text stringlengths 8 5.77M |
|---|
---
abstract: 'We investigate the structure of a simple class of affine toric Calabi-Yau varieties that are defined from quiver representations based on finite eulerian directed graphs (digraphs). The vanishing first Chern class of these varieties just follows from the characterisation of eulerian digraphs as being connected with all vertices balanced. Some structure theory is used to show how any eulerian digraph can be generated by iterating combinations of just a few canonical graph-theoretic moves. We describe the effect of each of these moves on the lattice polytopes which encode the toric Calabi-Yau varieties and illustrate the construction in several examples. We comment on physical applications of the construction in the context of moduli spaces for superconformal gauged linear sigma models.'
address: 'School of Mathematics and Maxwell Institute for Mathematical Sciences, University of Edinburgh, Scotland, UK'
author:
- Paul de Medeiros
bibliography:
- 'CYQuiversGLSM.bib'
title: 'Eulerian digraphs and toric Calabi-Yau varieties'
---
=1
Introduction and motivation {#sec:introduction}
===========================
Supersymmetric quantum field theories in four dimensions often undergo renormalisation group flow to interesting non-trivial fixed points in the infrared which exhibit an enhanced superconformal symmetry. Indeed the study of superconformal field theories in general continues to provide a great deal of progress in modern theoretical physics with superconformal symmetry typically allowing exact calculations of many interesting physical quantities like anomalous dimensions of chiral operators. An important structure in any such theory is the chiral ring of supersymmetric ground states. Classically the chiral ring corresponds to the coordinate ring of an algebraic variety whose points correspond to gauge-invariant monomials in the matter fields of the theory which solve the D- and F-term equations. To understand this structure, it is often convenient to begin by looking at the classical moduli space of gauge-inequivalent superconformal vacua in the theory before considering quantum corrections and conducting a more exact analysis of the full phase structure of the theory.
When realised as the low-energy description for D3-branes in IIB string theory, many details of the strongly coupled superconformal field theory can also be inferred from the geometry of the holographically dual supergravity background. Indeed, for D3-brane configurations probing a toric conical singularity, this represents by far the most exhaustively studied and best understood class of AdS/CFT dualities [@Malda; @KlebanovWitten; @AdSCFTReview]. Near the toric singularity, the transverse space to the D3-branes corresponds to an affine toric Calabi-Yau three-fold and the data for the singularity encodes both the superpotential and the gauge-matter couplings for the dual superconformal field theory in terms of a quiver representation of the gauge symmetry group [@Douglas:1996sw; @Douglas:1997de; @Beasley:1999uz; @Feng:2000mi; @Feng:2001xr]. For a single D3-brane, the gauge group is abelian and holography identifies a particular branch of the superconformal vacuum moduli space of the field theory with the aforementioned affine toric Calabi-Yau three-fold in the dual geometry. For multiple coincident D3-branes, the gauge group is nonabelian and the moduli space has a much more complicated structure but typically corresponds to the symmetric product of multiple copies of this geometry. Thus it is often more convenient to begin by considering the aforementioned branch in the moduli space of the abelian theory and systematic analyses have been undertaken in [@Forcella:2008bb; @Forcella:2008ng] in terms of both the forward algorithm developed in [@Feng:2000mi; @Feng:2001xr] and subsequent techniques involving dimer models and brane tilings [@Hanany:2005ve; @Franco:2005rj; @Feng:2005gw; @Franco:2006gc; @Franco:2005sm; @Hanany:2005ss]. It is precisely the cancellation of gauge anomalies at one-loop in the superconformal field theory that, in the context of the abelian theory, ensures the first Chern class vanishes for the relevant branch of the moduli space that is to be identified with the dual geometry. In this context, the anomaly cancellation condition is that the quiver representation must be based on a digraph with all vertices balanced (i.e. at each vertex, there must be an equal number of incoming and outgoing arrows). Whence, at least for connected quivers describing gauge-matter couplings for indecomposable superconformal field theories, this is tantamount to the associated digraph being eulerian (i.e. it must contain a circuit traversing each arrow exactly once). The correspondence between superconformal field theories and Calabi-Yau geometries here is certainly not one-to-one in the sense that non-anomalous theories based on different quiver representations can realise the same toric Calabi-Yau moduli spaces – this is the phenomenon of toric duality, corresponding to Seiberg duality in the associated superconformal field theory [@Beasley:1999uz; @Feng:2000mi; @Feng:2001xr; @Beasley:2001zp].
Superconformal gauged linear sigma models can provide a convenient physical description of affine toric Calabi-Yau varieties in arbitrary dimensions, following the construction in [@WittenGLSM]. It is perhaps most natural to think of a gauged linear sigma model as arising from the dimensional reduction of a supersymmetric field theory in four dimensions involving $n$ vector superfields and $e$ chiral matter superfields with integer charges $Q_{ia}$ under an abelian gauge group, where $i=1,...,n$ and $a=1,...,e$. The additional data needed to specify the classical theory in four dimensions consists of a choice of $n$ real numbers $t_i$ (corresponding to the Fayet-Iliopoulos parameters modifying the D-terms for each $U(1)$ factor in the gauge group) and a gauge-invariant holomorphic function ${\mathfrak{W}}$ of the matter fields $X_a$ (corresponding to the F-term superpotential). Quantum consistency of the reduced theory in two dimensions is less restrictive than in four dimensions and superconformal invariance of the gauged linear sigma model is guaranteed provided the charges obey $\sum_{a=1}^e Q_{ia} =0$ (e.g. it ensures the R-symmetry of the conformal superalgebra in two dimensions is non-anomalous). The Higgs branch of the space of classical supersymmetric vacua is defined by those constant matter fields which solve both the D- and F-term equations. The D-term equations are $\sum_{a=1}^e Q_{ia} |X_a |^2 = t_i$ and solutions of the F-term equations correspond to critical points of ${\mathfrak{W}}$. Whence the moduli space of gauge-inequivalent solutions of the D-term equations describes a Kähler quotient of ${\mathbb{C}}^e$ whose first Chern class vanishes precisely as a consequence of $\sum_{a=1}^e Q_{ia} =0$.
Although any choice of integral charges $Q_{ia}$ obeying $\sum_{a=1}^e Q_{ia} =0$ defines a consistent superconformal gauged linear sigma model, a natural class of solutions is obtained by taking the charges to be associated with a quiver representation based on any eulerian digraph with $n$ vertices and $e$ arrows. From this perspective, the simple class of affine toric Calabi-Yau varieties whose structure we shall investigate in this paper can be described physically as Higgs branches of gauge-inequivalent D-term solutions for superconformal gauged linear sigma models with matter field charges encoded by eulerian digraph quiver representations and with all the Fayet-Iliopoulos parameters set to zero. The motivation for this restriction is that it will allow us to take advantage of some structural results for the class of eulerian digraphs in order to understand the geometrical structure of the associated toric Calabi-Yau varieties in more detail. In particular, we will show how to generate arbitrary eulerian digraphs by iterating combinations of elementary graph-theoretic moves and determine the effect of each these moves on the associated toric Calabi-Yau varieties, or rather on the convex polytopes which encode them.
The Calabi-Yau geometries we will consider can also be thought of as Higgs branches of gauge-inequivalent D-term solutions for the non-anomalous superconformal abelian quiver gauge theories in four dimensions that were discussed in the second paragraph above. Of course, typically the existence of a non-trivial superpotential in that context means that it is only from the full space of gauge-inequivalent solutions to both the D- and F-term equations that one recovers the toric Calabi-Yau three-fold for the dual geometry. Indeed the strategy in the forward algorithm [@Feng:2000mi; @Feng:2001xr] is to use the constraints imposed on the superpotential by the toric Calabi-Yau dual geometry to recast the associated F-term equations obeyed by its critical points in the form of D-term equations. Thereby one can recover the relevant branch of the toric Calabi-Yau three-fold moduli space in terms of the Higgs branch of gauge-inequivalent D-term solutions in a certain auxiliary gauged linear sigma model. It is auxiliary’ in the sense that its matter content will typically differ markedly from that in the original superconformal field theory in four dimensions and the charges need not be associated with a quiver representation. It is worth remarking that this is a highly non-trivial procedure and the constraints on the superpotential are not guaranteed to be compatible with the quiver representation based on any eulerian digraph – the admissible ones are characterised more naturally in terms of the dimer models and brane tilings of [@Hanany:2005ve; @Franco:2005rj; @Feng:2005gw; @Franco:2006gc; @Franco:2005sm; @Hanany:2005ss], whose classification has been initiated in [@Davey:2009bp]. Furthermore, for any such admissible quiver representation with $n$ vertices, the results of [@Forcella:2008bb; @Forcella:2008ng] indicate that the so-called master space’ of gauge-inequivalent F-term solutions should itself also contain a branch of maximal dimension describing an affine toric Calabi-Yau variety of dimension $n+2$. Again, the auxiliary gauged linear sigma model description of this branch of the master space need not have charges associated with the quiver representation for an eulerian digraph though our construction would also apply to instances where this is the case.
The organisation of this paper is as follows. We begin in Section \[sec:graphtheory\] with a basic review of graph theory, noting some essential concepts and setting up a consistent notation for the rest of the paper. Section \[sec:generatingeuleriandigraphs\] describes the technique that will be used to generate an arbitrary finite eulerian digraph from some combination of four particular graph-theoretic moves discussed in Section \[sec:digraphs\]. Section \[sec:toricquivers\] begins by defining the quiver representation of an abelian lie group in terms of a finite digraph before describing how this data can be used to define a strongly convex rational polyhedral cone encoding an affine toric variety. The refinement of this construction is then described for an eulerian digraph which is used to define a convex rational polytope encoding an affine toric Calabi-Yau variety. Finally, we derive the effect of each of the four moves on the aforementioned polytopes before concluding with several examples.
Some graph theory {#sec:graphtheory}
=================
This section contains a brief review of a few basic graph theoretical concepts and results that will be useful in our forthcoming analysis. A more comprehensive introduction to this material can be found in any graph theory textbook such as [@BonMur; @BJGut; @Diestel].
Graphs {#sec:graphs}
------
A [*graph*]{} $G=(V,E)$ consists of a set of [*vertices*]{} $V$ and a set of [*edges*]{} $E$. To each edge in $E$ one must also assign a pair of vertices in $V$ that it connects. An edge connecting a vertex to itself is called a [*loop*]{}. The [*degree*]{} ${\mathrm{deg}}(v)$ of a vertex $v \in V$ is the number of edges in $E$ that end on $v$ (with each loop attached to $v$ counting twice in ${\mathrm{deg}}(v)$). If $E$ contains $e$ edges then clearly $\sum_{v \in V} {\mathrm{deg}}(v) = 2e$, whence the number of vertices with odd degree is always even (this is the so-called handshaking lemma). A graph is called $k$[*-regular*]{} if ${\mathrm{deg}}(v) = k$ for all $v \in V$. Thus $kn =2e$ for a $k$-regular graph with $n$ vertices and $e$ edges. The [*cycle graph*]{} $C_n$ with $n$ vertices is defined such that its edges form the sides of an $n$-sided polygon, whence it is $2$-regular. The [*complete graph*]{} $K_n$ with $n$ vertices is defined such that each pair of distinct vertices in it are connected by a single edge, whence it is $(n-1)$-regular.
An edge is called [*simple*]{} if it is the only one which connects the pair of vertices assigned to it. A graph is then said to be simple if it contains only simple edges (if loops are included here then a simple graph must be loopless). A [*walk*]{} in $G$ consists of a sequence of vertices in $V$ such that each pair of consecutive vertices in the sequence are connected by an edge in $E$. A walk with no repeated vertices is called a [*path*]{} and a closed path is called a [*cycle*]{}. A walk with no repeated edges is called a [*trail*]{} and a closed trail is called a [*circuit*]{}. A pair of vertices in $V$ are said to be [*connected*]{} if there exists a path between them in $G$. A graph is connected if all its vertices are connected. A path (cycle) is called [*hamiltonian*]{} if it contains every vertex in $V$ exactly once and a graph is called hamiltonian if it admits a hamiltonian cycle. A trail (circuit) is called [*eulerian*]{} if it traverses every edge in $E$ exactly once and a graph is called eulerian if it admits an eulerian circuit. There appears to be no simple characterisation of hamiltonian graphs though a number of sufficiency theorems have been established which all rely on assuming one has more than some critical number of edges in the graph. By contrast, for any graph $G$, the following statements are equivalent:
- [*$G$ is eulerian.*]{}
- [*$G$ is connected and contains no vertices of odd degree.*]{}
- [*$G$ is connected and its edge set can be partitioned into subsets which define edge-disjoint cycle graphs on the vertices of $G$.*]{}
The equivalence of the first two statements is Euler’s theorem. A corollary of the third statement is that any eulerian graph with $n$ vertices and $e$ edges can be obtained by identifying precisely $e-n$ appropriately chosen vertices in the cycle graph $C_e$. The statements above imply that a connected $k$-regular graph is eulerian when $k$ is even (e.g. every connected $2$-regular graph is a cycle graph). The construction of an eulerian circuit in a given eulerian graph can easily be accomplished using Fleury’s algorithm. Moreover, the BEST theorem (named after de Bruijn, van Aardenne-Ehrenfest, Smith and Tutte) provides an efficient (i.e. computable in polynomial time) algorithm for computing the number of distinct eulerian circuits in a given eulerian graph.
The [*contraction*]{} of an edge $a \in E$ which connects a pair of distinct vertices $v,w \in V$ in a graph $G$ is defined by first removing $a$ from $E$ (producing the intermediate graph, written $G-a$) and then identifying the vertices $v$ and $w$ to create the new graph, written $G/a$. (Notice that this will create at least one loop at the identified vertex $v=w$ in $G/a$ unless $a$ is simple.) The [*subdivision*]{} of an edge $a \in E$ connecting vertices $v,w \in V$ in $G$ is defined by adding a new vertex $x$ and two new edges $b$ and $c$ to the graph $G-a$ such that $b$ connects $v$ to $x$ and $c$ connects $x$ to $w$, whence $x$ has degree $2$ in the subdivided graph while the degrees of $v$ and $w$ remain the same as they were in $G$. This can also be thought of as placing an extra vertex on the edge $a$ in between vertices $v$ and $w$. (Notice that the definition of subdivision also applies to loops when $v=w$.) The reverse operation of removing a degree $2$ vertex from a graph (i.e. contracting an edge connected to a degree $2$ vertex) is called [*smoothing*]{} and we will call a graph [*smooth*]{} if it contains no vertices with degree $2$. These operations are depicted in Figure \[fig1\].
![Contraction and subdivision of an edge.[]{data-label="fig1"}](contraction.pdf "fig:") ![Contraction and subdivision of an edge.[]{data-label="fig1"}](subdivision.pdf "fig:")
Two graphs are defined to be [*homeomorphic*]{} if they can both be obtained from subdivisions of the same graph (i.e. the operation of subdivision does not modify the topology of a graph). A graph $H$ is a [*subgraph*]{} of $G$ if its vertex set is a subset of $V$ and its edge set is a subset of $E$ with edges restricted to end on elements in the vertex set of $H$. A graph $H$ is called a [*minor*]{} of $G$ if it can be obtained by contracting some number of edges in some subgraph of $G$. The notion of graph minor is pivotal in a number of fundamental structure theorems in graph theory. Perhaps the most important being the Robertson-Seymour theorem which states that, in any infinite set of graphs, at least one graph is a (proper) minor of any other. Moreover, any infinite class of graphs that is closed under the operation of taking graph minors can be characterised by a finite set of forbidden minor graphs called the [*obstruction set*]{} of the class. For example, Wagner’s theorem states that the class of planar graphs (i.e. graphs which can be drawn in the plane without any edges crossing) is characterised by an obstruction set consisting of just two elements; the complete graph $K_5$ on five vertices and the complete bipartite graph $K_{3,3}$ on six vertices. Any graph $G$ that is not planar can be drawn without any edges crossing on some closed Riemann surface $\Sigma$ of sufficiently high genus (i.e. the number of unavoidable edge crossings for $G$ drawn in the plane is equal to the minimum number of handles which must be added to the sphere to produce $\Sigma$). The obstruction set for the class of non-planar graphs which can be drawn without edge crossings on the torus is still not known but it must contain more than 16,000 elements!
Digraphs {#sec:digraphs}
--------
An [*orientation*]{} on a graph is defined by making each edge into an [*arrow*]{} connecting the same pair of vertices but now with a specified direction pointing from one vertex to the other (a loop based at a vertex in the graph being made into an arrow pointing from the base vertex to itself). A graph $G$ equipped with an orientation is called a [*directed graph*]{} or [*digraph*]{}, written $\vec{G}$. For example, a digraph obtained by equipping the complete graph $K_n$ with an orientation is called a [*tournament*]{}. Many of the concepts and results described above for unoriented graphs can be extended in an obvious way for digraphs. We shall therefore limit our consideration to only those properties which do not translate easily or are refined in a particular way for digraphs.
One such refinement is that the degree of any vertex $v$ in a digraph can be written ${\mathrm{deg}}(v) = {\mathrm{deg}}^+(v) + {\mathrm{deg}}^-(v)$, where ${\mathrm{deg}}^\pm (v)$ denote the number of arrows pointing from/to $v$ and are respectively referred to as the [*out-/in-degree*]{} of $v$ (with each loop arrow based at $v$ in the digraph contributing one to both ${\mathrm{deg}}^+(v)$ and ${\mathrm{deg}}^-(v)$). From this definition, it is straightforward to check that $\sum_{v \in V} {\mathrm{deg}}^+(v) = \sum_{v \in V} {\mathrm{deg}}^-(v) = e$ for any digraph with $e$ arrows. A digraph is said to be [*balanced*]{} if ${\mathrm{deg}}^+(v) = {\mathrm{deg}}^-(v)$ for all $v \in V$. A balanced digraph $\vec{G}$ will be called $k$-regular if ${\mathrm{deg}}^+(v) = k$ for all vertices $v$ (this means that the underlying unoriented graph $G$ is $2k$-regular). Thus $kn =e$ for a $k$-regular balanced digraph with $n$ vertices and $e$ arrows.
We define an arrow in a digraph $\vec{G}$ to be [*undirected simple*]{} if the corresponding undirected edge in $G$ is simple. An arrow in $\vec{G}$ pointing from one vertex $v$ to another vertex $w$ is called [*simple*]{} if it is the only one pointing from $v$ to $w$ (i.e. the arrow is simple even if there is another arrow pointing from $w$ to $v$). Thus any undirected simple arrow must be simple but the converse need not be true. A digraph is then said to be (undirected) simple if it contains only (undirected) simple edges. Thus not every simple digraph is obtained by defining an orientation on a simple graph. A digraph is called [*symmetric*]{} if, for every arrow pointing from a vertex $v$ to a vertex $w$, there is another arrow pointing from $w$ to $v$. Hence there is a bijective correspondence between symmetric digraphs and graphs, the bijection being the replacement of each pair of oppositely oriented arrows in the symmetric digraph with an unoriented edge in the graph.
All the different kinds of walks that were defined in a graph $G$ generalise in the obvious way to directed walks in a digraph $\vec{G}$ (i.e. one can only proceed in directions defined by the orientation of the arrows). A digraph $\vec{G}$ is called [*weakly connected*]{} if its underlying undirected graph $G$ is connected. A digraph $\vec{G}$ is called [*strongly connected*]{} if it contains a directed path from $v$ to $w$ and a directed path from $w$ to $v$ for all pairs of vertices $(v,w)$. Just as in the undirected case, hamiltonian digraphs are difficult to characterise and eulerian digraphs have a much more straightforward characterisation. That is, for any digraph $\vec{G}$ the following statements are equivalent:
- [*$\vec{G}$ is eulerian.*]{}
- [*$\vec{G}$ is weakly connected and balanced (which implies it is also strongly connected).*]{}
- [*$\vec{G}$ is strongly connected and its arrow set can be partitioned into arrow-disjoint directed cycles on the vertices of $\vec{G}$.*]{}
It is perhaps worth emphasising that not every strongly connected digraph is eulerian even though every eulerian digraph is strongly connected. Similar to the undirected case, a corollary of the third statement above is that any eulerian digraph with $n$ vertices and $e$ arrows can be obtained by identifying precisely $e-n$ appropriately chosen vertices in the directed cycle graph $\vec{C}_e$. Note that the cycle digraph is eulerian with the in-degree and out-degree for each of its vertices equal to one (it is the only possible type of $1$-regular eulerian digraph). Clearly the aforementioned identification of vertices in the cycle digraph will produce a new eulerian digraph, with each new identification adding one to both the in- and out-degree of the identified vertex. Both Fleury’s algorithm and the BEST theorem can still be used for constructing and counting directed eulerian circuits in eulerian digraphs.
Evidently the characterisation of eulerian digraphs is a refinement of the characterisation of eulerian graphs due to the additional data provided by the orientation. If $\vec{G}$ is an eulerian digraph then $G$ must be an eulerian graph but clearly the opposite implication follows only provided one chooses an orientation on $G$ such that all its vertices are balanced (i.e. not just of even degree). Moreover, there are typically a number of different balanced orientations that it is possible to equip a given eulerian graph with, leading to a number of distinct eulerian digraphs based on the same underlying eulerian graph. The problem of finding a balanced orientation on an arbitrary eulerian graph, a so-called [*eulerian orientation*]{}, can be solved efficiently (e.g. for any eulerian circuit on the graph, the order of the traversed edges around the circuit defines an eulerian orientation on the graph). However, the problem of counting the number of distinct eulerian orientations on an arbitrary eulerian graph is difficult (and has been proven to be NP-complete [@MikWin1; @MikWin2]). Even the problem of counting the number of (edge-labelled) eulerian orientations on a $4$-regular graph is in the same complexity class as the general problem though, in this special case, the number can also be realised in terms of a graph invariant called the Tutte polynomial and as the partition function of a statistical mechanical ice-type’ model [@Welsh].
The contraction and subdivision of an arrow in a digraph are shown in Figure \[fig2\] which defines the orientation assignments for these operations relative to Figure \[fig1\].
![Contraction and subdivision of an arrow.[]{data-label="fig2"}](contraction2.pdf "fig:") ![Contraction and subdivision of an arrow.[]{data-label="fig2"}](subdivision2.pdf "fig:")
Performing either of these operations on any arrow in an eulerian digraph will produce a new digraph that must also be eulerian. The only modification of vertex degrees are such that ${\mathrm{deg}}^+(v) + {\mathrm{deg}}^+(w) -1 = {\mathrm{deg}}^+(v=w)$ for contraction and ${\mathrm{deg}}^+(x)=1$ for subdivision. Only the contraction of an undirected simple arrow will not create a loop in the new digraph while subdivision of an arrow can never create a loop. (Subdivision of a loop based at vertex $v$ creates a $\vec{C}_2$ traversing $v$ and the new vertex $x$.) Contracting an arrow can never create a subdivision. Thus contraction of (unoriented simple) arrows is an operation within the class of (loopless) smooth eulerian digraphs and subdivision of arrows is an operation within the class of loopless eulerian digraphs. It is worth remarking that, if the initial digraph $\vec{G}$ has $n$ vertices and $e$ arrows, then contraction/subdivision of an arrow reduces/increases both of these parameters by one in the new digraph so that their difference is left invariant by both these operations.
Although the concept of a graph minor can be applied to digraphs, it turns out that this is not such a useful containment relation in the directed case. That is, it is not possible to use this relation to prove a version of the Robertson-Seymour structure theorem for digraphs. In [@Johnson], Johnson proved a structure theorem of this kind for the class of eulerian digraphs using a different containment relation that is more natural in this context and which we will now define. Take any eulerian digraph $\vec{G}$ that contains some positive number of vertices with out-degree $2$. Select one such vertex $v$ in $\vec{G}$ and label its two incoming and outgoing arrows $(a,b)$ and $(c,d)$. The [*splitting*]{} of vertex $v$ is defined by first deleting $v$ and then connecting the head of $a$ to the tail of either $c$ or $d$ (forming a new arrow $ac$ or $ad$) and the head of $b$ to the tail of either $d$ or $c$ (forming a new arrow $bd$ or $bc$). The two possible outcomes of this operation are shown in Figure \[fig3\].
![Splitting an out-degree $2$ vertex.[]{data-label="fig3"}](splitting.pdf)
The two possible digraphs that can result from splitting $v$ need not be isomorphic but are clearly both eulerian. The choice of which arrows to pair up fixes the eulerian digraph that results from the splitting. The splitting of an out-degree $2$ vertex in a smooth eulerian digraph can never create a subdivision. It is worth noting that, if the initial eulerian digraph has $n$ vertices and $e$ arrows, then splitting reduces $n$ by one and $e$ by two, thus reducing $e-n$ by one. An eulerian digraph $\vec{H}$ is said to be [*immersed*]{} in an eulerian digraph $\vec{G}$ if $\vec{H}$ can be obtained by applying some number of times to $\vec{G}$ the operations of smoothing, splitting and removing loops. This is the aforementioned containment relation in terms of which Johnson’s structure theorem for eulerian digraphs is established.
Generating eulerian digraphs {#sec:generatingeuleriandigraphs}
============================
In this section we will show how the graph-theoretic operations that were defined in the previous section can be used to systematically generate any eulerian digraph. The strategy will be described below.
Adding loops and subdivisions {#sec:loopandsubdiv}
-----------------------------
Consider first the set of eulerian digraphs $\vec{\mathfrak G}$ and identify any two elements in $\vec{\mathfrak G}$ if they differ only by either the addition of a loop or the subdivision of an arrow (which may be a loop). Within each equivalence class of eulerian digraphs in the set $\vec{\mathfrak F}$ that results from this identification, there is a unique loopless smooth eulerian digraph that can be used to represent the class. The other elements in the class being obtained from all the different possible ways of adding loops and subdividing arrows (including added loops) in the loopless smooth eulerian digraph representative. Starting from a representative loopless smooth eulerian digraph $\vec{G}$ with $n$ vertices and $e$ arrows, the most general element in the same class that can be obtained from only adding loops is specified by an $n$-tuple of non-negative integers denoting the number of loops to be added at each vertex. Likewise the most general element in the same class that can be obtained only from subdivisions of $\vec{G}$ is specified by an $e$-tuple of non-negative integers denoting the number of subdivisions to be performed on each arrow. Combining and iterating these operations will generate every element in the same class as $\vec{G}$. Of course, depending on the symmetry of $\vec{G}$, different choices of positive integers specifying such operations can give rise to the same eulerian digraph within the class of $\vec{G}$.
Loopless smooth eulerian digraphs {#sec:lsedig}
---------------------------------
Let us now examine the structure of $\vec{\mathfrak F}$. By definition, any loopless smooth eulerian digraph $\vec{G} $ representing a class in $\vec{\mathfrak F}$ must contain no subdivisions so that ${\mathrm{deg}}^+(v) >1$ for every vertex $v$ in $\vec{G}$. Consequently the formula $\sum_{v \in V} {\mathrm{deg}}^+(v) = e$ implies that $e \geq 2n$ with $e=2n$ occurring only if $\vec{G}$ is $2$-regular. Let us denote by $\vec{{\mathfrak F}_2} \subset \vec{\mathfrak F}$ the set of all $2$-regular loopless smooth eulerian digraphs and by $\vec{{\mathfrak G}_2} \subset \vec{\mathfrak G}$ the set of all $2$-regular eulerian digraphs. Clearly any element in $\vec{{\mathfrak G}_2}$ must be smooth and there cannot be more than two loops based at any of its vertices. The only possibility of having two loops based at any one vertex is if that is the only vertex in the eulerian digraph. Thus, the only other elements in $\vec{{\mathfrak G}_2}$ that are not in $\vec{{\mathfrak F}_2}$ must contain a single loop on some number of their vertices. Moreover, the removal of any one of these single loops must result in a balanced vertex with out-degree $1$ which is therefore the subdivision of some arrow (which could be a loop). Continuing this procedure of removing a single loop followed by smoothing the resulting subdivision must therefore eventually produce either an element in $\vec{{\mathfrak F}_2}$ or the digraph consisting of two loops based at a single vertex. Conversely, the combined operation of subdividing an arrow (which may be a loop) and adding a loop to the new vertex can therefore be iterated on elements in $\vec{{\mathfrak F}_2}$ and the two loop digraph to obtain any element in $\vec{{\mathfrak G}_2}$.
For each set of eulerian digraphs above, let us define a family of subsets with each member of the family labelled by a superscript $[t]$ and comprising all the elements in the corresponding set which have the same value of $e-n=:t$. As already noted, subdividing or contracting an arrow in a digraph does not change the value of $t$ and so these operations can only map between different elements in the same subset $\vec{\mathfrak G}^{[t]}$. Since any element in $\vec{\mathfrak F}$ has $e \geq 2n$ and $n >1$ then elements in $\vec{\mathfrak F}^{[t]}$ must have $2 \leq n \leq t$ vertices and $e=n+t$ arrows. The elements in $\vec{\mathfrak F}^{[t]}$ with the maximum number of vertices $n=t$ are precisely the $2$-regular ones comprising $\vec{\mathfrak F}_2^{[t]}$. The sets $\vec{\mathfrak F}_2^{[2]}$, $\vec{\mathfrak F}_2^{[3]}$ and $\vec{\mathfrak F}_2^{[4]}$ are shown in Figure \[fig4\]. When $t$ is even, there is a single element in $\vec{\mathfrak F}^{[t]}$ with the minimum number of vertices $n=2$ and it is $(\tfrac{t}{2} + 1)$-regular. When $t$ is odd, there are no elements with $n=2$ and $n=3$ is the minimum number of vertices which can be realised for more than one inequivalent eulerian digraph.
------------------------------------------------------------------------------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------------
![Elements in $\vec{\mathfrak F}_2^{[t]}$ are drawn in row $t-1$ for $t=2,3,4$.[]{data-label="fig4"}](4regular2.pdf "fig:")
![Elements in $\vec{\mathfrak F}_2^{[t]}$ are drawn in row $t-1$ for $t=2,3,4$.[]{data-label="fig4"}](4regular3a.pdf "fig:") ![Elements in $\vec{\mathfrak F}_2^{[t]}$ are drawn in row $t-1$ for $t=2,3,4$.[]{data-label="fig4"}](4regular3b.pdf "fig:")
![Elements in $\vec{\mathfrak F}_2^{[t]}$ are drawn in row $t-1$ for $t=2,3,4$.[]{data-label="fig4"}](4regular4a.pdf "fig:") ![Elements in $\vec{\mathfrak F}_2^{[t]}$ are drawn in row $t-1$ for $t=2,3,4$.[]{data-label="fig4"}](4regular4b.pdf "fig:") ![Elements in $\vec{\mathfrak F}_2^{[t]}$ are drawn in row $t-1$ for $t=2,3,4$.[]{data-label="fig4"}](4regular4c.pdf "fig:") ![Elements in $\vec{\mathfrak F}_2^{[t]}$ are drawn in row $t-1$ for $t=2,3,4$.[]{data-label="fig4"}](4regular4d.pdf "fig:") ![Elements in $\vec{\mathfrak F}_2^{[t]}$ are drawn in row $t-1$ for $t=2,3,4$.[]{data-label="fig4"}](4regular4e.pdf "fig:")
------------------------------------------------------------------------------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------------
### Contracting undirected simple arrows {#sec:conusa}
Contracting an arrow of some element in $\vec{\mathfrak F}^{[t]}$ will produce an element in $\vec{\mathfrak G}^{[t]}$. This new element is guaranteed to be smooth since contraction can never create a subdivision in a smooth eulerian digraph. However, the new element is also loopless, and hence in $\vec{\mathfrak F}^{[t]}$, only if the the contracted arrow was undirected simple. Thus one can always map from any element in $\vec{\mathfrak F}^{[t]}$ with at least one undirected simple arrow to another element in $\vec{\mathfrak F}^{[t]}$ (with one less vertex and one less arrow) by contracting an undirected simple arrow.
As we have seen, elements in $\vec{\mathfrak F}_2^{[t]}$ contain the maximum number of vertices and arrows of all the elements in $\vec{\mathfrak F}^{[t]}$. The only obstruction to being able to obtain by contraction an element in $\vec{\mathfrak F}^{[t]}$ with $t-1$ vertices from an element in $\vec{\mathfrak F}_2^{[t]}$ would be if the latter had no undirected simple arrows. For each value of $t$, there are only two possible elements in $\vec{\mathfrak F}_2^{[t]}$ that could cause such an obstruction which are depicted in Figure \[fig5\]. They can be thought of as the union of two copies of the cycle digraph $\vec{C}_t$ with the same or opposite orientations around the same $t$ vertices (the two orientations being isomorphic only for $t=2$).
![The two obstructing elements in $\vec{\mathfrak F}_2^{[t]}$ are necklace’ digraphs.[]{data-label="fig5"}](obstruct3.pdf "fig:")\
\[.2in\] ![The two obstructing elements in $\vec{\mathfrak F}_2^{[t]}$ are necklace’ digraphs.[]{data-label="fig5"}](obstruct2.pdf "fig:")
The element in $\vec{\mathfrak F}^{[t]}$ with $t-1$ vertices obtained by contracting an undirected simple arrow in any element in $\vec{\mathfrak F}_2^{[t]}$ (other than one of the two in Figure \[fig5\]) will have $t-2$ vertices with out-degree $2$ and one vertex with out-degree $3$ (i.e. the one which formed the endpoints of the contracted arrow). Indeed this must be the case for every element in $\vec{\mathfrak F}^{[t]}$ with $t-1$ vertices. That is, for any element $\vec{G}$ in $\vec{\mathfrak F}^{[t]}$ with vertex set $V$, a more convenient form of the hand-shaking lemma is $\sum_{v \in V} k(v) = t$, where $k(v) := {\mathrm{deg}}^+(v) -1$ is a positive integer for every vertex $v \in V$ as a consequence of $\vec{G}$ being smooth. Thus, when $|V|=t-1$, the only solution is when one vertex has out-degree $3$ with all the rest having out-degree $2$. It is also useful to note that the relation ${\mathrm{deg}}^+(v) + {\mathrm{deg}}^+(w) -1 = {\mathrm{deg}}^+(v=w)$ between the out-degrees of the vertices $v$ and $w$ which are identified under the contraction of an arrow connecting them can be more conveniently rewritten as $k(v) + k(w) = k(v=w)$. Now, for any element in $\vec{\mathfrak F}^{[t]}$ with $t-1$ vertices, it is possible to write $k(x)=2=1+1$ for the single out-degree $3$ vertex $x$ which means that this element can be obtained by the contraction of an undirected simple arrow in (at least) one element in $\vec{\mathfrak F}_2^{[t]}$. The element in $\vec{\mathfrak F}_2^{[t]}$ is constructed by simply partitioning the six arrow endpoints on $x$ into two sets of three; one set consisting of two outgoing and one incoming arrow endpoints and the other set consisting of one outgoing and two incoming arrow endpoints. Deleting $x$ and having the two sets of endpoints on two new vertices $v$ and $w$ then produces the element in $\vec{\mathfrak F}_2^{[t]}$ after adding a single new arrow $a$ connecting $v$ and $w$ whose orientation is fixed by requiring $v$ and $w$ to be balanced. The element in $\vec{\mathfrak F}^{[t]}$ with $t-1$ vertices is then recovered by contracting $a$. Clearly there are a number of distinct options for partitioning the arrow endpoints in this way leading to a number of different elements in $\vec{\mathfrak F}_2^{[t]}$ from which the same element in $\vec{\mathfrak F}^{[t]}$ with $t-1$ vertices can be obtained via the contraction of an undirected simple arrow. Nonetheless, the point is to have established that every element in $\vec{\mathfrak F}^{[t]}$ with $t-1$ vertices can be obtained by contracting an undirected simple arrow in some element in $\vec{\mathfrak F}_2^{[t]}$.
It is straightforward to extend this argument to show that in fact every element in $\vec{\mathfrak F}^{[t]}$ with fewer than $t$ vertices can be obtained from some element in $\vec{\mathfrak F}_2^{[t]}$ (other than one of the two in Figure \[fig5\]) by performing some sequence of contractions of unoriented simple arrows. The number of vertices in the resulting element being precisely $t$ minus the number of contractions performed. The trick is to again start with any element in $\vec{\mathfrak F}^{[t]}$ with fewer than $t$ vertices and pick some vertex $x$ with $k(x) >1$. (Such a vertex must exist or else the element would necessarily have $t$ vertices.) Next write $k(x) = p+q$ in terms of positive integers $p$ and $q$ and partition the $2(k(x)+1)$ arrow endpoints on $x$ into two sets; one set consisting of $p+1$ outgoing and $p$ incoming endpoints and the other set consisting of $q$ outgoing and $q+1$ incoming endpoints. Delete $x$ and reattach the two sets of endpoints on two new vertices $v$ and $w$ and connect these two vertices with a single appropriately oriented arrow $a$ such that they are both balanced (the out-degrees of the two new balanced vertices being $p+1$ and $q+1$). This construction therefore produces a new element in $\vec{\mathfrak F}^{[t]}$ with one extra vertex and one extra edge and at least one undirected simple arrow $a$ whose contraction gives back the original element. Again, for a given choice of positive integers $p$ and $q$, there will generally be a number of inequivalent partitions possible for the arrow endpoints leading to a number of different new elements for which the contraction of an undirected simple arrow will give back the same element we started with. This procedure can be iterated for all the different vertices $x$ with $k(x)>1$ of a given element in $\vec{\mathfrak F}^{[t]}$ until eventually one must stop when an element in $\vec{\mathfrak F}_2^{[t]}$ is obtained, thus establishing the result claimed above. Another way of stating this result is to say that every element in $\vec{\mathfrak F}^{[t]}$ is a minor of some element in $\vec{\mathfrak F}_2^{[t]}$. It is important to stress that this is not a manifestation of the Robertson-Seymour structure theorem for the finite class $\vec{\mathfrak F}^{[t]}$ since not every element in $\vec{\mathfrak F}^{[t]}$ has a (proper) minor that is also contained in $\vec{\mathfrak F}^{[t]}$. Indeed the elements in $\vec{\mathfrak F}^{[t]}$ which do not are precisely those loopless smooth eulerian digraphs with no undirected simple arrows.
### Loopless splitting of $2$-regular vertices {#sec:split2regvert}
The preceding analysis implies that $\vec{\mathfrak G}$ can be generated by applying to each set $\vec{\mathfrak F}_2^{[t]}$ (and the trivial graph with one vertex and no arrows) all possible combinations of the three operations of loop addition, subdivision and contraction of undirected simple arrows. The fourth and final operation that will be required involves the splitting of a vertex in an element in $\vec{\mathfrak F}_2 = \bigsqcup_{t=2}^\infty \vec{\mathfrak F}_2^{[t]}$.
Splitting a vertex in an element in $\vec{\mathfrak F}_2^{[t]}$ will produce an element in $\vec{\mathfrak G}_2^{[t-1]}$. Whichever of the two possible arrow reconnections are chosen in the splitting, the new element is necessarily smooth but need not be loopless. The conditions imposed by requiring the new element to be in $\vec{\mathfrak F}_2^{[t-1]}$ depend on the nature of the connections with other vertices that are made by the four arrows attached to the vertex $v$ to be split. There are seven distinct scenarios that are drawn in Figure \[fig6\] (only the four arrows attached to $v$ and the other vertices they are connected to are shown).
------------------------------------------------------------------------------------------------------------------------ --------------------------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------
![The inequivalent arrow connections for a $2$-regular vertex $v$.[]{data-label="fig6"}](lpsplit1.pdf "fig:") ![The inequivalent arrow connections for a $2$-regular vertex $v$.[]{data-label="fig6"}](lpsplit2.pdf "fig:") ![The inequivalent arrow connections for a $2$-regular vertex $v$.[]{data-label="fig6"}](lpsplit3.pdf "fig:")
\[.1in\] ![The inequivalent arrow connections for a $2$-regular vertex $v$.[]{data-label="fig6"}](lpsplit4.pdf "fig:") ![The inequivalent arrow connections for a $2$-regular vertex $v$.[]{data-label="fig6"}](lpsplit5.pdf "fig:") ![The inequivalent arrow connections for a $2$-regular vertex $v$.[]{data-label="fig6"}](lpsplit6.pdf "fig:") ![The inequivalent arrow connections for a $2$-regular vertex $v$.[]{data-label="fig6"}](lpsplit7.pdf "fig:")
------------------------------------------------------------------------------------------------------------------------ --------------------------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------
Let us define the splitting of a vertex in an element in $\vec{\mathfrak F}_2^{[t]}$ to be loopless if it produces an element in $\vec{\mathfrak F}_2^{[t-1]}$. In the three cases shown in the first row of Figure \[fig6\], either of the two arrow reconnections will give a loopless splitting of $v$. In the first two cases in the second row, only one arrow reconnection will produce a loopless splitting of $v$. In the last two cases in the second row, no loopless splittings of $v$ are possible. Therefore any element in $\vec{\mathfrak F}_2^{[t]}$ must contain a vertex that admits a loopless splitting except if all its vertices look like the last two scenarios in Figure \[fig6\]. Only for each even value of $t=2p$ is there such an obstructing element $\vec{O}_p$ in $\vec{\mathfrak F}_2^{[2p]}$ which is unique and is depicted in Figure \[fig7\] (this includes the unique element in $\vec{\mathfrak F}_2^{[2]}$ when $p=1$).
![The unique obstructing element $\vec{O}_p$ in $\vec{\mathfrak F}_2^{[2p]}$.[]{data-label="fig7"}](obstruct1.pdf)
Repeating the operation of loopless splitting on as many vertices as possible in any element in $\vec{\mathfrak F}_2^{[t]}$ therefore must eventually produce the digraph $\vec{O}_q$ for some value of $q \leq \lfloor \tfrac{t}{2} \rfloor$. Conversely, this means that any element in $\vec{\mathfrak F}_2$ can be obtained from some $\vec{O}_q$ by reversing the loopless splitting procedure some number of times. That is, by isolating pairs of arrows and joining them to form a new $2$-regular vertex according to the reversal of the diagram in Figure \[fig3\] (which will never create any loops or subdivisions). This reverse operation is shown in Figure \[fig8\] acting on an isolated pair of different arrows $\alpha$ and $\beta$ in some $\vec{H} \in \vec{\mathfrak F}_2^{[t]}$ to produce a new digraph $\vec{G} \in \vec{\mathfrak F}_2^{[t+1]}$ which is the same as $\vec{H}$ everywhere except within the dashed circle. The tails of the new arrows $a$ and $b$ in $\vec{G}$ touch the same vertices as the tails of $\alpha$ and $\beta$ in $\vec{H}$ while the heads of the new arrows $c$ and $d$ in $\vec{G}$ touch the same vertices as the heads of $\alpha$ and $\beta$ in $\vec{H}$.
![Simple immersion of $\vec{H}$ in $\vec{G}$.[]{data-label="fig8"}](basicimmersion.pdf)
The reversal of a single loopless vertex splitting in this manner just corresponds to the simplest non-trivial case of an immersion (i.e. it involves no loop additions nor subdivisions here since it is an operation within $\vec{\mathfrak F}_2$).
The objective of generating all the elements in $\vec{\mathfrak F}_2$ from those in $\{ \vec{O}_p \mid p \in {\mathbb{Z}}_{>0} \}$ by iterating the simple immersion operation above dictated that it need only act on elements in $\vec{\mathfrak F}_2$. However, in order generate the elements in $\{ \vec{O}_p \mid p \in {\mathbb{Z}}_{>0} \}$ themselves, it is useful to note that one can also define an immersion of $\vec{O}_p$ in $\vec{O}_{p+1}$ in the following way. Start by choosing any undirected simple arrow in $\vec{O}_p$, subdivide it once and then attach a loop to the new vertex. Finally, apply the simple immersion shown in Figure \[fig8\] to this intermediate digraph such that $\alpha$ is identified with the aforementioned loop and $\beta$ identified with the arrow whose tail is attached to its base. The resulting digraph is isomorphic to $\vec{O}_{p+1}$.
In summary, we have found that every element in $\vec{\mathfrak G}$ can be generated by applying to the trivial graph some combined iteration of just four moves:\
I. Loop addition, mapping $\vec{\mathfrak G}^{[t]} \rightarrow \vec{\mathfrak G}^{[t+1]} $.
II\. Subdivision of an arrow (see Figure \[fig2\]), mapping $\vec{\mathfrak G}^{[t]} \rightarrow \vec{\mathfrak G}^{[t]} $.
III\. Contraction of an undirected simple arrow (see Figure \[fig2\]), mapping $\vec{\mathfrak G}^{[t]} \rightarrow \vec{\mathfrak G}^{[t]} $.
IV\. Simple immersion (see Figure \[fig8\]), mapping $\vec{\mathfrak G}^{[t]} \rightarrow \vec{\mathfrak G}^{[t+1]} $.\
By definition, moves I and II generate $\vec{\mathfrak G}$ from $\vec{\mathfrak F} = \bigsqcup_{t=2}^\infty \vec{\mathfrak F}^{[t]}$. For each value of $t$, move III generates $\vec{\mathfrak F}^{[t]}$ from $\vec{\mathfrak F}_2^{[t]}$. The set $\vec{\mathfrak F}_2 = \bigsqcup_{t=2}^\infty \vec{\mathfrak F}_2^{[t]}$ is generated from $\{ \vec{O}_p \mid p \in {\mathbb{Z}}_{>0} \}$ using move IV and $\{ \vec{O}_p \mid p \in {\mathbb{Z}}_{>0} \}$ is generated using the combination of moves II+I+IV described above. Of course, moves I, II and IV collectively generate the more general operation of immersion for eulerian digraphs. However, it will be convenient in the forthcoming analysis to distinguish the different moves in this way.
The motivation for describing this graph-theoretic construction will become clear in the next section where we will use eulerian digraphs as the data defining a certain class of affine toric Calabi-Yau varieties. The idea will be to identify precisely what effect these four moves have on the associated toric geometry and thereby say something about the generic structure. It will aid our forthcoming geometrical interpretation of move IV to conclude this section by summarising a neat way of encoding $2$-regular eulerian digraphs.
Encoding $2$-regular eulerian digraphs {#sec:encoding2reg}
--------------------------------------
As already mentioned in Section \[sec:digraphs\], any eulerian digraph $\vec{G}$ with $n$ vertices and $e$ arrows can be obtained from the cycle digraph $\vec{C}_e$ by identifying $e-n$ appropriately chosen vertices. It worth emphasising that what this identification really produces is a particular eulerian circuit $\vec{\Gamma}$ in $\vec{G}$ (which is of course sufficient to define it). By assigning labels $( i_1 i_2 ... i_e )$ to the vertices cyclically ordered around $\vec{C}_e$, such that each $i_a \in \{ 1,2,...,n \}$ and precisely $e-n$ of the labels are repeated according to the identification above, one specifies a labelling for the vertices in $\vec{\Gamma}$. A labelling for the arrows in $\vec{\Gamma}$ can be specified by simply inserting a different label $m_a \in \{ 1,2,...,e \}$ for each arrow between each successive pair of vertices $i_a$ and $i_{a+1}$ in the cyclically ordered sequence above. We will generally not benefit from distinguishing different labellings of the same eulerian digraph but fixing a labelling can be useful for the purposes of distinguishing different circuits within a given eulerian digraph.
For a $2$-regular eulerian digraph $\vec{G}$, the situation is somewhat simpler. Since $\vec{G}$ has $e=2n$ then each of the $n$ distinct vertex labels must appear exactly twice in the sequence $( i_1 i_2 ... i_{2n} )$. Therefore one can depict any eulerian circuit $\vec{\Gamma}$ in $\vec{G}$ by a circle graph on $2n$ vertices with $n$ chords connecting the $n$ identified vertices within it. We will take the orientation for $\vec{\Gamma}$ to be defined by going clockwise around the circle. In terms of this picture, a pair of different vertices $i$ and $j$ are said to be [*interlaced*]{} if they appear in the order $(... i ... j ... i ... j ...)$ in $\vec{\Gamma}$ (i.e. if the chords associated with $i$ and $j$ intersect each other). An important insight due to Arratia, Bollobás and Sorkin in [@InterlaceABS] is that one can utilise the structure of such interlacings as a means of enumerating circuits in $2$-regular eulerian digraphs. The essential ingredient here is called the [*interlace graph*]{} $I( \vec{\Gamma} )$ of the eulerian circuit $\vec{\Gamma}$ in $\vec{G}$. It is defined as the undirected graph on $n$ vertices such that any pair of vertices $i$ and $j$ are connected by an edge only if they are interlaced in $\vec{\Gamma}$. The interlace graph is necessarily simple since any pair of vertices can obviously only be interlaced once.
A $2$-regular eulerian digraph is in $\vec{\mathfrak F}_2$ only if it is loopless. This condition just means that the same vertex can never appear consecutively in a sequence of vertices associated with any eulerian circuit. In the notation of Figure \[fig8\], the effect of move IV on an element $\vec{H}$ in $\vec{\mathfrak F}_2$, is easily visualised in terms of the chord diagram obtained from an eulerian circuit $\vec{\Gamma}_{\vec{H}}$ in $\vec{H}$ by replacing $( ... \alpha ... \beta ...)$ with $( ... a v c ... b v d ...)$ to form an eulerian circuit $\vec{\Gamma}_{\vec{G}}$ in $\vec{G}$. That is, it corresponds to inserting in the circle graph one copy of the new vertex $v$ between the head and tail of $\alpha$ and the other copy of $v$ between the head and tail of $\beta$ before finally connecting the two copies of $v$ with a new chord. In terms of the interlace graph, move IV introduces one new vertex $v$ which is connected to all those existing vertices that it is interlaced with in the chord diagram. The reverse operation is just the loopless splitting of vertex $v$ in $\vec{G}$ that is achieved by removing the chord associated with $v$. From this point of view, it is sometimes more convenient to denote by $I( \vec{\Gamma}_{\vec{G}} ) - v$ the interlace graph $I( \vec{\Gamma}_{\vec{H}} )$.
If a pair of vertices $i$ and $j$ are interlaced in $\vec{\Gamma}$ then the [*transposition*]{} $t_{ij}$ of the pair $(ij)$ gives the eulerian circuit $\vec{\Gamma}_{ij} = t_{ij} \vec{\Gamma}$ defined by replacing the vertex sequence $(... i k_1 ... k_p j ... i l_1 ... l_q j ...)$ with $(... i l_1 ... l_q j ... i k_1 ... k_p j ...)$ in $\vec{\Gamma}$ (i.e. exchanging the order of the two sequences of vertices $( k_1 ... k_p )$ and $( l_1 ... l_q )$ which both run from $i$ to $j$). Clearly any pair of vertices which are interlaced in an eulerian circuit in $\vec{H}$ will remain so in the corresponding eulerian circuit in $\vec{G}$ resulting from move IV. Moreover, it is straightforward to check that the act of transposing interlaced vertices commutes with move IV on all elements in $\vec{\mathfrak F}_2$. The effect that transposing interlaced vertices has on the associated interlace graph is described by an operation called [*pivoting*]{} which is defined as follows. Given an undirected simple graph $H$, begin by selecting a pair of distinct vertices $i$ and $j$ (which we will assume are connected by an edge). Next partition all the vertices other than $i$ and $j$ in $H$ into four sets according to how they are connected to $i$ and $j$ by edges. Vertices which are connected to $i$ but not $j$ live in the first set. Vertices which are connected to $j$ but not $i$ live in the second set. Vertices which are connected to both $i$ and $j$ live in the third set. All the other vertices not connected to either $i$ or $j$ live in the fourth set. The next step is to toggle’ pairs of vertices amongst the first three sets. That is, for any pair of vertices such that each vertex in the pair lives in a different one of the first three sets, if the pair is connected by an edge then remove the edge while if the pair is not connected by an edge then connect them with one. The resulting undirected simple graph $H_{ij}$ is called the pivot of $H$ about the edge $ij$. It is not difficult to see that the interlace graph $I ( \vec{\Gamma}_{ij} )$ of the transposed eulerian circuit $\vec{\Gamma}_{ij}$ is then, after relabelling $i \leftrightarrow j$, precisely the pivot of the original interlace graph $I ( \vec{\Gamma} )$ about $ij$. Clearly both transposition and pivoting are involutive operations. Even though $\vec{G}$ is connected, $I( \vec{\Gamma} )$ need not be. However, if $I( \vec{\Gamma} )$ is connected then so is its pivot about any edge.
The operations described in the previous paragraph are useful in order to understand the structure of circuits in a $2$-regular eulerian digraph. For example, a nice result from lemma 4 in [@InterlaceABS] is that any two eulerian circuits in a $2$-regular eulerian digraph are related by some number of transpositions. Thus any two interlace graphs that are related by some number of pivotings must encode the same $2$-regular eulerian digraph. The main result in [@InterlaceABS] however is the construction of a well-defined map that associates to the interlace graph $I$ of an eulerian circuit in any $2$-regular eulerian digraph $\vec{G}$ a polynomial function $q_I (x)$ in one variable $x$ with integer coefficients. This function is called the [*interlace polynomial*]{} and is defined uniquely by the simple recursion relations: $$q_I (x) =
\left\{
\begin{array}{ll}
q_{I - i}(x) + q_{I_{ij} - j} (x) & {\mbox{if $ij$ is an edge in $I$,}}\\
x^n & {\mbox{if $I$ has $n$ vertices and no edges.}} \\
\end{array}
\right.$$ Now let $r_k ( \vec{G} )$ denote the number of inequivalent partitions of $\vec{G}$ into $k$ (arrow-labelled) circuits and define the [*circuit partition polynomial*]{} as $r_{\vec{G}} (x) = \sum_k r_k ( \vec{G} ) x^k$. These two polynomials are related via $r_{\vec{G}} (x) = x\, q_I (x+1)$ and thus the interlace polynomial provides a useful tool for counting circuit partitions of $2$-regular eulerian digraphs. For example, $q_I (1)$ is the number of eulerian circuits on $\vec{G}$ while $q_I (2) = 2^n$ is number of circuit partitions of $\vec{G}$ defined by pairing up incoming and outgoing arrows at each vertex in $\vec{G}$. Notice that the relation between $r_{\vec{G}}$ and $q_I$ is well-defined because the interlace polynomial does not depend on the choice of eulerian circuit in $\vec{G}$ that is encoded by $I$ (i.e. it is invariant under pivoting).
Toric geometry from quiver representations {#sec:toricquivers}
==========================================
Quiver representations from digraphs {#sec:quiverrep}
------------------------------------
Let us define a [*quiver representation*]{} to be the complex unitary representation obtained by associating to each vertex $i$ in a directed graph $\vec{G}$ a complex unitary representation $V_i$ of a real lie group ${\mathcal{G}}_i$. An arrow pointing from vertex $i$ to vertex $j$ in $\vec{G}$ denotes (the real form of) the representation ${\bar V}_i \otimes V_j$. Perhaps the most common class of examples encountered in physical applications have $V_i \cong {\bf N}_i$ corresponding to the fundamental representation of ${\mathcal{G}}_i \cong U( N_i )$, wherein an arrow pointing from vertex $i$ to $j$ corresponds to the real form of the bifundamental representation of $U( N_i ) \times U( N_j )$ while a loop based at vertex $i$ corresponds to the adjoint representation of $U( N_i )$.
For simplicity, we will henceforth only consider the special case where ${\mathcal{G}}$ is abelian and let us assume for the time being that $\vec{G}$ is loopless. If $\vec{G}$ contains $n$ vertices and $e$ arrows then ${\mathcal{G}} \cong U(1)^n$ and $V \cong {\mathbb{C}}^e$ as a vector space. Labelling vertices $i=1,...,n$ and arrows $a=1,...,e$ in $\vec{G}$ fixes a basis for the quiver representation. With respect to this basis, the action of ${\mathcal{G}}$ on $V$ is defined by $X_a \mapsto \mbox{exp} \left( i \sum_{i=1}^n \theta_i Q_{ia} \right) X_a$, for all $( e^{i \theta_1} ,..., e^{i \theta_n} ) \in {\mathcal{G}}$ and $X \in V$, in terms of the $n \times e$ array of integer charges $Q_{ia}$ comprising the so-called [*incidence matrix*]{} of $\vec{G}$. A given column $a$ of the incidence matrix encodes an arrow in such a way that it contains an entry $+1$ or $-1$ in row $i$ if the arrow points respectively to or from vertex $i$, or a zero entry if the arrow does not touch $i$. Thus each column contains precisely one $+1$ and one $-1$ entry with only zeroes remaining and hence $\sum_{i=1}^n Q_{ia} =0$ for each $a$. Notice that this representation would act trivially on loops in $\vec{G}$ and thus could not distinguish between loops based at different vertices, hence their temporary exclusion. The ${\mathcal{G}}$-invariant hermitian inner product is just the canonical complex sesquilinear form $\sum_{a=1}^e X_a {\bar Y}_a$ on ${\mathbb{C}}^e$ for all $X,Y \in V$. An important remark to make at this point is that if $\vec{G}$ is chosen to be eulerian, and thus each of its vertices is balanced, then the incidence matrix must also obey $\sum_{a=1}^e Q_{ia} =0$ for each $i$.
The condition $\sum_{i=1}^n Q_{ia} =0$ ensures that the quiver representation defined above is not faithful. That is, for a given arrow $a$ which points from vertex $i$ to vertex $j$, $\sum_{i=1}^n \theta_k Q_{ka} = - \theta_i + \theta_j$ and so the kernel ${\mathcal{K}}$ of the quiver representation has dimension equal to the number of disconnected components of $\vec{G}$ that are not connected to each other by any arrows. If $\vec{G}$ is weakly connected then ${\mathcal{K}}$ is isomorphic to the diagonal $U(1)$ subgroup of $U(1)^n$ containing elements of the form $( e^{i \theta} ,..., e^{i \theta} )$. Henceforth we shall assume that this is always the case. Therefore, one can recover from the quiver representation associated with any weakly connected loopless digraph $\vec{G}$ an effective action of the quotient group ${\mathcal{H}} = {\mathcal{G}}/{\mathcal{K}} \cong U(1)^{n-1}$ on $V$.
Affine toric varieties from digraphs {#sec:affinetoric}
------------------------------------
Let us now use the data for the quiver representation above to associate with each weakly connected loopless digraph $\vec{G}$ a [*convex rational polyhedral cone*]{} $$\label{eq:polycone}
\Lambda_{\vec{G}} = {\mbox{Cone}} ( \Psi_{\vec{G}} ) = \left\{ \sum_{a=1}^e \zeta_a \, {\bm \nu}_a \, \middle | \, \forall \, \zeta_a \in {\mathbb{R}}_{\geq 0} \right\} \subset {\mathbb{R}}^{e-n+1}~,$$ that is generated by a finite set $$\label{eq:polyconegen}
\Psi_{\vec{G}} = \left\{ {\bm \nu}_a \in {\mathbb{Z}}^{e-n+1} \, \middle | \, \sum_{a=1}^e Q_{ia} \, {\bm \nu}_a = {\bm 0} \right\}~,$$ of $e$ integral $(e-n+1)$-vectors subject to precisely $n-1$ linearly independent relations dictated by the incidence matrix of $\vec{G}$. For any choice of $\Psi_{\vec{G}}$, each integral vector ${\bm \nu}_a$ is to be associated with arrow $a$ in $\vec{G}$. We take any such $\Psi_{\vec{G}}$ to be the unique [*minimal rational generating set*]{} formed by intersecting the $1$-dimensional faces, or [*rays*]{}, of $\Lambda_{\vec{G}}$ with ${\mathbb{Z}}^{e-n+1}$. It is minimal in the sense that any other generating set for $\Lambda_{\vec{G}}$ must contain $\{ m_a \, {\bm \nu}_a \}$ for some $m_a \in {\mathbb{Z}}_{>0}$. In this situation we take the vectors ${\bm \nu}_a$ to be primitive (i.e. for each $a$, there exists no integer $m_a \neq 1$ such that ${\bm \nu}_a = m_a \, {\bm \rho}_a$ for any ${\bm \rho}_a \in {\mathbb{Z}}^{e-n+1}$). It is important to stress that this is only fixing how a given generating set $\Psi_{\vec{G}}$ is to be contained in the corresponding polyhedral cone $\Lambda_{\vec{G}}$. However, clearly the relations $\sum_{a=1}^e Q_{ia} \, {\bm \nu}_a = {\bm 0}$ alone are insufficient to determine a unique solution for $\Psi_{\vec{G}}$ and indeed different solutions will typically generate different polyhedral cones. As a first step towards removing this ambiguity, it will be convenient to impose a few more caveats. First of all, whenever possible, let us choose $\Psi_{\vec{G}}$ such that $\Lambda_{\vec{G}}$ is [*strongly convex*]{}, meaning that $\Lambda_{\vec{G}}$ and $-\Lambda_{\vec{G}}$ intersect only at the origin in ${\mathbb{R}}^{e-n+1}$. If $\Lambda_{\vec{G}}$ is not strongly convex then it must contain a line through the origin and it is easily shown using the relations for $\Psi_{\vec{G}}$ that any point $\sum_{a=1}^e \zeta_a \, {\bm \nu}_a$ on such a line must have vanishing coefficients $\zeta_a = 0$ for each arrow $a$ that is contained in some circuit in $\vec{G}$. Consequently, for any choice of $\Psi_{\vec{G}}$, the corresponding polyhedral cone $\Lambda_{\vec{G}}$ is guaranteed to be strongly convex whenever ${\vec{G}}$ is eulerian. Let us also choose $\Psi_{\vec{G}}$ such that $\Lambda_{\vec{G}}$ has maximal dimension $e-n+1$. In general, the span $\langle \Psi_{\vec{G}} \rangle$ of $\Psi_{\vec{G}}$ over the integers forms a sublattice of ${\mathbb{Z}}^{e-n+1}$ and ${\mathbb{Z}}^{e-n+1} / \langle \Psi_{\vec{G}} \rangle$ will be isomorphic to a finite abelian group $\Gamma_{\vec{G}}$ that is non-trivial whenever the sublattice is proper. It will often be convenient in later sections to choose $\Psi_{\vec{G}}$ such that $\langle \Psi_{\vec{G}} \rangle$ is isomorphic to the lattice ${\mathbb{Z}}^{e-n+1}$ so that $\Gamma_{\vec{G}}$ is trivial – this will ensure that the data from $\vec{G}$ alone is sufficient to specify $\Lambda_{\vec{G}}$ uniquely, up to an affine unimodular transformation of the lattice. However, for the moment let us follow the generic construction wherein $\Gamma_{\vec{G}}$ can be non-trivial.
In the interests of making our exposition relatively self-contained, we will now briefly summarise the canonical way in which, from the different viewpoints of symplectic and algebraic geometry, the strongly convex rational polyhedral cone $\Lambda_{\vec G}$ can be used to encode the toric structure on a particular Kähler quotient and affine variety containing a conical singularity. A detailed introduction to symplectic toric geometry (for compact manifolds) and toric varieties in algebraic geometry can be found in, for example, [@SilvaSympToric] and [@CoxToric; @FulToric] respectively. See [@GIT3] for a good introduction to the relationship between these two types of toric structures from the perspective of geometric invariant theory.
The effective action of ${\mathcal{H}}$ that was derived from the quiver representation can be used to construct a Kähler quotient ${\mathbb{C}}^e {/\!/} {\mathcal{H}}$. Taking $\omega = -i \sum_{a=1}^e dX_a \wedge d {\bar X}_a$ to be the canonical Kähler form on ${\mathbb{C}}^e$ with respect to the quiver basis then the $n-1$ linearly independent vector fields $\xi_i = i \sum_{a=1}^e Q_{ia} \left( X_a \frac{\partial}{\partial X_a} - {\bar X}_a \frac{\partial}{\partial {\bar X}_a} \right)$ generate an effective Hamiltonian action of ${\mathcal{H}}$ on ${\mathbb{C}}^e$ preserving $\omega$. Thus one can solve $\iota_{\xi_i} \omega = d \mu_i$ to obtain the moment maps $$\label{eq:mmap}
\mu_i (X) = \sum_{a=1}^e Q_{ia} | X_a |^2 - t_i~,$$ up to a choice of integration constants $t_i \in {\mathbb{R}}$ obeying $\sum_{i=1}^n t_i = 0$. Just as the vector fields $\xi_i$ should naturally be thought to comprise an element in the lie algebra ${\mathfrak{h}}$ of ${\mathcal{H}}$, so too should the image of the moment maps $\mu_i (X)$ be thought to comprise an element in the dual lie algebra ${\mathfrak{h}}^* \cong {\mathbb{R}}^{n-1}$. The Kähler quotient is defined as the space of solutions of the $n-1$ independent real equations $\mu_i (X) = 0$ modulo the action of ${\mathcal{H}}$ and is a Kähler manifold of complex dimension $e-n+1$. Moreover, the Kähler quotient is [*symplectic toric*]{} in the sense that the canonical action of $U(1)^e$ on ${\mathbb{C}}^e$ descends to an effective Hamiltonian action of the maximal torus $U(1)^e/{\mathcal{H}}$ on ${\mathbb{C}}^e {/\!/} {\mathcal{H}}$ preserving the Kähler structure. The choice of integration constants $t_i$ is an essential piece of extra data that is needed to specify the topology of the Kähler quotient (e.g. it fixes the Kähler class) – they are identified with the Fayet-Iliopoulos parameters in the associated gauged linear sigma model construction discussed in Section \[sec:introduction\].
Let us denote by ${\mathcal{M}}_{\vec{G}}$ the particular Kähler quotient defined such that all $t_i =0$. Clearly ${\mathcal{M}}_{\vec{G}}$ is conical since it admits a homothety generated by $X \mapsto \gamma X$ which preserves $\sum_{a=1}^e Q_{ia} | X_a |^2 =0$ for any $\gamma \in {\mathbb{R}}_{>0}$. The apex of ${\mathcal{M}}_{\vec{G}}$ is at $X = 0$. It is perhaps worth noting that the other possible Kähler quotients we could have associated with $\vec{G}$ having some or all $t_i \neq 0$ can be obtained as certain resolutions of the conical singularity in ${\mathcal{M}}_{\vec{G}}$ (this is certainly the generic situation though the singularity may be only partially resolved for some particular choices of $t_i \neq 0$). Since ${\mathcal{M}}_{\vec{G}}$ is symplectic toric, the vector fields generating the action of the maximal torus $U(1)^e/{\mathcal{H}}$ define an $(e-n+1)$-tuple of moment maps taking each point in ${\mathcal{M}}_{\vec{G}}$ to an element in the dual lie algebra of $U(1)^e/{\mathcal{H}}$ which is isomorphic to ${\mathbb{R}}^{e-n+1}$. From the results of [@FalMor] (see also [@Lerman]), one finds that the image of ${\mathcal{M}}_{\vec{G}}$ under these moment maps is precisely the dual cone $$\label{eq:dualpolycone}
\Lambda_{\vec{G}}^\vee = \left\{ {\bm \upsilon} \in {\mathbb{R}}^{e-n+1} \, \middle | \, \langle {\bm \upsilon} , {\bm \nu}_a \rangle \geq 0 \, , \, \forall \, {\bm \nu_a} \in \Psi_{\vec{G}} \right\}~,$$ where $\langle -,- \rangle$ denotes the canonical euclidean inner product on ${\mathbb{R}}^{e-n+1}$. This is an equivalent way of defining a cone as the intersection of closed half-spaces and it follows from this definition that $( \Lambda_{\vec{G}}^\vee )^\vee = \Lambda_{\vec{G}}$ with elements in $\Psi_{\vec{G}}$ describing the (inward pointing) normal vectors to the facets of $\Lambda_{\vec{G}}^\vee$. The property of being a strongly convex rational polyhedral cone of maximal dimension is preserved by this duality. It is important to emphasise that the image $\Lambda_{\vec{G}}^\vee$ of ${\mathcal{M}}_{\vec{G}}$ here is only defined up to an affine unimodular transformation preserving the lattice in which the generating set for $\Lambda_{\vec{G}}$ is contained. The apex of $\Lambda_{\vec{G}}^\vee$ corresponds to the image of the apex of ${\mathcal{M}}_{\vec{G}}$ and can always be fixed to sit at the origin in ${\mathbb{R}}^{e-n+1}$ by choosing the integration constants for the moment maps such that they all transform homogeneously under the homothetic action of ${\mathbb{R}}_{>0}$ on ${\mathcal{M}}_{\vec{G}}$. Conversely, ${\mathcal{M}}_{\vec{G}}$ can be reconstructed as a torus bundle over $\Lambda_{\vec{G}}^\vee$ that is defined in terms of the data from $\Lambda_{\vec{G}}$. The typical fibre over a generic point in $\Lambda_{\vec{G}}^\vee$ is isomorphic to the maximal torus $U(1)^e/{\mathcal{H}}$ but degenerates to particular $(e-n+1-m)$-dimensional tori over faces in $\Lambda_{\vec{G}}^\vee$ with codimension $m$. The degenerations are encoded by the way the faces sit in $\Lambda_{\vec{G}}^\vee$ (e.g. for $m=1$, the integral components of any normal vector ${\bm \nu_a}$ to a facet in $\Lambda_{\vec{G}}^\vee$ defines the weights for a circle action $U(1)_a$ on $U(1)^e/{\mathcal{H}}$ such that the fibre over that facet is isomorphic to the quotient $( U(1)^e/{\mathcal{H}} ) / U(1)_a$). From this point of view, having fixed the apex of $\Lambda_{\vec{G}}^\vee$ to be at the origin in ${\mathbb{R}}^{e-n+1}$, the remaining freedom that allows $\Lambda_{\vec{G}}^\vee$ to be modified by a unimodular transformation in $SL(e-n+1,{\mathbb{Z}})$ may be interpreted as performing the same transformation as an automorphism of the generic $U(1)^e/{\mathcal{H}}$ fibres in ${\mathcal{M}}_{\vec{G}}$.
There is also a canonical way to construct an [*affine toric variety*]{} from a strongly convex rational polyhedral cone $\Lambda_{\vec{G}}$. It proceeds by first defining the map $$\begin{aligned}
\label{eq:pimap}
\Phi : &\; ( {\mathbb{C}}^* )^e \rightarrow ( {\mathbb{C}}^* )^{e-n+1} \nonumber \\
&\; x \mapsto \prod_{a=1}^e x_a^{{\bm \nu}_a}~,\end{aligned}$$ which is a group homomorphism between algebraic tori, thought of as abelian groups with respect to componentwise multiplication (i.e. each $x \in ( {\mathbb{C}}^* )^e$ corresponds to an $e$-tuple of non-zero complex numbers with component $x_a$ being associated with arrow $a$ in $\vec{G}$). Since $\Lambda_{\vec{G}}$ is strongly convex, $\Phi$ is surjective and its kernel is isomorphic to ${\mathcal{H}}_{\mathbb{C}}\times \Gamma_{\vec{G}}$ which acts effectively on ${\mathbb{C}}^e$. The action of ${\mathcal{H}}_{\mathbb{C}}\cong ( {\mathbb{C}}^* )^{n-1}$ here just follows from the obvious complexification of the the effective action of ${\mathcal{H}}$ on ${\mathbb{C}}^e$ defined by the quiver representation. That is, by replacing each $e^{i \theta_i} \in U(1)$ in elements of ${\mathcal{G}}$ with $\lambda_i \in {\mathbb{C}}^*$ in elements of ${\mathcal{G}}_{\mathbb{C}}$ one obtains the action $X_a \mapsto \left( \prod_{i=1}^n \lambda_i^{Q_{ia}} \right) X_a$, for all $( \lambda_1 ,..., \lambda_n ) \in {\mathcal{G}}_{\mathbb{C}}$ and $X \in V$. Thus, from this construction one is simply recovering the charges $Q_{ia}$ in the incidence matrix for the quiver representation as the coefficients in the linear relations $\sum_{a=1}^e Q_{ia} \, {\bm \nu}_a = {\bm 0}$ amongst the integral vectors in $\Psi_{\vec{G}}$. When $\langle \Psi_{\vec{G}} \rangle$ forms a proper sublattice of ${\mathbb{Z}}^{e-n+1}$, the non-trivial finite abelian group $\Gamma_{\vec{G}} \cong {\mathbb{Z}}^{e-n+1} / \langle \Psi_{\vec{G}} \rangle$ is also contained in the kernel of $\Phi$ with the canonical action on ${\mathbb{C}}^e$.
