanwhile, a group of Greuthungi, led by the chieftains Alatheus and Saphrax, who were co-regents for Vithericus, son and heir of the Greuthungi king Vithimiris, crossed the Danube without Roman permission. The Gothic War culminated in the Battle of Adrianople in 378, in which the Romans were badly defeated and Valens was killed.
Following the decisive Gothic victory at Adrianople, Julius, the magister militum of the Eastern Roman Empire, organized a wholesale massacre of Goths in Asia Minor, Syria and other parts of the Roman East. Fearing rebellion, Julian lured the Goths into the confines of urban streets from which they could not escape and massacred soldiers and civilians alike. As word spread, the Goths rioted throughout the region, and large numbers were killed. Survivors may have settled in Phrygia.
With the rise of Theodosius I in 379, the Romans launched a renewed offensive to subdue Fritigern and his followers. Around the same time, Athanaric arrived in Constantinople, having fled Caucaland through the scheming of Fritigern. Athanaric received a warm reception by Theodosius, praising the Roman Emperor in return, and was awarded a magnificent funeral by the emperor following his death shortly after his arrival. In 382, Theodosius decided to enter peace negotiations with the Thervingi, which were concluded on 3 October 382. The Thervingi were subsequently made foederati of the Romans in Thrace and obliged to provide troops to the Roman army.
Later division and spread of the Goths
In the aftermath of the Hunnic onslaught, two major groups of the Goths would eventually emerge, the Visigoths and Ostrogoths. The Visigoths, led by the Balti dynasty, claimed descend from the Thervingi and lived as foederati inside Roman territory, while the Ostrogoths, led by the Amali dynasty, claimed descent from the Greuthungi and were subjects of the Huns. Procopius interpreted the name Visigoth as "western Goths" and the name Ostrogoth as "eastern Goth", reflecting the geographic distribution of the Gothic realms at that time. A people closely related to the Goths, the Gepids, were also living under Hunnic domination. A smaller group of Goths were the Crimean Goths, who remained in Crimea and maintained their Gothic identity well into the Middle Ages.
Visigoths
Following Theodosius' treaty, Visigoths received prominent positions in the Roman army. Relations with Roman civilians were sometimes uneasy; in 391, Gothic soldiers, with the blessing of Theodosius I, massacred thousands of Roman spectators at the Hippodrome in Thessalonica as vengeance for the lynching of the Gothic general Butheric.
The Visigoths suffered heavy losses while serving Theodosius in the civil war of 394 against Eugenius and Arbogast. In 395, following the death of Theodosius I, the Visigoths elected Alaric I as their king and invaded Greece, where they sacked Piraeus (the port of Athens) and destroyed Corinth, Megara, Argos, and Sparta. Athens was spared by paying a large bribe, and the Eastern emperor Flavius Arcadius subsequently appointed Alaric magister militum (“master of the soldiers”) in Illyricum in 397.
In 401 and 402, Alaric made two attempts at invading Italy, but was defeated by Stilicho. In 405-406, another Gothic leader, Radagaisus, also attempted to invade Italy, and was also defeated by Stilicho. In 408, the Western Roman emperor Flavius Honorius ordered the execution of Stilicho and his family, then incited the Roman population to massacre tens of thousands of wives and children of Goths serving in the Roman military. Subsequently, around 30,000 Gothic soldiers defected to Alaric. Alaric in turn invaded Italy, seeking to pressure Honorious into granting him permission to settle his people in North Africa. In Italy, Alaric liberated tens of thousands of Gothic slaves, and in 410 he sacked the city of Rome. Although the city's riches were plundered, the civilian inhabitants of the city were treated humanely, and only a few buildings were burned. Alaric died soon afterwards, and was buried along with his treasure in an unknown grave under the Busento river.
Alaric was succeeded by his brother-in-law Athaulf, who was married to Honorius' sister Galla Placidia, who had been seized during Alaric's sack of Rome. Athaulf settled the Visigoths in southern Gaul. After failing to gain recognition from the Romans, Athaulf retreated into Hispania in early 415, and was assassinated in Barcelona shortly afterwards. He was succeeded by Sigeric and then Wallia, who succeeded in having the Visigoths accepted by Honorius as foederati in southern Gaul with their capital at Toulouse. Wallia subsequently inflicted severe defeats upon the Silingi Vandals and the Alans in Hispania. Periodically they marched on Arles, the seat of the praetorian prefect but were always pushed back. In 437 the Visigoths signed a treaty with the Romans which they kept.
Under Theodoric I the Visigoths allied with the Romans and fought Attila to a stalemate in the Battle of the Catalaunian Fields, although Theodoric was killed in the battle. Under Euric, the Visigoths established an independent Visigothic Kingdom and succeeded in driving the Suebi out of Hispania proper and back into Galicia. Although the barbarians controlled Spain, they still formed a tiny minority among a much larger Hispano-Roman population, approximately 200,000 out of 6,000,000.
In 507, the Visigoths were pushed out of most of Gaul by the Frankish king Clovis I at the Battle of Vouillé. They were able to retain Narbonensis and Provence after the timely arrival of an Ostrogoth detachment sent by Theodoric the Great. The defeat at Vouillé resulted in their further penetration of Hispania and establishment of a new capital at Toledo.
Under Liuvigild in the latter part of the 6th century, they succeeded in subduing the Suebi in Gallicia and the Byzantines in the south-west, achieving dominance over most of the peninsula. Liuvigild also abolished the law which prevented intermarriage between Hispano-Romans and Goths, and he remained an Arian Christian. The conversion of Reccared I to Roman Catholicism in the late 6th century prompted the assimilation of Goths and Hispano-Romans.
At the end of the 7th century, the Visigothic Kingdom began to suffer from internal troubles. Their kingdom fell and progressively to conquered by the Umayyad Caliphate from 711 after the defeat of their last king Roderic at the Battle of Guadalete. Some nobles found refuge in the mountain areas of the Pyrenees and Cantabria. The Christians began to regain control under the leadership of the Visigothic nobleman Pelagius of Asturias, who founded the Kingdom of Asturias in 718 and defeated the Muslims at the Battle of Covadonga in ca. 722, in what is taken to be the beginning of the Reconquista. It was from the Asturian kingdom that modern Spain and Portugal evolved.
The Visigoths never became completely Romanized, as they became rather 'Hispanicized' and further became widespread over a large territory and body of population. They progressively adopted a new culture, retaining little of their original culture except for practical military customs, some artistic modalities, family traditions such as heroic songs and folklore, as well as select conventions to include Germanic names still in use in present-day Spain. It is these artifacts of the original Visigothic culture that give ample evidence of its contributing foundation for the present regional culture. Portraying themselves heirs of the Visigoths, the subsequent Christian Spanish monarchs declared their responsibility for the Reconquista of Islamic Spain, which was completed with the Fall of Granada in 1492.
Ostrogoths
After the Hunnic invasion, many Goths became subjects of the Huns. These would become known as the Ostrogoths.
Others sought refuge in the Roman Empire, where many of them were recruited into the Roman army. In the spring of 399, Tribigild, a Gothic leader in charge of troops in Nakoleia, rose up in rebellion and defeated the first imperial army sent against him, possibly seeking to emulate Alaric's successes in the west. Gainas, a Goth who along with Stilicho and Eutropius had deposed Rufinus in 395, was sent to suppress Tribigild's rebellion, but instead plotted to use the situation to seize power in the Eastern Roman Empire. This attempt was however thwarted by the pro-Roman Goth Fravitta, and in the aftermath, thousands of Gothic civilians were massacred in Constantinople, many being burned alive in the local Arian church where they had taken shelter. As late as the 6th century Goths were settled as foederati in parts of Asia Minor. Their descendants, who formed the elite Optimatoi regiment, still lived there in the early 8th century. While they were largely assimilated, their Gothic origin was still well-known: the chronicler Theophanes the Confessor calls them Gothograeci.
The Ostrogoths fought together with the Huns at the Battle of the Catalaunian Plains in 451. Following the death of Attila and the defeat of the Huns at the Battle of Nedao in 454, the Ostrogoths broke away from Hunnic rule under their king Valamir. Under his successor, Theodemir, they utterly defeated the Huns at the Bassianae in 468, and then defeated a coalition of Roman-supported Germanic tribes at the Battle of Bolia in 469, which gained them supremacy in Pannonia.
Theodemir was succeeded by his son Theodoric in 471, who was forced to compete with Theodoric Strabo, leader of the Thracian Goths, for the leadership of his people. Afraid of the threat posed by Theodoric to Constantinople, the Eastern Roman emperor Zeno ordered Theodoric to invade Italy in 488. By 493, Theodoric had conquered all of Italy from the Scirian Odoacer, whom he killed with his own hands. Theodoric subsequently formed the Ostrogothic Kingdom. Theodoric settled his entire people in Italy, estimated at 100,000-200,000, mostly in the northern part of the country, and ruled the country very efficiently. The Goths in Italy constituted a small minority of the population in the country. Intermarriage between Goths and Romans were forbidden, and Romans were also forbidden from carrying arms. Nevertheless, the Roman majority was treated fairly.
The Goths were briefly reunited under one crown in the early 6th century under Theodoric, who became regent of the Visigothic kingdom following the death of Alaric II at the Battle of Vouillé in 507.
Shortly after Theodoric's death, the country was invaded by the Eastern Roman Empire in the Gothic War, which severely devastated and depopulated the Italian peninsula. The Ostrogoths made a brief resurgence under their efficient king Totila, who was however killed at the Battle of Taginae in 552. After the last stand of the Ostrogothic king Teia at the Battle of Mons Lactarius in 553, Ostrogothic resistance ended, and the remaining Goths in Italy were assimilated by the Lombards, another Germanic tribe, who invaded Italy and founded the Kingdom of the Lombards in 567 AD.
Crimean Goths
Gothic tribes who remained in the lands around the Black Sea, especially in Crimea - were known as the Crimean Goths. During the late 5th and early 6th century, the Crimean Goths had to fight off hordes of Huns who were migrating back eastward after losing control of their European empire. In the 5th century, Theodoric the Great tried to recruit Crimean Goths for his campaigns in Italy, but few showed interest in joining him. They became affiliated with the Eastern Orthodox Church through the Metropolitanate of Gothia, and became closely associated with the Byzantine Empire.
In the Middle Ages, the Crimean Goths were in perpetual conflict with the Khazars. John of Gothia, the metropolitan bishop of Doros, capital of the Crimean Goths, briefly expelled the Khazars from Crimea in the late 8th century, and was subsequently canonized as an Eastern Orthodox saint.
In the 10th century, the lands of Crimean Goths were once again raided by the Khazars. As a response, the leaders of the Crimean Goths made an alliance with Sviatoslav I of Kiev, who subsequently waged war upon and utterly destroyed the Khazar Khaganate. In the late Middle Ages the Crimean Goths were part of the Principality of Theodoro, which was conquered by the Ottoman Empire in the late 15th century. As late as the 18th century a small number of people in Crimea may still have spoken Crimean Gothic.
Physical appearance
In ancient sources, the Goths are always described as tall and athletic, with light skin, blonde hair and blue eyes. Their physical size became a source of contempt among the Romans. Procopius notes that the Vandals and Gepids looked similar to the Goths, and on this basis, he suggested that they were all of common origin. Of the Goths, he wrote that "they all have white bodies and fair hair, and are tall and handsome to look upon."
Genetics
A genetic study published in Scientific Reports in 2018 examined the mtDNA of 60 individuals buried at the Wielbark cemetery of Kowalewko in the 1st and 2nd centuries AD. The majority of the individuals carried types of haplogroup H and U, and notably displayed higher frequencies of U5b (a typically Western Hunter-Gatherer lineage) than preceding and succeeding populations in the area. They were found to be most closely related to Iron Age Scandinavian populations and the Bell Beaker culture. Strong genetic similarities with modern Scandinavians, such as Norwegians and Swedes, were detected. The males and females of Kowalewko were found to be of significantly different origins, with males displaying closer links to Iron Age Scandinavia and carrying higher amounts of steppe ancestry and hunter-gatherer ancestry than the females.