The affine toric variety is then defined by considering the holomorphic quotient of ${\mathbb{C}}^e$ by ${\mathcal{H}}_{\mathbb{C}}\times \Gamma_{\vec{G}}$. However, naively quotienting in this way by a non-compact lie group typically gives rise to rather unpleasant spaces that are not even Hausdorff. The problem is due to the existence of certain orbits which degenerate under the action of ${\mathcal{H}}_{\mathbb{C}}$. However, for toric varieties, one can remedy this problem in a systematic way using the data encoded by $\Lambda_{\vec{G}}$ to remove all the problematic orbits from the quotient. The prescription involves first selecting all the different subsets of $\Psi_{\vec{G}}$ consisting of integral vectors that do not generate a cone in $\Lambda_{\vec{G}}$. Each such subset in $\Psi_{\vec{G}}$ defines an algebraic subset in ${\mathbb{C}}^e$ such that, for each ${\bm \nu}_a$ contained in the former, one sets the associated component $X_a =0$ for all $X \in {\mathbb{C}}^e$ in the latter. Denoting by $Z_{\Lambda_{\vec{G}}}$ the union of all these algebraic sets then allows one to write the affine toric variety as the holomorphic quotient $$\label{eq:holquot}
{\mathcal{M}}_{\vec{G}} = \frac{{\mathbb{C}}^e \, \backslash \, Z_{\Lambda_{\vec{G}}}}{{\mathcal{H}}_{\mathbb{C}}\times \Gamma_{\vec{G}}}~.$$ It is toric in the sense that it contains a maximal algebraic torus isomorphic to $({\mathbb{C}}^* )^{e-n+1}$ as a dense open subset and it inherits a natural action of $( {\mathbb{C}}^* )^e / {\mathcal{H}}_{\mathbb{C}}$ under the quotient. An alternative realisation of this quotient that is often convenient to work with is as the affine scheme of prime ideals of the coordinate ring of ${\mathcal{M}}_{\vec{G}}$ itself. This coordinate ring is generated by ${\mathcal{H}}_{\mathbb{C}}$-invariant monomials of the form $\prod_{a=1}^e X_a^{\langle {\bm \upsilon} , {\bm \nu}_a \rangle}$ for all ${\bm \upsilon} \in {\mathbb{Z}}^{e-n+1} $ such that $\langle {\bm \upsilon} , {\bm \nu}_a \rangle \geq 0$ for all $a=1,...,e$, where $\langle -,- \rangle$ denotes the dual pairing for ${\mathbb{Z}}^{e-n+1}$. Whence, ${\bm \upsilon}$ is necessarily an element in the semigroup $\Lambda_{\vec{G}}^\vee \cap {\mathbb{Z}}^{e-n+1}$ which, from Gordan’s lemma, is finitely generated as a consequence of $\Lambda_{\vec{G}}$ being convex rational. Addition in the semigroup $\Lambda_{\vec{G}}^\vee \cap {\mathbb{Z}}^{e-n+1}$ becomes multiplication in the coordinate ring and linear relations amongst the generators of $\Lambda_{\vec{G}}^\vee \cap {\mathbb{Z}}^{e-n+1}$ become monomial relations amongst elements in the coordinate ring.
Let us conclude by briefly justifying why ${\mathcal{M}}_{\vec{G}}$ has been used to denote both the conical geometries found in terms of Kähler and holomorphic quotients constructed from $\Lambda_{\vec{G}}$ above. It is first worth remarking that the reconstruction of ${\mathcal{M}}_{\vec{G}}$ as a Kähler quotient in terms of a torus bundle over $\Lambda_{\vec{G}}^\vee$ requires some additional data unless ${\mathcal{M}}_{\vec{G}}$ is non-singular everywhere except at its apex. In order for this condition to be met in fact requires that $\Lambda_{\vec{G}}^\vee$ be good’ in the sense of Lerman’s definition 2.17 in [@Lerman] and this necessitates the finite group $\Gamma_{\vec{G}}$ defined in the holomorphic quotient construction being trivial. Assuming for simplicity that this is the case then, at a generic point $X \in {\mathbb{C}}^e$ where all $X_a \neq 0$, the equivalence between the two constructions can be seen as follows (this equivalence was first noted in [@WittenGLSM] and later generalised in [@LutyTaylor] in the context of gauged linear sigma models). The first step is to relate each $e^{i \theta_i}$ in ${\mathcal{G}}$ for the Kähler quotient with each $\lambda_i$ in ${\mathcal{G}}_{\mathbb{C}}$ for the holomorphic quotient such that $\lambda_i = r_i e^{i \theta_i}$ for some $r_i \in {\mathbb{R}}_{>0}$. One then finds that the moment map equation $\sum_{a=1}^e Q_{ia} | X_a |^2 =0$, which is invariant under ${\mathcal{G}}$ but not ${\mathcal{G}}_{\mathbb{C}}$, can be obtained identically by fixing some particular values for the radial parameters $r_i$ in terms of $X_a$. In this way one can match up all the coset representatives in the two constructions.
Affine toric Calabi-Yau varieties from eulerian digraphs {#sec:affinetoricCY}
--------------------------------------------------------
Recall from Section \[sec:quiverrep\] that a consequence of $\vec{G}$ being eulerian is that the charges of the incidence matrix must obey $\sum_{a=1}^e Q_{ia} =0$ for each vertex $i$. Conversely, this condition implies that any weakly connected digraph $\vec{G}$ is eulerian. A crucial fact is that this is also precisely the necessary condition for triviality of the canonical bundle on ${\mathcal{M}}_{\vec{G}}$ understood as an affine toric variety. In particular, the first Chern class of ${\mathcal{M}}_{\vec{G}}$ vanishes only if $\sum_{a=1}^e Q_{ia} =0$. Thus one can associate to every loopless eulerian digraph $\vec{G}$ an affine toric Calabi-Yau variety ${\mathcal{M}}_{\vec{G}}$.
A further useful implication of this condition is that it ensures the integral vectors ${\bm \nu}_a$ generating $\Lambda_{\vec{G}}$ must all end on points in a sublattice contained within some particular ${\mathbb{R}}^{e-n} \subset {\mathbb{R}}^{e-n+1}$ called the [*characteristic hyperplane*]{}. This fact can be understood in terms of the map $\Phi$ in . Since each of the $e-n+1$ components of $\Phi (x)$ is invariant under ${\mathcal{H}}_{\mathbb{C}}\times \Gamma_{\vec{G}}$ then, for every element ${\bm \omega} \in {\mathbb{Z}}^{e-n+1}$, one can define an ${\mathcal{H}}_{\mathbb{C}}\times \Gamma_{\vec{G}}$-invariant character of the algebraic torus $( {\mathbb{C}}^* )^e$ mapping to $\prod_{a=1}^e x_a^{\langle {\bm \omega} , {\bm \nu}_a \rangle}$ from each $x \in ( {\mathbb{C}}^* )^e$. Indeed all such characters of $( {\mathbb{C}}^* )^e$ follow in this way and the corresponding set of ${\mathcal{H}}_{\mathbb{C}}\times \Gamma_{\vec{G}}$-invariant functions they define can be thought of locally as sections of the trivial bundle on ${\mathcal{M}}_{\vec{G}}$. On the other hand, for any $X \in {\mathbb{C}}^e$ with all $X_a \neq 0$, $\prod_{a=1}^e X_a$ is ${\mathcal{H}}_{\mathbb{C}}$-invariant due to the condition $\sum_{a=1}^e Q_{ia} =0$ and can be thought of locally as the coefficient of a section of the anti-canonical bundle on ${\mathcal{M}}_{\vec{G}}$ whose triviality is precisely the Calabi-Yau condition. Thus, there must exist some particular ${\bm \eta} \in \Lambda_{\vec{G}}^\vee \cap {\mathbb{Z}}^{e-n+1}$ such that $\langle {\bm \eta} , {\bm \nu}_a \rangle =1$ for all $a=1,...,e$ which can be thought of as the normal vector defining the characteristic hyperplane. From the point of view of symplectic geometry, thinking of ${\mathcal{M}}_{\vec{G}}$ as a Calabi-Yau cone over a Sasaki-Einstein manifold, ${\bm \eta}$ also has a natural interpretation; it corresponds to a particular element in the lie algebra of the maximal torus $U(1)^e / {\mathcal{H}}$ that is associated with the canonical [*Reeb*]{} Killing vector field on the Sasaki-Einstein manifold whose real metric cone is ${\mathcal{M}}_{\vec{G}}$. The vector ${\bm \eta}$ being integral here is non-trivial and implies that the associated Reeb vector generates a locally free circle action on the Sasaki-Einstein geometry, restricting it to be of quasi-regular type.
For any eulerian digraph $\vec{G}$, intersecting the strongly convex rational polyhedral cone $\Lambda_{\vec{G}}$ with the characteristic hyperplane associated with the integral vector ${\bm \eta}$ defines a [*convex rational polytope*]{} as the convex hull of the endpoints of the integral vectors in $\Psi_{\vec{G}}$. It will be convenient in the forthcoming analysis to now fix a basis such that ${\bm \eta} = ( {\bm 0} , 1)$ with ${\bm 0} \in {\mathbb{R}}^{e-n} \subset {\mathbb{R}}^{e-n+1}$. With respect to this basis, the integral vectors in $\Psi_{\vec{G}}$ can be written ${\bm \nu}_a = ( {\bm v}_a , 1 )$ where each ${\bm v}_a \in {\mathbb{Z}}^{e-n} \subset {\mathbb{Z}}^{e-n+1}$. Notice that the linear relations $\sum_{a=1}^e Q_{ia} \, {\bm \nu}_a = {\bm 0}$ and $\sum_{a=1}^e Q_{ia} \, {\bm v}_a = {\bm 0}$ are equivalent due to the condition $\sum_{a=1}^e Q_{ia} =0$. In terms of these integral vectors, we take the more convenient form of the convex rational polytope as the convex hull $$\label{eq:polytope}
\Delta_{\vec{G}} = {\mbox{Conv}} ( \psi_{\vec{G}} ) = \left\{ \sum_{a=1}^e \zeta_a \, {\bm v}_a \, \middle | \, \forall \, \zeta_a \in {\mathbb{R}}_{\geq 0} \, , \, \sum_{a=1}^e \zeta_a = 1 \right\} \subset {\mathbb{R}}^{e-n}~,$$ of a finite set $$\label{eq:polytopegen}
\psi_{\vec{G}} = \left\{ {\bm v}_a \in {\mathbb{Z}}^{e-n} \, \middle | \, \sum_{a=1}^e Q_{ia} \, {\bm v}_a = {\bm 0} \right\}~.$$ This choice of basis leaves unfixed the $SL(e-n, {\mathbb{Z}})$ subgroup of $SL(e-n+1, {\mathbb{Z}})$ that is contained in the isotropy group of ${\bm \eta}$ and redefining $\Delta_{\vec{G}}$ by any unimodular transformation in this subgroup will therefore reconstruct the same affine toric Calabi-Yau cone ${\mathcal{M}}_{\vec{G}}$. With respect to this basis, $\langle \Psi_{\vec{G}} \rangle \cong {\mathbb{Z}}^{e-n+1}$ follows from any choice of $\psi_{\vec{G}}$ containing ${\bm 0} \in {\mathbb{R}}^{e-n} \subset {\mathbb{R}}^{e-n+1}$ and with $\langle \psi_{\vec{G}} \rangle \cong {\mathbb{Z}}^{e-n} \subset {\mathbb{Z}}^{e-n+1}$.
Having now established the necessary vocabulary, let us move on to consider what effect the four moves which generate all the eulerian digraphs have on the polytopes above which encode the associated toric Calabi-Yau geometries.
Generating toric Calabi-Yau geometries {#sec:gentoricCY}
--------------------------------------
For any eulerian digraph $\vec{G}$ in $\vec{\mathfrak G}^{[t]}$, the associated affine toric Calabi-Yau cone ${\mathcal{M}}_{\vec{G}}$ has complex dimension $t+1$ and is encoded by the convex rational polytope $\Delta_{\vec{G}} \subset {\mathbb{R}}^t$. Therefore, moves I and IV will both increase by one the dimension of the space in which the polytope lives while moves II and III will both preserve this dimension. We will first consider the detailed effect of each of these four moves in order before concluding with a few examples.
### Move I {#sec:moveI}
As already noted, adding a loop to any vertex in a digraph $\vec{G} \in \vec{\mathfrak G}^{[t]}$ will modify the quiver representation only by adding one extra dimension to ${\mathbb{C}}^e$ which is invariant under the action of ${\mathcal{H}}$. The effect of move I on ${\mathcal{M}}_{\vec{G}}$ will therefore retain no information about which vertex in $\vec{G}$ the loop was added to. In terms of the polytope $\Delta_{\vec{G}}$, the effect of move I involves first supplanting the generating set $\psi_{\vec{G}}$ with a set of vectors in ${\mathbb{Z}}^{t+1}$ satisfying the same relations as they did in ${\mathbb{Z}}^t$. To this new set, one further unconstrained vector in ${\mathbb{Z}}^{t+1}$ is then added, corresponding to the loop that was added to $\vec{G}$. One can use an $SL(t+1, {\mathbb{Z}})$ transformation to take the integral vector associated with the added loop to be $( {\bm 0} , p)$, for some $p \in {\mathbb{Z}}^*$ where ${\bm 0} \in {\mathbb{Z}}^t \subset {\mathbb{Z}}^{t+1}$, with all the other integral vectors taking the form $( {\bm v}_a , 0 )$ such that they live only in the ${\mathbb{Z}}^t \subset {\mathbb{Z}}^{t+1}$ subspace. The value of the non-zero integer $p$ is not specified here and different values give rise to different polytopes that are not related by a unimodular transformation of the lattice (although the sign of $p$ can be taken positive, without loss of generality). Defining the effect of move I unambiguously for a general choice of generating set $\psi_{\vec{G}}$ would therefore require specifying $p$ as extra data. Thus it is more convenient to work within the class of generating sets $\psi_{\vec{G}}$ defined such that they contain ${\bm 0} \in {\mathbb{R}}^{t}$ and have $\langle \psi_{\vec{G}} \rangle \cong {\mathbb{Z}}^t$ so that $\Gamma_{\vec{G}}$ is trivial. An unambiguous definition of move I applied within this class is therefore to always take $p=1$. The new polytope after move I can therefore be taken as $\mbox{Conv} \left( ( {\bm v}_a , 0 ) ,( {\bm 0} , 1) \right)$ which will be denoted by $\Pi \left( \Delta_{\vec{G}} \right)$ since it corresponds to what is referred to as the [*pyramid*]{} over $\Delta_{\vec{G}}$ in the lattice polytope literature. Thus move I simply maps ${\mathcal{M}}_{\vec{G}} \rightarrow {\mathcal{M}}_{\vec{G}} \times {\mathbb{C}}$ (it would map to a cyclic quotient $\left( {\mathcal{M}}_{\vec{G}} \times {\mathbb{C}}\right) / {\mathbb{Z}}_{p}$ for any $p>1$).
### Move II {#sec:moveII}
Consider the subdivision that is depicted in Figure \[fig2\] of an arrow $a$ in a digraph $\vec{G} \in \vec{\mathfrak G}^{[t]}$. The effect this has on $\Delta_{\vec{G}}$ is to first replace the integral vector ${\bm v}_a \in \psi_{\vec{G}}$ with a pair of vectors ${\bm v}_b , {\bm v}_c \in {\mathbb{Z}}^t$. The relations between the integral vectors in $\psi_{\vec{G}}$ are only modified for the vertices $v$, $x$ and $w$ that involve the new arrows $b$ and $c$. The relations for vertices $v$ and $w$ are just as they were before but with ${\bm v}_a$ replaced respectively by ${\bm v}_b$ and ${\bm v}_c$. The relation for vertex $x$ then sets ${\bm v}_b = {\bm v}_c$. Therefore the generating set is also $\psi_{\vec{G}}$ after the subdivision. Hence move II does not effect ${\mathcal{M}}_{\vec{G}}$.
### Move III {#sec:moveIII}
Consider now the contraction shown in Figure \[fig2\] of an undirected simple arrow $a$ in a digraph $\vec{G} \in \vec{\mathfrak G}^{[t]}$ that produces the digraph $\vec{G} /a \in \vec{\mathfrak G}^{[t]}$. The effect this has on $\Delta_{\vec{G}}$ is simply to delete one of its vertices corresponding to the removal of ${\bm v}_a$ from the generating set $\psi_{\vec{G}}$ (i.e. $\Delta_{\vec{G} /a} = \mbox{Conv} \left( \psi_{\vec{G}} \, \backslash \, {\bm v}_a \right)$). Its removal is of course consistent with the relations between the elements in $\psi_{\vec{G}}$ since one can combine the two relations for the vertices $v$ and $w$ (to which $a$ is attached) into the single relation $\sum_{b \neq a} Q_{vb} \, {\bm v}_b = - \sum_{b \neq a} Q_{wb} \, {\bm v}_b \, ( = {\bm v}_a )$ for the identified vertex $v=w$. That is, one defines the charges $Q_{(v=w) \, b} = Q_{vb} + Q_{wb}$ for any arrow $b$ in $\vec{G} /a$. Since $a$ is undirected simple, any arrow $b$ in $\vec{G} /a$ could only have been connected to either $v$ or $w$ or neither in $\vec{G}$ and so $Q_{(v=w) \, b} $ is still either $\pm 1$ or $0$ and defines correctly the corresponding row in the incidence matrix for $\vec{G} /a$. Let us denote by ${\mathbb{C}}_a$ the axis in ${\mathbb{C}}^e$ associated with arrow $a$ and by $U(1)_{vw}$ the subgroup of ${\mathcal{G}}$ consisting of elements containing the identity for every $U(1)$ factor in ${\mathcal{G}}$ except for the pair associated with vertices $v$ and $w$ whose angles sum to zero. In terms of the quiver representation, move III therefore replaces ${\mathbb{C}}^e$ with ${\mathbb{C}}^e \backslash {\mathbb{C}}_a^*$ and ${\mathcal{G}}$ with ${\mathcal{G}} / U(1)_{vw}$. The subgroup $U(1)_{vw}$ intersects the kernel of the quiver representation only at the identity (since $\vec{G}$ is weakly connected) and so the effective action of ${\mathcal{H}}$ for $\vec{G}$ is replaced with the effective action of ${\mathcal{H}} / U(1)_{vw}$ for $\vec{G} /a$. Furthermore, since $\psi_{\vec{G}/a} = \psi_{\vec{G}} \, \backslash \, {\bm v}_a$ for the polytope $\Delta_{\vec{G} /a}$ then clearly $\Psi_{\vec{G}/a} = \Psi_{\vec{G}} \, \backslash \, {\bm \nu}_a$ for the polyhedral cone $\Lambda_{\vec{G} /a}$ which defines the finite abelian group $\Gamma_{\vec{G} /a} = {\mathbb{Z}}^{t+1} / \langle \Psi_{\vec{G} /a} \rangle$. Thus one arrives at the effect of move III mapping ${\mathcal{M}}_{\vec{G}}$ to $$\label{eq:holquotmoveIII}
{\mathcal{M}}_{\vec{G} /a} = \frac{\left( {\mathbb{C}}^e \, \backslash \, {\mathbb{C}}_a^* \right) \backslash \, Z_{\Lambda_{\vec{G} /a}}}{\left( {\mathcal{H}}_{\mathbb{C}}/ {\mathbb{C}}_{vw}^* \right) \times \Gamma_{\vec{G} /a}}~.$$
This move has a natural physical interpretation in terms of Higgsing’ the corresponding superconformal field theory whose gauge-inequivalent D-term vacua are described by ${\mathcal{M}}_{\vec{G}}$. This proceeds by expanding around a constant non-zero vacuum expectation value for the matter field $X_a$ associated with arrow $a$ which breaks the $U(1)_{vw}$ subgroup of the gauge symmetry. A new superconformal field theory is recovered at energy scales much lower than that set by the vacuum expectation value for $X_a$ and the Higgs branch of gauge-inequivalent D-term vacua in this new theory is precisely ${\mathcal{M}}_{\vec{G} /a}$.
### Move IV {#sec:moveIV}
Finally, let us consider the simple immersion shown in Figure \[fig8\] of a digraph $\vec{H} \in \vec{\mathfrak F}_2^{[t]}$ into another digraph $\vec{G} \in \vec{\mathfrak F}_2^{[t+1]}$. This move defines a map from the polytope $\Delta_{\vec{H}} \subset {\mathbb{R}}^t$ to another polytope $\Delta_{\vec{G}} \subset {\mathbb{R}}^{t+1}$ in the following way. First notice that identifying all the arrows $\gamma$ which $\vec{H}$ and $\vec{G}$ have in common implies there must exist a bijection between the elements of $\psi_{\vec{H}} \backslash \{ {\bm v}_\alpha , {\bm v}_\beta \}$ in ${\mathbb{Z}}^t$ and those of $\psi_{\vec{G}} \backslash \{ {\bm v}_a , {\bm v}_b , {\bm v}_c , {\bm v}_d \}$ in ${\mathbb{Z}}^{t+1}$ such that ${\mathbb{Z}}^t$ is embedded as a sublattice in ${\mathbb{Z}}^{t+1}$. It is convenient to use an $SL(t+1, {\mathbb{Z}})$ transformation to fix a basis such that the bijection is defined by writing each integral vector in $\psi_{\vec{G}} \backslash \{ {\bm v}_a , {\bm v}_b , {\bm v}_c , {\bm v}_d \}$ that is associated with an arrow $\gamma$ as $( {\bm v}_\gamma , w_\gamma )$, where ${\bm v}_\gamma$ is the corresponding integral vector in $\psi_{\vec{H}} \backslash \{ {\bm v}_\alpha , {\bm v}_\beta \}$ and $w_\gamma$ is an integer specifying the coordinate in the complementary direction to ${\mathbb{Z}}^t \subset {\mathbb{Z}}^{t+1}$. With respect to this basis, the remaining integral vectors in $\psi_{\vec{G}}$ associated with the four arrows $a$, $b$, $c$ and $d$ respectively become $( {\bm v}_\alpha , w_a )$, $( {\bm v}_\beta , w_b )$, $( {\bm v}_\alpha , w_c )$ and $( {\bm v}_\beta , w_d )$ for some integers $w_a$, $w_b$, $w_c$ and $w_d$, such that one recovers the polytope $\Delta_{\vec{H}}$ from $\Delta_{\vec{G}}$ by projecting onto the corresponding ${\mathbb{R}}^t \subset {\mathbb{R}}^{t+1}$ subspace. This projection just corresponds to the loopless splitting of vertex $v$ in $\vec{G}$ such that the respective heads of $a$ and $b$ are reconnected to the tails of $c$ and $d$ to recover the arrows $\alpha$ and $\beta$ in $\vec{H}$. Of course, there are many possible choices of integers $\{ w_a , w_b , w_c , w_ d , w_\gamma \}$ for the integral vectors in $\psi_{\vec{G}}$. It is therefore more convenient to work within the class of generating sets $\psi_{\vec{H}}$ defined such that they contain ${\bm 0} \in {\mathbb{R}}^{t}$ and have $\langle \psi_{\vec{H}} \rangle \cong {\mathbb{Z}}^t$ so that $\Gamma_{\vec{H}}$ is trivial. By taking each integer in $\{ w_a , w_b , w_c , w_ d , w_\gamma \}$ to be either $0$ or $1$, it will be seen that one is guaranteed to remain within this class of generating sets after applying move IV (i.e. $\psi_{\vec{G}}$ contains $( {\bm 0} , 0) \in {\mathbb{R}}^{t+1}$ and $\langle \psi_{\vec{G}} \rangle \cong {\mathbb{Z}}^{t+1}$ so that $\Gamma_{\vec{G}}$ is trivial). We exclude the possibility that these integers all equal $0$ or all equal $1$ because $\Delta_{\vec{G}}$ would then degenerate to a $t$-dimensional polytope in ${\mathbb{R}}^{t+1}$ that is just related to $\Delta_{\vec{H}}$ by a lattice translation. Moreover, so that the integral vectors associated with each pair of arrows $(a,c)$ and $(b,d)$ are not identical in ${\mathbb{Z}}^{t+1}$, let us demand that $w_ a + w_c = 1 = w_b + w_d$.
To examine the relations which must be obeyed by these integral vectors in $\psi_{\vec{G}}$, it will be convenient to introduce the label $A \in \{ a,b,c,d, \gamma \}$ for the arrows in $\vec{G}$. It is clear that the relations for all the components ${\bm v}_\alpha$, ${\bm v}_\beta$, ${\bm v}_\gamma$ in the ${\mathbb{Z}}^t \subset {\mathbb{Z}}^{t+1}$ sublattice for these integral vectors are precisely equivalent to those defining $\psi_{\vec{H}}$ and so are satisfied identically in $\psi_{\vec{G}}$. The only non-trivial relations that must be solved are for the binary integers $w_A \in \{ 0 , 1 \}$ and it will be helpful to think of the value $0$ or $1$ to correspond to the assignment of a colour, say, white or black to the arrow $A$. Since $\vec{G} \in \vec{\mathfrak F}_2^{[t+1]}$, at each vertex $x$ in $\vec{G}$, all these relations must take the form $w_{A_1} + w_{A_2} = w_{A_3} + w_{A_4}$ where the arrows $A_1$, $A_2$ both point to/from $x$ while arrows $A_3$, $A_4$ both point from/to $x$. Consequently, at each vertex, solutions must always have equal numbers of incoming and outgoing arrows with the same colour. Equivalently, for every incoming arrow with a given colour at any vertex in $\vec{G}$, there must be another outgoing arrow from that vertex with the same colour. This implies that arrows of a given colour must traverse circuits in $\vec{G}$ and so the general solution is specified by taking any circuit decomposition for $\vec{G}$ (which must exist since it is eulerian) and colouring each circuit either white or black. Of course, in addition, we must pay heed to the caveats that were assumed at the end of the previous paragraph. Firstly this means that we must not choose the same colour for all the circuits in the decomposition (so the decomposition must contain at least two circuits). Secondly, given that $w_ a + w_c = 1 = w_b + w_d$, the relation $w_a + w_b = w_c + w_d$ for the new vertex $v$ in $\vec{G}$ implies that both $a$ and $d$ must have the same colour whilst $b$ and $c$ must both have the opposite colour (for concreteness, let us say that $w_a = 0 = w_d$ and $w_b = 1 = w_c$ which represents no loss of generality given that we can always relabel $0 \leftrightarrow 1$ by the binary involution $w_A \mapsto 1 - w_A$). A canonical solution for all the binary integers $w_\gamma$ associated with the arrows $\gamma$ appearing in the remaining relations can then be found by utilising the results described in Section \[sec:encoding2reg\] for $2$-regular eulerian digraphs. The solution is obtained by first choosing any eulerian circuit in $\vec{H}$, which must involve some sequence of arrows of the form $( ... \alpha ... \beta ...)$. Recall that the operation of simple immersion can be understood by simply replacing this sequence with $( ... a v c ... b v d ...)$ to form an eulerian circuit in $\vec{G}$. In terms of the chord diagrams for the circle graphs associated with these eulerian circuits, the simple immersion of $\vec{H}$ in $\vec{G}$ therefore just involves inserting the new vertex $v$ at two points bisecting the arrows $\alpha$ and $\beta$ on the circumference and then connecting these two points with a new chord. Rotating the circle graph such that this new chord for $v$ is aligned vertically then the solution follows by colouring respectively white/black all the arrows around the circumference of the circle to the left/right of the chord. The choice of colour scheme is fixed by our having taken $a$ and $d$ to be white and $b$ and $c$ to be black. Furthermore, any vertex that is interlaced with $v$ in the eulerian circuit in $\vec{G}$ must have both pairs of incoming and outgoing arrows with opposite colours. Any vertex that is not interlaced with $v$ must have all four connecting arrows the same colour (the colour being white/black according to whether they lie to the left/right of $v$ in the circle graph).
By partitioning the set of arrows $\{ \gamma \}$ in $\vec{G}$ into two subsets $\{ \gamma^\circ \, | \, w_{\gamma^\circ} = 0 \}$ and $\{ \gamma^\bullet \, | \, w_{\gamma^\bullet} = 1 \}$ according to the colour assignments defined by the eulerian circuit above, one can express the polytope $\Delta_{\vec{G}} = \mbox{Conv} \left( ( {\bm v}_\alpha , 0 ), ( {\bm v}_\beta , 1 ), ( {\bm v}_\alpha , 1 ) , ( {\bm v}_\beta , 0 ) , ( {\bm v}_{\gamma^\circ} , 0 ) , ( {\bm v}_{\gamma^\bullet} , 1 ) \right) \subset {\mathbb{R}}^{t+1}$. The convex hull of the integral vectors associated with arrows $a$, $b$, $c$ and $d$ is therefore always a rectangle in $\Delta_{\vec{G}}$ which projects to the interval $\mbox{Conv} \left( {\bm v}_\alpha , {\bm v}_\beta \right)$ in $\Delta_{\vec{H}}$. Polytopes of this kind can be understood as a subclass of a well-studied class of lattice polytopes that is defined as follows. Given a set of $s+1$ lattice polytopes $\{ \Delta_0 , \Delta_1 ,..., \Delta_s \}$ in ${\mathbb{R}}^t$, take $\{ {\bf e}_0 , {\bf e}_1 ,..., {\bf e}_s \}$ to define the vertices of the unit simplex in ${\mathbb{R}}^s$ such that ${\bf e}_0$ corresponds to the origin in ${\mathbb{R}}^s$. From this data, one can define the [*Cayley polytope*]{} $\Delta_0 * \Delta_1 *...* \Delta_s = \mbox{Conv} \left( \Delta_0 \times \{ {\bf e}_0 \} , \Delta_1 \times \{ {\bf e}_1 \} ,..., \Delta_s \times \{ {\bf e}_s \} \right)$ as a lattice polytope in ${\mathbb{R}}^t \oplus {\mathbb{R}}^s$. For example, the pyramid $\Pi ( \Delta )$ over a lattice polytope $\Delta \subset {\mathbb{R}}^t$ can be thought of as the Cayley polytope $\Delta * \{ {\bm 0} \}$, where ${\bm 0} \in {\mathbb{R}}^t$ denotes the origin. Thus, by defining the pair of polytopes $\Delta_{\vec{G}}^\circ = \mbox{Conv} \left( {\bm v}_\alpha , {\bm v}_\beta , {\bm v}_{\gamma^\circ} \right)$ and $\Delta_{\vec{G}}^\bullet = \mbox{Conv} \left( {\bm v}_\alpha , {\bm v}_\beta , {\bm v}_{\gamma^\bullet} \right)$ in ${\mathbb{R}}^t$, one can express $\Delta_{\vec{G}} = \Delta_{\vec{G}}^\circ * \Delta_{\vec{G}}^\bullet$ as a Cayley polytope in ${\mathbb{R}}^{t+1}$. Notice that the generating set $\psi_{\vec{G}}$ resulting from move IV has $\langle \psi_{\vec{G}} \rangle \cong {\mathbb{Z}}^{t+1}$, having taken $\langle \psi_{\vec{H}} \rangle \cong {\mathbb{Z}}^{t}$ with the extra lattice direction spanned by the difference between the integral vectors associated with either arrows $a$ and $c$ or arrows $b$ and $d$. Since $\psi_{\vec{H}}$ was taken to contain ${\bm 0} \in {\mathbb{R}}^{t}$ then, assuming the arrow associated with this integral vector is coloured white following move IV, $\psi_{\vec{G}}$ must contain $( {\bm 0} , 0) \in {\mathbb{R}}^{t+1}$ (one can always use the binary involution relabelling $0 \leftrightarrow 1$ to define the white/black colour assignments such that this is the case).
Notice that the initial polytope $\Delta_{\vec{H}} = \mbox{Conv} \left( {\bm v}_\alpha , {\bm v}_\beta , {\bm v}_\gamma \right)$ will therefore generally not be contained in $\Delta_{\vec{G}}$. In fact, the only way to have $\Delta_{\vec{H}}$ contained as a facet in $\Delta_{\vec{G}}$ here would be if it could be identified with either $\Delta_{\vec{G}}^\circ$ or $\Delta_{\vec{G}}^\bullet$ which is only possible if all the arrows $\gamma$ could be chosen to have the same colour. Equivalently, this means that the chord associated with the new vertex $v$ introduced by simple immersion must have only arrows $a$ and $d$ to its left or only arrows $b$ and $c$ to its right in the circle graph. In either case, the polytope is given by $\Delta_{\vec{G}} = \Delta_{\vec{H}} * \mbox{Conv} \left( {\bm v}_\alpha , {\bm v}_\beta \right)$. Moreover, in this special situation, as an alternative to performing the loopless splitting of $v$, one can equivalently recover the polytope $\Delta_{\vec{H}}$ by using a combination of moves III and I. This works by first contracting one of the pair of arrows in $\vec{G}$ that have the opposite colour to all the arrows $\gamma$. This corresponds to move III although it is worth noting that both arrows in the aforementioned pair necessarily connect the vertex $v$ and one other vertex in $\vec{G}$. Hence contracting either one of these two arrows must turn the other into a loop based at the vertex which $v$ is identified with in the contraction. The polytope associated with this intermediate eulerian digraph corresponds to the pyramid $\Pi ( \Delta_{\vec{H}} )$. The final step is the removal of this loop and the resulting polytope $\Delta_{\vec{H}}$ just comes from collapsing the pyramid.
Before moving on, it is worth making a few remarks about the consistency of this prescription. As mentioned in Section \[sec:encoding2reg\], given any pair of vertices $(ij)$ that are interlaced in an eulerian circuit in $\vec{H}$, the transposition $t_{ij}$ commutes with move IV. Since any two eulerian circuits in $\vec{H}$ are related by some number of transpositions of interlaced vertices, this allowed the simple immersion of $\vec{H}$ in $\vec{G}$ to be defined unambiguously, for any choice of eulerian circuit. However, in the prescription above, an additional piece of data is defined by the subsequent white/black colour scheme assigned to arrows in $\vec{G}$ after performing move IV that is used to define the polytope $\Delta_{\vec{G}}$. Let us take this arrow colour assignment to be part of the definition of move IV and let ${\mathrm{IV}}_v$ denote this operation on an eulerian circuit in $\vec{H}$ such that the new vertex $v$ is introduced in $\vec{G}$. Generally the two $t_{ij}$-conjugate operations ${\mathrm{IV}}_v$ and $t_{ij} \, {\mathrm{IV}}_v \, t_{ij}$ on some eulerian circuit in $\vec{H}$ for which vertices $i$ and $j$ are interlaced will give rise to different coloured eulerian circuits in $\vec{G}$. That is, they still describe the same fixed sequence of labelled vertices and arrows but the assignment of white/black colours to the arrows in $\vec{G}$ will generally be different (they are only the same when $v$ is interlaced with neither $i$ nor $j$). However, it is important to stress that, by construction, the different coloured eulerian circuits in $\vec{G}$ resulting from ${\mathrm{IV}}_v$ and $t_{ij} \, {\mathrm{IV}}_v \, t_{ij}$ both generate solutions of the linear relations in for $\Delta_{\vec{G}}$. Consequently, choosing different eulerian circuits in $\vec{H}$ will generally result in different polytopes though they will always be related via some unimodular transformation and therefore give rise to the same affine toric Calabi-Yau variety ${\mathcal{M}}_{\vec{G}}$. One is therefore free to choose any eulerian circuit in $\vec{H}$ from which the colouring assignment prescribed above yields a convenient representative polytope $\Delta_{\vec{G}}$ encoding ${\mathcal{M}}_{\vec{G}}$.
### Examples {#sec:examples}
As explained at the end of Section \[sec:split2regvert\], the $2$-regular eulerian digraphs $\vec{O}_p$ depicted in Figure \[fig7\] which do not admit a loopless splitting of any of their vertices can be generated by a particular combination of moves II+I+IV. Using this fact together with the results above allows one to construct the associated polytopes $\Delta_{\vec{O}_p} \subset {\mathbb{R}}^{2p}$ recursively in the following way. For any $\vec{O}_p$, the first step is to perform move II by subdividing any one of its undirected simple arrows, which will not modify the polytope $\Delta_{\vec{O}_p}$. The next step is to perform move I by adding a loop based at the new vertex, and the associated polytope is given by the pyramid $\Pi( \Delta_{\vec{O}_p} ) \subset {\mathbb{R}}^{2p+1}$. The final step requires first a choice of eulerian circuit in this intermediate digraph. However, from Figure \[fig7\] it is clear that any eulerian circuit in $\vec{O}_p$ must traverse vertices in the sequence $(12123434...(2p-1)(2p)(2p-1)(2p))$. Since the subdivided arrow must have pointed from a vertex $2i$ to $2i+1$ in this sequence (for some $i \in \{ 1,...,p \}$ and identifying labels modulo $2p$) then the effect of the previous moves II+I here is just to replace $(...(2i)(2i+1)...)$ with $(...(2i)ww(2i+1)...)$, where $w$ is the label for the new vertex. One must then identify the loop based at $w$ with $\alpha$ and the arrow whose tail is attached to $w$ with $\beta$ to perform the relevant simple immersion corresponding to the final move IV. Thus, the relevant vertex and arrow labels must appear in the order $(...(2i)w \alpha w \beta (2i+1)...)$ in the eulerian circuit which gets replaced with $(...(2i)w a v c w b v d (2i+1)...)$ under move IV, following again the notation in Figure \[fig8\]. This means that only arrows $b$ and $c$ are coloured black in the resulting eulerian circuit in $\vec{O}_{p+1}$ which has resulted from applying this combination of moves II+I+IV to $\vec{O}_p$. Therefore the polytope for $\vec{O}_{p+1}$ can be written $\Delta_{\vec{O}_{p+1}} = \Pi ( \Delta_{\vec{O}_p} ) * \mbox{Conv} \left( {\bm v}_\alpha , {\bm v}_\beta \right) \subset {\mathbb{R}}^{2(p+1)}$. It is worth remarking that it is precisely the four arrows $a$, $b$, $c$ and $d$ in this construction that describe the extra block in $\vec{O}_{p+1}$ relative to $\vec{O}_p$ and that $\mbox{Conv} \left( {\bm v}_a , {\bm v}_b , {\bm v}_c , {\bm v}_d \right)$ lies in a plane ${\mathbb{R}}^2 \subset {\mathbb{R}}^{2(p+1)}$ which intersects $\Delta_{\vec{O}_p}$ only at the lattice point ${\bm v}_d$. It is convenient to take this point to be the origin in ${\mathbb{R}}^{2(p+1)}$ and so $\mbox{Conv} \left( {\bm v}_a , {\bm v}_b , {\bm v}_c , {\bm v}_d \right)$ can be taken to describe the unit square in the aforementioned plane. Up to a unimodular transformation, the structure of the general polytope $\Delta_{\vec{O}_p}$ can therefore be obtained by iterating this result. That is, by thinking of $\vec{O}_p$ as a chain of $p$ blocks containing 4 arrows each as in Figure \[fig7\], one associates to each block the unit square in a plane ${\mathbb{R}}_i^2 \subset {\mathbb{R}}^{2p}$ such that $\bigcap_{i=1}^p {\mathbb{R}}_i^2 = {\bm 0} \in {\mathbb{R}}^{2p}$ and then $\Delta_{\vec{O}_p}$ is just the convex hull of the corners of all these squares. Clearly the generating set $\psi_{\vec{O}_p}$ contains ${\bm 0} \in {\mathbb{R}}^{2p}$ and has $\langle \psi_{\vec{O}_p} \rangle \cong {\mathbb{Z}}^{2p}$ so that $\Gamma_{\vec{O}_p}$ is trivial.
A similar recursive technique can be utilised to describe the structure of the polytopes associated with the second class of $2$-regular eulerian necklace’ digraphs shown in Figure \[fig5\] which contain no undirected simple arrows. Let us denote by $\vec{A}_t$ the necklace digraph of this type on $t$ vertices. By selecting any pair of oppositely oriented arrows connecting vertices $i$ and $i+1$ in $\vec{A}_t$ (for some $i \in \{ 1,...,t \}$ and identifying labels modulo $t$) then performing move IV on them will produce the necklace digraph $\vec{A}_{t+1}$. If one identifies this pair of arrows with $\alpha$ and $\beta$ in Figure \[fig8\] then one can define an eulerian circuit in $\vec{A}_t$ by the sequence $(... (i-1) i \alpha (i+1) \beta i (i-1) ... (i+2)(i+1)(i+2)...)$ (displaying only the labels for arrows $\alpha$ and $\beta$). The chord associated with the vertex $i+1$ in the circle graph for this eulerian circuit is therefore interlaced with the chords for all the other vertices though none of these other chords are interlaced with each other. Performing move IV replaces the sequence with $(... (i-1) i avc (i+1) bvd i (i-1) ... (i+2)(i+1)(i+2)...)$ which defines an eulerian circuit in $\vec{A}_{t+1}$. Again, the chord for vertex $i+1$ is interlaced with all the others, including the new one for vertex $v$, while none of these other chords are interlaced with each other. Thus, only arrows $b$ and $c$ are to be coloured black here and so the associated polytope can be written $\Delta_{\vec{A}_{t+1}} = \Delta_{\vec{A}_t} * \mbox{Conv} \left( {\bm v}_\alpha , {\bm v}_\beta \right) \subset {\mathbb{R}}^{t+1}$ and one can take $\mbox{Conv} \left( {\bm v}_\alpha , {\bm v}_\beta \right)$ to be the unit interval $[0,1]$. Consequently, one can express $\Delta_{\vec{A}_t} = \underbrace{[0,1] * [0,1] * ... * [0,1]}_{t} \subset {\mathbb{R}}^t$. This is known as a (narrow) [*Lawrence prism*]{} in the lattice polytope literature and can be equivalently expressed as $\Delta_{\vec{A}_t} = \sigma_{t-1} * \sigma_{t-1}$ in terms of the unit simplex $\sigma_{t-1} \subset {\mathbb{R}}^{t-1}$. The generating set $\psi_{\vec{A}_t}$ therefore contains ${\bm 0} \in {\mathbb{R}}^{t}$ and has $\langle \psi_{\vec{A}_t} \rangle \cong {\mathbb{Z}}^{t}$ since the vertices of either copy of $\sigma_{t-1}$ together with the unit interval connecting them form a ${\mathbb{Z}}$-basis.
The polytopes associated with the first class of $2$-regular eulerian necklace’ digraphs in Figure \[fig5\] can be described in a similar manner. Denoting by $\vec{B}_t$ the necklace digraph of this type on $t$ vertices then performing move IV on any pair of arrows connecting vertices $i$ and $i+1$ in $\vec{B}_t$ (for some $i \in \{ 1,...,t \}$ and again identifying labels modulo $t$) will produce $\vec{B}_{t+1}$. Identifying this pair of arrows with $\alpha$ and $\beta$ in Figure \[fig8\] then they must appear in the sequence $(... (i-1) i \alpha (i+1) (i+2) ... (i-1) i \beta (i+1) (i+2) ...)$ in an eulerian circuit in $\vec{B}_t$ (i.e. ignoring arrow labels, there is only one possible eulerian circuit in $\vec{B}_t$ formed by traversing all the vertices in order twice). The interlace graph for this eulerian circuit in $\vec{B}_t$ is therefore the complete graph $K_t$ on $t$ vertices and move IV replaces the sequence with $(... (i-1) i avc (i+1) (i+2) ... (i-1) i bvd (i+1) (i+2) ...)$ defining the corresponding eulerian circuit in $\vec{B}_{t+1}$ whose interlace graph is $K_{t+1}$. Let us now introduce the labels $i$ and $t+i$ for the pairs of arrows connecting vertices $i$ and $i+1$ in $\vec{B}_t$. The linear relations in for the polytope $\Delta_{\vec{B}_t}$ say that the integral vectors must obey $\bm{v}_i + \bm{v}_{t+i} = \bm{u}$ for all $i=1,...,t$ in terms of some fixed $\bm{u} \in {\mathbb{Z}}^t$. The corresponding equations for $\Delta_{\vec{B}_{t+1}}$ following move IV say that each pair of arrows $i$ and $t+i$ in $\vec{B}_t$ must have opposite colours (i.e. $w_i + w_{t+i} = 1$ for all $i=1,...,t$). Since any $\vec{B}_t$ can be constructed by simply repeating this operation then clearly one can take the vector $\bm{u}$ above to contain only unit entries with all the components of $\bm{v}_i$ and $\bm{v}_{t+i}$ being either zero or one. Consequently, for each $i$, the pair of vectors $\bm{v}_i$ and $\bm{v}_{t+i}$ can be taken to end on opposite corners of the unit hypercube $[0,1]^t \subset {\mathbb{R}}^t$ and the representative polytope $\Delta_{\vec{B}_t}$ obtained from this construction is defined by $\bm{v}_1 = {\bf e}_0$ and $\bm{v}_i = \sum_{j=2}^i {\bf e}_j$ for $i=2,...,t$, where $\{ {\bf e}_0 , {\bf e}_1 ,..., {\bf e}_t \}$ define the vertices of the unit simplex $\sigma_t \subset {\mathbb{R}}^t$ with ${\bf e}_0$ corresponding to the origin in ${\mathbb{R}}^t$. The generating set $\psi_{\vec{B}_t}$ clearly has $\langle \psi_{\vec{B}_t} \rangle \cong {\mathbb{Z}}^{t}$ with ${\bf e}_1 = \bm{v}_{2t}$ and ${\bf e}_i = \bm{v}_i - \bm{v}_{i-1}$ for $i=2,...,t$. The corresponding toric Calabi-Yau variety ${\mathcal{M}}_{\vec{B}_t}$ can be expressed as the real metric cone over the compact homogeneous Sasaki-Einstein manifold $SU(2)^t / U(1)^{t-1}$. This can be easily seen by considering the intersection of solutions of the moment map equation for $\vec{B}_t$ (i.e. $| X_i |^2 + | X_{t+i} |^2 = r$ for all $i=1,...,t$ in terms of some $r \in {\mathbb{R}}_{>0}$) with the round unit-radius $(4t-1)$-sphere canonically embedded in ${\mathbb{C}}^{2t}$ via $\sum_{i=1}^t | X_i |^2 + | X_{t+i} |^2 = 1$. The intersection fixes $r=1/t$ and describes the product of $t$ copies of $S^3 \cong SU(2)$ (each with radius $\frac{1}{\sqrt{t}}$). The quotient by $U(1)^{t-1}$ then follows in the Kähler quotient construction of ${\mathcal{M}}_{\vec{B}_t}$ as precisely the group ${\mathcal{H}}$ which acts effectively on the intersection above, corresponding to the quotient of the maximal torus $U(1)^t \subset SU(2)^t$ by its diagonal $U(1)$ subgroup. For $t=2,3$, these homogeneous Sasaki-Einstein geometries are often denoted by $T^{1,1}$ and $Q^{1,1,1}$ in the physics literature and appear in the well-known supersymmetric $AdS_5 \times T^{1,1}$ and $AdS_4 \times Q^{1,1,1}$ solutions of IIB string theory and M-theory respectively.
Acknowledgments {#acknowledgments .unnumbered}
===============
I would like to thank José Figueroa-O’Farrill, Amihay Hanany and Dario Martelli for some helpful discussions, Charles Boyer for email correspondence and Elena Méndez-Escobar for collaboration during the early stages of this work. I am also grateful to the members of the Institute for the Physics and Mathematics of the Universe (IPMU) for their kind hospitality during the conception of this work. This research was supported in part by grant ST/G000514/1 “String Theory Scotland” from the UK Science and Technology Facilities Council.
|
WASHINGTON, D.C.— Cascading from the heights of the Talamanca Mountains, the Changuinola River forms the heart of the Panamanian portion of La Amistad International Park, a UNESCO World Heritage Site that provides habitat for hundreds of rare, endemic, endangered and migratory species, as well as the indigenous Ngöbe and Naso tribes.
AES Corp., a Virginia-based company, plans to build three hydroelectric dams on the Changuinola, threatening to forever ruin this ecological gem. AES is building the dams on the Changuinola – which runs through the La Amistad Biosphere Reserve – in an effort to gain carbon-offset credits. The first of the dams will flood four Ngöbe villages and create impassible barriers for fish species the tribes rely upon, such as the mountain mullet and the bocachica.
“No other time in the history of Panama has a project been developed with so much disregard for the environment, human rights, and indigenous peoples as the Chan 75 hydroelectric project by AES Corporation. The Company and its Danish contractors are practically building on top of the people of Charco de La Pava, as if their lives and properties had no value,” said Osvaldo Jordan of Alianza para la Conservación y el Desarrollo (Alliance for Conservation and Development), one of the groups fighting to protect the tribes.
Because Panama lacks adequate legal mechanisms for indigenous people to obtain title to their land – even though Panama’s Constitution expressly recognizes indigenous peoples’ rights to their traditional lands – and because indigenous people have failed to gain traction in Panamanian administrative and penal processes, the Alliance for Conservation and Development, and three other advocacy groups, submitted a petition to the Inter-American Commission on Human Rights. Consequently, the IACHR has scheduled a public hearing for 9 a.m. Tuesday in Washington.
“What is most tragic about the dam construction and the oppression of the Ngöbe and Naso communities is that the destruction of their land is being done in the name of fighting climate change … it’s the most shameful form of greenwashing,” said Jacki Lopez, a legal researcher from the Center for Biological Diversity, a group that authored an amicus brief to the IACHR on behalf of the tribes.
The IACHR has consistently held that governments must recognize indigenous land claims and develop mechanisms to obtain land titles. With the social impacts of the dam construction to include the forced displacement of more than 1,000 Ngöbe indigenous people, and impairment to the livelihoods of 4,000 more, a favorable IACHR decision could be the boost the tribes need. Already, the Ngöbe people have suffered beatings, arbitrary detention, public humiliation and threats by local police to expedite the dam construction. And according to the tribe, AES has failed to obtain their free, prior, informed consent to take the land.
The immediate environmental impacts of the dam constructions are expected to include the destruction of riverine and forest ecosystems, including harm to fish and shrimp biodiversity, by blocking migrations between the San San-Pond Sak Wetlands, a Ramsar Convention site and the Reserve. The long-term effects are lesser known, but are expected to include an increase in methane production, a powerful greenhouse gas.
The AES Corp. has applied for “green company” status with GES Investment Services, a green investment company in Western Europe. However, a growing body of scientific evidence reveals that dams dramatically increase – rather than decrease – overall greenhouse gas emissions. The science shows there is a link between reservoirs and methane gas emissions related to resulting vegetation decomposition, making reservoirs significant contributors to overall greenhouse gas emissions.
The Center for Biological Diversity is a national nonprofit conservation organization with nearly 200,000 members and online activists dedicated to the protection of endangered species and wild places.
At least 2 of the dams are now under construction. However, a case is pending in the Inter-American Commission on Human Rights in which members of both the Ngobe communities affected by the Chan 75 dam and the Naso communities affected by the Bonyic dam presented their complaints. You might find more information at burica.wordpress.com. Thanks for the comment and your interest! |
Q:
Magento Custom Backend module Grid sort/filter problem
I am working on a custom admin module where I show a list of customers based on a custom attribute, the grid loads fine but then I am having problems whenever I try to sort/filter the grid.
This is the error I am getting :
Fatal error: Call to a member function toHtml() on a non-object in <b>/***/***/public_html/***/app/code/local/BelVG/Events/controllers/CodesController.php</b> on line <b>28</b>
This is the code that causes the error in the CodesController file :
public function customerGridAction() {
$this->loadLayout();
$this->getResponse()->setBody($this->getLayout()->getBlock('events.codes.edit.customer')->toHtml());
}
XML layout file:
<events_codes_edit>
<reference name="content">
<block type="events/codes_edit" name="events.codes.edit" template="events/codes/edit.phtml">
<block type="events/codes_edit_customer" name="events.codes.edit.customer" as="customer"/>
</block>
</reference>
</events_codes_edit>
<events_codes_edit_customergrid>
<remove name="root"/>
<block type="events/codes_edit_customer" name="events.codes.edit.customer" as="events.codes.edit.customer"/>
</events_codes_edit_customergrid></code>
Class file for the Grid:
class BelVG_Events_Block_Codes_Edit_Customer extends Mage_Adminhtml_Block_Widget_Grid
{
public function __construct() {
parent::__construct();
$this->setId('events_codes_edit_product');
$this->setUseAjax(true);
$this->setDefaultSort('entity_id');
$this->setDefaultDir('asc');
$this->setSaveParametersInSession(true);
}
protected function _prepareCollection()
{
$current_code = Mage::registry('current_code');
$code = $current_code->getCode();
$collection = Mage::getResourceModel('customer/customer_collection')
->addNameToSelect()
->addAttributeToSelect('email')
->addAttributeToSelect('i_code')
->addAttributeToSelect('gender')
->addFieldToFilter('i_code', $code)
->joinAttribute('billing_postcode', 'customer_address/postcode', 'default_billing', null, 'left')
->joinAttribute('billing_city', 'customer_address/city', 'default_billing', null, 'left')
->joinAttribute('billing_telephone', 'customer_address/telephone', 'default_billing', null, 'left')
->joinAttribute('billing_region', 'customer_address/region', 'default_billing', null, 'left')
->joinAttribute('billing_country_id', 'customer_address/country_id', 'default_billing', null, 'left');
$this->setCollection($collection);
return parent::_prepareCollection();
}
protected function _prepareColumns() {
$this->addColumn('entity_id', array(
'header' => Mage::helper('customer')->__('ID'),
'width' => '50px',
'index' => 'entity_id',
'type' => 'number'
));
$this->addColumn('name', array(
'header' => Mage::helper('customer')->__('Name'),
'index' => 'name'
));
$this->addColumn('email', array(
'header' => Mage::helper('customer')->__('Email'),
'width' => '150',
'index' => 'email'
));
$this->addColumn('Telephone', array(
'header' => Mage::helper('customer')->__('Telephone'),
'width' => '100',
'index' => 'billing_telephone'
));
$this->addColumn('billing_postcode', array(
'header' => Mage::helper('customer')->__('ZIP'),
'width' => '90',
'index' => 'billing_postcode'
));
$this->addColumn('billing_country_id', array(
'header' => Mage::helper('customer')->__('Country'),
'width' => '100',
'index' => 'billing_country_id'
));
$this->addColumn('billing_region', array(
'header' => Mage::helper('customer')->__('State/Province'),
'width' => '100',
'index' => 'billing_region'
));
$this->addColumn('gender', array(
'header' => Mage::helper('customer')->__('Gender'),
'align' => 'center',
'index' => 'gender'
));
return parent::_prepareColumns();
}
public function getGridUrl() {
return $this->getUrl('*/*/customergrid', array('_current'=> true));
}
}
This grid is first called inside another block, which is Edit.php, and it's called from a template file edit.phtml
Edit.php block class:
class BelVG_Events_Block_Codes_Edit extends Mage_Core_Block_Template {
public function getGridHtml() {
return $this->getChild('customer')->toHtml();
}
}
Code for calling the customer grid inside edit.phtml:
<div id="" class="fieldset">
<div class="hor-scroll">
<?php echo $this->getGridHtml() ?>
</div>
</div>
I have no idea why this is happening, I have double checked the block name in the controller, and the layout files and they seem to be matching, I even tried to use createBlock() instead of getBlock() and pointed directly to the block file, but still it showed the exact same error.
Can anyone point me in the right direction?
A:
I am not sure what your module/controller/action path looks like, but I would say that you have made something wrong in your xml at:
<events_codes_edit_customergrid>
I am guessing this should say
<events_codes_customergrid>
But anyhow. this is not really required if you want to get the html for one particular block. What I recommend doing is, use the layout class to create the block and then show it.
This usually works for all grid blocks, as they have the Collection instance defined inside the class.
so try using
$this->getResponse()->setBody($this->getLayout()->createBlock('events/codes_edit_customer')->toHtml());
|
Method for measuring the concentration of urinary proteins according to their molecular size category.
We combined the use of a concentrating device (Minicon) and polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate to semi-quantitate the concentration of (a) the collective low-molecular-weight proteins and (b) of albumin excreted in the urine of patients after renal transplantation. Analytical recovery of many serum proteins from samples concentrated 100-fold in the Minicon apparatus was about 70%. It was possible to examine many urine samples by polyacrylamide gel electrophoresis after concentration with this device. The reproducibility (CV) of the technique was on the order of 20% when albumin and low-molecular-weight protein were in about equal concentration. The method was adequate to differntiate glomerular and tubular proteinuria, because in glomerular proteinuria the ratio of albumin to low-molecular-weight proteins is about 20/1, whereas in tubular proteinuria the ratio is about 1/1. |
Q:
Which is better Struts or Spring and Why?
I am a Java developer working on Swing API. I have some knowledge of JSp and Servlet.
I wanna learn a framework. I want to know which one is better, Struts or Spring.And what about Apache's wicket.
Thanks in advance
A:
It depends on what you want to learn them for. Struts is a lot simpler, or maybe just smaller, so it might be better to start with.
Struts is a Web framework and it's usually used simply to define the Controllers and render the views, in an MVC architecture. Here's more about MVC Architectures if you need it. So you ususally need to combine it with other frameworks, such as Hibernate and EJBs to finish off your project.
Spring is huge, it's more like an entire platform. It has all kinds of modules, but you don't have to use all of them. Spring MVC would be a good starting point and the equivalent of Struts, and from there you could pick other modules, such as Spring Security and Spring Data, to tailor to your project's needs.
Here's more about Spring.
|
Here is the Calpine model. Give me a call if you have any questions. Have
not gotten the power curve or the VOM. Thanks
Ben |
While communication with the audience or group of people, most of us use gestures to drive our point, sometimes our gestures speak louder than our words. Experts believe that your stance and gestures are arguably more important than what you actually say.
According to Daily Mail, with right kind of gestures, you can captivate your audience because your gestures enhance your confidence. Here we look at the five gestures that will make you likeable and credible at the same time.
1. Gesturing towards the audience
Eye contact is something which is very important while addressing the gathering. This kind of gesture helps engage your audience effectively. Gesturing towards audience or gathering increases their attention and also helps them connect with you immediately. What is important is that you must look around at the audience in order to make eye contact. Eye contact not only ensure audience involvement but also gives you an opportunity to ask for their feedback that leads to interaction. Pointing towards the audience shows your confidence.
2. Putting hand on Heart
Touching your heart while addressing a gathering shows your sincerity and intense conviction. This kind of gesture makes your audience believe you and engage them with what you are saying. Pairing these gestures with a smile or an animated facial expression allows the audience to connect with you emotionally and warmly. You can see social activist and Nobel Prize winner Malala Yousafzai often touching her heart.
3. Raising hands above waist level
This kind of gesture allows you to better direct and signal the points you are making. It also shows an open personality and a willingness to engage with the audience. Strong gestures can also aid in keeping the audience's attention focused on the story being told or points being made.
4. Leaning in towards the audience
Leaning in towards the audience with your head forward shows your eagerness to relay your information to the audience and your level of comfort while speaking with them. Pushing your head forward also shows that you have lots of ideas and thoughts. By raising the head or shoulders, help you emphasise the points you are making. Former US president Barack Obama is a perfect example of this particular gesture.
5. Maintaining a symmetrical stance
It is very important to stay natural and use the space available while speaking to an audience. This gesture shows your comfort level and also your confidence. The audience is more likely to absorb information from someone they view as balanced and confident.
For more interesting stories download the Lopscoop application from Google Play Store and earn extra money by sharing it on social media. |
Experimental infection of sheep with Mycoplasma ovipneumoniae and Pasteurella haemolytica.
A group of Caesarian-derived, colostrum-deprived lambs was inoculated intranasally and intratracheally with a virulent Mycoplasma ovipneumoniae isolate selected from ovine mammary studies and propagated in an ovine mammary gland. Other groups of lambs were inoculated with M. ovipneumoniae in combination with Pasteurella haemolytica type Al or P. haemolytica alone. The M. ovipneumoniae isolate alone did not induce any specific pneumonic lesions in the lambs and when combined with P. haemolytica type Al did not increase the severity of the P. haemolytica-type lesions. Fifty percent of lambs inoculated with P. haemolytica developed a purulent and exudative bronchopneumonia with pleurisy and high titres of P. haemolytica were recovered from these lesions. |
Company email (January 2012):
"I confirm you that all the products branded as La Gioiosa are suitable both for vegan and vegetarian people. La Gioiosa does not use any type of animal ingredients nor animal products during the production of its wines." |
If you have been reading my blog for a while you already know that we started the Journey for baby #2 a little over a year ago. We both went on a ketogenic weight loss journey in August to see if that would help our chances. In May we made a huge life change of moving from New York City to Texas so TTC took a place on the back burner for a couple of months. Now that we are settled and happy in Texas, TTC is fresh on our minds for baby #2.
Since I am in my late 30s and my husband is in his early 40s we are doing everything possible to give us the best chances to become pregnant as soon as possible. I used The Stork OTC on the best day for me to conceive according to my basal temperatures and ovulation charts. We wanted to try everything possible before seeking help from a doctor so The Stork OTC was the perfect conception aid for us.
The Stork OTC is an at-home conception aid that helps couples conceive naturally without the help or expense of a doctor's visit. You can easily buy The Stork OTC over-the-counter at stores like CVS. The Stork OTC helps get the sperm exactly where it needs to be for the best chance of conception. The instructions are super easy to follow and the design of the conception aid really makes it goof-proof.
We used it a few days ago and it was really easy and comfortable to do. I love that after using it I could get up and do my normal household routine while waiting the 4 to 6 hours. I am really anxious and hopeful that I will see positive results in a couple of weeks.
Go to StorkOTC.com for more information and find out where you can purchase it for yourself. You can also buy 1, Get 1 50% off with code STORK50 at CVS.com for the months of July and August.
Join me on July 20 at 8pm EST for a Twitter Party using #successwithStorkOTC. Click to RSVP and join the party for a night of learning and prizes.
One of my favorite things about living a ketogenic lifestyle is that I get to eat bacon and still lose weight. Since I am eating a high fat and low carb diet, bacon is one of the top foods to eat because it fits the macros of a ketogenic diet.
When my best friend and I were talking about my journey on the ketogenic diet she quickly told me that she could make me a custom beaded charm of bacon! Since bacon is basically the mascot of the ketogenic lifestyle I got super excited to proudly display my love for bacon.
My best friend Angela has been creating customized beaded jewelry for quite some time now. She takes the time to create exactly what you want by designing a chart and giving you different color options. After the design is approved she creates each design, one bead at a time using the best materials. She mostly uses delica seed beads, size 11, and Fireline 17lb pull thread. Swarovski Pearls and jewels are also used in some of her designs.
Alexiwing Designs accepts custom orders through Etsy, Instagram, and/or Facebook page. You can also email her at angela@alexiwing.com
About Me
I am a first time mom of a little girl. During the journey of having my baby I gained baby weight and then some. Join me on my journey as I try to lose the weight while juggling the craziness of being a first time mom. |
using System;
using System.Collections.Generic;
using System.Linq;
using System.Text;
namespace PeNet.FileParser
{
public class BufferFile : IRawFile
{
private byte[] _buff;
public long Length => _buff.Length;
public BufferFile(byte[] file)
=> (_buff) = (file);
public string ReadAsciiString(long offset)
{
static int GetCStringLength(IReadOnlyList<byte> buff, int stringOffset)
{
var currentOffset = stringOffset;
var currentLength = 0;
while (buff[currentOffset] != 0x00)
{
currentLength++;
currentOffset++;
}
return currentLength;
}
var length = GetCStringLength(_buff, (int) offset);
var tmp = _buff.AsSpan((int)offset, length);
return Encoding.ASCII.GetString(tmp);
}
public Span<byte> AsSpan(long offset, long length)
=> _buff.AsSpan((int) offset, (int) length);
public string ReadUnicodeString(long offset)
{
var size = 1;
for (var i = offset; i < _buff.Length - 1; i++)
{
if (_buff[i] == 0 && _buff[i + 1] == 0)
{
break;
}
size++;
}
var bytes = _buff.AsSpan((int) offset, size);
return Encoding.Unicode.GetString(bytes);
}
public string ReadUnicodeString(long offset, long length)
{
var bytes = _buff.AsSpan((int) offset, (int) length * 2);
return Encoding.Unicode.GetString(bytes);
}
public byte ReadByte(long offset) => _buff[offset];
public uint ReadUInt(long offset)
=> BitConverter.ToUInt32(_buff, (int) offset);
public ulong ReadULong(long offset)
=> BitConverter.ToUInt64(_buff, (int) offset);
public ushort ReadUShort(long offset)
=> BitConverter.ToUInt16(_buff, (int) offset);
public void WriteByte(long offset, byte value)
{
_buff[offset] = value;
}
public void WriteBytes(long offset, Span<byte> bytes)
{
Array.Copy(bytes.ToArray(), 0, _buff, offset, bytes.Length);
}
public void WriteUInt(long offset, uint value)
{
var x = BitConverter.GetBytes(value);
_buff[offset] = x[0];
_buff[offset + 1] = x[1];
_buff[offset + 2] = x[2];
_buff[offset + 3] = x[3];
}
public void WriteULong(long offset, ulong value)
{
var x = BitConverter.GetBytes(value);
_buff[offset] = x[0];
_buff[offset + 1] = x[1];
_buff[offset + 2] = x[2];
_buff[offset + 3] = x[3];
_buff[offset + 4] = x[4];
_buff[offset + 5] = x[5];
_buff[offset + 6] = x[6];
_buff[offset + 7] = x[7];
}
public void WriteUShort(long offset, ushort value)
{
var x = BitConverter.GetBytes(value);
_buff[offset] = x[0];
_buff[offset + 1] = x[1];
}
public byte[] ToArray() => _buff;
public void RemoveRange(long offset, long length)
{
var x = _buff.ToList();
x.RemoveRange((int) offset, (int) length);
_buff = x.ToArray();
}
public int AppendBytes(Span<byte> bytes)
{
var oldLength = _buff.Length;
Array.Resize(ref _buff, _buff.Length + bytes.Length);
Array.Copy(bytes.ToArray(), 0, _buff, oldLength, bytes.Length);
return oldLength;
}
}
}
|
Tribal advocates sought to attach the IHCIA to the federal budget resolution and to other pieces of must-pass legislation. But with a final vote on the $700 billion financial bailout set for this afternoon, it looks like Indian Country will have to wait for the next Congressional session for action.
"Indian country’s health care system is so poor that cancer is being misdiagnosed as depression," National Congress of American Indians President Joe Garcia said in a recent Indian Country Today column.
Opposition from the Bush administration and from some Republican Senators kept Congress from reauthorizing the IHCIA for much of the past seven years. The Senate was finally able to pass the bill in February but it never got a vote on the House floor. |
<?php
/**
* Created by IntelliJ IDEA.
* User: chuxiaofeng
* Date: 17/5/24
* Time: 下午7:54
*/
$redis_pool = new \swoole_connpool(\swoole_connpool::SWOOLE_CONNPOOL_REDIS);
$r = $redis_pool->setConfig([
"host" => "127.0.0.1",
"port" => 6379,
"connectTimeout" => 1,
]);
assert($r === true);
$r = $redis_pool->createConnPool(1, 1);
assert($r > 0);
//swoole_timer_after(1, function() {
// swoole_event_exit();
//}); |
The present disclosure relates to a method for removing burrs of a sand core for casting.
A sand core for casting (hereinafter also referred to as a “casting sand core”) is molded inside a plurality of divided dies. Therefore, burrs are formed on the casting sand core along a surface on which the dies are joined to each other, i.e., along a parting surface of the dies. Needless to say, it is necessary to remove the burrs from the casting sand core. Japanese Unexamined Patent Application Publication No. H7-136739 discloses a method in which burrs are removed while rotating a bundle of metal wires attached to a tip of a rotation shaft. |
PAM
News
US & KSA Commit to Advancing Clean Fuels
U.S. Secretary of Energy Rick Perry was received by H.E. Khalid Al Falih, Saudi Minister of Energy, Industry, and Mineral Resources, during his visit to the Kingdom of Saudi Arabia. The two parties discussed means to enhance the relations between the two countries in the energy fields, including cooperation opportunities in clean energy. In this regard, the Minister and the Secretary signed a Memorandum of Understanding (MOU) to establish a framework for mutually beneficial cooperation in the area of clean fossil fuels and carbon management.
“After a productive and informative visit to the Kingdom, today the United States and our friend Saudi Arabia enter an exciting new phase in our energy partnership, building on our collective success with an eye to the future,” said Secretary Perry. “This MOU outlines a future alliance not only in supercritical carbon dioxide, but also in a range of clean fossil fuels and carbon management opportunities. Together through the development of clean energy technologies our two countries can lead the world in promoting economic growth and energy production in an environmentally responsible way. I thank Minister Al Falih and the rest of my Saudi hosts for their hospitality and look forward to working together in the months and years to come.”
Also commenting on the visit, H.E. Al Falih said: “As I thank HE Secretary Perry for this important visit, I would like to express my deep gratitude for his continuous support to the cooperation between the two friendly countries in the energy fields. The potential of this cooperation has no limits and its positive impact on the global economy, environment, and energy supplies is so great. The signing of this MOU reflects one of the valuable opportunities this cooperation can avail.”
“The MOU also underscores the Kingdom’s leadership role in clean energy deployment at scale, venturing, and international collaborations to advance innovation in clean energy technology. This also highlights the Ministry’s commitment to maintaining its national contributions on enhancing clean energy technologies that would enable sustainable development in line with Saudi Vision 2030, the national economic diversification plan, and fulfill its responsibilities as a global energy producer and exporter,” said Minister Al Falih.
Al Falih also pointed that to achieve the objective outlined in the MOU, the two countries will exchange experts, engineers, and scientists, along with facilitate the transfer of technology. The MOU will also encourage the organization of joint seminars and workshops, as well as visits by experts to facilities, such as research laboratories, institutes, and industrial sites.
The MOU covers many technical fields in this regard including supercritical carbon dioxide (sCO2) power cycles; carbon capture, utilization, and storage (CCUS); chemical looping and oxy-combustion; the energy-water nexus, as well as other areas of mutual interest related to clean fossil fuels and carbon management. |
No. SD 33207.
Decided: June 23, 2014
Anne Louise Currie (“Defendant”) appeals from the trial court's denial of her motion seeking an order nunc pro tunc. Defendant's arguments are based on the failure to recognize that her case is governed by Section 558.0191 rather than by Section 558.016 and Section 558.021, RSMo (2000). Because Defendant's arguments are without merit, we affirm the trial court's order.
Factual and Procedural Background
In 2001, Defendant was charged with first-degree robbery after she held up a beauty shop at gunpoint. Defendant subsequently pleaded guilty without the benefit of a plea agreement. On August 30, 2002, the trial court sentenced Defendant to 18 years in the Missouri Department of Corrections. The judgment stated Defendant “was not charged as a prior, persistent or class X offender.”
Defendant received a letter dated August 15, 2013, regarding her parole eligibility from a records officer of the Department of Corrections. That letter stated:
RSMo 558.019.3 states in part ․ “any offender who has pleaded guilty to or has been found guilty of a dangerous felony as defined in section 556.061, RSMo, and is committed to the department of corrections shall be required to serve a minimum prison term of eighty-five percent of the sentence imposed by the court ․”
You pled guilty to the charge of Robbery 1st Degree on June 28, 2002. As defined in statute, your charge is a dangerous felony and you are required to serve 85% before you are eligible for parole.
On October 17, 2013, Defendant filed a motion for an order nunc pro tunc, requesting the trial court to direct the Department of Corrections that her “sentence is not to be executed as an extended sentence as a prior, persistent or dangerous offender status.” In support, Defendant alleged she had not been charged under Section 558.021, RSMo (2000), and the Department of Corrections had “reclassified [her] case” to require her to serve eighty-five percent of her sentence before becoming eligible for parole. Defendant attached to her petition a copy of the August 15 letter and a copy of the judgment in her criminal case.
On November 26, 2013, the trial court denied the motion. This appeal follows.
Discussion
Defendant raises two points on appeal. In her first point, Defendant argues the trial court abused its discretion in denying her motion for an order nunc pro tunc because the Missouri Department of Corrections altered the judgment in Defendant's case to add a dangerous offender designation. In her second point, Defendant argues the trial court abused its discretion in denying Defendant's motion for an order nunc pro tunc because any statute or regulation granting the Missouri Department of Corrections the authority to alter a criminal judgment violates due process. Both of these points fail because they rely on the same misunderstanding of the statutory framework. When the facts of this case are viewed in light of a correct understanding of the statutory framework, it is clear the Missouri Department of Corrections did not alter the judgment in Defendant's case.
This Court reviews the denial of a motion for an order nunc pro tunc for an abuse of discretion. See State v. Young, 235 S.W.2d 369, 370–71 (Mo.1950). Clerical errors in the sentence and judgment in a criminal case may be corrected by an order nunc pro tunc where the written record does not reflect what was actually done. Rule 29.12(c)2 ; State v. Carroll, 207 S.W.3d 140, 142 (Mo.App.E.D.2006). Such orders are appropriate where the decision of the trial court as announced in open court is inaccurately recorded. State v. Kerns, 389 S.W.3d 244, 248 (Mo.App.S.D.2012).
Here, the actions taken in court were not inaccurately recorded. Defendant was not charged as a prior, persistent, or dangerous offender. The State presented no proof of prior convictions at either the guilty plea hearing or the sentencing hearing, and Defendant was not sentenced as a prior, persistent, or dangerous offender. The judgment specifically states Defendant “was not charged as a prior, persistent or class X offender.” The judgment reflects what actually happened in court, so no order nunc pro tunc was necessary.
Defendant's arguments to the contrary rest on a misunderstanding of the applicable statutes. As Defendant points out, before an offender can be sentenced to an extended term of incarceration as a prior, persistent, or dangerous offender, the prosecution must plead and prove beyond a reasonable doubt the facts sufficient to support a finding that the defendant is a prior, persistent, or dangerous offender.3 § 558.021.2, RSMo (2000); see also Schamhorst v. State, 775 S.W.2d 241, 244 (Mo.App.W.D.1989). If the trial court finds the defendant to be a persistent or dangerous offender the maximum term of imprisonment is extended. See § 558.016.7.
Parole eligibility, however, is governed by a different statute. Section 558.019 states the percentages of a sentence that must be served before an offender may become eligible for parole. See § 558.019.5 (“For purposes of this section, the term ‘minimum prison term’ shall mean time required to be served by the offender before he or she is eligible for parole, conditional release or other early release by the department of corrections.”). That statute does not speak in terms of whether the defendant is a prior, persistent, or dangerous offender. Rather, that statute applies based on the number of prior prison commitments the offender has or the type of offense for which the offender was sentenced. §§ 558.019.2, 558.019.3. As applicable to this case, Section 558.019 provides that:
[o]ther provisions of the law to the contrary notwithstanding, any offender who has pleaded guilty to or has been found guilty of a dangerous felony as defined in section 556.061 and is committed to the department of corrections shall be required to serve a minimum prison term of eighty-five percent of the sentence imposed by the court or until the offender attains seventy years of age, and has served at least forty percent of the sentence imposed, whichever occurs first.
§ 558.019.3. That statute does not require a separate finding by the trial court.
Defendant's arguments do not recognize the difference between these two statutes. Section 558.019 and Section 558.016 use similar language: Section 558.016 authorizes “an extended term of imprisonment” under certain circumstances while Section 558.019 regulates the “minimum prison terms ” under certain other circumstances. Compare § 558.016.1 (emphasis added) with § 558.019.2 (emphasis added). Without looking at the statutory definitions, it would appear the two sections both govern prison “terms” and should be interpreted together.
However, as noted above, Section 558.019 contains a definition of “minimum prison term” which makes clear that Section 558.019, in contrast to Section 558.016, governs parole eligibility rather than the length of the sentence. See § 558.019.5 (“For purposes of this section, the term ‘minimum prison term’ shall mean time required to be served by the offender before he or she is eligible for parole, conditional release or other early release by the department of corrections.”). As Defendant correctly points out, Defendant is not subject to an extended term of imprisonment under Section 558.016 because the prosecution did not plead and prove she was a persistent or dangerous offender. However, the pleading and proof requirements of Section 558.021, RSMo (2000), do not apply to the parole eligibility guidelines enunciated in Section 558.019, as they do to the prior and persistent offender designations under Section 558.016, because Section 558.019 does not mention Section 558.021, RSMo (2000), or prior, persistent, or dangerous offender status. Because of this difference, Defendant was required to serve eighty-five percent of her sentence automatically as a matter of law once she was convicted of first degree robbery. No additional judicial finding was necessary.
Here, Defendant's crime, first-degree robbery, is one of the crimes referred to in Section 558.019.3 requiring the offender to serve eighty-five percent of his or her sentence before becoming eligible for parole. See §§ 556.061(8); 558.019.3. Thus, based on the crime of which she was convicted, Defendant must serve eighty-five percent of her sentence before becoming eligible for parole. § 558.019.3. That requirement is not based on a prior, persistent, or dangerous offender designation, and the August 15 letter did not alter Defendant's sentence in any way. As the facts Defendant alleged are simply incorrect, the trial court did not abuse its discretion in denying Defendant's motion for an order nunc pro tunc.
3. After the briefing on appeal was completed, Defendant filed a motion to take judicial notice asking this Court to consider the recently decided case of State v. Norman, ––– S.W.3d ––––, ED99620, 2014 WL 2109076 (Mo.App.E.D. May 20, 2014). We grant Defendant's motion, but the reasoning in Norman does not change the result in this case. Norman involved a claim that the defendant had been improperly sentenced under Section 558.021, RSMo (2000). Norman, supra, slip op. at 11–12. As discussed above, Defendant's case is not governed by Section 558.021, RSMo (2000), but by Section 558.019. Since Norman applied a different statute, it is not applicable to this case. |
Introduction: A Socio-Emotionally Enriched Language Education {#S1}
=============================================================
Language, as a powerful human cultural artifact, mediates our knowledge of the world, our connection to others, and our own thought and self-regulation. All these functions intervene when a person takes the role of mediator -- a very much needed helper for those who have difficulties in understanding texts, concepts or in communicating in a foreign language or culture ([@B22]).
In recent years, signs of increasingly narrow-minded attitudes, rejection of those who are different, and even tension between member states ([@B2], p. 6) have been commonplace in European societies. In this context, the notions of mediation and plurilingualism ([@B20]) have become highly relevant. This concept of mediation, based mainly on [@B28], was already included in the *Common European Framework for Languages* (CEFR) published in 2002, but it has gained a more central position within the *CEFR Companion Volume* (CERF/CV) ([@B3]), released recently. [@B20] states that this work on mediation implies a paradigm shift in the foreign language classroom, while [@B2] connect it to the urge for educational tools for processes that build up pluricultural and plurilingual competences for collaborative dialogue, leading, in turn, to the development of the acceptance of others and the removal of social inequalities.
[@B18] affirm that "Mediation involves the use of language in creating the space and conditions for communication and/or learning, in constructing and co-constructing new meaning, and/or in facilitating understanding by simplifying, elaborating, illustrating or otherwise adapting the original" (p. 87). Thus, the learning process transcends the individual sphere and enters the interactive space. As explained by Piccardo in the CEFR/CV launch conference (2018), mediation implies a dynamic process of meaning-making through "languaging" ([@B24]) and "plurilanguaging" ([@B14]; [@B21]), while creating a shared safe "third space" ([@B11]). In fact, the Council of Europe emphasizes the mediating function of schools, because educating citizens who competently act as mediators relies also on the responsibility of institutions. Mediation fosters a wide range of discourse competences relevant for language learners because they are required to rephrase, to alternate languages, and even to combine and switch genres or oral and written expressions. Thus, language resources are developed through interaction ([@B2], pp. 62--63).
However, a configuration of action-oriented learning experiences that may foster learners' and that may support teachers' awareness and predisposition toward the benefits of mediation is still needed. This is the focus of this paper: to explore how a music-mediated language learning experience (MeLLE) may affect students' motivation, students' socio-emotional development, students' foreign language competence, and students' willingness to cooperate with others. We believe that mediation as a paradigm shift in foreign language learning reinforced through musical activities provides an environment where learners maximize their socio-emotional abilities and their communicative skills.
Mediated-Foreign Language Learning Experiences {#S1.SS1}
----------------------------------------------
[@B15], p. 1) explain humans' capacity to affect other people positively or negatively through their actions. This capacity, called *agency*, is central in communication and relates to the concept of mediation. Agency means that all of those involved in the teaching and learning process -- teachers, students, parents and school staff -- can affect one another.
According to [@B26], the good language teacher in his/her role of facilitator knows "subject, methods and internal processes" (p. 144) that "generate a psychological climate that is conducive to high quality learning" (p. 147). [@B5] explain this role of facilitator through their Theory of Mediation which states that adults, parents, or teachers mediate when they prepare the content and select those stimuli that help their learners to achieve success. The term "mediated learning experiences" was originally developed by the Israeli psychologist Feuerstein who worked with traumatized youths after the Holocaust. [@B19] describes his work and affirms "When others were modifying materials for those with learning disabilities, Feuerstein chose to invest his energies in modifying those learners directly" (p. 54).
Similarly, the Council of Europe's preparatory study for the development of the CEFR/CV equates "pedagogic mediation" with successful teaching approaches, which encompass facilitating access to knowledge, collaboratively co-constructing meaning as a member of a group in a learning setting, and generating the necessary conditions by creating, organizing and controlling space for creativity ([@B18]; [@B20]). Thus, the following actions characterize pedagogic mediation: awakening students' awareness of the meaning and relevance of the task, ensuring that learners understand the purpose of the task, and monitoring to ensure that pedagogic intentions are shared in order to confirm that learners clearly know what the teacher is asking for ([@B29]). In conclusion, teachers as facilitators and mediators foster students' desire to participate in the language classroom and promote student autonomy through the teaching of meaningful techniques and strategies that encourage reflection, creativity and agency ([@B9]).
However, despite the fact that students may also act as mediators, the dynamic relationship among students of the same group is often forgotten, thus overlooking the potential that "any cognitive and affective learning can be substantially enhanced by adroit use of interpersonal and group dynamics" ([@B4], p. 2).
[@B1] endorses Feuerstein's mediated learning experiences as an approach that may spur students' predispositions toward language learning. Socio-cultural theory defines the socialization effect of language ([@B13]), where learning a language goes beyond the acquisition of isolated words to name objects or actions. In our study, MeLLEs -- which take an action-oriented approach -- learners are regarded as social agents who co-construct meaning while mobilizing their general plurilingual and pluricultural competences. In the words of the CEFR/CV, engaging in mediation activities entails that "...one is less concerned with one's own needs, ideas or expression than with those of the party or parties for whom one is mediating. One needs to have a well-oriented emotional intelligence, \[...\] empathy for the viewpoints and emotional states of other participants in the communicative situation." Particularly with regard to cross-linguistic mediation, "\[...\] this inevitably also involves social and cultural competence as well as plurilingual competence" ([@B3]).
Naturally, some individuals are more socially oriented than others ([@B16]); thus, encouraging the full development of affective factors such as empathy, respect, tolerance, leadership and cooperation capacities is pivotal in order to achieve successful language learning through mediation, where the main focus is to use language in real-life situations to collaborate with others to co-construct meanings. [@B16] ascribe the learners' social aptitude to their emotional and social skills, along with their empathy and interpersonal sensitivity. During the validation phase of their socio-emotional expertise scale (SEE), which was performed through the analysis of high-quality socio-emotional interactions, they also identified adaptability and expressivity as two relevant factors to be considered. The interactive space where social interplay occurs is constantly being reassessed by participants in communicative acts and, thus, students' cognitive, social and affective abilities may be affected by a mental filter which hinders their performance in tasks that require interaction and teamwork. Social interactions in the language learning setting may be facilitated through musical activities due to the social bonding effect of music, because "language enables articulation of what is within us, whereas music strengthens what is shared between us" ([@B12], p. 208). In this sense, several authors maintain that the incorporation into the classroom of musical material can entail a series of benefits in terms of socio-emotional expression by creating a relaxed and safe classroom atmosphere ([@B8]). [@B25] confirm that a "self-other merging" occurs while music-making, but whether this phenomenon takes place while engaging in passive listening or when viewing music videos together is yet to be determined.
A growing body of research evidence explores the complementarity of musical activities in developing both first language and additional languages, based on the reciprocal relationship between music and language as the "two sides of the human communication coin" ([@B12], p. 216). Music has been found to be useful in reinforcing the learning of languages and the student's autonomy ([@B10]), while making it a more motivating and socializing learning process. Thus, while semantically precise communication is conducted through language, music has been linked to the enhancement of social cohesion within a group, the development of interpersonal skills and community building, because "the great strength of music lies in its facilitation of social bonding and shared emotion" ([@B12], p. 217). In fact, one of the major hurdles to succeeding in learning languages is the occurrence of negative emotions when engaging in collaborative activities and when adapting to the classroom environment. Fear, insecurity and shyness, among others, limit or prevent interaction with the group in the learning environment, lessening its pedagogical value. In this sense, emotional arousal induced by familiar musical stimuli ([@B27]) could counterbalance the affective filters which constrain effective classroom communication. [@B7] assert that the use of music can be the tool that elicits fundamental positive emotions in the classroom: "Melodies and rhythm can create an attractive and enjoyable environment fostering learners' willingness to participate in the language classroom, similar to the effects on human well-being of music and songs in everyday life" (p. 362).
Despite the potential of music to boost cognitive, affective and social faculties, empirical evidence which fully defines the benefits that musical experiences furnish to adults' foreign language classroom dynamics is very scarce ([@B17]; [@B6]). Because language learning is a multifarious activity which draws on the learner's cognitive, social and affective competences, we hypothesize that music could take on a role as mediator, enhancing motivation and positive emotions, which in turn stimulate the deepening and widening of language learning skills.
Aims {#S1.SS2}
----
The purpose of this study is to determine the effects of a classroom-based educational intervention conducted over a 4-week period, designed to mobilize textual and communication-based mediation strategies as well as to further the development of socio-emotional finesse by adult language learners, thus expanding their affective skills and bolstering the relations with their peers within the classroom setting. In order to do so, a music-MeLLE designed to exploit adult language learners' mediation skills was conceived, placing students in plurilingual classes in the central role of mediators.
Although the role of the teacher as a facilitator of the MeLLE is pivotal and merits further consideration, the scope of the present study is restricted to exploring how this experience influences learners' mediation competences and socio-emotional expertise.
Research Questions {#S1.SS3}
------------------
1. Does a MeLLE affect learners' perceptions of their socio-emotional and mediation abilities?
2. Do learners' perceptions of their socio-emotional expertise and mediation competences differ according to their proficiency level?
3. Are there differences in the outcome of the intervention based on the number of foreign languages spoken by learners?
4. Does the student's socio-emotional profile relate to their mediation competences after intervention?
5. How do learners value the music-MeLLE?
Materials and Methods {#S2}
=====================
Participants {#S2.SS1}
------------
The participants were adult students who were enrolled in an intensive English language course during the 2018--2019 academic year at a language school.
In order to measure the effects of the intervention, a pre--post approach was adopted for a sample of 44 students (65.9% female, 34.1% male) of different nationalities: 36 Spaniards (81.8%) and 18.2% (*n* = 8) from other countries (3 Latvian, 2 Turkish, 1 French, 1 Mexican, and 1 Slovak). Their level of competence in English fluctuated from A2 to C1 levels. Most of them had an A2 level (40.9%, *n* = 18); 14 students belonged to the B1--B2 level group (31.8%), while the remaining 27.3% (*n* = 12) had a C1 level. Research participants were multilingual: 43.2% (*n* = 19) spoke two languages, 31.8% (*n* = 14) three, and 25% (*n* = 11) more than three.
Instruments and Data Collection {#S2.SS2}
-------------------------------
### Socio-Emotional Expertise Scale ([@B16]) {#S2.SS2.SSS1}
The concept of SEE encapsulates an array of specific cognitive abilities which are relevant to successfully navigating social environments, among which the timing and synchrony of behaviors that support overall social-emotional ability are paramount. The descriptors which comprise the SEE are designed to determine the prevalence of two factors -- adaptability and expressivity -- in the respondents' psychological and societal repertoires. The descriptors contributing to each factor construe the students' ability to adequately engage in social interactions and their ability to competently convey affect and ideas to their peers, respectively. Following [@B16], the items pertaining to "adaptability" appraise the respondent's ability to adjust to a variety of social and emotional interpersonal situations; the construct of "expressivity," on the other hand, reflects the individual's ability to convey emotion to others.
### CEFR/CV Mediation Descriptor Scales ([@B3]) {#S2.SS2.SSS2}
A2--B2 level-differentiated self-assessment scales with mediation descriptors were developed for collecting data regarding the students' mediation skills and strategies before and after the classroom experience. Relevant descriptors from the CEFR/CV Mediation Descriptor Scales (MDS) were selected and customized to conform to the research aims of the intervention and to the linguistic competence of the participants. In the analysis, the descriptors were divided into two categories: textual mediation and communication-based mediation. For the purposes of this study, textual mediation focuses on learners' ability to make the information contained in oral or written texts accessible to others, while communication-based descriptors measure skills mobilized in order to avoid misunderstandings when communication exchanges take place and interaction with others is required.
Procedure {#S2.SS3}
---------
First, a music-MeLLE with action-oriented tasks entitled "Plurilingual Songs for Language Learners" was designed. The tasks included require textual and communication-based mediation. Second, the SEE test and the MDS were administered ([Figure 1](#F1){ref-type="fig"}). Permission from principals to carry out the project was requested, and the teachers and students were informed beforehand of the project so that they could express their willingness to participate.
{#F1}
The initial data collection took place in the middle of the second trimester and it was completed again approximately 4 weeks later, once the participants had completed the allotted activities. In order to achieve the set aims, a batch of tasks encompassing music preference and perception and understanding of emotions were proposed. After being informed about the purpose of the study and the tasks they had to complete, the students were asked to cooperatively conduct an analysis of popular music videos of their choice, examining both the visual cues and the lyrics of the songs, and to infer the figurative meaning of the textual elements.
In session one, a modern music video was selected for its visual narrative script and its potential to trigger discussion with the purpose of modeling the activity. A description of its audio-visual and textual elements was elicited from the session. Subsequently, the students were organized into working groups to which different songs were assigned. They were asked to replicate the analysis, focusing on words or expressions connected to feelings and figurative language. As an independent study task, the students looked for examples of songs whose lyrics depict different emotional states; they subsequently brought their lyrics to the next session.
In session two, using the lyrics contributed by the team members, the groups collected examples of vocabulary, idiomatic expressions and metaphors used to articulate feelings. In a whole-class discussion, each group shared and compared their findings with their classmates. Recurrent themes and stereotypes across the examined songs were identified. Back in their working groups, the students were asked to list the features that quality songs should have.
In session three, the students reflected on the importance of deciphering the messages which are implicitly conveyed in popular music videos. Subsequently, they considered the music media consumption choices of youngsters nowadays and the impact that the exposure to certain topics might have on young people's development, as well as what alternative messages they would like to direct toward adolescents today. The groups were encouraged to discuss how they could use the typical features of songs and music videos to get educational messages across.
As a culminating task, the students were requested to post a blog entry recommending songs which carry positive messages or songs which can help to develop the linguistic competence of foreign language learners. Messages that students produced nominating the best songs for learning foreign languages were required to identify the elements which made those songs stand out for such a purpose. A model for a blog post was provided and comments were included which identified parts, style and features; time was allotted for the students to work on a draft of the text they intended to post online.
Once their texts were complete, they went through a peer editing process and received feedback based on a peer-assessment checklist provided by the teacher. Special emphasis was placed on the register and appropriateness of the reported observation messages, thus honing the affect-related processes that underlie desirable social behavior. When the production of the texts was complete, the students shared their posts on a blog administered by the teacher and were encouraged to post comments about their fellow classmates' entries.
Students were also asked to fill in the SEE and MDS in view of their music-MeLLE. Finally, a sample of twelve students was re-contacted to partake in a focus group interview, in order to value the mediated experience and supplement the information obtained during the previous quantitative research phase.
Data Analysis {#S2.SS4}
-------------
A mixed method was used to analyze all data obtained.
The statistical analysis includes a univariate descriptive analysis of target study variables to inform the description of the variables in the sample. Non-parametric tests were used, given the non-normality of the variables under study determined by the Shapiro--Wilk and Kolmogorov--Smirnov tests. To ascertain the possible effect of the linguistic proficiency level of the subjects on the test results, the Kruskal--Wallis *H* test for pre- and post-test variables was carried out. The Mann--Whitney *U* test was used to identify the proficiency level groups among which such a difference existed. For the contrast between pre- and post-test moments, and given the non-normality mentioned above, the non-parametric Wilcoxon test was carried out. Finally, a correlation analysis based on Spearman's Rho was performed.
This quantitative analysis was completed using a qualitative, thematic analysis which revealed students' evaluation of the learning experience.
Results {#S3}
=======
Between the pre- and post-test periods, the response rate remained invariant. In the post-test, fully completed questionnaires were received from 44 students. Descriptive variables were calculated, disaggregated both globally and by gender, and a pre--post comparison was carried out using the Wilcoxon signed rank test, which rendered significant differences in the pre- and post-scores of overall mediation (*W* = −2.197, *p* = 0.028) and the pre- and post-scores of textual mediation (*W* = −3.341, *p* = 0.001). No significant differences were observed in the pre--post socio-emotional variables or in the pre--post communication-based mediation variables ([Table 1](#T1){ref-type="table"}).
######
Target study variables mean scores (SD) and pre--post differences.
**Total sample** **Male** **Female** **Wilcoxon test** ***p***
------------------------------------ ------------------ --------------- --------------- ------------------- -----------
Pre-socio-emotional expertise 90.34 (13.03) 90.40 (11.02) 90.31 (14.15) --0.393 0.695
Post-socio-emotional expertise 92.09 (1.25) 90.93 (10.73) 92.69 (10.14)
Pre-adaptability score 57.52 (8.98) 57.73 (7.90) 57.41 (9.63) --0.091 0.928
Post-adaptability score 58.41 (6.26) 57.80 (7.17) 58.72 (5.85)
Pre-expressivity score 32.82 (4.97) 32.67 (3.98) 32.90 (5.48) --0.802 0.423
Post-expressivity score 33.68 (4.93) 33.13 (4.56) 33.97 (5.16)
Overall mediation pre 78.11 (15.30) 74.11 (15.48) 80.25 (15.04) −2.197^a^ 0.028^∗^
Overall mediation post 81.70 (16.45) 79.57 (16.05) 82.88 (16.84)
Pre-textual mediation 72.67 (19.34) 68.16 (19.04) 75.08 (19.41) −3.341^a^ 0.001^∗∗^
Post-textual mediation 83.17 (15.74) 86.20 (13.33) 81.49 (16.93)
Pre-communication-based mediation 80.60 (15.64) 76.31 (17.08) 82.98 (14.57) --0.235 0.814
Post-communication-based mediation 79.63 (18.50) 76.15 (20.86) 81.64 (17.11)
a
Based on negative ranks (H
0
: POST \< PRE).
∗
Differences were significant at the 0.05 level (2-tailed).
∗∗
Differences were significant at the 0.01 level (2-tailed).
With respect to the comparison of results according to CEFR proficiency levels, there were also significant differences in overall mediation scores (KW = 15.411, *p* \< 0.01) and textual mediation (KW = 29.827, *p* \< 0.01) in its pre-moment, but there were no significant differences observed which were attributable to proficiency levels in the post-intervention nor in the rest of variables in both moments. For both variables, differences were found between the level of competence A and levels B and C; there were no differences between levels B and C. Regarding the pre--post contrast differentiated for each of the CEFR levels, significant differences were only observed in Level A for textual mediation (*W* = −3.245, *p* \< 0.01) ([Table 2](#T2){ref-type="table"}).
######
Contrasts according to CEFR proficiency levels.
**CEFR A^c^** **CEFR B^c^** **CEFR C^c^**
------------------------------------ ----------- ----------- --------------- --------------- --------------- ------- --------- -------
Pre-adaptability score 0.632^a^ 0.729 --0.683 0.495 --1.508 0.132 --1.061 0.288
Post-adaptability score 2.368^a^ 0.306
Pre-expressivity score 3.542^a^ 0.170 --1.092 0.275 --0.566 0.571 --0.903 0.366
Post-expressivity score 3.421^a^ 0.181
Pre-socio-emotional expertise 1.487^a^ 0.475 --1.090 0.276 --1.365 0.172 --1.020 0.308
Post-socio-emotional expertise 2.682^a^ 0.262
Pre-textual mediation 29.827^a^ 0.000^∗∗^ --3.245 0.001^∗∗^ --0.665 0.506 --1.011 0.312
A--B 0.500^b^ 0.000^∗∗^
A--C 4.000^b^ 0.000^∗∗^
B--C 59.000^b^ 0.321
Post-textual mediation 4.988^a^ 0.083
Pre-communication-based mediation 2.617^a^ 0.270 --1.336 0.181 --1.379 0.168 --0.059 0.953
Post-communication-based mediation 5.086^a^ 0.079
Overall mediation pre 15.411^a^ 0.000^∗∗^ --1.327 0.185 --1.119 0.263 --0.222 0.824
A--B 47.500^b^ 0.003^∗∗^
A--C 21.000^b^ 0.000^∗∗^
B--C 63.500^b^ 0.459
Overall mediation post 5.367^a^ 0.068
a
Kruskal--Wallis test.
b
Mann--Whitney
U
, not corrected for ties.
c
Wilcoxon signed ranks test.
∗∗
Differences were significant at the 0.01 level (2-tailed).
When conducting pre--post intervention contrasts according to the number of languages spoken by the subjects under study, there were significant differences in textual mediation in learners who speak two languages (Zw = −2.788, *p* \< 0.01) and in those speaking three languages (Zw = −2.040, *p* = 0.041), with no differences observed in students who speak more than three languages or for the rest of the variables under study ([Table 3](#T3){ref-type="table"}).
######
Wilcoxon signed ranks test pre--post based on number of languages spoken.
**2 Langs** **3 Langs** **+3 Langs**
----------------------------------------- ------------- ------------- -------------- ----------- -------- -------
Pre--post adaptability score −1.265 0.206 −0.910 0.363 −1.070 0.285
Pre--post expressivity score −0.262 0.793 −0.315 0.752 −1.607 0.108
Pre--post socio-emotional expertise −1.148 0.251 −0.816 0.414 −1.376 0.169
Pre--post textual mediation −2.788 0.005^∗∗^ −2.040 0.041^∗^ −0.153 0.878
Pre--post communication-based mediation −0.840 0.401 −0.051 0.959 −0.771 0.441
Pre--post overall mediation −1.155 0.248 −1.570 0.116 −0.890 0.374
Based on negative ranks (H
0
: POST \< PRE).
∗
Differences were significant at the 0.05 level (2-tailed).
∗∗
Differences were significant at the 0.01 level (2-tailed).
Finally, the relational study between the general scores in mediation, and the general and differentiated variables of socio-emotional skills after the intervention revealed a significant relationship between the general mediation and socio-emotional scores (ρ = 0.409, *p* \< 0.01). When the general socio-emotional variable was disaggregated into its components of adaptability and expressivity, we only found a significant relationship between the overall mediation score and the expressivity score (ρ = 0.465, *p* \< 0.01) ([Table 4](#T4){ref-type="table"}).
######
Spearman's rho correlations between target variables.
**Overall mediation post**
-------------------------------- ----- ----------------------------
Post-socio-emotional expertise ρ 0.409^∗∗^
*p* 0.007
*N* 42
Post-adaptability score ρ 0.246
*p* 0.116
*N* 42
Post-expressivity score ρ 0.465^∗∗^
*p* 0.002
*N* 42
∗∗
Correlation is significant at the 0.01 level (2-tailed).
Qualitative Findings {#S4}
====================
In order to better understand the perceptions of the participants, a focus group interview was conducted. Twelve students were selected so that language proficiency levels would be equally represented; the Spanish and foreign ratio was balanced. They were invited to talk about their classroom experiences: what they had liked the most and what they least minded about the collaborative approach taken in this intervention, whether they favored further use of musical media to inspire their language learning, and whether they had become aware of anything new about themselves.
A thematic analysis of the students' responses was made by applying a four-step process to synthesize the data. Two of the authors independently reviewed the focus group transcript and identified recurring themes mentioned by participants. Then, the script was coded and the informative extracts were transferred to an *ad hoc* designed data extraction sheet. Finally, themes were grouped into two categories ([Tables 5](#T5){ref-type="table"}, [6](#T6){ref-type="table"}), subdivided into four key concepts: (1) music as a plurilingual and pluricultural mediator; (2) musical activation of agency and positive emotions; (3) teamwork as a valuable and enjoyable experience; and (4) flexibility and coping with uncertainty.
######
Students' views on the music-mediated experience.
**Music as a plurilingual and pluricultural mediator**
-------------------------------------------------------- -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
"...trends in current music videos, fashions, everything we have discussed in class, gender equality, social critique, anti-sexist movements, those topics are present in music now more than ever before."
"The chance of finding out how people from other cultures process information is great."
"The forms of society and lifestyle are changing; in some countries they develop and change before they do in others and it is through music that young people are coming to learn about those changes."
"Music inoculates people with these messages (of cultural change)"
"I am now also wiser in terms of dealing and understanding Spanish culture's mindset."
**Musical activation of agency and positive emotions**
"We have been able to describe the different songs that each of us contributed and to examine what they conveyed."
"Choosing the song, talking about feelings and so on, and writing the text interpreting the author's intention was interesting."
"We like to find the emotions, what the lyrics want to express. As it is another language, they are expressed differently, the translations cannot be done literally, the language is figurative."
"(In class) We worked to recognize the emotions and what they meant to us."
######
Students' views on the progress of their interpersonal dimension.
**Teamwork as a valuable and enjoyable experience**
----------------------------------------------------- ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
"We learn more together because we exchange knowledge."
"When one of us had difficulties in understanding something or was not sure on what to do, we would take the time to explain and help them in order for everyone to be on the same page."
"Because we had to speak and explain the matter as clear as possible in a language that was not our mother tongue -- this way all my partners and I experienced the importance of speech in language learning and its impact on the different reactions of my classmates."
"It was nice to get to work with people that I had never met and with an Erasmus student, as I do not get that opportunity very often."
"Working as a team was very enjoyable, mainly because we were very organized and distributed the tasks evenly, everyone in the group knew what they had to do and did it to the best of their abilities."
"Working in a team has always been challenging for me, as I love doing things independently. You never know if you can fully count on people, especially on the ones you do not know."
**Flexibility and coping with uncertainty**
"I was dazed, for we had never had classes like this before."
"Initially I felt slightly uncomfortable, and also baffled because I didn't know which song to select."
We sometimes have had some different thoughts about how to carry out the project, but at the end we always reached a common agreement."
"The problem with English was a barrier as well. Our levels ranged from B1 to C1 and that level gap was a huge problem when explaining our ideas, so we helped each other."
"It has been a challenge because we are not used to doing teamwork activities, and I still have a lot to learn."
"I enjoyed the discussions because everyone had their own opinion that only meant that we care about the result and it only made the ideas more thought through."
"Each group leader should give directions to the members of the group \[...\] Otherwise, the other members of the group would be distracted even by a single person who did not perform what was asked of them. Unfortunately, this is what we experienced."
Analyzing the audio-visual narratives of music videos produced in different countries led to a better understanding of some traits of the target culture, and some reflections also made evident the awakening of the students' pluricultural and plurilingual competences. Several students highlighted the opportunity to showcase their work, as well as to access their classmates' contributions and provide feedback:
1. "I think the most interesting thing was networking with other communities in other countries. That was the most powerful part. Because, after all, posting something on the Internet is easy, but it doesn't always allow you to connect with someone who is studying English out there." (Luis B.)
```{=html}
<!-- -->
```
1. "Posting our blog entry, seeing our final product online and getting to read what the rest of my classmates have produced, reading everyone's posts and seeing how our own blog was taking shape was really cool." (José Ignacio C.)
In general terms, students valued collaborative work as a rewarding and enriching experience. Some of them even openly expressed what they considered to be successful teamwork practices. Conversely, they were displeased when one team member failed to contribute equally to the collective effort; this was the main reason for their reluctance to work with others. On the whole, their reflections show that they were willing to collaborate with others in order to attain the final result. This implies that they managed to join forces to co-construct meaning, to understand new concepts and to access information. That is, they actively assumed the role of mediators. Related to this, students also considered that working with students from other nationalities was an enriching experience which could help them improve their language skills.
A significant number of interviewees reported having felt confused or overwhelmed during the initial stages of implementation of the lesson plan due to a lack of familiarity with the approach. However, they showed awareness of the importance of overcoming uncertainty when interacting with others and of the transferability of the skills acquired to everyday life situations. In their view, striving to come to an agreement in order to achieve a shared goal will be commonplace in the different contexts that they will encounter in their professional careers and personal lives. Consequently, students also felt proud of their ability to overcome the difficulties they had encountered during the learning experience. On the other hand, learners showed concern about difficulties met which had not been easily solved. They also expressed their need to further learn how to handle critical situations, similar to those experienced in teamwork.
Regarding this last issue, on one occasion the students complained to the teachers about the uncooperative attitude of one of their team members. When asked whether they had raised the issue and discussed it, they reported that they did not want to stir up a conflict with that person. It seemed that they were unsure about how to address the problem.
Finally, according to the learners' self-reported perceptions, music-MeLLEs seem to give prominence to reciprocity and negotiation of goals and outcomes, as set out by the teacher and pursued by the learners. They acknowledged the sense of practicality of this musical MeLLE because it is rooted in reality, in the immediate context of the students. In the adult education context, learners are often notably goal-oriented. The students also acknowledged the integration of diversified activities in its design, which they considered to be adaptable to different levels of complexity and well sequenced, with increasing difficulty to challenge and engage them.
Discussion and Conclusion {#S5}
=========================
All the different research questions have been addressed by our study. The main aim of our study was to explore whether a music-MeLLE could potentially affect students' awareness of their socio-emotional and mediation skills while learning foreign languages. The most obvious finding to emerge from the analysis is that the MeLLE had an impact on students' awareness of their mediation skills, more significantly of their textual mediation skills.
The next question in this study sought to determine the co-dependency of language proficiency level and mediation skills. Prior to the intervention, overall and textual mediation competences were underdeveloped or overlooked by students with lower levels of CEFR proficiency, whereas students with an intermediate or advanced command of English displayed a sound knowledge of their mediation skills and strategies. This seems to indicate that once an intermediate level of proficiency is reached in the foreign language, trainees feel more capable of mediating a text. A possible explanation for these results may be the lack of cross-cultural communication encounters undertaken by students at the initial stages of foreign language acquisition, as compared with a greater exposure to speakers of other languages that learners experience during subsequent years of language learning. However, after the intervention presented in this study, those differences between language proficiency groups were no longer observable, because the learning experience triggered a noteworthy increase in textual mediation scores as well as in overall mediation measures of the least proficient students. This might imply that the MeLLE assisted in making visible the usefulness of pre-existing cultural and language resources and gave the learners a sense of confidence to manage intercommunity relations ([@B2]).
As far as the number of foreign languages spoken is concerned, the data obtained shows that students who speak three languages outperformed, in textual mediation activities, their peers who spoke two languages. However, on the question of whether the number of languages spoken by the learners influenced the outcome of the intervention, it seems that the MeLLE benefits most those students who speak only one foreign language. This result may be explained by the fact that those who speak more foreign languages feel that their textual mediation competences have reached their full potential. The knowledge of at least two foreign languages seems to favor the natural development of text mediation skills. Hence, the adoption of a plurilingual take on language education, which focuses on pursuing the learners' personal development, self-awareness, linguistic and critical awareness, and interculturality ([@B22]) is supported. The results obtained also suggest that similar interventions could probably offset the shortcomings of monolingual and bilingual education programs. Thus, in contexts in which implementing plurilingual teaching approaches is not feasible, interventions based on MeLLE would possibly parallel the students' perceptions of their mediation skills with those of more linguistically diversified, accomplished students.
However, the most remarkable result derived from the statistical data analyzed is the highly significant correlation between overall mediation competence and socio-emotional expertise. Therefore, our MeLLE affected students' awareness of their role as agents in interpersonal communication and this awareness linked to learners' socio-emotional portraits. When examining separately the two contributing factors of learners' socio-emotional profiles, expressivity and adaptability, it was the former that resulted in a more significant correlation. Because expressivity has been defined as "the ability to successfully convey affect and ideas to other people" ([@B16], p. 1), this could further indicate the benefits of adopting MeLLE in the language classroom.
Additional advantages of MeLLE are highlighted by the qualitative results collected during the focus group interview. The students' documented perceptions when exposed to the music-MeLLE seem to endorse the suitability of this approach to induce a measurable improvement of their wellbeing and a positive language learning setting, as well as to raise learners' awareness of their role as social agents within the communicative act. By the end of the intervention program, the students were familiar with the concept of mediation and had got used to working collaboratively. Students showed enthusiasm during teamwork tasks and they were able to show flexibility by overcoming the difficulties encountered. Besides, the students reported that these types of activities made them conscious of their own learning process. They recognized the importance of active listening, respecting everyone's opinions, and taking on an agentic role by providing feedback to the work of their peers. Moreover, they were satisfied with the common effort to find a shared language and to succeed in the tasks. However, they also demonstrated their need to learn more about how to manage personal accountability for the tasks assigned to each team member. Driven by the above-mentioned benefits, they were willing to engage in MeLLE in the future.
As for the role of music, the qualitative findings obtained in our focus group interviews appear to be consistent with the idea that songs can evoke positive emotions in the foreign language classroom ([@B7]). In this sense, learners highlighted the motivating potential of working with music of their choosing and sieving through familiar lyrics, discovering messages and emotional states expressed therein. These findings seem to correlate favorably with the studies conducted by [@B27] and further support the idea that familiarity with self-selected music may amplify the benefits of music-based classroom activities. Similarly, the interviewees reported a renewed feeling of group conscience and sense of belonging brought about by the musical input, which is coherent with the bonding effect mentioned by [@B25] and [@B12].
The results recorded so far highlight the appropriateness of introducing these types of music-mediated experiences to the language classroom in order to improve students' development of mediation skills, awareness of their socio-emotional skills and of other people's perspectives or intentions ([@B23]). By developing empathy toward others and social cognition, explaining and predicting other people's behavior, language learners become more socio-emotionally oriented and prepared to narrow intercultural gaps and social inequalities.
Limitations and Future Research {#S6}
===============================
The tentative results of this study suggest the need to carry out a broader longitudinal study over an extended period of time to empirically confirm the effects of this type of pedagogic intervention on foreign language adult learners.
Data Availability Statement {#S7}
===========================
The datasets generated for this study are available on request to the corresponding author.
Ethics Statement {#S8}
================
Ethical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements. The patients/participants provided their written informed consent to participate in this study.
Author Contributions {#S9}
====================
MF-M: conceptualization, investigation, and funding acquisition. FM: methodology and formal analysis. EC-B, AF-C, FM, and MF-M: writing -- original draft. EC-B, AF-C, and MF-M: writing -- review and editing.
Conflict of Interest {#conf1}
====================
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
**Funding.** This study was supported by the R + D project "Musical aptitude, reading fluency and intercultural literacy of European university students" (FFI2016-75452-R), funded by the Spanish Ministerio de Economía, Industria y Competitividad.
[^1]: Edited by: Xinjie Chen, Stanford University, United States
[^2]: Reviewed by: Alberto Cabedo-Mas, Universitat Jaume I, Spain; Mari Tervaniemi, University of Helsinki, Finland; Enrica Piccardo, OISE-University of Toronto, Canada
[^3]: This article was submitted to Language Sciences, a section of the journal Frontiers in Psychology
|
Prevention of virus transmission to macaque monkeys by a vaginally applied monoclonal antibody to HIV-1 gp120.
A topical microbicide reduces the probability of virus transmission when applied to the vagina or rectum of a person at risk of sexually acquiring HIV-1 infection. An effective microbicide could significantly reduce the global spread of HIV-1, particularly if women were able to use it covertly to protect themselves. A microbicide could target the incoming virus and either permanently inactivate it or reduce its infectivity, or it could block receptors on susceptible cells near the sites of transmission. We describe here how vaginal administration of the broadly neutralizing human monoclonal antibody b12 can protect macaques from simian-human immunodeficiency virus (SHIV) infection through the vagina. Only 3 of 12 animals receiving 5 mg b12 vaginally in either saline or a gel and then challenged vaginally (up to 2 h later) with SHIV-162P4 became infected. In contrast, infection occurred in 12 of 13 animals given various control agents under similar conditions. Lower amounts of b12 were less effective, suggesting that protection was dose dependent. These observations support the concept that viral entry inhibitors can help prevent the sexual transmission of HIV-1 to humans. |
Q:
How can I set image in textDocumentProxy with custom keyboard extension iOS 8?
How can we set an image behalf of the text?
Following code is to display text in the input view:
[self.textDocumentProxy insertText:[key currentTitle]];
My code of paste board to display the image :
NSData *imgData = UIImagePNGRepresentation(image);
[pasteBoard setData:imgData forPasteboardType:[UIPasteboardTypeListImage objectAtIndex:0]];
NSString* newStr = [[NSString alloc] initWithData:imgData encoding:NSUTF8StringEncoding];
[self.textDocumentProxy insertText:[pasteBoard string]];
I have created a pasteboard with the images just I have to display the images in to input view.
See this picture for the concept :
Note:
I have to select image from keyboard and show in inputview not to copy paste from library.
If anyone know please reply as answer or any suggestion will also acceptable.
Thanks!
A:
I have get solution for this question use clipboard copy and paste
Code :
UIPasteboard *pasteBoard = [UIPasteboard generalPasteboard];
NSData *data = [self.Videoassets objectAtIndex:btn.tag];
NSLog(@"File size is : %.2f MB",(float)data.length/1024.0f/1024.0f);
[pasteBoard setData:data forPasteboardType:@"public.mpeg-4"];
|
Update on Mucin-1 immunotherapy in cancer: a clinical perspective.
Mucin 1 (MUC1) is particularly well suited as a cancer immunotherapy target due to the elevated protein expression and aberrant forms associated with malignancy. A variety of therapeutic strategies have been explored, including antibodies intended to induce cancer cell destruction, and vaccinations with peptides, tumor extracts, and gene expression systems. MUC1 immunotherapeutic strategies have included vaccination with peptide sequences, glycan molecules, viruses, and dendritic cells, monoclonal antibodies and monoclonal antibody conjugates. Here we review the relevant clinical trials in each field of immunotherapy with particular focus on large and recently published trials. Long clinical experience in the trial setting has reduced concerns of immunotherapy associated toxicities and inappropriate immune responses, with the main limitation (common to many experimental approaches) being a lack of clinical efficacy. However, there have been sufficient treatment-associated responses to justify continued pursuit of MUC1 targeted immunotherapies. The focus now should be on application to the relevant cancers under appropriate circumstances and combination with the emerging non-specific immunotherapy approaches such as the PD-1 pathway inhibitors. |
MRI morphometric analysis and neuropsychological function in patients with neurofibromatosis.
Volumes of cerebral gray and white matter were measured in 22 children with neurofibromatosis type 1 (NF1) and in 20 controls. Judgment of Line Orientation (JLO) and the Developmental Test of Visual-Motor Integration (DTVMI) were administered to 16 of the NF1 patients. General linear models analysis of covariance revealed significantly larger brain volumes in NF1 children than in controls, particularly in white matter, and particularly in girls. JLO and DTVMI performance were positively related to right-hemisphere gray-matter volume. The results implicate a failure of growth control in NF1, leading to aberrant neurodevelopment. Our findings also suggest a basis for refined understanding of learning disabilities, which are a prominent feature of NF1. |
1. Introduction {#sec0005}
===============
It has been established that water with good quality produces healthier humans than one with poor quality [@bib0005]. Water quality is essentially determined by its physical, chemical as well as microbiological characteristics [@bib0010]. Such water should be palatable, oxygenated, colorless, odorless, and free from harmful organisms and salts of heavy metals. However, the quality of water, both for drinking and other uses deteriorates due to inadequacy of treatment plants, direct discharge of untreated sewage into rivers and stream in addition to inefficient management of piped water distribution system [@bib0015]. This therefore has serious health implications for the users.
The ability to control the quality of water is based on routine tests, the results of which are compared with established standards*.* Chemical and microbial analysis can thus give an idea of the possibility of water being polluted, the extent of its pollution and the possibility of it containing pathogenic micro-organisms [@bib0020], [@bib0025].
In the chemical analysis of water, the major parameters commonly analyzed for include: Ca^2+^, Mg^2+^, CO~3~^2−^, SO~4~^2−^, total hardness as CaCO~3~, Mg-hardness, as well as minor ions such as: Fe^2+^, Fe^3+^, NO~3~, NH~3~ (Nitrate and Ammonia) and Nitrogen. These ions are important parameters because of their sensitive effects on human health [@bib0030].
In Michael Okpara University of Agriculture, Umudike, Nigeria and surrounding environments, table water of different brands is commercially hawked by vendors. To the best of our knowledge, there is no scientific documentation on the quality of these water samples. The fact that there have been occasional reports of food poisoning among people residing within the study area underscores the need for analysis of these water samples.
In order to ensure that these water samples do not contain contaminants that exceed the health based standards as stipulated by APHA [@bib0020], WHO [@bib0050], [@bib0055] and NIS [@bib0060] thereby indicating health risk for the consumer, this study was set up to investigate the physicochemical properties of these water samples.
2. Materials and methods {#sec0010}
========================
The water samples that were used for the experiment were randomly collected from three branded table water samples- MOUAU table water, Aqua table water and Mowo table water commercially sold in Umudike environment.
3. Sampling procedures and analysis {#sec0015}
===================================
The chemical analysis of the water samples was carried out at the Chemistry Laboratory of National Root Crops Research Institute, Umudike, Umuahia, Abia State, Nigeria. Analysis was done approximately 24 h after collection of the samples.
4. Physicochemical analysis {#sec0020}
===========================
The pH of the water samples was determined using a pH meter (Hana 211), the Brucine method [@bib0035] was used for determination of nitrates, the Mohr's argentometric titration method [@bib0040] was used for the determination of chlorides, measurement of turbidity was carried out using a turbidity meter, the Winkler method with azide modification [@bib0020] was used for the determination of dissolved oxygen, total hardness was determined using the EDTA titrimetric method [@bib0020], the gravimetric method was used for the determination of total dissolved solids (TDS) and total suspended solids (TSS), the Winkler method [@bib0020] was used in the determination of the biochemical oxygen demand (BOD), ammonium nitrogen (NH~3~-N) was determined using a spectrophotometer [@bib0045], Na and K were determined using a flame photometer, Ca was determined using an atomic absorption spectrophotometer (Analyst 200, PerkinElmer, Waltham, MA, USA) while Mg was determined using the EDTA titrimetric method [@bib0040]. All chemicals used were of analytical grade.
5. Statistical analysis {#sec0025}
=======================
The statistical package for social sciences (SPSS Inc., Chicago, IL, USA), version 17.0 was used to analyze all data. Results are presented as means ± standard deviation. One-way analysis of variance (ANOVA) was used for comparison of means. Differences between means were considered to be significant when *p *\< 0.05.
6. Results {#sec0030}
==========
The standard for drinking water as given by WHO [@bib0050], [@bib0055], NIS [@bib0060] and APHA [@bib0020] is shown in [Table 1](#tbl0005){ref-type="table"}.Table 1Maximum permissible limits of drinking water quality.GroupsAPHAWHONISpH6.5--8.56.5--8.56.5--8.5Chlorides (mg/L)250200250Turbidity (NTU)1010Total hardness (as CaCO~3~) (mg/L)--500150Calcium (mg/L)--200200Sulphate (mg/L)--400400Sodium (mg/L)----200Nitrate (NO~3~) (mg/L)--50NRNH~3~-N (mg/L)--1.5--Magnesium (mg/L)--1500.2Dissolved solids (mg/L)--2000500Suspended solids (mg/L)--150150[^1]
While the pH of MOUAU water was significantly higher (*p *\< 0.05) than MOWA water, it did not differ significantly (*p *\> 0.05) from that of AQUA water ([Table 2a](#tbl0010){ref-type="table"}).Table 2aPhysicochemical properties of water samples (mg/L).GroupspHTDSBODTotal hardnessDissolved oxygenMOUA6.95 ± 0.10^b^270 ± 0.28^a^14.3 ± 2.41^a^9.30 ± 1.27^a^3.08 ± 0.91^c^AQUA6.81 ± 0.01^ab^501 ± 1.91^b^8.84 ± 3.20^a^23.0 ± 1.63^b^1.89 ± 0.67^a^MOWA6.15 ± 0.35^a^505 ± 0.99^b^15.2 ± 3.30^a^41.3 ± 0.64^c^2.67 ± 0.02^b^[^2]
Whereas the TDS of AQUA and MOUAU water samples did not differ significantly from each other (*p *\> 0.05) ([Table 2a](#tbl0010){ref-type="table"}), they were significantly higher (*p* \< 0.05) than that of MOUAU water.
There were no significant differences (*p *\> 0.05) in the levels of BOD in the three different brands of water samples investigated ([Table 2a](#tbl0010){ref-type="table"}).
In terms of total hardness, while AQUA water contained significantly higher levels (*p *\< 0.05) compared with other water samples studied, MOUAU water had the least ([Table 2a](#tbl0010){ref-type="table"}).
MOUAU water sample contained significantly higher levels (*p *\< 0.05) of dissolved oxygen (DO) compared with other water samples studied, AQUA water had the least ([Table 2a](#tbl0010){ref-type="table"}).
While the chloride levels of AQUA and MOWA water samples did not differ significantly from each other (*p *\> 0.05), they were significantly lower (*p *\< 0.05) than that of MOUAU water ([Table 2b](#tbl0015){ref-type="table"}).Table 2bPhysicochemical contents of water sources (mg/L).GroupsCl^−^NO~3~^−^NH~3~-NTurbidityTSSMOUAU180 ± 3.47^b^10.5 ± 4.95^a^2.8 ± 0.0^a^0.9 ± 0.1^a^27.8 ± 7.5^a^AQUA35.2 ± 5.23^a^26.8 ± 1.77^b^4.2 ± 0.0^b^0.65 ± 0.1^a^19.5 ± 6.0^b^MOWA38.8 ± 0.07^a^9.1 ± 0.99^a^2.1 ± 9.8^a^0.90 ± 0.0^a^34.1 ± 4.90^c^[^3]
Whereas the nitrate and NH~3~-N levels in MOUAU and MOWA water samples did not differ significantly from each other (*p *\> 0.05), they were significantly lower (*p *\< 0.05) than that of AQUA water ([Table 2b](#tbl0015){ref-type="table"}).
As shown in [Table 2b](#tbl0015){ref-type="table"}, the turbidity of these water samples ranged from 0.54 to 1.04 NTU. There were no significant differences (*p *\> 0.05) in the turbidity of all the water samples studied.
In terms of TSS, MOWA water contained significantly higher levels (*p *\< 0.05) compared other brands of water samples investigated ([Table 2b](#tbl0015){ref-type="table"}).
The Ca contents of AQUA and MOWA water samples did not differ significantly from each other (*p *\> 0.05) but were significantly lower (*p *\< 0.05) than MOUAU water sample ([Table 3](#tbl0020){ref-type="table"}).Table 3Mineral contents of water sources.GroupsCa^2+^Mg^2+^Na^+^K^+^MOUAU28.1 ± 0.0^b^8.40 ± 1.9^a^3.05 ± 0.4^a^1.54 ± 0.1^a^AQUA22.1 ± 2.9^a^12.20 ± 0.0^ab^2.65 ± 0.1^a^1.90 ± 0.1^a^MOWA19.6 ± 0.6^a^13.15 ± 1.3^b^2.38 ± 0.1^a^2.60 ± 0.2^b^[^4]
The Mg contents of AQUA and MOWA water samples did not differ (*p *\> 0.05) from each other while the Mg contents of MOWA water significantly lower (*p *\< 0.05) than MOUAU water ([Table 3](#tbl0020){ref-type="table"}).
There were no significant differences (*p *\> 0.05) in the Na contents of all the water samples studied ([Table 3](#tbl0020){ref-type="table"}).
MOWA water contained significantly higher (*p *\< 0.05) levels of K compared with other water samples studied while the K contents of MOUAU and AQUA water samples were not significantly different (*p *\> 0.05) ([Table 3](#tbl0020){ref-type="table"}).
There was a significant positive correlation between turbidity, BOD and TSS of the water samples (*r *= 0.815 to 0.868; *p *\< 0.01; [Table 4](#tbl0025){ref-type="table"})Table 4Pearson correlation between water quality parameters.Biochemical oxygen demandTotal soluble solidsTurbidity0.868[\*\*](#tblfn0005){ref-type="table-fn"}0.815[\*\*](#tblfn0005){ref-type="table-fn"}Total soluble solids0.862[\*\*](#tblfn0005){ref-type="table-fn"}[^5]
7. Discussion {#sec0035}
=============
Results obtained indicate that the pH of MOUAU and AQUA water samples were within the permissible levels given by WHO [@bib0050], [@bib0055], NIS [@bib0060] and APHA [@bib0020], respectively, while the pH of MOWA water was lower than the permissible levels. The observed low pH may be due to uptake of CO~2~ from the air and or temperature deviations in the sample and as such, may not pose any significant health risk.
Total dissolved solid is a good indicator of dissolved ions in water [@bib0065], [@bib0070]. The study showed that while the TDS in MOUAU water samples fell within the permissible ranges given by WHO and NIS, the levels found in AQUA and MOWA water samples were higher than the permissible range given by NIS but within the permissible range given by WHO [@bib0050], [@bib0055].
Biochemical oxygen demand (BOD) is the amount of dissolved oxygen needed by aerobic biological organisms in a body of water. BOD is widely used as an indicator of the organic quality of water [@bib0075]. The criteria for BOD in drinking water were given to be 4 mg/L [@bib0080]. Values obtained for these water samples were lower than this reference range.
Hardness is defined as the sum of calcium and magnesium concentrations and is a measure of the capacity of water to form lather with soap. Although AQUA water contained higher levels of these ions compared with other brands of water investigated, values obtained for these water samples which were lower than the permissible ranges given by WHO and NIS, suggest that these water samples are not hard.
Dissolved oxygen (DO) measures the amount of oxygen dissolved in an aqueous solution [@bib0085]. Adequate dissolved oxygen is necessary for good water quality. The criteria for DO in drinking water were given to be 4 mg/L [@bib0080]. Although MOUAU water contained higher levels of DO compared with other brands of water samples investigated, values obtained for all the brands of water samples were lower than this reference range.
Chloride is an inorganic compound resulting from the combination of chlorine with metal. Some common chlorides include sodium chloride (NaCl) and magnesium chloride (MgCl~2~). Environmental impact of chlorides is not usually harmful to human health; however, the sodium part of sodium chloride has been linked to heart and kidney diseases [@bib0085]. Public drinking water standards require chloride level not to exceed 250 mg/L [@bib0085]. Furthermore, the chloride levels in these brands of water samples were within the permissible ranges given by WHO, USEPA and NIS, respectively.
High level of nitrate in drinking water due to excessive use of agriculture fertilizers or domestic wastes has become a serious problem as it has been implicated in some disease conditions [@bib0085]. Values obtained for these water samples were within the permissible range (50 mg/L) given by WHO.
Ammonium nitrogen is an inorganic pollutant of water, formed at low concentration through nitrogen mineralization process from organic matter. The presence of NH~3~-N can affect the taste and odor of water and also carries some health risks to humans. Results obtained for NH~3~-N in these water samples, which values were higher than the reference range given by WHO, calls for serious checks on the processes of production of these water samples.
Turbidity is caused by particles suspended or dissolved in water that scatter light making the water appear cloudy or murk. Values obtained for turbidity and TSS in these water samples were within the permissible ranges set by WHO and NIS.
Ca^2+^, Mg^2+^, Na^+^, and K^+^ are known as major cations and they constitute more than 30% of the total content of elements in the earth's crust. Calcium is one of the principal cations associated with hardness in drinking water. The hardness of water can range from less than 75 mg/L as CaCO~3~ (considered a soft water) to more than 300 mg/L as CaCO~3~ (considered a very hard water) [@bib0090]. The presence of calcium in drinking water could reduce the availability of copper as a result of the less aggressive leaching of copper in the delivery system [@bib0095]. Values obtained for Ca^2+^, Na^+^ and K^+^ in the water samples were within the permissible limits set by WHO and NIS indicating that their levels in these water samples could not be considered hazardous to human consumption.
In terms of magnesium, while values obtained for these water samples were higher than the permissible range given by NIS, they fell within the permissible range given by WHO.
Finally, the significant correlation between turbidity, BOD and TSS of the water samples suggests an additive effect between these parameters.
8. Conclusion {#sec0040}
=============
Results obtained from this study indicated that most of the chemical constituents of these table water samples commercially sold in Umudike environs conformed to acceptable standards. However, values obtained for nitrates and ammonium nitrogen in these water samples calls for serious checks on methods of their production and delivery to the end users.
Conflicts of interest {#sec0045}
=====================
We declare none.
The authors wish to thanks the technical staff of Soil Chemistry Laboratory, National Root Crops Research Institute, Umudike for their assistance.
[^1]: Sources: [@bib0050], [@bib0055], [@bib0060]; [@bib0020]; NTU -- nephelometric turbidity units; NR -- no relaxation.
[^2]: Values are means ± SD of three determinations. a--c Means with different superscripts along each column are significantly different (*p* \< 0.05). N -- 5 bottled water samples per brand; Total hard -- Total hardness; BOD -- Biochemical oxygen demand; DO -- Dissolved oxygen (mg/L).
[^3]: Values are means ± SD of two determinations. a--c Means with different superscripts along each column are significantly different (*p* \< 0.05). N -- 5 bottled water samples per brand Turbidity-NTU.
[^4]: Values are means ± SD of two determinations. a and b Means with different superscripts along each column are significantly different (*p* \< 0.05). N -- 5 bottled water samples per brand.
[^5]: Highly significant at *p *\< 0.01.
|
The scrypt key derivation function and encryption utility - ligouras
https://www.tarsnap.com/scrypt.html
======
M4v3R
How it is news? It's been around for years already. Was there a major new
development in scrypt that I didn't hear about? Or is this just "let's submit
everything tar snap related week" as cperciva put it?
~~~
gaelow
I find interesting that scrypt asics are on the way:
[http://techcrunch.com/2014/03/20/kncminer-sells-2-million-
wo...](http://techcrunch.com/2014/03/20/kncminer-sells-2-million-worth-of-
scrypt-mining-machines-in-four-hours/?ncid=tcdaily)
~~~
chubot
OK interesting, I didn't realize that the altcoins use scrypt. I remember
hearing that Litecoin used a scheme that was supposed to be GPU-resistant, but
didn't realize it was scrypt.
[https://en.bitcoin.it/wiki/Litecoin](https://en.bitcoin.it/wiki/Litecoin)
Looks like there is a Bitcoin variant:
[http://bitcoinscrypt.org/](http://bitcoinscrypt.org/)
------
natch
Anyone know, how do I determine the version of scrypt currently installed on
my system? I've tried various things: -v, -version, --version, man scrypt,
strings /usr/local/bin/scrypt... no luck.
|
It comes as Bank of England governor Mark Carney warned of a 'lost decade' of economic growth.
Bank of England governor Mark Carney: There are ‘high levels’ of inequality in UKITN
Despite a turbulent year politically and a sombre warning from the Bank of England Governor Mark Carney, the United Kingdom will finish the year as the fastest growing economy in the G7, a respected survey of businesses has shown.
That optimism is based on the purchasing managers' index (PMI) which showed a reading of 55.2 for the services sector in November, the highest since January and up from 54.4 in October, The Times reported.
Experts say that Britain's economy is on course to grow at 0.5% in the final quarter, beating forecasts by the Bank of England and putting Britain ahead of the rest of the world's leading economies.
Alan Clarke, an economist at Scotiabank, told the newspaper: "As things stand, the survey-based evidence is very encouraging. If it is right, then we are looking at a very good end to 2016."
Chris Williamson, from IHS Markit, which compiled the survey, said: "The further upturn in the vast services sector shows that the pace of UK economic growth remains resiliently robust in the fourth quarter, despite ongoing uncertainty," The Times reported.
On Monday evening, BoE governor Mark Carney sounded a solemn note, saying that Britain is going through its first "lost decade" of economic growth for 150 years.
He also said that the UK could lose up to 15 million jobs to robots in the coming years as new technologies come to the fore.
At a speech in Liverpool on Monday evening (5 November), he said the UK's lack of growth had caused inequalities and led people to question the benefits of globalisation.
"We meet today during the first lost decade since the 1860s," he said. "Over the past decade, real earnings have grown at the slowest rate since the mid-19th century."
He said globalisation had become "associated with low wages, insecure employment, stateless corporations and striking inequalities", but warned: "Turning our backs on open markets would be a tragedy, but it is a possibility."
On the prospect of losing 15 million jobs, or half the workforce, to robots, he said: "The fundamental challenge is, alongside its great benefits, every technological revolution mercilessly destroys jobs and livelihoods – and therefore identities – well before the new ones emerge." |
They Were Expendable
Watch it on:
What's it About
This is the inspiring true story of the PT boats — and the men who commanded them — during the dispiriting early days of the Second World War in the Pacific. Frustrated Skipper John Brickley (Montgomery) and his right hand man, Rusty Ryan (Wayne), initially have considerable difficulty convincing the Navy brass of the PT boats' value to the war effort. In the face of reversals and retreat from the Japanese, these valiant, steadfast officers are forced to hunker down and wait for the opportunity to show the world what the PTs can really do. Eventually, these nimble craft will play a vital role in turning the tide in the Pacific theater, allowing General MacArthur to fulfill his famous promise to return there in glory.
Why we love it
The legendary director John Ford delivers a powerful human tale of faith and hope sustained during the darkest days of the war for the Allies. Montgomery (father of Elizabeth from "Bewitched," and a decorated PT boat captain himself during the conflict) delivers a remarkably human, unmannered performance as the embattled but stoic Brickley, while the Duke cements his own growing stardom with a charismatic turn as Ryan. Donna Reed also makes for a bewitching love interest as the nurse who falls for Rusty. One of Ford's real gems, too often overlooked.
Up Next
BEST MOVIES BY FARR is your personal guide to great movies to rent, stream, or buy; to watch at home or on-the-go. Led by film advocate John Farr, the Best Movies by Farr team works as a "quality filter" for the discerning moviegoer. Every day, we bring you the best of the best, the fantastic familiar films and hidden gems, to answer that age-old question: "What should we watch tonight?" |
SmartPayday Fast Loans - Fast Payday Loans
Emergency fast loans are for when you require cash money for an emergency scenario. It's not uncommon for someone to need an emergency situation fast loan eventually in their life. It is difficult to anticipate exactly when an urgent financial need will arise and from which side of life. Therefore it is even more difficult to stay ready to tackle such eventualities. This is the main utility of the fast payday loans online because when such events occur, you have a quick and fast way to get the loans you may need.
There are many numerous kind of emergency situations that might arise. It could be that your automobile has actually broken down as well as you need some cash at your disposal just so you might take the children to college as well as commute to work. Or possibly your plumbing system isn't really around scrape. Regardless, you may require access to some instant payday loans in emergency scenario to see you through.
How to access the smart lenders for fast payday loans
Fill the online application form Soon after you submit your application, you will get a notification informing you whether you have been approved or not and when you will receive the money The loan will be deposited into your bank account In case of any confusion regarding the application, use our contact page to submit your query
Fast loans is a responsible enterprise
Because we have no idea when emergency circumstances are going to develop, the least we can do is prepare ourselves monetarily. It is regularly great approach to have some emergency fast available or a "rainy day fund." Nonetheless simply how much should we except for a rainy day? Some say in between â? $ 500 as well as â? $ 1,000. Most financial experts suggest 3-6 months of living expenditures as a beginning factor for a reserve. Some folks keep their rainy day fund in a jar in our home or kept in a secret compartment somewhere in their home. Some choose to proceed their emergency situation quick in a checking account, ready to withdraw when it's required.
The only issue with an emergency situation quick fund is that not everyone has one. It is difficult to save cash, especially for an emergency situation that we can not view coming. Typically we require a quick procedure to watch us with given that if we do not have actually the cash saved, this is normally the only means we could resolve our emergency situations. A fast try could stem from a family members or a pal, a monetary organization or a momentary fast loan.
Fast loans can be a great short term credit solution
When it comes to emergency scenario fast, nonetheless you get it, you need it quickly. One of the most normal method of seeing quick in an emergency situation is getting from a member of the family. Whether it's your brother or sister, mom, daddy or sis, member of the family are a credible source to provide you money. Nevertheless when you need cash fast and also your household aren't around, asking a chum for money may be a far better choice.
Of course, you may go to your bank however when it's an emergency situation you might not have time to fill in line at the branch, fill in prolonged records and wait for the cash to enter your account. Fast payday advance loan are favored for people which want money right into their account quickly. There are few payday loan firms on the greater road yet a number of lenders online. The indicates it operates is that you are provided the money beforehand in one round figure then you pay it back with interest on your payday, normally the last Friday of the month. Different other means to obtain emergency situation quickly contain supplying home items. There are numerous website where you could sell your aged mobile or jewellery as well as get cash just days later on. Nevertheless, if you need the cash that day, it may be worthy of going after the other alternatives.
SmartPayday Fast Loans - Fast Payday Loans |
And here comes part 2 in the "Bruce Peter covers players from both his favourite hockey teams" segment. With the 51st pick overall in the 2012 NHL Entry Draft, the Canadiens selected a guy who many had as a late first round pick in mock drafts in two-way defender Dalton Thrower. Thrower, possessing one of the finest names in the entire draft class, shot up the rankings this year with an offensive explosion to go with a 'plays above his weight class' style of rugged, aggressive, good 'ole western-boy defense.
Unlike a lot of draft selections from the junior ranks, Thrower is already a veteran of major junior hockey. 2011-12 was his third year in the league, making the Saskatoon Blades out of training camp in 2009-10 before he had turned 16 years old. 211 WHL regular season and playoff games later, he's now entering possibly his final WHL season in which he'll be asked to play on a top defensive pairing for the Memorial Cup hosts. And now he's got the fanbase of the Montreal Canadiens keeping an eye on his progress as well.
Things are about to get real for Dalton Thrower in 2012-13.
The panel continued to be divisive on Thrower, a fresh face from the 2012 Draft class, but there seemed to be more of a consensus forming around this pick than other ones:
Player Berkshire Cooper Peter Boyle van Steendelaar Dahan Ive Boucher La Rose Rice Thrower 17 18 17 16 - 12 15 17 13 24
A second round draft pick generally has a lot of positives to his name coming out of his draft year, though a couple of our panelists are still quite conservative with the 18 year olds compared to the rest. In general, though, it's quite a strong vote of confidence for Thrower from the panel as a whole.
Strengths:
Thrower was probably the top skating defenseman on the Saskatoon Blades last year, as well as their most fearless and reliable overall. His skating ability isn't in the high end category, but is above average overall and he only seems to struggle against the elite skaters. His point shot is very hard and in 2011-12 seemed to find it's way on goal a lot more than previously. He's the point man on the Blades' PP and can unleash a powerful one-timer. In his own end, he's an effective puck-clearer and is a very strong checker, both with his body and his stick. His own-zone positioning is improving, but he was still a bit reliant on Duncan Siemens, his defence partner, in that respect.
Thrower receives high marks for his toughness, displayed in both his on-ice pugilistic efforts and his off-ice work ethic and character. His mother is a cancer survivor, and his father is currently fighting cancer as well, something he's had to contend with off the ice while trying to improve as a player on it. When asked about his father at the NHL Entry Draft, Thrower faced the media throng with great admiration and hope (via Neate Sager of Yahoo!):
Thrower's guard dropped when asked about his father. Murray Thrower is still receiving chemotherapy in pill form. But he's leading a regular life and was in the stands to see his oldest son get drafted by an Original Six team. "He's a lot better, he's getting a lot better," Dalton Thrower said. "He's back at work. He's still doing chemotherapy. He's looking good and I'm very grateful to have both my parents. "I've had to grow up fast," he added. "I have two younger siblings. It's brought us closer as a family."
He was easily the most improved player on the Blades' roster in 2011-12, and he seems likely to be one of the best defencemen overall in the WHL for 2012-13. As for that on-ice toughness, Thrower regularly throws big hits, often in open ice, and has had to respond more than a few times. He famously fought Capitals first rounder Tom Wilson in the CHL Top Prospects game despite a notable size disadvantage. But don't call Thrower small (via New England Hockey Journal):
"I don't consider myself 'small' at all," he said. "I'm 6-feet and can throw my body around effectively, even if a guy has four inches on me. I've always heard people say that about me, though, and I've just gone out to show that I can go up against any big guy."
The aspect of his game that impressed me the most in 2011-12 was his creativity and offensive smarts. While he possesses a big point shot, he often got his points through simple wrist shots, drawing coverage to him and then finding an open man, and using his teammates properly. He's a very smart player.
Weaknesses:
Well, he might not like to hear this, but his biggest weakness might be that recklessness that he plays with. The Habs have an excellent young defenceman on their main roster who is similarly exuberant, but is more adept at picking his spots physically. Dalton Thrower would be well advised not to be so willing to drop the gloves. He fought 9 times in 2011-12 (plus one in the Top Prospects game) and 22 times in his WHL career to date. He's a very good fighter but I'm worried that for such an important and skilled player it could definitely end up hurting him as he tries to establish himself as a professional player. This is one of the hardest things to change about a player barring an injury scare, since teammates, fans and coaches alike are generally appreciative of guys like Thrower defending their teammates or their own actions.
While I criticized Dietz for his spike in penalties, I can't say exactly the same for Thrower, as his PIM total only jumped 12 and two of those were added fighting majors, all while playing way more minutes in 2011-12 than the previous year. Still, it'd be nice to see Thrower on the ice more often, and I'm quite confident he can do this in 2012-13 while maintaining his physical edge.
Thrower's defensive reads are probably the area most in need of improvement, as he tends to be over-aggressive in puck pursuit. In general, though, Thrower does so much well or good enough that he makes up for his mistakes.
2012-13 Projection:
I think Thrower can be a dominant defenceman at the major junior level next season. He will be deployed in every situation, will be paired with a high-quality partner that will also be 19 years old, and should only improve with the lessons learned from attending the Canadiens evaluation camps. He faces a tough battle with a lot of high-quality right-handed defencemen in the Canadiens system, but should be able to work his way into the AHL for 2013-14 to begin his professional career.
Thrower could very well be the Saskatoon Blades' MVP during their Memorial Cup hosting season. Getting him at 51st overall could prove a huge steal in the long run.
You can follow Dalton on Twitter at @thrower47 |
This image from the video below shows the machine that uses bouncing beads to perform work, confirming a thought experiment from 1912. Credit: University of Twente.
(PhysOrg.com) -- By building a machine that uses 2,000 bouncing beads to spin a paddle and perform work, researchers from the University of Twente have finally realized a long-debated thought experiment.
A similar machine was first proposed in 1912 by the Polish physicist Marian Smoluchowski. In his thought experiment, he suggested that tiny moving particles could generate enough force to spin a windmill-type paddle. A locking mechanism such as a pawl could prevent backward motion, forcing the wheel to move in the forward direction only.
However, several years later, physicist Richard Feynman argued that, in reality, the bouncing beads would not be capable of doing meaningful work. Feynman showed that, since the entire system operates at the same temperature, a pawl would occasionally slip off the wheel. As a result, the system would generate zero net movement.
Now, physicist Devaraj van der Meer from the University of Twente and his colleagues have demonstrated that such a machine can in fact spin the paddles forward only, generating a positive net movement. The details of their study will be published in an upcoming issue of Physical Review Letters.
Looking somewhat like a high-speed lotto machine, the new system consists of a vigorously shaken platform that causes 2,000 small glass beads to bounce around. When the beads make contact with the vanes of a windmill-like device inside the machine, the vanes move, turning a rod, which rotates a sensor.
In this machine, 2,000 bouncing beads spin the vanes of a ratchet. Credit: University of Twente.
The key challenge was getting the vanes to move in the forward direction only, which the scientists achieved with - somewhat surprisingly - duct tape. With duct tape covering one side of each vane, the vanes spun in one direction only. Since the beads lost more energy when they hit the soft duct-taped side than the non-taped side of the vanes, the machine generated a positive net movement.
Van der Meer noted that the machine doesn’t come close to violating the second law of thermodynamics, since the system is extremely inefficient. Most of the beads’ energy is lost through heat and sound.
However, the system could still provide scientists with insight into classical mechanics. For instance, the system exhibits a property called back interaction, so that not only do the beads move the vanes, but the vanes also move the beads. After the vanes begin to turn in one direction, the researchers observed a new roiling pattern in the beads.
The physicists say this back interaction might also occur in tiny “molecular ratchets,” which include molecules in the body such as RNA polymerase and protein kinesin. At much smaller scales, these molecules move themselves through the body by ratcheting along tracks inside cells. The macroscopic system built here could help researchers better understand how molecular ratchets work by allowing the researchers to observe and manipulate the interactions on a large scale.
© 2010 PhysOrg.com |
Q:
Deriving units using equation
I have the question "Using the equation and information below, derive the units for the permittivity of free space , $\epsilon_{_0}$.
$V = \dfrac 1 {4 \pi \epsilon_{_0}} ~ \dfrac Q r$
$V$ is voltage in volts, $Q$ is charge in coulombs, $r$ is distance in metres, $4$ and $\pi$ are numbers and have no units."
From this information do I need to rearrange the formula to make e0 the subject and then workout the si units of each value?
When I checked the solutions the answer to this is $Q/Vm$ or $QV^{-1}m^{-1}$.
A:
Yes, solving for $\epsilon_0$ first is a good idea:
$$V = \frac{1}{4\pi\epsilon_0}\frac{Q}{r} \\ \epsilon_0 = \frac{1}{4\pi V}\frac{Q}{r} \\ [\epsilon_0] = \frac{1}{\textrm{V}}\frac{\textrm{C}}{\textrm{m}} = \textrm{C} \textrm{V}^{-1}\textrm{m}^{-1}$$
Read out, $\epsilon_0$ has units of "Coulombs per volt per meter".
|
Marquette Historic District
The Marquette Historic District is located in Kewaunee, Wisconsin. It is largely made up of a residential neighborhood.
References
Category:Historic districts on the National Register of Historic Places in Wisconsin
Category:National Register of Historic Places in Kewaunee County, Wisconsin |
Background
==========
In spite of the recent development of targeted therapies (e.g., Temozolomide and avastin), glioblastoma (GBM) still continues to be a medical challenge. Identification of novel targets such as uPA and uPAR that are over expressed in glioblastoma and understanding the different signaling pathways they regulate will greatly enhance the clinical treatment and outcome for patients affected with glioblastoma.
The uPA/uPAR system is a multifunctional system which is involved in several cellular processes like migration, angiogenesis and invasion. Studies by others and us have conclusively shown that the uPA/uPAR system significantly correlates to tumor aggressiveness and poor outcome. Our studies have also shown that shRNA constructs directed against uPA/uPAR, either singly or in combination, have a significant inhibitory effect on the migration, invasion and angiogenesis of GBM cells and xenografts.