A genetic study published in Scientific Reports in 2019 examined the mtDNA of 27 Goths buried at a Wielbark cemetery in Masłomęcz from the 2nd to the 4th centuries AD. They were found to be mostly carriers of haplogroup H and U. The individuals displayed even closer genetic links to Iron Age Scandinavian populations than those of Kowalewko did. Males and females at Masłomęcz were found to be more closely related to each other than those at Kowalewko were. They also carried fewer samples of U5b, and displayed less strong genetic links to the steppe than earlier Wielbark samples from Kowalewko. The results appeared to support the theory that the Goths originated in southern Scandinavia and expanded southwards through the Wielbark culture towards the Black Sea, where they mixed with local populations and established the Chernyakhov culture.
A genetic study published in Scientific Reports in 2019 examined the mtDNA of three Gothic females from the Chernyakhov culture. They carried haplogroup H1n6, H1c and T2g1 respectively. These individuals were genetically significantly different from previous populations of the area, being distinguished by a higher amount of ancestry from western and northern Europe. The results appeared to confirm the theory that the Chernyakhov culture emerged as a result of a Gothic migration from the north.
Culture
Art
Before the invasion of the Huns, the Gothic Chernyakhov culture produced jewelry, vessels, and decorative objects in a style much influenced by Greek and Roman craftsmen. They developed a polychrome style of gold work, using wrought cells or setting to encrust gemstones into their gold objects.
Language
The Gothic language is the Germanic language with the earliest attestation (300s), making it a language of interest in comparative linguistics. All other East Germanic languages are known, if at all, from proper names or short phrases that survived in historical accounts, and from loan-words in other languages. It is known primarily from the Codex Argenteus, a translation of the Bible. The language was in decline by the mid-500s, due to the military victory of the Franks, the elimination of the Goths in Italy, and geographic isolation. In Spain the language lost its last and probably already declining function as a church language when the Visigoths converted to Catholicism in 589. The language survived as a domestic language in the Iberian peninsula (modern Spain and Portugal) as late as the 8th century, and Frankish author Walafrid Strabo wrote that it was still spoken in the lower Danube area in the early 9th century.
In pockets of Crimea, a related dialect known as Crimean Gothic survived up until the early modern period, and the 4th-century Bible translation was in use there until at least the ninth century.
Society
Archaeological evidence in Visigothic cemeteries shows that social stratification was analogous to that of the village of Sabbas the Goth. The majority of villagers were common peasants. Paupers were buried with funeral rites, unlike slaves. In a village of 50 to 100 people, there were four or five elite couples. In Eastern Europe, houses include sunken-floored dwellings, surface dwellings, and stall-houses. The largest known settlement is the Criuleni District. Chernyakhov cemeteries feature both cremation and inhumation burials; among the latter the head is to the north. Some graves were left empty. Grave goods often include pottery, bone combs, and iron tools, but hardly ever weapons.
Peter Heather suggest that the freemen constituted the core of Gothic society. These were ranked below the nobility, but above the freedmen and slaves. It is estimated that around a quarter to a fifth of weapon-bearing Gothic males of the Ostrogothic Kingdom were freemen.
Law
Warfare
Economy
Archaeology shows that the Visigoths, unlike the Ostrogoths, were predominantly farmers. They sowed wheat, barley, rye, and flax. They also raised pigs, poultry, and goats. Horses and donkeys were raised as working animals and fed with hay. Sheep were raised for their wool, which they fashioned into clothing. Archaeology indicates they were skilled potters and blacksmiths. When peace treaties were negotiated with the Romans, the Goths demanded free trade. Imports from Rome included wine and cooking-oil.
Roman writers note that the Goths neither claimed taxes from their own nor their subjects. The early 5th century Christian writer Salvian compared the Goths' and related people's favourable treatment of the poor to the miserable state of peasants in Roman Gaul:
For in the Gothic country the barbarians are so far from tolerating this sort of oppression that not even Romans who live among them have to bear it. Hence all the Romans in that region have but one desire, that they may never have to return to the Roman jurisdiction. It is the unanimous prayer of the Roman people in that district that they may be permitted to continue to lead their present life among the barbarians.
Religion
Initially practising Gothic paganism, the Goths were gradually converted to Arianism in the course of the 4th Century as a result of the missionary activity by the Gothic bishop Ulfilas, who devised a Gothic alphabet to write the Gothic Bible.
During the 370s, Goths converting to Christianity were subject to persecution by the Thervingian king Athanaric, who was a pagan.
The Visigothic Kingdom in Hispania converted to Roman Catholicism in the late 6th Century.
The Ostrogoths (and their remnants, the Crimean Goths) were closely connected to the Patriarchate of Constantinople from the 5th Century, and became fully incorporated under the Metropolitanate of Gothia from the 9th Century.
Legacy
The Goths' relationship with Sweden became an important part of Swedish nationalism, and until the 19th Century, before the Gothic origin had been thoroughly researched by archaeologists, Swedish scholars considered Swedes to be the direct descendants of the Goths. Today, scholars identify this as a cultural movement called Gothicismus, which included an enthusiasm for things Old Norse.
In Medieval and Modern Spain, the Visigoths were believed to be the origin of the Spanish nobility (compare Gobineau for a similar French idea). By the early 7th Century, the ethnic distinction between Visigoths and Hispano-Romans had all but disappeared, but recognition of a Gothic origin, e.g. on gravestones, still survived among the nobility. The 7th century Visigothic aristocracy saw itself as bearers of a particular Gothic consciousness and as guardians of old traditions such as Germanic namegiving; probably these traditions were on the whole restricted to the family sphere (Hispano-Roman nobles did service for Visigothic nobles already in the 5th century and the two branches of Spanish aristocracy had fully adopted similar customs two centuries later).
Beginning in 1278, when Magnus III of Sweden ascended to the throne, a reference to Gothic origins was included in the title of the King of Sweden: In 1973, with the death of King Gustaf VI Adolf, the title was changed to simply "King of Sweden."
The Spanish and Swedish claims of Gothic origins led to a clash at the Council of Basel in 1434. Before the assembled cardinals and delegations could engage in theological discussion, they had to decide how to sit during the proceedings. The delegations from the more prominent nations argued that they should sit closest to the Pope, and there were also disputes over who were to have the finest chairs and who were to have their chairs on mats. In some cases, they compromised so that some would have half a chair leg on the rim of a mat. In this conflict, Nicolaus Ragvaldi, bishop of the Diocese of Växjö, claimed that the Swedes were the descendants of the great Goths, and that the people of Västergötland (Westrogothia in Latin) were the Visigoths and the people of Östergötland (Ostrogothia in Latin) were the Ostrogoths. The Spanish delegation retorted that it was only the "lazy" and "unenterprising" Goths who had remained in Sweden, whereas the "heroic" Goths had left Sweden, invaded the Roman empire and settled in Spain.
In Spain, a man acting with arrogance would be said to be "haciéndose los godos" ("making himself to act like the Goths"). In Chile, Argentina and the Canary Islands, godo was an ethnic slur used against European Spaniards, who in the early colony period often felt superior to the people born locally (criollos).
A large amount of literature has been produced on the Goths, with Henry Bradley's The Goths (1888) being the standard English-language text for many decades. More recently, Peter Heather has established himself that the leading authority on the Goths in the English-speaking world. The leading authority on the Goths in the German-speaking world is Herwig Wolfram.
List of early literature on the Goths
In the sagas
Gutasaga
Hervarar saga ok Heiðreks (The Saga of Hervör and Heidrek)
Hlöðskviða (The Battle of the Goths and Huns)
In Greco-Roman literature
Ambrose.
Ammianus Marcellinus
The anonymous author(s) of the Augustan History
Aurelius Victor: The Caesars, a history from Augustus to Constantius II
Cassiodorus: A lost history of the Goths used by Jordanes
Claudian: Poems
Epitome de Caesaribus
Eunapius"
Eutropius: Breviary
Eusebius
George Syncellus
Gregory of Nyssa
Isidore of Seville in his History of the Kings of the Goths, Vandals, and Suevi
Jerome: Chronicle
Jordanes, in his Getica
Julian the Apostate
Lactantius: On the death of the Persecutors
Olympiodorus of Thebes
Panegyrici latini
Paulinus the Deacon: Life of bishop Ambrose of Milan
Paulus Orosius
Philostorgius: Greek church history
Pliny the Elder in Natural History
Procopius
Ptolemy in Geography Sozomen
Strabo in Geographica Synesius: De regno and De providentia. Tacitus in Germania and Annals''
Themistius: Speeches
Theoderet of Cyrrhus
Theodosian Code
Zosimus
See also
Gothic Wars
Gaut
Getae
Gutes
Geats
Gothicism
Gutian people
Notes and sources
Notes
Ancient sources
Modern sources
Further reading
Category:Early Germanic peoples |
644 S.E.2d 227 (2007)
JAMES RIVER EQUIPMENT, INC.
v.
MECKLENBURG UTILITIES, INC., Orange County Board of Education and Jeffrey W. Tharpe, as Trustee after termination of Tharpe's Excavating, Inc.
No. 540P06.
Supreme Court of North Carolina.
March 8, 2007.
Perry R. Safran, Brian J. Schoolman, M. Riana Smith, Raleigh, for Mecklenburg Utilities.
D. Michael Parker, Hillsborough, for Orange County Bd. of Ed.
Celie B. Richardson, Durham, Elaine R. Jordan, Richmond, VA, for James River Equipment.
Jeffrey W. Tharpe, Trustee, for Tharpe.
Prior report: ____ N.C.App. ____, 634 S.E.2d 557.
ORDER
Upon consideration of the conditional petition filed on the 19th day of October 2006 by Defendant (Orange County Board of Education) in this matter for discretionary review of the decision of the North Carolina Court of Appeals pursuant to G.S. 7A-31, the following order was entered and is hereby certified to the North Carolina Court of Appeals:
"Dismissed as moot by order of the Court in conference, this the 8th day of March 2007."
Justice HUDSON recused.
|
Conventional clothes dryers include a rotating drum into which textiles to be dried are placed. The textiles are dried by forcing heated air through the wet laundry rotating within the drum. Moisture is removed along with the air exiting the dryer or via a condensed water duct.
Conventional clothes dryers have been controlled in various ways. The simplest of these is a timer that controls the duration of the drying cycle. When using a timer, the user places wet laundry inside the dryer and selects the duration for the drying cycle. The dryer cycle then proceeds until the timer expires. Although this method is relatively simple, it is difficult to accurately estimate the length of time required to reach a desired final moisture level, or “dryness,” for every type of textile. If the cycle length is too short, the textiles will not be fully dry at the end of the cycle, and the user must initiate another dryer cycle to finish the drying process. If, on the other hand, the cycle length is too long, the clothes may become “overdry,” which may result in premature textile degradation and/or damage, excess energy consumption, and an associated increase in energy costs. |
1. Field of Invention
This invention relates to the processing of a flow in a pipe, including a slurry having tailings from a mining operation, such as mature fine tailings (MFT) from oil/sands mining; more particularly, this invention relates to a technique for determining information about an injection of a chemical into the flow in the pipe, including flocculation chemicals, as well as for controlling or regulating the injection of the chemical into the flow in the pipe.
2. Description of Related Art
Tailings are the materials left over after the process of separating the valuable fraction from the worthless fraction of an ore, such as oil sands, copper ore, etc.