Notch signaling is a highly conserved pathway playing an important role during embryo development and adulthood. In mammals, it consists of four receptors, namely Notch 1, Notch 2, Notch 3 and Notch 4 \[[@B1],[@B2]\]. The Notch receptor is a hetero-oligomer and a single-pass transmembrane receptor. The transmembrane monomer is bound through non-covalent interactions to a fully extracellular monomer. Notch is involved in cell proliferation, apoptosis, differentiation, survival and stabilization of arterial endothelial fate, angiogenesis and many other functions \[[@B3],[@B4]\]. Notch signaling is deregulated in many cancers including glioblastoma \[[@B5]\]. The Notch receptor contains the extracellular peptide which contains EGF repeats that non-covalently associate with the transmembrane peptide and binds the Notch ligands (e.g. Delta and Jagged). Upon ligand binding, the Notch receptor is cleaved and sensitized by ADAM metalloproteases and gamma secretase. This leads to cleavage of NICD (Notch intracellular domain) to the nucleus, and the NICD forms a complex with CBF-1 and the transcriptional co-activator MAML for transcription of Notch genes \[[@B6]\]. Previous studies have shown that inhibition of Notch signaling by pharmacological or genetic means leads to cell cycle arrest and suppression of cell growth \[[@B7]-[@B9]\].
We have shown that uPA and uPAR downregulation inhibits invasion in SNB19 glioma cells by decreasing phosphorylation of the Ras-activated FAK, p38MAPK, JNK and ERK1/2, as well as the MEK-activated phosphatidylinositol 3-kinase, AKT and mTOR pathway, indicative of a feedback signaling mechanism of the uPAR/uPA system \[[@B10]\]. Moreover, studies have shown that Notch 1 signaling is known to cross talk with ERK, NF-κB and with the PI3-K/AKT/mTOR pathway \[[@B1]\]. Notch has multiple roles in invasion and angiogenesis of many human cancers but the mechanisms are not understood \[[@B11],[@B12]\]. In this study, we have shown that down regulation of uPA and uPAR inhibits invasion of U251 MG cells and xenograft glioma cells by inhibition of Notch- related gene transcription, signaling mechanism and targeting Notch 1 to the lysosomal pathway. We have also shown that uPA/uPAR down regulation inhibits Notch 1 expression in pre-established tumors in nude mice. Overall, our results suggest that down regulation of uPA/uPAR, either singly or in combination, results in the inhibition of glioma cell invasion via inhibition of Notch 1 receptor cleavage, signaling and endosomal trafficking of the Notch 1 receptor.
Methods
=======
Cells and Reagents
------------------
U251 MG cells were obtained from American Type Culture Collection, (Manassas, VA), and glioma xenograft cell lines (5310 & 4910) were kindly provided by Dr. David James (University of California, San Francisco, San Francisco, CA). All cell lines were cultured as described previously \[[@B10]\]. Antibodies to Notch 1, 2, 3 and 4 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies to cleaved Notch between Gly 1743 and Val 1744 were obtained from Cell Signaling (Beverly MA). Antibodies to extracellular domain of Notch were obtained from Abcam (Cambridge, UK). Antibodies to Delta and Jagged were obtained from Santa Cruz Biotechnology, (Santa Cruz, CA). Antibodies to RBPJκ, Lamin B, alpha tubulin, pAKT, NF-κB p65, MEK, pERK, pmTOR Ser 2448, were obtained from Cell Signaling (Beverly MA). Antibodies to uPA and uPAR were purchased from R&D Systems (Minneapolis, MN). Notch 1 siRNA and antibodies to GAPDH and LAMP-1 were purchased from SCBT (Santa Cruz, CA).
uPA and uPAR shRNA constructs
-----------------------------
shRNA sequences targeting uPAR and uPA were constructed according to our previous publication \[[@B13]\].
Transfection with shRNA constructs
----------------------------------
1.5 × 10^5^cells were plated in 100 mm petri dishes for each transfection experiment. The cells were transfected in serum-free L-15 media using 10 μg of Fugene reagent (Roche, USA) according to the manufacturer\'s instructions. The following constructs were used for transfection: puPA, puPAR, pU2 (both uPA and uPAR) and pSV (scrambled vector). No plasmid was introduced in the control plates. After 12 hrs of transfection, the serum-free media was replaced with serum-containing media and the cells were left in the incubator at 37°C for 48 hrs. The media was then replaced with serum-free media, and conditioned media was collected 12 hrs later. Cells were harvested for isolation of total RNA and/or total cell lysates. Conditioned media was used for fibrinogen plasminogen zymography.
Fibrinogen plasminogen zymography
---------------------------------
We used fibrin zymography to determine the activity of the plasminogen activators as previously described \[[@B14]\]. The samples were subjected to SDS-PAGE with 10% gels that contained fibrinogen and plasminogen. Following electrophoresis, the gels were washed twice with 2.5% (v/v) Triton X-100 for 30 min each time to remove SDS. Finally, the gels were incubated with 0.1 M glycine buffer (pH 7.5) at 37°C overnight, stained with amido black, and then destained. The final gel had a uniform background except in regions to which uPA had migrated and cleaved its substrate.
Western blotting
----------------
U251 MG, 5310 and 4910 cells were left untreated or transfected with puPA, puPAR or pU2. Cells were collected and whole cell lysates were prepared by lysing cells in RIPA lysis buffer containing a protease inhibitor cocktail (Sigma, St. Louis, MO). Equal amounts of protein fractions, immunoprecipitates or lysates were resolved by SDS-PAGE and transferred to a polyvinylidene difluoride membrane. Proteins were detected with appropriate primary antibodies followed by HRP-conjugated secondary antibodies. Comparable loading of proteins was verified by reprobing the blots with an antibody specific for the housekeeping gene product, GAPDH.
Reverse transcriptase polymerase chain reaction
-----------------------------------------------
Total RNA was isolated from U251MG, 4910 and 5310 cells using the TRIzol reagent as per the standard protocol. Total RNA was treated with DNAse I (Invitrogen, Carlsbad, CA) to remove contaminating genomic DNA. PCR analysis was done using the one-step reverse transcription-PCR kit (Invitrogen, Carlsbad, CA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. The following primers were used:
Notch 1 Forward 5\'-CAGCTTGCACAACCAGACAGAC-3\'
Notch 1 Reverse 5\'-ACGGAGTACGGCCCATGTT-3\'
Notch 2 Forward AACTGTCAGACCCTGGTGAAC
Notch 2 Reverse CGACAAGTGTAGCCTCCAATC
Notch 3 Forward TGACCGTACTGGCGAGACT
Notch 3 reverse CCGCTTGGCTGCATCAG
Notch 4 Forward AGTCCAGGCCTTGCCAGAACG
Notch 4 Reverse GTAGAAGGCATTGGCCAGAGAG
GAPDH:5\'-CGGAGTCAACGGATTTGGTCGTAT-3\'sense
5\'-AGCCTTCTCCATGGTGGTGAAGAC-3\' antisense
The PCR conditions were as follows: 95°C for 5 min., followed by 30 cycles of 95°C for 1 min., and annealing temperature set according to the AT and GC content of the primers.
NF-κB family transcription factor assay
---------------------------------------
Nuclear extracts from untreated U251 MG, 5310 and 4910 cells transfected with pSV, puPA, puPAR or pU2 were assayed for activation of NF-κB transcription factor by TransAM NF-κB family activation kit (Active Motif, Carlsbad, CA) according to the manufacturer\'s instructions.
Immunofluorescence assay
------------------------
U251 MG, 4910 and 5310 cells were either transfected with pSV, puPA, puPAR or pU2 or left untransfected. The cells were then fixed, permeabilized, stained with primary antibodies against Notch 1 and LAMP-1, washed, incubated with Alexa fluor tagged secondary antibodies, washed with PBS and mounted in an anti-fading reagent containing DAPI. The cells were then visualized using a confocal microscope using Olympus Fluoview software.
uPA/uPAR quantification by ELISA
--------------------------------
Conditioned medium from mock and pSV, puPA, puPAR, or pU2-transfected U251 MG, 5310 and 4910 cells were subjected to ELISA for uPA and uPAR (R&D Systems, Minneapolis, MN) according to the manufacturer\'s instructions.
Soft colony agar assay
----------------------
Anchorage independent growth was determined by assaying colony formation in soft agar \[[@B15]\]. Briefly, U251 MG, 5310 and 4910 cells which were either untreated or transfected with pSV, puPA, puPAR or pU2 were suspended in DMEM or RPMI containing 10% FBS and 0.33% sea plaque low-melting temp agarose. 2 ml containing 2 × 10^4^cells were plated on a 35 mm dish over a 3 ml layer of solidified DMEM/RPMI 10% FBS and 0.6% agarose. The cells were fed by adding 200 μl of RPMI/10% FBS or with DMEM/10% FBS. The colonies were photographed at 10x and 20x magnification after 4 weeks.
Matrigel invasion assay
-----------------------
Invasion of U251MG and 4910 cells was determined by a Matrigel invasion assay as described previously \[[@B16]\]. Briefly, U251MG, 4910 cells which were either left untreated, treated with DAPT (N-\[N-(3,5-Difluorophenacetyl)-L-alanyl\]-S-phenylglycine t-butyl ester ( NICD inhibitor) for 1 h at 37°C or transfected with pSV, puPA, puPAR or pU2 were detached, washed twice in PBS, suspended in serum-free medium and seeded in the upper chamber of a Transwell insert (8-μm pores) coated with matrigel (1 mg ml^-1^) (Collaborative Research Inc., Boston, MA). The lower chamber was filled with 700 μl of complete medium. After 18 hrs of incubation period, the non-migrated cells in the upper chamber were gently scraped away, and invaded cells present on the lower surface of the insert were stained with Hema-3 (Fisher Diagnostics, Middletown, VA). Photographs of the invaded cells were taken with a light microscope (Olympus IX-71, Minneapolis, MN).
Co-localization of Notch 1 with LAMP-1
--------------------------------------
Semi-confluent U251 MG cells grown in 8-well chamber slides were left untreated or transfected with pSV,puPA, puPAR and pU2. After 48 hrs, the cells were washed, fixed with 2% paraformaldehyde, permeabilized in 0.5% Triton X-100, and stained with primary antibodies against Notch-1 and LAMP-1. The cells were then washed and further incubated with appropriate secondary Alexa fluor antibodies, and examined under an Olympus Fluoview microscope.
Animal experiments
------------------
U251 MG cells (2 × 10^6^) were injected into the brains of nude mice using a stereotactic frame. After 8-10 days the mice were treated with pSV, puPAR, puPA and pU2. The *in vivo*intracranial delivery of the vectors was performed using Alzet mini-osmotic pumps (Direct Corp, Cupertion, CA) at the rate of 0.25 μl/h \[mock (PBS), 150 μg of Vector DNA, 150 μg of puPA, 150 μg of puPAR and 150 μg of pU2\]. All experiments were performed in compliance with institutional guidelines established by the University Of Illinois College Of Medicine at Peoria. After five weeks or when the control mice started showing symptoms, mice were euthanized by cardiac perfusion with formaldehyde. The brains were then removed and paraffin embedded following standard protocols. Sections were prepared with H&E. In each case sections were blindly reviewed and scored semi-quantitatively for tumor size. Sections were observed and immunohistochemical analysis for Notch 1 was done on paraffin-embedded brain tumor sections of mice treated with pSV, puPA and pU2 with specific antibody for Notch 1.
Results and Discussion
======================
Notch receptors are expressed in human glioblastoma tissue microarray and in glioblastoma cells and glioma xenograft cell lines
-------------------------------------------------------------------------------------------------------------------------------
To determine if Notch is expressed in glioblastoma tissues and cells, we wanted to check for Notch receptor expression by GBM human tissue array, western blot and by RT-PCR in U251 MG, 4910 and 5310 cells. Consistent with previous reports, Notch 1, Notch 2, Notch 3 and Notch 4 expression by immunohistochemistry was observed in the GBM tissue array (Figure [1A](#F1){ref-type="fig"}, panels a, c, e, and g ). Notch receptors 1 to 4 were minimally expressed in normal brain tissue. (Figure [1A](#F1){ref-type="fig"}, panels b, d, f, h) Further confirmation of our GBM tissue array results was accomplished with immunofluorescent analysis (data not shown). Lysates from all the three cell lines showed expression of Notch 1, 2, 3, and 4 (Figure [1B](#F1){ref-type="fig"}) and results of mRNA analysis by RT-PCR also showed gene expression of all the four receptors (Figure [1C](#F1){ref-type="fig"}).
{#F1}
shRNA-mediated uPA/uPAR downregulation inhibits anchorage independent growth of U251 MG, 5310 and 4910 cells
------------------------------------------------------------------------------------------------------------
U251 MG, 5310, 4910 cells were left untransfected or transfected with puPA, puPAR and pU2 were analyzed by a colony formation assay in soft agar (Figure [1D](#F1){ref-type="fig"}). puPA-, puPAR- and pU2-transfected U251 MG (Figure [1D](#F1){ref-type="fig"}, panel a to e), 5310 (Figure [1D](#F1){ref-type="fig"}, panel f to j) and 4910 (Figure [1D](#F1){ref-type="fig"}, panel k to o) cells showed significant decreases in colony number (\*\*p \< 0.0001). Quantitative analysis of the number of anchorage independent colonies in soft agar after shRNA transfection in U251 MG, 5310 and 4910 cells is shown in Figure [1E](#F1){ref-type="fig"}. The colony size was also decreased in the shRNA-transfected cells in comparison to the controls. A complete recovery in both colony number and size was obtained when exogenous uPA and ruPAR was added (data not shown) indicating a specific role for uPA and uPAR in anchorage-independent growth of U251, 5310 and 4910 cells. To further confirm our results, we performed a matrigel invasion assay in U251MG and 4910 cells left untransfected or transfected with SV, puPA, puPAR and pU2 and with DAPT (an NICD inhibitor). Results showed that invasion was inhibited in puPA, puPAR, pU2 and DAPT-treated conditions compared with controls, suggesting that inhibition of invasion by shRNA constructs against uPA, uPAR and U2 is mediated by Notch-1 receptor (Figure [1F](#F1){ref-type="fig"}).
puPA, puPAR and pU2 inhibit cleavage of Notch receptor in U251MG and xenograft cell lines
-----------------------------------------------------------------------------------------
Notch receptor is cleaved by four enzymes and each cleaved product is significant to its function. However, cleavage of Notch 1 by gamma secretase is very critical for the function of the Notch receptor. Cleavage of Notch 1 by γ secreatase results in the release of NICD (Notch intracellular domain), and release of NICD to the nucleus is critical for Notch gene expression. In all of the three cell lines examined, we observed that puPA, puPAR and pU2 inhibited the cleavage of the Notch receptor as indicated by the absence of a cleaved band at 80 Kda compared with the controls (Figure [2A](#F2){ref-type="fig"}). Notch 1 is a transmembrane domain protein that is involved in the development and determination of cell fate \[[@B17]\]. During maturation, the Notch molecule is cleaved by a furin-like convertase at its extracellular domain \[[@B18]\]. Upon ligand binding, the carboxy terminal Notch 1 fragment is released and is further cleaved at Gly 1743 and Val 1744 \[[@B19],[@B20]\]. Endogenous levels of cytosolic domain are observed only upon cleavage between Gly 1743 and Val 1744. Results show cleavage of Notch at the Val 1744 position is inhibited in puPA- and pU2-transfected U251, 4910 and 5310 cells (Figure [2A](#F2){ref-type="fig"}). Quantitative representation of activated Notch 1 and cleaved Notch 1 levels is shown in Figure [2B](#F2){ref-type="fig"} and Figure [2C](#F2){ref-type="fig"}, respectively. To further confirm our western blotting results, we checked for the NICD domain in U251 MG cells by staining the cells with an antibody to NICD in untreated U251 MG cells and in U251 MG cells transfected with pSV, puPA, puPAR and pU2. As demonstrated by our western blot results, we observed increased expression of NICD in mock and pSV-treated cells (Figure [2D](#F2){ref-type="fig"}, panel a & b) while the cells treated with the three shRNA constructs showed very little staining (Figure [2D](#F2){ref-type="fig"}, panel c to e). NICD staining was seen as small green spots at the periphery and at the center of the cells.
{#F2}
puPA, puPAR and pU2 inhibits the gene expression of Notch 1 mRNA in all the three cell lines examined
-----------------------------------------------------------------------------------------------------
To determine whether puPA, puPAR and pU2 inhibit Notch 1 mRNA, we subjected controls and shRNA-transfected U251 MG, 5310 and 4910 cells to RT PCR for Notch 1 gene expression. Results showed that simultaneous down regulation of uPA and uPAR by pU2 efficiently down regulated Notch 1 mRNA in all three cell lines compared with puPA and puPAR (Figure [2E](#F2){ref-type="fig"}). Quantitative analysis of the RT-PCR results is shown in Figure [2F](#F2){ref-type="fig"}. These results suggest that simultaneous down regulation of both uPA and uPAR with pU2 is a better approach to knockdown Notch 1 mRNA than using single shRNA constructs.
Notch inhibits uPA expression and activity in glioblastoma cells and xenografts
-------------------------------------------------------------------------------
To ascertain whether Notch plays a role in regulating uPA activity and expression, we transfected U251 MG, 5310 and 4910 cells with scrambled vector siRNA and siRNA to Notch 1 and checked for uPA activity by fibrinogen zymography and uPA expression using western blotting. In all three cell lines tested, results showed that Notch siRNA downregulated uPA expression (Figure [3A](#F3){ref-type="fig"}) and uPA activity (Figure [3B](#F3){ref-type="fig"}). This probably suggests that Notch and uPA regulate each other through a positive feedback mechanism. Quantitative expression of relative uPA expression and relative uPA activity is shown in Figures [3C](#F3){ref-type="fig"} and Figure [3D](#F3){ref-type="fig"}, respectively.
{#F3}
Exogenous addition of uPA and uPAR activate Notch 1 in uPAR antisense and in U251 MG cells
------------------------------------------------------------------------------------------
Our previous results showed that shRNA against uPA and uPAR inhibits Notch expression and cleavage (Figure [2A](#F2){ref-type="fig"}). We wanted to check if addition of exogenous uPA and uPAR activates the Notch 1 receptor in uPAR antisense cells and in U251 MG cells. Our results indicate that upon exogenous addition of uPA and ruPAR, individually and in combination, Notch 1 expression was activated in uPAR antisense cells and in U251 MG cells (Figure [3E](#F3){ref-type="fig"}). This probably suggests that uPA independent of its role as a uPAR ligand can activate the Notch 1 receptor in glioblastoma cells.
uPA activates Notch 1 receptor independent of Notch ligands, Delta and Jagged
-----------------------------------------------------------------------------
To further clarify the role of uPA as a ligand for Notch 1 in glioblastoma cells, we wanted to ascertain if uPA activates Notch 1 in uPAR antisense cells in both the presence and absence of Notch ligands, namely Delta and Jagged. For this purpose, we used siDelta and siJagged transfected uPAR antisense cells and stimulated these cells with uPA. Surprisingly, we found that in uPAR antisense cells, exogenous uPA activated Notch 1 and showed a further increase in fold activation in the presence of siDelta and Jagged siRNA (Figure [3F](#F3){ref-type="fig"}). These results suggest that Notch 1 can be activated by uPA by independent of uPAR and Notch ligands, Delta and Jagged. Quantitative expression of Notch 1 expression from Figure [3E](#F3){ref-type="fig"} &[3F](#F3){ref-type="fig"} is depicted in Figure [3G](#F3){ref-type="fig"} and Figure [3H](#F3){ref-type="fig"}, respectively. Overall, these results indicate that Notch 1 and uPA regulate each other in glioblastoma and GBM uPAR antisense cells.
puPA, puPAR and pU2 inhibits NICD and HES-induced AKT, NF-κB and ERK pathways in U251 MG and 4910 cells
-------------------------------------------------------------------------------------------------------
Previously, we have shown that down regulation of uPA, uPAR and pU2 in SNB19 cells leads to decreased phosphorylation of AKT and mTOR at the Ser 2448 position, and ERK downstream of AKT. To further confirm these results in the cells lines used in this study, we checked for phosphorylation of AKT, ERK and mTOR after transfection with shRNA against uPA/uPAR, singly and in combination. As anticipated, we observed that transfection with puPA-, puPAR- and pU2-transfected cells significantly down regulated phosphorylation of AKT, mTOR and ERK pathways in the three cell lines used in this study. (Figure [4A-C](#F4){ref-type="fig"}). Previous studies have shown that NF-κB is a downstream target for ERK \[[@B21]\]. To confirm whether uPA/uPAR downregulation inhibits NF-κB, which is downstream to ERK, we checked the nuclear activation of p50 (NF-κB1), p52 (NF-κB2) and p65 (Rel A). As expected, we observed significant reduction in the nuclear activation of p50, p52 and p65 in all three cell lines tested (Figure [4D-F](#F4){ref-type="fig"}). Overall, these results suggest that shRNA against uPA, uPAR and U2 inhibits AKT/mTOR, ERK and NF-κB pathways in glioblastoma cells and xenografts.
{#F4}
The cross talk between Notch signaling and AKT/mTOR pathways has been reported in the literature in many studies \[[@B22]-[@B24]\]. Previous reports in the literature \[[@B25],[@B26]\] have shown that there is a cross talk between Notch and NF-κB. To determine whether puPA down regulates Notch-induced AKT, NF-κB and ERK pathways, we overexpressed NICD and HES1 in U251 MG and 4910 cells. We also transfected these cells with puPA to check if puPA inhibits NICD and HES-induced phosphorylation of AKT, NF-κB and phosphorylation of ERK. Interestingly, we observed activation of AKT, ERK and NF-κB in pSV-transfected cells and in NICD and HES1-overexpressed cells (Figure [4G](#F4){ref-type="fig"} and [4H](#F4){ref-type="fig"}). AKT, ERK phosphorylation and NF-kB p65 levels were significantly down regulated upon transfection with puPA (Figure [4G](#F4){ref-type="fig"} and [4H](#F4){ref-type="fig"}). To confirm the cross talk of AKT/mTOR/NF- κB/ERK pathways with Notch-1, U251MG and 4910 cells were left untreated or treated with pSV and siNotch 1 and checked for the expression of pmTOR, pERK, pAKT and NF-kB p65. Results showed that siNotch 1 inhibited phosphorylation of AKT, ERK, mTOR and NF-kB levels compared with controls in both the cell lines tested (Figure [4I](#F4){ref-type="fig"} and Figure [4J](#F4){ref-type="fig"}). To further confirm if NICD/HES1-overexpressed Notch 1 is inhibited by puPA, puPAR and pU2 shRNA constructs, we checked for Notch 1 expression in U251MG and 4910 cells after transfection with shRNA constructs against uPA, uPAR and U2. Results showed that NICD/HES1 induced Notch1 expression levels were significantly reduced in uPA andU2 transfected cells and moderately in puPAR transfected cells (Figure [4K](#F4){ref-type="fig"} and Figure [4L](#F4){ref-type="fig"}). These results suggest that shRNA against uPA, uPAR and U2 inhibit AKT, ERK and NF- κB pathways. These results also show that shRNA against uPA down regulates NICD and HES-induced Notch1, AKT, NF-κB and ERK activation in glioblastoma cell lines.
Transcriptional inactivation of uPA/uPAR inhibits trafficking of Notch 1 receptor in the U251 MG cell line
----------------------------------------------------------------------------------------------------------
The trafficking of Notch receptor is known to be mediated by endosomes. To determine if Notch 1 is targeted to lysosomes after transfection with shRNA against uPA, uPAR and U2 (bicistronic construct), we conducted immunofluorescent staining in U251 cells after transfection and checked for co-localization of NICD with LAMP-1 (a lysosomal marker). We did not observe co-localization of Notch 1 with LAMP-1 in mock and pSV-treated cells (Figure [5A](#F5){ref-type="fig"}, panel a to f) but there were few spots of co-localization in puPA- (Figure [5A](#F5){ref-type="fig"}, panel g to i) and puPAR- (Figure [5A](#F5){ref-type="fig"}, panel j to l) treated cells. In pU2-treated cells, we were able to observe a significant association of Notch 1 receptor with LAMP-1, as indicated by a significant number of yellow spots which is suggestive of co-localization (Figure [5A](#F5){ref-type="fig"}, panel m to o). The percent of cell count showing co-localization is depicted quantitatively in Figure [5B](#F5){ref-type="fig"}. This result suggests that Notch 1 receptor trafficking is significantly affected in puPA- puPAR- and pU2-transfected U251 MG cells.
{#F5}
puPA and pU2 affect growth and pre-established intracranial tumors in nude mice
-------------------------------------------------------------------------------
To further confirm our *in vitro*results, we checked if shRNA against puPA and pU2 affected pre-established intracranial tumors in nude mice and also assessed Notch 1 expression. In U251 MG pre-established intracranial tumors, we observed expression of Notch 1 (Figure [6A](#F6){ref-type="fig"}, panel a to c), but in puPA-treated tumors, we observed a significant decrease in the tumor margin and infiltration, as well as in inhibition of Notch 1 expression (Figure [6A](#F6){ref-type="fig"}, panel d to f). In pU2-treated tumors, the tumor margin showed more inhibition than in puPA-treated tumors, and there was also significant inhibition of Notch 1 expression and more inhibition at the tumor margin than in puPA- treated tumors. (Figure [6A](#F6){ref-type="fig"}, panel g to i). Overall, these results show that uPA and uPAR down regulation in combination inhibits invasion in glioblastoma cells by down regulation of Notch 1 receptor activation and expression, as well as by blocking the trafficking of the Notch 1 receptor.
{#F6}
Expression of Notch 1 has been reported in various types of human cancers \[[@B27],[@B28]\]. Notch 1 has shown to be involved in several functions in cancer cells including proliferation, invasion and angiogenesis \[[@B21],[@B29],[@B30]\]. In this study, we report that Notch 1 is over expressed in glioblastoma cell line U251 MG and xenografts consistent with previous studies \[[@B11],[@B12],[@B31]\]. Studies by us and others have previously shown that simultaneous down regulation of uPA and uPAR in glioblastoma cells significantly down regulated invasion and angiogenesis by *in vitro*and *in vivo*\[[@B32],[@B33]\]. In this study, we found that Notch 1 is a direct target for puPA and by pU2. Studies by many groups \[[@B11],[@B34],[@B35]\] have shown that Notch 1 is target for many genes in glioblastoma, and siRNA against Notch 1 down regulates uPA and inhibits prostate cancer and pancreatic cancer cell invasion \[[@B27],[@B36]\]. Inspite of this current knowledge, the role of uPA and uPAR down regulation in glioma cell invasion remains poorly understood. In this study, we show that knockdown of uPA and uPAR in tandem inhibits cleavage of the Notch receptor, down regulates Notch 1 gene expression and Notch 1 signaling cross talk, and significantly blocks the trafficking of the Notch receptor in glioblastoma cells.
As previously shown in glioblastoma cell line SNB19, we observed that targeted down regulation of uPA and uPAR by single and bicistronic constructs inhibited invasion in U251 MG and in glioma xenografts 4910 and 5310 by Matrigel invasion assay (Figure [1F](#F1){ref-type="fig"}) and also anchorage independent growth by soft agar colony formation assay (Figure [1D](#F1){ref-type="fig"}). Increased expression of Notch 1 has been detected in brain tumors \[[@B37]\] and other cancers \[[@B38],[@B39]\]. The role of Notch 1 in different cancers is considerably varied \[[@B40]\]. As previously reported \[[@B11]\], we observed increased expression of Notch 1 in glioma human tissue array, western blot and RT-PCR.
The down regulation of uPA and uPAR inhibited activated Notch 1 activity and cleavage of Notch 1 at the Val 1744 position which resulted in the inhibition of Notch gene transcription. Moreover, glioblastoma cells treated with siRNA against Notch showed decreased uPA expression as shown by western blotting and decreased uPA activity by fibrin zymography. Based on these observations, it is tempting to speculate that the uPA/uPAR system might play a direct role in Notch 1 signaling and that uPA alone could directly regulate Notch 1 in glioblastoma. Whether uPA/uPAR regulates Notch 1 promoter activity is to be studied in future. Our data corresponds to a previous study \[[@B41]\] which showed that Notch 1 knockdown regulates the expression of uPA and uPAR by a distinct gene expression mechanism in prostrate cancer cells. Bin Hafeez et al. \[[@B41]\] conclude their study by stating that in addition to MMP-9, uPA and uPAR might work synergistically to enhance tumor invasion and metastasis in prostrate cancer. As our results show that Notch 1 expression is severely altered with puPA, puPAR and pU2 treatments, we hypothesize that uPA/uPAR could be a target for intervention in glioma.
Previous studies have shown that Notch 1 regulates the PI3K/AKT/mTOR pathway in other cancers. Notch 1 has been reported to cross talk with the AKT pathway in human cancer cells \[[@B22]-[@B24],[@B42]\]. Studies by us have also shown that uPA and uPAR down regulation inhibits phosphorylation of Akt \[[@B32]\] in glioblastoma cells. Our results suggest that inhibition of AKT/mTOR signaling pathway via uPA/uPAR down regulation might be mediated by Notch 1 signaling in glioblastoma cells. Phosphorylation of AKT induced by NICD and HES 1 over expression was down regulated by shRNA against uPA in GBM cells. These results suggest the existence of a reciprocal regulation of Notch-1 and AKT pathway in uPA/uPAR down regulation in glioblastoma cells.
Notch is known to cross talk with NF-κB and ERK pathways which are downstream of AKT \[[@B27],[@B36]\]. Our studies have shown that uPA/uPAR down regulation inhibits nuclear activation of NF-κB \[[@B43]\] and phosphorylation of ERK \[[@B41]\]. The present study has also shown that NF-κB and AKT induced by NICD and HES1 over expression in glioblastoma cell lines is inhibited by shRNA against uPA. Further in-depth mechanistic studies are required to understand the role of uPA in regulation of Notch 1-induced AKT, NF-κB and ERK pathways. Our results have comprehensively suggested that uPA/uPAR down regulation results in the inhibition of invasion of GBM cells by targeting the Notch 1 receptor signaling, cleavage, decreased Notch1 mRNA transcription and trafficking. Purow et al \[[@B11]\] have shown that Notch siRNA leads to increased cell death, decreased proliferation and inhibition of cell cycle in glioblastoma cells. Our results suggest that uPA/uPAR down regulation might regulate Notch 1-mediated events in glioblastoma. Interestingly, our results show that uPA/uPAR down regulation resulted in Delta and Jagged downregulation (data not shown). Studies by Purow et al \[[@B11]\] have also shown that Notch ligands could themselves have a potential for transformation and play important roles in gliomagenesis. How shRNA against uPA and uPAR regulates Delta and Jagged is under further investigation. Our results also show that in uPAR antisense cells and in U251 MG cells, uPA was able to activate Notch 1 in the absence of Delta and Jagged ligands. These results suggest that uPA by itself could mediate uPAR independent functions such as Notch 1 regulation in glioblastoma cell lines.
Our studies also indicate that uPA/uPAR down regulation also results in the lysosomal targeting of the Notch 1 receptor in U251 MG cells. The mechanistic details of lysosomal targeting are yet to be explored. Notch 1 expression was also inhibited in pupa- and pU2-treated pre-established intracranial tumors in nude mice. Involvement of uPA/uPAR in a plethora of cellular processes in glioma gives us the advantage of targeting this multifunctional system for therapeutic intervention in patients with high grade glioma.
Conclusions
===========
In summary, we have presented experimental evidence that strongly suggests the role of Notch 1 in uPA/uPAR down regulation in glioblastoma. shRNA against uPA and uPAR inhibited Notch 1 cleavage, Notch gene transcription and Notch 1-mediated AKT/ERK phosphorylation and NF-κB subunits. From our results, we can conclude that down regulation of uPA/uPAR, singly and in tandem, could be an effective therapeutic approach for inactivation of Notch-1 cleavage, signaling and trafficking and to down regulate Notch-signaling-induced NF-κB, ERK and AKT pathways which are known to play roles in growth, migration, invasion and angiogenesis of glioblastoma. Based on our results, we provide a hypothetical pathway by which uPA/uPAR inhibits the Notch 1 pathway which may be partly mediated by AKT/NF-κB and ERK pathways. Overall, our results suggest that targeting uPA/uPAR may be advantageous for future treatment of gliomas.
List of Abbreviations
=====================
uPA: urokinase plasminogen activator; uPAR: urokinase plasminogen activator receptor; AKT: RAC-alpha serine/threonine-protein kinase; PI3-K: phosphotidyl inositide 3 kinase; ERK:Extracellular regulated kinase; NICD: Notch intracellular domain: HES: Hairy enhancer of split; GAPDH: glyceraldehydephosphate 3 dehydrogenase; LAMP-1: lysosome associated membrane protein 1.
Competing interests
===================
The authors declare there are no conflicts of interest regarding this manuscript.
Funding
=======
This research was supported by a grant from National Institutes of Health, CA75557 (to J.S.R.). The contents are solely the responsibility of the authors and do not necessarily represent the official views of NIH. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Authors\' contributions
=======================
HR conceived and carried out the experiments. HR wrote the manuscript. HR, CG and JSR reviewed and analyzed the data. JSR, MG and DD contributed reagents/materials/analysis tools. All members read and approved the final manuscript.
Acknowledgements
================
The authors thank Shellee Abraham for manuscript preparation and Diana Meister and Sushma Jasti for manuscript review.
|
A Simple Plan For Researching Plumbers
One thing that people need to be aware of that plumbing is one primary activity which is very important to human and therefore it should be taken seriously. Plumbing involves many activities, and it all depends on the kind of project which one needs to be undertaken by the plumbing company.
It therefore says that this is a delicate profession which needs to be taken seriously to ensure people have all they would need because in case of any mistake or work being done in a wrong way there could be a lot of damage caused by the water or the waste drainage system. The first thing you will need to consider is the size of the project so that you are sure of the size of the company you are looking because in most case the plumbing projects may be big or small depending on the type of commercial plumbing that needs to be done.
Similarly we have the commercial plumbing companies which can only handle small plans and others who can manage big projects depending on the expertise and the personnel and the equipment of work so one will need to make sure they get a company which can handle the type of the project they have. The company should be licensed and registered to do the kind of job which you need them to do, and this is one of the things which many people would like to see.
The expertise and the capability of the company can only be seen through some of the similar projects which they may have done recently, and therefore there is need for people to make sure they do all that would make sure they can view such projects. You can only be able to handle the project in a right way and this one involves people making sure they do all that is required of them. Plumbing work is very delicate and if people are not careful enough sometimes they can have some accidents and injuries which needs to be covered by an insurance service.
In places where people are constructing their houses there are different regulations that they are sup[posed to adhere to so that they are up to the standards of the place, and therefore it is important to subscribe to them. People set budgets which need to be taken care of and therefore there is a need for them to make sure they get a company which will let the money do the work. |
Remembering Junaid Jamshed and many others
Junaid Jamshed’s tragic demise in an air crash conjured up my entire childhood right before my eyes. I was in the capital city last year attending a national-level convention’s session when the gruesome incident occurred and the haunting news broke. The day’s hectic session had ended and everyone sans I was heading towards rooms; I was busy in drafting the day’s news briefing along with the council’s secretariat. Work commitment demands aloofness from the surroundings, following which principle we switched on our mobiles only after having completed our tasks. It was then that we got to know about the plane crash near Havelian that had consumed the lives of all on board.
The ill-fated flight PK-661 en route to Islamabad from Chitral was carrying over 45 people and was reportedly seen on fire before hitting the ground. Scale of the loss would not have been less by any degree in the other case but was surely more evocative owing to Junaid Jamshed being among the dead. Yes, our very own dearly loved JJ whom we remember as a bearded singer-turned-preacher. But the kids and youth of the late ‘80s and early ‘90s hark back to a different set of memories associated with him. The delightful sight of a band comprising young boys singing Dil Dil Pakistan and raising its illustriousness to an altogether new pinnacle of fame by making it Pakistan’s unofficial pop anthem and the world’s third most favourite song ever as rated in a global poll conducted by BBC World in 2002.
An interesting aspect of his life that caught the glare of publicity after his departure was him being the son of a Group Captain in the Pakistan Air Force (PAF) and his own aim to become its part as a fighter pilot. His weak eyesight could not forestall his loyalty and devotion and he briefly worked as a civilian contractor and engineer for the PAF before pursuing his career in music. The patriotism that ran in his blood was aptly reflected in other scores sung by him, including Hum hain Pakistani, Tera karam maula and Qasam uss waqt ki, a tribute by Jamshed to the PAF and our jawans. He always kept his eyes on the sky, he flew high and he was surely destined to breathe his last in an unwonted manner.
The transformation, however, is the most mooted feature of his life. I did not realise the importance of this metamorphosis until it was time to memorialise our sentiments for him on his death – whether to warble his songs or recite his nasheeds. I, being an individual who had just realised what life really is, so transient and fragile, rushed to my room, offered my Isha prayer, switched on the television and watched the news and special reports on the deadly crash and Jamshed’s life. Something was aching deep inside. I wanted to address the twinge but was unable to agnise it. On spur of moment, without realising what words I was uttering and what actions I was doing, I started snapping my fingers and intoning Na tu ayege. By the time I reached the hotel’s lobby I was humming the tune of Aitbaar. There I found sitting several members of the convention who, too, were in immense grief. And we sat all night remembering Junaid Jamshed in the most befitting manner we could think of – by singing all his songs and sharing with each other our childhood memories.
The ill-fated flight PK-661 en route to Islamabad from Chitral was carrying over 45 people and was reportedly seen on fire before hitting the ground
Nevertheless, we soon realised that his loss was not the only one and the lives of 46 other people who had died in the crash were equally important. The next day started with special prayers for all followed by two-minute silence after which we discussed the shady dynamics of the whole incident: the causes of this crash, in particular, and all those before it, in general, and the reason why all the investigation reports lead to nothing. The discourse unearthed facts too bitter to acknowledge and accept.
Our aviation history is dark, with 18 major air crashes, either within the boundaries of Pakistan or involving Pakistani planes, and a cumulative toll of over one thousand fatal casualties. Starting from the latest, why was ATR 42-500 given green signal to fly without thorough detection and rectification of detects when majority of its aircrafts, in words of the plane’s first officer as reportedly mentioned to his mother, “are not fit to fly and should not be allowed to operate on dangerous routes”? A direct vindication of this lies in the refusal of another PIA pilot to fly an aircraft with a faulty engine just two days after the crash. Engine failure is not an unpredicted and out-of-the-blue fault; it shows its signs and symptoms way before the occurrence of tragedy just like any other disorder. Then why are these indications left unnoticed? We hope that the loss of these 47 lives teach us the lesson we having been yearning to learn since long.
Bhoja Air Flight 213 that crashed in bad weather back in 2012 during its approach to Islamabad airport is yet another tale of negligence on the part of aviation authority and training of crew. The final investigation report released by the Civil Aviation Authority held ineffective management by the cockpit crew of the basic flight parameters, airspeed, altitude and thrust management to quote few, as the primary reason behind the crash. As per the report, “the pilots had inadequate flying experience, training and competence level in the aircraft”. Then who allowed the airline to play with the lives of 127 people on board?
The deadliest air accident of all times, as it is considered to be, struck Airblue Flight 202 which crashed in the Margalla Hills on 28 July 2010, killing 146 passengers and six crew members. Allegedly there was “nothing wrong in conversations between the pilot and the Islamabad control tower that suggests anything was wrong”; however, multiple EGPWS “TERRAIN AHEAD” warnings were recorded on the black box starting 40 seconds before the crash. A witness reported to have seen the plane losing its balance and then going down. As claimed by another one, the aircraft was seen “flying as low as the four-storey building”. Among the fatalities were six members of the same forum which I was attending last year on this day.
Who is responsible for this loss? Who is to be blamed? Have investigation reports of any of the aforementioned crashes been a word of caution for those whom we trust with our and our beloveds’ lives? The lesson is yet to be learnt as is indicated by a video clip shared by a PIA passenger wherein leakage from the aircraft’s engine could be visibly seen during the flight. “During the flight, I could see on my left side some liquid dripping out of engine and near the wing.” His calling to attention resulted in the flight reaching its destination 15 minute before the estimated time of arrival. Withal, his concern was addressed with severe castigation by a crew member who “instead of being concerned about the complaint… was more concerned about my video”. With such ‘dedication’ and ‘sense of responsibility’ we surely are destined towards more and more calamities and remembering more and more Junaid Jamsheds. The only thing we, as citizens of Mulk-e-Khudadad, could wish for is the realisation that we choose our own path because the only verse I can think of on this day is “Hum kyun chalen uss rah par, jis rah par sab he chalen.” Rest in peace everyone, for that world is surely more peaceful than this one. |
414 F.Supp.2d 1289 (2006)
HYUNDAI ELECTRONICS INDUSTRIES CO., LTD. and Hyundai Electronics America, Inc., Plaintiffs,
v.
UNITED STATES, Defendant, and
Micron Technology, Inc., Defendant-Intervenor.
Slip Op. 06-9. Court No. 00-01-00027.
United States Court of International Trade.
January 18, 2006.
Willkie, Farr & Gallagher LLP, Washington, DC (Daniel L. Porter and James P. Durling) for Plaintiffs Hyundai Electronics Industries Co., Ltd. and Hyundai Electronics America, Inc.
Peter D. Keisler, Assistant Attorney General, David M. Cohen, Director, Jeanne E. Davidson, Deputy Director, Commercial Litigation Branch, Civil Division, United States Department of Justice (Kenneth S. Kessler); Patrick V. Gallagher, Jr., Office of the Chief Counsel for Import Administration, United States Department *1290 of Commerce, for Defendant United States, of counsel.
King & Spalding LLP, Washington, DC (Gilbert B. Kaplan, Cris R. Revaz, and Daniel L. Schneiderman) for Defendant-Intervenor Micron Technology, Inc.
OPINION
GOLDBERG, Senior Judge.
This case is before the Court following second remand to the United States Department of Commerce ("Commerce") of the results of a fifth administrative review of an antidumping duty order and upon motion for reconsideration of the Court's previous remand decisions. The Court has jurisdiction pursuant to 28 U.S.C. § 1581(c).
I. BACKGROUND
In Hyundai Electronics Industries Co. v. United States, 29 CIT ___, 395 F.Supp.2d 1231 (CIT 2005) ("Hyundai II"), familiarity with which is presumed, the Court sustained in part and remanded in part Commerce's first redetermination in the fifth administrative review regarding Dynamic Random Access Memory Semiconductors of one megabit or above from the Republic of Korea ("Korea") produced by Hyundai Electronics Industries Co., Ltd. and Hyundai Electronics America, Inc. (collectively "Hyundai") and LG Semicon Co., Ltd. ("LG Semicon").[1]See Final Results of Redetermination Pursuant to Court Remand (Aug. 31, 2004), available at http://ia.ita.doc.gov/remands/04-37.pdf (the "First Remand Results"); Dynamic Random Access Memory Semiconductors of One Megabit or Above From the Republic of Korea, 64 Fed.Reg. 69694 (Dec. 14, 1999) (final results of administrative review) (the "Final Results").
In Hyundai II, the Court reviewed several aspects of the First Remand Results, including, in relevant part:[2] (1) Commerce's decision to use Plaintiffs' amortized research and development ("R & D") expenses in the calculation of the cost of producing the subject merchandise; and (2) Commerce's provision of additional evidence to support its rejection of Plaintiffs' deferral of R & D costs related to longterm projects. See Hyundai II, 29 CIT at ___, 395 F.Supp.2d at 1239-42. The Court sustained Commerce's redetermination with respect to issue (1), id. at ___, 395 F.Supp.2d at 1240-41; but, citing evidentiary deficiencies, rejected Commerce's position as to issue (2). Id. at ___, 395 F.Supp.2d at 1242. The Court remanded this issue to Commerce with instructions to accept Plaintiffs' deferral methodology in calculating R & D expenses for longterm projects. Id. Commerce duly complied with the Court's order. After receiving no comments from Plaintiffs or Defendant-Intervenor Micron Technology, Inc. ("Micron") on its draft calculations, Commerce released the Final Results of Redetermination Pursuant to Court Remand *1291 (Sept. 23, 2005) (the "Second Remand Results"). Although expressing disagreement with the findings in Hyundai II, Commerce recalculated Plaintiffs' R & D expenses pursuant to the Court's instructions. Second Remand Results at 1.
Eighteen days later, Micron submitted a Memorandum Addressing the Final Results of Redetermination Pursuant to Court Remand ("Def.-Intvr.'s Br."). While acknowledging the Second Remand Results' conformity with Hyundai II, Micron argued that an intervening opinion by the United States Court of Appeals for the Federal Circuit (the "Federal Circuit") had indirectly overruled the conclusions of law underpinning Hyundai II. Def.-Intvr.'s Br. at 1 (citing Hynix Semiconductor Inc. v. United States, 424 F.3d 1363 (Fed.Cir. 2005) ("Hynix IV")[3]). Plaintiffs submitted Rebuttal Comments in Response to Defendant-Intervenor's Memorandum ("Pls.' Br."), arguing that the Federal Circuit's decision in Hynix IV was based on conclusions of fact particular to the investigation at issue in that case rather than general conclusions of law. Pls.' Br. at 2. Commerce filed a response brief ("Commerce's Br.") agreeing with Micron's arguments. Commerce's Br. at 2. Commerce additionally filed a motion for reconsideration and partial modification of the Court's previous remand decisions ("Commerce's Motion"), requesting that the Court direct Commerce to reinstate certain of its original findings and recalculate the antidumping duty margins accordingly. Commerce's Motion at 2.
This case is now properly before the Court following second remand and upon Commerce's Motion, consolidated for purposes of this opinion. The Court must uphold Commerce's determination if it is supported by substantial evidence and otherwise in accordance with law. 19 U.S.C. 1516a(b)(1)(B)(i) (2000). The Court may exercise its discretion to revise its previous remand decisions, see USCIT R. 59(a),[4] although the Court will generally only do so on motion for reconsideration where the Court's previous decisions are "manifestly erroneous." Former Employees of Quality Fabricating, Inc. v. United States, 28 CIT ___, ___, 353 F.Supp.2d 1284, 1288 (2004) (quotation marks omitted); cf. Doe v. New York City Dep't of Social Services, 709 F.2d 782, 789 (2d Cir.1983) ("The major grounds justifying reconsideration are an intervening change of controlling law, the availability of new evidence, or the need to correct a clear error or prevent manifest injustice.") (quotation marks omitted). After due consideration of the parties' submissions, the Federal Circuit's decision in Hynix IV, the administrative record, and all other papers had herein, and for the reasons that follow, the Court grants in part Commerce's Motion, modifies its previous decisions, and remands this case with instructions.
II. DISCUSSION
A. The Court Must Apply Relevant Federal Circuit Decisions Issued During the Course of Remand Proceedings
At the outset, it is necessary to recite that this Court is bound by the decisions of its appellate courts. Before entering final judgment, the U.S. Court of International Trade must consider the legal effect of Federal Circuit or U.S. Supreme Court decisions issued during the *1292 course of the often lengthy remand proceedings which characterize this Court's antidumping and countervailing duty cases. When, for example, an intervening decision by the Federal Circuit clarifies a legal principle of relevance to a case at bar, the Court must apply it. See, e.g., E.I. DuPont de Nemours & Co. v. United States, 17 CIT 1266, 1288, 841 F.Supp. 1237, 1254 (1993) (remanding case to allow Commerce to reexamine its methodology in light of intervening Federal Circuit decision); Federal-Mogul Corp. v. United States, 18 CIT 160, 163, 1994 WL 88926 (1994) (remanding case to allow Commerce to consider issues raised by intervening Federal Circuit decision). A regrettable byproduct of this due deference may be to prolong already lengthy litigation with another agency remand; nonetheless, the Court may not shirk its ongoing responsibility to review the legality of agency determinations.
It is, however, equally true that there are certain natural limits to the reach of Federal Circuit decisions. As with any judicial precedent, they are only as relevant to subsequent cases as their unique fact patterns will allow. A Federal Circuit decision which turns on case-specific findings of fact may be of less precedential importance to a case at bar than a decision based on generally applicable conclusions of law. The Court is charged with discerning the controlling legal principles from Federal Circuit decisions. See Aves. In Leather, Inc. v. United States, 423 F.3d 1326, 1331 (Fed.Cir.2005) (noting "doctrine of stare decisis applies to only legal issues and not issues of fact").
In this light, it is clear that Micron has rightly drawn the Court's attention to Hynix IV, a recent Federal Circuit decision potentially relevant to the disposition of certain issues in this case. By the same measure, Plaintiffs have appropriately cautioned the Court to consider the possibly limited application of a case involving a different factual record. With the inquiry so framed, the Court turns to its analysis of Hynix IV.
B. Hynix IV Clarified Legal Principles at Issue in this Case
1. Overview of Hynix IV
The factual and procedural background of Hynix IV is familiar to the parties and the Court. Hynix IV involved an appeal of judgments by the U.S. Court of International Trade (Carman, J.)[5] which reviewed several aspects of the seventh administrative review of the same antidumping duty order at issue in the case at bar. Although the cases cover two different periods of review and two different administrative records, the parties in these two cases are identical[6] and they raised many of the same issues in both proceedings.
Of particular relevance is the issue of the appropriate treatment by Commerce of certain R & D cost accounting practices used by Hynix during the period of review covered by Hynix IV. During the seventh administrative review, Hynix accounted for R & D costs by amortizing them, which represented a change from the cost accounting practice of expensing used in previous periods of review. Hynix I, 27 CIT *1293 at ___, 248 F.Supp.2d at 1305. At the same time, Hynix also chose to defer recognition of the R & D costs associated with certain long-term projects until these projects were commercialized (i.e., revenue-producing). Id. Although acknowledging that these two cost accounting practices were recognized under Korea's generally accepted accounting principles ("GAAP"), Commerce rejected the amortization and deferral of Hynix's R & D expenses as distortive of the antidumping calculations required for its final determination. Id. at ___, 248 F.Supp.2d at 1307-09. Concerning amortization, Commerce found that the switch in accounting methods resulted in an undercounting of production costs in the current period of review, because Hynix's recent adoption of amortization necessarily resulted in recognition of only a fraction of Hynix's costs. Id. at ___, 248 F.Supp.2d at 1308. Likewise, Commerce found that deferral also resulted in an undercounting of production costs, because the future commercialization dates of Hynix's long-term, projects were too speculative and could result in indefinite deferral of certain R & D costs. Id. at ___, 248 F.Supp.2d at 1309.
After two remands, the court required Commerce to accept the amortization of R & D costs as an acceptable accounting method, but upheld Commerce's rejection of deferred R & D, costs related to longterm projects. With regard to the amortization issue, the court concluded that Commerce had failed to establish "that a change from one permissible accounting method to another necessarily creates a distortion in the cost of production calculation[.]" Hynix II, 27 CIT at ___, 295 F.Supp.2d at 1369. In so concluding, the court rejected' Commerce's use of hypothetical factual scenarios to demonstrate the per se distortive effect of switching cost accounting practices from expensing to amortization. Id. Instead, the court viewed the relevant section of the antidumping statute, 19 U.S.C. § 1677b(f)(1)(A),[7] as requiring Commerce to produce substantial evidence that the change in cost accounting methods actually resulted in a distortion of antidumping calculations "in this period of review for these Plaintiffs under these facts." Id. Unable to produce such specific evidence, Commerce revised its calculations using amortized R & D costs, which the court affirmed. Hynix III, 28 CIT at ___, 318 F.Supp.2d at 1319.
With regard to the deferral issue, the court concluded that Commerce was ultimately able to satisfy 19 U.S.C. § 1677b(f)(1)(A) by providing "a reasoned explanation for rejecting Plaintiffs' indefinite deferral of certain R & D expenses." Hynix II, 27 CIT at ___, 295 F.Supp.2d at 1371. The court concurred with Commerce that Hynix had failed to provide evidence on the administrative record of the expected timing of revenues from the deferred R & D costs, making likely the prospect of indefinite deferral and thus cost undercounting during the period of review. Id. at ___, 295 F.Supp.2d at 1371.
On appeal, the Federal Circuit reversed the court on the issue of amortization but affirmed as to the issue of deferral. Hynix IV, 424 F.3d at 1370, 1372. First speaking generally of the appropriate application *1294 of 19 U.S.C. § 1677b(f)(1)(A), the Hynix IV, court stated:
The statute and our prior pronouncements are clear. The company has the responsibility of showing that its records are kept in accordance with its home country's GAAP. If the company meets this burden, Commerce may counter with substantial evidence that the records do not comply with the home country's GAAP. If the records withstand this scrutiny, Commerce may show, by substantial evidence, that the costs do not reasonably reflect the costs of production and should not, therefore, be used.
Id. at 1369.
Turning specifically to the issue of amortization, the Federal Circuit concluded that, "[w]hile Hynix was able to show that its records compl[ied] with Korean GAAP, Commerce showed by substantial evidence that Hynix's reported R & D expenses fail[ed] to reflect the costs of production." Id. at 1370. The Hynix IV court found that, during the period immediately following a company's switch in cost accounting methods from expensing to amortizing, an amount representing only a fraction of the company's current costs is necessarily recognized by the company.[8]Id. The Federal Circuit concluded that "[it is facially apparent that a fraction of costs does not accurately capture full costs[,]" thereby justifying a judgment by Commerce that a company's reported costs do not reasonably reflect the costs of production under 19 U.S.C. § 1677b(f)(1)(A). Id. The Hynix IV court further indicated that, even in situations where the "inadequacy of [the cost accounting] method [is] not transparent," it would be appropriate to defer to Commerce's expert judgment in this area. Id. The Hynix IV court therefore remanded this issue with instructions for Commerce to revise its calculations by expensing R & D costs as in Commerce's original determination. Id.
Next considering the issue of deferral, the Federal Circuit found that Commerce produced substantial evidence that Hynix's cost accounting records did "not comport with the requirements of its home country's GAAP[.]" Id. at 1372. The Hynix IV court accepted Commerce's conclusion that an investigated company has the burden of providing sufficient evidence that "its R & D costs [would] result in future revenues" in order to establish compliance with home country GAAP and that Hynix failed to do so on the record of the seventh administrative review. Id. The Federal Circuit therefore affirmed Commerce's disallowance of indefinite deferral of certain R & D costs. Id.
2. Applicability of Hynix IV to this Case
The applicability of Hynix IV to the case at bar is manifest. Hynix IV plainly clarifies legal principles of direct relevance *1295 to this case i.e., Commerce's permissible treatment of certain cost accounting practices in antidumping proceedings. These are the very same cost accounting practices at issue in this case. Indeed, the Federal Circuit expressly stated that its analysis of the factual scenarios presented in Hynix IV was intended to "help to clarify the application of [19 U.S.C. § 1677b(f) ] further." Hynix IV, 424 F.3d at 1369. It cannot be seriously argued that the Federal Circuit did not mean for this clarification of the law to be applied on a prospective basis by courts facing similar (much less the same) interpretative issues under the same section of the antidumping statute. Plaintiffs' arguments to this effect are therefore without merit.
Moreover, the factual parallels between Hynix IV and this case cannot be ignored. The cases involve the same cost accounting practices followed by the same company and subject to the same treatment by Commerce during the course of antidumping review. The only difference between the two cases is the timing of Commerce's review of the underlying antidumping duty order. To be sure, this difference is an important one, as material variations in the records for each administrative review (and arguments related thereto) could lead to divergent dispositions. Absent such variations, however, the Court cannot reach an outcome other than that legally compelled by Hynix IV See Elkem Metals Co. v. United States, 28 CIT ___, ___, 2004 WL 825314, *3 (2004) (finding an issue resolved as a matter of law by Federal Circuit in earlier review).
C. The Court Must Revise Its Previous Decisions and Remand to Bring the Instant Case into Conformity with Hynix IV on the Issue of R & D Cost Amortization Only
The sole remaining question before the Court is therefore the appropriate next step in this long-litigated case in light of Hynix IV. In Commerce and Micron's view, Hynix IV is virtually identical to this case and thus requires the Court to revise its prior decisions and reinstate Commerce's original findings with respect to both amortization and deferral of Plaintiffs' R & D costs. Plaintiffs maintain that Hynix IV did not announce conclusions of law which require a change in the Court's prior fact-based holdings with regard to either issue.
The Court finds that Hynix IV announced legal conclusions which require modification of the Court's prior decisions only with respect to the first issue the amortization of R & D costs. Because the Court discerns an important factual difference between this case and Hynix IV on the issue of R & D cost deferral, the Court finds that application of the legal conclusions of Hynix IV does not upset (and in fact reinforces) the Court's prior decisions with regard to this second issue.
1. Amortization of Plaintiffs' R & D Costs
With regard to the amortization issue, it is uncontroverted that Plaintiffs switched their cost accounting method from expensing to amortization during the fifth administrative review. Because Hynix IV concluded that such a recent switch in these cost accounting practices is facially distortive of antidumping calculations, Commerce was entitled to reject Plaintiffs' amortized R & D costs without any additional factual substantiation. Commerce's original findings to this effect therefore must be reinstated; the Court's previous decisions to the contrary must be, and accordingly are, modified.
2. Deferral of R & D Costs
With regard to the deferral issue, a similarly straightforward application of Hynix IV is foreclosed by certain factual *1296 findings expressly made by Commerce in this case. In Hyundai I, the Court noted that "Commerce does not disagree that the [deferral] accounting methodology is in accordance with Korean GAAP[.]" Hyundai I, 28 CIT at ___, 342 F.Supp.2d at 1158. In other words, the Court found that Commerce had conceded that Plaintiffs' R & D cost deferral was in accordance with Korean GAAP.[9] This is a critical factual distinction between this case and Hynix IV overlooked by Commerce and Micron. In Hynix IV, Commerce was able to demonstrate by substantial evidence to the Federal Circuit that "Hynix's records do not comport with the requirements of its home country's GAAP[.]" Hynix IV, 424 F.3d at 1372.[10] Unlike Hynix IV, Commerce did not attempt to prove here that Plaintiffs had failed to meet the requirements of their home country GAAP; rather, Commerce expressly found the opposite to be true. As such, the Federal Circuit's specific disposition of the R & D cost deferral issue in Hynix IV on the basis of noncompliance with home country GAAP an argument neither raised nor proven here by Commerce is not applicable to this case under well established principles of administrative law. It is axiomatic that the Court's review is defined by Commerce's determination below. See SEC v. Chenery Corp., 332 U.S. 194, 196, 67 S.Ct. 1575, 91 L.Ed. 1995 (1947) ("[A] reviewing court, in dealing at 248 F.Supp.2d at 1308 (noting that with a determination or judgment which an administrative agency alone is authorized to make, must judge the propriety of such action solely by the grounds invoked by the agency."). "Chenery stands for the proposition that a court may not make its own factual findings to support an agency's determination." Defenders of Wildlife v. Hogarth, 330 F.3d 1358, 1368 (Fed.Cir. 2003). Because the Court would essentially have to rewrite Commerce's factual findings in order to apply the same legal principles used by the Federal Circuit to resolve the R & D cost deferral issue in Hynix IV, the Court cannot agree that Hynix IV controls this case in the way Commerce and Micron contend. For this reason, the Court declines to modify its previous decisions on this issue.
Moreover, in the Court's view, Hynix's IV general guidance on the application of 19 U.S.C. § 1677b(f) actually supports the analytical framework employed in the Court's previous decisions concerning this issue. Commerce's arguments in Hyundai I and Hyundai II focused on the agency's contention that Plaintiffs had failed to offer "reasonable evidence" that the deferred R & D costs were more appropriately recognized in future periods rather than the current period of review. First Remand Results at 6.[11] The Court rejected Commerce's arguments on the basis of its holding that Commerce, not *1297 Plaintiffs, bore the burden of proof on this issue i.e., the burden of providing substantial evidence that R & D costs deferred in accordance with home country GAAP in fact benefitted (and thus should be reflected in the cost accounting for) the current period of review. Hyundai II, 29 CIT at ___, 395 F.Supp.2d at 1241-42. Hynix IV confirms this holding. In Hynix IV, the Federal Circuit made clear that, where an investigated company's cost accounting records withstand scrutiny of their compliance with home country GAAP, it is the obligation of Commerce to "show, by substantial evidence, that the costs do not reasonably reflect the costs of production and should not, therefore, be used." Hynix IV, 424 F.3d at 1369. This case presents exactly that scenario. Because the Court employed the burden of proof dictated by Hynix IV, the Court finds no legal error in its analytical approach to this issue.
Nevertheless, the Court acknowledges that Commerce's argument on the issue of R & D cost deferral is identical in form to Commerce's argument, accepted by the Federal Circuit in Hynix IV, concerning the distortive effect of switching cost accounting methods from expensing to amortizing. The Hynix IV court allowed Commerce to satisfy its evidentiary burden by employing a per se rule concerning the distortive effect of such a switch. In this case, Commerce seeks a similar rule for situations involving switches from expensing to deferral. However, the Court does not understand Hynix IV to have created the broad rule that all switches in cost accounting methods are per se distortive of antidumping calculations. Such a rule seems particularly inapt here: it is not "facially apparent" that a switch to deferral necessarily results in cost undercounting in the current period of review, Hynix IV, 424 F.3d at 1370, because Plaintiffs' home country GAAP allows deferral only if "certain conditions are satisfied, namely that there be a reasonable expectation of future benefit." Id. at 1372.
Finally, while the Court is mindful that "Commerce's determinations are entitled to deference" in the complex area of antidumping calculations, id. at 1370, such deference is appropriate only "so long as there is substantial evidence to be found in the record as a whole." NLRB v. Brown, 380 U.S. 278, 292, 85 S.Ct. 980, 13 L.Ed.2d 839 (1965); see also Anderson v. Dep't of Transp., FAA, 827 F.2d 1564, 1577 (Fed. Cir.1987) (Baldwin, J., dissenting) ("Although deference is to be accorded to an administrative determination, we, the reviewing court, retain a responsibility to scrutinize the entire record and to reverse or remand a decision which is not supported by substantial evidence."). Here, the Court has concluded that Commerce did not meet its evidentiary burden; therefore, deference to Commerce's determination on the issue of R & D cost deferral is not warranted.
Accordingly, absent a showing of previous manifest error, see Former Employees of Quality Fabricating, 28 CIT at ___, 353 F.Supp.2d at 1288, the Court declines to revisit its conclusions on the issue of R & D cost deferral.
III. CONCLUSION
The Court concludes that it is a sound use of its discretion under USCIT Rule 59(a) to revise its previous decisions in order to bring this case into conformity with Hynix IV. This case is therefore remanded for Commerce to reinstate its original findings regarding R & D cost amortization and recalculate the antidumping duty margins. A separate order will be issued accordingly.
NOTES
[1] After the fifth administrative review was completed, respondent Hyundai acquired LG Semicon. In this opinion, Hyundai-as-successor-in-interest-to-LG Semicon is referred to as LG Semicon.
[2] These are two of the aspects of the Final Results which were first remanded to Commerce in Hyundai Electronics Industries Co. v. United States, 28 CIT ___, 342 F.Supp.2d 1141 (2004) ("Hyundai I"), familiarity with which is presumed. In addition, the Court in Hyundai II also reviewed two other previously-remanded aspects of the Final Results: Commerce's recalculation of LG Semicon's dumping margin using only partial adverse facts available and Commerce's provision of additional evidence to support its R & D cost cross-fertilization theory. Hyundai II, 29 CIT at ___, 395 F.Supp.2d 1234-39. Hyundai II also addressed certain newly raised challenges to Commerce's calculation of Hyundai's entered value. Id. at 1242-44.
[3] The Federal Circuit issued its mandate in Hynix IVon November 28, 2005.
[4] "Courts have liberally construed Rule 59(a) to include any matter which is appealable, or for which the court has issued a decision foreclosing further arguments pertaining thereto." Witex, U.S.A., Inc. v. United States, 29 CIT ___, ___, n. 2, 360 F.Supp.2d 1327, 1328 n. 2 (2005) (citations omitted).
[5] See Hynix Semiconductor, Inc. v. United States, 27 CIT ___, 248 F.Supp.2d 1297 (2003) ("Hynix I"); Hynix Semiconductor, Inc. v. United States, 27 CIT ___, 295 F.Supp.2d 1365 (2003) ("Hynix II"); Hynix Semiconductor, Inc. v. United States, 28 CIT ___, 318 F.Supp.2d 1314 (2004) ("Hynix III"). The Hynix case history also includes two opinions concerning evidentiary issues which were not reviewed in Hynix IV.
[6] The difference in the named plaintiffs in these two cases is attributable to Hyundai's corporate name change, which took place subsequent to the fifth administrative review at issue here.
[7] This section provides, in pertinent part, that:
Costs shall normally be calculated based on the records of the exporter or producer of the merchandise, if such records are kept in accordance with the generally accepted accounting principles of the exporting country (or the producing country, where appropriate) and reasonably reflect the costs associated with the production and sale of the merchandise.
19 U.S.C. § 1677b(f)(1)(A) (2000).
[8] For example, in the first year following a switch to a five-year cost amortization schedule, a company would recognize only one-fifth of its current expenses, instead of recognizing one-fifth of its current expenses plus one-fifth of the previous four years' expenses as would occur under an established amortization schedule. In this example, undercounting of current costs would continue until the fifth year following the switch in cost accounting methods. See Hynix IV, 424 F.3d at 1370. Of course, this analysis assumes that no radical decreases in the company's year-over-year costs occur during the period immediately following the switch in cost accounting methods a factor which Commerce is apparently not required to consider under Hynix's IV per se rule that a switch in this cost accounting practice is necessarily distortive of antidumping calculations in subsequent periods of review. But see Hynix IV, 424 F.3d at 1374 (Dyk, J., dissenting) (rejecting per se rule and noting that "Commerce is obligated to base its decision on actual data establishing distortion, not on hypothetical numbers picked from thin air").
[9] See also Final Results, 64 Fed.Reg. at 69699 ("We agree with Hyundai and LG [Semicon] that their method of amortizing and deferring R & D costs is permissible with Korean GAAP. . . ."). The Court has carefully reviewed the First Remand Results and the Second Remand Results and has found no indication of Commerce's intention to eschew its original factual finding on this issue.
[10] Commerce was entitled and, according to the Federal Circuit, chose to make different arguments and factual concessions in this case than in Hynix IV. But see Hynix I, 27 CIT at ___, 248 F.Supp.2d at 1308 (noting that Commerce "concedes that Plaintiffs' method of amortizing and deferring R & D costs is permissible under Korean GAAP").
[11] This argument is based on the second half of the two-part statutory requirement for use of exporter/producer cost accounting records in antidumping calculations. See 19 U.S.C. § 1677b(f)(1)(A) (2000) (for use in antidumping calculations, requiring investigated company's cost records to (1) be kept in accordance with home country GAAP and (2) "reasonably reflect the costs associated with the production and sale of the merchandise").
|
Minnesota charities were seen as the winners last month when lawmakers said they would push for electronic pull-tab games to be the state’s main funding source for a new Vikings stadium.
But without final details about what the deal might mean for them, the groups are wondering just what it is they have won.
“That’s what we don’t know,” said King Wilson, executive director of Allied Charities of Minnesota, which represents charitable gaming interests.
“I bet you I had more calls last week than I had in the two or three months before that,” Wilson said. “We’re trying to ask folks to be patient. But quite frankly, it’s frustrating.”
More than 1,200 nonprofit groups around the state offer paper pull-tab games in bars and restaurants as fundraisers for local school and civic causes.
The groups have long argued they’re taxed too heavily. Of roughly $80 million in net profits in 2009, they paid about $37 million in taxes and had $43 million left to contribute to community programs.
But since any relief from that tax burden was unlikely with the state facing huge budget deficits, the groups needed a new revenue source. Electronic version of paper pull-tabs, they believe, will draw more players, especially young people.
The state Department of Revenue estimates authorizing e-pull-tabs would generate $72 million per year in new tax money for the state.
Rep. Morrie Lanning, R-Moorhead, the key stadium promoter in the House, said the charities will get a piece of that.
“I have assured them that there will be significant tax relief,” Lanning said, though no number has been settled on.
Part of the uncertainty stems from the fact that nobody is sure how much of the $72 million the state will need to finance its share of the stadium project.
Gov. Mark Dayton has estimated it would take more than $30 million annually to finance the state’s $340 million portion of a rebuilt stadium on the Metrodome site. Others have said more might be required because bonding houses could perceive gambling revenue as a risky source of money.
“People can make an educated guess,” said Minnesota Management and Budget office spokesman John Pollard, but “we’re not prepared to do that. We don’t have enough information yet in order to give a good, accurate estimate.”
Wilson didn’t specify what share the charities need to make the plan work, but he said if it turns out the state takes roughly half the $72 million for a stadium and devotes the other half to tax relief, “I think we can have some meaningful discussions, and I think something is workable.” The problem, he said, is “there’s other people bandying about much smaller numbers.
“It’s simple: The higher the number the state needs for the stadium, the less money that’s available to do reform and relief, which is our priority,” Wilson said.
“At some point, we’re hoping somebody will touch base and say ‘You know, we’re thinking X,’ and then I can look and say, ‘Well if we do X, here’s what I think we can do for reform,’ ” he said. “We’ve heard no number.”
And it’s not clear that being tied to the Vikings stadium is helping the groups’ cause.
“Our bill was not designed to build a stadium. Our bill was designed to give tax relief and reform via electronic pull-tabs and bingo so that we would have additional funding for the bottom line so we can do the many worthy programs and projects these 1,200 charities do,” Wilson said.
He said some lawmakers tell him being part of the stadium package will cost him votes, while others say there’s no way he’ll get tax relief without being part of the Vikings deal. “I think that’s a real mixed bag.”
Wilson said someone likened putting the Vikings deal together to playing 3D chess: “If we move this to here, it creates five other problems.”
He said his biggest fear is that the stadium issue gets pushed off till next year and delays the pull-tab question along with it. “My folks need tax reform and relief and increased revenue now,” he said.
Bob Matson, a consultant to the charitable gaming industry, said about every week for the past few years an organization drops out of gaming. Facing falling receipts, numerous regulations and a high tax burden, “some say enough’s enough,” he said.
To maintain the health of the industry, Matson said, “I’d certainly like to see some action before long.”
As you comment, please be respectful of other commenters and other viewpoints. Our goal with article comments is to provide a space for civil, informative and constructive conversations. We reserve the right to remove any comment we deem to be defamatory, rude, insulting to others, hateful, off-topic or reckless to the community. See our full terms of use here.
More in News
FRIDLEY, Minn. (AP) — Garrison Keillor looked comfortable on the small stage as he sang Christmas lullabies, told off-color limericks and spun a tale about a lutefisk dinner at the fictitious Lake Wobegon.
NEW YORK (AP) — Penny Marshall, who indelibly starred in the top-rated sitcom "Laverne & Shirley" before becoming the trailblazing director of smash-hit big-screen comedies such as "Big" and "A League of Their Own," has died. She was 75.
The St. Paul City Council recently approved $1 million in Cultural STAR grants to 33 organizations, while tweaking eligibility and reimbursement requirements for the twice-annual awards. The rule changes are intended to help small and mid-sized arts and nonprofit groups have a better shot at scoring or even applying for funding. Funding can range from $5,000 grants to $100,000 or...
The Minnesota Pollution Control Agency said Tuesday it has taken the unusual step of denying denied a permit for a large hog farm proposed for Fillmore County in southeastern Minnesota because of the threat of adding to groundwater nitrate pollution in the geologically porous region. MPCA Commissioner John Linc Stine said at a news conference that he denied the general...