In the processing of tailings from a mining operation, such as the processing of mature fine tailings (MFT) in the oil sands mining and separation process, the effectiveness of flocculation chemicals added to a pipe flow of MFT slurry is negatively impacted by (locally) high shear stresses. Flocs are formed by coagulation of particles forming larger aggregates which separate more easily from the carrier fluid. Often it is necessary to add surfactants to overcome repulsive electrostatic forces. Flocs are destroyed by mechanical forces, such as shear forces, breaking the relatively weak induced dipole (Van der Waals) forces.
In complex fluids, such as MFT slurries, the relationship between shear rate and shear stress follows from the generalized Newton equation:
τ = - η ∂ v ∂ r In this equation the shear rate equals the velocity gradient dv/dr, t is the shear stress and n is the viscosity which may be dependent on the shear rate and or time. Four conceptually different types of rheological behaviour may be present, either in isolation or in combination: 1. Dilatant, where the viscosity increases with increasing rate of shear, often called shear thickening. 2. Pseudoplastic, where the viscosity decreases with increasing rate of shear, often called shear thinning. 3. Thixotropic, where the viscosity decreases with time under a constant rate of shear, often called time thinning. 4. Rheopectic, where the viscosity increases with time under a constant rate of shear, often called time thickening.In all cases, however the shear stress is dependent on the velocity profile. In the case of a direct proportionality between shear stress and shear rate the fluid is said to be Newtonian. |
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN">
<HTML>
<HEAD>
<meta http-equiv="content-type" content="text/html; charset=utf-8">
<meta http-equiv="content-style-type" content="text/css">
<link href="pcpdoc.css" rel="stylesheet" type="text/css">
<link href="images/pcp.ico" rel="icon" type="image/ico">
<TITLE>PCP Charts</TITLE>
</HEAD>
<BODY LANG="en-AU" TEXT="#000060" DIR="LTR">
<TABLE WIDTH="100%" BORDER=0 CELLPADDING=0 CELLSPACING=0 STYLE="page-break-before: always">
<TR> <TD WIDTH=64 HEIGHT=64><A HREF="https://pcp.io/"><IMG SRC="images/pmcharticon.png" ALT="pmcharticon" ALIGN=TOP WIDTH=64 HEIGHT=64 BORDER=0></A></TD>
<TD WIDTH=1><P> </P></TD>
<TD WIDTH=500><P ALIGN=LEFT><A HREF="index.html"><FONT COLOR="#cc0000">Home</FONT></A> · <A HREF="lab.pmchart.html"><FONT COLOR="#cc0000">Charts</FONT></A> · <A HREF="timecontrol.html"><FONT COLOR="#cc0000">Time Control</FONT></A></P></TD>
</TR>
</TABLE>
<H1 ALIGN=CENTER STYLE="margin-top: 0.48cm; margin-bottom: 0.32cm"><FONT SIZE=7>Notes for pmchart users</FONT></H1>
<P>Users of the original SGI pmchart utility will be immediately at home with the current pmchart. This page discusses two areas where differences are more likely to be noticed by people familiar with pmchart.
<h2>Configuration file syntax</h2>
<P>pmchart provides the ability to parse and interpret all versions of the original SGI pmchart configuration file language (i.e. versions 1, 1.1, 1.2 and 2.0. In addition, the current pmchart provides it's own configuration file syntax extensions, which both addresses some of the quirkier aspects of the original pmchart language and provides support for features specific to pmchart (Legend Labels and Tabs, for example).
<P>Refer to the discussion of pmchart <A HREF="views.html">Views</A> for a detailed description of the configuration language.
<P>Finally, while pmchart will read all versions of configuration files, it does not implement support for writing the older formats - only the latest format is written during a View save operation.
<H2>User interface changes</H2>
<P>While every effort has been made to keep all of the excellent features of the original user interface, pmchart now provides support for several user interface advances above and beyond those features of the original tool.
<P><BR></P>
<HR>
<CENTER>
<TABLE WIDTH="100%" BORDER=0 CELLPADDING=0 CELLSPACING=0>
<TR> <TD WIDTH="50%"><P>Copyright © 2007-2010 <A HREF="https://www.aconex.com/"><FONT COLOR="#000060">Aconex</FONT></A><BR>Copyright © 2000-2004 <A HREF="https://www.sgi.com/"><FONT COLOR="#000060">Silicon Graphics Inc</FONT></A></P></TD>
<TD WIDTH="50%"><P ALIGN=RIGHT><A HREF="https://pcp.io/"><FONT COLOR="#000060">PCP Site</FONT></A><BR>Copyright © 2012-2018 <A HREF="https://www.redhat.com/"><FONT COLOR="#000060">Red Hat</FONT></A></P></TD> </TR>
</TABLE>
</CENTER>
</BODY>
</HTML>
|
Neil Horwood
Neil Horwood is a footballer who played as a forward in the Football League for Tranmere Rovers.
References
Category:1964 births
Category:Living people
Category:People from Peterhead
Category:Association football forwards
Category:Scottish footballers
Category:King's Lynn F.C. players
Category:Grimsby Town F.C. players
Category:Halifax Town A.F.C. players
Category:Tranmere Rovers F.C. players
Category:Cambridge United F.C. players
Category:Spalding United F.C. players
Category:English Football League players
Category:Sportspeople from Aberdeenshire |
//
// MySQLException.cpp
//
// Library: Data/MySQL
// Package: MySQL
// Module: Connector
//
// Copyright (c) 2008, Applied Informatics Software Engineering GmbH.
// and Contributors.
//
// SPDX-License-Identifier: BSL-1.0
//
#include "Poco/Data/MySQL/Connector.h"
#include "Poco/Data/MySQL/SessionImpl.h"
#include "Poco/Data/SessionFactory.h"
#include "Poco/Exception.h"
#include <mysql.h>
namespace Poco {
namespace Data {
namespace MySQL {
std::string Connector::KEY("mysql");
Connector::Connector()
{
}
Connector::~Connector()
{
}
const std::string& Connector::name() const
{
return KEY;
}
Poco::AutoPtr<Poco::Data::SessionImpl> Connector::createSession(const std::string& connectionString,
std::size_t timeout)
{
return Poco::AutoPtr<Poco::Data::SessionImpl>(new SessionImpl(connectionString, timeout));
}
void Connector::registerConnector()
{
if (mysql_library_init(0, 0, 0) != 0)
{
throw Exception("mysql_library_init error");
}
Poco::Data::SessionFactory::instance().add(new Connector());
}
void Connector::unregisterConnector()
{
Poco::Data::SessionFactory::instance().remove(KEY);
mysql_library_end();
}
} } } // namespace Poco::Data::MySQL
|
Dorsolateral frontal cortex and peripheral muscarinic receptors participation in the discriminative stimulus properties of scopolamine in rats.
Organisms are capable of making decisions based on their ability to discriminate between different stimuli. This principle is fundamental for the adaptation of organisms to their environment, by emitting appropriate behaviors based on a previously acquired discriminative process. The present study analyzed the participation of the peripheral nervous system, the M₁ muscarinic receptor subtype, as well as the contribution of the dorsolateral frontal cortex to discrimination process using scopolamine as discriminative stimulus. Male Wistar rats were trained to discriminate between scopolamine (1.0 mg/kg) and saline injections (i.p.) using a two-lever operant procedure. Once discrimination was acquired, generalization curves for scopolamine, methylscopolamine, pirenzepine, dorsolateral frontal cortex lesion and control conditions were obtained. Results showed that rats were able to discriminate and generalize its responses to different doses of scopolamine but not for methylscopolamine or pirenzepine, thus the data suggest that discriminative properties of scopolamine are processed in CNS and that the M₁ receptor does not participate in this process. Dorsolateral frontal cortex lesion did not produce any statistically significant difference in the generalization curve, which suggests that a system different from the dorsolateral prefrontal cortex may be responsible for the control of stimulus produced by scopolamine. |
//
// NSString+FontAwesome.h
//
// Copyright (c) 2012 Alex Usbergo. All rights reserved.
//
//
// Permission is hereby granted, free of charge, to any person obtaining a copy
// of this software and associated documentation files (the "Software"), to deal
// in the Software without restriction, including without limitation the rights
// to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
// copies of the Software, and to permit persons to whom the Software is
// furnished to do so, subject to the following conditions:
//
// The above copyright notice and this permission notice shall be included in
// all copies or substantial portions of the Software.
//
// THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
// IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
// FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
// AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
// LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
// OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
//
#import <Foundation/Foundation.h>
static NSString *const kFontAwesomeFamilyName = @"FontAwesome";
typedef NS_ENUM(NSInteger, FAIcon) {
FAIconGlass = 0,
FAIconMusic,
FAIconSearch,
FAIconEnvelope,
FAIconHeart,
FAIconStar,
FAIconStarEmpty,
FAIconUser,
FAIconFilm,
FAIconThLarge,
FAIconTh,
FAIconThList,
FAIconOk,
FAIconRemove,
FAIconZoomIn,
FAIconZoomOut,
FAIconOff,
FAIconSignal,
FAIconCog,
FAIconTrash,
FAIconHome,
FAIconFile,
FAIconTime,
FAIconRoad,
FAIconDownloadAlt,
FAIconDownload,
FAIconUpload,
FAIconInbox,
FAIconPlayCircle,
FAIconRepeat,
FAIconRefresh,
FAIconListAlt,
FAIconLock,
FAIconFlag,
FAIconHeadphones,
FAIconVolumeOff,
FAIconVolumeDown,
FAIconVolumeUp,
FAIconQrcode,
FAIconBarcode,
FAIconTag,
FAIconTags,
FAIconBook,
FAIconBookmark,
FAIconPrint,
FAIconCamera,
FAIconFont,
FAIconBold,
FAIconItalic,
FAIconTextHeight,
FAIconTextWidth,
FAIconAlignLeft,
FAIconAlignCenter,
FAIconAlignRight,
FAIconAlignJustify,
FAIconList,
FAIconIndentLeft,
FAIconIndentRight,
FAIconFacetimeVideo,
FAIconPicture,
FAIconPencil,
FAIconMapMarker,
FAIconAdjust,
FAIconTint,
FAIconEdit,
FAIconShare,
FAIconCheck,
FAIconMove,
FAIconStepBackward,
FAIconFastBackward,
FAIconBackward,
FAIconPlay,
FAIconPause,
FAIconStop,
FAIconForward,
FAIconFastForward,
FAIconStepForward,
FAIconEject,
FAIconChevronLeft,
FAIconChevronRight,
FAIconPlusSign,
FAIconMinusSign,
FAIconRemoveSign,
FAIconOkSign,
FAIconQuestionSign,
FAIconInfoSign,
FAIconScreenshot,
FAIconRemoveCircle,
FAIconOkCircle,
FAIconBanCircle,
FAIconArrowLeft,
FAIconArrowRight,
FAIconArrowUp,
FAIconArrowDown,
FAIconShareAlt,
FAIconResizeFull,
FAIconResizeSmall,
FAIconPlus,
FAIconMinus,
FAIconAsterisk,
FAIconExclamationSign,
FAIconGift,
FAIconLeaf,
FAIconFire,
FAIconEyeOpen,
FAIconEyeClose,
FAIconWarningSign,
FAIconPlane,
FAIconCalendar,
FAIconRandom,
FAIconComment,
FAIconMagnet,
FAIconChevronUp,
FAIconChevronDown,
FAIconRetweet,
FAIconShoppingCart,
FAIconFolderClose,
FAIconFolderOpen,
FAIconResizeVertical,
FAIconResizeHorizontal,
FAIconBarChart,
FAIconTwitterSign,
FAIconFacebookSign,
FAIconCameraRetro,
FAIconKey,
FAIconCogs,
FAIconComments,
FAIconThumbsUp,
FAIconThumbsDown,
FAIconStarHalf,
FAIconHeartEmpty,
FAIconSignout,
FAIconLinkedinSign,
FAIconPushpin,
FAIconExternalLink,
FAIconSignin,
FAIconTrophy,
FAIconGithubSign,
FAIconUploadAlt,
FAIconLemon,
FAIconPhone,
FAIconCheckEmpty,
FAIconBookmarkEmpty,
FAIconPhoneSign,
FAIconTwitter,
FAIconFacebook,
FAIconGithub,