It was supposed to be Lanette Johnson's day off from her job at Best Buy, one she would spend with her then-4-month-old son, Logan. But that day in October 2017, Johnson's manager said her Arlington, Va., store was scheduled for an important visit from corporate. Could Johnson find someone to watch Logan and come in? The day care Logan would... |
1. Introduction {#sec1-antioxidants-09-00621}
===============
Hydrogen sulfide (H~2~S) is a flammable, colorless gas with a characteristic odor of rotten eggs. H~2~S naturally occurs in volcanic gases, natural gas and some well water and is also produced when bacteria break down organic matter in the absence of oxygen. H~2~S poisoning has mainly been observed in industrial settings. Thus, workers may be exposed to H~2~S in many industries, including agriculture, petroleum, and sewage processing \[[@B1-antioxidants-09-00621]\]. H~2~S is toxic to humans and acute exposure to high amounts of H~2~S (\>500 ppm) can lead to death \[[@B1-antioxidants-09-00621]\]. The first reported biological experiment to study the effect of H~2~S in animals was published in 1908 and described the lethal effects of H~2~S gas when it was absorbed through the skin or directly administered to the stomach or rectum \[[@B2-antioxidants-09-00621]\]. Since then, hundreds of articles reporting on the toxicological effects of H~2~S in various species, including humans, different cell types and organs, were published during the last century. This gas has always been considered toxic due to its ability to inhibit mitochondrial respiration through inhibition of cytochrome c oxidase, similar to hydrogen cyanide (HCN) \[[@B3-antioxidants-09-00621]\]. Nevertheless, over the last few decades of the past century, several investigations were conducted on the presence of H~2~S as an endogenous product in bacteria and mammals. In the oral microbiota in humans, H~2~S was found to be responsible for oral halitosis and to be related to periodontal inflammation \[[@B4-antioxidants-09-00621]\], and in the intestinal microbiota, H~2~S was found to be a component of flatus \[[@B5-antioxidants-09-00621]\]. In parallel, several publications conducted detailed characterizations of the biochemical properties of the endogenous production pathways of H~2~S in different species. The mammalian enzymes responsible for H~2~S production are cystathionine beta-synthase, CBS; cystathionine gamma-lyase, CSE; and 3-mercaptopyruvate sulfurtransferase, 3-MST \[[@B6-antioxidants-09-00621],[@B7-antioxidants-09-00621]\] ([Figure 1](#antioxidants-09-00621-f001){ref-type="fig"}), which have homologs in other species: in *Klebsiella pneumoniae*, CBS is the main source of H~2~S; in *E. coli*, 3-MST is the main source of H~2~S under aerobic conditions, while the cysteine desulfurase (IscS) is the primary source under anaerobic conditions \[[@B8-antioxidants-09-00621]\].; Similar to mammals, *C. elegans* has three H~2~S-synthesizing enzymes, CSE, CBS and 3-MST \[[@B9-antioxidants-09-00621],[@B10-antioxidants-09-00621],[@B11-antioxidants-09-00621]\]. In plants, H~2~S production was first observed in 1964, when the release of sulfide components in Liliaceous vegetables was described \[[@B12-antioxidants-09-00621]\], and then, in 1968, Cormis described the emission of H~2~S from plants after exposure to SO~2~ \[[@B13-antioxidants-09-00621]\]. In 1987, two enzymes, L- and D-cysteine desulfhydrases, were found to catalyze the production of H~2~S in chloroplasts and mitochondria \[[@B14-antioxidants-09-00621]\] ([Figure 1](#antioxidants-09-00621-f001){ref-type="fig"}). In recent years, several characterizations of these enzymes have been conducted, revealing detailed H~2~S biosynthesis and sulfur assimilation pathways in plants \[[@B15-antioxidants-09-00621],[@B16-antioxidants-09-00621]\].
2. Physiological Role {#sec2-antioxidants-09-00621}
=====================
During the past century, H~2~S was thought to only be a toxic molecule, and it was not until 1990 that Kimura and coworkers revealed its role in essential functions in human physiology, opening a new emerging field in life science \[[@B17-antioxidants-09-00621]\]. The first physiological assay published in 1996 demonstrated that H~2~S acts as an endogenous neuromodulator \[[@B18-antioxidants-09-00621]\]. The participation of H~2~S in many physiological and pathological processes in animals has been described over the last two decades, including its role in the regulation of cell proliferation, apoptosis, inflammatory processes, hypoxia, neuromodulation, and cardioprotection \[[@B19-antioxidants-09-00621],[@B20-antioxidants-09-00621],[@B21-antioxidants-09-00621]\]. Therefore, H~2~S is now accepted as playing roles as a gasotransmitter (gaseous signaling compound) that is as important as nitric oxide (NO) and carbon monoxide (CO) in mammals, and as a signaling molecule that is as important as hydrogen peroxide (H~2~O~2~) in plants \[[@B18-antioxidants-09-00621],[@B22-antioxidants-09-00621],[@B23-antioxidants-09-00621]\]. The term 'gasotransmitter' was introduced in 2002 to describe these molecules, which share common characteristics: they are endogenously produced, with a signaling role, generated by enzymatic pathways, and permeable to cell membranes; their endogenous biosynthesis may be regulated; and their effect is dose-dependent ([Figure 1](#antioxidants-09-00621-f001){ref-type="fig"}). The scientific interest in H~2~S in the past was mainly due to its role in important and devastating human diseases, such as neurodegenerative disorders, including Alzheimer's disease, Parkinson's disease, and vascular dementia \[[@B24-antioxidants-09-00621],[@B25-antioxidants-09-00621],[@B26-antioxidants-09-00621]\]; Huntington's disease \[[@B27-antioxidants-09-00621]\]; and cancer \[[@B28-antioxidants-09-00621],[@B29-antioxidants-09-00621],[@B30-antioxidants-09-00621]\].
Although the first descriptions of the effects of H~2~S in plants were from the 1960s \[[@B31-antioxidants-09-00621]\], interest in the role of H~2~S in plant systems arose later. It was not until the past decade that the effects of H~2~S were described in seed germination \[[@B32-antioxidants-09-00621]\], the number and length of adventitious roots \[[@B33-antioxidants-09-00621]\] and the regulation of genes involved in photosynthesis \[[@B34-antioxidants-09-00621]\]. Thereafter, the protective effects of exogenous H~2~S against different stresses were documented, such as protection against oxidative and metal stresses \[[@B32-antioxidants-09-00621],[@B35-antioxidants-09-00621],[@B36-antioxidants-09-00621],[@B37-antioxidants-09-00621],[@B38-antioxidants-09-00621],[@B39-antioxidants-09-00621],[@B40-antioxidants-09-00621]\], drought and heat tolerance \[[@B39-antioxidants-09-00621],[@B41-antioxidants-09-00621]\], and osmotic and saline stresses \[[@B42-antioxidants-09-00621]\]. Thus, publications on these dose-dependent effects of H~2~S have emerged, postulating H~2~S to be an important signaling molecule that has analogous functions in plant systems to those previously described in mammals. H~2~S was also shown to be a regulator of other important physiological processes in plants, such as stomatal closure/aperture \[[@B43-antioxidants-09-00621],[@B44-antioxidants-09-00621],[@B45-antioxidants-09-00621],[@B46-antioxidants-09-00621]\]; thus, its importance in drought stress relief is due to the ability of H~2~S to induce stomatal closure in *Arabidopsis thaliana* \[[@B46-antioxidants-09-00621],[@B47-antioxidants-09-00621]\]. Another positive effect of H~2~S was described by Dooley et al., who showed that low doses of H~2~S strongly affected plant metabolism, improved germination, caused significant plant growth and increased biomass, leading to a higher fruit yield \[[@B48-antioxidants-09-00621]\]. H~2~S has also been shown to be involved in the regulation of flower senescence in plants \[[@B49-antioxidants-09-00621]\], in lateral root formation in tomato mediated by auxin-regulation \[[@B50-antioxidants-09-00621]\] and in nicotine biosynthesis in tobacco \[[@B51-antioxidants-09-00621]\].
More recently, there has been increasing interest in the effect of H~2~S on autophagy regulation in the scientific community. In mammals, the protective effect of H~2~S against some of the diseases mentioned above has been linked with the regulation of autophagy \[[@B52-antioxidants-09-00621],[@B53-antioxidants-09-00621]\]. Autophagy is a cellular catabolic pathway that is evolutionarily conserved from yeast to mammals, and it involves the digestion of cell contents to recycle nutrients or to degrade damaged or toxic components. The AMP-dependent kinase (AMPK) and mammalian target of rapamycin (mTOR) pathways play important roles in the control of autophagy. To this end, activation of AMPK or inhibition of mTOR has been shown to activate autophagy \[[@B54-antioxidants-09-00621]\]. Exposure to H~2~S has been shown to cause a significant increase in AMPK phosphorylation, which increases its activity and inhibits the activation of downstream targets, such as mTOR \[[@B55-antioxidants-09-00621]\]. In plants, H~2~S was shown to inhibit autophagy by preventing ATG8 (autophagy-related ubiquitin-like protein) accumulation \[[@B56-antioxidants-09-00621]\]. H~2~S is able to inhibit starvation-induced autophagy in Arabidopsis roots, and this repression is independent of redox conditions \[[@B57-antioxidants-09-00621]\].
The first mechanism proposed for H~2~S was based on its chemical properties, since this nucleophilic molecule is able to react with reactive oxygen/nitrogen species and reduce the cellular oxidative state \[[@B58-antioxidants-09-00621],[@B59-antioxidants-09-00621]\]. In addition, H~2~S is able to regulate several antioxidant enzymes, such as ascorbate peroxidase (APX) \[[@B60-antioxidants-09-00621],[@B61-antioxidants-09-00621],[@B62-antioxidants-09-00621]\], catalase (CAT) \[[@B63-antioxidants-09-00621],[@B64-antioxidants-09-00621]\], superoxide dismutase (SOD) \[[@B63-antioxidants-09-00621],[@B65-antioxidants-09-00621]\], and glutathione reductase (GR) \[[@B62-antioxidants-09-00621]\], and non-enzymatic compounds, such as the glutathione anti-oxidant pool \[[@B66-antioxidants-09-00621],[@B67-antioxidants-09-00621]\].
The antioxidant role of H~2~S has been the focus of numerous studies in mammalian systems as a critical mediator of multiple pathophysiological processes \[[@B68-antioxidants-09-00621]\]. In plants, the number of studies on the effects of H~2~S in the model plant Arabidopsis has increased in recent years; in addition, the effects of H~2~S in agricultural crops are relevant as an exogenous treatment to cope with economic loss due to environmental stress. The effects of exogenous (pre-)treatment with water-soluble donors of H~2~S have been the focus of numerous studies in several agricultural species. Fotopoulos et al. have reviewed these studies regarding the effects of H~2~S on plant growth, its ability to improve resistance against abiotic and biotic stress, and its positive postharvest effects \[[@B69-antioxidants-09-00621]\]. Thus, a better understanding of the mechanism of action of H~2~S is important to fight against crop loss. This knowledge would help in agricultural sustainability and in producing the food required by the increasing world population \[[@B70-antioxidants-09-00621]\].
3. Quantification Methods of H~2~S {#sec3-antioxidants-09-00621}
==================================
H~2~S in aqueous solution can be found as hydrogen sulfide gas (H~2~S) or in one of its dissociated forms, hydrosulfide anions (HS^−^) and sulfide anions (S^2−^), although at physiological pH, S^2−^ is only found in a negligible concentration. In addition, H~2~S can bind to some biological matrixes (proteins, glutathione, etc.) and can dissociate in response to a physiological stimulus into free H~2~S. Moreover, the anion HS^−^ and H~2~S have a high propensity to oxidize, especially in the presence of trace metal ions and oxygen in water solutions \[[@B71-antioxidants-09-00621]\]. Therefore, accurately and reliably measuring H~2~S in vivo is an arduous task. Solutions should be prepared under a nitrogen or argon atmosphere, and H~2~S volatilization should be prevented using septum-sealed vials.
**Methylene blue method:** The first quantification method of H~2~S was published in 1949 and included spectrophotometric determination using the methylene blue method, but the sensitivity was very low \[[@B72-antioxidants-09-00621]\]. In 1969, an improved method was described based on the methylene blue method using *n,n*-dimethyl-p-phenylenediamine sulfate, which increased the sensitivity of the method by 10%, with concentration limits of 1 to 1000 µM \[[@B73-antioxidants-09-00621]\]. However, the main drawbacks of this method for biological sample measurements are its low sensitivity, overestimation of H~2~S under acidic pH and interference due to the turbidity of biological samples.
**Monobromobimane derivatization (MBB):** this is another method that is extensively used in biological samples to measure the H~2~S concentration. In this method, H~2~S is derivatized into a sulfide-dibimane product that can be subsequently measured by HPLC due to its fluorescence \[[@B74-antioxidants-09-00621]\]. The sensitivity of MBB reaches the nanomolar range, but the weaknesses of this method are the instability of the standards and the need for exhaustive control of pH when comparing samples \[[@B75-antioxidants-09-00621]\]. Another advantage of this method is that it allows the detection and quantification of all three sulfide biological forms: free hydrogen sulfide, acid-labile sulfide and bound sulfane sulfur \[[@B76-antioxidants-09-00621]\]. An improved method based on MBB was developed that included ^36^S-labeled sulfide- dibimane as an internal standard and measured derivatized products by liquid chromatography-mass spectrometry \[[@B77-antioxidants-09-00621]\]. This improvement ensured the sensitivity and feasibility of the method and also made it suitable for large-scale analysis.
The gas chromatography method was first used in 1988 \[[@B78-antioxidants-09-00621]\] and was recently improved using a chemiluminescence sulfur detector to increase its sensitivity up to 0.5 pmol \[[@B79-antioxidants-09-00621]\]. Nevertheless, the need for special equipment and special care in sample processing make this method not widely used.
**Specific ion electrodes and polarographic sensors** are others tools that have been used for H~2~S quantitation. Their easy handling and the relatively inexpensive cost of electrodes make this method a good choice for several studies. Since this method does not require derivatization, it can be used for real-time measurements in biological samples. Nevertheless, it was reported that the sensitivity of this method is apparently affected by the materials used in the electrodes \[[@B75-antioxidants-09-00621]\], and the main disadvantage of this method is the difficulty of calibration due to the formation of Ag~2~S on the electrode surface.
**H~2~S-selective fluorescent probes** are receiving increasing interest since they are powerful tools for the detection and quantification of H~2~S in biological samples. Fluorescent probes have very high sensitivity and can be used for real-time measurements even in specific tissues or cellular compartments. The reactivity and specificity of these probes are based on the characteristic nucleophilicity of the anion HS^−^, on the reduction of an azide by H~2~S into an amine compound, or on the quenching effect of Cu^2+^ of a nearby fluorophore and the strong affinity of anion sulfide for this heavy metal ion \[[@B80-antioxidants-09-00621]\]. In addition, the increasing interest in other sulfane sulfur molecules, such as persulfides (R--S--SH), polysulfides (R--S--S~x~--S--R), and hydrogen polysulfides (H~2~S~x~), in biological systems, has led to the development of probes that are able to detect these species. Several recent reviews summarize the latest probes reported in the literature \[[@B80-antioxidants-09-00621],[@B81-antioxidants-09-00621]\]. However, the main limitation of these probes is the irreversible reaction that removes H~2~S from the pool, leading to saturation \[[@B71-antioxidants-09-00621]\]. Motivated by these limitations, Takano et al. designed a reversible fluorescent probe to detect these sulfane sulfur species, SSip-1, based on the ability of sulfane sulfur to bind other sulfur atoms \[[@B82-antioxidants-09-00621]\]. In parallel, Dulac et al. developed a new method of reversible quantification in biological fluids, detecting up to 200 nM of H~2~S at pH 7.4 using hemoglobin I from *Lucina pectinate* and a fluorophore \[[@B83-antioxidants-09-00621]\]. Therefore, these reversible fluorescent probes allow the dynamics of intracellular sulfane sulfur molecules to be studied. Since the cytotoxicity of these probes is a drawback for their use in in vivo studies, a new low-cytotoxic biosensor for H~2~S has recently been developed based on anthracene derivatives \[[@B84-antioxidants-09-00621]\]. A further disadvantage in the plant system is the inability of these probes to penetrate the cell wall. Although there are few reports on the use of fluorescent probes for H~2~S detection in plants, selective detection of intracellular H~2~S was described using the probe WSP-1 \[3′-methoxy-3-oxo-3H-spiro \[isobenzofuran-1, 9′-xanthen\]-6′-yl 2-(pyridin-2-yldisulfanyl) benzoate\] in tomato roots \[[@B85-antioxidants-09-00621]\]. However, the use of fluorescent probes for quantification of H~2~S also has some limitations, such as a limited sensitivity range, interference by tissue autofluorescence when the emission/excitation wavelengths are similar, or non-specific reactions with other biological thiols. Thus, the fluorescent probe or the H~2~S quantification method must be carefully chosen by the researcher depending on the sample, the tissue or organelle target, the sensitivity range, the equipment and the budget.
Data from in vivo measurements have been in conflict for a long time. The first data reported used the methylene blue method, and the H~2~S concentration was above 35 µM and from 50 to 160 µM in mammalian plasma and brains, respectively \[[@B86-antioxidants-09-00621],[@B87-antioxidants-09-00621]\]. However, these measurements were incorrect and using newly described methods, the H~2~S concentration was more accurately reported at approximately 0.7--3 µM in mammalian plasma \[[@B74-antioxidants-09-00621]\]. Moreover, it has been recently reported than H~2~S concentration in mouse plasma is about 15 nM \[[@B88-antioxidants-09-00621]\]. Taken altogether, the H~2~S concentration has been estimated in the range of nanomolar, but the H~2~S concentration may depend on the microenvironment at the precise moment of the H~2~S measurement. For example, H~2~S can be bound to sulfur compounds or conjugates and H~2~S released under a certain stress or stimulus \[[@B89-antioxidants-09-00621]\], H~2~S biosynthesis may be up- or downregulated in particular scenarios \[[@B90-antioxidants-09-00621],[@B91-antioxidants-09-00621]\], and H~2~S consumption or accumulation may be modulated by the regulation of H~2~S detoxification enzymes \[[@B92-antioxidants-09-00621]\]. In addition, different H~2~S concentrations have been reported in different tissues, species or stages of life. In cucurbit plants, the H~2~S concentration was reported to be higher in leaves from older plants \[[@B93-antioxidants-09-00621]\], while in Arabidopsis, the highest H~2~S concentration was found in 2-week-old seedlings and gradually decreased in 4--10-week-old plants \[[@B94-antioxidants-09-00621]\]. The highest H~2~S content in Arabidopsis was found in flowers, while the lowest H~2~S concentration was found in cauline leaves \[[@B94-antioxidants-09-00621]\]. Determination of the H~2~S concentration is further complicated by the fact that some stimuli only affect the H~2~S concentration in some tissues, such as nicotine, which affects the H~2~S concentration in the mouse kidney and heart but not in the brain and liver tissues \[[@B95-antioxidants-09-00621]\]. A further important consideration must be taken when quantifying H~2~S in biological samples, since H~2~S is spontaneously oxidized in the presence of molecular O~2~ \[[@B96-antioxidants-09-00621]\]. Therefore, the method of quantification must be accurate, and sample management must be taken into account because the H~2~S concentration may not remain constant under certain conditions.
4. H~2~S Mechanism of Action {#sec4-antioxidants-09-00621}
============================
The underlying mechanisms of H~2~S action are poorly understood. There is an important effect of H2S binding to heme moieties in target proteins such as cytochrome c oxidase, hemoglobin and myoglobin, among others \[[@B97-antioxidants-09-00621]\]. It has, however, become widely accepted that a huge number of the processes controlled by H~2~S are caused by a posttranslational modification of cysteine residues called persulfidation \[[@B98-antioxidants-09-00621],[@B99-antioxidants-09-00621],[@B100-antioxidants-09-00621]\]. Protein persulfidation is an oxidative posttranslational modification of cysteine residues caused by H~2~S, in which a thiol group (--SH) is transformed to a persulfide group (--SSH). Sulfane sulfur species, persulfides and polysulfides are more nucleophilic than H~2~S and therefore more effective at persulfidation \[[@B101-antioxidants-09-00621]\]. Due to the intrinsic instability of persulfides and their higher reactivity than thiols, protein persulfides largely remain understudied. Nevertheless, over the last decade, study of this protein modification has become more relevant for researchers because it can affect protein function, localization inside cells, stability, and resistance to oxidative stress \[[@B23-antioxidants-09-00621],[@B60-antioxidants-09-00621],[@B102-antioxidants-09-00621],[@B103-antioxidants-09-00621],[@B104-antioxidants-09-00621]\]. The broad physiological importance of persulfidation has only recently started to emerge; a proteomic analysis revealed that approximately 10--25% of liver proteins contain this modification \[[@B104-antioxidants-09-00621]\], and at least 5--10% of the entire proteome may undergo persulfidation in plants \[[@B105-antioxidants-09-00621]\]. Several detection methods have been developed in recent years based on the nucleophilic characteristic of persulfide groups. Conversely, due to their instability and similarity to thiol groups, the development of a specific method for persulfide detection has become a challenge. These detection methods have recently been reviewed, including further explanations of the reactions and procedures \[[@B106-antioxidants-09-00621],[@B107-antioxidants-09-00621],[@B108-antioxidants-09-00621]\]. Using these methods, researchers have been able to decipher the mechanism of action of H~2~S through persulfidation in several diseases, such as cancer, neuronal degeneration diseases, or ischemia--reperfusion injury. Persulfidation of the α subunit of ATP synthase \[[@B109-antioxidants-09-00621]\], lactate dehydrogenase A \[[@B110-antioxidants-09-00621]\], the K~ATP~ channel \[[@B99-antioxidants-09-00621],[@B111-antioxidants-09-00621]\], and MEK1 \[[@B112-antioxidants-09-00621]\] contributes to cancer promotion. In Parkinson's disease patients, the E3 ubiquitin ligase PARKIN shows a decrease in persulfidation, which decreases its enzymatic activity \[[@B113-antioxidants-09-00621]\]. Keap1 persulfidation protects gastric epithelial cells from ischemia/reperfusion injury \[[@B114-antioxidants-09-00621]\]. In mammals, the mechanism of action of H~2~S has been deeply studied since 2009, when Mustafa et al. described this new posttranslational modification \[[@B104-antioxidants-09-00621]\]. By contrast, in the plant system, persulfidation has been described more recently \[[@B60-antioxidants-09-00621]\], but a greater number of proteins have been shown to undergo this modification \[[@B105-antioxidants-09-00621]\]. A total of 3147 proteins were found to be persulfidated in Arabidopsis leaves under physiological conditions, suggesting that this number may be higher under certain stress conditions \[[@B105-antioxidants-09-00621]\]. These proteins are mainly involved in important biological pathways, such as the tricarboxylic acid cycle, glycolysis, Calvin cycle, photorespiration and autophagy. Further physiological studies of these proteins must be performed to decipher the role of persulfidation in these biological pathways. Nevertheless, initial studies in plants demonstrated that persulfidation regulates the enzymatic activity of chloroplastic glutamine synthetase (GS2), cytosolic ascorbate peroxidase (APX1), and cytosolic glyceraldehyde 3-phosphate dehydrogenase (GapC1) \[[@B60-antioxidants-09-00621]\]. Persulfidation regulates the cytosolic/nuclear localization of GapC1, allowing it to likely act as a transcription factor \[[@B102-antioxidants-09-00621]\]. The actin cytoskeleton and root hair growth are regulated through persulfidation of ACTIN2 \[[@B115-antioxidants-09-00621]\]. Furthermore, ethylene biosynthesis is regulated by persulfidation of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1) in tomato \[[@B116-antioxidants-09-00621]\]. Recently, a peroxisomal proteome study in Arabidopsis revealed that the interplay of different PTMs such as *s*-nitrosation, nitration, persulfidation, and acetylation regulates redox signaling to protect proteins against oxidative damage \[[@B117-antioxidants-09-00621]\]. From an evolutionary point of view, it is reasonable to assume that ancestral purple and green sulfur bacteria lived in an H~2~S-rich atmosphere; and therefore bacteria developed H~2~S-mediated signaling processes to resist oxidative stress. Similarly as peroxide (H~2~O~2~) produces ROS, persulfide (H~2~S~2~) produces RSS (reactive sulfide species), but with the difference that persulfides can be produced with several sulfur molecules (S~x~) and stored \[[@B118-antioxidants-09-00621]\].
This assumption was described in a recent study, in which a proteomic evaluation of *Staphylococcus aureus* showed that many proteins regulated by persulfidation were involved in reactive oxygen and nitrogen species (ROS and RNS) stress-responses and that bacterial virulence was regulated by persulfidation of the HTH-type transcriptional regulator MgrA (MgrA), a global virulence regulator \[[@B119-antioxidants-09-00621]\].
All these data suggest that persulfidation is a conserved mechanism of H~2~S signaling throughout all kingdoms of life.
5. Crosstalk of H~2~S with Other Signaling Molecules {#sec5-antioxidants-09-00621}
====================================================
5.1. Nitric Oxide {#sec5dot1-antioxidants-09-00621}
-----------------
It is well established that H~2~S regulates different physiological processes in cells directly or by crosstalk with other signaling molecules. There is clear evidence of crosstalk of H~2~S and NO in the literature. In mammals, both gasotransmitters interact with each other to modulate the cardiovascular system by regulating angiogenesis and endothelium-dependent vasorelaxation \[[@B120-antioxidants-09-00621],[@B121-antioxidants-09-00621]\], and to modulate Alzheimer's disease by regulating pathways involved in the central nervous system \[[@B122-antioxidants-09-00621]\]. Furthermore, inhibition of NO generation by H~2~S has been extensively studied \[[@B123-antioxidants-09-00621],[@B124-antioxidants-09-00621],[@B125-antioxidants-09-00621]\], but there is also evidence that NO can activate the production of H~2~S in endothelial cells \[[@B126-antioxidants-09-00621]\]. However, NO can bind to cystathionine β-synthase (CBS), which is responsible for H~2~S biosynthesis and can impede its enzymatic activity \[[@B127-antioxidants-09-00621]\], showing the complexity of the crosstalk between these two gasotransmitters.
In plants, NO and H~2~S play crucial roles in the regulation of multiple responses towards a variety of abiotic and biotic stresses \[[@B44-antioxidants-09-00621],[@B128-antioxidants-09-00621],[@B129-antioxidants-09-00621]\], including stomatal closure/aperture \[[@B46-antioxidants-09-00621]\], modulation of photosynthesis \[[@B34-antioxidants-09-00621],[@B130-antioxidants-09-00621],[@B131-antioxidants-09-00621]\] and autophagy \[[@B56-antioxidants-09-00621],[@B132-antioxidants-09-00621],[@B133-antioxidants-09-00621]\]. NO levels increase in plants under drought stress, which helps plants mitigate the negative effects of water deficit. NO increases the activities of antioxidant enzymes such as catalase (CAT), superoxide dismutase (SOD), ascorbate peroxidase (APX), glutathione reductase (GPX), and peroxidase (POD), and NO is an important player in ABA-induced stomatal closure, minimizing plant transpiration \[[@B134-antioxidants-09-00621]\]. H~2~S application reduces the accumulation of NO in guard cells, causing stomatal opening in the presence of light and preventing stomatal closure in the dark \[[@B45-antioxidants-09-00621]\]. Exogenous H~2~S induces stomatal closure through the regulation of ATP-binding cassette (ABC) transporters, while scavenging H~2~S can partially block ABA-dependent stomatal closure, indicating the protective role of H~2~S in plants against drought stress \[[@B46-antioxidants-09-00621]\]. It has been demonstrated that H~2~S acts downstream of ABA and upstream of NO \[[@B44-antioxidants-09-00621]\]. H~2~S-induced stomatal closure can be reversed by cPTIO (a NO-specific scavenger), confirming that the function of H~2~S in stomatal closure is mediated by NO \[[@B44-antioxidants-09-00621]\]. It has been proposed that these contradictory effects of H~2~S on stomatal movement and its crosstalk with NO depend on the environment or the age of the plant \[[@B135-antioxidants-09-00621]\]. In agricultural crops such as pepper plants, the crosstalk between NO and H~2~S plays an important role in the tolerance to iron deficiency and salt stress \[[@B136-antioxidants-09-00621]\]; and these gasotransmitters partially modulate the NADPH-generating system by regulating 6-phosphogluconate dehydrogenase (6PGDH) and NADP-malic enzyme (NADP-ME) \[[@B137-antioxidants-09-00621]\].
Furthermore, NO and H~2~S are involved in the functional regulation of proteins, frequently with opposite effects. *s*-nitrosation of GAPC abolishes its catalytic activity, whereas persulfidation increases its activity \[[@B60-antioxidants-09-00621],[@B138-antioxidants-09-00621]\]. Nonetheless, a cooperative effect of both signaling molecules can also be observed in the case of cytosolic ascorbate peroxidase (APX1), which can be S-nitrosylated by NO or persulfidated by H~2~S, both of which increase the activity of the enzyme. These reversible modifications may protect the enzyme from irreversible oxidation under abiotic stress, where the oxidative stress increases and s-nitrosothiols have usually been observed \[[@B139-antioxidants-09-00621]\].
H~2~S and NO may chemically interact and produce novel reactive molecules, such as nitroxyl (HNO) and nitrosothiols (RSNO) \[[@B140-antioxidants-09-00621],[@B141-antioxidants-09-00621]\], which have their own outcomes. Recent studies also demonstrated that persulfides can produce NO using nitrite via intermediates such as polysulfide, SNO^−^ (thionitrite) and S~2~NO^−^ (perthionitrite, nitrosodisulfide) \[[@B142-antioxidants-09-00621],[@B143-antioxidants-09-00621],[@B144-antioxidants-09-00621]\]. Therefore, H~2~S and NO interaction forms some intermediates, which also have significant roles in cell signaling.
5.2. Carbon Monoxide {#sec5dot2-antioxidants-09-00621}
--------------------
Carbon monoxide is another important gasotransmitter in animals; carbon monoxide is generated from oxidative degradation of heme by the enzyme heme oxygenase. CO may inhibit CBS activity and therefore may modulate H~2~S biosynthesis \[[@B145-antioxidants-09-00621]\]. Exogenous H~2~S also upregulates the CO/heme oxygenase system in the pulmonary arteries of hypoxic rats \[[@B146-antioxidants-09-00621]\] and stimulates heme oxygenase levels in mouse retinal ganglion cells (RGC-5 cells) \[[@B147-antioxidants-09-00621]\]. In plants, auxin induces endogenous H~2~S and CO during the initiation of lateral root primordia, and this growth is promoted by H~2~S but depends on the endogenous production of CO \[[@B50-antioxidants-09-00621],[@B148-antioxidants-09-00621]\]. Furthermore, in a similar way as in mammals, exogenous H~2~S induces an increase in the transcription of heme oxygenase and its activity in tomato and cucumber roots \[[@B149-antioxidants-09-00621],[@B150-antioxidants-09-00621]\]. Therefore, it has been suggested that H~2~S regulates the feedback loop between the CO/heme oxygenase system and auxin during lateral root initiation \[[@B151-antioxidants-09-00621]\]. Although the crosstalk between H~2~S and CO needs further study, previous research on plant and animal systems provides evidence for an interrelationship of these two signaling molecules.
5.3. Hydrogen Peroxide {#sec5dot3-antioxidants-09-00621}
----------------------
Hydrogen peroxide (H~2~O~2~) is a well-known signaling molecule in plants. H~2~O~2~ emerged as a key signaling molecule that enhances abiotic stress resistance by modulating the expression of resistance genes and antioxidant enzyme activities. Recently, signaling crosstalk between NO and H~2~S with H~2~O~2~ has been shown to induce thermotolerance in maize seedlings \[[@B152-antioxidants-09-00621]\]. Hydrogen peroxide is also involved in H~2~S-induced lateral root formation in tomato seedlings, revealing that the cell cycle regulatory genes modulated by H~2~S, such as up-regulation of *SlCYCA2;1*, *SlCYCA3;1*, and *SlCDKA1*, and down-regulation of *SlKRP2*, are prevented by co-treatment with H~2~O~2~ scavengers \[[@B153-antioxidants-09-00621]\]. A study in *Vicia faba* revealed crosstalk between H~2~S and H~2~O~2~ in salt stress-induced stomatal closure, with H~2~S being downstream of H~2~O~2~ \[[@B154-antioxidants-09-00621]\]. This observation was also described in white clover, where H~2~S acts as a downstream signal of H~2~O~2~ and NO in response to dehydration \[[@B155-antioxidants-09-00621]\]. A recent study showed a newly discovered crosstalk between H~2~S and H~2~O~2~ in another abiotic stress response, in which H~2~S can act as a positive regulator of Vacuolar H + -ATPase, while H~2~O~2~ acts as a negative regulator during cadmium stress in cucumber roots \[[@B156-antioxidants-09-00621]\]. In mammalian cells, H~2~O~2~ is a key signal in redox regulation, and as it occurs in plants, these regulatory pathways may also be influenced by H~2~S. H~2~O~2~ is produced by NAPDH oxidases in the plasma membrane and is transported to the cytosol through protein channels named aquaporins (AQP3, AQP8, and AQP9). It has been demonstrated that treatment with H~2~S is sufficient to block H~2~O~2~ cell permeability in unstressed cells, and this phenomenon is mediated by the persulfidation of cysteine 53 of AQP8 \[[@B157-antioxidants-09-00621]\]. By contrast, H~2~S production is dependent on the levels of H~2~O~2~ produced by NADPH oxidase, which attenuates the phosphorylation of vascular endothelial growth factor receptor 2 (VEGFR2) \[[@B158-antioxidants-09-00621]\]. As with NO and CO, autoregulation of these signals may be influenced by their generation, increasing or reducing their intracellular concentrations depending on the levels of each other. Another example was provided by Feng et al., who found that autophagy was induced by H~2~O~2~ through ER stress in cardiac fibroblast cells and that H~2~S was able to suppress autophagic flux by inhibiting ROS production and preserving mitochondrial function \[[@B159-antioxidants-09-00621]\]. All these studies establish a link for H~2~S/H~2~O~2~ crosstalk.
5.4. Hormones {#sec5dot4-antioxidants-09-00621}
-------------
H~2~S is a regulator of glucose homeostasis and plays an important role in the metabolism of hormones, such as insulin and glucagon \[[@B160-antioxidants-09-00621],[@B161-antioxidants-09-00621]\]. It has been demonstrated that β cells of the pancreas can produce high levels of H~2~S, predominantly by cystathionine *γ*-lyase (CSE), which blocks glucose-stimulated insulin secretion \[[@B162-antioxidants-09-00621]\]. This effect is caused by increased endoplasmic reticulum stress, leading to apoptosis of β cells, which drives the reduction in insulin secretion \[[@B161-antioxidants-09-00621]\]. Some other studies revealed the importance of H~2~S in the modulation of estrogen receptor expression and its anti-proliferative effect on vascular smooth muscle cell growth and proliferation \[[@B163-antioxidants-09-00621]\]. Further research concluded that the antiatherosclerotic effect of estrogen is mediated by CSE-generated H~2~S and that H~2~S production in the liver and vascular tissues is enhanced by estrogen via its stimulatory effect on CSE activity \[[@B164-antioxidants-09-00621]\]. In a recent study, H~2~S signaling was also linked with the regulation of two endocrine hormones associated with longevity control, growth hormone and thyroid hormone. Thyroid hormone suppresses H~2~S production by inhibiting CSE gene expression, while growth hormone controls its substrate availability via autophagy. Surprisingly, CSE-generated H~2~S is necessary for the feedback regulation of thyroid and growth hormones \[[@B165-antioxidants-09-00621]\].
Moreover, H~2~S has been linked to plant hormone signaling, such as gibberellin (GA) \[[@B166-antioxidants-09-00621]\], auxin \[[@B33-antioxidants-09-00621]\], jasmonic acid (JA) \[[@B167-antioxidants-09-00621]\], ethylene (ET) \[[@B168-antioxidants-09-00621]\], salicylic acid (SA) \[[@B169-antioxidants-09-00621]\] and abscisic acid (ABA) \[[@B45-antioxidants-09-00621],[@B46-antioxidants-09-00621],[@B47-antioxidants-09-00621]\].
A synergistic effect between GA and H~2~S was observed in seed germination in plants, and this outcome was more evident when treatment with H~2~S was prolonged \[[@B170-antioxidants-09-00621]\]. It was also observed that GA decreased L-cysteine desulfhydrase (LCD) activity and thus H~2~S production. This enzyme inhibition induced an increase in programmed cell death (PCD) \[[@B166-antioxidants-09-00621]\]. Nevertheless, exogenous H~2~S treatment alleviated GA-triggered PCD in wheat aleurone cells and blocked the decrease in endogenous H~2~S release by modulating glutathione homeostasis and heme oxygenase-1 gene expression \[[@B166-antioxidants-09-00621]\].
Auxin is a phytohormone associated with lateral root morphogenesis and root growth regulation. Similar to other phytohormones, a synergistic effect with H~2~S has been observed. Exogenous treatments with H~2~S donors increased the number and length of lateral roots in sweet potato seedlings in a dose-dependent manner \[[@B33-antioxidants-09-00621]\]. As mentioned previously in this review, crosstalk between the CO/heme oxygenase system and H~2~S is established during lateral root initiation \[[@B151-antioxidants-09-00621]\]. Furthermore, H~2~S can modulate *CDKA;1*, *CYCA2;1* and Cyclin-dependent kinase inhibitor 2 (*KRP2)* gene expression and act as a downstream component of auxin signaling to activate lateral root formation in tomato \[[@B50-antioxidants-09-00621]\]. New data shed light on this crosstalk recently, as it was reported that H~2~S inhibited auxin transport through modulation of the subcellular distribution of Peptidyl-prolyl cis-trans isomerase NIMA-interacting (PIN) proteins \[[@B171-antioxidants-09-00621]\], which is an actin-dependent process. Additionally, it was proven that the regulation of the F-actin cytoskeleton in Arabidopsis roots by H~2~S could affect the auxin distribution in plants \[[@B171-antioxidants-09-00621]\]. Therefore, the signaling network that includes auxin, H~2~S and F-actin must be finely knotted to regulate root development.
Jasmonic acid regulates diverse plant growth processes and is involved in defense responses against biotic and abiotic stresses. It is well known that H~2~S can regulate abiotic stress tolerance and biotic stress resistance in Arabidopsis \[[@B172-antioxidants-09-00621]\] and that H~2~S is involved in JA-induced stomatal closure \[[@B173-antioxidants-09-00621]\]. However, the interaction between H~2~S and JA is still under study. A recent publication demonstrated that treatment with JA promoted endogenous H~2~S generation and that treatments with exogenous H~2~S donors significantly enhanced JA-induced cadmium tolerance \[[@B167-antioxidants-09-00621]\]. This observation was also described by other authors, whose research described that JA treatments increased D-cysteine desulfhydrase activity and that this JA-induced H~2~S regulated ascorbate and glutathione metabolism \[[@B61-antioxidants-09-00621]\]. Taken together, these data suggest intertwined signaling between H~2~S and this plant hormone.
Salicylic acid is a phenolic compound involved in local and systemic plant defense responses against pathogens and abiotic stress. SA treatment increased the activity of L-cysteine desulfhydrase and H~2~S accumulation, which improved the heat tolerance of maize seedlings \[[@B174-antioxidants-09-00621]\]. Contrary to the feedback observed for other hormones and H~2~S, sulfide treatments had no significant effect on SA accumulation and its biosynthesis enzymes \[[@B169-antioxidants-09-00621]\]. However, a synergistic role was observed between SA and H~2~S in the antioxidant system and osmolyte in crosstalk-induced heat tolerance of maize seedlings \[[@B169-antioxidants-09-00621]\].
ET is another phytohormone that has been linked with H~2~S signaling. Several authors have described how exogenous treatments with ET induce L- and D-cysteine desulfhydrase activity, and this H~2~S regulates ethylene-induced stomatal closure in *Arabidopsis thaliana* and *Vicia faba* \[[@B168-antioxidants-09-00621],[@B175-antioxidants-09-00621],[@B176-antioxidants-09-00621]\]. A new study revealed that treatments with ET induced H~2~S generation, and feedback regulation was also observed since ethylene-induced H~2~S negatively regulated ethylene biosynthesis; this regulation occurred through the persulfidation of ACO1 in tomato plants \[[@B116-antioxidants-09-00621]\]. Further investigations have shown that H~2~S may have an antagonistic effect on ethylene, reducing oxidative stress and repressing ethylene synthesis-related gene expression \[[@B177-antioxidants-09-00621]\].
In recent years, the crosstalk of ABA with H~2~S has been the focus of several investigations since ABA is a key player in plant physiology, mainly under drought stress. It has been broadly reported that H~2~S plays a role in stomatal closure \[[@B43-antioxidants-09-00621],[@B46-antioxidants-09-00621]\] and that impaired H~2~S generation mutants (*DES1* knockout Arabidopsis mutants) do not show stomatal closure upon ABA treatment, although this effect could be reversed by exogenous application of H~2~S \[[@B46-antioxidants-09-00621]\]. This crosstalk was also observed in wheat \[[@B178-antioxidants-09-00621]\]. Surprisingly, *abi1* mutants were not able to close their stomata in response to sulfide, suggesting that functional ABI1 is required to close the stomata through H~2~S \[[@B44-antioxidants-09-00621]\]. As described above, H~2~S acts upstream of NO to regulate ABA-induced stomatal closure \[[@B44-antioxidants-09-00621]\], but H~2~S acts downstream of NO in ethylene-induced stomatal closure \[[@B175-antioxidants-09-00621]\]. In a parallel study, the authors demonstrated that H~2~S induced ABA-dependent stomatal opening instead \[[@B45-antioxidants-09-00621]\], which was further demonstrated by Honda et al., who found that H~2~S donors were able to close the stomata during the first 150 min of treatment and induce opening after prolonged treatments \[[@B179-antioxidants-09-00621]\]. This dual effect could be related to the production of NO in guard cells, and therefore, a complex crosstalk of H~2~S, NO, ET and ABA might regulate stomatal movement depending on environmental stress. A recent study demonstrated the persulfidation of several proteins involved in ABA signaling and ABA biosynthesis, such as SnRK2.2, a key component and activator of ABA signaling; two ABA receptors, pyrabactin resistance receptor 1 (PYR1) and pyrabactin resistance-like receptor (PYL1); the protein phosphatase 2C (HAB2), which is a repressor of ABA signaling; and the nuclear transcription factor Y (NFYC4), which is involved in the ABA signaling pathway \[[@B105-antioxidants-09-00621]\]. Another enzyme that was shown to be persulfidated in this study was phospholipase D, the activity of which was demonstrated to be regulated by H~2~S to control stomatal closure \[[@B180-antioxidants-09-00621]\]. Other studies demonstrated the *s*-nitrosation of some proteins involved in ABA signaling, such as the leucine zipper transcription factor Abscisic acid insensitive 5 (ABI5); SnRK2.2, which was also persulfidated; and Open Stomata1 (OST1) \[[@B181-antioxidants-09-00621],[@B182-antioxidants-09-00621]\]. The mechanism of action of H~2~S and NO in this tight regulation has been proposed to be through persulfidation and *s*-nitrosation of proteins that play key roles in ABA signaling \[[@B105-antioxidants-09-00621],[@B182-antioxidants-09-00621]\]. More recently, the mechanism of action of this crosstalk was deciphered; ABA stimulates the persulfidation of L-cysteine desulfhydrase 1, and H~2~S accumulation drives persulfidation of the NADPH oxidase respiratory burst oxidase homolog protein D (RBOHD), enhancing its activity and triggering stomatal closure \[[@B183-antioxidants-09-00621]\].
5.5. Thioredoxins {#sec5dot5-antioxidants-09-00621}
-----------------
As proposed by several authors, one mechanism of action of H~2~S is modulation of protein persulfidation, but the thiol group may undergo a wide range of posttranslational modifications (PTMs) in cells, including oxidation to disulfide (-S-S-), sulfenylation (-SOH), sulfinylation (-SO~2~H), and sulfonylation (-SO~3~H); *s*-nitrosation (-SNO) and glutathionylation (-SS-glutathione). Some of these PTMs can be chemically reversible by reductants in vivo, such as glutathione, or by a cysteine nucleophilic attack to rebuild a disulfide bond. Thioredoxins (TRX) are small oxidoreductases that mainly reduce oxidized cysteines and cleave disulfide bonds. However, TRX may also act as transpersulfidases \[[@B184-antioxidants-09-00621]\], denitrosylases \[[@B185-antioxidants-09-00621],[@B186-antioxidants-09-00621]\] or deglutathionylases \[[@B187-antioxidants-09-00621]\]. Hence, modified cysteines can be restored to a thiol group. In that sense, persulfidation may protect cysteine residues from the other oxidative modifications, which can be eventually more damaging or irreversible. Deregulation of H~2~S, NO or glutathione levels in the cell can be devastating, and these signaling molecules can reversibly modify proteins. Thioredoxin could be necessary to restore a native protein and transfer the modification to another protein to fulfil other outcomes.
In a prolonged oxidative environment, thiol oxidation leads to the irreversible formation of sulfinic and sulfonic acids. H~2~S has been proposed to act as a protective molecule to avoid these irreversible modifications, since persulfidated proteins can react with reactive oxygen/nitrogen species but can also be reduced by thioredoxins to restore the thiol group \[[@B108-antioxidants-09-00621]\]. The role of thioredoxins in maintaining persulfidation has been reported in human embryonic kidney cells and the mouse liver because two thioredoxin knockdown cells showed increased polysulfide and protein persulfidation levels \[[@B188-antioxidants-09-00621]\]. In a recent study, it has been demonstrated that H~2~S regulates the redox state of Trx, disrupting the H~2~O~2~-initiated polymerization of Trx, modulating this antioxidant system \[[@B189-antioxidants-09-00621]\]
The interaction between H~2~S and a wide number of other signaling molecules indicates that H~2~S is an essential molecule of signaling in cell life ([Figure 2](#antioxidants-09-00621-f002){ref-type="fig"}).
6. H~2~S in Human and Plant Therapies {#sec6-antioxidants-09-00621}
=====================================
It is well known that sulfurous water baths were used by ancient civilizations and were known to have healing effects against particular diseases. H~2~S has been recognized as having anti-inflammatory, anti-bacterial, vasodilator, and anti-fungal properties owing to its sulfur content \[[@B68-antioxidants-09-00621],[@B190-antioxidants-09-00621],[@B191-antioxidants-09-00621]\]. Several extracts from the genus Allium, mainly onion and garlic, and their derivatives have been used since ancient times in China as medicines to treat numerous diseases, including cancer \[[@B192-antioxidants-09-00621]\], cardiovascular disease \[[@B193-antioxidants-09-00621]\] and other diseases. It is known that these extracts are a source of sulfur-containing flavor compounds such as diallyl sulfide, allicin and cycloalliin, among others, and which release H~2~S in cells upon interaction with reductants \[[@B194-antioxidants-09-00621],[@B195-antioxidants-09-00621]\].
Currently, these beneficial effects are still under study to develop new strategies and therapies to treat certain diseases in mammals and to address agricultural challenges. In mammals, therapies that include H~2~S are used for their anti-inflammatory effects, cytoprotective properties and antiapoptotic features \[[@B196-antioxidants-09-00621]\]. The aim of these therapies is to be able to use this signaling molecule in heart failure, neurodegenerative diseases and stroke, and ischemia, among others. There has recently been an increasing number of publications indicating that deficiency or excess sulfur amino acids (SAAs), namely, methionine and cysteine, in the diet affect the normal growth of animals and that it is important that SAAs are ingested at the appropriate dose \[[@B197-antioxidants-09-00621],[@B198-antioxidants-09-00621]\], since they affect signaling in cells through H~2~S \[[@B199-antioxidants-09-00621]\]. These amino acids are metabolized through the transsulfuration pathway, which is the one of the main sources of H~2~S in cells; H~2~S has been shown to increase the lifespan of *C. elegans* \[[@B200-antioxidants-09-00621]\] and even humans \[[@B201-antioxidants-09-00621]\].
Nevertheless, clinical research on H~2~S is not easy to perform due to its toxicity, and H~2~S therapy is still in a preliminary preclinical stage. A bottleneck for developing gasotransmitter-based therapeutics is the lack of a safe administration drug. There are some candidate compounds for CO and NO prodrugs \[[@B202-antioxidants-09-00621],[@B203-antioxidants-09-00621],[@B204-antioxidants-09-00621]\] and more interestingly, some H~2~S-releasing drugs are currently in clinical trials \[[@B205-antioxidants-09-00621],[@B206-antioxidants-09-00621]\]. In a recent study, intraperitoneal injections of JK-1 (a H~2~S donor) were administered to mice after transverse aortic constriction and were shown to have substantial beneficial effects on renal and vascular function \[[@B207-antioxidants-09-00621]\]. Another exciting approach was a high increase in the dietary intake of taurine, which boosted CSE-mediated H~2~S production to exert significant protective effects in atherogenesis, hypertension and heart failure \[[@B208-antioxidants-09-00621]\]. However, most therapies use an increase in the dietary intake of sulfur amino acids or directly use slow-releasing H~2~S donors to avoid the toxicity of high H~2~S concentrations \[[@B209-antioxidants-09-00621]\]. These therapies in mouse models can be used as models to study H~2~S donors in humans. A recent study revealed that persulfidation decreases with aging and that dietary/pharmacological interventions could be used to increase persulfidation and extend lifespan \[[@B210-antioxidants-09-00621]\]. Moreover, a few recently published articles described the interplay between H~2~S, CO and NO within the gastrointestinal tract, especially in ulcer healing and prevention of non-steroidal anti-inflammatory drugs (NSAIDs)---induced gastropathy \[[@B211-antioxidants-09-00621],[@B212-antioxidants-09-00621]\]. In addition, a novel H~2~S donor not only increases H~2~S levels, but also increases circulating NO bioavailability in heart failure patients, highlighting the crosstalk between these gasotransmitters in therapeutic trials \[[@B213-antioxidants-09-00621]\].
In plants, new therapies or strategies using H~2~S are being used to deal with economic losses due to fruit and vegetable ripening or crop stress resistance. It has been shown that H~2~S fumigation slows fruit ripening and senescence in fruits and vegetables by inducing antioxidant activities, such as ascorbate peroxidase, catalase, peroxidase, glutathione reductase, and superoxide dismutase \[[@B214-antioxidants-09-00621],[@B215-antioxidants-09-00621],[@B216-antioxidants-09-00621]\]. Treatments with exogenous H~2~S have also been used to control the color degradation of certain horticultural vegetables and fruits by suppressing the degradation of anthocyanins \[[@B214-antioxidants-09-00621]\] and downregulating some chlorophyll degradation genes \[[@B217-antioxidants-09-00621]\]. Interactions between H~2~S and other signaling molecules, such as NO and ethylene, have also been a focus of recent investigations on the senescence of flowers or ripening of fruits. Hydrogen sulfide alleviates postharvest ripening and senescence of fruits by antagonizing the effect of ethylene \[[@B218-antioxidants-09-00621],[@B219-antioxidants-09-00621]\]. In addition, a cooperative effect of H~2~S and NO has been observed on delaying the softening and decay of fruits \[[@B220-antioxidants-09-00621]\], and the crosstalk between these two gasotransmitters is associated with the inhibition of ethylene biosynthesis \[[@B221-antioxidants-09-00621]\].
There is a long list of publications on the beneficial effects of H~2~S treatments in crops, such as enhancing resistance to metal, heat, cold, salt and drought stresses, which have been recently summarized \[[@B222-antioxidants-09-00621]\]. It has been demonstrated that sulfur fertilization of crops reduces sensitivity to pathogens, in a process mediated by hydrogen sulfide \[[@B16-antioxidants-09-00621]\]. H~2~S-induced pathogen resistance is conferred through increased expression of salicylic acid-dependent pathogen-related (PR) genes \[[@B223-antioxidants-09-00621]\] and increased transcription levels of microRNA393 (*MIR393*) genes \[[@B39-antioxidants-09-00621]\]. Another important beneficial effect of H~2~S treatment of crops is its influence on the modulation of photosynthesis \[[@B34-antioxidants-09-00621]\] and autophagy regulation \[[@B57-antioxidants-09-00621]\]. Apparently, H~2~S is able to regulate energy production in mitochondria, protecting against aging and increasing the lifespan of plants in a similar way as in animals \[[@B224-antioxidants-09-00621]\]. All of these advantageous outcomes lead to increased yields and biomass and enhanced germination of agricultural crops after H~2~S administration \[[@B48-antioxidants-09-00621],[@B225-antioxidants-09-00621]\].
7. Conclusions and Future Research {#sec7-antioxidants-09-00621}
==================================
Early life forms had to survive in an atmosphere that contained highly reactive compounds, such as NO, CO and H~2~S, and it seems that during evolution, early life forms not only tolerated these compounds but also included them as important molecules in their signaling mechanisms.
In this review, we summarized the wide promiscuity of H~2~S, which is able to react with a broad range of signaling molecules, acting on its own or in cooperation with those molecules. In addition, we showed that a wide series of pathways are regulated by H~2~S, including either important physiological pathways and pathophysiological or stress conditions. Persulfidation has been proposed to be the mechanism of action of H~2~S in cells throughout all *regna,* but how this modification affects individual proteins and the general consequences on signaling pathways needs further study. The instability of H~2~S and persulfidated cysteines and the imprecise quantitative detection methods for them have slowed the progress of research. Further investigation into developing an appropriate detection method is crucial to understanding H~2~S signaling. Future studies on the compartmentalization or microenvironment of these molecules will be important for studying different modifications on the same target and their biological outcomes. A better understanding of this signaling pathway would shed light on new targets for medical therapies and agricultural remedies.
We thank Marie Skłodowska-Curie grant agreement No. 834120 for funding support and Junta de Andalucıa-FEDER (Project *ref. US-1255781*).
A.A. organized, wrote and prepared the manuscript. C.G., D.C.B. and L.C.R. contributed to writing and reviewing the major parts of the manuscript. All authors have read and agreed to the published version of the manuscript.
This work has received funding from the European Union's Horizon 2020 research and innovation programme under the Marie Skłodowska-Curie grant agreement No. 834120.
The authors declare that this research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.
{#antioxidants-09-00621-f001}
{#antioxidants-09-00621-f002}
|
Barry Norman may have left the BBC's Film show 15 years ago, but he's still an influential voice of cinema opinion, as his waspish comments at the Henley literary festival proved over the weekend.
According to the Mail Online, Norman told his audience "Too many films are made for a generation with the attention span of fruit flies ... I heard a depressing fact that films today are made for the 15 year-old to 18 year-old audience, who are there for the quick thrill and the fast effects."
Norman, 80, went on to complain that cinema failed to serve his generation. "You can't make a film on an idea you need a great story but sadly a lot of films today are made on special effects and the 'crash, bang, wallop' effect. We are at an age where people go to the cinema and they want dialogue and that is a shame. Often with these blockbuster films there is lots of shooting, lots of effects, lots of car chases and explosions and not very much substance."
A former Guardian columnist, Norman has recently published See You in the Morning, a memoir of his late wife, novelist Diana Narracott.
More on Barry Norman
• News: Barry Norman and Mel Gibson lock horns over height
• Barry Norman: 'The people I worked with were terrified of me' |
Actuality Specials
Actuality Specials is an American television series consisting of a collection of documentaries produced by NBC News and broadcast during the 1960s. Some of the programs were reruns that had been shown earlier; others were produced specifically for this series.
Narrators
The documentaries were usually narrated by one of the NBC news anchors and included Chet Huntley, Robert MacNeil, Frank McGee and Edwin Newman. Narration was sometimes provided by Hollywood personalities such as Lorne Greene and Raymond Burr.
Broadcast history
The series was originally produced as a summer series beginning in July 1962. It left the air for three years, returned in October 1965 and ran for three more years. During this time, it alternated broadcast with The Bell Telephone Hour.
References
External links
Category:1962 American television series debuts
Category:1968 American television series endings
Category:1960s American documentary television series
Category:1960s American television series
Category:NBC original programming
Category:Black-and-white American television programs
Category:English-language television programs |
Dewayne White
absolved in a melee that sent four to the hospital. All were treated and released within hours, but police chief DewayneWhite has said one of the injured men had fractured vertebrae. "Today is a sad day for the city of Baton Rouge. Today
University, the LSU alumni and the countless fans that follow the Tiger football program," Baton Rouge police chief DewayneWhite said. "It is also a sad day for the Baton Rouge police department." White said the evidence in the case would be |
Airway clearance in COPD: need for a breath of fresh air? A systematic review.
Airway clearance is a key component of respiratory physiotherapy management for patients with excess secretions, including patients with chronic obstructive pulmonary disease (COPD). The aim of this review is to give an overview of the available evidence for the use of different airway clearance techniques (ACT) and their effects in patients with COPD. A systematic literature search was performed on CEBAM, PUBMED, Cochrane CT, Science Direct and Biomed central data bases. After screening, a total of 26 articles were included. Studies that provide solid evidence of the effectiveness of different airway clearance techniques in patients with COPD are rather scarce. The available evidence indicates that active breathing techniques, such as active cycle of breathing techniques, autogenic drainage and forced expiration, can be effective in the treatment of COPD. The evidence for passive techniques such as postural drainage and percussion is low. Supporting techniques such as intrapulmonary percussive ventilation, positive expiratory pressure and non-invasive ventilation have little evidence because of the small number of studies. Little evidence is found for the combined use of active techniques and supporting techniques such as (oscillating) positive expiratory pressure, postural drainage and vibration in COPD patients. There is clearly a need for well-powered controlled clinical trials on the long-term effects of (combined) airway clearance techniques in COPD. |
/*
* Copyright 2008-2009 the original author or authors.
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package net.hasor.dataql.compiler.qil;
import net.hasor.utils.StringUtils;
import java.lang.reflect.Field;
/**
* QL 指令
* @author 赵永春 (zyc@hasor.net)
* @version : 2017-07-03
*/
public class InstructionInfo implements Opcodes, Instruction {
private byte instCode = 0;
private Object[] instParam = null;
public InstructionInfo(byte instCode, Object[] instParam) {
this.instCode = instCode;
this.instParam = instParam == null ? new Object[0] : instParam;
}
/**获取指令码。*/
public byte getInstCode() {
return this.instCode;
}
/**获取 字符串数据*/
public String getString(int index) {
return (String) this.instParam[index];
}
/**获取 布尔数据*/
public Boolean getBoolean(int index) {
return (Boolean) this.instParam[index];
}
/**获取 数字数据*/
public Number getNumber(int index) {
return (Number) this.instParam[index];
}
/**获取 数字数据*/
public int getInt(int index) {
return (Integer) this.instParam[index];
}
/**获取 字符串数据*/
public Object[] getArrays() {
return this.instParam;
}
/**
* 将 Label 替换为本身标记的行号。
* 如果出现 Label 未插入情况，则返回false。
* （每个Label 都要通过 InstQueue.inst方法插入到指令序列中，一个被使用的 Label 如果没有插入到序列中的情况被成为，Label未插入）
* */
public boolean replaceLabel() {
for (int i = 0; i < this.instParam.length; i++) {
if (this.instParam[i] instanceof Label) {
Label label = (Label) this.instParam[i];
if (label.getIndex() == null) {
return false;
}
this.instParam[i] = label.getIndex();
}
}
return true;
}
@Override
public String toString() {
StringBuilder codeName = new StringBuilder();
try {
//
Field[] fields = Opcodes.class.getFields();
for (Field field : fields) {
byte aByte = field.getByte(null);
if (aByte == this.instCode) {
codeName.append(field.getName());
break;
}
}
//
} catch (IllegalAccessException e) {
codeName.append("error : ");
codeName.append(e.getMessage());
return codeName.toString();
}
//
int needSpace = 10 - codeName.length();
if (needSpace > 0) {
codeName.append(StringUtils.leftPad("", needSpace, ' '));
}
for (int i = 0; i < this.instParam.length; i++) {
if (i > 0) {
codeName.append(", ");
}
codeName.append(this.instParam[i]);
}
//
return codeName.toString().trim();
}
} |
Detention centers for Muslims in the western Chinese province of Xinjiang are "campuses, not camps" and are set to be closed as a "training program" for the ethnic Uighurs is downsized, a top Chinese diplomat said Friday.
At the U.N. Human Rights Council in Geneva, Executive Vice Foreign Minister Le Yucheng reiterated China's insistence that the centers are designed to provide training and fight terrorism that, he said, has infected the region for years. He also took aim at a U.S.-led "side event" in Geneva on Xinjiang — calling that "unacceptable" interference in Chinese sovereignty.
He said officials from around the world, including from the U.N., had visited the region and that the centers in Xinjiang are "actually boarding schools or campuses, not camps as claimed by the ill-intentioned few."
He didn't specify when the centers would be closed, other than telling reporters afterward that they would be "at the appropriate time."
Le also told reporters he had recently visited some centers in Xinjiang — and played ping pong and ate halal food there.
The centers have drawn condemnation from across the world, including from the United States, as well as from human rights groups.
The comments by Le came as China was responding to more than 200 recommendations by other countries on ways that Beijing could improve human rights as part of a Human Rights Council process known as the Universal Periodic Review, or UPR.
All U.N. member states undergo such screening, generally every four to five years. Le said China had accepted 82 percent of the recommendations presented during the review last November. The council formally adopted the review of China without a vote on Friday.
The U.S. State Department this week said China "significantly intensified" a campaign of mass detentions over the last year, with between 800,000 and 2 million people from the Xinjiang Uighur Autonomous Region interned in camps.
The United States, historically one of the few countries to confront China over its human rights records, pulled out of the 47-country Geneva-based U.N. body last year, alleging it has an anti-Israeli bias and other shortcomings.
Norway's ambassador in Geneva voiced the most criticism among diplomats at the council on Friday. Hans Brattskar said the Nordic country regretted that China did not accept any recommendations in the UPR process related to the situation in Xinjiang. |
Immunochromatographic strip assay for the rapid and sensitive detection of Salmonella Typhimurium in artificially contaminated tomato samples.
This study was designed to confirm the applicability of a liposome-based immunochromatographic assay for the rapid detection of Salmonella enterica subsp. enterica serovar Typhimurium (Salmonella Typhimurium) in artificially contaminated tomato samples. To determine the detection limit and pre-enrichment incubation time (10, 12, and 18 h pre-enrichment in 1% buffered peptone water), the tests were performed with different cell numbers of Salmonella Typhimurium (3 × 10(0), 3 × 10(1), 3 × 10(2), and 3 × 10(3) CFU·mL(-1)) inoculated into 25 g of crushed tomato samples. The assay was able to detect as few as 30 Salmonella Typhimurium cells per 25 g of tomato samples (1.2 cells·g(-1)) after 12 h pre-enrichment incubation. Moreover, when the developed assay was compared with traditional morphological and biochemical culture-based methods as well as colloidal gold nanoparticle-based commercial test strips, the developed assay yielded positive results for the detection of Salmonella Typhimurium within a shorter period time. These findings confirm that the developed assay may have practical application for the sensitive detection of Salmonella Typhimurium in various food samples, including raw vegetables, with a relatively low detection limit and shorter analysis time. |
Sir,
Vitamin D deficiency is common in chronic kidney disease patients undergoing hemodialysis and is associated with bone disorders\[[@ref1]\] and increased mortality.\[[@ref2]\] Previous studies suggest that vitamin D deficiency is more frequent in patients with an African origin whose skin pigmentation is a barrier to ultraviolet rays necessary to 25-OH vitamin D synthesis.\[[@ref1][@ref3]\] Like in many developing regions, little is currently known about vitamin D status of dialysis patients from Sub-Saharan Africa.\[[@ref4]\] Data from black populations living in the United States or Europe might not be applicable for African patients whose dietary habits and sunlight exposures are different. We report here a pilot study that aimed to determine the prevalence of vitamin D deficiency in Senegalese hemodialysis patients.
In a cross-sectional study between March 30^th^ and October 30^th^ 2011, we included 46 patients from two main hemodialysis centers in Dakar. Clinical data, serum calcium, phosphate and vitamin D levels during the last 3 months were collected from patients'medical records. All dosages of 25-OH vitamin D were performed using electrochemiluminescence immunoassay (COBAS Roche Diagnostics). Vitamin D deficiency was defined as a serum 25-OH vitamin D level \<15 μg/l. Univariate and multivariate logistic regressions were used to identify the factors associated with vitamin D deficiency.
Mean age of patients was 50.3 ± 12.7 years (13-77 years) and 39.1% of them were females. All patients were dialyzed using the bicarbonate buffer and a calcium rich dialysate (1.75 mmol/l). Almost all of them (91%) had a weekly Kt/V \>1.2. Thirty six patients (78.2%) presented pre-dialysis high blood pressure (≥140/90 mmHg) and six patients (13%) had a body mass index above 30 kg/m^2^. The etiologies of end-stage renal disease were dominated by hypertension (39%) and diabetes (26%).
Prevalence of vitamin D deficiency was 32.6% and 28 patients (60.8%) had a vitamin D level between 15 μg/Land 30 μg/l). This prevalence was comparable between men and women (respectively 47.3% and 50.0%, *P* = 0.93). After multivariate logistic regression, age ≥50 years, hypocalcemia and hyperparathyroidism showed significant association of vitamin D deficiency, but gender and hyperphosphatemia did not \[[Table 1](#T1){ref-type="table"}\].
######
Parameters associated with vitamin D deficiency
The present results show that the prevalence of vitamin D deficiency in hemodialysis patients living in Senegal is similar to those reported in Western countries.\[[@ref1][@ref3][@ref5]\]
Despite limitation due to small sample size and the cross-sectional study design, this study could be a basis for larger prospective cohort that would also assess the effect of vitamin D deficiency on bone and cardiovascular outcomes in African dialysis patients.
|
using System.Threading.Tasks;
namespace Abc.Zebus.Tests.Dispatch.DispatchMessages
{
public class AsyncFailingCommandHandler : IAsyncMessageHandler<AsyncFailingCommand>
{
public Task Handle(AsyncFailingCommand message)
{
if (message.ThrowSynchronously)
throw message.Exception;
return Task.Factory.StartNew(() => { throw message.Exception; });
}
}
}
|
#include <stdlib.h> /* for calloc, free */
#include "header.h"
extern struct SN_env * SN_create_env(int S_size, int I_size, int B_size)
{
struct SN_env * z = (struct SN_env *) calloc(1, sizeof(struct SN_env));
if (z == NULL) return NULL;
z->p = create_s();
if (z->p == NULL) goto error;
if (S_size)
{
int i;
z->S = (symbol * *) calloc(S_size, sizeof(symbol *));
if (z->S == NULL) goto error;
for (i = 0; i < S_size; i++)
{
z->S[i] = create_s();
if (z->S[i] == NULL) goto error;
}
z->S_size = S_size;
}
if (I_size)
{
z->I = (int *) calloc(I_size, sizeof(int));
if (z->I == NULL) goto error;
z->I_size = I_size;
}
if (B_size)
{
z->B = (symbol *) calloc(B_size, sizeof(symbol));
if (z->B == NULL) goto error;
z->B_size = B_size;
}
return z;
error:
SN_close_env(z);
return NULL;
}
extern void SN_close_env(struct SN_env * z)
{
if (z == NULL) return;
if (z->S_size)
{
int i;
for (i = 0; i < z->S_size; i++)
{
lose_s(z->S[i]);
}
free(z->S);
}
if (z->I_size) free(z->I);
if (z->B_size) free(z->B);
if (z->p) lose_s(z->p);
free(z);
}
extern int SN_set_current(struct SN_env * z, int size, const symbol * s)
{
int err = replace_s(z, 0, z->l, size, s, NULL);
z->c = 0;
return err;
}
|
// { dg-options "-std=gnu++17" }
// Copyright (C) 2013-2019 Free Software Foundation, Inc.
//
// This file is part of the GNU ISO C++ Library. This library is free
// software; you can redistribute it and/or modify it under the
// terms of the GNU General Public License as published by the
// Free Software Foundation; either version 3, or (at your option)
// any later version.
// This library is distributed in the hope that it will be useful,
// but WITHOUT ANY WARRANTY; without even the implied warranty of
// MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
// GNU General Public License for more details.
// You should have received a copy of the GNU General Public License along
// with this library; see the file COPYING3. If not see
// <http://www.gnu.org/licenses/>.
// class basic_istream::sentry
#include <string_view>
#include <ostream>
#include <sstream>
#include <locale>
#include <typeinfo>
#include <testsuite_hooks.h>
#include <testsuite_character.h>
void
test01()
{
using namespace std;
using __gnu_test::pod_ushort;
typedef basic_string_view<pod_ushort> string_type;
typedef basic_stringbuf<pod_ushort> stringbuf_type;
typedef basic_ostream<pod_ushort> ostream_type;
string_type str;
stringbuf_type strbuf01;
ostream_type stream(&strbuf01);
try
{
stream << str;
}
catch (std::bad_cast& obj)
{
// Ok, throws bad_cast because locale has no ctype facet.
}
catch (...)
{
VERIFY( false );
}
const std::locale loc(std::locale::classic(), new std::ctype<pod_ushort>);
stream.imbue(loc);
try
{
stream << str;
}
catch (...)
{
VERIFY( false );
}
}
int
main()
{
test01();
return 0;
}
|
Nigeria: Strong Faith (Video)
Ten years ago, Nigerian Christians could expect a major attack against them about once every year. Then the attacks began to occur monthly. In the past year, attacks have occurred nearly every other week. Today, simply attending church on Sunday puts a believer at risk, and those who actively tell Muslims about Christ are at greater risk still.
Evangelist Johnson was seriously injured in a bomb explosion on his way to a Christian meeting. As with hundreds of other injured Nigerian Christians last year, VOM supported Johnson by paying his medical bills, helping him arrange needed treatment and providing spiritual encouragement. Sadly, the need for medical care is growing at an incredible rate among Christians in northern Nigeria today.
But Johnson exemplifies the persevering spirit of Nigerian believers. While many of these Christians could leave, they feel called to reach their Muslim neighbors. As Johnson says, “If I didn’t love my work, if I didn’t love Jesus, I would give up.” Johnson and many other Nigerian Christians live under constant threat for the sake of Christ. Johnson shares his encouraging story in this interview. |
Dobutamine stress MRI. Part II. Risk stratification with dobutamine cardiovascular magnetic resonance in patients suspected of myocardial ischemia.
The aim of this study was to determine the prognostic value of dobutamine cardiovascular magnetic resonance (CMR) in patients suspected of myocardial ischemia. Clinical data and dobutamine-CMR results were analyzed in 299 consecutive patients. Follow-up data were analyzed in categories of risk levels defined by the history of coronary artery disease and presence of rest wall motion abnormalities (RWMA). Major adverse cardiac events (MACE) as evaluated end points included cardiac death, nonfatal myocardial infarction and clinically indicated coronary revascularization. Follow-up was completed in 214 (99%) patients with a negative dobutamine-CMR study (no signs of inducible myocardial ischemia) with an average of 24 months. The patients with a negative dobutamine-CMR study and RWMA showed a significantly higher annual MACE rate (18%) than the patients without RWMA (0.56%) ( P<0.001). Patients without RWMA showed an annual MACE rate of 2% when they had a history of coronary artery disease and <0.1% without a previous coronary event ( P<0.001). Dobutamine-CMR showed a positive and negative predictive value of 95 and 93%, respectively. The cardiovascular occurrence-free survival rate was 96.2%. In patients suspected of myocardial ischemia, dobutamine-CMR is able to assess risk levels for coronary events with high accuracy. |
Q:
`git clean` from other working directory
Some git commands take a --git-dir argument, but git clean doesn't seem to do so.
How can I do what cd someDir && git clean -abcd would have done, without changing working directory?
A:
--git-dir is an option of git, not git-clean.
git --git-dir someDir/.git clean -abcd
|
Q:
using SMO .net to backup and restore through DeviceType.Pipe
I wrote a Program that backup SQL Databases using SMO Library on .net , and everything is just going smoothly, I just have one last point, I'm changing my way to save the .bak file on the hard disk, from DeviceType.File to DeviceType.Pipe, I have used pipes before, I just didn't know how to implement it here .
A:
I thought PIPE backup device was not available in SQL Server 2005 and above.
From sys.backup_devices, pipe is obsolete.
I could be wrong of course, and I've never used pipe backups (even back to my SQL Server 6.5 days)
Edit, OK found it...
1st entry here: Discontinued Database Engine Functionality in SQL Server 2005
Discontinued feature = Named pipe backup devices
With comment
"For security reasons, SQL Server does not support backup to named pipes."
So why is it still listed in the DeviceType enumeration?
|
/* SPDX-License-Identifier: Apache-2.0 */
/* Copyright Contributors to the ODPi Egeria project. */
package org.odpi.openmetadata.accessservices.softwaredeveloper.listener;
import org.odpi.openmetadata.adminservices.ffdc.exception.OMAGConfigurationErrorException;
import org.odpi.openmetadata.frameworks.auditlog.AuditLog;
import org.odpi.openmetadata.repositoryservices.connectors.omrstopic.OMRSTopicListenerBase;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
import org.odpi.openmetadata.frameworks.connectors.properties.beans.Connection;
import org.odpi.openmetadata.repositoryservices.connectors.stores.metadatacollectionstore.repositoryconnector.OMRSRepositoryHelper;
import org.odpi.openmetadata.repositoryservices.connectors.stores.metadatacollectionstore.repositoryconnector.OMRSRepositoryValidator;
import java.util.List;
/**
* SoftwareDeveloperOMRSTopicListener received details of each OMRS event from the cohorts that the local server
* is connected to. It passes NEW_ENTITY_EVENTs to the publisher.
*/
public class SoftwareDeveloperOMRSTopicListener extends OMRSTopicListenerBase
{
private static final Logger log = LoggerFactory.getLogger(SoftwareDeveloperOMRSTopicListener.class);
private OMRSRepositoryHelper repositoryHelper;
private OMRSRepositoryValidator repositoryValidator;
private String componentName;
private List<String> supportedZones;
/**
* The constructor is given the connection to the out topic for Asset Consumer OMAS
* along with classes for testing and manipulating instances.
*
* @param softwareDeveloperOutTopic connection to the out topic
* @param repositoryHelper provides methods for working with metadata instances
* @param repositoryValidator provides validation of metadata instance
* @param componentName name of component
* @param supportedZones list of zones covered by this instance of the access service.
* @param auditLog log for errors and information messages
* @throws OMAGConfigurationErrorException problems creating the connector for the outTopic
*/
public SoftwareDeveloperOMRSTopicListener(Connection softwareDeveloperOutTopic,
OMRSRepositoryHelper repositoryHelper,
OMRSRepositoryValidator repositoryValidator,
String componentName,
List<String> supportedZones,
AuditLog auditLog) throws OMAGConfigurationErrorException
{
super(componentName, auditLog);
this.repositoryHelper = repositoryHelper;
this.repositoryValidator = repositoryValidator;
this.componentName = componentName;
this.supportedZones = supportedZones;
}
}
|
Q:
java charAt() array issue
I have some sort of problem even tho, idk what it's actually that's my code
package $Random_Projects;
import java.util.Scanner;
public class PhoneBook {
public static void main (String[] args){
Scanner myScan = new Scanner(System.in);
System.out.println("Enter number of entries in the phone book ");
int num= myScan.nextInt();
String PBEnteries[]=new String[num];
for(int i=0; i<PBEnteries.length;i++){
System.out.println("Enter name and telephone number: ");
PBEnteries[i]=myScan.nextLine();
}
System.out.println("Enter name: ");
String nameSearch=myScan.next();
boolean search=false;
for(int i=0;i<PBEnteries.length;i++)
for(int j=0;j<nameSearch.length();j++){
if(nameSearch.charAt(j)==PBEnteries[i].charAt(j)){
if(j == nameSearch.length()){
search=true;
System.out.println(PBEnteries[i]);}
}
}
if(search == false)
System.out.println("Invalid name.");
}
}
my issue in 21 line : if(nameSearch.charAt(j)==PBEnteries[i].charAt(j)){
it should be searching for the name so the type name and phone number, ex."Sam 0000", "Danial 1111" and in search he writes the name ex."Sam" and should post num or even the whole array as "Sam 0000", but I've a problem with equalizing each char
note: it's not a personal program, they want it all in one array with specific java knowledge, so it should compare each char in the name that he typed with the array
output :
Enter number of entries in the phone book
3
Enter name and telephone number:
Enter name and telephone number:
Mohammed 1212
Enter name and telephone number:
Ali 0000
Enter name:
Ali
Exception in thread "main" java.lang.StringIndexOutOfBoundsException: String index out of range: 0
at java.lang.String.charAt(String.java:658)
at $Random_Projects.PhoneBook.main(PhoneBook.java:21)
A:
If you have an empty string or null for index 0 of your entries array -- and from your run output it looks like you might -- it would make sense that asking for charAt[0] of that entry would fail. You may want to include a guard not to store empty entries, or, when you're looking up entries, you might want to check that it's not null or empty.
|
Q:
What is causing this error on nginx server – 502 Bad gateway
I have a site built in Drupal 7 on a nginx server. A few times a week when I edit any content and press save, or when I log in to the site, or when I change some configuration, I get a white screen with the message "502 Bad gateway". The error is never showed to anonymous visitors, only when logged in and saving changes. It doesn't seem to matter what kind of changes I do. I can press the back button in the browser, which takes me back to the edit screen and press save again, and save the change successfully.
The error happened again this morning at 08:09, so I looked at the PHP log:
2016/10/20 08:09:00 [error] 20703#20703: *3297348 recv() failed (104: Connection reset by peer) while reading response header from upstream, client: 195.198.76.66, server: www.example.com, request: "POST /node/88/edit HTTP/1.1", upstream: "fastcgi://unix:/run/php/php-fpm.sock:", host: "www.example.com", referrer: "http://www.example.com/node/88/edit"
And here is the nginx log at that same time:
[20-Oct-2016 08:09:00] WARNING: [pool www0] child 10909, script '/srv/www/example/public_html/index.php' (request: "POST /index.php") execution timed out (8189.954999 sec), terminating
[20-Oct-2016 08:09:00] WARNING: [pool www0] child 10909 exited on signal 15 (SIGTERM) after 19080.476683 seconds from start
[20-Oct-2016 08:09:00] NOTICE: [pool www0] child 13002 started
Can anyone see what is happening here?
A:
I had a HTTP 502 problem on a setup with nginx & php-fpm. It seems that many timeouts & limits must be modified according to the data transfer time. What was happening in this case is that the keepalive timeout was too short.
Here are some settings that might help solve 502 problems:
In nginx.conf: keepalive_timeout
In the site's configuration file (which is in thesites-available folder):
send_timeout
fastcgi_connect_timeout
fastcgi_send_timeout
fastcgi_read_timeout
in php.ini:
max_execution_time
max_input_time
The real source of the problem can be any of these settings.
|
They graduated in 2008 and immediately secured jobs in three very different breweries. Van Lancker got a job at De Proef Brouwerij. In Flemish, “proef” can mean “taste,” “test,” or “try.” But De Proef the brewery is a contract facility in Lochristi owned by scientist and brewmaster Dirk Naudts, who’s known as “The Prof” by locals. “I’ve got huge respect for Dirk,” Van Lancker says. “He’s one of my brewing heroes. He’s one of the best brewers in the world. He wanted to stay out of the limelight, but in doing so, he has become famous.”
Working at De Proef—who brews for Mikkeller, Omnipollo, and To Øl—exposed Van Lancker to myriad styles and a range of beers from other parts of the world. “Belgium has always been our first influence,” Van Lancker says. “But because I worked for De Proef I had a lot of Scandinavian beers and a lot of American-style beers.”
Lippens began working for Brouwerij Omer Vanderghinste, a regional family brewery in West Flanders most known for its traditional blond, Omer (8% ABV), and its mixed fermentation Vanderghinste Oud Bruin (5.5% ABV). “The day after I ended my brewing studies I started working in Omer,” Lippens says. “After two years there I became head brewer.”
He split his time between the brewhouse and technical projects such as automating the brewery filtration and cleaning systems. For Lippens, Verzet fulfills his craving for a different challenge. “I was never involved in recipe development at Omer,” he says. “I told them I loved working there, but that my creativity was being pushed down. I need to do stuff. I want to fail. At Omer, nothing can fail. Every beer has to be right on. I personally don’t mind bringing a beer out that doesn’t work. My personal goal is to be the best brewer in the world. It’s impossible to be that. But for me it’s about learning.” |
Introduction {#s1}
============
A high level of genetic diversity is the hallmark of human immunodeficiency virus type 1 (HIV-1). HIV-1 is classified into four groups: M, O, N and P [@pone.0099693-Plantier1], [@pone.0099693-VanHeuverswyn1]. HIV-1 group M strains are responsible for the vast majority of HIV infections worldwide and consist of 11 subtypes and sub-subtypes, 58 circulating recombinant forms (CRFs) ([www.hiv.lanl.gov](http://www.hiv.lanl.gov)), and various types of unique recombinant forms (URFs). A variety of CRFs and URFs continue to be detected worldwide. In particular, new CRF strains with serial numbers above 51 were all reported from Asia: CRF51_01B from Singapore [@pone.0099693-Ng1]; CRF52_01B from Thailand and Malaysia [@pone.0099693-Liu1]; CRF53_01B [@pone.0099693-Chow1] and CRF54_01B [@pone.0099693-Ng2] from Malaysia; and CRF55_01B [@pone.0099693-Han1] from China. All CRFs reported from Asia are recombinants of CRF01_AE and subtype B, except CRF07_BC [@pone.0099693-Su1] and CRF08_BC [@pone.0099693-Piyasirisilp1]. Widespread co-circulation and dual infection of CRF01_AE and subtype B in various regions in Asia have led to the emergence of a large number of CRFs comprising subtype B and CRF01_AE. Of note among them, CRF51_01B and CRF55_01B are CRFs that were identified mainly among men-who-have-sex-with-men (MSM).
The HIV-1 epidemic continues to expand rapidly among MSM in China [@pone.0099693-Ministry1]--[@pone.0099693-Ministry2]. In 2011, MSM accounted for 29.4% of all newly diagnosed HIV cases [@pone.0099693-Ministry1]. MSM became one of the nation\'s most targeted populations for HIV prevention and care. Initially, the MSM population in China was predominantly infected with subtype B [@pone.0099693-Zhang1], [@pone.0099693-Wang1], the typical U.S.-European strains that are prevalent in western countries. However, in recent years, a dramatic shift in genotype distribution from subtype B to CRF01_AE and other virus lineages has been observed in China [@pone.0099693-He1]. Furthermore, studies [@pone.0099693-An1], [@pone.0099693-Han2] have identified a number of distinct phylogenetic clusters uniquely associated with the epidemic among MSM in China: CRF01_AE clusters 1 and 2, and CRF07_BC cluster 3. These three lineages of HIV-1 strains account for approximately 80% of HIV-1 infections among MSM in China [@pone.0099693-Han2]. In addition, various new recombinant strains mostly comprising CRF01_AE and subtype B have been detected [@pone.0099693-Wang2], [@pone.0099693-Wu1].
In the present study, we discuss a new circulating recombinant form that we identified (CRF59_01B) and that is uniquely associated with transmission among MSM in China. Additionally, we investigate its nationwide occurrence and the evolutionary history of it emergence.
Materials and Methods {#s2}
=====================
Study Subjects, HIV-1 RNA Isolation and Screening of HIV-1 Genotypes {#s2a}
--------------------------------------------------------------------
This study was performed as part of a nationwide molecular epidemiological survey of Chinese MSM. A total of 920 plasma samples were collected from HIV-1-seropositive MSM in 11 provinces/municipalities across China from 2008 to 2013: Jilin province (n = 8); Liaoning province (n = 263); Beijing (n = 163); Shandong province (n = 42); Jiangsu province (n = 49); Shanghai (n = 26); Anhui province (n = 136); Henan province (n = 58); Hunan province (n = 68); Guangdong province (n = 40); and Yunnan province (n = 67). This study was approved by the Institutional Review Board of the First Affiliated Hospital of China Medical University. Written informed consent was obtained from all participants before sample collection. HIV-1 RNA was extracted from participants\' plasma using QIAamp Viral Mini Kits (Qiagen, Germany) and was used to amplify and determine the nucleotide sequences of the 1.1-kb protease-reverse transcriptase (pro-RT) region in the *pol* gene (HXB2: 2253--3318). HIV-1 genotypes were determined based on the neighbor-joining analysis of the Kimura 2-parameter distance matrix and a transition-to-transversion ratio of 2.0, using MEGA software Version 5.0
Near Full-Length HIV- 1 Nucleotide Sequencing {#s2b}
---------------------------------------------
Near-full-length genome (NFLG) sequences of the strains of interest were determined using the single-gene amplification (SGA) method [@pone.0099693-Kirchherr1] to prevent any artificial recombination that might have occurred with a nested polymerase chain reaction (PCR). Briefly, plasma HIV-1 RNA was reverse-transcribed into single-strand cDNA using Superscript III First-Strand Synthesis System (Invitrogen, USA) with 5′-half -reverse primer 07Rev8 (5′-CCTARTGGGATGTGTACTTCTGAACTT-3′; HXB2: 5193--5219 nt) and 3′--half-reverse primer 1.R3.B3R (5′-ACTACTTGAAGCACTCAAGGCAAGCTTTATTG-3′; HXB2: 9611--9642 nt) as described previously [@pone.0099693-Liu2]. The 5′- and 3′- halves of the HIV-1 viral genome were independently amplified from cDNA by using two rounds of nested PCR with specific primers [@pone.0099693-Liu2]. Both PCR reactions were performed in a final volume of 20 ul containing 15.3 ul RNase-free Water, 2 ul 10× High-Fidelity Platinum PCR buffer, 0.8 ul MgSO~4~ (50 mM), 0.4 ul dNTP (10 mM), 0.2 ul of each primer (20 pmol/ul), 0.1 ul Platinum Taq High-Fidelity polymerase (Invitrogen, USA), and 1 ul template. The first and second rounds of PCR were both performed under the following conditions: 94°C for 2 minutes, 35 cycles at 94°C for 10 seconds, 60°C for 30 seconds, 68°C for 4.5 minutes, final extension of 10 minutes at 68°C. The second-round PCR products were electrophoresed on 0.7% TAE agarose gel to check for positive amplification. Then, the positive amplification products were purified and directly sequenced using internal walking primers with an ABI 3730XL Sanger-based genetic analyzer. All sequences were analyzed, edited and assembled by overlapping the sequences of the two half-genome fragments with Sequencer 4.10.1 and Bioedit version 5.0.
Recombination breakpoint analyses {#s2c}
---------------------------------
The NFLG sequences were first analyzed using the Recombination Identification Program (RIP) and the jumping profile Hidden Markov Model (jpHMM) on the Los Alamos HIV Sequence Database ([www.hiv.lanl.gov](http://www.hiv.lanl.gov)) to define the recombinant structures. Subsequently, all NFLG sequences were aligned with HIV-1 subtypes/CRFs reference sequences using HIVAlign (<http://www.hiv.lanl.gov/content/sequence/VIRALIGN/viralign.html>) and then manually edited with Bioedit 5.0. A phylogenetic tree of the NFLG was constructed by applying the neighbour-joining method based on Kimura\'s two-parameter distance matrix with 1000 bootstrap replicates using MEGA 5.0. Subtype B (83FR.HXB2), CRF01_AE (90TH.CM240) and subtype C (95IN21068) were used in the bootscanning analysis with SimPlot version 3.5.1. Insertion segments were used to build sub-regions phylogenetic tree via the neighbour-joining method with bootstrapping to confirm the origin of the different segments. The Recombinant HIV-1 Drawing Tool (<http://www.hiv.lanl.gov/content/sequence/DRAWCRF/recom_mapper.html>) was used to elucidate the structure of the new HIV-1 recombinant forms (CRF01_AE/B).
Estimate of Appearance of Most Recent Common Ancestor of CRF59_01B {#s2d}
------------------------------------------------------------------
The rate of the evolution of different segments of CRF59_01B were estimated from a set of subtype B and CRF01_AE references with known sampling dates using BEAST v.1.6.0. Dates were estimated using Bayesian Markov Chain Monte Carlo (MCMC) inference under both the general time-reversal (GTR) and Hasegawa-Kishino-Yano (HKY) nucleotide substitution models. The MCMC analysis was computed for 20 million states sampled at every 1000 states, and the MCMC results were evaluated using the Tracer 1.5 program. All parameters were estimated from an effective sampling size (ESS) \>200. The maximum clade credibility (MCC) trees were viewed and edited using FigTree v1.3.1.
Results {#s3}
=======
Identification of Novel Circulating Recombinant Form (CRF59_01B) among MSM in China {#s3a}
-----------------------------------------------------------------------------------
The primary screening of HIV-1 genotypes based on 1.1-kb *pol* (pro-RT) region sequences revealed that the genotype distribution of HIV-1 strains circulating among MSM in 11 provinces in China (n = 920) were as depicted in [Figure 1A](#pone-0099693-g001){ref-type="fig"}: CRF01_AE (533, 57.9%); CRF07_BC (223, 24.2%); B (101, 11.0%); B′ (Thai variant of subtype B) (11, 1.2%); CRF08_BC (4, 0.4%); CRF33_01B (1, 0.1%); other recombinants (47, 5.1%). Furthermore, CRF01_AE strains were classified into two distinct clusters [@pone.0099693-An1], [@pone.0099693-Han2]: cluster 1 (295, 32.1%) and cluster 2 (232, 25.2%). Similarly, most CRF07_BC strains formed a unique phylogenetic cluster that is designated cluster 3 (210, 22.8%) [@pone.0099693-Han2]. Additionally, 19 strains (2.1%) belong to the recently-identified CRF55_01B strain [@pone.0099693-Han1].
{#pone-0099693-g001}
Within a group of other recombinant strains (n = 28), we found that six strains (0.7%) formed a distinct phylogenetic cluster that is different from any other known HIV-1 genotype: 3 from Liaoning province (northeast), and 1 each from Guangdong, Yunnan and Hunan provinces ([Table 1](#pone-0099693-t001){ref-type="table"}, [Figure 1B](#pone-0099693-g001){ref-type="fig"}). Furthermore, we also identified one additional strain (11CN.LNSY300876) that belonged to this cluster from a heterosexual male in Liaoning province ([Table 1](#pone-0099693-t001){ref-type="table"}). These seven study subjects share no obvious epidemiologic link. Recombination breakpoint analysis revealed that these seven strains contained a small subtype B segment in a CRF01_AE backbone in the 1.1-kb *pol* segment (data not shown).
10.1371/journal.pone.0099693.t001
###### Summary of demographic and genotype information of study subjects infected with CRF59_01B in China.
{#pone-0099693-t001-1}
Study subject Geographic origin Province (City) Sampling year Age Sex Risk factor Genome sequence Accession number Remarks
----------------- ----------------------------------- --------------- ----- ----- -------------- --------------------- ------------------ ---------------------------
09CN.LNSY300423 Liaoning (Shenyang) 2009 51 M MSM NFLG JX960635 Cite [@pone.0099693-An1]
10CN.LNSY300533 Liaoning (Shenyang) 2010 31 M Bisexual NFLG KC462191 Cite [@pone.0099693-Han3]
11CN.LNSY300392 Liaoning (Shenyang) 2011 51 M MSM NFLG KC462190 Cite [@pone.0099693-Han3]
11CN.GDMM152 Guangdong (Maoming) 2011 40 M MSM NFLG KJ484433 This study
12CN.YNKM200199 Yunnan (Kunming) 2012 43 M MSM NFLG KJ484434 This study
12CN.HNCS501137 Hunan (Changsha) 2012 24 M MSM 1.1-kb pol (pro-RT) KJ484435 This study
11CN.LNSY300876 Liaoning (Shenyang) 2011 45 M Heterosexual NFLG KJ484436 This study
M, Male; MSM, men-who-have-sex-with-men; NFLG, near full-length genome.
To define the detailed subtype structure of these strains, we determined the NFLG sequences from the plasma RNA samples. We successfully amplified and determined the NFLG sequences of six of the seven study subjects (all except 12CN.HNCS501137 from Hunan) ([Table 1](#pone-0099693-t001){ref-type="table"}). As shown in [Figure 2](#pone-0099693-g002){ref-type="fig"}, a total of six NFLG sequences (five from MSM; one from a heterosexual male) ([Table 1](#pone-0099693-t001){ref-type="table"}) formed a distinct monophyletic cluster that is distinct from any other known subtype or CRF. Recombination breakpoint analysis revealed that these six NFLG sequences shared identical recombinant structures in which two subtype B regions (nucleotide position 2570--2718 in the *pol* region and 6149--8243 nt in the region relative to the HXB2 genome) were located in a CRF01_AE backbone ([Figure 3](#pone-0099693-g003){ref-type="fig"}). The recombinant structure is distinct from any other known CRFs comprising CRF01_AE and subtype B, including CRF15_01B [@pone.0099693-Tovanabutra1], CRF33_01B [@pone.0099693-SahBandar1], CRF34_01B [@pone.0099693-Tovanabutra2], CRF48_01B [@pone.0099693-Li1], CRF51_01B [@pone.0099693-Ng1], CRF52_01B [@pone.0099693-Liu1], CRF53_01B [@pone.0099693-Chow1], CRF54_01B [@pone.0099693-Ng2], and CRF55 01B [@pone.0099693-Han1]. Subregion tree analyses further confirmed the parental origins of each region of the recombinant genome as follows ([Figure 3C](#pone-0099693-g003){ref-type="fig"}): Region I (HXB2: 790--2569) = CRF01_AE; Region II (HXB2: 2570--2718) = B; Region III (HXB2: 2719--6148) = CRF01_AE; Region IV (HXB2: 6149--8243) = B; Region V (HXB2: 8244--9600) = CRF01_AE. Subregion tree analyses also indicated that the subtype B regions (Region II+IV) were of U.S.-European origin and not the type B′ (Thai variant of subtype B) [@pone.0099693-Kalish1], [@pone.0099693-Ou1] lineage associated with blood-borne epidemics in Asia [@pone.0099693-Li2]. Additionally, the CRF01_AE regions were found in the Thailand CRF01_AE radiation and were not related to the CRF01_AE variants (clusters 1 and 2) that we recently identified among MSM in China [@pone.0099693-An2]. We designated these novel CRF01_AE/B recombinants as CRF59_01B [@pone.0099693-Han3].
![Neighbor-joining tree analysis of the near full-length nucleotide sequences of CRF59_01B.\
The neighbor-joining tree was constructed using the near full-length nucleotide sequences (8.8 kb) (HXB2: 790--9600 nt) of CRF59_01B strains identified in six epidemiologically-unlinked individuals \[five MSM (Bi) and one heterosexual\] from China ([Table 1](#pone-0099693-t001){ref-type="table"}). These strains are compared with the reference sequences of all known subtypes/sub-subtypes as well as CRFs relevant to this study, including CRF15_01B, CRF34_01B and CRF52_01B from Thailand; CRF51_01B from Singapore; CRF33_01B, CRF48_01B, CRF53_01B and CRF54_01B from Malaysia; and CRF55_01B from China (<http://www.hiv.lanl.gov/content/index>). Bootstrap values (\>70) of the respective nodes are indicated. 01[th]{.smallcaps} = Thailand CRF01_AE; 01[af]{.smallcaps} = African CRF01_AE; Chinese MSM clusters 1 and 2 = CRF01_AE variants associated with transmission among MSM in China.](pone.0099693.g002){#pone-0099693-g002}
![Recombination breakpoint analyses of CRF59_01B.\
(A) Bootscanning plot analysis. Analyses were performed using CRF01_AE (90TH.CM240) and subtype B (83FR.HXB2) as parental subtypes, and subtype C (95IN21068) as an out-group with a moving window of 350 nt with a step of 50 nt. Numbers represent nucleotide positions relative to the HXB2 genome. (B) The deduced subtype structure. Black = subtype B (of U.S.-European origin); gray = CRF01_AE; blank = no sequence data available. (C) Subgenomic phylogenies estimated using the neighbor-joining method from alignments representing Regions I, III, V (CRF01_AE) and the concatenated II+IV (subtype B) region. Bootstrap scores greater than 70% are indicated at corresponding nodes. 01[th]{.smallcaps} = Thailand CRF01_AE; 01[af]{.smallcaps} = African CRF01_AE; clusters 1 and 2 = CRF01_AE variants associated with transmission among MSM in China.](pone.0099693.g003){#pone-0099693-g003}
Evolutionary Characteristics of CRF59_01B {#s3b}
-----------------------------------------
To estimate the timeline of emergence of CRF59_01B, we performed Bayesian molecular clock analyses on the CRF01_AE regions \[Regions I (HXB2: 790--2569 nt), II (HXB2: 2719--6418 nt), III (HXB2: 8244--9600 nt) and concatenated genome regions for CRF01_AE (Regions I+III+V)(HXB2: 790--2569; 2719--6418; 8244--9600)\] and on the subtype B regions \[Region IVa (HXB: 7626--8243 nt) and the concatenated subtype B region (Regions II+IVa) (HXB2: 2570--2718; 7626--8243)\] ([Figure 4](#pone-0099693-g004){ref-type="fig"}), respectively. Analyses were performed by using a relaxed molecular clock approach. Since the most recent common ancestor estimates (tMRCAs) using individual or combined regions for CRF01_AE \[Regions I, III, V or the concatenated CRF01_AE region (I+III+V)\] and subtype B regions \[Regions IVa or the concatenated subtype B region (II+IVa)\] yielded essentially similar results. For simplicity, we are showing the MCC trees for only the concatenated CRF01_AE region (I+III+V) and the subtype B (II+IVa) region ([Figure 4](#pone-0099693-g004){ref-type="fig"}).
![Maximum clade credibility (MCC) trees of CRF59_01B.\
The MCC tree was obtained by Bayesian Markov Chain Monte Carlo (MCMC) analysis of the concatenated CRF01_AE \[(Regions I+III+V) (HXB2: 790--2569; 2719--6418; 8244--9600)\] regions and subtype B \[(Regions II+IVa) (HXB2: 2570--2718; 7626--8243)\] regions, using a relaxed clock model in GTR+G4 with a constant coalescent model. Analyses were implemented in BEAST v.1.6.0. HIV-1 subtype C sequences are used as an out-group. The medians of the estimated tMRCAs with 95% highest probability density (HPD) (in parentheses) and the posterior probability (\>0.95) of the nodes relevant to this study are indicated. (C) The distribution of the posterior probability of the estimated tMRCAs for CRF59_01B as well as the related CRF01_AE lineages (top) and subtype B lineages (bottom).](pone.0099693.g004){#pone-0099693-g004}
As shown in [Figure 4](#pone-0099693-g004){ref-type="fig"}, the estimated tMRCAs for concatenated CRF01_AE regions (Regions I+III+V) and subtype B regions (Regions II+IVa) were 2000.6 \[95% highest probability density (HPD): 1998.0, 2002.9\] and 2001.2 \[95% highest probability density (HPD): 1995.4, 2005.8\], respectively ([Figure 4](#pone-0099693-g004){ref-type="fig"}). These resulting estimated tMRCAs for the CRF01_AE and subtype B regions are consistent with each other ([Figure 4C](#pone-0099693-g004){ref-type="fig"}). This suggests that the recombination generating CRF59_01B from parental lineages of subtype B and CRF01_AE occurred around the year 2001. In contrast, the estimated tMRCAs for Chinese MSM CRF01_AE cluster 1 \[1989.4 (1986.8--1992.0)\] and cluster 2 \[1996.7(1993.6--1999.2)\] are significantly earlier than those of CRF59_01B ([Figure 4](#pone-0099693-g004){ref-type="fig"}).
Discussion {#s4}
==========
The large-scale national survey we conducted on HIV-1 strains circulating among MSM in China ([Figure 1](#pone-0099693-g001){ref-type="fig"}) identified a new CRF that we designated CRF59_01B ([Figure 2](#pone-0099693-g002){ref-type="fig"}, [3](#pone-0099693-g003){ref-type="fig"}). CRF59_01B is the second CRF (after CRF55_01B [@pone.0099693-Han1]) to circulate primarily among MSM in China. This is the third CRF (after CRF51_01B from Singapore [@pone.0099693-Ng1] and CRF55_01B [@pone.0099693-Han1]) to be identified among MSM in Asia. The appearance of this CRF reflects the recent upsurge of disease activity among MSM throughout the Chinese regions we studied [@pone.0099693-vanGriensven1]. As shown in the subregion trees ([Figure 3C](#pone-0099693-g003){ref-type="fig"}), the subtype B regions of CRF59_01B are of U.S.-Eurpoean origin, not of the subtype B′ (Thai variant of subtype B), which is associated with blood-borne epidemics in Asia. Additionally, CRF01_AE regions were found in the Thai CRF01_AE radiation and are not related to any CRF01_AE variants (clusters 1 and 2) that were recently identified among MSM in China [@pone.0099693-Han2]. As demonstrated in previous studies [@pone.0099693-Zhang1], subtype B was the predominant strain among MSM in China initially, but CRF01_AE has showed increasing prevalence among Chinese MSM in recent years. The co-circulation of these two HIV-1 lineages has led to the generation of various recombinants between the Thai CRF01_AE and subtype B strains, including CRF55_01B and CRF59_01B. These recombinants are distinct from other known CRFs consisting of CRF01_AE and subtype B′, including CRF15_01B and CRF34_01B from Thailand; CRF33_01B, CRF48_01B, CRF53_01B, CRF54_01B from Malaysia; and CRF52_01B from Thailand and Malaysia.
While CRF55_01B circulated widely among MSM in southern Chinese provinces, accounting for more than 10% of HIV-1 infections among MSM (X. Han et al., un- published data), CRF59_01B showed limited circulation among Chinese MSM. Although only a few CRF59_01B strains have been identified to date, they have been detected among MSM in various regions in China: 1.1% (3 of 263) in Liaoning from 2008 to 2012; 1.5% (1 of 68) in Hunan from 2010 to 2012; 2.5% (1 of 40) in Guangdong from 2011 to 2012; 1.5% (1 of 67) in Yunnan in 2012 ([Figure 1B](#pone-0099693-g001){ref-type="fig"}). These detections may suggest that an unknown focus of CRF59_01B is present outside the study sites. Alternatively, CRF59_01B has a very limited circulation, but the high mobility exhibited by the MSM population may explain the strain\'s sporadic and diffuse distribution across China.
According to the behavior studies [@pone.0099693-Shang1], [@pone.0099693-Zhang2], most MSM lack a basic knowledge about HIV/AIDS and usually have multiple sexual partners with whom they exhibit unprotected sexual behavior. Indeed, the rate of infection of sexually transmitted diseases, such as syphilis, is remarkably high in many cities: 27.7% in Nanjing and Yangzhou [@pone.0099693-Guo1], 31.1% in Shenyang [@pone.0099693-Xu1], and 14.3% in Harbin [@pone.0099693-Zhang3]. These factors make it possible for MSM to experience multiple HIV infections and superinfections, facilitating the emergence of new recombinant strains and their rapid dissemination across China. The emergence of CRF55_01B and CRF59_01B suggests that new recombinant forms comprising the CRF01_AE and subtype B lineages are actively being generated among MSM in various regions of China.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
[^2]: Conceived and designed the experiments: XXH WQZ MHA. Performed the experiments: WQZ BZ YT. Analyzed the data: WQZ XXH. Contributed reagents/materials/analysis tools: QHH ZXC JCX WPC XC JHF ZW JJW LL MHZ HW HJY. Wrote the paper: WQZ XXH HS. Revised language: CL.
|
import {Routes, RouterModule} from '@angular/router';
import {ModuleWithProviders} from '@angular/core';
import {FileUploadComponent} from './section/fileupload.component';
const router: Routes = [
{path: '', redirectTo: 'chapter9/fileupload', pathMatch: 'full'},
{path: 'chapter9/fileupload', component: FileUploadComponent},
{path: '**', redirectTo: 'chapter9/fileupload' }
];
export const routes: ModuleWithProviders = RouterModule.forRoot(router);
|
This award-winning winery's original Shawnee Hills Wine Trail location (Alto also has a Champaign outpost) offers free wine tasting and a gift shop, in addition to spring, summer and fall festivals with music and food.
Illinois' newest wine trail connects six wineries dotted throughout the southeast corner of the state. Visitors can enjoy both breathtaking vistas and friendly rural communities, all while sampling excellent red and white wines.
Make the scenic trek to Giant City State Park for the all-you-can-eat fried chicken dinner, served in the rustic dining room at Giant City Lodge. The family-style Southern fried chicken comes with made-from-scratch dumplings, mashed potatoes and biscuits with rich country milk gravy.
Producing world-class wines made from Southern Illinois grapes, Owl Creek is located near beautiful Giant City State Park, country bed and breakfasts, and antique shops. Wine by the glass may be enjoyed on the deck, or in the picnic area surrounded by the vineyard.
Tree ripened peaches & nectarines from July - August, and apples from September - December. This farm market is open 7 days a week with seasonal produce, preserves, pickles and other specialty food items and gifts.
Trails End Lodge is a new steakhouse and saloon, featuring traditional steakhouse cuisine, indoor and outdoor dining, live entertainment, and a friendly atmosphere all served in a rustic, yet luxurious western style lodge. Trails End Lodge is located in the heart of Southern Illinois wine country on scenic Skyline Drive between Cobden and Alto Pass, Illinois. The Lodge itself is not visible from Skyline Drive, so watch for our sign!
On the Shawnee Hills Wine Trail, StarView offers estate grown and bottled wines. Sit on the deck, or indoors by the fireplace and enjoy views of the vineyards, ponds, and the expansive Southern Illinois hills. Works by local artists cover the walls, and sandwiches and salads are severed.
Offers complimentary tastings of hand crafted wines and frequently offers special wine recipes to sample as well. Gourmet cheeses, salamis and crackers are available for purchase and you are invited to bring a picnic basket filled with your own goodies. There are a small selection of other beverages on hand.
Come relax with us a while and enjoy the lovely Southern Illinois down-home atmosphere. Make yourself comfortable in our tasting room or have a seat outside on our country porch. Open 7 days a week for locally made wine.
Turn of the century decor - over 200 sets of antlers with many other taxidermy artifacts. Varieties of root beer, old-fashioned soda fountain drinks, cappuccino and espresso bar, gourmet sandwiches, assorted candies, chocolates and gifts. Fun shopping! Belly up to the Root Beer Saloon for a cold one.
Bella Terra Winery is nestled in the beautiful surroundings of Johnson County, Illinois. With a scenic view of ponds, trees, and our vineyard we provide the perfect setting for sipping wines or celebrating special occasions. Bella Terra Winery was not created just for wine connoisseurs, we offer food and activities for the whole family. You can play bocce ball, throw a game of washers, watch your favorite team on T.V., or just relax under a tree and enjoy the breeze.The manicured grounds of Bella T Winery combined with beautiful shade trees create a striking backdrop for any occasion.
This family-owned vineyard harvests three acres of grapes each fall. The varieties include Vignoles, Chambourcin, Catawba, Concord, Niagara and Cayuga. Windy Hill is located on the Southern Illinois Wine Trail.
Orlandini Vineyard began its roots in 1988 when their first vines were planted. Over two decades later the grapes are still flourishing. Orlandini Vineyard is located on one of southern Illinois' highest ridge tops, deep in the heart of the Shawnee Hills A.V.A. After years of practice and experimentation in wine making, Orlandini Vineyard began releasing wines to the the public in 2001. Novices and connoisseurs have been enjoying our hand tended vintages ever since.
Popular with locals and travelers alike, Weeze's Country Barn, located in the Potato Barn, offers a variety of gifts and novelties and features locally made items. The restaurant offers a down home atmosphere and a delicious variety of foods to tantalize your taste buds, including homemade pies, made fresh every morning. Sundays they offer a plate lunch menu with down home variety of grandma's favorites, including fried chicken, chicken and dumplings, meatloaf, fried catfish, and salmon patties along with all the fixings. Come on in to Weeze's Country Barn and experience Southern Illinois hospitatlity at its finest! Open Daily 11-2
The Yellowmoon Cafe is a cozy coffeehouse which features live music Thursday, Friday, and Saturday evenings and most Sunday afternoons. We serve all types of coffee and coffee specialty drinks, local wines, and the best milkshakes in Southern Illinois.
Located at the Gambit Golf Club, this casual restaurant features dishes such as the grilled rib eye with red wine glaze and sautéed flounder with swiss chard. For a group, reserve the large banquet room.
Famous for generous portions and smoked items such as ribs, ham, and pulled pork. Other specialties include fried fish, mouth-watering steaks, fried chicken on Sundays, and excellent value with our daily specials! Looking for healthy alternatives? Try fresh salads, lemon pepper tilapia, or marinated, grilled chicken strips. The children's menu provides several options for children ages 12 and under. Be sure to try one of our unique appetizers, such as Barbeque Nachos, Fried Green Beans, or Fried Pickles.
Located two blocks from Harrah's Fat Edd's Roadhouse offers a variety of foods and drinks. Many appetizers such as peel-n-eat shrimp and great food choices from salads to Roadhouse platters. They also offer a full bar. Open daily 11:00 am to 10:00 pm.
Visit this Metropolis icon for barbecue done the old fashion way! In business since 1965 and located just 2 blocks from Ft. Massac State Park, you will enjoy some of the best breakfast sandwiches and BBQ in town! Open 4:00 am - 4:00 pm Tuesday - Saturday.
Chicago Style Pizza at its best. Even though you are 6 hours away from Chicago you will feel like you are on the streets of the Windy City every time you bite into one of the handmade pizzas at Cubby Bears. A pizza buffet makes it easy to sample all that Cubby's has to offer. Sandwiches and pasta also available. 11:00 a.m.-9:00 p.m. Daily
Bringing the atmosphere of China to Metropolis, The China House Buffet has opened in a newly remodeled facility. This deluxe buffet has everything you could possibly want and more. From Chinese favorites, pizza, American classics, seafood, salad and desserts you will find something you will enjoy. Located across U.S. 45 from Ft. Massac State Park. 11:00 a.m.-9:30 p.m. daily.
Down-home cookin' at Rube's is served up three meals a day. The cooks in the kitchen specialize in cooking "the way your mamma made it'" so you'll find something to your liking on the menu. Daily specials are sure to please even the pickiest eater. 6:00 a.m. - 7:00 p.m. Monday – Friday 6:00 a.m. - 1:00 p.m. Saturday 6:00 a.m. - 3:00 p.m. Sunday
Located directly across from Ft. Massac State Park you will feel like you have stepped across the border into old Mexico. Select from the finest traditional Mexican cuisine or have a drink from the bar. 11:00 a.m.-10:00 p.m. daily |
load("data/lnd.RData")
library(raster)
r = raster(nrow = 10, ncol = 10)
p = SpatialPoints(
cbind(
rnorm(100, sd = 100),
rnorm(100, mean = 180, sd = 180)
))
rp = rasterize(p, r, fun = "count")
plot(rp)
points(p)
r = raster(nrow = 50, ncol = 50, ext = extent(lnd))
lnd_raster = rasterize(lnd, r)
class(lnd_raster)
plot(lnd_raster)
head(lnd_raster@data@attributes)
plot(lnd_raster$layer)
plot(lnd_raster, "Pop_2001")
# for more details
?raster::plot
library(mapview)
mapview(lnd_raster)
bbox(lnd_raster)
# Add stations data
stns = tmap::read_shape("data/lnd-stns.shp")
crs(stns)
stns = spTransform(stns, CRS(proj4string(lnd)))
names(stns)
stns_raster = rasterize(stns, r,
field = "NAME",
fun = "count")
summary(stns_raster)
values(stns_raster)[is.na(values(stns_raster))] = 0
plot(stns_raster)
points(stns)
mapview(stns, stns_raster)
plot(stns)
# poznan data
poz = raster("data/poz_modified.tif")
mapview(poz)
|
<!doctype html>
<html xmlns="http://www.w3.org/1999/xhtml">
<head>
<meta http-equiv="X-UA-Compatible" content="IE=Edge" />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><script type="text/javascript">
var _gaq = _gaq || [];
_gaq.push(['_setAccount', 'UA-55120145-3']);
_gaq.push(['_trackPageview']);
(function() {
var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true;
ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js';
var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s);
})();
</script>
<title>pyFTS.models package — pyFTS 1.6 documentation</title>
<link rel="stylesheet" href="_static/bizstyle.css" type="text/css" />
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
<script type="text/javascript" src="_static/documentation_options.js"></script>
<script type="text/javascript" src="_static/jquery.js"></script>
<script type="text/javascript" src="_static/underscore.js"></script>
<script type="text/javascript" src="_static/doctools.js"></script>
<script type="text/javascript" src="https://cdnjs.cloudflare.com/ajax/libs/mathjax/2.7.1/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script>
<script type="text/javascript" src="_static/bizstyle.js"></script>
<link rel="index" title="Index" href="genindex.html" />
<link rel="search" title="Search" href="search.html" />
<link rel="next" title="pyFTS.models.ensemble package" href="pyFTS.models.ensemble.html" />
<link rel="prev" title="pyFTS.hyperparam package" href="pyFTS.hyperparam.html" />
<meta name="viewport" content="width=device-width,initial-scale=1.0">
<!--[if lt IE 9]>
<script type="text/javascript" src="_static/css3-mediaqueries.js"></script>
<![endif]-->
</head><body>
<div class="related" role="navigation" aria-label="related navigation">
<h3>Navigation</h3>
<ul>
<li class="right" style="margin-right: 10px">
<a href="genindex.html" title="General Index"
accesskey="I">index</a></li>
<li class="right" >
<a href="py-modindex.html" title="Python Module Index"
>modules</a> |</li>
<li class="right" >
<a href="pyFTS.models.ensemble.html" title="pyFTS.models.ensemble package"
accesskey="N">next</a> |</li>
<li class="right" >
<a href="pyFTS.hyperparam.html" title="pyFTS.hyperparam package"
accesskey="P">previous</a> |</li>
<li class="nav-item nav-item-0"><a href="index.html">pyFTS 1.6 documentation</a> »</li>
<li class="nav-item nav-item-1"><a href="modules.html" >pyFTS</a> »</li>
<li class="nav-item nav-item-2"><a href="pyFTS.html" accesskey="U">pyFTS package</a> »</li>
</ul>
</div>
<div class="sphinxsidebar" role="navigation" aria-label="main navigation">
<div class="sphinxsidebarwrapper">
<p class="logo"><a href="index.html">
<img class="logo" src="_static/logo_heading2.png" alt="Logo"/>
</a></p>
<h3><a href="index.html">Table Of Contents</a></h3>
<ul>
<li><a class="reference internal" href="#">pyFTS.models package</a><ul>
<li><a class="reference internal" href="#module-pyFTS.models">Module contents</a></li>
<li><a class="reference internal" href="#subpackages">Subpackages</a></li>
<li><a class="reference internal" href="#submodules">Submodules</a></li>
<li><a class="reference internal" href="#module-pyFTS.models.song">pyFTS.models.song module</a></li>
<li><a class="reference internal" href="#module-pyFTS.models.chen">pyFTS.models.chen module</a></li>
<li><a class="reference internal" href="#module-pyFTS.models.yu">pyFTS.models.yu module</a></li>
<li><a class="reference internal" href="#module-pyFTS.models.cheng">pyFTS.models.cheng module</a></li>
<li><a class="reference internal" href="#module-pyFTS.models.hofts">pyFTS.models.hofts module</a></li>
<li><a class="reference internal" href="#module-pyFTS.models.hwang">pyFTS.models.hwang module</a></li>
<li><a class="reference internal" href="#module-pyFTS.models.ifts">pyFTS.models.ifts module</a></li>
<li><a class="reference internal" href="#module-pyFTS.models.ismailefendi">pyFTS.models.ismailefendi module</a></li>
<li><a class="reference internal" href="#module-pyFTS.models.pwfts">pyFTS.models.pwfts module</a></li>
<li><a class="reference internal" href="#module-pyFTS.models.sadaei">pyFTS.models.sadaei module</a></li>
</ul>
</li>
</ul>
<h4>Previous topic</h4>
<p class="topless"><a href="pyFTS.hyperparam.html"
title="previous chapter">pyFTS.hyperparam package</a></p>
<h4>Next topic</h4>
<p class="topless"><a href="pyFTS.models.ensemble.html"
title="next chapter">pyFTS.models.ensemble package</a></p>
<div role="note" aria-label="source link">
<h3>This Page</h3>
<ul class="this-page-menu">
<li><a href="_sources/pyFTS.models.rst.txt"
rel="nofollow">Show Source</a></li>
</ul>
</div>
<div id="searchbox" style="display: none" role="search">
<h3>Quick search</h3>
<div class="searchformwrapper">
<form class="search" action="search.html" method="get">
<input type="text" name="q" />
<input type="submit" value="Go" />
<input type="hidden" name="check_keywords" value="yes" />
<input type="hidden" name="area" value="default" />
</form>
</div>
</div>
<script type="text/javascript">$('#searchbox').show(0);</script>
</div>
</div>
<div class="document">
<div class="documentwrapper">
<div class="bodywrapper">
<div class="body" role="main">
<div class="section" id="pyfts-models-package">
<h1>pyFTS.models package<a class="headerlink" href="#pyfts-models-package" title="Permalink to this headline">¶</a></h1>
<div class="section" id="module-pyFTS.models">
<span id="module-contents"></span><h2>Module contents<a class="headerlink" href="#module-pyFTS.models" title="Permalink to this headline">¶</a></h2>
<p>Fuzzy Time Series methods</p>
</div>
<div class="section" id="subpackages">
<h2>Subpackages<a class="headerlink" href="#subpackages" title="Permalink to this headline">¶</a></h2>
<div class="toctree-wrapper compound">
<ul>
<li class="toctree-l1"><a class="reference internal" href="pyFTS.models.ensemble.html">pyFTS.models.ensemble package</a><ul>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.ensemble.html#submodules">Submodules</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.ensemble.html#module-pyFTS.models.ensemble.ensemble">pyFTS.models.ensemble.ensemble module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.ensemble.html#module-pyFTS.models.ensemble.multiseasonal">pyFTS.models.ensemble.multiseasonal module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.ensemble.html#module-pyFTS.models.ensemble">Module contents</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="pyFTS.models.incremental.html">pyFTS.models.incremental package</a><ul>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.incremental.html#module-pyFTS.models.incremental">Module contents</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.incremental.html#submodules">Submodules</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.incremental.html#module-pyFTS.models.incremental.TimeVariant">pyFTS.models.incremental.TimeVariant module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.incremental.html#module-pyFTS.models.incremental.IncrementalEnsemble">pyFTS.models.incremental.IncrementalEnsemble module</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="pyFTS.models.multivariate.html">pyFTS.models.multivariate package</a><ul>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#module-pyFTS.models.multivariate">Module contents</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#submodules">Submodules</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#module-pyFTS.models.multivariate.FLR">pyFTS.models.multivariate.FLR module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#module-pyFTS.models.multivariate.common">pyFTS.models.multivariate.common module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#module-pyFTS.models.multivariate.variable">pyFTS.models.multivariate.variable module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#module-pyFTS.models.multivariate.flrg">pyFTS.models.multivariate.flrg module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#module-pyFTS.models.multivariate.partitioner">pyFTS.models.multivariate.partitioner module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#module-pyFTS.models.multivariate.grid">pyFTS.models.multivariate.grid module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#module-pyFTS.models.multivariate.mvfts">pyFTS.models.multivariate.mvfts module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#module-pyFTS.models.multivariate.wmvfts">pyFTS.models.multivariate.wmvfts module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#module-pyFTS.models.multivariate.cmvfts">pyFTS.models.multivariate.cmvfts module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.multivariate.html#module-pyFTS.models.multivariate.granular">pyFTS.models.multivariate.granular module</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="pyFTS.models.nonstationary.html">pyFTS.models.nonstationary package</a><ul>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.nonstationary.html#submodules">Submodules</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.nonstationary.html#module-pyFTS.models.nonstationary.common">pyFTS.models.nonstationary.common module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.nonstationary.html#module-pyFTS.models.nonstationary.cvfts">pyFTS.models.nonstationary.cvfts module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.nonstationary.html#module-pyFTS.models.nonstationary.flrg">pyFTS.models.nonstationary.flrg module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.nonstationary.html#module-pyFTS.models.nonstationary.honsfts">pyFTS.models.nonstationary.honsfts module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.nonstationary.html#module-pyFTS.models.nonstationary.nsfts">pyFTS.models.nonstationary.nsfts module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.nonstationary.html#module-pyFTS.models.nonstationary.partitioners">pyFTS.models.nonstationary.partitioners module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.nonstationary.html#module-pyFTS.models.nonstationary.perturbation">pyFTS.models.nonstationary.perturbation module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.nonstationary.html#module-pyFTS.models.nonstationary.util">pyFTS.models.nonstationary.util module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.nonstationary.html#module-pyFTS.models.nonstationary">Module contents</a></li>
</ul>
</li>
<li class="toctree-l1"><a class="reference internal" href="pyFTS.models.seasonal.html">pyFTS.models.seasonal package</a><ul>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.seasonal.html#submodules">Submodules</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.seasonal.html#module-pyFTS.models.seasonal.SeasonalIndexer">pyFTS.models.seasonal.SeasonalIndexer module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.seasonal.html#module-pyFTS.models.seasonal.cmsfts">pyFTS.models.seasonal.cmsfts module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.seasonal.html#module-pyFTS.models.seasonal.common">pyFTS.models.seasonal.common module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.seasonal.html#module-pyFTS.models.seasonal.msfts">pyFTS.models.seasonal.msfts module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.seasonal.html#module-pyFTS.models.seasonal.partitioner">pyFTS.models.seasonal.partitioner module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.seasonal.html#module-pyFTS.models.seasonal.sfts">pyFTS.models.seasonal.sfts module</a></li>
<li class="toctree-l2"><a class="reference internal" href="pyFTS.models.seasonal.html#module-pyFTS.models.seasonal">Module contents</a></li>
</ul>
</li>
</ul>
</div>
</div>
<div class="section" id="submodules">
<h2>Submodules<a class="headerlink" href="#submodules" title="Permalink to this headline">¶</a></h2>
</div>
<div class="section" id="module-pyFTS.models.song">
<span id="pyfts-models-song-module"></span><h2>pyFTS.models.song module<a class="headerlink" href="#module-pyFTS.models.song" title="Permalink to this headline">¶</a></h2>
<p>First Order Traditional Fuzzy Time Series method by Song & Chissom (1993)</p>
<ol class="upperalpha simple" start="17">
<li>Song and B. S. Chissom, “Fuzzy time series and its models,” Fuzzy Sets Syst., vol. 54, no. 3, pp. 269–277, 1993.</li>
</ol>
<dl class="class">
<dt id="pyFTS.models.song.ConventionalFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.song.</code><code class="descname">ConventionalFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.song.ConventionalFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.fts.FTS" title="pyFTS.common.fts.FTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.fts.FTS</span></code></a></p>
<p>Traditional Fuzzy Time Series</p>
<dl class="method">
<dt id="pyFTS.models.song.ConventionalFTS.flr_membership_matrix">
<code class="descname">flr_membership_matrix</code><span class="sig-paren">(</span><em>flr</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.song.ConventionalFTS.flr_membership_matrix" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.song.ConventionalFTS.forecast">
<code class="descname">forecast</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.song.ConventionalFTS.forecast" title="Permalink to this definition">¶</a></dt>
<dd><p>Point forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted values</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.song.ConventionalFTS.operation_matrix">
<code class="descname">operation_matrix</code><span class="sig-paren">(</span><em>flrs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.song.ConventionalFTS.operation_matrix" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.song.ConventionalFTS.train">
<code class="descname">train</code><span class="sig-paren">(</span><em>data</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.song.ConventionalFTS.train" title="Permalink to this definition">¶</a></dt>
<dd><p>Method specific parameter fitting</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first last simple">
<li><strong>data</strong> – training time series data</li>
<li><strong>kwargs</strong> – Method specific parameters</li>
</ul>
</td>
</tr>
</tbody>
</table>
</dd></dl>
</dd></dl>
</div>
<div class="section" id="module-pyFTS.models.chen">
<span id="pyfts-models-chen-module"></span><h2>pyFTS.models.chen module<a class="headerlink" href="#module-pyFTS.models.chen" title="Permalink to this headline">¶</a></h2>
<p>First Order Conventional Fuzzy Time Series by Chen (1996)</p>
<p>S.-M. Chen, “Forecasting enrollments based on fuzzy time series,” Fuzzy Sets Syst., vol. 81, no. 3, pp. 311–319, 1996.</p>
<dl class="class">
<dt id="pyFTS.models.chen.ConventionalFLRG">
<em class="property">class </em><code class="descclassname">pyFTS.models.chen.</code><code class="descname">ConventionalFLRG</code><span class="sig-paren">(</span><em>LHS</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.chen.ConventionalFLRG" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.flrg.FLRG" title="pyFTS.common.flrg.FLRG"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.flrg.FLRG</span></code></a></p>
<p>First Order Conventional Fuzzy Logical Relationship Group</p>
<dl class="method">
<dt id="pyFTS.models.chen.ConventionalFLRG.append_rhs">
<code class="descname">append_rhs</code><span class="sig-paren">(</span><em>c</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.chen.ConventionalFLRG.append_rhs" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.chen.ConventionalFLRG.get_key">
<code class="descname">get_key</code><span class="sig-paren">(</span><em>sets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.chen.ConventionalFLRG.get_key" title="Permalink to this definition">¶</a></dt>
<dd><p>Returns a unique identifier for this FLRG</p>
</dd></dl>
</dd></dl>
<dl class="class">
<dt id="pyFTS.models.chen.ConventionalFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.chen.</code><code class="descname">ConventionalFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.chen.ConventionalFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.fts.FTS" title="pyFTS.common.fts.FTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.fts.FTS</span></code></a></p>
<p>Conventional Fuzzy Time Series</p>
<dl class="method">
<dt id="pyFTS.models.chen.ConventionalFTS.forecast">
<code class="descname">forecast</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.chen.ConventionalFTS.forecast" title="Permalink to this definition">¶</a></dt>
<dd><p>Point forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted values</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.chen.ConventionalFTS.generate_flrg">
<code class="descname">generate_flrg</code><span class="sig-paren">(</span><em>flrs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.chen.ConventionalFTS.generate_flrg" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.chen.ConventionalFTS.train">
<code class="descname">train</code><span class="sig-paren">(</span><em>data</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.chen.ConventionalFTS.train" title="Permalink to this definition">¶</a></dt>
<dd><p>Method specific parameter fitting</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first last simple">
<li><strong>data</strong> – training time series data</li>
<li><strong>kwargs</strong> – Method specific parameters</li>
</ul>
</td>
</tr>
</tbody>
</table>
</dd></dl>
</dd></dl>
</div>
<div class="section" id="module-pyFTS.models.yu">
<span id="pyfts-models-yu-module"></span><h2>pyFTS.models.yu module<a class="headerlink" href="#module-pyFTS.models.yu" title="Permalink to this headline">¶</a></h2>
<p>First Order Weighted Fuzzy Time Series by Yu(2005)</p>
<p>H.-K. Yu, “Weighted fuzzy time series models for TAIEX forecasting,”
Phys. A Stat. Mech. its Appl., vol. 349, no. 3, pp. 609–624, 2005.</p>
<dl class="class">
<dt id="pyFTS.models.yu.WeightedFLRG">
<em class="property">class </em><code class="descclassname">pyFTS.models.yu.</code><code class="descname">WeightedFLRG</code><span class="sig-paren">(</span><em>LHS</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.yu.WeightedFLRG" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.flrg.FLRG" title="pyFTS.common.flrg.FLRG"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.flrg.FLRG</span></code></a></p>
<p>First Order Weighted Fuzzy Logical Relationship Group</p>
<dl class="method">
<dt id="pyFTS.models.yu.WeightedFLRG.append_rhs">
<code class="descname">append_rhs</code><span class="sig-paren">(</span><em>c</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.yu.WeightedFLRG.append_rhs" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.yu.WeightedFLRG.weights">
<code class="descname">weights</code><span class="sig-paren">(</span><em>sets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.yu.WeightedFLRG.weights" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
<dl class="class">
<dt id="pyFTS.models.yu.WeightedFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.yu.</code><code class="descname">WeightedFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.yu.WeightedFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.fts.FTS" title="pyFTS.common.fts.FTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.fts.FTS</span></code></a></p>
<p>First Order Weighted Fuzzy Time Series</p>
<dl class="method">
<dt id="pyFTS.models.yu.WeightedFTS.forecast">
<code class="descname">forecast</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.yu.WeightedFTS.forecast" title="Permalink to this definition">¶</a></dt>
<dd><p>Point forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted values</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.yu.WeightedFTS.generate_FLRG">
<code class="descname">generate_FLRG</code><span class="sig-paren">(</span><em>flrs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.yu.WeightedFTS.generate_FLRG" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.yu.WeightedFTS.train">
<code class="descname">train</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.yu.WeightedFTS.train" title="Permalink to this definition">¶</a></dt>
<dd><p>Method specific parameter fitting</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first last simple">
<li><strong>data</strong> – training time series data</li>
<li><strong>kwargs</strong> – Method specific parameters</li>
</ul>
</td>
</tr>
</tbody>
</table>
</dd></dl>
</dd></dl>
</div>
<div class="section" id="module-pyFTS.models.cheng">
<span id="pyfts-models-cheng-module"></span><h2>pyFTS.models.cheng module<a class="headerlink" href="#module-pyFTS.models.cheng" title="Permalink to this headline">¶</a></h2>
<p>Trend Weighted Fuzzy Time Series by Cheng, Chen and Wu (2009)</p>
<p>C.-H. Cheng, Y.-S. Chen, and Y.-L. Wu, “Forecasting innovation diffusion of products using trend-weighted fuzzy time-series model,”
Expert Syst. Appl., vol. 36, no. 2, pp. 1826–1832, 2009.</p>
<dl class="class">
<dt id="pyFTS.models.cheng.TrendWeightedFLRG">
<em class="property">class </em><code class="descclassname">pyFTS.models.cheng.</code><code class="descname">TrendWeightedFLRG</code><span class="sig-paren">(</span><em>LHS</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.cheng.TrendWeightedFLRG" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="#pyFTS.models.yu.WeightedFLRG" title="pyFTS.models.yu.WeightedFLRG"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.models.yu.WeightedFLRG</span></code></a></p>
<p>First Order Trend Weighted Fuzzy Logical Relationship Group</p>
<dl class="method">
<dt id="pyFTS.models.cheng.TrendWeightedFLRG.weights">
<code class="descname">weights</code><span class="sig-paren">(</span><em>sets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.cheng.TrendWeightedFLRG.weights" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
<dl class="class">
<dt id="pyFTS.models.cheng.TrendWeightedFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.cheng.</code><code class="descname">TrendWeightedFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.cheng.TrendWeightedFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="#pyFTS.models.yu.WeightedFTS" title="pyFTS.models.yu.WeightedFTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.models.yu.WeightedFTS</span></code></a></p>
<p>First Order Trend Weighted Fuzzy Time Series</p>
<dl class="method">
<dt id="pyFTS.models.cheng.TrendWeightedFTS.generate_FLRG">
<code class="descname">generate_FLRG</code><span class="sig-paren">(</span><em>flrs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.cheng.TrendWeightedFTS.generate_FLRG" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
</div>
<div class="section" id="module-pyFTS.models.hofts">
<span id="pyfts-models-hofts-module"></span><h2>pyFTS.models.hofts module<a class="headerlink" href="#module-pyFTS.models.hofts" title="Permalink to this headline">¶</a></h2>
<p>High Order FTS</p>
<p>Severiano, S. A. Jr; Silva, P. C. L.; Sadaei, H. J.; Guimarães, F. G. Very Short-term Solar Forecasting
using Fuzzy Time Series. 2017 IEEE International Conference on Fuzzy Systems. DOI10.1109/FUZZ-IEEE.2017.8015732</p>
<dl class="class">
<dt id="pyFTS.models.hofts.HighOrderFLRG">
<em class="property">class </em><code class="descclassname">pyFTS.models.hofts.</code><code class="descname">HighOrderFLRG</code><span class="sig-paren">(</span><em>order</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.HighOrderFLRG" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.flrg.FLRG" title="pyFTS.common.flrg.FLRG"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.flrg.FLRG</span></code></a></p>
<p>Conventional High Order Fuzzy Logical Relationship Group</p>
<dl class="method">
<dt id="pyFTS.models.hofts.HighOrderFLRG.append_lhs">
<code class="descname">append_lhs</code><span class="sig-paren">(</span><em>c</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.HighOrderFLRG.append_lhs" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.HighOrderFLRG.append_rhs">
<code class="descname">append_rhs</code><span class="sig-paren">(</span><em>c</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.HighOrderFLRG.append_rhs" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
<dl class="class">
<dt id="pyFTS.models.hofts.HighOrderFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.hofts.</code><code class="descname">HighOrderFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.HighOrderFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.fts.FTS" title="pyFTS.common.fts.FTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.fts.FTS</span></code></a></p>
<p>Conventional High Order Fuzzy Time Series</p>
<dl class="method">
<dt id="pyFTS.models.hofts.HighOrderFTS.configure_lags">
<code class="descname">configure_lags</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.HighOrderFTS.configure_lags" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.HighOrderFTS.forecast">
<code class="descname">forecast</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.HighOrderFTS.forecast" title="Permalink to this definition">¶</a></dt>
<dd><p>Point forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted values</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.HighOrderFTS.generate_flrg">
<code class="descname">generate_flrg</code><span class="sig-paren">(</span><em>data</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.HighOrderFTS.generate_flrg" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.HighOrderFTS.generate_flrg_fuzzyfied">
<code class="descname">generate_flrg_fuzzyfied</code><span class="sig-paren">(</span><em>data</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.HighOrderFTS.generate_flrg_fuzzyfied" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.HighOrderFTS.generate_lhs_flrg">
<code class="descname">generate_lhs_flrg</code><span class="sig-paren">(</span><em>sample</em>, <em>explain=False</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.HighOrderFTS.generate_lhs_flrg" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.HighOrderFTS.generate_lhs_flrg_fuzzyfied">
<code class="descname">generate_lhs_flrg_fuzzyfied</code><span class="sig-paren">(</span><em>sample</em>, <em>explain=False</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.HighOrderFTS.generate_lhs_flrg_fuzzyfied" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.HighOrderFTS.train">
<code class="descname">train</code><span class="sig-paren">(</span><em>data</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.HighOrderFTS.train" title="Permalink to this definition">¶</a></dt>
<dd><p>Method specific parameter fitting</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first last simple">
<li><strong>data</strong> – training time series data</li>
<li><strong>kwargs</strong> – Method specific parameters</li>
</ul>
</td>
</tr>
</tbody>
</table>
</dd></dl>
</dd></dl>
<dl class="class">
<dt id="pyFTS.models.hofts.WeightedHighOrderFLRG">
<em class="property">class </em><code class="descclassname">pyFTS.models.hofts.</code><code class="descname">WeightedHighOrderFLRG</code><span class="sig-paren">(</span><em>order</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.WeightedHighOrderFLRG" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.flrg.FLRG" title="pyFTS.common.flrg.FLRG"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.flrg.FLRG</span></code></a></p>
<p>Weighted High Order Fuzzy Logical Relationship Group</p>
<dl class="method">
<dt id="pyFTS.models.hofts.WeightedHighOrderFLRG.append_lhs">
<code class="descname">append_lhs</code><span class="sig-paren">(</span><em>c</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.WeightedHighOrderFLRG.append_lhs" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.WeightedHighOrderFLRG.append_rhs">
<code class="descname">append_rhs</code><span class="sig-paren">(</span><em>fset</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.WeightedHighOrderFLRG.append_rhs" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.WeightedHighOrderFLRG.get_lower">
<code class="descname">get_lower</code><span class="sig-paren">(</span><em>sets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.WeightedHighOrderFLRG.get_lower" title="Permalink to this definition">¶</a></dt>
<dd><p>Returns the lower bound value for the RHS fuzzy sets</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><strong>sets</strong> – fuzzy sets</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body">lower bound value</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.WeightedHighOrderFLRG.get_midpoint">
<code class="descname">get_midpoint</code><span class="sig-paren">(</span><em>sets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.WeightedHighOrderFLRG.get_midpoint" title="Permalink to this definition">¶</a></dt>
<dd><p>Returns the midpoint value for the RHS fuzzy sets</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><strong>sets</strong> – fuzzy sets</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body">the midpoint value</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.WeightedHighOrderFLRG.get_upper">
<code class="descname">get_upper</code><span class="sig-paren">(</span><em>sets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.WeightedHighOrderFLRG.get_upper" title="Permalink to this definition">¶</a></dt>
<dd><p>Returns the upper bound value for the RHS fuzzy sets</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><strong>sets</strong> – fuzzy sets</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body">upper bound value</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.hofts.WeightedHighOrderFLRG.weights">
<code class="descname">weights</code><span class="sig-paren">(</span><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.WeightedHighOrderFLRG.weights" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
<dl class="class">
<dt id="pyFTS.models.hofts.WeightedHighOrderFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.hofts.</code><code class="descname">WeightedHighOrderFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.WeightedHighOrderFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="#pyFTS.models.hofts.HighOrderFTS" title="pyFTS.models.hofts.HighOrderFTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.models.hofts.HighOrderFTS</span></code></a></p>
<p>Weighted High Order Fuzzy Time Series</p>
<dl class="method">
<dt id="pyFTS.models.hofts.WeightedHighOrderFTS.generate_lhs_flrg_fuzzyfied">
<code class="descname">generate_lhs_flrg_fuzzyfied</code><span class="sig-paren">(</span><em>sample</em>, <em>explain=False</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hofts.WeightedHighOrderFTS.generate_lhs_flrg_fuzzyfied" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
</div>
<div class="section" id="module-pyFTS.models.hwang">
<span id="pyfts-models-hwang-module"></span><h2>pyFTS.models.hwang module<a class="headerlink" href="#module-pyFTS.models.hwang" title="Permalink to this headline">¶</a></h2>
<p>High Order Fuzzy Time Series by Hwang, Chen and Lee (1998)</p>
<p>Jeng-Ren Hwang, Shyi-Ming Chen, and Chia-Hoang Lee, “Handling forecasting problems using fuzzy time series,”
Fuzzy Sets Syst., no. 100, pp. 217–228, 1998.</p>
<dl class="class">
<dt id="pyFTS.models.hwang.HighOrderFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.hwang.</code><code class="descname">HighOrderFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hwang.HighOrderFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.fts.FTS" title="pyFTS.common.fts.FTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.fts.FTS</span></code></a></p>
<dl class="method">
<dt id="pyFTS.models.hwang.HighOrderFTS.configure_lags">
<code class="descname">configure_lags</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hwang.HighOrderFTS.configure_lags" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.hwang.HighOrderFTS.forecast">
<code class="descname">forecast</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hwang.HighOrderFTS.forecast" title="Permalink to this definition">¶</a></dt>
<dd><p>Point forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted values</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.hwang.HighOrderFTS.train">
<code class="descname">train</code><span class="sig-paren">(</span><em>data</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.hwang.HighOrderFTS.train" title="Permalink to this definition">¶</a></dt>
<dd><p>Method specific parameter fitting</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first last simple">
<li><strong>data</strong> – training time series data</li>
<li><strong>kwargs</strong> – Method specific parameters</li>
</ul>
</td>
</tr>
</tbody>
</table>
</dd></dl>
</dd></dl>
</div>
<div class="section" id="module-pyFTS.models.ifts">
<span id="pyfts-models-ifts-module"></span><h2>pyFTS.models.ifts module<a class="headerlink" href="#module-pyFTS.models.ifts" title="Permalink to this headline">¶</a></h2>
<p>High Order Interval Fuzzy Time Series</p>
<p>SILVA, Petrônio CL; SADAEI, Hossein Javedani; GUIMARÃES, Frederico Gadelha. Interval Forecasting with Fuzzy Time Series.