FAIconUnlock,
FAIconCreditCard,
FAIconRss,
FAIconHdd,
FAIconBullhorn,
FAIconBell,
FAIconCertificate,
FAIconHandRight,
FAIconHandLeft,
FAIconHandUp,
FAIconHandDown,
FAIconCircleArrowLeft,
FAIconCircleArrowRight,
FAIconCircleArrowUp,
FAIconCircleArrowDown,
FAIconGlobe,
FAIconWrench,
FAIconTasks,
FAIconFilter,
FAIconBriefcase,
FAIconFullscreen,
FAIconGroup,
FAIconLink,
FAIconCloud,
FAIconBeaker,
FAIconCut,
FAIconCopy,
FAIconPaperClip,
FAIconSave,
FAIconSignBlank,
FAIconReorder,
FAIconListUl,
FAIconListOl,
FAIconStrikethrough,
FAIconUnderline,
FAIconTable,
FAIconMagic,
FAIconTruck,
FAIconPinterest,
FAIconPinterestSign,
FAIconGooglePlusSign,
FAIconGooglePlus,
FAIconMoney,
FAIconCaretDown,
FAIconCaretUp,
FAIconCaretLeft,
FAIconCaretRight,
FAIconColumns,
FAIconSort,
FAIconSortDown,
FAIconSortUp,
FAIconEnvelopeAlt,
FAIconLinkedin,
FAIconUndo,
FAIconLegal,
FAIconDashboard,
FAIconCommentAlt,
FAIconCommentsAlt,
FAIconBolt,
FAIconSitemap,
FAIconUmbrella,
FAIconPaste,
FAIconLightbulb,
FAIconExchange,
FAIconCloudDownload,
FAIconCloudUpload,
FAIconUserMd,
FAIconStethoscope,
FAIconSuitcase,
FAIconBellAlt,
FAIconCoffee,
FAIconFood,
FAIconFileAlt,
FAIconBuilding,
FAIconHospital,
FAIconAmbulance,
FAIconMedkit,
FAIconFighterJet,
FAIconBeer,
FAIconHSign,
FAIconPlusSignAlt,
FAIconDoubleAngleLeft,
FAIconDoubleAngleRight,
FAIconDoubleAngleUp,
FAIconDoubleAngleDown,
FAIconAngleLeft,
FAIconAngleRight,
FAIconAngleUp,
FAIconAngleDown,
FAIconDesktop,
FAIconLaptop,
FAIconTablet,
FAIconMobilePhone,
FAIconCircleBlank,
FAIconQuoteLeft,
FAIconQuoteRight,
FAIconSpinner,
FAIconCircle,
FAIconReply,
FAIconFolderCloseAlt,
FAIconFolderOpenAlt,
FAIconExpandAlt,
FAIconCollapseAlt,
FAIconSmile,
FAIconFrown,
FAIconMeh,
FAIconGamepad,
FAIconKeyboard,
FAIconFlagAlt,
FAIconFlagCheckered,
FAIconTerminal,
FAIconCode,
FAIconReplyAll,
FAIconMailReplyAll,
FAIconStarHalfFull,
FAIconStarHalfEmpty,
FAIconLocationArrow,
FAIconCrop,
FAIconCodeFork,
FAIconUnlink,
FAIconQuestion,
FAIconInfo,
FAIconExclamation,
FAIconSuperscript,
FAIconSubscript,
FAIconEraser,
FAIconPuzzlePiece,
FAIconMicrophone,
FAIconMicrophoneOff,
FAIconShield,
FAIconCalendarEmpty,
FAIconFireExtinguisher,
FAIconRocket,
FAIconMaxcdn,
FAIconChevronSignLeft,
FAIconChevronSignRight,
FAIconChevronSignUp,
FAIconChevronSignDown,
FAIconHtml5,
FAIconCss3,
FAIconAnchor,
FAIconUnlockAlt,
FAIconBullseye,
FAIconEllipsisHorizontal,
FAIconEllipsisVertical,
FAIconRssSign,
FAIconPlaySign,
FAIconTicket,
FAIconMinusSignAlt,
FAIconCheckMinus,
FAIconLevelUp,
FAIconLevelDown,
FAIconCheckSign,
FAIconEditSign,
FAIconExternalLinkSign,
FAIconShareSign,
};
@interface NSString (FontAwesome)
/* Returns the correct enum for a font-awesome icon.
* The list of identifiers can be found here:
* http://fortawesome.github.com/Font-Awesome/#all-icons */
+ (FAIcon)fontAwesomeEnumForIconIdentifier:(NSString*)string;
/* Returns the font-awesome character associated to the
* icon enum passed as argument */
+ (NSString*)fontAwesomeIconStringForEnum:(FAIcon)value;
/* Returns the font-awesome character associated to the font-awesome
* identifier.
* http://fortawesome.github.com/Font-Awesome/#all-icons */
+ (NSString*)fontAwesomeIconStringForIconIdentifier:(NSString*)identifier;
@end
|
Energy companies and other businesses that accidentally kill migratory birds will no longer be criminally prosecuted, the Trump administration said Friday in a decision hailed by industry but denounced by environmental groups
The decision, in a legal memo from the U.S. Department of Interior, reverses a longstanding practice at the agency as well as a last-minute rule released by the outgoing Obama administration. It comes after several appeals courts ruled that the government was interpreting a century-old law aimed at protecting birds too broadly.
“Christmas came early for bird killers,” said David O’Neill, chief conservation officer for the National Audubon Society. “The White House is parting ways with more than 100 years of conservation legacy.”
U.S. Bureau of Land Management photo shows a sage grouse in this undated photo. Bob Wick/BLM/Handout/
The administration’s move is the latest of several actions Trump has taken to weaken environmental protections viewed as burdensome to industry, including shrinking the size of two national monuments in Utah and reconsidering protections for the Greater Sage Grouse, a Western bird whose population has dropped precipitously amid threats to its habitat.
In the legal opinion issued late Friday, the Interior Department’s principal deputy solicitor, Daniel Jorjani, said that a 1918 law that officials have used to prosecute those who kill birds “incidentally” as part of doing business was really aimed at preventing poaching and hunting without a licence.
The Migratory Bird Treaty Act “applies only to direct and affirmative purposeful actions that reduce migratory birds, their eggs, or their nests, by killing or capturing, to human control,” Jorjani wrote
His opinion reverses a January effort by outgoing former President Barack Obama to encode the Interior Department’s ability to prosecute those who accidentally kill migratory birds, which never went into effect as it was suspended shortly after Trump came into office.
But it also makes clear that law enforcement officials working for the department are not to attempt to file criminal charges in such cases, which Jorjani said would be a change in the agency’s practices.
Kathleen Sgamma, president of the Western Energy Alliance, said oil and gas companies “protect birds every day” and accused the Obama administration of abusing the law by making companies criminally liable.
“The MBTA was enacted by Congress as a criminal statute to stop the hunting and poaching of migratory birds,” she said in a statement. “It was not meant to address activities that do not directly kill birds.”
But environmentalists predicted the Trump administration’s decision meant no accountability for the deaths of otherwise unprotected birds, from songbirds to falcons.
The Interior Department did not immediately respond to a request for comment form Reuters. |
Raman spectroscopy is an optical spectroscopy technique, which measures the inelastic scattering, i.e. Raman scattering of monochromatic light by a material to produce a spectrum characteristic of the material. Raman spectroscopy has been demonstrated to be a powerful non-invasive analytical technology for material characterization and identification.
Conventional Raman spectroscopy generally utilizes a well-focused laser beam to produce Raman scattering signal from the sample. This approach has the apparent advantage of relatively high efficiency in Raman signal excitation and collection. However, it also suffers from the following drawbacks. First, only a small volume of the sample is measured. Thus the collected Raman spectrum may not be very representative, especially for some non-uniform samples. Second, the tightly focused laser beam may cause damage to some delicate samples. Third, for diffusely scattering samples which are not transparent to the laser beam, this approach will only measure the Raman scattering signal from the surface layer of the sample. The majority of the material underneath the surface will be almost completely out of reach.
There thus exists a need for an improved light delivery and collection device for performing Raman spectroscopy, which not only allows the measurement of a large area of the sample but also enables sub-surface Raman signal excitation and collection. |
Investigation of sexual dimorphisms through mouse models and hormone/hormone-disruptor treatments.
Sexual dimorphism in mouse reproductive tissues is observable in adult, post-natal, and embryonic stages. The development of sexually dimorphic tissues starts with an ambisexual structure. It is followed by sex-specific organogenesis as guided by different signaling pathways that occur from late embryonic stages. The measurement of the anogenital distance (AGD), and the observation of the external genitalia are practical ways to distinguish male and female pups at birth and thereafter. Careful observation of the morphological or histological features and the molecular signatures of the external genitalia and perineum enable identification of sex or feminization/masculinization of embryos. Aberrations in hormone signaling via castration or treatment with hormones or hormone disruptors result in dysmorphogenesis of reproductive tissues. Several hormone disruptors have been used to modulate different aspects of hormone action through competitive inhibition and exogenous hormone treatment. Concomitantly, the vast advancement of conditional mutant mouse analysis leads to the frequent utilization of Cre recombination technology in the study of reproductive/urogenital tissue development. Mouse Cre-lines that are tissue-specific and cell-specific are also effective tools in identifying the molecular mechanisms during sexually dimorphic development. Cre-lines applicable to different cell populations in the prostate, seminal vesicles, testis and ovaries, and mammary glands are currently being utilized. In the external genitalia and perineum, Cre lines that examine the signaling pathways of cells of endodermal, ectodermal, and mesenchymal origin reveal the roles of these tissues in the development of the external genitalia. The interaction of hormones and growth factors can be examined further through a variety of techniques available for researchers. Such cumulative information about various technologies is summarized. |
Q:
Python equivalent of MATLAB's lsqr() with first argument a function
As per title, I am looking for a Python equivalent of MATLAB's lsqr() (possibly in NumPy / SciPy) when the first argument is a function.
Briefly, lsqr solves numerically for x the following problem:
argmin_x || A*x - b ||_2
where x and b are vectors (of potentially different size) and A is a linear operator.
I believe that for numerical input the equivalent is numpy.linalg.lstsq().
The function scipy.optimize.least_squares() can, in principle, be used for solving the argmin problem, but it seems that it uses a different (and much slower) algorithm internally, which seems unsuited for optimization over relatively large inputs.
I believe that lsqr() internally uses A*x and A'*b and does not require an explicit rappresentation of A.
So, is there an equivalent of MATLAB's lsqr (with first argument a function)?
A:
For large and sparse inputs (which would be the use case for lsqr anyway), the Python / SciPy equivalent of MATLAB's lsqr is:
scipy.sparse.linalg.lsqr()
The first argument of this function can be scipy.sparse.linalg.LinearOperator(), which is a proxy for the linear operator where A*x and A'*b (' is the transpose operator) must be provided as the callable corresponding to matvec and rmatvec (respectively).
This can ultimately be used to compute lsqr where A is not known explicitly.
For example:
def Ax(x):
"""Returns A*x"""
...
def Atb(b):
"""Returns A'*b"""
...
A = scipy.sparse.linalg.LinearOperator((m,n), matvec=Ax, rmatvec=Atb)
result = scipy.sparse.linalg.lsqr(A, b)
Note that both MATLAB and Python documentations of lsqr indicate that A'*x (more precisely A^T x in the case of Python, but with the same meaning) is computed, but this is not (and cannot be) correct.