In: Computational Intelligence (SSCI), 2016 IEEE Symposium Series on. IEEE, 2016. p. 1-8.</p>
<dl class="class">
<dt id="pyFTS.models.ifts.IntervalFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.ifts.</code><code class="descname">IntervalFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.IntervalFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="#pyFTS.models.hofts.HighOrderFTS" title="pyFTS.models.hofts.HighOrderFTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.models.hofts.HighOrderFTS</span></code></a></p>
<p>High Order Interval Fuzzy Time Series</p>
<dl class="method">
<dt id="pyFTS.models.ifts.IntervalFTS.forecast_ahead_interval">
<code class="descname">forecast_ahead_interval</code><span class="sig-paren">(</span><em>data</em>, <em>steps</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.IntervalFTS.forecast_ahead_interval" title="Permalink to this definition">¶</a></dt>
<dd><p>Interval forecast n steps ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>steps</strong> – the number of steps ahead to forecast</li>
<li><strong>start_at</strong> – in the multi step forecasting, the index of the data where to start forecasting (default: 0)</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted intervals</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.ifts.IntervalFTS.forecast_interval">
<code class="descname">forecast_interval</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.IntervalFTS.forecast_interval" title="Permalink to this definition">¶</a></dt>
<dd><p>Interval forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the prediction intervals</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.ifts.IntervalFTS.get_lower">
<code class="descname">get_lower</code><span class="sig-paren">(</span><em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.IntervalFTS.get_lower" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.ifts.IntervalFTS.get_sequence_membership">
<code class="descname">get_sequence_membership</code><span class="sig-paren">(</span><em>data</em>, <em>fuzzySets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.IntervalFTS.get_sequence_membership" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.ifts.IntervalFTS.get_upper">
<code class="descname">get_upper</code><span class="sig-paren">(</span><em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.IntervalFTS.get_upper" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
<dl class="class">
<dt id="pyFTS.models.ifts.WeightedIntervalFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.ifts.</code><code class="descname">WeightedIntervalFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.WeightedIntervalFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="#pyFTS.models.hofts.WeightedHighOrderFTS" title="pyFTS.models.hofts.WeightedHighOrderFTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.models.hofts.WeightedHighOrderFTS</span></code></a></p>
<p>Weighted High Order Interval Fuzzy Time Series</p>
<dl class="method">
<dt id="pyFTS.models.ifts.WeightedIntervalFTS.forecast_ahead_interval">
<code class="descname">forecast_ahead_interval</code><span class="sig-paren">(</span><em>data</em>, <em>steps</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.WeightedIntervalFTS.forecast_ahead_interval" title="Permalink to this definition">¶</a></dt>
<dd><p>Interval forecast n steps ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>steps</strong> – the number of steps ahead to forecast</li>
<li><strong>start_at</strong> – in the multi step forecasting, the index of the data where to start forecasting (default: 0)</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted intervals</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.ifts.WeightedIntervalFTS.forecast_interval">
<code class="descname">forecast_interval</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.WeightedIntervalFTS.forecast_interval" title="Permalink to this definition">¶</a></dt>
<dd><p>Interval forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the prediction intervals</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.ifts.WeightedIntervalFTS.get_lower">
<code class="descname">get_lower</code><span class="sig-paren">(</span><em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.WeightedIntervalFTS.get_lower" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.ifts.WeightedIntervalFTS.get_sequence_membership">
<code class="descname">get_sequence_membership</code><span class="sig-paren">(</span><em>data</em>, <em>fuzzySets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.WeightedIntervalFTS.get_sequence_membership" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.ifts.WeightedIntervalFTS.get_upper">
<code class="descname">get_upper</code><span class="sig-paren">(</span><em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ifts.WeightedIntervalFTS.get_upper" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
</div>
<div class="section" id="module-pyFTS.models.ismailefendi">
<span id="pyfts-models-ismailefendi-module"></span><h2>pyFTS.models.ismailefendi module<a class="headerlink" href="#module-pyFTS.models.ismailefendi" title="Permalink to this headline">¶</a></h2>
<p>First Order Improved Weighted Fuzzy Time Series by Efendi, Ismail and Deris (2013)</p>
<p>R. Efendi, Z. Ismail, and M. M. Deris, “Improved weight Fuzzy Time Series as used in the exchange rates forecasting of
US Dollar to Ringgit Malaysia,” Int. J. Comput. Intell. Appl., vol. 12, no. 1, p. 1350005, 2013.</p>
<dl class="class">
<dt id="pyFTS.models.ismailefendi.ImprovedWeightedFLRG">
<em class="property">class </em><code class="descclassname">pyFTS.models.ismailefendi.</code><code class="descname">ImprovedWeightedFLRG</code><span class="sig-paren">(</span><em>LHS</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ismailefendi.ImprovedWeightedFLRG" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.flrg.FLRG" title="pyFTS.common.flrg.FLRG"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.flrg.FLRG</span></code></a></p>
<p>First Order Improved Weighted Fuzzy Logical Relationship Group</p>
<dl class="method">
<dt id="pyFTS.models.ismailefendi.ImprovedWeightedFLRG.append_rhs">
<code class="descname">append_rhs</code><span class="sig-paren">(</span><em>c</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ismailefendi.ImprovedWeightedFLRG.append_rhs" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.ismailefendi.ImprovedWeightedFLRG.weights">
<code class="descname">weights</code><span class="sig-paren">(</span><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ismailefendi.ImprovedWeightedFLRG.weights" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
<dl class="class">
<dt id="pyFTS.models.ismailefendi.ImprovedWeightedFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.ismailefendi.</code><code class="descname">ImprovedWeightedFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ismailefendi.ImprovedWeightedFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.fts.FTS" title="pyFTS.common.fts.FTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.fts.FTS</span></code></a></p>
<p>First Order Improved Weighted Fuzzy Time Series</p>
<dl class="method">
<dt id="pyFTS.models.ismailefendi.ImprovedWeightedFTS.forecast">
<code class="descname">forecast</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ismailefendi.ImprovedWeightedFTS.forecast" title="Permalink to this definition">¶</a></dt>
<dd><p>Point forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted values</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.ismailefendi.ImprovedWeightedFTS.generate_flrg">
<code class="descname">generate_flrg</code><span class="sig-paren">(</span><em>flrs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ismailefendi.ImprovedWeightedFTS.generate_flrg" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.ismailefendi.ImprovedWeightedFTS.train">
<code class="descname">train</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.ismailefendi.ImprovedWeightedFTS.train" title="Permalink to this definition">¶</a></dt>
<dd><p>Method specific parameter fitting</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first last simple">
<li><strong>data</strong> – training time series data</li>
<li><strong>kwargs</strong> – Method specific parameters</li>
</ul>
</td>
</tr>
</tbody>
</table>
</dd></dl>
</dd></dl>
</div>
<div class="section" id="module-pyFTS.models.pwfts">
<span id="pyfts-models-pwfts-module"></span><h2>pyFTS.models.pwfts module<a class="headerlink" href="#module-pyFTS.models.pwfts" title="Permalink to this headline">¶</a></h2>
<dl class="class">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFLRG">
<em class="property">class </em><code class="descclassname">pyFTS.models.pwfts.</code><code class="descname">ProbabilisticWeightedFLRG</code><span class="sig-paren">(</span><em>order</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFLRG" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="#pyFTS.models.hofts.HighOrderFLRG" title="pyFTS.models.hofts.HighOrderFLRG"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.models.hofts.HighOrderFLRG</span></code></a></p>
<p>High Order Probabilistic Weighted Fuzzy Logical Relationship Group</p>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFLRG.append_rhs">
<code class="descname">append_rhs</code><span class="sig-paren">(</span><em>c</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFLRG.append_rhs" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFLRG.get_lower">
<code class="descname">get_lower</code><span class="sig-paren">(</span><em>sets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFLRG.get_lower" title="Permalink to this definition">¶</a></dt>
<dd><p>Returns the lower bound value for the RHS fuzzy sets</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><strong>sets</strong> – fuzzy sets</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body">lower bound value</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFLRG.get_membership">
<code class="descname">get_membership</code><span class="sig-paren">(</span><em>data</em>, <em>sets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFLRG.get_membership" title="Permalink to this definition">¶</a></dt>
<dd><p>Returns the membership value of the FLRG for the input data</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – input data</li>
<li><strong>sets</strong> – fuzzy sets</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">the membership value</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFLRG.get_midpoint">
<code class="descname">get_midpoint</code><span class="sig-paren">(</span><em>sets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFLRG.get_midpoint" title="Permalink to this definition">¶</a></dt>
<dd><p>Return the expectation of the PWFLRG, the weighted sum</p>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFLRG.get_upper">
<code class="descname">get_upper</code><span class="sig-paren">(</span><em>sets</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFLRG.get_upper" title="Permalink to this definition">¶</a></dt>
<dd><p>Returns the upper bound value for the RHS fuzzy sets</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><strong>sets</strong> – fuzzy sets</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body">upper bound value</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFLRG.lhs_conditional_probability">
<code class="descname">lhs_conditional_probability</code><span class="sig-paren">(</span><em>x</em>, <em>sets</em>, <em>norm</em>, <em>uod</em>, <em>nbins</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFLRG.lhs_conditional_probability" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFLRG.lhs_conditional_probability_fuzzyfied">
<code class="descname">lhs_conditional_probability_fuzzyfied</code><span class="sig-paren">(</span><em>lhs_mv</em>, <em>sets</em>, <em>norm</em>, <em>uod</em>, <em>nbins</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFLRG.lhs_conditional_probability_fuzzyfied" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFLRG.partition_function">
<code class="descname">partition_function</code><span class="sig-paren">(</span><em>sets</em>, <em>uod</em>, <em>nbins=100</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFLRG.partition_function" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFLRG.rhs_conditional_probability">
<code class="descname">rhs_conditional_probability</code><span class="sig-paren">(</span><em>x</em>, <em>sets</em>, <em>uod</em>, <em>nbins</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFLRG.rhs_conditional_probability" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFLRG.rhs_unconditional_probability">
<code class="descname">rhs_unconditional_probability</code><span class="sig-paren">(</span><em>c</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFLRG.rhs_unconditional_probability" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
<dl class="class">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.pwfts.</code><code class="descname">ProbabilisticWeightedFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="#pyFTS.models.ifts.IntervalFTS" title="pyFTS.models.ifts.IntervalFTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.models.ifts.IntervalFTS</span></code></a></p>
<p>High Order Probabilistic Weighted Fuzzy Time Series</p>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.add_new_PWFLGR">
<code class="descname">add_new_PWFLGR</code><span class="sig-paren">(</span><em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.add_new_PWFLGR" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.flrg_lhs_conditional_probability">
<code class="descname">flrg_lhs_conditional_probability</code><span class="sig-paren">(</span><em>x</em>, <em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.flrg_lhs_conditional_probability" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.flrg_lhs_conditional_probability_fuzzyfied">
<code class="descname">flrg_lhs_conditional_probability_fuzzyfied</code><span class="sig-paren">(</span><em>x</em>, <em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.flrg_lhs_conditional_probability_fuzzyfied" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.flrg_lhs_unconditional_probability">
<code class="descname">flrg_lhs_unconditional_probability</code><span class="sig-paren">(</span><em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.flrg_lhs_unconditional_probability" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.flrg_rhs_conditional_probability">
<code class="descname">flrg_rhs_conditional_probability</code><span class="sig-paren">(</span><em>x</em>, <em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.flrg_rhs_conditional_probability" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast">
<code class="descname">forecast</code><span class="sig-paren">(</span><em>data</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast" title="Permalink to this definition">¶</a></dt>
<dd><p>Point forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted values</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_ahead">
<code class="descname">forecast_ahead</code><span class="sig-paren">(</span><em>data</em>, <em>steps</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_ahead" title="Permalink to this definition">¶</a></dt>
<dd><p>Point forecast n steps ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>steps</strong> – the number of steps ahead to forecast (default: 1)</li>
<li><strong>start_at</strong> – in the multi step forecasting, the index of the data where to start forecasting (default: 0)</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted values</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_ahead_distribution">
<code class="descname">forecast_ahead_distribution</code><span class="sig-paren">(</span><em>ndata</em>, <em>steps</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_ahead_distribution" title="Permalink to this definition">¶</a></dt>
<dd><p>Probabilistic forecast n steps ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>steps</strong> – the number of steps ahead to forecast</li>
<li><strong>start_at</strong> – in the multi step forecasting, the index of the data where to start forecasting (default: 0)</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted Probability Distributions</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_ahead_interval">
<code class="descname">forecast_ahead_interval</code><span class="sig-paren">(</span><em>data</em>, <em>steps</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_ahead_interval" title="Permalink to this definition">¶</a></dt>
<dd><p>Interval forecast n steps ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>steps</strong> – the number of steps ahead to forecast</li>
<li><strong>start_at</strong> – in the multi step forecasting, the index of the data where to start forecasting (default: 0)</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted intervals</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_distribution">
<code class="descname">forecast_distribution</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_distribution" title="Permalink to this definition">¶</a></dt>
<dd><p>Probabilistic forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with probabilistic.ProbabilityDistribution objects representing the forecasted Probability Distributions</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_distribution_from_distribution">
<code class="descname">forecast_distribution_from_distribution</code><span class="sig-paren">(</span><em>previous_dist</em>, <em>smooth</em>, <em>uod</em>, <em>bins</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_distribution_from_distribution" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_interval">
<code class="descname">forecast_interval</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.forecast_interval" title="Permalink to this definition">¶</a></dt>
<dd><p>Interval forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the prediction intervals</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.generate_flrg">
<code class="descname">generate_flrg</code><span class="sig-paren">(</span><em>data</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.generate_flrg" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.generate_flrg2">
<code class="descname">generate_flrg2</code><span class="sig-paren">(</span><em>data</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.generate_flrg2" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.generate_flrg_fuzzyfied">
<code class="descname">generate_flrg_fuzzyfied</code><span class="sig-paren">(</span><em>data</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.generate_flrg_fuzzyfied" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.generate_lhs_flrg">
<code class="descname">generate_lhs_flrg</code><span class="sig-paren">(</span><em>sample</em>, <em>explain=False</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.generate_lhs_flrg" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.generate_lhs_flrg_fuzzyfied">
<code class="descname">generate_lhs_flrg_fuzzyfied</code><span class="sig-paren">(</span><em>sample</em>, <em>explain=False</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.generate_lhs_flrg_fuzzyfied" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.get_lower">
<code class="descname">get_lower</code><span class="sig-paren">(</span><em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.get_lower" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.get_midpoint">
<code class="descname">get_midpoint</code><span class="sig-paren">(</span><em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.get_midpoint" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.get_sets_from_both_fuzzyfication">
<code class="descname">get_sets_from_both_fuzzyfication</code><span class="sig-paren">(</span><em>sample</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.get_sets_from_both_fuzzyfication" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.get_upper">
<code class="descname">get_upper</code><span class="sig-paren">(</span><em>flrg</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.get_upper" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.interval_heuristic">
<code class="descname">interval_heuristic</code><span class="sig-paren">(</span><em>sample</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.interval_heuristic" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.interval_quantile">
<code class="descname">interval_quantile</code><span class="sig-paren">(</span><em>ndata</em>, <em>alpha</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.interval_quantile" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.point_expected_value">
<code class="descname">point_expected_value</code><span class="sig-paren">(</span><em>sample</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.point_expected_value" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.point_heuristic">
<code class="descname">point_heuristic</code><span class="sig-paren">(</span><em>sample</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.point_heuristic" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.pwflrg_lhs_memberhip_fuzzyfied">
<code class="descname">pwflrg_lhs_memberhip_fuzzyfied</code><span class="sig-paren">(</span><em>flrg</em>, <em>sample</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.pwflrg_lhs_memberhip_fuzzyfied" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.train">
<code class="descname">train</code><span class="sig-paren">(</span><em>data</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.train" title="Permalink to this definition">¶</a></dt>
<dd><p>Method specific parameter fitting</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first last simple">
<li><strong>data</strong> – training time series data</li>
<li><strong>kwargs</strong> – Method specific parameters</li>
</ul>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.pwfts.ProbabilisticWeightedFTS.update_model">
<code class="descname">update_model</code><span class="sig-paren">(</span><em>data</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.ProbabilisticWeightedFTS.update_model" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
<dl class="function">
<dt id="pyFTS.models.pwfts.visualize_distributions">
<code class="descclassname">pyFTS.models.pwfts.</code><code class="descname">visualize_distributions</code><span class="sig-paren">(</span><em>model</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.pwfts.visualize_distributions" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</div>
<div class="section" id="module-pyFTS.models.sadaei">
<span id="pyfts-models-sadaei-module"></span><h2>pyFTS.models.sadaei module<a class="headerlink" href="#module-pyFTS.models.sadaei" title="Permalink to this headline">¶</a></h2>
<p>First Order Exponentialy Weighted Fuzzy Time Series by Sadaei et al. (2013)</p>
<p>H. J. Sadaei, R. Enayatifar, A. H. Abdullah, and A. Gani, “Short-term load forecasting using a hybrid model with a
refined exponentially weighted fuzzy time series and an improved harmony search,” Int. J. Electr. Power Energy Syst., vol. 62, no. from 2005, pp. 118–129, 2014.</p>
<dl class="class">
<dt id="pyFTS.models.sadaei.ExponentialyWeightedFLRG">
<em class="property">class </em><code class="descclassname">pyFTS.models.sadaei.</code><code class="descname">ExponentialyWeightedFLRG</code><span class="sig-paren">(</span><em>LHS</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.sadaei.ExponentialyWeightedFLRG" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.flrg.FLRG" title="pyFTS.common.flrg.FLRG"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.flrg.FLRG</span></code></a></p>
<p>First Order Exponentialy Weighted Fuzzy Logical Relationship Group</p>
<dl class="method">
<dt id="pyFTS.models.sadaei.ExponentialyWeightedFLRG.append_rhs">
<code class="descname">append_rhs</code><span class="sig-paren">(</span><em>c</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.sadaei.ExponentialyWeightedFLRG.append_rhs" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.sadaei.ExponentialyWeightedFLRG.weights">
<code class="descname">weights</code><span class="sig-paren">(</span><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.sadaei.ExponentialyWeightedFLRG.weights" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
</dd></dl>
<dl class="class">
<dt id="pyFTS.models.sadaei.ExponentialyWeightedFTS">
<em class="property">class </em><code class="descclassname">pyFTS.models.sadaei.</code><code class="descname">ExponentialyWeightedFTS</code><span class="sig-paren">(</span><em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.sadaei.ExponentialyWeightedFTS" title="Permalink to this definition">¶</a></dt>
<dd><p>Bases: <a class="reference internal" href="pyFTS.common.html#pyFTS.common.fts.FTS" title="pyFTS.common.fts.FTS"><code class="xref py py-class docutils literal notranslate"><span class="pre">pyFTS.common.fts.FTS</span></code></a></p>
<p>First Order Exponentialy Weighted Fuzzy Time Series</p>
<dl class="method">
<dt id="pyFTS.models.sadaei.ExponentialyWeightedFTS.forecast">
<code class="descname">forecast</code><span class="sig-paren">(</span><em>ndata</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.sadaei.ExponentialyWeightedFTS.forecast" title="Permalink to this definition">¶</a></dt>
<dd><p>Point forecast one step ahead</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first simple">
<li><strong>data</strong> – time series data with the minimal length equal to the max_lag of the model</li>
<li><strong>kwargs</strong> – model specific parameters</li>
</ul>
</td>
</tr>
<tr class="field-even field"><th class="field-name">Returns:</th><td class="field-body"><p class="first last">a list with the forecasted values</p>
</td>
</tr>
</tbody>
</table>
</dd></dl>
<dl class="method">
<dt id="pyFTS.models.sadaei.ExponentialyWeightedFTS.generate_flrg">
<code class="descname">generate_flrg</code><span class="sig-paren">(</span><em>flrs</em>, <em>c</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.sadaei.ExponentialyWeightedFTS.generate_flrg" title="Permalink to this definition">¶</a></dt>
<dd></dd></dl>
<dl class="method">
<dt id="pyFTS.models.sadaei.ExponentialyWeightedFTS.train">
<code class="descname">train</code><span class="sig-paren">(</span><em>data</em>, <em>**kwargs</em><span class="sig-paren">)</span><a class="headerlink" href="#pyFTS.models.sadaei.ExponentialyWeightedFTS.train" title="Permalink to this definition">¶</a></dt>
<dd><p>Method specific parameter fitting</p>
<table class="docutils field-list" frame="void" rules="none">
<col class="field-name" />
<col class="field-body" />
<tbody valign="top">
<tr class="field-odd field"><th class="field-name">Parameters:</th><td class="field-body"><ul class="first last simple">
<li><strong>data</strong> – training time series data</li>
<li><strong>kwargs</strong> – Method specific parameters</li>
</ul>
</td>
</tr>
</tbody>
</table>
</dd></dl>
</dd></dl>
</div>
</div>
</div>
</div>
</div>
<div class="clearer"></div>
</div>
<div class="related" role="navigation" aria-label="related navigation">
<h3>Navigation</h3>
<ul>
<li class="right" style="margin-right: 10px">
<a href="genindex.html" title="General Index"
>index</a></li>
<li class="right" >
<a href="py-modindex.html" title="Python Module Index"
>modules</a> |</li>
<li class="right" >
<a href="pyFTS.models.ensemble.html" title="pyFTS.models.ensemble package"
>next</a> |</li>
<li class="right" >
<a href="pyFTS.hyperparam.html" title="pyFTS.hyperparam package"
>previous</a> |</li>
<li class="nav-item nav-item-0"><a href="index.html">pyFTS 1.6 documentation</a> »</li>
<li class="nav-item nav-item-1"><a href="modules.html" >pyFTS</a> »</li>
<li class="nav-item nav-item-2"><a href="pyFTS.html" >pyFTS package</a> »</li>
</ul>
</div>
<div class="footer" role="contentinfo">
© Copyright 2018, Machine Intelligence and Data Science Laboratory - UFMG - Brazil.
Created using <a href="http://sphinx-doc.org/">Sphinx</a> 1.7.2.
</div>
</body>
</html> |
Conan O'Brien to host "Carson On TCM"
Starting in July, Conan will host a weekly show delving into five Johnny Carson interviews. Conan did get to speak with Johnny in 2004, the year before Carson died, soon after Conan was announced as the next "Tonight Show" host.
Norman Weiss has been doing TV Tattle since the week "Freaks and Geeks" was canceled. He is a Hollywood outsider who was born and raised in Hollywood. "American Idol" and "Dancing with the Stars" are broadcast 2 blocks from his high school. |
2011 All Stars match
The 2011 All Stars Match was the second of the annual representative exhibition match played between the Indigenous All Stars and the NRL All Stars which was held on the 12 of February 2011 at the Gold Coast's Skilled Park. The game was won by the NRL All Stars 28–12, claiming their first annual title. Canberra Raiders fullback Josh Dugan won the Preston Campbell medal for Man of the Match.
Preceding game included a Women's All Stars exhibition match which was won by the NRL Women's All Stars 22-6.
Teams
1 - Greg Inglis was originally selected but withdrew due to injury. He was replaced by Beau Champion.
2 - Sam Thaiday was originally selected but withdrew due to injury. He was replaced by Cory Paterson whilst Joel Moon joined the interchange.
3 - Gareth Ellis was originally selected but withdrew due to injury. He was replaced by Liam Fulton.
4 - Preston Campbell was originally selected but withdrew due to injury. He was replaced by Matt Bowen whilst Anthony Mitchell joined the interchange. Johnathan Thurston was handed the captaincy title from Campbell.
Result
Women's All Stars match
The 2011 Women's All Stars Match was the first time the event was held.
Women's Teams
References
All Stars match
Category:Rugby league on the Gold Coast, Queensland
Category:NRL All Stars match |
752 S.W.2d 661 (1988)
SECURITY STATE BANK, Appellant,
v.
VALLEY WIDE ELECTRIC SUPPLY COMPANY, INC. and J.L.D. Construction Company, Appellees.
No. 13-87-216-CV.
Court of Appeals of Texas, Corpus Christi.
May 26, 1988.
Rehearing Denied June 23, 1988.
*663 Ralph L. Alexander, Edinburg, Russell McMains, Corpus Christi, for appellant.
W. Michael Fisher, Jeffrey D. Roerig, Brownsville, Stephen M. Gano, Houston, for appellees.
Before SEERDEN, UTTER, and BENAVIDES, JJ.
OPINION
SEERDEN, Justice.
Appellees sued appellant for fraud and misrepresentation, conversion, and breach of contract. Pursuant to a jury verdict, the trial court entered judgment in favor of Valley Wide Electric Supply Co., Inc. (Valley Wide), for $70,000.00 actual damages and $50,000.00 exemplary damages, and in favor of J.L.D. Construction Co. (Drennan) for $75,000.00 actual damages and $150,000.00 *664 exemplary damages. Each received prejudgment interest and attorney's fees. Appellant raises eleven points of error. We modify and, as modified, affirm the trial court's judgment.
Drennan was the general contractor for a construction project at Progreso High School. A subcontract for the electrical work was awarded to Jay Sweeney, d/b/a Sweeney Electric Co. (Sweeney). Sweeney contracted for materials with Valley Wide. Sweeney was already indebted to the bank, and after the transaction described below the bank extended further credit to Sweeney.
The bank, through Paul Moxley, its executive vice-president, wrote a letter to Valley Wide, with a copy to Drennan, which stated:
Security State Bank has agreed to extend credit to Mr. John J. Sweeney d/b/a Sweeney Electric Company, and has accepted the assignment of his contract with the Drennan Company as collateral.
It is our understanding that Mr. Sweeney has entered into a contract with the Drennan Company for materials totalling approximately $175,000.00.
The Drennan Company will submit their checks for services jointly to Security State Bank and Sweeney Electric Company. Your billing to Sweeney Electric should be current and payable within 30 days. Please advise me immediately if the account exceeds the 30 day period. Sweeney Electric will present your invoice to me for payment, which will be made by Cashier's Check for the invoice amount.
Please notify me if the arrangement is not suitable or if we can be of further assistance in regards to this account.
By point one, appellant claims that the trial court erred in awarding appellees judgment based on a theory of conversion, contending that money or "funds" may not be the subject of conversion unless specifically identified. Appellant also argues that the trial court erred for the same reason when it denied its Motion for a New Trial, Motion to Disregard Findings, Motion for Judgment, and Reply to Motion filed by Plaintiffs, and granted Plaintiff's Motion to Disregard Jury Findings and Motion to Disregard Findings on Special Issues and for Additional Express Findings.
In response to Special Issues 9, 10 and 11, the jury found that the bank knew that Drennan intended for the bank to use part of the funds Drennan paid to pay Valley Wide's invoices, that it used "such part of the fund" for some other purpose, and that this use was willful, intentional, and without just cause or excuse, or with a conscious indifference to, or in reckless disregard of, the rights and welfare of parties affected by the use of those funds.
Appellant does not challenge the sufficiency of the evidence to support these jury findings. Moxley testified that the funds from the checks Drennan issued for the Progreso job were earmarked to be used, at least in part, to pay Valley Wide. However, the funds were applied to Sweeney's overdrafts and to servicing Sweeney's debt to the bank, and Valley Wide was not paid.
A bank which has notice of the trust character of funds may not use those funds to offset a depositor's debt. Steere v. Stockyards National Bank, 113 Tex. 387, 256 S.W. 586, 591 (Comm'n App.1923, opin. adopted); Allied Bank West Loop, N.A. v. C.B.D. & Associates, Inc., 728 S.W.2d 49, 58 (Tex.App.Houston [1st Dist.] 1987, writ ref'd n.r.e.); First National Bank v. Winkler, 146 S.W.2d 201, 205 (Tex.Civ.App. Austin 1940), aff'd, 161 S.W.2d 1053 (Tex.Comm'n App.1942, opin. adopted).
The bank claims that it was impossible to determine what amount of Drennan's check was intended for Valley Wide, and points out that the checks themselves did not specify any part that was for Valley Wide. No evidence indicates that the bank attempted to determine the amount. Valley Wide sent invoices to Sweeney, whose account was in overdraft during the time Valley Wide was not being paid. Moxley testified that he approved all of Sweeney's expenditures daily, and that the bank had records of the payments made. Moxley testified that since Sweeney was unable to *665 make payments without bank approval, the bank was able to obtain the invoices from Sweeney.
By sending the invoices to Sweeney, Valley Wide was conforming to the arrangement Moxley described in his letter. The evidence shows that the bank not only had actual knowledge that funds intended for Valley Wide would be in the account, but that the bank instigated the arrangement.
Money can be converted if a bank, with knowledge of its trust character, applies it to reduce a debt to the bank. Houston National Bank v. Biber, 613 S.W.2d 771, 774-75 (Tex.Civ.App.Houston [14th Dist.] 1981, writ ref'd n.r.e.). In this case, the money was to pay for specific expenses. When a person has designated a particular use for proceeds from a check, those proceeds count as "specific money" capable of conversion. Southwest Industries Investment Co. v. Berkeley House Investors, 695 S.W.2d 615, 617 (Tex.App. Dallas 1985, writ ref'd n.r.e.).
Moreover, it is the bank's duty to segregate the funds in a mixed account before applying any to overdrafts. Steere, 256 S.W.2d at 591; see also City State Bank v. National Bank of Commerce, 261 S.W.2d 749, 752 (Tex.Civ.App.Fort Worth 1953, writ ref'd n.r.e.).
The bank also argues that appellees failed to obtain a jury finding of a fiduciary agreement or trust arrangement. If the jury finds one or more elements of a ground of recovery, but another element is omitted from the issues submitted, and factually sufficient evidence would support a finding on the element, the judge may make the finding. If the judge makes no written findings, the omitted element is deemed found in support of the judgment. Tex.R.Civ.P. 279.
When one person delivers money to another for a specific purpose, the person accepting the money becomes a trustee and the transaction becomes a trust. City State Bank, 261 S.W.2d at 752; First National Bank v. Slaton Independent School District, 58 S.W.2d 870, 873 (Tex. Civ.App.Amarillo 1933, writ dism'd).
Evidence supporting the trust character of part of the money includes the bank's letter and Moxley's testimony that he knew part of the funds were earmarked for a specific purpose.
Appellant's reply brief also contends that appellee did not adequately plead conversion and was not entitled to submit Issues 9 and 10 or to recover on theories of conversion or of wrongful offset. We have found no objection to the charge based on a lack of pleadings. Thus, appellant waived any right to complain. See Ortiz v. O.J. Beck & Sons, 611 S.W.2d 860, 867 (Tex.Civ.App.Corpus Christi 1980, no writ). We overrule point one.
By point three, appellant attacks any recovery on appellees' contract theory, contending that the trial court erred in setting aside the jury's findings on Issues 2 and 3. Responding to Issue 1, the jury found that the bank had agreed to pay Valley Wide as Sweeney's account became due if Drennan made its checks to both the bank and Sweeney. To Issue 2, the jury answered that the bank's agreement was conditioned on Sweeney's submitting Valley Wide's invoices to the bank, and to Issue 3, it answered that Sweeney did not submit the invoices.
Appellees properly objected to the submission of Issue 2 on the grounds that the contract is in evidence and is clear, unambiguous, and, as a matter of law, not conditioned on Sweeney's submitting invoices.
Ambiguity in a contract is a question of law. A fact issue is not created unless the court finds that the contract is ambiguous after applying pertinent rules of construction. Walker v. Horine, 695 S.W.2d 572, 577 (Tex.App.Corpus Christi 1985, no writ); O'Shea v. Coronado Transmission Co., 656 S.W.2d 557, 561 (Tex.App. Corpus Christi 1983, writ ref'd n.r.e.). If the contract can be given a certain definite legal meaning or interpretation, then it is not ambiguous and the court will construe it as a matter of law. Coker v. Coker, 650 S.W.2d 391, 393 (Tex.1983); Corriveau v. 3005 Investment Corp., 697 S.W.2d 766, 767 (Tex.App.Corpus Christi 1985, writ ref'd n.r.e.). The court will limit its search *666 for the intent of the parties to the intent expressed within the four corners of a document. Smith v. Liddell, 367 S.W.2d 662, 666 (Tex.1963); Walker, 695 S.W.2d at 577.
Appellant argues that it was not obligated to pay Valley Wide, contending that the words, "Sweeney will submit your invoices to me for payment," created a condition, and the condition was not met.
While no particular words are necessary to create a condition, terms like "if," "provided that," "on condition that," or a similar phrase usually connote an intent for a condition rather than a promise. In the absence of such a limiting clause, to ascertain whether a certain contractual provision is a condition, rather than a promise, one must look to the contract as a whole and the intent of the parties. Temple-Eastex, Inc. v. Addison Bank, 672 S.W.2d 793, 798 (Tex.1984); Hohenberg Brothers Co. v. George E. Gibbons & Co., 537 S.W.2d 1, 3 (Tex.1976); Gulf Construction Co. v. Self, 676 S.W.2d 624, 627 (Tex. App.Corpus Christi 1984, writ ref'd n.r. e.). The language of a contract will not be construed as creating a condition precedent if another reading of that language is possible. Powers v. Powers, 714 S.W.2d 384, 388 (Tex.App.Corpus Christi 1986, no writ). Courts will not declare a forfeiture unless they are compelled to do so by language which can be construed in no other way. Reilly v. Rangers Management, Inc., 727 S.W.2d 527, 530 (Tex.1987); Gulf Construction, 676 S.W.2d at 627-28.
In Texas, a writing is generally construed most strictly against its author. Temple-Eastex, 672 S.W.2d at 798; Gulf Construction, 676 S.W.2d at 628. Moreover, where a condition would impose an absurd or impossible result, the agreement will be interpreted as creating a covenant rather than a condition. Hohenberg, 537 S.W.2d at 3; Gulf Construction, 676 S.W. 2d at 627.
Moxley admitted that he composed the letter, and that he could compel delivery of the invoices. Since the contract was not ambiguous, the trial court properly disregarded Issue 2, and Issue 3 became irrelevant. We overrule point three.
By point nine, appellant argues that the trial court erred in allowing Stephen Gano to testify to the contents of a written document over an objection that the testimony violated the best evidence rule.
The best evidence rule applies only where the purpose of the evidence is to prove the contents of the writing. Raymond v. Aquarius Condominium Owners Association, Inc., 662 S.W.2d 82, 92 (Tex. App.Corpus Christi 1983, no writ).
The record shows that Stephen Gano testified that Moxley called in response to a letter Gano had sent Moxley, to clarify things mentioned in the letter. Appellees' attorney asked Gano to tell the contents of the conversation. Gano began, "I had written a letter on May 30th to Paul Moxley, which basically said that we were agreeable to making checks jointly to the bank on certain conditions." Appellant's attorney objected, the court overruled the objection, and Gano continued. No further objection was made when Gano described the condition and then the conversation.
The admission or exclusion of evidence is reversible error only if it was error which was harmful and calculated to cause, and probably did cause, the rendition of an improper judgment. Howard v. Faberge, Inc., 679 S.W.2d 644, 647 (Tex.App.Houston [1st Dist.] 1984, writ ref'd n.r.e.); Tex. R.Civ.P. 81. Any error in the admission of evidence is harmless if that evidence is merely cumulative of evidence to which no objection was made. Richardson v. Green, 677 S.W.2d 497, 501 (Tex.1984); Baker Marine Corp. v. Herrera, 704 S.W. 2d 58, 62 (Tex.App.Corpus Christi 1985, writ ref'd n.r.e.).
Subsequently, appellant's counsel also inquired about the contents of the letter. He then asked appellees to produce it. During recess, appellees located the letter in the bank's files and tendered it to appellant's counsel, who did not admit it into evidence. Finally, appellant elicited testimony from its witness, Moxley, on the contents of the letter. Thus, any error in admitting the *667 testimony rather than the letter itself was harmless. We overrule point nine.
By points seven and eight, appellant challenges the legal and factual sufficiency of the evidence to support the damage awards to Drennan and to Valley Wide.
There is evidence that Drennan paid Valley Wide $68,551.04 which should have been paid to Valley Wide out of Drennan's checks to Sweeney and the bank. Additionally, Stephen Gano of Drennan testified that the bank's failure to pay Valley Wide caused delays which cost Drennan an additional $6,000. This totals $74,551.04. Valley Wide requested $65,554.99, which is supported by plaintiff's exhibit 3, a tally of its invoices minus the money Drennan paid directly. Thus, the awards are excessive.
However, we do not need to disregard the jury's findings on Issues 12 and 13, as appellant suggests. We will modify the judgment to show awards in the amounts the evidence supports. Tex.R.App.P. 80.
Appellant challenges the award of exemplary damages by points four, five, and six. Point four claims the trial court erred in the award, contending that appellee has no valid cause of action giving rise to actual damages upon which exemplary damages may be predicted. Under point one, we upheld the award of damages for wrongful offset and conversion of trust funds. This tort gives rise to actual damages and will support exemplary damages. Accent Builders Co. v. Southwest Concrete Systems, Inc., 679 S.W.2d 106, 111 (Tex.App.Dallas 1984, writ ref'd n.r.e.); First Security Bank & Trust v. Roach, 493 S.W.2d 612, 618 (Tex.Civ.App.Dallas 1973, writ ref'd n.r.e.). We overrule point four.
Point five cites as error the submission of exemplary damage issues on behalf of each appellee. Appellant claims that any claim of Drennan's was solely derivative of Valley Wide's, and that by allowing the jury to assess exemplary damages both for Drennan and for Valley Wide, it permitted two punishments for a single action.
One aspect of appellant's complaint questions the bank's need to be punished for its action toward Drennan in addition to actions against Valley Wide. In assessing exemplary damages, the jury may consider the situation and sensibilities of the parties. Wright v. Gifford-Hill & Co., 725 S.W.2d 712, 714 (Tex.1987); Alamo National Bank v. Kraus, 616 S.W.2d 908, 910 (Tex.1981). Some of the evidence on which the jury may have based its awards includes evidence that the bank actively induced Drennan to pay it instead of paying Valley Wide directly, and by keeping Drennan's money, made Drennan liable to Valley Wide. Evidence showed that the bank also represented to the Small Business Association that it had a security interest in the contract from Drennan, which Drennan denied. There was also evidence that Drennan suffered expensive delays. While Drennan had to pay some bills twice, Valley Wide merely had to wait longer to be paid. There was also evidence that Valley Wide knew from the outset that Sweeney was not credit worthy, and was charging him extra to satisfy a previously unpaid balance. Drennan may have seen the bank's letter as an assurance. Given the impact of the bank's actions, the separate exemplary damage award to Drennan can be justified.
The other aspect of appellant's complaint under point of error number five is that the awards to separate plaintiffs is two punishments. A major concern of those disfavoring separate exemplary damage awards is that a defendant will be overpunished by different juries in successive suits. See Annot., 11 A.L.R. 4th 1261 (1982).
It appears the weight of authority rejects the argument that exemplary damages should be restricted to one plaintiff. In Texas, separate exemplary awards in the same case have gone unquestioned. See Alamo National Bank, 616 S.W.2d at 909, Kneip v. UnitedbankVictoria, 734 S.W. 2d 130, 134-35 (Tex.App.Corpus Christi 1987, no writ).
In this case, both plaintiffs were before the same jury, which was cognizant of the total award. The jury could apportion the *668 exemplary damages based on its view of the wrongfulness of the conduct toward each plaintiff. We overrule point five.
By point six, appellant urges reversal because Issues 16 and 17, which asked the amount of exemplary damages, were not conditionally submitted. It claims this was a comment on the weight of the evidence.
Issues 16 and 17 begin, "Find from a preponderance of the evidence what sum of money, if any, should be assessed ..." (emphasis added). Moreover, the instructions explain that the jury "may" award exemplary damages in addition to "any amount you may have found as actual damages." Thus, the jury was free to award nothing. We overrule point six.
By point eleven, appellant asserts that the exemplary damages awarded to Drennan are excessive.
There is no set rule or ratio between the amount of actual and exemplary damages which will be considered reasonable. This determination depends on the facts of each particular case. Alamo National Bank, 616 S.W.2d at 910; Delta Drilling Co. v. Cruz, 707 S.W.2d 660, 667 (Tex.App.Corpus Christi 1986, writ ref'd n.r.e.).
Factors in determining the reasonableness of an award of exemplary damages include the nature of the wrong, the character of the conduct involved, the degree of culpability of the wrongdoer, the situation and sensibilities of the parties, and the extent to which the conduct offends a public sense of justice and propriety. Wright, 725 S.W.2d at 714; Alamo National Bank, 616 S.W.2d at 910; Delta Drilling, 707 S.W.2d at 666.
Appellant has not demonstrated that the amount of the award is unreasonable in light of the circumstances, or that the jury was influenced by passion, prejudice, or improper motive. Having reviewed the whole record, we decline to substitute our judgment for that of the jury. We overrule point eleven.
Point ten challenges the award of attorney's fees to both Drennan and Valley Wide, claiming that they did not succeed on a cause of action upon which attorney's fees could be granted and that Drennan did not adduce evidence of the reasonableness of its attorney's fees.
Since appellees recovered on a contract cause, they may also receive attorney's fees. Tex.Civ.Prac. & Rem.Code § 38.001(8) (Vernon 1986). Moreover, Tex. Civ.Prac. & Rem.Code § 38.003 (Vernon 1986) supplies a presumption that the usual and customary attorney's fees are reasonable.
Stephen Gano testified that he, as Drennan's president, hired an attorney, and that the number of hours spent on the case were necessary, and that he, as an attorney, spent 96 hours and his co-counsel John Gano spent 50½ hours on the case. Marshall Ray testified that a reasonable rate in the area for lawyers doing litigation of the type in this suit was $100 an hour. Thus, the evidence would support $14,650 as Drennan's reasonable and necessary fees through trial, and $14,000 were awarded. We overrule point ten.
Having discussed the dispositive issues on appeal, we find it unnecessary to address appellant's second point of error. Tex.R.App.P. 90(a).
We MODIFY the judgment to award Drennan $74,551.04 and Valley Wide $65,554.99, order the prejudgment interest adjusted to reflect these awards, and, as modified, AFFIRM the trial court's judgment.
|
Introduction {#s1}
============
Serial thin sections of \<100 nm thickness have been used to visualize and reconstruct cellular and subcellular structures in the three-dimensional (3D) context from a wide variety of biological systems. Examples include, but are not limited to, Gram-negative bacteria [@pone.0059573-Cook1], yeast [@pone.0059573-Keddie1], algae [@pone.0059573-Osafune1], nematode [@pone.0059573-Jarrell1], lobster [@pone.0059573-Chiang1], frog [@pone.0059573-Thaemert1], mouse [@pone.0059573-Starborg1], rat [@pone.0059573-Bundgaard1]--[@pone.0059573-Spacek1], and human cells [@pone.0059573-Reichelt1]. In the central nervous system, serial section (ss) EM provides sufficient resolution to reveal cellular and subcellular structures within the three dimensional context of the surrounding neuropil, including dendrites, axons, and astroglial processes. In the last decade, ssEM has become widely recognized as a crucial tool to map and understand synaptic circuitry in the brain [@pone.0059573-Helmstaedter1]--[@pone.0059573-Briggman1].
Our laboratory and others have used ssEM to understand how the structure of synapses and neuropil is modified by experience and in models of learning and memory [@pone.0059573-Ostroff1]--[@pone.0059573-Bourne1] or under pathological conditions [@pone.0059573-Spacek2]--[@pone.0059573-Villalba1]. The results from these studies have provided fundamental insights into the anatomical substrates for changes in information processing and behavioral output. Both normal and pathological changes in neuronal morphology can involve subcellular structures such as, polyribosomes, microtubules, endosomes, dense core vesicles, and smooth endoplasmic reticulum, that require ssEM at nanoscale lateral resolution (\<2 nm per pixel in x--y) to be reliably identifiable. Although microtubules and other small organelles have been detected at lower image resolutions using other ssEM techniques (e.g., [@pone.0059573-Horstmann1], [@pone.0059573-Micheva1]), our experience is that reliable identification and quantification becomes difficult at lower resolutions [@pone.0059573-Ostroff1], [@pone.0059573-Bourne1], [@pone.0059573-CuiWang1], [@pone.0059573-Fiala2].
The ssEM approach with biological tissue has been implemented using transmission EM (TEM) on heavily en bloc and post-section stained specimens, because TEM affords the high lateral resolution required for the analysis of nanoscale subcellular structures. The tissue volume is generated by stacking and aligning the images of single or montaged fields across hundreds of serial ultrathin (∼45--70 nm) sections of plastic-embedded tissue on electron-transparent support films spanning slot grids [@pone.0059573-Harris1]. However, TEM imaging suffers from a relatively small individual field size (∼100 µm^2^, or 10 µm per side), and therefore requires montaging with substantial data redundancy and electron dosage to achieve large image volumes. Manual exchange of specimen grids also adds to the cumbersome nature of TEM imaging for large scale analyses even with automated montaging [@pone.0059573-Bock1], [@pone.0059573-Suloway1], [@pone.0059573-Saalfeld1].
Renewed interest in ssEM as a high-resolution 3D tool for neuroscience has led to improvements over the last decade in this otherwise time-, skill-, and labor-intensive approach [@pone.0059573-Briggman2], [@pone.0059573-Denk1]. Recent studies [@pone.0059573-Briggman1], [@pone.0059573-Knott1] have benefitted from newly developed methods based on an SEM platform using backscatter imaging from a tissue block surface that is successively removed by the diamond knife (serial block-face SEM, or SBFSEM; [@pone.0059573-Denk2]) or a focused ion beam (FIB-SEM; [@pone.0059573-Cantoni1], [@pone.0059573-Knott2]). Unfortunately, these approaches may not yield the level of lateral resolution or contrast necessary for unequivocal identification of the nanoscale subcellular structures as discussed above. Furthermore, these approaches are destructive, so that sections cannot be retrieved for subsequent viewing at higher resolution.
We sought to improve ssEM by increasing the size of single image fields, while maintaining the needed lateral resolution and image quality, and reducing operator time and instrument cost. These goals were achieved by imaging serial ultrathin sections with a transmitted electron detector mounted on a field-emission (FE) SEM [@pone.0059573-Mendenhall1], that we call "transmission-mode SEM" or "tSEM" to differentiate from scanning transmission EM based on a TEM platform commonly referred to as "STEM" [@pone.0059573-Postek1]. Transmission imaging in a SEM platform (sometimes referred to as "STEM-in-SEM") has long been in use [@pone.0059573-Bogner1], but image resolution was unsatisfactory when compared to TEM and large frame storage at high resolution was not possible. Recently, field emission sources have become more commonly available for SEM instruments, contributing to an increase in beam brightness and image resolution [@pone.0059573-Bogner1]. The use of "STEM-in-SEM" imaging was previously proposed for polymer characterization as a more practical and affordable alternative to TEM imaging (e.g., [@pone.0059573-Guise1]), although this prior approach lacked the large frame image acquisition. Our tSEM system has robust automated control of the specimen stage translation and electron beam scan dimension and rotation over large areas. The tSEM method is capable of acquiring single-frame images that can be more than 60 times larger than those taken with a TEM, while easily achieving the required 2 nm pixel size. In addition, tSEM imaging induces far less specimen drift and charging than the TEM, resulting in less physical distortion of the sections. Furthermore, the cost of this new system is substantially less than that of modern TEM or SEM-based ssEM systems (i.e., SBFSEM and FIB-SEM). We compare image quality between the new tSEM system and our modern TEM to analyze synapses and subcellular components as a basis for understanding synaptic connectivity and plasticity in the complex neuropil of the brain. The results show outstanding images that can be readily aligned using a new automated elastic alignment tool in TrakEM2 [@pone.0059573-Saalfeld2].
Materials and Methods {#s2}
=====================
Tissue Sample Preparation {#s2a}
-------------------------
All animal procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The animal protocols were approved by Institutional Animal Care and Use Committee of The University of Texas at Austin (protocol numbers: 06062801 and AUP-2010-00181) and the Otago University Animal Ethics Committee (protocol number: 115/09). Hippocampal dentate gyrus tissue was obtained from adult rats that were rapidly perfusion-fixed with 2% formaldehyde and 2.5% glutaraldehyde (both aldehydes from Ladd Research, Williston, VT) in 0.1 M cacodylate buffer (pH = 7.35--7.4) under halothane anesthesia and tracheal supply of oxygen. Hippocampal area CA1 tissue was obtained from an acute brain slice (350 µm thickness) prepared from a rat under isoflurane anesthesia. The acute slice was recovered in oxygenated artificial cerebrospinal fluid for 3 hr before being fixed with 2.5% formaldehyde and 6% glutaraldehyde in 0.1 M cacodylate buffer (pH = 7.4) in a microwave oven [@pone.0059573-Chitwood1]. The fixed tissue was then cut into slices (70 µm thickness) with a vibrating blade microtome (Leica Microsystems, Buffalo Grove, IL) and processed for electron microscopy as described previously [@pone.0059573-Harris1], [@pone.0059573-Kuwajima1]. Briefly, the tissue was treated with reduced osmium (1% osmium tetroxide and 1.5% potassium ferrocyanide in 0.1 M cacodylate buffer), followed by microwave-assisted incubation in 1% osmium tetroxide under vacuum. Then the tissue underwent microwave-assisted dehydration and *en bloc* staining with uranyl acetate in ascending concentrations of ethanol. The tissue was embedded into LX-112 epoxy resin (Ladd Research) at 60°C for 48 hr before being cut into series of ultrathin sections at the nominal thickness of 45 nm with a 35° diamond knife (DiATOME, Biel, Switzerland) on an ultramicrotome (Leica Microsystems). The thickness of 45 nm was chosen to minimize overlap among small organelles within individual ultrathin sections (e.g. small synaptic vesicles are ∼30 nm in diameter). The serial ultrathin sections were collected onto Synaptek® Be-Cu slot grids (Electron Microscopy Sciences, Hatfield, PA, or Ted Pella, Redding, CA) coated with Pioloform F (Ted Pella), and stained with a saturated aqueous solution of uranyl acetate followed by lead citrate [@pone.0059573-Reynolds1]. The SynapTek grids are thicker and more durable than TEM grids made only of Cu, and thus much less prone to damage even after handling multiple times. These specimens imaged at 28 kV, a relatively high accelerating voltage for SEM, displayed no charging and hence required no carbon coating or low vacuum operation. A typical series for our experiments consists of at least 200 serial sections collected on about 12 grids.
Serial Section EM Imaging {#s2b}
-------------------------
The serial ultrathin sections were imaged with either a JEOL JEM-1400 TEM (Tokyo, Japan) or a Zeiss SUPRA® 40 field-emission (FE) SEM (Oberkochen, Germany). The TEM is equipped with a charge coupled device (CCD) camera with the field size of 4,080×4,080 (or 16.65×10^6^) pixels (Gatan UltraScan 4000; Pleasanton, CA), controlled by DigitalMicrograph software (Gatan). For TEM, the slot grids containing serial ultrathin sections were loaded into grid cassettes that were individually loaded into a Gatan 650 CC specimen holder that allow the grid to be rotated inside the chamber. The holder accommodates one grid at a time, and requires manual exchange between grids. At 6,000×magnification at 2 nm pixel size with the accelerating voltage of 120 kV, serial section images were manually acquired as the Gatan proprietary.dm3 files, which were later batch converted into 8-bit JPEG files with DigitalMicrograph software. Conversion into JPEG was originally done to save space in our database. No practical differences in identification of key structures were found compared to the same.dm3 images converted into TIFF format.
The FE-SEM is equipped with a retractable multi-mode transmitted electron detector ("T" in [Fig. 1A](#pone-0059573-g001){ref-type="fig"}) and the integrated module called ATLAS™ ([A]{.ul}u[T]{.ul}omated [L]{.ul}arge [A]{.ul}rea [S]{.ul}canning; software version 3.5.2.385), which is a package of hardware and software designed to control scan generation, stage translation, and serial acquisition of large-field images ([Fig. 1A](#pone-0059573-g001){ref-type="fig"}). Multiple TEM grids containing serial sections were loaded into a single specimen holder ([Fig. 1B, C](#pone-0059573-g001){ref-type="fig"}). The "Zeiss Multi-Mode" transmitted electron detector is composed of the center aperture and four quadrants ([Fig. 1D](#pone-0059573-g001){ref-type="fig"}); for tSEM imaging, the imaging mode was set to 'normal' (for bright field detection behind the central aperture) and 'inverted' (for dark field), respectively. For serial tSEM imaging, the center of the region of interest was marked manually on each section throughout the entire series using the ATLAS system ([Fig. 1E](#pone-0059573-g001){ref-type="fig"}); for 200 serial sections this process took less than a half day. Then the ATLAS system automatically translated the stage, rotated the scan field if necessary, and acquired single-frame serial images (section-to-section and grid-to-grid) of up to 32,768×32,768 (or 1.07×10^9^) pixels with the transmitted electron detector at the pixel size of 2 nm (i.e., scan area = 4,295 µm^2^). The scan beam with a high brightness generated by the field-emission source is a critical component in achieving the level of lateral resolution demonstrated by this tSEM system. Pixel size can be adjusted depending on the operator's needs; however, the limits on image resolution (i.e., the smallest distance between two points that can be visualized) was about 1.5 nm based on our experience with this system. The scan beam was set for a dwell time of ∼1.3 µs, with the accelerating voltage of 28 kV in high-current mode. Focus and brightness were also adjusted automatically with ATLAS. The acquired serial images were saved as 8-bit TIFF files, although as noted in the Results, 16-bit TIFF files retained image quality in the brightened area where focus was obtained from multiple scans ([Fig. 1F](#pone-0059573-g001){ref-type="fig"}).
{#pone-0059573-g001}
If the size of each image field needs to be extended beyond 32,768×32,768 pixels, the operator can set up mosaics by specifying the target dimensions of the image field and the amount of overlap between image tiles. ATLAS then automatically determines the number of image tiles per field, based on the pixel size and the size of each image tile. For example, an image field of 360 µm wide×60 µm tall can be set up as a 6×1 mosaic of image tiles measuring 32,768×32,768 pixels each at 2 nm pixel size ([Fig. 1E](#pone-0059573-g001){ref-type="fig"}). The operator is required to mark only the center of mosaic field (\* in [Fig. 1E](#pone-0059573-g001){ref-type="fig"}), versus (\# in [Fig. 1E](#pone-0059573-g001){ref-type="fig"}) in the single-frame images. The ATLAS system can also be used to acquire large frame images with secondary detectors (on our system; [Fig. 1A](#pone-0059573-g001){ref-type="fig"}) or backscatter detectors (not on our system). On occasions where we needed lower magnification views of the overall grid or section (e.g., [Fig. 1E](#pone-0059573-g001){ref-type="fig"}), the specimens were imaged with secondary electron detectors mounted on the side of the chamber or inside the final lens (see [Fig. 1A](#pone-0059573-g001){ref-type="fig"}).
Serial EM images were aligned automatically using Fiji with the TrakEM2 plugin (<http://fiji.sc>, <http://www.ini.uzh.ch/~acardona/trakem2.html>) [@pone.0059573-Saalfeld2], [@pone.0059573-Cardona1], [@pone.0059573-Schindelin1]. The images were aligned rigidly first, followed by application of affine and then elastic alignment. TrakEM2 was also used to generate single images from mosaics of image tiles. The aligned series was then imported into RECONSTRUCT™ software (<http://synapses.clm.utexas.edu/>) [@pone.0059573-Fiala3] to compare images acquired by the two EM platforms.
For preparation of figure plates, brightness and contrast of EM images were adjusted with either Fiji or Adobe Photoshop CS4 Extended (San Jose, CA). The original image pixels were retained unless otherwise noted in figure captions. Images from distortion analysis (see below) were generated in Matlab (version R2011b; MathWorks, Natick, MA). Final figure plates were prepared with Adobe Illustrator CS4.
Image Distortion Analysis {#s2c}
-------------------------
We had hoped to use a carbon replica grating to compare high-order distortions in the TEM and tSEM; however, the tSEM scan field is much larger than the individual grid support window, within which the grating replica also revealed large scale wrinkles ([Fig. 2A](#pone-0059573-g002){ref-type="fig"}). Instead, we imaged an unused integrated circuit (IC) chip, which has a regular pattern and is etched onto a very stiff substrate and is therefore very flat. The substrate is electron opaque, which makes the IC ineligible for use in calibrating the TEM. In the tSEM, we may image it under the same conditions that we might use for transmission imaging, with the exception that we use a secondary electron detector ([Fig. 2B](#pone-0059573-g002){ref-type="fig"}). We wrote software in Matlab to measure the high-order geometric distortion due to imaging with an electron microscope (available from: <https://github.com/larrylindsey/MatlabCode/tags>). Unfortunately, we have no prior knowledge to guide our expectation of how the sample should appear. Visual inspection tells us that the pattern consists of squares that are regular over a parallelogram with an inner angle of approximately 60° ([Fig. 2C](#pone-0059573-g002){ref-type="fig"}). To estimate the imaging distortion, we found the imaged locations of the units of this pattern and compared them to their expected locations. A match kernel representing a single unit was selected manually from the image and used for normalized cross-correlation with the original image, resulting in a map in which local maxima represent the precise image locations of these repeated units ([Fig. 2D](#pone-0059573-g002){ref-type="fig"}). To extract the maxima, we perform a simple threshold ([Fig. 2E](#pone-0059573-g002){ref-type="fig"}). Thresholding is advantageous in that it is simple to implement, but may occasionally result in spurious detections. We correct for these and extract our model for the expected pattern at the same time using RANSAC ([RAN]{.ul}dom [SA]{.ul}mple [C]{.ul}onsensus) [@pone.0059573-Fischler1].
{#pone-0059573-g002}
For each detected location **x~i~** ([Fig. 2E](#pone-0059573-g002){ref-type="fig"}), we find the nearest neighbor, **x~i,r~** ([Fig. 2F](#pone-0059573-g002){ref-type="fig"}). We form a triplet by finding the point **x~i,l~** at as close to the expected angle and distance from **x~i,r~** about **x~i~** as possible. In the case of a rectangular pattern, this angle would be 90°, but in our case this is +60° or −120° ([Fig. 2G](#pone-0059573-g002){ref-type="fig"}). Without loss of generality, we may orient the triplet **\[x~i,l~, x~i~, x~i,r~\]** such that **x~i,l~** is offset in approximately the same direction (positively or negatively) from **x~i~** for each *i*, and similarly for **x~i,r~** ([Fig. 2H](#pone-0059573-g002){ref-type="fig"}). Now, the average sign corrected vectors **g~i,r~** = **x~i,r~** − **x~i~** and **g~i,l~** = **x~i,l~** − **x~i~** yield a potential model for the regular pattern that we refine using RANSAC.
For a given population, the RANSAC algorithm attempts to find the largest subpopulation that fits a given model as follows: first, a random sample of the original population is taken and a model is fit to it. Each remaining member of the original population is tentatively added to this consensus sample. If it fits the model to a given certainty, it is kept. The model that yields the largest consensus sample is said to be the correct one, and is said to fit its corresponding sample population. In our case, a sample is taken from the set of right and left offset vectors, **g~i,r~** and **g~i,l,~** corresponding to a single point, **x~i~**, taken at random. To calculate the certainty for any point **x~j~**, we find the neighbor closest to one of its four expected neighbor-locations given an exact fit to the model, **x~j~** ± **g~i,r~** and **x~j~** ± **g~i,l~**. The uncertainty is the distance between this neighbor and its expected location. The final model, consisting of **g~r~** and **g~l~,** is taken as the mean offset vector pair over the consensus set. Now, if we impose an exactly regular pattern on the sample, we would find the unit located at the *n*th column and *m*th row at an offset of *m* **g~r~**+*n* **g~l~** from the origin, where *m* and *n* are integers.
We select a detected location **x~i~** to assign to row 0 and column 0. Any location is as good as any other, so we may arbitrarily select **x~0~**. This location's neighbors are traversed and assigned to the appropriate column and row, and in turn the neighbors of those locations are traversed, and so on until each location has a row and column associated with it that is consistent with all of its neighbors. For example, the neighbor located at **x~0~**+ **g~r~** would be assigned to column 1, row 0, and **x~0~** - **g~l~**, if it exists, would be at column 0, row −1. Let the *c~r,i~* and *c~l,i~* represent the column and row coordinates for location **x~i~** respectively, then the expected "real" location for **x~i~** is **y~i~** = **x~0~**+ *c~r,I~* **g~r~**+*c~l,I~* **g~l~**. Now we have a set **{x~i~}** of measured locations and a set **{y~i~}** of expected locations. The overall distortion may be modeled as a function ***T***: **y~i~** → **x~i~**. Although it is not possible to know how accurate our idealized model is with respect to "shear" and "stretch," we can ignore this affine distortion because standard registration techniques are invariant to it. Let **{y'~i~}** be the result of affine alignment of **{y~i~}** to **{x~i~}**, then we take ***T***: **y'~i~** → **x~i~** to be the nonlinear distortion model for the tSEM.
Results {#s3}
=======
tSEM Image Quality is Comparable to TEM Images {#s3a}
----------------------------------------------
The new tSEM system accommodates specimens prepared in the same manner as for TEM. Compared to TEM, we observed qualitatively that the tSEM imaging was less prone to drift and shrinkage. The autofocus routine in tSEM repeatedly scans a small area in the center of the imaging field, which leads to greater brightening of the focus area compared to the rest of scan area ([Fig. 1F](#pone-0059573-g001){ref-type="fig"}). This brightening, however, does not cause loss of content; adjusting the brightness to the autofocus scan area and imaging in 16-bit mode retained the greyscale for later analysis of ultrastructure in this repeatedly scanned area ([Fig. 1F](#pone-0059573-g001){ref-type="fig"}2). [Figure 3](#pone-0059573-g003){ref-type="fig"} demonstrates the tSEM image quality is comparable to TEM, and is excellent for identification, 3D reconstruction, and analysis of subcellular structures.
{#pone-0059573-g003}
Scan and Lens Distortions were Negligible in the tSEM System {#s3b}
------------------------------------------------------------
Image distortions can affect calibration of pixel size and section thickness, which are critical steps in quantitative 3D analysis of tissue volumes. Pixel size was calibrated based on a grating replica image ([Fig. 2A](#pone-0059573-g002){ref-type="fig"} inset) that was imaged along with the serial section series. Section thickness is estimated with the cylindrical mitochondria method, which uses the ratio of the maximum diameter of longitudinally sectioned mitochondria (or other cylindrical objects) to the number of serial sections they span [@pone.0059573-Fiala4]. For our typical series acquired on either tSEM or TEM, the voxel size obtained through these methods is about 2 nm×2 nm×45 nm (x×y×z). This calibration is applied to the entire tissue volume for three-dimensional quantitative analysis of reconstructed neuropil and synapse structures (e.g., counting, lengths, area, volume, z-distances) that are sampled based on well-defined sets of structural criteria (see [Discussion](#s4){ref-type="sec"}).
Scan distortion was estimated using a bivariate polynomial model, created as described in the methods section. We calculated the transformed location for each pixel in the original image and measured the distance to its original location, after affine alignment. The root-mean-square (rms) of the distance measurements for the full 24,000×24,000 pixel field was found to be 9.68 pixels ([Fig. 4A](#pone-0059573-g004){ref-type="fig"}). This reduces drastically when the field is cropped to be similar to that obtained in the TEM. Over a 4,096×4,096 pixel field, we measured an rms distortion magnitude of only 0.19 pixels, which is negligible ([Fig. 4B](#pone-0059573-g004){ref-type="fig"}).
{#pone-0059573-g004}
Size of Single Image Fields in tSEM are much Greater than in TEM Cameras at the Same Pixel Size {#s3c}
-----------------------------------------------------------------------------------------------
The bottom mount CCD camera on our TEM obtains an image field of 4,080×4,080 pixels (i.e. ∼67 µm^2^ at 2 nm/pixel, obtained at 6,000 magnification), which is among the largest currently available. The conventional interface on a FE-SEM only obtains image fields of about 3,000×2,000 pixels (i.e. ∼28 µm^2^ at 2 nm/pixel); however, when integrated with the ATLAS system, the single tSEM image field can be at least 32,768×32,768 pixels (i.e. 4,295 µm^2^ at 2 nm/pixel). Thus, the tSEM readily images an area more than 60 times greater than the TEM ([Fig. 5](#pone-0059573-g005){ref-type="fig"}). The tSEM system with its large chamber and precise scan and stage control was used to automate acquisition of serial section images from these much larger field areas.
{#pone-0059573-g005}
The imaging field size of the tSEM can be extended further by automated montaging through the ATLAS system ([Figs. 1E](#pone-0059573-g001){ref-type="fig"} and [6A](#pone-0059573-g006){ref-type="fig"}). The montaging process in tSEM, by virtue of the larger field size, greatly reduces the total number of smaller images required and; hence, the total amount of edge-overlap than would be needed to produce a comparable montage area in TEM. It is possible now to take advantage of these automated acquisition and montaging capabilities in tSEM to photograph the entire face of much larger serial sections each ∼500 µm wide×\>100 µm high ([Figs. 1E](#pone-0059573-g001){ref-type="fig"} and [6A](#pone-0059573-g006){ref-type="fig"}), increased from ∼100 µm wide×30 µm high used in our previous studies [@pone.0059573-Harris1]. The much larger tSEM field sizes can be used to automatically photograph and montage tissue volumes comparable to a typical confocal image volume ([Fig. 6B](#pone-0059573-g006){ref-type="fig"}), with much greater resolution to identify and measure synapses and other key subcellular structures ([Fig. 3](#pone-0059573-g003){ref-type="fig"}).
![Field size comparison of images acquired on tSEM and two-photon laser-scanning microscope (2PLSM).\
A: A tSEM image containing a mosaic of 7 image tiles, from rat hippocampal area CA1, with the field size measuring 67 µm×399 µm. Overlaps between image tiles appear as lighter bands. Soma of the pyramidal neurons are indicated by "+". The original image tiles were taken as 10×1 mosaic covering 608 µm×65 µm area (32,768×32,768 pixels per tile at 2 nm pixel size), encompassing all layers in the area CA1 (SO = Stratum Oriens; SP = Stratum Pyramidale; SR = Stratum Radiatum; SL-M = Stratum Lacunosum Moleculare). The image tiles were stitched together with Fiji/TrakEM2, down-sampled to 223 nm pixel size, rotated 90°, and cropped to 303×1792 pixels (67 µm×399 µm) to scale with the image in B. B: A pyramidal neuron in the rat (10-week old) hippocampal area CA1 was filled with Alexa 594 dye (40 µM) with a patch pipette (\#). The original fluorescence image stack was acquired using laser tuned to 880 nm (Spectra Physics Mai Tai) on a 2PLSM (Leica SP 5 RS) with a 20× water immersion objective (N.A. = 1.0). Image field size was 1024×1024 pixels (455.88 µm×455.88 µm and 120 µm deep; 255 optical sections), which was then projected and cropped to 384×896 pixels (171 µm×399 µm). White box indicates calculated field for imaging with a 63× objective and 2× digital zoom (i.e., 455.88 µm/\[63/20\]/2 = 72.36 µm), which is on the order of single field size of a tSEM image. Scale bar is valid for both A and B. Image courtesy of R. Chitwood, Center for Learning and Memory, The University of Texas at Austin.](pone.0059573.g006){#pone-0059573-g006}
Reduced Operator Involvement for Image Acquisition with tSEM Compared to TEM ([Table 1](#pone-0059573-t001){ref-type="table"}) {#s3d}
------------------------------------------------------------------------------------------------------------------------------
In both TEM and tSEM, the total z-dimension of the imaged tissue volume is limited by the number of serial ultrathin sections obtained, which increases with operator skill. Collection of 200 serial sections is routine, and 1000 serial sections is possible for skilled operators, and about one day is required to prepare, cut and collect 200--1000 serial sections. For TEM, a single field image can be acquired rapidly (∼1 sec); however, there are many manual steps that multiply the operator time substantially and image acquisition across 200 serial sections requires several attended working **[days]{.ul}**. First, the operator must insert one or a few specimen grids at a time in the TEM, and then find, align and stabilize the field of interest before acquiring each image. Alignment during image acquisition is critical for the small TEM field sizes because even a slight shift in positioning from section to section, caused by drift or operator error, can substantially reduce the region of interest collected on adjacent sections, and hence the tissue volume available for subsequent 3D analysis. Thus, the operator time for manual serial image acquisition in TEM is proportional to the total number of images required to generate the volume of interest. Some systems have been developed to automate the grid loading (e.g., [@pone.0059573-Potter1] and Gatan Select 100™), but at present they still require a lot of operator attention. Even though automated TEM montaging (e.g., [@pone.0059573-Bock1], [@pone.0059573-Suloway1]) has helped to reduce operator time, the process of montaging has its own issues including: (1) montaging many small field images produces substantial data redundancy and requires significant computing time; (2) electron dosage is not evenly distributed during montaging and hence can result in non-uniform distortion, requiring further post-image processing to correct the distortions, and (3) manual exchange of specimen grids can add substantial operator time for TEM montaging across serial sections. The new tSEM overcomes these cumbersome features of montaging in TEM.
In addition, the grid exchanges are minimized in the new tSEM system because the current specimen holder accommodates up to 12 grids at a time (easily 200 serial sections) and there is certainly room for a larger holder in the chamber. The attended operation involves simply locating, adjusting scan rotation, and marking the center of the imaging field on each serial section, which takes several hours (not days) for 200 serial sections. The rest of the image acquisition process is automated for image focus and brightness optimization, acquisition, and stage translation from one field to the next. Since the fields are so large, slight shifts in positioning of the center mark do not dramatically affect the tissue volume available for subsequent 3D analysis. Furthermore, operator time remains constant even when montaging to enlarge the field because only the center of the entire field need be marked per section to guide the automated acquisition ([Fig. 1E](#pone-0059573-g001){ref-type="fig"}).
Image Artifacts are Balanced by Increased Image Area and Automated Elastic Alignment {#s3e}
------------------------------------------------------------------------------------
Because tSEM uses serial ultrathin sections to achieve the desired axial resolution, the same limitations of TEM apply regarding handling of fragile serial section ribbons and grids [@pone.0059573-Harris1]. A long ribbon of serial sections must be broken into shorter segments to fit them within the slot of a TEM grid. Sections must be supported on low-structure, electron transparent support film, such as Pioloform. Depending on the quality of the knife and skill of the operator, cutting forces can produce compression or knife marks and tears, settling of the sections on the film can produce folds, and sections can be lost, especially during ribbon breakup. These artifacts can interfere with accurate local alignment, making 3D reconstructions challenging or even impossible. Hence, in the past with a TEM, sections were first viewed through the entire series to find small regions where the fields could be imaged across serial sections while minimizing encounters with artifacts. The larger tSEM imaging field makes it harder to avoid these potential artifacts. The new elastic alignment tool in TrakEM2 [@pone.0059573-Saalfeld2] is much less sensitive to the section artifacts than prior alignment strategies, and provides accurate alignment across sections that would otherwise be distorted ([Movie S1](#pone.0059573.s001){ref-type="supplementary-material"}). Thus, the combination of automated image acquisition, afforded by the tSEM, and the enhanced elastic alignment tool, quickly provides much larger volumes for quantitative ultrastructural analysis.
The tSEM System Images More, yet is Simpler, Smaller and More Affordable than the TEM {#s3f}
-------------------------------------------------------------------------------------
[Table 1](#pone-0059573-t001){ref-type="table"} further summarizes the main characteristics of TEM and tSEM. The tSEM is similar to TEM in the methods used to process the tissue and maintains the minimum nanoscale resolution needed to recognize and measure subcellular elements of the neuropil. The tSEM instrument is simpler and smaller compared to the TEM, at least partly because it does not require an image-forming lens below the specimen and the vacuum requirement for tSEM at 28 kV is less stringent than for the TEM operating at 120 kV. Thus, the tSEM occupies a smaller floor space that readily fits in a standard laboratory. Fully outfitted, the tSEM system price is about half the cost of a TEM with a large-format CCD camera, making tSEM more affordable for new and established investigators.
10.1371/journal.pone.0059573.t001
###### Comparison of the new tSEM versus TEM systems.
{#pone-0059573-t001-1}
tSEM TEM
--------- --------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------ ----------------------------------------------------------------------------------------------------------------------------
Specimen holder multiple grids at a time usually one grid at a time (some special holders)
Illumination rastered probe entire image field
Accelerating voltage 28 kV 120 kV
Detection method transmitted electron detector CCD camera
Automation *Routine*: Stage translation, image optimization (focus, brightness, etc.), image acquisition, and mosaic. *Specialized*: Some modules for focus and astigmatism compensation, some mosaic functions.[b](#nt102){ref-type="table-fn"}
Usual operator involvement Identify center of image fields & set scan rotation on each section Repeated specimen exchange & stage translation, physical specimen rotation, image optimization & acquisition
Relative cost of instrument: ∼Half that of manual TEM
**(a)** Optimal pixel size (in x--y) for analysis 2 nm 2 nm
**(b)** Section thickness 45 nm 45 nm
Voxel size ( = **a**×**a**×**b**) 2 nm×2 nm×45 nm 2 nm×2 nm×45 nm
**(c)** Typical number of serial sections 200 200
**(d)** Maximum single field dimensions 32,768 pixels per side 4,080 pixels per side
**(e)** Maximum single image field dimensions ( = **a**×**d**) 65.54 µm per side 8.160 µm per side
**(f)** Maximum single image field area ( = **e**×**e**) 4,295 µm^2^ 66.59 µm^2^
**(g)** Volume of imaged tissue ( = **b**×**c**×**f**) 38,660 µm^3^ 599.3 µm^3^
Total number of voxels ( = **c**×**d**×**d**) 2.147×10^11^ voxels 3.329×10^9^ voxels
**(h)** Operator time to acquire single field image over 200 sections ∼4 hr (plus additional ∼74 hr for unattended image acquisition).[c](#nt103){ref-type="table-fn"} ∼40 hr.
Volume of imaged tissue per operator time ( = **g**/**h**) 9664 µm^3^/hr 14.98 µm^3^/hr
At the time of this writing, Zeiss is the sole source of the FE-SEM system designed for high-resolution large-field transmission imaging of biological samples as described here.
TEM can be retrofitted to acquire mosaic images automatically with open source software such as Leginon (National Resource for Automated Molecular Microscopy, The Scripps Research Institute; <http://www.leginon.org/>) and SerialEM (The Boulder Lab for 3D Electron Microscopy, University of Colorado; <http://bio3d.colorado.edu/SerialEM/>).
Note that the operator time for tSEM remains constant for the same number of serial sections, even when the volume size is increased by montaging.
Discussion {#s4}
==========
The new tSEM offers a cost-effective and labor-reducing approach to high-throughput ultrastructural imaging of biological specimens. It provides a high degree of automation that markedly reduces operator time during image acquisition while greatly increasing the size of the image fields and volumes without compromising image quality. The tissue volumes one can image with tSEM are comparable to those obtained through light microscopy, such as two-photon imaging, thereby providing a new and efficient platform to link live-imaging with ultrastructural analysis of underlying subcellular processes.
The tSEM system described here adds to a list of several new ssEM methods that have been developed recently to obtain dense volume reconstructions of brain neuropil in order to understand neural circuitry at the level of synaptic connections [@pone.0059573-Bock1], [@pone.0059573-Horstmann1], [@pone.0059573-Micheva1], [@pone.0059573-Denk2]--[@pone.0059573-Knott2]. Each of these new ssEM approaches has advantages and disadvantages relative to ssTEM. Some of the advantages include larger image field size, finer axial resolution, reduced section loss, reduced physical and optical distortion, and automation of serial sectioning, imaging, alignment, and segmentation (for more comprehensive comparisons, see [@pone.0059573-Denk2], [@pone.0059573-Briggman3]).
The use of non-destructive physical sectioning of the tissue for tSEM imaging has several advantages over the other SEM methods including: (1) The specimens can be archived for repeated tSEM imaging with larger field sizes or at higher resolutions. (2) The specimen can be used for high resolution post-embedding immunolabeling studies (fluorescent or gold) to localize molecules of interest in 3D (e.g., [@pone.0059573-Nuntagij1]). (3) The same specimen can be imaged with increased axial resolution by EM tomography to examine convoluted organelles buried within the thickness of a single ultrathin section, such as macromolecular complexes found, for example, in the presynaptic active zone (e.g., [@pone.0059573-Szule1]). (4) Transmission imaging through ultrathin sections achieves greater lateral resolution compared to the backscatter imaging methods discussed below. (5) Sections are amenable to post-section staining for increased contrast. (6) Good ultramicrotomes are reasonably priced and commonly available.
The main disadvantage of the tSEM approach is that it still involves collection of ultrathin sections requiring substantial operator skill. Difficulties of serial ultrathin sectioning include: (1) Generating a long continuous ribbon of serial ultrathin sections with uniform thickness. (2) Dividing the ribbon into shorter segments that fit on the slot grids. (3) Avoiding breakage or folds in the fragile electron transparent substrates used to fill the slot and support the sections. (4) Reducing compression due to contact with the diamond knife. (5) Achieving uniform section thickness and avoiding contamination from local environment or poor preparation of post-section heavy metal stains. We have published numerous methods to avoid or minimize these potential flaws in serial ultrathin sections [@pone.0059573-Harris1], [@pone.0059573-Kuwajima1]. Ultrathin sections supported on film materials such as polyimide and silicon nitride (e.g., [@pone.0059573-Ring1]) that are more rigid and/or stable might reduce folds, and decrease further the fragility of the support. Such materials may also allow for larger specimen windows, reducing the need to break up ribbons into smaller segments.
Recently, several SEM-based serial section systems have been developed that avoid mounting ultrathin sections on slot grids. Two of these are serial imaging methods that are freed of the constraint of retaining intact sections, as well as facilitating a larger total axial imaging dimension. In these systems, backscattered electrons are detected to image directly from the block face that is serially removed either by a focused ion beam (FIB-SEM) [@pone.0059573-Cantoni1], [@pone.0059573-Knott2] or a diamond knife inside the SEM chamber (SBFSEM) [@pone.0059573-Denk2]. Although FIB-SEM and SBSEM avoid ultrathin sectioning, the lateral resolution is currently lower than tSEM. Although microtubules and other small organelles have been detected in images acquired with FIB-SEM and SBFSEM [@pone.0059573-Denk2], [@pone.0059573-Cantoni1], our experience is that reliable identification and quantification, especially of microtubules, smooth-endoplasmic reticulum, and other small tubular structures in cross-section, becomes difficult or impossible at lower lateral resolutions [@pone.0059573-Ostroff1], [@pone.0059573-Bourne1], [@pone.0059573-CuiWang1], [@pone.0059573-Fiala2]. In addition, the image volumes obtained through FIB-SEM are currently too small to provide the circuit scale volumes achieved by the new tSEM system. Furthermore, the destructive nature of these block face imaging approaches does not allow for post-embedding immunolabeling, or for re-imaging of particular regions of interest at higher axial resolution through TEM tomography.
Low accelerating voltages are desirable for backscatter detection in that they improve lateral resolution, though at the expense of signal to noise ratio and dwell time. Another aspect of the backscatter imaging methods merits consideration: the depth of the tissue volume that interacts with the electron beam and emits the signal (i.e., backscattered electrons) depends on several parameters, including the accelerating voltage and the density of the tissue and stains. In the block face imaging methods, the signal depth does not always correspond with the thickness of the tissue removed by the knife or the FIB leaving open the possibility for oversampling from overlap of imaged tissue, or undersampling which would produce missing volumes where the amount of tissue removed is greater than that imaged on the block face. This potential for oversampling or undersampling of the tissue can affect quantitative analysis of small structures. In contrast, the projected images from the tSEM and TEM systems contain all of the objects, although some may be buried within the section depth. Since the sectioning and imaging in tSEM and TEM are non-destructive, re-examining small objects within the thickness of the sections can be done on the same grids using TEM tomography. In the future, it should be possible to exploit the robust control of stage, beam, and scan, as well as detector variety of tSEM to perform tomography [@pone.0059573-Veeraraghavan1] and improve axial resolution in the tSEM while performing large field imaging.
In other SEM-based backscatter imaging methods, serial ultrathin sections are collected on electron-opaque substrates, such as plastic tape (automatic tape collecting ultramicrotome or ATUM) [@pone.0059573-Hayworth1], carbon-coated glass coverslips (array tomography) [@pone.0059573-Micheva1], or silicon wafers (serial section scanning electron microscopy or S^3^EM) [@pone.0059573-Horstmann1]. In these applications, the issue of oversampling is mitigated by physical ultrathin sectioning of the tissue. However, lateral resolution may not be sufficient for the nanoscale analyses required for our studies. Specimen charging is known to affect lateral resolution in these low-voltage backscatter imaging methods, which may require additional carbon coating of the specimen (e.g., [@pone.0059573-Micheva1]). Charging can be reduced by the use of conductive silicon wafers [@pone.0059573-Horstmann1] or carbon-coated glass coverslips [@pone.0059573-Micheva1] as specimen substrate. A recently developed method for *en bloc* heavy metal staining also helps to reduce specimen charging by making the biological specimen more conductive for block face imaging with backscattered electrons [@pone.0059573-Tapia1]. As noted above (Methods), we have not experienced charging of ultrathin sections prepared in the same manner as for TEM when imaged with tSEM at relatively high voltage (28 kV).