An important difference exists between Python and MATLAB implementations:
MATLAB: the first argument of afun seems to be x, independently of whether afun(x,'notransp') or afun(x,'transp') is called, and b must be obtained differently.
Python: the first argument is either x or b, depending on whether the A.matvec() or A.rmatvec() (respectively) is called.
(This is based on the very informative answer from @AnderBiguri and scipy.sparse.linalg.lsqr() source code).
|
This invention relates to data logging systems, and in particular, to systems for logging or registering items of data related to persons or articles. It is particularly, although not exclusively, adapted for use as a classroom roll-taking system, for recording the presence or absence of pupils or students, their test results and other such data.
Various alternative methods of automating the collection of attendance data in schools have previously been proposed, including systems in which pupils are issued with cards which must be inserted in card readers to record attendance, and systems in which specially prepared forms are completed in the classroom, and subsequently inserted into a "optical mark reader" at a central point, to transfer the information into the schools information system.
Both of these systems have specific weaknesses, and in particular, the card reader system is open to abuse by pupils who give their cards to others to make registrations for them, while the "optical mark reader" system suffers from the inherent deficiency of "paper bound" systems, since it requires the completed forms to be physically transferred from the classroom to the school office, wasting staff time and also, of course, giving rise to pupil supervision problems if the teachers themselves are required to deliver the collected data. |
[The outermost enamel layer. A comparative scanning electron microscopic study].
The surface of the enamel layer was scanned in teeth of some representative animal species. We studied the structural organization of enamel at the surface of the teeth and also in subsurface. The surface layer was often described as "aprismatic". But, nevertheless, in mammals, prisms often reach the surface. They are packed together almost perpendicular to the periphery. The term "aprismatic" seems inappropriate. But the surface layer is particular in both a structural, physical and chemical standpoint. Its distribution on the enamel surfaces explains the variability of the etching patterns from an area to another on the same tooth. |
The little child born in a stable and cradled in a manger was a gift to the world from a Loving Heavenly Father, President Henry B. Eyring, First Counselor in the First Presidency, said at a Christmas devotional on December 5.
“He was the promised Redeemer of the World, the Savior of mankind, the Son of the living God. He was with His Father before He came to earth in mortality, the Creator of the earth upon which we stand.”
Related Links
The First Presidency Christmas Devotional is an opportunity each year for the Church President and his Counselors to bear witness of the Savior and to offer Christmas messages to Church members and others seeking to follow the Lord Jesus Christ. The event is also watched by hundreds of thousands worldwide, thanks to broadcasts on the Church’s satellite system and on stations affiliated with Brigham Young University.
“Many of you will in the Christmas season find ways to give food to people who are hungry,” President Eyring said. “As you do, you bring joy to the Lord. Yet He taught us that there is a way to give an even more priceless and lasting gift. He said, ‘I am the bread of life: he that cometh to me shall never hunger; and he that believeth on me shall never thirst’ (John 6:35).”
President Eyring said the Savior has suggested two things Church members can do that will cause Him to have joy. First, offer Him a broken heart and a contrite spirit, demonstrating faith in Him and belief in His Atonement. “We can repent and make sacred covenants with Him,” President Eyring said. Second, serve others by doing for them what He would do for them. “Many of you have already done that and felt His appreciation,” he added.
President Eyring said that each act of kindness to someone becomes an act of kindness to the Savior, who loves all of His Father’s children. “Because that brings joy to Him, it also brings joy to His Father, to whom we owe thanks beyond measure,” President Eyring said.
Noting that the Savior came to earth in humble circumstances and worked in His earthly father’s carpentry shop, President Eyring said, “In His mortal ministry He walked the dusty roads of Palestine, healed the sick, raised the dead, taught His gospel to people who rejected Him, gave His life on Calvary’s hill, and rose on the third day in what began the Resurrection to break the bands of death for us all.”
Christ paid the price for our sins, President Eyring said, noting that those who have felt the Savior’s peace and healing have hearts filled with gratitude. Those who love them are also affected, he said.
“As Latter-day Saints, we feel our hearts drawn out in gratitude to a loving Father and His Beloved Son. We are thankful to feel that blessing because of the faith of a 14-year-old boy, Joseph Smith,” President Eyring said, noting that Joseph’s prayer on a spring morning in 1820 made possible a sure witness that Heavenly Father and His Son live and love us.
“The gift of that glorious assurance that we are known and loved,” he said, “can sustain us in the trials life will surely bring. We need never feel that we are alone. We need never give up hope.”
President Eyring told about visiting his aunt in a rest home a number of years ago. She was advanced in age, a widow, unable to care for herself. She did not recognize President Eyring or others in the room. But her face showed love and joy, and every few minutes she repeated six words from a well-known hymn: “I know that my Redeemer lives.”
“While the passing years had stripped away from her life so much of what had brought her joy, she retained the supernal gifts we can feel at Christmastime,” President Eyring said. “She remembered her Redeemer. She knew that He lived. She felt His love. And she felt His love for all of Heavenly Father’s children, wherever they were and whatever their circumstances.”
His aunt, he realized, had shared with him the same gift she had received. “She knew the source of the peace she felt. And out of her gratitude and love for the Savior, she wanted us to share in the blessing with her,” he said.
This feeling should be a part of Christmas, President Eyring said. “We feel a spirit of giving and gratitude for what we have been given,” he said. “The celebration of Christmas helps us keep our promise to always remember Him and His gifts to us. And that remembrance creates a desire in us to give gifts to Him.” |
Black Country Living Museum
Address: Tipton Road, Dudley
Postcode: DY1 4SQ
Phone: 0121 557 9643
About the Museum
Historic buildings from all around the Black Country have been moved and authentically rebuilt at the Museum, to create a tribute to the traditional skills and enterprise of the people that once lived in the heart of industrial Britain. Electric tramcars and trolleybuses transport visitors back in time from the modern exhibition halls to the canal-side village, where costumed demonstrators and working craftsmen bring the buildings to life with their local knowledge, practical skills and unique Black Country humour. Our trolley bus collection includes two operational trolley buses made by Sunbeam, Wolverhampton. We also have a selection of Black Country Trolley buses awaiting long term restoration including a rare and early Wolverhampton trolleybus, Number 78, made by Guy Motors in 1931. Trolley buses last ran in Britain in 1972 in Bradford, our trolley bus route is currently the longest in the country.
Search Box
Related Links
Black Country Living Museum 2019 Event Schedule
Date
Event
No events at the moment.
Get in touch
Use the information below to get in touch with the museum before setting off.
Black Country Living Museum Office
Address: Tipton Road, Dudley
Postcode: DY1 4SQ
Phone: 0121 557 9643
URL: www.bclm.co.uk
Business Hours
The Museum is Open throughout the year with reduced hours in winter and welcomes individuals, parties and organised group visits. An admission charge is made. Educational parties are especially welcome with tours specifically designed to suit their requir |
Endgame In Ireland
Ireland is notoriously a turn-off subject for viewers on the mainland, but this illuminating series (by the makers of such monuments of the art as The Death Of Yugoslavia) really should be seen by anyone seeking to make sense of the tortuous phenomenon known as the 'Northern Ireland peace process'.
All the key players and decision makers give first-hand accounts of their involvement: in programme one, Bomb And Ballot Box, they range from Margaret Thatcher and Garret Fitzgerald to loyalist paramilitaries Johnny Adair and Michael Stone, via the endlessly slippery Gerry Adams and Martin McGuin-ness.
Bomb And Ballot Box takes the story as far as the end of Mrs Thatcher's premiership. |
Q:
Encrypt URL to that user cant read that
I have a senerio in what i have to encrypt URL so that user cant read that.
For example i have a url at server side,
http://testserver/admin/read/myvideo.mp3
This url i render in html page so that my javascript can pick it up and pass to my player.
Now the problem is that, any one can see that url from View source of my page.
What i want is to secure that, like i encrypt that at server side before rendering to html and in my java script use the same logic to decrypt it again and send to my player
can any body tell me any engine that works on both side and i dont have to do much work?
EDIT:
I know it will be visible from Fiddler, JS and Fire Bug but not that easy to read as compare to what is right now
A:
Maybe you should consider generating something like one-time urls which get invalid after the first get. That would prohibit sharing that url.
|
1. Introduction {#sec1-nutrients-08-00221}
===============
Ingestion of dietary protein increases muscle protein synthesis rates \[[@B1-nutrients-08-00221],[@B2-nutrients-08-00221],[@B3-nutrients-08-00221],[@B4-nutrients-08-00221],[@B5-nutrients-08-00221]\]. This increase in muscle protein synthesis has been attributed to the post-prandial rise in circulating (essential) amino acid concentrations, with leucine being of particular relevance \[[@B6-nutrients-08-00221],[@B7-nutrients-08-00221],[@B8-nutrients-08-00221],[@B9-nutrients-08-00221]\]. The post-prandial muscle protein synthetic response is regulated on multiple levels, ranging from protein digestion and amino acid absorption \[[@B10-nutrients-08-00221],[@B11-nutrients-08-00221]\], post-prandial insulin release, and the subsequent increase in muscle perfusion \[[@B12-nutrients-08-00221]\], amino acid uptake in muscle \[[@B13-nutrients-08-00221]\], activation of anabolic signaling pathways \[[@B9-nutrients-08-00221],[@B14-nutrients-08-00221],[@B15-nutrients-08-00221]\], and subsequent myofibrillar protein synthesis \[[@B1-nutrients-08-00221],[@B2-nutrients-08-00221],[@B3-nutrients-08-00221],[@B4-nutrients-08-00221],[@B5-nutrients-08-00221]\].
The post-prandial muscle protein synthetic response can be modulated by changing the type \[[@B10-nutrients-08-00221],[@B16-nutrients-08-00221]\], amount \[[@B3-nutrients-08-00221],[@B4-nutrients-08-00221],[@B17-nutrients-08-00221],[@B18-nutrients-08-00221]\], and timing \[[@B19-nutrients-08-00221],[@B20-nutrients-08-00221]\] of protein ingestion. Differences in the anabolic properties of various proteins have been attributed to their specific protein digestion and amino acid absorption kinetics \[[@B21-nutrients-08-00221]\], as well as their amino acid composition \[[@B22-nutrients-08-00221]\]. Previous work from our group \[[@B16-nutrients-08-00221]\] as well as others \[[@B3-nutrients-08-00221],[@B23-nutrients-08-00221],[@B24-nutrients-08-00221],[@B25-nutrients-08-00221],[@B26-nutrients-08-00221],[@B27-nutrients-08-00221],[@B28-nutrients-08-00221],[@B29-nutrients-08-00221]\] has shown that the ingestion of more rapidly digestible protein, such as whey, results in a greater post-prandial rise in circulating amino acid concentrations, thereby further increasing whole body and/or muscle protein synthesis rates when compared with the ingestion of a more slowly digestible protein, such as intact casein. However, whey and casein do not only differ in their protein digestion and absorption kinetics, but also in their amino acid composition, with whey containing more leucine \[[@B11-nutrients-08-00221],[@B24-nutrients-08-00221],[@B27-nutrients-08-00221]\].
To define the impact of dietary protein digestion and absorption kinetics *per se* on post-prandial protein handling, we assessed protein digestion and amino acid absorption together with post-prandial muscle protein synthesis rates following the ingestion of intact micellar casein in comparison with its hydrolyzed form \[[@B10-nutrients-08-00221],[@B16-nutrients-08-00221]\]. Ingestion of the more rapidly digestible casein hydrolysate resulted in a more rapid post-prandial rise in circulating amino acids, greater post-prandial dietary protein-derived amino acid availability, and \~30% higher post-prandial muscle protein synthesis rates when compared to ingestion of intact casein \[[@B10-nutrients-08-00221]\]. These findings confirmed the importance of the rate of digestion and amino acid absorption in stimulating post-prandial muscle protein synthesis rates. These findings sparked research investigating various factors that may modulate post-prandial protein handling, which include the type of protein \[[@B16-nutrients-08-00221],[@B26-nutrients-08-00221],[@B27-nutrients-08-00221]\], the matrix in which the protein is consumed \[[@B30-nutrients-08-00221],[@B31-nutrients-08-00221],[@B32-nutrients-08-00221]\], the macronutrient composition of a protein-rich meal \[[@B33-nutrients-08-00221],[@B34-nutrients-08-00221]\], as well as food preparation \[[@B35-nutrients-08-00221],[@B36-nutrients-08-00221],[@B37-nutrients-08-00221]\] and mastication \[[@B38-nutrients-08-00221]\]. We speculated that protein digestion and absorption might also be modulated by a factor as simple as body position (*i.e.*, sitting upright or lying down). Digestive modulation through changes in body position may be of particular interest since a blunted muscle protein synthesis response to feeding is typically observed in settings where patients are subjected to prolonged supine rest or in the absence of gravity \[[@B39-nutrients-08-00221]\].
In the present study, we tested our hypothesis that changes in body position strongly modulate gastric emptying rate and affect the post-prandial rise in amino acid concentrations *in vivo* in humans. To test this hypothesis, eight young males were selected to participate in this randomized, cross-over study with two treatments. We assessed gastric emptying rate and the post-prandial rise in circulating amino acids following ingestion of a single, meal-like amount of protein while maintaining a conventional, upright seated body position and while laying supine at a −20° head-down tilted position. This study is the first proof-of-principle study to show that gastric emptying rate is reduced and post-prandial plasma amino acid responses are attenuated when food is ingested in a partly inverted *versus* upright body position.
2. Materials and Methods {#sec2-nutrients-08-00221}
========================
2.1. Subjects {#sec2dot1-nutrients-08-00221}
-------------
A total of 8 healthy young males (25 ± 2 years, 23.9 ± 0.8 kg·m^−2^) were recruited to participate in the study. All subjects were instructed to refrain from any exhaustive physical activity and alcohol consumption for two days prior to each trial. Subjects remained fasted from 2200 h in the evening before each test. This study is part of a larger project (Netherlands Trial Register, NTR5027) that was approved by the Medical Ethical Committee of the Maastricht University Medical Centre+, The Netherlands (METC143052) and conformed to standards for the use of human subjects in research as outlined in the seventh revision of the Declaration of Helsinki (Brazil, 2013).
2.2. Experimental Protocol {#sec2dot2-nutrients-08-00221}
--------------------------
This randomized, cross-over study compared the effect of body position on gastric emptying rate and plasma amino acid availability after protein ingestion. In a proof-of-principle approach, we chose to assess potential differences in body position by comparing an upright seated body position with a moderately inverted body position. Therefore, subjects consumed the protein bolus in an upright seated position (control) and in a −20° head-down tilted position (inversion). On the test days, participants reported to the lab in a fasted state and had one Teflon catheter inserted into the antecubital vein of the right arm. A background blood sample was collected, and blood pressure and heart rate were measured before subjects were positioned in either the control or inversion position, completed in a randomized order. For the control treatment, subjects sat in a standardized, stationary chair and were instructed to hold their lower back against the back support of the chair. Subjects were supervised throughout the test day and were constantly reminded to maintain the upright posture. For the inversion treatment, subjects were secured with shoulder and waist straps onto a rotatable bed (Confidence Inversion Table, Confidence Fitness, UK) for the duration of the test. Once secured, the table was tilted to an angle of −20° head-down from a horizontal position, confirmed using an electronic level. Subjects acclimatized to each body position for 30 min after which a baseline blood sample was drawn, and blood pressure and heart rate were measured. Following the baseline blood draw, subjects ingested 60 g of skim milk powder (Campina, The Netherlands---Energy (En): 890 kJ, Protein: 22 g, Carbohydrate: 29 g; Fat: 0.4 g) plus 1.5 g paracetamol (acetaminophen, Kruidvat, Leiden, The Netherlands) dissolved in water up to a volume of 500 mL. Paracetamol was added to the beverage to assess gastric emptying rate. The protein bolus was ingested within a 5-min time period for both treatments. Following ingestion of the drink (*t* = 0 min), blood samples were collected at *t* = 15, 30, 45, 60, 90, 120, 180, 240 min. After the last blood sample was collected, subjects were slowly returned to an upright body position and re-acclimatized throughout a 10-min time period.
2.3. Gastric Emptying {#sec2dot3-nutrients-08-00221}
---------------------
Gastric emptying rate was assessed by measuring the post-prandial rise in plasma paracetamol (acetaminophen) concentrations after ingestion of protein with 1.5 g of paracetamol added \[[@B40-nutrients-08-00221],[@B41-nutrients-08-00221]\]. With paracetamol being rapidly absorbed in the small intestine, gastric emptying forms the rate-limiting step determining the appearance rate of paracetamol in the circulation. Peak plasma paracetamol concentrations are typically reached after 30--60 min following ingestion with a *t*1/2 of \~2 h \[[@B42-nutrients-08-00221]\]. We used plasma paracetamol appearance in the circulation as a marker of gastric emptying rate as applied previously in our laboratory \[[@B42-nutrients-08-00221]\] as well as others \[[@B43-nutrients-08-00221],[@B44-nutrients-08-00221],[@B45-nutrients-08-00221]\].
2.4. Plasma Analysis {#sec2dot4-nutrients-08-00221}
--------------------
Blood samples were collected in tubes containing EDTA and centrifuged at 1000× *g* for 10 min at 4 °C. Aliquots of plasma were frozen in liquid nitrogen and stored at −80 °C until further analyses. Plasma glucose and insulin concentrations were analyzed using commercially available kits (Glucose HK CP, Horiba ABX Diagnostics, France, Ref: AA11A01667, and Human Insulin-specific (RIA), Merck Millipore, Germany, Cat \#: HI-14K, respectively). Plasma (100 µL) for amino acid analyses was deproteinized on ice with 5-sulphosalicylic acid and mixed, and the clear supernatant was collected after centrifugation. Amino acid profiles were determined using ultra-performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) as described previously \[[@B46-nutrients-08-00221]\]. Plasma paracetamol concentrations were analyzed with an acetaminophen assay kit (K991598, Roche, Basel, Switzerland) with the COBAS-Integra 800 immuno-assay analyzer. Briefly, acetaminophen is hydrolyzed to *p*-aminophenol and acetate. The *p*-aminophenol is then converted to an indophenol by enzymatic reaction. The production of indophenol is colorimetrically analyzed and is directly proportional to acetaminophen concentration in plasma.
2.5. Statistics {#sec2dot5-nutrients-08-00221}
---------------
All data are displayed as means + standard error of means (SEM). Time-dependent variables such as plasma glucose, insulin, amino acid, and paracetamol concentrations were analyzed using a two-way repeated measure ANOVA (time × treatment). Upon identification of a significant time × treatment interaction, Bonferroni *post hoc* testing was used to identify time points at which the treatments differed. Differences in treatment-dependent variables, such as area under the curve (AUC), were analyzed using a Student's paired *t*-test. Pearson's *r* product moment correlation was used to examine the linear relationship between plasma essential amino acids (EAAs) and paracetamol AUC for each test. Statistical significance was set at *p* \< 0.05. All calculations were performed using SPSS 21.0 (SPSS Inc., Chicago, IL, USA).
3. Results {#sec3-nutrients-08-00221}
==========
3.1. Plasma Glucose and Insulin Concentrations {#sec3dot1-nutrients-08-00221}
----------------------------------------------
Plasma glucose ([Figure 1](#nutrients-08-00221-f001){ref-type="fig"}A) and insulin ([Figure 1](#nutrients-08-00221-f001){ref-type="fig"}B) concentrations increased following protein ingestion in both treatments (*p* \< 0.05). After reaching peak concentrations, plasma glucose concentrations decreased in both treatments and were significantly lower in the control *vs*. inversion treatment between *t* = 60--240 min (time × treatment interaction, *p* \< 0.05). The increase in insulin was significantly different between the inversion and control treatments (time × treatment interaction, *p* \< 0.05). Peak post-prandial insulin concentrations were reached at *t* = 15 min and were significantly lower in the inversion *vs*. control treatment (27 ± 8 *vs*. 52 ± 13 mU·L^−1^, *p* \< 0.05).
3.2. Plasma Amino Acid Responses {#sec3dot2-nutrients-08-00221}
--------------------------------
Plasma leucine ([Figure 2](#nutrients-08-00221-f002){ref-type="fig"}A) and EAA ([Figure 2](#nutrients-08-00221-f002){ref-type="fig"}B) concentrations increased following protein ingestion in both treatments (*p* \< 0.01). Plasma leucine and total EAA concentrations showed an attenuated rise in the inversion compared with the control treatment, with concentrations being significantly lower in the inversion treatment between *t* = 15--120 min (*p* \< 0.05). Overall leucine and EAA availability, expressed as AUC calculated over 240 min, were lower in the inversion compared with control treatment (*p* \< 0.05). No significant differences were observed in post-prandial non-essential amino acid (NEAA) availability ([Figure 2](#nutrients-08-00221-f002){ref-type="fig"}C) between treatments (main effect for time, *p* \< 0.05; time × treatment interaction, *p* \> 0.05).
3.3. Gastric Emptying {#sec3dot3-nutrients-08-00221}
---------------------
Plasma paracetamol ([Figure 3](#nutrients-08-00221-f003){ref-type="fig"}) concentrations increased following protein ingestion in both treatments (*p* \< 0.05). An attenuated post-prandial rise in paracetamol concentrations was observed in the inversion compared with control treatment (time × treatment, *p* \< 0.05). Peak paracetamol concentrations reached 10.0 ± 0.6 mg·L^−1^ at *t* = 90 min in the control treatment and 5.8 ± 1.1 mg·L^−1^ at *t* = 120 min (*p* \< 0.05) in the inversion treatment. Gastric emptying rate during the early post-prandial phase, assessed by paracetamol AUC from *t* = 0--60 min was 54% ± 13% lower in the inversion compared with control treatment (132 ± 37 *vs*. 344 ± 47 AU (arbitrary units); *p* \< 0.05). When assessed over the entire 240-min post-prandial period, paracetamol AUC was 38% ± 13% lower in the inversion compared with control treatment (1054 ± 196 *vs*. 1693 ± 101 AU; *p* \< 0.05).
Pearson's *r* product moment correlation was performed between plasma EAAs and paracetamol AUCs over the 240-min post-prandial period ([Figure 4](#nutrients-08-00221-f004){ref-type="fig"}). A significant positive (*r* = 0.68; *p* \< 0.01) correlation was detected between plasma EAAs and paracetamol AUCs.
4. Discussion {#sec4-nutrients-08-00221}
=============
In the present study, we observed that gastric emptying rates were reduced when protein was ingested in an inverted *versus* upright seated position. The post-prandial rise in circulating amino acid concentrations was attenuated following protein ingestion in the head-down tilted position along with substantially lower post-prandial amino acid availability when compared to feeding in the upright seated position.
It has been well established that the post-prandial rise in plasma EAA concentrations following food ingestion increases muscle protein synthesis rates \[[@B6-nutrients-08-00221],[@B7-nutrients-08-00221],[@B8-nutrients-08-00221],[@B47-nutrients-08-00221]\]. In the present study, we observed a rapid rise in plasma glucose and insulin ([Figure 1](#nutrients-08-00221-f001){ref-type="fig"}) and EAA ([Figure 2](#nutrients-08-00221-f002){ref-type="fig"}) concentrations following ingestion of a single, meal-like amount of protein when sitting in a normal, upright position. Total EAA concentrations increased rapidly, reaching peak levels of 1408 ± 80 umol·L^−1^ within 30 min after ingesting 22 g of milk protein. In line, plasma leucine concentrations rapidly reached peak levels of 236 ± 15 umol·L^−1^ within the same post-prandial time frame ([Figure 2](#nutrients-08-00221-f002){ref-type="fig"}A). The level of increase in plasma EAA concentrations, and leucine in particular, observed in the control treatment have been previously shown to result in post-prandial muscle protein synthesis rates that were 30%--100% higher when compared to basal, post-absorptive muscle protein synthesis rates \[[@B3-nutrients-08-00221],[@B4-nutrients-08-00221],[@B5-nutrients-08-00221],[@B30-nutrients-08-00221],[@B33-nutrients-08-00221],[@B48-nutrients-08-00221]\].
When the same bolus of protein was ingested in an inverted body position, the post-prandial rises in plasma insulin ([Figure 1](#nutrients-08-00221-f001){ref-type="fig"}B), EAA ([Figure 2](#nutrients-08-00221-f002){ref-type="fig"}B), and leucine ([Figure 2](#nutrients-08-00221-f002){ref-type="fig"}A) concentrations were substantially reduced. Peak plasma EAAs, and leucine in particular, reached levels of 1112 ± 70 and 177 ± 15 umol·L^−1^, respectively, which were substantially lower when compared to levels observed after ingesting protein in an upright seated position (*p* \< 0.05). The extent of the difference in the post-prandial rise in amino acid concentrations following ingestion of a meal-like amount of protein in an inverted *versus* a normal, upright seated position was beyond our expectations. The blunted post-prandial rise in plasma EAA concentrations, and leucine concentrations in particular, observed in the inversion treatment would unlikely suffice to induce a measurable increase in post-prandial muscle protein synthesis rates as shown in previous work \[[@B4-nutrients-08-00221],[@B18-nutrients-08-00221]\].
Besides the blunted post-prandial rise in amino acid concentrations following feeding in the inverted *versus* upright seated position, we also observed lower plasma EAA and leucine availability over the 4-h post-prandial period ([Figure 2](#nutrients-08-00221-f002){ref-type="fig"}). These findings are in line with Koopman *et al*., who showed that ingestion of a single 35 g bolus of intact, micellar casein resulted in less protein-derived amino acids being released into the circulation when compared with the ingestion of the same amount of hydrolyzed casein \[[@B10-nutrients-08-00221]\]. The reduction in protein-derived amino acid release could be attributed to reduced gastric emptying rates and/or greater splanchnic amino acid retention following ingestion of a more slowly digested protein. In the present study, we assessed gastric emptying rates by measuring the increase in plasma paracetamol concentrations following the co-ingestion of 1.5 g paracetamol \[[@B40-nutrients-08-00221],[@B41-nutrients-08-00221],[@B42-nutrients-08-00221],[@B49-nutrients-08-00221]\]. Peak plasma paracetamol concentration was substantially lower (5.8 *vs*. 10.0 mg·L^−1^) and was reached 30 min later when protein was ingested in the inverted compared with the upright seated position ([Figure 3](#nutrients-08-00221-f003){ref-type="fig"}). The attenuated rise in plasma paracetamol concentrations following protein ingestion implies that gastric emptying rates were substantially reduced in the inverted *versus* upright seated position. Furthermore, we found that the overall appearance of plasma paracetamol was positively correlated with the overall plasma EAA availability ([Figure 4](#nutrients-08-00221-f004){ref-type="fig"}). The reduction in gastric emptying rate demonstrated in the inverted position may be partly explained by recently published work using computer modeling techniques to demonstrate that the movement of stomach content is slowed in a supine position due to a lower amount of stomach content gathering near the pylorus \[[@B50-nutrients-08-00221]\]. Therefore, we conclude that the attenuated post-prandial rise in plasma amino acid concentrations following ingestion of protein in an inverted compared with an upright seated position can, at least partly, be attributed to a reduction in gastric emptying rate.
The present findings may be of relevance in various settings of disuse atrophy. Disuse atrophy has been partly attributed to a reduced sensitivity of the muscle protein synthetic response to the post-prandial rise in plasma amino acid concentrations, and leucine concentrations in particular \[[@B51-nutrients-08-00221],[@B52-nutrients-08-00221]\]. Feeding hospitalized patients in a supine as opposed to a normal upright sitting position may attenuate the post-prandial rise in plasma amino acid concentrations, contributing to anabolic resistance in these patients. Proper upright body positioning may be an important pre-requisite to increase the post-prandial rise in plasma amino acid availability, thereby increasing the post-prandial muscle protein synthetic response to meal ingestion. In other words, our mothers may have been right in more than one way by telling us to sit up straight at the dinner table. Lastly, the present findings imply that part of the muscle lost by astronauts due to microgravity \[[@B53-nutrients-08-00221],[@B54-nutrients-08-00221]\] may also be explained by reduced protein digestion and amino acid absorption, thereby attenuating the post-prandial rise in plasma amino acid concentrations and lowering the post-prandial muscle protein synthetic response to food intake.
5. Conclusions {#sec5-nutrients-08-00221}
==============
Changes in body position substantially modulate gastric emptying rate and the subsequent post-prandial rise in plasma amino acid availability. Therefore, an upright body position during and after feeding is important for adequate nutrient absorption and should be considered when aiming to optimize post-prandial muscle protein accretion in both health and disease.
We would like to acknowledge the enthusiastic support of the subjects who volunteered to participate in this experiment.
A.M.H., K.L., and L.J.C.L. designed the research; A.M.H. conducted the research; A.M.H., K.L., J.B., and L.J.C.L. analyzed the data; A.M.H. performed the statistical analysis; and A.M.H. and L.J.C.L. wrote the paper and hold primary responsibility for the final content. All authors read and approved the final manuscript.
The authors declare no conflict of interest.
The following abbreviations are used in this manuscript: AUArbitrary unitAUCArea under the curveEAAEssential amino acidNEAANon-essential amino acidSEMStandard error of the mean
{#nutrients-08-00221-f001}
{#nutrients-08-00221-f002}
{#nutrients-08-00221-f003}
{#nutrients-08-00221-f004}
|
Inverse agonism: the classic concept of GPCRs revisited [Review].
In the classical two-state model, G protein-coupled receptors (GPCRs) are considered to exist in equilibrium between an active and an inactive conformation. Thus, even at the resting state, some subpopulation of GPCRs is in the active state, which underlies the basal activity of the GPCRs. In this review, we discuss inverse agonists, which are defined as GPCR ligands that shift the equilibrium toward the inactive state and thereby suppress the basal activity. Theoretically, if constitutive activation plays an essential role in the pathogenesis of a disease, only inverse agonists, and not neutral antagonists, can reverse this pathophysiological activation. Although many pharmacological examples of inverse agonism have been identified, its clinical importance is still unclear and debated. Thus, even though inverse agonism of angiotensin receptor blockers (ARBs) has been discussed for more than 10 years, its clinical relevance remains to be completely clarified. |
The IRS will allow people who are diagnosed by a physician as being obese to deduct the costs of the services in this program. The revenue ruling, IR 2002-19, approves the fees related to services (i.e. medical services and nutrition education meetings) when they are occurring for medically valid reasons. A person must be under the guidance of a physician in order to qualify. The ruling does not cover the cost for foods or Meal Replacements, which people would have to pay for regardless of their weight. Click here for further information concerning Medical Weight Loss Tax Deduction Information.
A: The patented UltraShape technology uses a handheld ultrasonic transducer to deliver controlled focused ultrasound at a precise depth within the fat layer. The technology is selective, meaning that only fat cells are broken down and surrounding important structures such as blood vessels nerves and connective tissue remain intact. The treatment area is marked and each point within that designated area is treated only once to ensure complete and uniform treatment.
How much weight will I lose? : it really does depend on how much weight you have to lose in the first place and how well you stick with the programme. I have seen 3-4 kg lost in the first two phases (2 weeks and 2 days) through to a staggering 10kg. For most people the first two phases sees the most dramatic loss in weight after which point is does slow down a bit. One lady on the plan at the moment has lost 7kg and she is a couple of weeks into phase 3 (more relaxed phase where one weekly treat meal is allowed) and is half way to her total weight loss goal.
Gastric Sleeve Gastric Band Surgery for Diabetes Mini Gastric Bypass. The London Weight Clinic offers a comprehensive multidisciplinary weight loss programme which includes lifestyle, medical and surgical options for weight loss and is run by a team of dedicated and highly trained professionals. Source: National Institute of Health and Care Excellence. We encourage our clients to share their experiences of The London Weight Clinic, view a few testimonials below. This reputation is built on a commitment to clinical professionalism and a devotion to excellent patient care. Provide you with nutrition advice and a diet plan. During your initial free meeting your consultant will. Get in touch today for a free no-obligation weight loss consultation with a qualified NHS doctor. Gastric Bypass Orbera Gastric Balloon Obalon Gastric Balloon Non Surgical Options. At the London Weight Clinic we aim to offer you a number of weight loss options suited to your personal needs, both surgical and non surgical. When choosing a surgeon, personal recommendation is as important as reputation, experience and qualifications.
For some reason I have been getting lots of interest lately in the Metabolic Balance weight loss programme. These spikes of interest are usually down to some type of celebrity endorsement. Sam Smith and Boy George have both helped to raise the profile of the programme in the past. I am not sure quite sure who is behind it this time around, but I will put money on it some high profile person has attributed their dramatic weight loss to the Metabolic Balance.
The Medi-Weightloss® Program is not a diet; it's a lifestyle change. Get off the dieting roller coaster and rejuvenate your life, learning to live healthy and lean for a lifetime through a three-phase, physician-supervised weight loss program that works. In each location, patients receive a VIP experience from caring, experienced healthcare professionals and an abundance of hands-on support, education, and accountability. Our trained professionals help make your weight loss journey stress free and uncomplicated. It's true. Come see for yourself.
• If you are a patient of the practice you have the right to withdraw consent for important notifications, newsletters, surveys or marketing. You can inform us to correct errors in your personal details or withdraw consent from communication methods such as telephone, email or text. You have the right to obtain a free copy of your patient records within one month.
Among the services on offer are hair extensions, dermabrasion, microneedling, microblading and body hair bleaching, all of which are carefully administered by a team of highly trained specialists. Don’t hesitate to ask if you need advice or a second opinion about your treatment, as the staff here are always more than happy to help. We also offer free customer parking on site. |
Q:
Can't find weston.ini on Ubuntu 17.10 to turn on Numlock
From my basic understanding Ubuntu 17.10 now uses Wayland instead of Xorg, even though it is still possible to switch between the two.
I want to have my numlock key ON when I enter Ubuntu. I read people usually install numlockx to enable it, but it seems that it only works on Xorg.
I also read that in the Weston implementation of Wayland there is a config file where I can turn on the numlock key by defaul. Documentation here.
But I can't seem to find this weston.ini config file on my Ubuntu 17.10. Does ubuntu not use Weston? Is there a way for me to achieve this numlock behavior without having to switch GDM to Xorg?
A:
Ubuntu does use Wayland as the default (on GPUs which it can work on). However, Wayland is simply a protocol definition. Weston is one implementation of the protocol, but it is not the implementation used by default in Ubuntu. The implementation used in Ubuntu, is the GNOME shell itself.
|
{% extends '@WebProfiler/Profiler/layout.html.twig' %}
{% block toolbar %}
{% set profiler_markup_version = profiler_markup_version|default(1) %}
{% if profiler_markup_version == 1 %}
{% set icon %}
<img width="20" height="28" alt="Redis" src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAABQAAAAcCAYAAABh2p9gAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAv5JREFUeNrsVd9L01EUP9/tbm5ubtI2VqAOYpJP0WCYNOilQAiySbICHyp67CXqrf8jqKeejAVJ9GAUmUEMfYjSl5IYexqM1G3Mn1O3uT6fy+4QMV/yoQe/cLi7557zOZ/zOder1Ww25Tg/mxzzdwL4HwKqZDJ51Pkpy7JGtre3r9dqtbMul2vB4XBM4qp9gr962JVTBx0IcsIS+HkL64jP5zuTSqWkXq9LPp+/MDs7e1cp9QuAk4h5iZgfhwIioB8sxvb29m673e7z2Eu1WpVwOCwDAwMSi8VkZmZGcrmcFIvFc7u7u09sNttjgH8B6CvYW8AUrdHR0SvYPETA1Wg06hofH5dQKMQCUqlUZGJiQhYXFyWRSMj8/Lxsbm7KxsZG27q7u3W80+ksAeepWltbe9TZ2XmNLDs6OiQQCEhvb6/Y7Xa2r1uFhjI3Nycej0dQWPtZEJoKutGxOzs7ARRIWWjlPdCHASoQXAd4vV4N1NPTI0NDQxKJRHSR6elpSafTgjbboCxApltbW9JoNL4qv9//HVoNsz1WIksGoIgUCgXJZrPS19cny8vLMjU1pWOQqPUlCJi12fIWKLQRwSR1WwTiykACMolAmUxGF+LeALEDMu3q6tJSsDvkDqqlpaUg26ST4mLSWngmQV/BJDU4pq/P2Cr36EzLQ3aMLZfLZGtXSMgRgMZAApMxE8iGftMWWZIR2yPD9fV1fW7YImdBBYNBDydsWLESmXFINJxrzfi1psl7qKUhaxYhAbJFXL8qlUqnmcjKPDCsWJ3WElsDmiFQBiMTAenjUFHEr4D6e3V1VQ+EiYYV2yCwGQS1o/C8yIwhKP0rKyvmbjbhe8c/vQf48Rn7+wC4BBY2JjKJjM0NMBqyTRYnGIvCX4K9gT0D1jcrHo/vf8oGcXAP4DeQGKZmbI1mWjZsEfcTrhd8IGCF9puwD9A8ElxCSLqJ9Q7Wi3S3jhs4/4D1OewjrHrwtfoboLTeOjvsMmwMVoO9hmWOekCtk//L//z9EWAADA/Sh+MqnZ4AAAAASUVORK5CYII="/>
<span class="sf-toolbar-status">{{ collector.commandcount }}</span>
{% endset %}
{% set text %}
<div class="sf-toolbar-info-piece">
<b>Queries</b>
<span class="sf-toolbar-status">{{ collector.commandcount }}</span>
</div>
<div class="sf-toolbar-info-piece">
<b>Query time</b>
<span>{{ '%0.2f'|format(collector.time) }} ms</span>
</div>
{% if collector.erroredCommandsCount > 0 %}
<div class="sf-toolbar-info-piece">
<b>Failed Queries</b>
<span class="sf-toolbar-status sf-toolbar-status-red">{{ collector.erroredCommandsCount }}</span>
</div>
{% endif %}
{% endset %}
{% include '@WebProfiler/Profiler/toolbar_item.html.twig' with { 'link': profiler_url, status: collector.erroredCommandsCount > 0 ? 'red' : '' } %}
{% elseif collector.commandcount > 0 %}
{% set icon %}
{{ include('@SncRedis/Collector/icon.svg.twig') }}
<span class="sf-toolbar-value">{{ collector.commandCount }}</span>
<span class="sf-toolbar-info-piece-additional-detail">
<span class="sf-toolbar-label">in</span>
<span class="sf-toolbar-value">{{ '%0.2f'|format(collector.time) }}</span>
<span class="sf-toolbar-label">ms</span>
</span>
{% endset %}
{% set text %}
<div class="sf-toolbar-info-piece">
<b>Queries</b>
<span class="sf-toolbar-status">{{ collector.commandcount }}</span>
</div>
<div class="sf-toolbar-info-piece">
<b>Query time</b>
<span>{{ '%0.2f'|format(collector.time) }} ms</span>
</div>
{% if collector.erroredCommandsCount > 0 %}
<div class="sf-toolbar-info-piece">
<b>Failed Queries</b>
<span class="sf-toolbar-status sf-toolbar-status-red">{{ collector.erroredCommandsCount }}</span>
</div>
{% endif %}
{% endset %}
{% include '@WebProfiler/Profiler/toolbar_item.html.twig' with { 'link': profiler_url, status: collector.erroredCommandsCount > 0 ? 'red' : '' } %}
{% endif %}
{% endblock %}
{% block menu %}
{% set profiler_markup_version = profiler_markup_version|default(1) %}
{% if profiler_markup_version == 1 %}
<span class="label">
<span class="icon">
<img width="32" height="28" src="data:image/png;base64, iVBORw0KGgoAAAANSUhEUgAAACAAAAAcCAYAAAAAwr0iAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAABZ5JREFUeNqUl11InmUYx69XH79e5+ecSkIMGW4TZmNIw2BzB9kHRCoFYyxYrU4KrM7WzqLTHS3qxGAQjgLrJFhBsR1sFnNDMKKTtrVZOhQ/8Fs3ddr/d/NcL8/eXOYNf+7n/ri+/vd1fzyp9vZ2S6VStrGxYdsoNevr642Se0VoVvuu5H/S9y/6/psJ6KRsptftUUfbMJorHBaOSfB4aWlp09TUlK2srKDoaFlZ2ZuPHj0a1fhXwvfCb8LUlkr37duX8fYJ5WnhuHBG+Fh4+eHDhzV79uyxkydPWkVFhbW2tlpeXp4NDw+X5OTkPKc5J4QW6X0qdmIymwGv/4uBo6LptOpnhf1J4cbGRuvs7LSWlhZra2sLfZcvX7bbt2/b7Oys5ebm5kv2WMzWO/q+ru9vhB+E1ScxkCPsEk5pfc+vra19EEXRYUW2S3WI0B0oLCy05eVlGxkZsYaGBpucnLQ7d+6EcbFjCwsLmW+VCrHSJLwaM1MpHX+pXlK9DgNpgUR6TXhL3pZgrKmpyZqbm2337t3BqBTY3Nyc3bx50wYGBuzKlSsmJ624uNhu3LgR+nCUPpwjN3BkaWnJysvLTTmTLigo2J+fn/+J7HwkXJLeT1MdHR3v6eNzRR0MIXzgwAE7d+7cE9emp6fHent7g1MYRRbDbtAd5nt6ejpkPKzV1tZaVVVVZgesrq5ez62urn5bk5tR5BQrm8OkdDodvPciAbt69ar19fUZOwDD0Ey0yGDE9dBmPu2amppgfMeOHcExnJ2fn4fR4dShQ4fOa9L7oifQiRImUBDCAc9ajI2NjYVxlNbV1YU5Bw8etPHxcevu7n7MOMXzB8OeHw8ePPDxftzNQwC6GGAyjuDQ6Oio3b9/P7CBwM6dO62rq8v27t1rlZWVZHuGnbNnzwbDGKIf+IGDXjdMO8a6xidz6+vry9Vgy6WhFJAHTEYBDoGioqJgoL+/3+7duxcM0AetFy5csGvXrmWMAlhCx8zMTEhe2m6ceWJ6WXrPRKJyWNHPaXIVAvHJFhxBOJ4cgEHag4ODwRG2IAlLXiDDGDqA74Tk0ctywCx6lF9FYqszEjUnRHk9CYcA68RyULsji4uLQSE0IuyRDw0N2a1bt0Kywg6RelKGg0XLgTyGfVkB/XIyJb3PRNomqxhAIYqh251xw04dyskF+lGkPR0MsNUY893jy8A4eqlxgj5PRPRKdiWSQARlDDDJHXFvWTsYQYBvN+KJ6zeeG2YZMFhSUhKWzVnEBo5nJeJGpME/pWNWKMMA0UAlLKAAZVw4OskyjPi+d+OerDhMAMj5zkkuqV/NcT6san5vJOV/qGPFWfB9jBMI4gCMoJSoWEvmJROWOZ6oFMbcqOeDG8ZR5inADektjdQ4Ik924a2vu29BqPPzASPADys/sJx2CnNZ3yRDXjwQzzM5k69d9no0MTGRhm6oo2ZC8lx3zz0a+pxqlLphHHea/V7xpfF88F2BbqCgF8mBFA0UMIkIfd31yslkLAx5AjoryedWMhExmkxEjCLP+Y8d2vH5UMhRvORKPNv9sKDGCRTRzzgsoMyjTL77nGaYRNZ3CrLxtkuuChfOdzjwBXeGlJySwkpPIr8XUOTMoBiaAZH4peUXGQ741uVl5ImNYehPlK+Fi7yQUjw64tIovCh8GL8DHzu7/ZIC8V3+r3H6fMlwIsvwjNArfCkMCsthGRIOeCkVnpeRd3kPykCpU+wZ74eVZz9Uw4ivr+dCTPNQHDF3Na/mx7bHZg4kX65HhDfiB2ZDMuGIjKj9eE0YtTivfuXxJHyb/SpOlq3+C/pi1AvtwgvCS367+YWVcHhRda/GLpFg2dFuGugWDGT/3ZQIrQJ/RKfVnxf3z6l9UW2o/nk7v1jb+TOizPOaFX4UPhOa4mT6nd+z/xNxdvlHgAEAHIoINM0o2rsAAAAASUVORK5CYII=" alt="Redis" />
</span>
<strong>Redis</strong>
<span class="count">
<span>{{ collector.commandcount }}</span>
<span>{{ '%0.0f'|format(collector.time) }} ms</span>
</span>
</span>
{% else %}
<span class="label label-status-{{ collector.erroredCommandsCount > 0 ? 'error' : '' }} {{ collector.commandcount == 0 ? 'disabled' }}">
<span class="icon">{{ include('@SncRedis/Collector/icon.svg.twig', {colors: {light: '#DDD', dark: '#999'}}) }}</span>
<strong>Redis</strong>
{% if collector.erroredCommandsCount > 0 %}
<span class="count">
<span>{{ collector.erroredCommandsCount }}</span>
</span>
{% endif %}
</span>
{% endif %}
{% endblock %}
{% block panel %}
{% set profiler_markup_version = profiler_markup_version|default(1) %}
<h2>Commands</h2>
{% if collector.commandcount == 0 %}
<div class="empty">
<p{% if profiler_markup_version == 1 %} style="font-style:italic;"{% endif %}>No commands were executed or the logger is disabled.</p>
</div>
{% else %}
<div class="metrics">
<div class="metric">
<span class="value">{{ collector.commandcount }}</span>
<span class="label">Queries</span>
</div>
<div class="metric">
<span class="value">{{ '%0.2f'|format(collector.time) }} <span class="unit">ms</span></span>
<span class="label">Query time</span>
</div>
<div class="metric highlight">
<span class="value{% if collector.erroredCommandsCount > 0 %} error{% endif %}">{{ collector.erroredCommandsCount }}</span>
<span class="label">Failed Queries</span>
</div>
</div>
<table class="alt">
<thead>
<tr>
<th class="nowrap">#</th>
<th class="nowrap">Time</th>
<th class="nowrap">Connection</th>
<th style="width:100%">Command</th>
</thead>
<tbody>
{% for command in collector.commands %}
<tr {{ command.error ? 'class="status-error"' }}>
<td>{{ loop.index }}</td>
<td class="nowrap">{{ '%0.2f'|format(command.executionMS) }} ms</td>
<td class="font-normal">{{ command.conn }}</td>
<td>
{{ command.cmd }}
{% if command.error %}
<br><strong class="font-normal">An error occured: {{ command.error }}</strong>
{% endif %}
</td>
</tr>
{% endfor %}
</tbody>
</table>
{% endif %}
{% endblock %}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.