With the tSEM system, we were able to increase substantially the size of single-frame images by montaging with minimal total overlap. Another approach to increase the size of the imaging field has used a custom-built TEM with an array of four CCD cameras (TEMCA) to acquire image mosaics rapidly across individual serial ultrathin sections [@pone.0059573-Bock1]. However, TEMCA requires substantial modification to the instrument (e.g., custom-built electron optics and camera systems) and specialized computational tools for image mosaicking and registration. Thus, the cost and limited availability of such a specialized custom-built system is prohibitive for most EM laboratories.
Concluding Remarks {#s5}
==================
This new tSEM system is based on the detection of transmitted electrons on the FE-SEM platform and offers a cost-effective and labor-reducing method to obtain tissue volumes on the order of 10^4^--10^5^ µm^3^. This volume range is suitable for reconstruction of local circuits, such as determining synaptic relationships between an interneuron and neighboring pyramidal cells, or the composition of synapses in the neuropil within the domain of a single astrocyte. This level of analysis provides the opportunity to investigate many aspects of synaptic development and plasticity, while maintaining sufficient resolution to investigate changes in local subcellular components indicative of modified functions. Obviously, this new tSEM approach is not limited to investigation of brain tissue, but is generally applicable to all biological specimens prepared for standard ultrastructural analyses. Further improvements in computational tools will greatly facilitate 3D reconstruction and investigation of these large volumes.
Supporting Information {#s6}
======================
######
**Serial tSEM images aligned with elastic alignment tool.** Here 201 serial section images were acquired from the rat dentate gyrus on tSEM at 16,384×16,384 pixels (2 nm/pixel), and aligned as described in Methods using Fiji/TrakEM2 software. The aligned images were then cropped to 12,830×6,861 pixels (25.66 µm×13.72 µm) and down-sampled to 1,920×799 pixels in Fiji/TrakEM2. The image histograms were adjusted using Fiji with the "Enhance Local Contrast (CLAHE)" plugin (<http://fiji.sc/wiki/index.php/Enhance_Local_Contrast_%28CLAHE%29>) before this movie (7 frames/sec) was generated. This movie demonstrates the effectiveness of the elastic alignment tool, where the presence of various section artifacts (e.g., folds and staining artifacts) does not affect the alignment of artifact-free regions across large serial tSEM images.
(ZIP)
######
Click here for additional data file.
We thank John Yorston (Carl Zeiss) and Ken Lagarec (Fibics, Ottawa, Canada) for their help with the tSEM instrumentation. We thank Stephan Saalfeld (Max Planck Institute for Molecular Cell Biology and Genetics, Dresden, Germany) for help with the triplet model design used with RANSAC. Jared Bowden (The University of Texas at Austin) and Cliff Abraham (University of Otago, New Zealand) provided the hippocampal dentate tissue (Figs. 1E, 1F, 3, and 5). Acute slice tissue from the hippocampal area CA1 (Fig. 6A) was provided by Randy Chitwood and Heather Smith (The University of Texas at Austin). Randy Chitwood also provided the 2PLSM image in Fig. 6B.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
[^2]: Designed and wrote the software used in image distortion analysis: LFL. Conceived and designed the experiments: JMM LFL KMH. Performed the experiments: MK JMM LFL KMH. Analyzed the data: MK JMM LFL KMH. Contributed reagents/materials/analysis tools: MK JMM LFL KMH. Wrote the paper: MK JMM LFL KMH.
|
DD Chat
It's all the rage these days.
Chat, one of DD Tech add-ons, gives you a clear advantage in servicing your clients when both customers and users might be working from anywhere. |
Q:
vim-snipmate not expanding non-source code file
I am using snipmate for coding and it works fine.
However I would also like to use it on txt file extension, but this does not work at all.
Is it designed to work like that? How can I get snippet expansion on ad-hoc file types?
A:
*.txt files have the text filetype but you probably don't have snippets for that filetype. You can create them in ~/.vim/snippets/text.snippets and do the same for every filetype for which you don't have snippets.
Note that the snippets in ~/.vim/snippets/_.snippets are "global" and thus available in any filetype.
If you want to expand JavaScript snippets in an HTML file, you can "combine" filetypes with :set ft=html.javascript.
|
More like this
Nokia gets the upper hand in global IPR wrestle with Qualcomm
Battle not over, but...
Comment While we are not saying that the long-running battle between Nokia and Qualcomm is actually over - anything but - there are signs that Nokia’s position is a lot stronger than many observers first thought.
Last week, the International Trade Commission said it would not review its earlier decision that Nokia did not infringe three Qualcomm patents, and now a UK High court has confirmed that many of the patents by which Qualcomm demands royalties for GSM technology are not valid.
Nokia has either sued or counter claimed in the US, UK, Germany, France, Italy, the Netherlands, and China, and so far it has either won or at least not lost any case that has gone to completion. When it initially tried to get German and Dutch courts to say that the Qualcomm GSM patents were exhausted back in Fall 2007, the Courts said its claims were too vague and asked Nokia to either appeal or rephrase the suit. Aside from these, the Nokia cases have been all positive and it points to a very different future between the two companies.
All Nokia wants in life is the ability to use its scale to drive down handset costs, and excessive royalties hamper this. Qualcomm, which has been Nokia’s arch-enemy for too long now, wants royalties ahead of anything but would in the end, we suspect, settle for a deal where the rest of the handset community couldn’t follow the Nokia lead and sue for IPR reductions, and some chip business from Nokia. Neither look set to happen now though.
Qualcomm has been telling US journalists to wait until July when another US court hearing will be heard in Delaware, upon which most of Qualcomm’s hopes rest to turn the tide.
But to some extent the cat is already out of the bag. The UK High Court decision seems to suggest that Qualcomm took older, expired patents, touched them up slightly and re-filed them, to continue its claims.
"The UK High Court and US ITC findings are further evidence of Qualcomm overstating its position as an industry innovator and demanding compensation for patents that are not relevant or valid," a Nokia spokesman said.
Similar patents, asserted against Nokia GSM products, are at issue in separate cases filed by Qualcomm against Nokia in China, Europe, and the United States. Both parties agreed to temporarily stay these lawsuits pending court proceedings in the Delaware Chancery Court. Patent invalidation actions, filed by Nokia against Qualcomm patents, continue in China and Germany.
If Qualcomm does not appeal the UK case, it risks every country in Europe, each with similar patent laws, going the same way, and already the Qualcomm phone lines will be busy with licensees requesting a reduction in their payments if these patents are invalid.
In terms of the entire industry, this may well lead to Nokia getting its way and reducing the IPR load on handsets to a manageable level, which in turn will let Nokia drive down and down the costs of building devices.
For Qualcomm’s part, any reduction in revenues in its IPR will likely be more than offset by its increases in chip sales, as it now dominates the HSDPA chip market, despite holding far less IPR assets there. Our conclusion is that Qualcomm will suffer slightly in that its IPR revenues go straight to the bottom line, but it will continue to gather momentum as a chip builder, and in the end will retain some proportion of its IPR revenues.
US investors have always been too bullish about Qualcomm prospects and this news took only a two per cent to three per cent sheen off Qualcomm’s value - about the same as all telecoms stock fell by last week, Nokia’s included.
In June, Nokia filed US lawsuits against both Qualcomm’s MediaFLO mobile TV technology and its Brew content delivery system, claiming they both use Nokia technologies. We thought at the time that this would be a significant lever in the negotiations between these two companies, but the failure of MediaFLO to make an impact at Verizon has perhaps made this less significant.
Nokia could settle this thing in a moment if it so chose, agreeing a lower level of royalty for IPR and possibly holding out juicy contracts for chip supply to its handsets. But as long as it is on the front foot, it will not go down that route. And unless there is a significant setback in that July action there will be no resolution of this dispute until the tail end of this year at best. By which time even the US market bulls might be selling Qualcomm stock.
Faultline is published by Rethink Research, a London-based publishing and consulting firm. This weekly newsletter is an assessment of the impact of the week's events in the world of digital media. Faultline is where media meets technology. Subscription details here. |
July 3 (UPI) -- A Canadian woman said a long wait for pizza inspired her to buy the lottery ticket that earned her a $1.5 million lottery jackpot.
Anita Snyder told the British Columbia Lottery Corporation she found out there was a 20 minute wait for the pizza she ordered, so she stopped into London Drugs at Morgan Crossing to kill some time.
"The woman said there was a new $30 Weekly Pack for all the draws, so I thought I'd try it," Snyder said.
Snyder said she used the BCLC's app to scan her ticket after the June 26 BC/49 drawing and discovered she had matched all six numbers, earning a $1,530,400 jackpot.
"The only reason I scanned the ticket was because I was changing my purse before I left for lunch," she said. "I ran into my husband's room and asked him if he could see [the prize] too. I think I screamed." |
/*
* (C) Copyright 2009
* Marvell Semiconductor <www.marvell.com>
* Written-by: Prafulla Wadaskar <prafulla@marvell.com>
*
* SPDX-License-Identifier: GPL-2.0+
*/
#include <common.h>
#include <miiphy.h>
#include <asm/arch/cpu.h>
#include <asm/arch/kirkwood.h>
#include <asm/arch/mpp.h>
#include "sheevaplug.h"
DECLARE_GLOBAL_DATA_PTR;
int board_early_init_f(void)
{
/*
* default gpio configuration
* There are maximum 64 gpios controlled through 2 sets of registers
* the below configuration configures mainly initial LED status
*/
kw_config_gpio(SHEEVAPLUG_OE_VAL_LOW,
SHEEVAPLUG_OE_VAL_HIGH,
SHEEVAPLUG_OE_LOW, SHEEVAPLUG_OE_HIGH);
/* Multi-Purpose Pins Functionality configuration */
static const u32 kwmpp_config[] = {
MPP0_NF_IO2,
MPP1_NF_IO3,
MPP2_NF_IO4,
MPP3_NF_IO5,
MPP4_NF_IO6,
MPP5_NF_IO7,
MPP6_SYSRST_OUTn,
MPP7_GPO,
MPP8_UART0_RTS,
MPP9_UART0_CTS,
MPP10_UART0_TXD,
MPP11_UART0_RXD,
MPP12_SD_CLK,
MPP13_SD_CMD,
MPP14_SD_D0,
MPP15_SD_D1,
MPP16_SD_D2,
MPP17_SD_D3,
MPP18_NF_IO0,
MPP19_NF_IO1,
MPP20_GPIO,
MPP21_GPIO,
MPP22_GPIO,
MPP23_GPIO,
MPP24_GPIO,
MPP25_GPIO,
MPP26_GPIO,
MPP27_GPIO,
MPP28_GPIO,
MPP29_TSMP9,
MPP30_GPIO,
MPP31_GPIO,
MPP32_GPIO,
MPP33_GPIO,
MPP34_GPIO,
MPP35_GPIO,
MPP36_GPIO,
MPP37_GPIO,
MPP38_GPIO,
MPP39_GPIO,
MPP40_GPIO,
MPP41_GPIO,
MPP42_GPIO,
MPP43_GPIO,
MPP44_GPIO,
MPP45_GPIO,
MPP46_GPIO,
MPP47_GPIO,
MPP48_GPIO,
MPP49_GPIO,
0
};
kirkwood_mpp_conf(kwmpp_config, NULL);
return 0;
}
int board_init(void)
{
/*
* arch number of board
*/
gd->bd->bi_arch_number = MACH_TYPE_SHEEVAPLUG;
/* adress of boot parameters */
gd->bd->bi_boot_params = kw_sdram_bar(0) + 0x100;
return 0;
}
#ifdef CONFIG_RESET_PHY_R
/* Configure and enable MV88E1116 PHY */
void reset_phy(void)
{
u16 reg;
u16 devadr;
char *name = "egiga0";
if (miiphy_set_current_dev(name))
return;
/* command to read PHY dev address */
if (miiphy_read(name, 0xEE, 0xEE, (u16 *) &devadr)) {
printf("Err..%s could not read PHY dev address\n",
__FUNCTION__);
return;
}
/*
* Enable RGMII delay on Tx and Rx for CPU port
* Ref: sec 4.7.2 of chip datasheet
*/
miiphy_write(name, devadr, MV88E1116_PGADR_REG, 2);
miiphy_read(name, devadr, MV88E1116_MAC_CTRL_REG, ®);
reg |= (MV88E1116_RGMII_RXTM_CTRL | MV88E1116_RGMII_TXTM_CTRL);
miiphy_write(name, devadr, MV88E1116_MAC_CTRL_REG, reg);
miiphy_write(name, devadr, MV88E1116_PGADR_REG, 0);
/* reset the phy */
miiphy_reset(name, devadr);
printf("88E1116 Initialized on %s\n", name);
}
#endif /* CONFIG_RESET_PHY_R */
|
Introduction {#S1}
============
> Books must follow sciences, and not sciences books
>
> (Francis Bacon)
This article is a plea for paying more attention to growth conditions and growth curves when growing filamentous fungi in submerged culture. The importance of stating in detail the growth conditions and studying in detail the growth curves of microorganisms grown in batch culture, was clearly stated by [@B58] and [@B17], and is summarized in the statement of [@B44] that data derived from "*a poorly characterized culture is all but useless.*" That the transition from one growth phase to another has severe consequences on the macromolecular cell composition, the fluxes through metabolic pathways as well as activity of membrane transport enzymes was documented for bacteria (e.g., [@B68]; [@B18], [@B19], [@B20]) and for filamentous fungi ([@B5], [@B4]). There is, however, much less work for filamentous fungi and the frequency of growth curves deviating from textbook model curves is mostly neglected. Thus the focus of this article is the delimitation and the characterization of the growth phases -- and if applicable the physiological states within a growth phase -- of our model filamentous fungus *Penicillium ochrochloron* in batch cultures with different nutrient limitations.
It is worth considering the origin of the classical growth curve for batch cultures. As stated in the outstanding review of [@B68], [@B9] summarized the knowledge of his time about the dynamics of bacterial growth in batch culture. He proposed a growth curve consisting of seven growth phases, which nowadays is often simplified to the well-known four growth phases: lag, exponential, stationary and declining phase (e.g., [Figure 1A](#F1){ref-type="fig"}). The data on which he based his scheme were derived from heterotrophic bacteria under carbon and energy restricted growth conditions. Although Buchanan's growth curve was deduced from a very specific experiment, it appears that it was subsequently generalized in textbooks in two respects: First, it was assumed that Buchanan's growth curve concept holds true for most microorganisms, including organisms with complex intracellular organization and enormous phenotypic plasticity like filamentous fungi. Secondly, it was assumed that growth in batch culture stops immediately after depletion of the first essential nutrient -- irrespective of the nature of this essential nutrient.
![**(A)** Typical growth curve in batch culture as depicted in textbooks. This growth curve, proposed by [@B9] for bacterial growth in carbon and energy limited cultures, comprises the following growth phases: I- lag, II- transition, III- exponential, IV- transition (also termed deceleration), V- stationary, VI- transition, VII- declining phase. These growth phases are often even more simplified. **(B)** Suggestion for an alternative depiction in textbooks to account for possible variations of the growth curve scheme. Arrows indicate the influence of the first depleted nutrient as well as the importance of the depletion of further nutrients. Adapted and expanded from [@B9].](fmicb-10-02391-g001){#F1}
This inadequate simplification in textbooks and thus often also in teaching has consequences for research. "*What is clear from many of the growth curves published in the literature is that despite the simplicity of appearance and familiarity of the \[*...*\] batch growth curve, analysis of them is often superficial and the complexity of the processes occurring is then overlooked*" [@B37]. Or in other words, up to date dynamics in batch cultures are alarmingly poorly understood ([@B37]).
Deviations from the general growth curves given in textbooks are frequent, although most textbooks seem to consider such deviations -- if mentioned at all -- as an exception ([Supplementary Table S1](#DS1){ref-type="supplementary-material"}). Examples for bacteria can be found in [@B68], and for filamentous fungi in [@B5], [@B4] as well as in the literature on organic acid production by *Aspergillus niger* ([@B11]; [@B33]).
The shape of a growth curve is affected -- if not determined -- by the nature of the first essential nutrient depleted and by the capability of the organism to cope with its restriction. This has been demonstrated by systematic studies on this subject involving the bacterium *Klebsiella pneumoniae* ([@B68]) and the fungus *Gibberella fujikuroi* ([@B5], [@B4]). In both organisms, the first depleted nutrient was decisive of the growth curve's further progress, and in many cases the growth curves contained a substantially prolonged deceleration phase before entering the stationary phase.
Assuming a high variability of growth curves to be common, why are there not more reports in the literature? In many studies the experimental setup is inadequate to detect complex growth dynamics ([@B68]). A few examples: (i) if biomass is the only parameter and sampling frequency is low, it is unlikely to detect any deviation from the classical growth curve; (ii) the course of nutrient depletions often remains unknown ([@B44]) or is limited to the carbon source. The latter is particularly problematic in carbon-excess cultures, where other essential nutrients may exhaust unnoticed and lead to an unrecognized change in growth dynamics as well as physiology; (iii) changes in cultivation conditions (e.g., agitation speed) can conceal a potential deviation; (iv) online measurement of cultivation parameters (e.g., dissolved oxygen tension (DOT), oxygen consumption, proton excretion, or formation of biomass) is often absent, although this would facilitate the identification of nutritional and physiological changes in the culture, as demonstrated later in this study.
A detailed study of growth curves is of special importance for filamentous fungi because of their intrinsic morphological and physiological heterogeneity within hyphae and mycelia ([@B3]; [@B70]) and their extraordinary phenotypic plasticity/variability elicited by minor changes in their environment ([@B21]; [@B45]; [@B51]).
In this study we summarized approximately a decade of observations of growth characteristics from bioreactor batch grown filamentous fungi -- in particular the two *P. ochrochloron* strains CBS123.823 and CBS123.824. These two strains were initially used for metal leaching from industrial wastes ([@B59]) and developed in the meantime to the second best -- besides *A. niger* -- investigated species concerning organic acid excretion by filamentous fungi ([@B67]). Experiments were performed in highly standardized bioreactor batch cultures with defined minimal media and with constant temperature, pH and aeration. Besides the nutritional status, also the excretion of organic acids and concentration of biomass in terms of dry weight were estimated with a high sampling frequency. The data were gained during different experimental contexts, by different experimenters and using a variety of bioreactor types (ranging from approximately 2--10 L working volume), all coupled to online respirometry. Thus, the results obtained also highlight the robustness of the observed phenomena.
We noticed (i) that growth of *P. ochrochloron* under conditions leading to organic acid excretion (i.e., glucose excess and ammonium as first nutrient to be depleted) strongly deviated from the textbook growth curve, and (ii) that the exhaustion of ammonium (i.e., end of exponential growth) was associated with a strong decrease in oxygen consumption and carbon dioxide evolution ([@B65], [@B66]). Consequently, we payed special attention to this phenomenon while exploring the excretion of organic acids in batch cultures under various nutrient limitations. We focused on the succession of the exponential growth phase to the deceleration phase before the culture enters the stationary phase, as this phase is of utmost importance for many biotechnological applications. Of further interest was the suitability of online respirometry to delimit growth phases quasi-online (especially the exponential growth phase), which would allow a more precise timing of sampling in a defined growth phase.
For *Escherichia coli* studies concerning changes on transcriptomic, proteomic and metabolomic levels related to nutrient exhaustion in batch cultures are available. The situation with filamentous fungi is, however, completely different. Not only are there no such studies for filamentous fungi, but even worse detailed studies of growth curves related to the exhaustion of different nutrient are missing ([@B40]). Before "...omics" studies of the effect of nutrient exhaustion in batch culture of filamentous fungi can be carried out meaningfully, detailed knowledge about the growth curves under different nutrient limitations must be available. Therefore the aim of this work is to provide characteristic growth curves of the filamentous fungus *P. ochrochloron* with different nutrient limitations and to characterize the physiological states after nutrient exhaustion in batch cultures using quasi online respirometry.
We consider this work as a contribution to demonstrate the widespread presence of "atypically" shaped growth curves -- especially with filamentous fungi. Being additionally involved in teaching and in higher education research and thus acknowledging the importance of the correct presentation of this topic in textbooks, we also propose a modified growth curve scheme to sensitize students for potential alternatively shaped growth curves.
Materials and Methods {#S2}
=====================
Fungal Strains {#S2.SS1}
--------------
Most experiments were performed with the *Penicillium ochrochloron* strains CBS123.823 and CBS123.824. In addition *Trichoderma harzianum* (kindly donated from Hermann Strasser, University of Innsbruck) and *Aspergillus nidulans* FGSC A4 (kindly donated from Hubertus Haas, Medical University of Innsbruck) were used to study their growth in ammonium limited batch cultivations.
Precultures {#S2.SS2}
-----------
### Preculture Media {#S2.SS2.SSS1}
The preculture medium varied depending on the media composition of the main culture. For most bioreactor batch cultivations, where ammonium was used as nitrogen source and glucose as carbon-source, a filamentous growing preculture was produced using a HEPES-glucose medium ([@B22]) with the following composition (mM): glucose × 1 H~2~O (400), (NH~4~)~2~SO~4~ (6.25), NH~4~Cl (12.5), KH~2~PO~4~ (5.8), MgSO~4~ × 7 H~2~O (1.6), HEPES (1000), 10 mL L^--1^ trace element solution (see below); pH 7.3 adjusted with 10 M NaOH. For bioreactor batch experiments with nitrate as nitrogen source the preculture medium was as follows (mM): glucose × 1 H~2~O (400), NaNO~3~ (25), NaCl (12.5), KH~2~PO~4~ (5.8), MgSO~4~ × 7 H~2~O (1.6), NaSO~4~ (6.25), HEPES (1000), 10 mL L^--1^ of trace element solution; pH 7.0 adjusted with 10 M NaOH. In case of citrate as carbon source a modified medium after [@B61] was used which consisted of (mM): citrate × 1 H~2~O (250), (NH~4~)~2~SO~4~ (6.25), NH~4~Cl (12.5), KH~2~PO~4~ (5.8), MgSO~4~ × 7 H~2~O (1.6), 10 mL L^--1^ trace element solution (see below); pH 5.0 adjusted with 10 M NaOH. The trace element solution consisted of (mM): Fe(II)SO~4~ × 7 H~2~O (3.6), Mn(II)SO~4~ × 1 H~2~O (2.8), ZnCl~2~ (2.94), Cu(II)SO~4~ × 5 H~2~O (0.4) and CaCl~2~ × 2 H~2~O (4.0). To avoid precipitation, the pH was adjusted to 3.0 with 5 M HCl. Glucose, salts and -- if present -- HEPES were sterilized separately and combined aseptically after reaching room temperature. The trace element solution was sterile filtered (0.22 μm, cellulose acetate) and also added aseptically.
### Incubation {#S2.SS2.SSS2}
Precultures were grown in 500 mL Erlenmeyer flasks, each containing 100 mL preculture medium, which was inoculated with an appropriate amount of spores to reach a spore density of approximately 10^6^--10^7^ spores per mL. The cultures were incubated at 30°C and 350 rpm with a diameter of rotary motion of 25 mm on an orbitary shaker (Certomat, Braun) for 60--72 h, with the exception of cultures with nitrate as the sole nitrogen source, which grew at a slower rate and were therefore incubated for 75--80 h. Nitrogen was depleted in all precultures after approximately 48 h. At the end of incubation, the precultures were still in the deceleration phase and had not yet reached the stationary phase. The bioreactors were inoculated with 50 mL preculture per L working volume.
Conditions for Bioreactor Batch Cultivations {#S2.SS3}
--------------------------------------------
### Bioreactor Batch Media {#S2.SS3.SSS1}
The medium composition for bioreactor batch cultivations varied depending on the nutrient to be depleted first:
*Glucose-limitation.* The medium consisted of (mM) glucose × 1 H~2~O (20), (NH~4~)~2~SO~4~ (6.25), NH~4~Cl (12.5), KH~2~PO~4~ (5.8), MgSO~4~ × 7 H~2~O (1.6). Cultivations were performed at pH 7.0, which was kept constant with 1 M NaOH.
*Ammonium-limitation (with glucose as carbon source).* The medium (after [@B64]) consisted of (mM) glucose × 1 H~2~O (400), (NH~4~)~2~SO~4~ (5), NH~4~Cl (10), KH~2~PO~4~ (5.8), MgSO~4~ × 7 H~2~O (1.6). Cultivations were performed at pH 5.0 or pH 7.0, respectively, which was kept constant with 1 M NaOH.
*Ammonium-limitation (with citrate as carbon source).* The medium consisted of (mM) citrate × 1 H~2~O (250), (NH~4~)~2~SO~4~ (6.25), NH~4~Cl (12.5), KH~2~PO~4~ (5.8), MgSO~4~ × 7 H~2~O (1.6). Cultivations were performed at pH 5.0, which was kept constant with 1 M HCl and 1 M NaOH (the latter was needed at the end of the cultivation).
*Nitrate-limitation.* The medium consisted of (mM) glucose × 1 H~2~O (400), NaNO~3~ (12.5), NaCl (12.5), KH~2~PO~4~ (5.8), MgSO~4~ × 7 H~2~O (1.6), NaSO~4~ (6.25). Cultivations were performed at pH 7.0, which was kept constant with 1 M NaOH.
*Phosphate-limitation.* The medium (after [@B64]) consisted of (mM) glucose × 1 H~2~O (400), (NH~4~)~2~SO~4~ (6.25), NH~4~Cl (12.5), KH~2~PO~4~ (0.5), KCl (3.8), MgSO~4~ × 7 H~2~O (5.3). Cultivations were performed at pH 5.0 or pH 7.0, respectively, which was kept constant with 1 M NaOH.
In all media 1 g L^--1^ antifoam agent (Clerol FBA 5075, Cognis, Germany) and 10 mL L^--1^ trace element solution were added. Sugar and salts were autoclaved separately and combined aseptically after reaching room temperature. The trace element solution was sterilized by filtration (cellulose acetate filter, pore size 0.22 μm) and also added aseptically.
### Bioreactor Batch Cultivations {#S2.SS3.SSS2}
Bioreactor batch cultivations were performed either in bioreactors with 1.8 L working volume (Biostat M or Biostat A bioreactor; Sartorius/Braun, Melsungen, Germany), KLF 2000 bioreactor (Bioengineering; Wald, Switzerland), with 4.5 L working volume (Biostat B; Sartorius/Braun, Melsungen, Germany) or 10 L working volume (NLF 200; Bioengineering, Wald, Switzerland). All bioreactors were operated with identical stirrer types with identical stirrer circumferential speed and therefore equal shearing forces. The experiments were carried out at 30°C, 700--1300 rpm and 0.56 vvm (volume of air per volume of medium and minute; 1 l^--1^ min^--1^). The further details of sampling and sample treatment followed the procedure as previously described ([@B64]). For the bioreactors with small working volumes, only one sample was taken per sampling time in order to disturb the cultivation and experimental conditions as little as possible. At least three independent bioreactor batch cultivations were performed for each nutrient condition investigated. Additionally, at least one undisturbed control cultivation (i.e., without sampling) was carried out per condition. Although the growth curves in the parallel experiments were similar, we observed slight temporal shifts caused, for example, by a slightly different inoculum and/or different bioreactors. To take into account the inter-bioreactor variability, the data from different experiments of more than 20--40 replicate batch cultivations were not averaged, but one representative experiment is shown for each nutrient limitation.
### Delimitation of Growth Phases {#S2.SS3.SSS3}
The end of the lag phase (i.e., the beginning of exponential growth) was approximated by determining the intercept of the logarithmic plot of the oxygen uptake curve with the x-axis of the initial oxygen uptake level. The end of exponential growth was indicated by the depletion of the first limiting nutrient, which was also reflected in the respiration curves (see section Looking Closer With Online Respirometry -- A Powerful Tool to Improve Experimental Standardization of Batch Cultures). A clear delimitation between the deceleration phase and the stationary phase was difficult and was a trade-off between biomass and respiratory markers (see section Looking Closer With Online Respirometry -- A Powerful Tool to Improve Experimental Standardization of Batch Cultures).
Meta-Analysis of the Culture Media Composition {#S2.SS4}
----------------------------------------------
[@B17] emphasized that quantitative aspects of the media composition should be given greater attention in order to avoid the use of inappropriate media. One of these aspects is that it should be proved which nutrient limits growth stoichiometrically and whether the other nutrients are in sufficient excess (recommended excess factors in a carbon limited medium are 3--5 for N, 5--10 for P, S, K. Mg and 10--20 for Fe; [@B17]). Following this suggestion, we analyzed the media used for *P. ochrochloron* in this work according to the procedure exemplified in Tables 1, 2 of [@B17]. In addition, we have partially experimentally verified the calculated results.
Central for the calculation of excess factors are the values for the biomass yield (Y~X/E~; g dry weight/g element). The Y~X/E~ values strongly depend on the composition of the medium, other cultivation conditions and the specific growth rate. Therefore, we did not use the YX/E values given by [@B17], derived from gram negative bacterial cells growing at μmax in batch culture, but Y~X/E~ values calculated from a series of batch cultivations with *P. ochrochloron*. In general, our own Y~X/E~ values for C, N, and P are higher than those of [@B17]. Reasons for this could be for instance the heterotrophic carbon dioxide fixation (in the case of carbon limited growth; the respiratory quotient in these cultivations was between 0.6 and 0.9 and thus distinctly below 1) or the accumulation of reserve carbohydrates (in the case of nitrogen limited growth). Values of Y~X/E~ higher than 1 were also found for other filamentous fungi cultivated in bioreactor batch culture at near neutral pH ([Supplementary Table S2](#DS1){ref-type="supplementary-material"}).
The calculated excess factors for the media used are given in [Supplementary Table S3](#DS1){ref-type="supplementary-material"}. These excess factors indicate that the growth of *P. ochrochloron* was indeed limited by a single nutrient when grown in carbon, nitrogen or phosphorus limited batch culture. This was confirmed experimentally by measuring glucose, ammonium and phosphate in the culture filtrates ([Figure 2](#F2){ref-type="fig"}).
{ref-type="fig"}: I, lag phase; III, exponential phase; IV, deceleration phase; V, stationary phase; VII, declining phase. Upper panel, limiting nutrient (open squares), biomass (closed circles), ln(biomass) (open circles); lower panel: OUR, oxygen uptake rate (gray line); CER, carbon dioxide evolution rate (black line); TQ, transfer quotient calculated as CER/OUR (small open circles) ([@B55]). Note that some datasets depicted here or in [Supplementary Files](#DS1){ref-type="supplementary-material"}, namely in **(B,E,F)** have been expanded from previous works ([@B66], [@B64]). Representative experiments are shown in this figure and further examples in [Supplementary Figure S1](#DS1){ref-type="supplementary-material"}.](fmicb-10-02391-g002){#F2}
However, the results given in [Supplementary Table S3](#DS1){ref-type="supplementary-material"} suggest a growth limitation by calcium and iron. We have tested this prediction in shake flask cultures ([Supplementary Table S4](#DS1){ref-type="supplementary-material"}). Neither additional supplementation with iron nor an elevated concentration of trace element solution increased the formation of biomass. This contradiction between calculated and experimental results may perhaps be due to inappropriate yield factors (assuming that oxygen was not limiting growth in shake flask cultures) or due to the insolubility of the additionally added trace elements at a pH near 7.
Analytical Methods {#S2.SS5}
------------------
Glucose, ammonium, phosphate and extracellular organic acids in culture filtrates, dry weight, oxygen consumption and carbon dioxide production were determined as previously described ([@B64]). Nitrate was measured by HPLC using a Hypersil ODS 5 μ precolumn (40 × 4.6 mm, ARC Seibersdorf, Austria) using the method of [@B14].
Results and Discussion {#S3}
======================
Growth Curves of *Penicillium ochrochloron* and Other Filamentous Fungi Depending on the Nature of the First Exhausted Nutrient {#S3.SS1}
-------------------------------------------------------------------------------------------------------------------------------
None of the growth curves observed in our experiments followed the progress of the classical growth curve. Additionally, the nature of the first depleted nutrient in *P. ochrochloron*, grown over a broad range of various nutrient limitations, strongly influenced the further progress of the growth curve ([Figures 2](#F2){ref-type="fig"},[3](#F3){ref-type="fig"}).
![Effect of ammonium limitation in a defined medium on biomass evolution, nutrient uptake, oxygen consumption and carbon dioxide production on bioreactor batch cultivations of various filamentous fungi carried out in bioreactors with 1.7 L working volume **(A,B,D)** and 4.5 L working volume **(C)**. **(A,B)** *Pencillium ochrochloron* CBS123.824 cultivated at pH 7 and pH 5, **(C)** *Aspergillus nidulans* FGSC A4 and **(D)** *Trichoderma harzianium*. Data for **(E)** *Aspergillus niger* were derived from [@B33] by extracting the data from the respective figures with the software "Engauge Digitizer Version 4.1" and replotting them. Delimitation of growth phases were done as described in section "Materials and Methods." Numbering of growth phases are according to [Figure 1](#F1){ref-type="fig"}: I, lag phase; III, exponential phase; IV, deceleration phase; V, stationary phase; VII, declining phase; OUR, oxygen uptake rate; CER, carbon dioxide evolution rate. Upper panel: limiting nutrient (open squares), biomass (closed circles), ln(biomass) (open circles). Lower panel: OUR, oxygen uptake rate (gray line); CER, carbon dioxide evolution rate (black line). Note that some datasets depicted here or in [Supplementary Files](#DS1){ref-type="supplementary-material"}, namely in **(A,B)** have partly been rearranged and expanded from a previous work ([@B64]). Representative experiments are shown in this figure and further examples in [Supplementary Figure S2](#DS1){ref-type="supplementary-material"}.](fmicb-10-02391-g003){#F3}
When glucose was the first exhausted nutrient, the culture passed from the exponential growth phase to an extremely short, almost negligible stationary phase, followed by a decline in dry weight ([Figure 2A](#F2){ref-type="fig"}). Unsurprisingly, the onset of glucose exhaustion caused strong metabolic responses, for instance, an immediate decrease of respiration rates (more details on respirometry to delimit growth phases see section Looking Closer With Online Respirometry -- A Powerful Tool to Improve Experimental Standardization of Batch Cultures) and the immediate reuptake of previously excreted organic acids. These findings are not specific to *P. ochrochloron* as studies of other filamentous fungi report comparable observations (e.g., [@B35]; [@B13]; [@B16]; [@B60]). Also morphological alterations under glucose or carbon starvation such as progressive vacuolation are known (e.g., [@B46]; [@B27]; [@B49]). This would explain why carbon starved cultures of filamentous fungi frequently decline in dry weight (e.g., [@B5]; [@B10]; [@B63]; [@B34]).
In contrast to glucose limitation, the exponential growth phase was followed by a considerably prolonged deceleration phase in all phosphate and nitrogen limited cultivations of *P. ochrochloron*, *T. harzianum*, and *A. nidulans* ([Figures 2](#F2){ref-type="fig"}, [3](#F3){ref-type="fig"}). Also in these experiments the end of the exponential growth phase was clearly indicated by the respiration curves (more details see section Looking Closer With Online Respirometry -- A Powerful Tool to Improve Experimental Standardization of Batch Cultures) and the biomass continued to increase after depletion of the first essential nutrient. The length of the deceleration phase and the increase in dry weight depended on the nature of the first nutrient depleted as well as the carbon source and was especially pronounced in phosphate limited cultures (up to sixfold increase in dry weight). As we will discuss in more detail later (see section Looking Even More Closer -- The Transition Phase Between Exponential Growth Phase and Stationary Growth Phase), the observation of a prolonged deceleration phase was not a unique characteristic of the fungal species examined in this work, but appears to be present in many other microorganisms.
Looking Closer With Online Respirometry -- A Powerful Tool to Improve Experimental Standardization of Batch Cultures {#S3.SS2}
--------------------------------------------------------------------------------------------------------------------
Respirometry is frequently used to determine a broad range of parameters related to growth in batch cultures ([@B25]; [@B23]). Considering the key function of oxygen in aerobic (micro)organisms, the oxygen uptake rate (OUR) in cultures without oxygen limitation can be used as an indicator for metabolic activity and to optimize growth conditions for improved product yields ([@B23]). It is evident that a correct delimitation of the growth phases in batch cultures, especially of the exponential growth phase, is paramount considering the rapidly occurring changes in physiology. Therefore the suitability of respiration curves to do this was of special interest in this work.
In all our experiments, the end of exponential growth was clearly indicated in the respiration curves ([Figures 2](#F2){ref-type="fig"}, [3](#F3){ref-type="fig"}) or -- when available -- in the corresponding dissolved oxygen curve. This observation was highly reproducible for all tested filamentous fungi. The respiration curves also indicated drastic shifts in catabolic fluxes in the subsequent deceleration phase (see also section Looking Even More Closer -- The Transition Phase Between Exponential Growth Phase and Stationary Growth Phase), though most dynamics within the respiration curves still remained unknown. An exception was when the carbon source in carbon excess cultures was exhausted, which could usually be traced back in the corresponding respiration curve (e.g., strong decrease in respiration in [Figure 2C](#F2){ref-type="fig"} at approximately 60 h is due to citrate reaching low levels and becoming depleted at approximately 64 h of cultivation time).
In contrast to the clear delimitation of the exponential growth phase, there was no comparable strong marker which indicated the start of the stationary phase. We found, however, that the beginning of the stationary phase often, but not in all experiments (e.g., not in [Figure 2F](#F2){ref-type="fig"}), was given when a transfer quotient (TQ; [@B55]) of 1 was reached again ([Figures 2B--E](#F2){ref-type="fig"}). However, this could be a coincidence for cultures at pH 7 and might not hold true for cultures that have grown at other pH levels due to the pH-sensitive carbon dioxide equilibrium.
Remarkably, each limiting nutrient seemed to trigger a specific pattern in the respiration curves (e.g., compare respiration of glucose, ammonium, and phosphate limitation, [Figure 2](#F2){ref-type="fig"}). Furthermore, there is evidence that these progresses might be species-independent. For example, the characteristic double peaked respiration curves for *P. ochrochloron, T. harzianum, A. nidulans* (present work [Figures 2B,D](#F2){ref-type="fig"}, [3A--D](#F3){ref-type="fig"}) and *A. niger* ([@B33], [Figure 3E](#F3){ref-type="fig"}) were strikingly similar at the onset of a nitrogen limitation when glucose was the carbon source. DOT curves of ammonium-limited grown *E. coli* also showed a double peak ([@B7]), which was even more pronounced than those observed in this study. In contrast to nitrogen limitation, glucose limitation triggered a single-peak response in *P. ochrochloron* ([Figure 2A](#F2){ref-type="fig"}), which was also reported for DOT curves of *P. chrysogenum* ([@B26]) or *Aspergillus oryzae* ([@B35]). We therefore hypothesize that, similarly to the progress of the growth curves, the nature of the first nutrient depleted is decisive for the shape of the corresponding respiratory curve. These characteristic respiratory patterns might be similar for a broad range of aerobic microorganisms.
Summarizing the above mentioned observations, we think that the potential of respirometry to characterize growth characteristics and physiological in submerged cultures of filamentous fungi states is far from being exhausted and is definitely worth to pay more attention to it.
Looking Even More Closer -- The Transition Phase Between Exponential Growth Phase and Stationary Growth Phase {#S3.SS3}
-------------------------------------------------------------------------------------------------------------
As already mentioned, in most of our experiments the duration of the deceleration phase was considerably prolonged and exceeded the length of the exponential growth phase ([Figures 2](#F2){ref-type="fig"}, [3](#F3){ref-type="fig"}). These findings are not restricted to the filamentous fungi examined in this work, but are also in line with a wealth of growth curves of even very well-investigated microorganisms like *Klebsiella pneumoniae* ([@B68]) or *E. coli* ([@B2]), *Saccharomycopsis lipolytica* ([@B8]; [@B29]; [@B43]), *Aspergillus nidulans* ([@B15]; [@B62]), *Aspergillus niger* ([@B11]; [@B32]; [@B33]; [@B54]; [@B12]; [@B39]), *Aspergillus foetidus* ([@B31]), *G. fujikuroi* ([@B5], [@B4]), *Neurospora crassa* ([@B24]), *or Penicillium chrysogenum* ([@B62]) which all show this type of "deviation." The overwhelming evidence from the research literature severely contrasts the concept of a short, even negligible deceleration phase as often depicted in textbooks or other teaching materials ([@B37]). Thus, we concur with [@B37], who suggested that the nature of the first exhausted nutrient is relevant for the further progress of the deceleration phase, which is also reflected in the characteristic progress of the respirometric curves in our own experiments (section Looking Closer With Online Respirometry -- A Powerful Tool to Improve Experimental Standardization of Batch Cultures). Moreover, there is evidence from literature that the sequence of further nutrient depletions also strongly determines the shape and length of the deceleration phase ([@B5], [@B4]).
Beside a considerable prolongation, we observed that the deceleration phase is physiologically (and morphologically) a remarkably dynamic growth phase. For instance, in experiments with a high sampling frequency, we found that -- apart from the strong response in respirometry -- the onset of an ammonium limitation apparently stopped for a short period of time the proton pumping activity of the plasma membrane H^+^-ATPase, which is the main source of ATP driven proton efflux in yeasts and filamentous fungi including *P. ochrochloron* ([@B64]; [Figure 4](#F4){ref-type="fig"}). This pause was accompanied by a quick rise in external pH ([Figure 4](#F4){ref-type="fig"}) and probably also a short stop in biomass production. In a previous work ([@B65]) we furthermore noticed that in this phase also a drastic change in glucose uptake rate occurs, which we also found in other fungi after analyzing published data of *A. niger*, *A. awamori*, *G. fujikuroi*, and *S. lipolytica*.
![Increased time resolution experiments exploring the transition between exponential growth phase and the deceleration phase of ammonium limited cultures at pH 7 of *Penicillium ochrochloron* CBS123.824 illustrated with two independent cultivations. Experiments were carried out in a Biostat B bioreactor with 5 L working volume. The arrow indicates the time point of ammonium exhaustion in the culture. Batch \#1 (**○**), batch \#2 (**\***). **(A)** Oxygen uptake rate (OUR) and amount of titrated NaOH (0.5 N) over the whole cultivation. Batch \#1 (gray line), batch \#2 (black line). The red square indicates the time frame depicted in **(B,C)**. **(B)** Progress of extracellular pH during the transition from the exponential growth phase and the deceleration phase. Note that cultures at pH 5 with the same strain (depicted in [@B64]) showed an even more distinct rise in extracellular pH over a prolonged time. **(C)** Progress of excreted organic acids and their partial reuptake. Note that the reuptake in cultures at pH 5 with the same strain (depicted in [@B64]) was even more pronounced.](fmicb-10-02391-g004){#F4}
Interestingly, the length and progress of the observed rise in pH was strain and pH dependent and ranged from a few hours at pH 7 ([Figure 4](#F4){ref-type="fig"}) to a period of at least 40--60 h at pH 5 ([@B64]). In a previous work we hypothesized that this rise was due to an observed reuptake of organic acids despite glucose excess conditions, indicating a probably still unknown function of organic acid excretion ([@B64]). These results unequivocally document that the deceleration phase is a period of major metabolic rearrangements which regard several different levels of metabolism.
Considering the severe physiological alterations caused by nutrient exhaustion ([@B37]), these findings of a dynamic deceleration phase are not very surprising. Nevertheless "*the many and varied factors governing entry into, and growth during the deceleration phase have been given little attention. Growth kinetics during this period are therefore largely uncharacterized, despite the importance of the deceleration phase for biotechnological processes, as the period when secondary metabolite production begins*" ([@B50]). It appears that more than 20 years later this statement is still true and many important physiological processes occurring in this growth phase have yet to be explored.
Factors Influencing the Shape of Growth Curves -- A Short Summary {#S3.SS4}
-----------------------------------------------------------------
So far, a number of factors have been identified in literature which evidently influence the progress of a microbial growth curve, but have not yet been recognized for their importance in textbooks and teaching material. We thus strongly suggest a modified growth curve scheme ([Figure 1B](#F1){ref-type="fig"}) to increase students' awareness of potential alternatively shaped growth curves. In addition, we propose [Figure 5](#F5){ref-type="fig"}, which offers a brief summary of what we consider to be the most relevant influencing parameters: There is strong evidence that the nature of the first exhausted nutrient is of remarkable importance for the resulting shape of a growth curve ([@B5], [@B4]; [@B68]; [@B37]). Also the sequence of all subsequent nutrient depletions, especially the time of glucose exhaustion, influences the further progress of a growth curve ([@B5], [@B4]). Another source for deviations from the classical standard growth curve is hidden diauxic growth, which can occur via reutilization of previously excreted metabolites such as polyols ([@B53]; [@B13]), gluconate ([@B60]) or organic acids ([@B35]; [@B1]; [@B16]; present work). In case nutrients serve similar metabolic functions (e.g., potassium and sodium, or, different carbon sources), they may replace or complement each other ([@B28]; [@B69]; [@B71]). Depending on the nature of these nutrients and their relative concentration within the medium, typical diauxic growth or simultaneous nutrient uptake can occur ([@B36]; [@B68]; [@B30]; [@B52]; [@B71]; [@B60]). Finally, the inoculum with its cultural history and thus its physiological state, morphology, cell density or volumetric size has a considerable influence on the further progress of a batch culture, including its productivity ([@B41]; [@B42]; [@B38]; [@B36]; [@B37]; [@B47]; [@B58]; [@B56]) In addition, in bacteria the properties of the inoculum appear to have direct consequences on the progress of the declining phase ([@B48]).
{#F5}
Conclusion {#S4}
==========
Based on literature data and summarizing over a decade of our own work, we are in line with others and hypothesize that growth curves of a non-textbook type are the rule rather than the exception for filamentous fungi, as seems to be the case for many other microorganisms. Despite being a fundamental method in microbiology, growth and growth curves are still vastly underrepresented in textbooks. Moreover, the frequent oversimplification of the growth curve itself leads to a general misconception of its complexity and to an undervaluation of the often extreme, largely unexplored physiological dynamics the cultures undergo. This in turn has a direct and strong consequence on all experimental aspects. As long as "*microbial growth seems to be considered as a 'specialised subject', a point that has little relevance to the question that one wants to investigate (or, alternatively, one assumes that it is safe to follow 'standard' or often used procedures)*" ([@B17]), scientific progress is hampered to a certain extent.
This issue is clearly not a simple academic problem. Considering some of the future challenges for humanity involving filamentous fungi (or microorganisms in general) such as the production of chemical building blocks out of renewable resources ([@B57]) or the search for novel antibiotics to combat (multiple) antibiotic resistance ([@B6]), the study and understanding of growth and its underlying physiology might be essential to understand these challenges and problems and to find solutions.
Data Availability Statement {#S5}
===========================
All datasets generated for this study are included in the manuscript/[Supplementary Files](#DS1){ref-type="supplementary-material"}.
Author Contributions {#S6}
====================
PV conceived the overall study and designed it together with BH, CS, and WB. BH, CS, DA, PV, and WB performed the experiments. PV wrote the first draft of the manuscript, which was then critically revised and rewritten by CS, DA, PV, and WB. PV and CS performed the literature research for the text books. DA and WB analyzed the media on the meta-level. All authors contributed to the drafting of the figures, data analysis and interpretation, and read and approved the final manuscript version.
Conflict of Interest {#conf1}
====================
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
**Funding.** This work was supported by the Austrian Science Fund (Projects P16565, P22220, and T862), the University of Innsbruck, and the Theodor Körner Fonds.
We thank all the participants of the practical courses "Fungal Physiology" from 2008 to 2016 for their curiosity and help to test the robustness of our observations. Furthermore, we want to thank Hermann Strasser (University of Innsbruck) and Hubertus Haas (Medical University of Innsbruck) for donating fungal strains, Reinhard Aigner for the pictogram of the bioreactor, and Viktoria Fuchs, Barbara Pichler, Sebastian Strasser, and Petra Thurnbichler for technical assistance with the bioreactor experiments. Special thanks also to Thomas Egli (ETH Zürich, Switzerland and EAWAG, Switzerland) who contributed with helpful suggestions and critical reflections to this work.
Supplementary Material {#S9}
======================
The Supplementary Material for this article can be found online at: <https://www.frontiersin.org/articles/10.3389/fmicb.2019.02391/full#supplementary-material>
######
Click here for additional data file.
[^1]: Edited by: Mohamed Hijri, Université de Montréal, Canada
[^2]: Reviewed by: Stefan Junne, Technische Universität Berlin, Germany; Falk Hillmann, Leibniz Institute for Natural Product Research and Infection Biology, Germany
[^3]: This article was submitted to Fungi and Their Interactions, a section of the journal Frontiers in Microbiology
|
New Initiative for minority entrepreneurs
WDSU's Casey Ferrand previews the announcement of a new initiative aimed at making New Orleans a start-up hub for minority entrepreneurs.
Share
Shares
Copy Link
{copyShortcut} to copy
Link copied!
Updated: 7:05 AM CDT Mar 11, 2014
New Initiative for minority entrepreneurs
WDSU's Casey Ferrand previews the announcement of a new initiative aimed at making New Orleans a start-up hub for minority entrepreneurs.
Share
Shares
Copy Link
{copyShortcut} to copy
Link copied!
Updated: 7:05 AM CDT Mar 11, 2014
Hide TranscriptShow Transcript
WEBVTT HAPPENING TODAY -- MAYOR MITCHLANDRIEU AND OTHER CITYLEADERS WILL GATHER AT DILLARDUNIVERSITY TOANNOUNCE A NEW PROGRAM FORMINORITY ENTREPRENEURS.IT'S A PARTNERSHIP BETWEEN THENEW ORLEANSSTARTUP FUND -- CHEVRON -- ANDTHE ESSENCE FESTIVAL BYCOCO-COLA... WDSU'S CASEYFERRAND JOINS US LIVE FROMDILLARD UNIVERSITY WITH WHATTHIS MEANS FOR THECOMMUNITY... GOOD MORNING CASEYTHERE ARE VERY FEW MINORITYENTREPRENEURS, AND THEY RARELYGET FUNDING. HOWEVER TODAY...BUSINESS AND CITY LEADERS AREANNOUNCING AN INITITIVE THATCOULD CHANGE THAT.IT'S A NEW PROGRAM FOR MINORITYENTREPRENEURS... AN INITIATIVE THAT'S COULDPOSITION NEW ORLEANS AS AMINORITY START-UP HUB IN THEUNITED STATES. MINORITYENTREPRENEURS MADE UP JUST 8.5PERCENT OF THE PEOPLE PITCHINGTHEIR BUSINESSES TO ANGELINVESTORS IN THE FIRST HALF OF2013. THAT'S ACCORDING TO AREPORT ON THE ANGEL MARKET BYTHE UNIVERSITY OF NEW HAMPSHIRECENTER FORVENTURE RESEARCH. ANGELINVESTORS PROVIDEFINANCIAL BACKING FOR SMALLSTARTUPS ORENTREPRENEURS... THEY'RE USUALLYAN ENTREPRENEUR'SFAMILY MEMBER OR FRIEND. ETHNICMINORITY ENTREPRENEURS...ARE LESS LIKELY TO RECEIVEINVESTMENTS. ACCORDING TOTHE REPORT... JUST 15 PERCENT OFMINORITY-OWNED FIRMSSUCCESSFULLY TRANSLATED THEIRPITCHES INTO MONEY.THAT'S COMPARED TO 22 PERCENT OFALL OTHER BUSINESSES.HOWEVER TODAY THE NEW ORLEANSSTARTUP FUND WILL JOINCHEVRON, REPRESENTATIVES OF THE2014 ESSENCE FESTIVAL PRESENTEDBY COCA-COLA, MAYOR MITCHLANDRIEU AND A HOST OF BUSINESSAND CIVIC LEADERS TOANNOUNCE A NEW INITIATIVE INSUPPORT OF THOSE MINORITYENTREPRENEURS. THE ANNOUNCMENTWILL HAPPEN AT10:30 THIS MORNING IN THESTUDENT UNION HERE ONDILLARD'S CAMPUS.WE'LL HAVE MORE ON THISMORNING'S ANNOUNCMENT INLATER NEWSCASTS. ON YOUR SIDECASEY FERRAND WDSUNEWS.NEW THIS MORNING WE NOW KNOW THEIDENTITY OF ONE
New Initiative for minority entrepreneurs
WDSU's Casey Ferrand previews the announcement of a new initiative aimed at making New Orleans a start-up hub for minority entrepreneurs. |
Maybe it is not a goal that matters: a report from a physical activity intervention in youth.
Decline in physical activity (PA), specifically in adolescents raises concerns. Setting goals and strategies are often used to increase the level of moderate-to-vigorous physical activity (MVPA), recently introducing also modern technological devices for achieving different goals. The aim of this study was to investigate the effectiveness of two different goal strategies in increasing PA of youth. It was expected that there would be positive relationships between support and goal strategy which would contribute to increase MVPA. Classmate and teacher support scales were used to evaluate support in physical education (PE) classes. Activity trackers were used to count daily steps. Data were collected from 65 late adolescents, divided into two groups: "Goal" (group 1) and "Do your best" (group 2) set with different step goals and strategies. Differences between the terms were tested. To compare MVPA levels with the different level of support they received in girls and boys, a two-way ANOVA was used. There was a difference noticed in teacher support between the genders in all the two groups in favor of boys. Boys with low teacher support in group 1 indicated a higher level of MVPA. In group 2 when teacher support was high girls reported the highest level of MVPA. This study has shown that in terms of MVPA teacher support is more efficient than a goal strategy. The results highlight the importance of perceived teacher support for motivation in PA and pointed at PE teachers as the agents of behavior change, specifically in girls. |
AMP-activated protein kinase (AMPK) molecular crossroad for metabolic control and survival of neurons.
AMP-activated protein kinase (AMPK) constitutes a molecular hub for cellular metabolic control, common to all eukaryotic cells. Numerous reports have established how AMPK responds to changes in the AMP:ATP ratio as a measure of cellular energy levels. In this way, it integrates control over a number of metabolic enzymes and adapts cellular processes to the current energy status in various cell types, such as muscle and liver cells. The role of AMPK in the development, function, and maintenance of the nervous system, on the other hand, has only recently gained attention. Neurons, while highly metabolically active, have poor capacity for nutrient storage and are thus sensitive to energy fluctuations. Recent reports demonstrate that AMPK may have neuroprotective properties and is activated in neurons by resveratrol but also by metabolic stress in the form of ischemia/hypoxia and glucose deprivation. Novel studies on AMPK also implicate neuronal activity as a critical factor in neurodegeneration. Here we discuss the latest advances in the knowledge of AMPK's role in the metabolic control and survival of excitable cells. |
It’s official, we’re a nation stuck in routine. According to recent research, Brits are spending almost half of their lives confined to the same schedule – and psychologists think it could be behind that Sunday sinking feeling. |
Q:
SQL related wonky error if there is no HTTP in the URL
select
wu.ACCOUNT_NUMBER as WS_ACCOUNT_NUMBER,
wu.LIFETIME_REVENUE as WS_LIFETIME_REVENUE,
wu.FIRST_NAME||' '||wu.LAST_NAME as WS_ACCOUNT_NAME,
wu.PRIMARY_EMAIL as WS_ACCOUNT_EMAIL,
wu.TIME_CREATED as WS_ACCOUNT_TIME_CREATED,
wuu.URL as BUSINESS_URL
from
WUSER wu
left outer join WUSER_URL wuu on wu.ACCOUNT_NUMBER = wuu.ACCOUNT_NUMBER
where
wu.ACCOUNT_NUMBER = 123456789;
URL displayed on the screen is hyperlink and should take us to the website on clicking it. Problem is that it works only and only when it has a HTTP protocol attached prior to it in the Oracle db.
for example, it works when the url in db is http://www.google.com or http://google.com
but it FAILS when the url is google.com or www.google.com
Our client is very specific about this requirement and wants to be able to hop over to the website when there is no HTTP to the URL record in the db.
**What are the possible solutions? Can I write a conditional insert to check record by record if there is HTTP, and if not, then append it somehow ?
If yes, please tell me the SQL too**
Please Help!!!!!!
A:
Are you able to check the data before it's being inserted, and pre-pend the HTTP://?
Conditional code to put HTTP:// in front of the string could be...
CASE WHEN UPPER(wuu.URL) LIKE 'HTTP://%'
THEN wuu.UR
ELSE 'HTTP://' || wuu.URL
END
(It's only on several lines to make it easier to read.)
|
About Carroll & Lions
Carroll & Lions are highly recognized local leaders in Real Estate, specializing in Residential, Multi-Family and Investment properties in the Seattle Metro and Surrounding Area. Carroll & Lions is affiliated with Allison James Estates & Homes and based in Kirkland, Washington.
Resources
Get Social
About Us
The listing data relating to real estate for sale on this web site comes in part from the Northwest Multiple Listing Service. Real estate listings held by brokerage firms other than Allison James Estates & Homes are marked by the "three tree" symbol; detailed information about such listings includes the names of the listing brokers. Data last updated 2018-03-19T21:16:38.823. |
// Licensed to the .NET Foundation under one or more agreements.
// The .NET Foundation licenses this file to you under the MIT license.
// See the LICENSE file in the project root for more information.
using System.Buffers;
namespace System.Text.Http.Parser
{
public interface IHttpParser
{
bool ParseRequestLine<T>(T handler, in ReadOnlySequence<byte> buffer, out SequencePosition consumed, out SequencePosition examined) where T : IHttpRequestLineHandler;
bool ParseHeaders<T>(T handler, in ReadOnlySequence<byte> buffer, out SequencePosition consumed, out SequencePosition examined, out int consumedBytes) where T : IHttpHeadersHandler;
void Reset();
}
}
|
/*------------------------------------------------------------------------------
Copyright (c) CovertJaguar, 2011-2019
http://railcraft.info
This code is the property of CovertJaguar
and may only be used with explicit written
permission unless otherwise specified on the
license page at http://railcraft.info/wiki/info:license.
-----------------------------------------------------------------------------*/
package mods.railcraft.client.render.carts;
import mods.railcraft.client.render.tools.OpenGL;
import mods.railcraft.common.core.RailcraftConstants;
import mods.railcraft.common.plugins.forge.LocalizationPlugin;
import mods.railcraft.common.plugins.misc.SeasonPlugin;
import net.minecraft.client.model.ModelBase;
import net.minecraft.client.renderer.BufferBuilder;
import net.minecraft.client.renderer.Tessellator;
import net.minecraft.client.renderer.vertex.DefaultVertexFormats;
import net.minecraft.entity.item.EntityMinecart;
import net.minecraft.util.ResourceLocation;
import org.jetbrains.annotations.Nullable;
import org.lwjgl.opengl.GL11;
/**
* @author CovertJaguar <http://www.railcraft.info/>
*/
public class LocomotiveRendererDefault extends LocomotiveModelRenderer {
protected final String modelTag;
private final ModelBase model;
private final ModelBase snowLayer;
private final ResourceLocation[] textures;
private final int[] color = new int[3];
// protected final IIcon[] itemIcons = new IIcon[3];
private float emblemSize = 0.15F;
private float emblemOffsetX = 0.47F;
private float emblemOffsetY = -0.17F;
private float emblemOffsetZ = -0.515F;
public LocomotiveRendererDefault(String rendererTag, String modelTag, ModelBase model, ModelBase snowLayer) {
this(rendererTag, modelTag, model, snowLayer, new ResourceLocation[]{
new ResourceLocation(RailcraftConstants.LOCOMOTIVE_TEXTURE_FOLDER + modelTag + ".primary.png"),
new ResourceLocation(RailcraftConstants.LOCOMOTIVE_TEXTURE_FOLDER + modelTag + ".secondary.png"),
new ResourceLocation(RailcraftConstants.LOCOMOTIVE_TEXTURE_FOLDER + modelTag + ".nocolor.png"),
new ResourceLocation(RailcraftConstants.LOCOMOTIVE_TEXTURE_FOLDER + modelTag + ".snow.png")
});
}
public LocomotiveRendererDefault(String rendererTag, String modelTag, ModelBase model, ModelBase snowLayer, ResourceLocation[] textures) {
super(rendererTag);
this.modelTag = modelTag;
this.model = model;
this.snowLayer = snowLayer;
this.textures = textures;
color[2] = 0xFFFFFF;
setRenderItemIn3D(false);
}
public void setEmblemPosition(float size, float offsetX, float offsetY, float offsetZ) {
this.emblemSize = size;
this.emblemOffsetX = offsetX;
this.emblemOffsetY = offsetY;
this.emblemOffsetZ = offsetZ;
}
@Override
public String getDisplayName() {
return LocalizationPlugin.translate("railcraft." + modelTag + ".name");
}
// @Override
// public IIcon[] getItemIcons() {
// return itemIcons;
// }
//
// @Override
// public void registerItemIcons(IIconRegister iconRegister) {
// String tag = "railcraft:locomotives/" + MiscTools.cleanTag(modelTag);
// itemIcons[0] = iconRegister.registerIcon(tag + ".primary");
// itemIcons[1] = iconRegister.registerIcon(tag + ".secondary");
// itemIcons[2] = iconRegister.registerIcon(tag + ".nocolor");
// }
@Override
public void renderLocomotive(RenderCart renderer, EntityMinecart cart, int primaryColor, int secondaryColor, @Nullable ResourceLocation emblemTexture, float light, float time) {
OpenGL.glPushMatrix();
OpenGL.glPushAttrib(GL11.GL_ENABLE_BIT);
// OpenGL.glEnable(GL11.GL_BLEND);
// OpenGL.glBlendFunc(GL11.GL_SRC_ALPHA, GL11.GL_ONE_MINUS_SRC_ALPHA);
OpenGL.glScalef(-1F, -1F, 1.0F);
color[0] = primaryColor;
color[1] = secondaryColor;
float alpha = SeasonPlugin.isGhostTrain(cart) ? 0.5F : 1F;
for (int pass = 0; pass < 3; pass++) {
renderer.bindTex(textures[pass]);
int c = color[pass];
float dim = 1.0F;
float c1 = (float) (c >> 16 & 255) / 255.0F;
float c2 = (float) (c >> 8 & 255) / 255.0F;
float c3 = (float) (c & 255) / 255.0F;
OpenGL.glColor4f(c1 * dim, c2 * dim, c3 * dim, alpha);
model.render(cart, 0.0F, 0.0F, -0.1F, 0.0F, 0.0F, 0.0625F);
}
if (SeasonPlugin.isPolarExpress(cart)) {
renderer.bindTex(textures[3]);
snowLayer.render(cart, 0.0F, 0.0F, -0.1F, 0.0F, 0.0F, 0.0625F);
}
OpenGL.glPopAttrib();
if (emblemTexture != null) {
renderer.bindTex(emblemTexture);
Tessellator tess = Tessellator.getInstance();
BufferBuilder vertexBuffer = tess.getBuffer();
// float size = 0.22F;
// float offsetX = -0.25F;
// float offsetY = -0.25F;
// float offsetZ = -0.46F;
// TODO: Test this!
vertexBuffer.begin(GL11.GL_QUADS, DefaultVertexFormats.POSITION_TEX);
vertexBuffer.pos(emblemOffsetX - emblemSize, emblemOffsetY - emblemSize, emblemOffsetZ).tex(0, 0).endVertex();
vertexBuffer.pos(emblemOffsetX - emblemSize, emblemOffsetY + emblemSize, emblemOffsetZ).tex(0, 1).endVertex();
vertexBuffer.pos(emblemOffsetX + emblemSize, emblemOffsetY + emblemSize, emblemOffsetZ).tex(1, 1).endVertex();
vertexBuffer.pos(emblemOffsetX + emblemSize, emblemOffsetY + -emblemSize, emblemOffsetZ).tex(1, 0).endVertex();
vertexBuffer.pos(emblemOffsetX + emblemSize, emblemOffsetY + -emblemSize, -emblemOffsetZ).tex(0, 0).endVertex();
vertexBuffer.pos(emblemOffsetX + emblemSize, emblemOffsetY + emblemSize, -emblemOffsetZ).tex(0, 1).endVertex();
vertexBuffer.pos(emblemOffsetX - emblemSize, emblemOffsetY + emblemSize, -emblemOffsetZ).tex(1, 1).endVertex();
vertexBuffer.pos(emblemOffsetX - emblemSize, emblemOffsetY - emblemSize, -emblemOffsetZ).tex(1, 0).endVertex();
tess.draw();
}
// OpenGL.glDisable(GL11.GL_BLEND);
OpenGL.glPopMatrix();
}
}
|
Friday, 1 May 2015
Sir Run Run Shaw as he is known in the West was born in 1907 in Ningbo, China as Shao Ren Leng. Run Run Shaw was the youngest of seven children of Shaw Yuh Hsuen 邵玉軒 (1867 - 1920) and Wang Shun Xiang (1871 - 1939). He was widely known among Chinese diaspora for the Chinese entertainment industry with a Hong Kong-based television station, Television Broadcasts Ltd (TVB).
Run Run Shaw spent his childhood mostly in Shanghai, and received English education from the Shanghai YMCA School. Run Run Shaw career began in 1925, when he joined his eldest brother Runje Shaw's film company in Shanghai. Two years later he left Shanghai for Singapore to join his another brother, Runme Shaw's business involving distributing films in Malaya and Singapore. During the Japanese Occupation, the Shaw brothers' studio in Shanghai was badly destroyed, thus forcing the entire operations relocated to Hong Kong, where they were known as Shaw Brothers Studios.
Throughout 1940s until 1970s, the Shaw brothers were collectively known in both Malaya and Singapore as the largest proprietors in cinemas. Almost every Malayan towns had cinemas associated with the Shaws. In 1957, Run Run Shaw returned to Hong Kong and focussing mainly in Chinese entertainment. He reorganised the company and setup a permanent film production site at Clearwater Bay known as Shaw Movie Town. The Shaw brothers also ventured in producing Western films when competition became fierce in the 1970s. By the millennium, the Shaw brothers sold their collection of 760 classic productions to Celestial Pictures Ltd, and invested USD180 million project on film production facilities at Tseung Kwan O, Hong Kong.
In his later years, Run Run Shaw was known as a generous philanthropist. He had donated more than USD15 billion through his Sir Run Run Shaw Charitable Trust and the Shaw Foundations. He also founded the Shaw Prize, to award scientists in three research areas, astronomy, mathematics, and lift and medical sciences for their important discoveries and contributions towards human development.
Run Run Shaw died peacefully on 7 January 2014, leaving behind his wife, four children, nine grandchildren and several great-grandchildren. His funeral was attended by various Chinese Statesmen, including China's President Xi Jinping. He was cremated at the Cape Collinson Crematorium in Chai Wan, Hong Kong. |
BARRE — A Granite City man is facing another aggravated domestic assault charge after being convicted of the same charge against the same woman in February 2012.
Jason R. Batchelder, 28, pleaded not guilty to the felony Thursday in Washington County criminal court in Barre. If convicted, he faces a maximum of 15 years in prison and a $25,000 fine.
According to an affidavit, police went to Batchelder’s residence on Washington Street in March on a report of domestic assault. An officer said he could hear yelling coming from the residence and that as he entered, the woman came to him and said she had been assaulted.
She told police she had arrived to pick up some things and that Batchelder started arguing, pushed her and struck her in the head.
Batchelder told police he was on probation for the domestic assault conviction and was barred from having contact with the woman, according to the affidavit. He told police he and the woman started arguing and that she threw her phone at him.
Police said he told them that as he tried to get her out of the apartment, she grabbed his hand, and that when he pulled away she fell down.
Batchelder has a felony conviction listed as “conspiracy — drug,” but the records check did not elaborate. His many misdemeanor convictions include disorderly conduct, simple assault, leaving the scene of an accident, attempt to elude, disturbing the peace and two counts of unlawful mischief. |
After seeing "The Spectacular Now," it's no surprise that stars Miles Teller and Shailene Woodley won the Special Jury Prize for Acting when the film premiered at the Sundance Film Festival. The two star in a movie about a high school relationship, but their characters Sutter and Aimee resonate in a way that should connect especially well with adults.
"I think it's because we are dealing with all this subject matter honestly," Teller explains to Zap2it during an interview. "This is a point that everyone should be able to, or could relate to because it's like the end of high school. Like, it deals with that world appropriately. I think you're going to look in this in that our relationship is going to remind you of probably your first one that was really important and just kind of high school is coming to an end and what you deal with."
He adds, "It should bring back a lot of feelings."
But "The Spectacular Now" does more than just dredge up nostalgia for high school years. It also deals openly with issues of alcoholism and familial relations in a way different from how movies about the teenage experience usually do. It's no surprise that director James Ponsoldt's previous movie was "Smashed," a film about what happens when one half of an alcoholic couple decides to get sober. Woodley agrees that the way Ponsoldt treats the subject of alcohol in "The Spectacular Now" helps set it apart from other similar movies.
"The whole drinking thing I think is dealt so phenomenally in this film because in a lot of movies it's either a character and it's exaggerated or they sort of pretend that it doesn't exist," she says. "It does exist, but it's not something that teenagers exploit in high school. It's just something that's there, and when you're bored and when you grow up in a small town like both of us did, it just exists."
Woodley continues, "Relating that sort of back to my high school experience was really cool, and I just thought that the way that it was written and the way that James decided to portray it and chose to sort of ignore it and put it on the sidelines was really smart."
In addition to "The Spectacular Now," Woodley and Teller are starring together in the upcoming "Divergent." Instead of playing romantic leads in that film, they play enemies in the Dauntless faction -- or at least that's what we thought.
"As an actor, I feel very comfortable with Shailene because I know that when we do a scene together it's both of us trying to do the best scene possible, and I'm not going to try and direct her and vice versa," Teller explains of their working relationship. "But in ['The Spectacular Now'] I knew that we were kind of in love and then we fall out of love maybe, and then in 'Divergent' I know that I don't really like her so much -- but maybe there's something deeper there. Maybe I'm secretly in love with her."
He jokes that sometimes his directors have directed him to "be mad at [Woodley] and beat her up," to which he responds, "Okay." We noted that he roughs her characters up a bit in both "Divergent" and "The Spectacular Now," to which Woodley says she makes up for it by *"Divergent" spoiler alert* shooting his character in "Divergent." Just don't expect Teller or Woodley to be throwing up any spoiler alert warnings when they talk about the project.
"It's not a spoiler. It's in the book," Woodley argues. Teller agrees, "Like five million people know what happen."
He says of his stance on spoilers, "I just think this 'spoiler alert' thing is just such a buzz now. Yeah, if you don't want to see that -- if I don't want to know the score of a baseball game, I don't watch ESPN. You know, you just avoid those things." For Woodley, that means avoiding ice-skating and pole-vaulting scores as often as possible. (Yes, she is kidding.)
"The Spectacular Now" is in theaters today. "Divergent" is due out on March 21, 2014. |
The goal of this research project is to increase the understanding of the role of erythrocyte alpha-spectrin in both erythroid and non-erythroid murine tissues. Deficiencies of membrane-bound erythrocyte alpha-spectrin result in a severe hemolytic anemia in spherocytic mice and can cause a similar phenotype in humans. Histological examination of two of the spherocytic mutations in mice reveals evidence of thrombi, emboli, and infarctions in the brain and cardiac tissues that may be secondary effects of the anemia or primary effects of tissue-specific alpha-spectrin deficiency. It is known, for example that erythroid alpha-spectrin is present in the brain. Northern blot and in situ hybridization will be used to extend expression studies of the erythroid alpha-spectrin gene in normal erythroid and non-erythroid tissues. Similar analyses will be used to identify changes in erythroid alpha-spectrin gene expression in erythroid and non-erythroid tissues from spherocytic mice. Based upon the results of these analyses, RT-PCR, PCR, and sequencing will be used to identify the mutation in the alpha-spectrin gene associated with one of the spherocytic mutant mouse lines. Finally, bone marrow transplantation will be used to determine if the thrombi, emboli, and infarctions in the brain and heart tissues of spherocytic mice arise due to erythroid alpha-spectrin deficiency in hematopoietic cells. Further histological analyses will also be used to define the developmental age at which these histological anomalies occur. These studies will identify cell types in which a deficiency of erythrocyte alpha-spectrin alters structural integrity and function. |
Equity and efficiency preferences of health policy makers in China--a stated preference analysis.
Macroeconomic growth in China enables significant progress in health care and public health. It faces difficult choices regarding access, quality and affordability, while dealing with the increasing burden of chronic diseases. Policymakers are pressured to make complex decisions while implementing health strategies. This study shows how this process could be structured and reports the specific equity and efficiency preferences among Chinese policymakers. In total, 78 regional, provincial and national level policymakers with considerable experience participated in a discrete choice experiment, weighting the relative importance of six policy attributes describing equity and efficiency. Results from a conditional logistic model are presented for the six criteria, measuring the associated weights. Observed and unobserved heterogeneities were incorporated and tested in the model. Findings are used to give an example of ranking health interventions in relation to the present disease burden in China. In general, respondents showed strong preference for efficiency criteria i.e. total beneficiaries and cost-effectiveness as the most important attributes in decision making over equity criteria. Hence, priority interventions would be those conditions that are most prevalent in the country and cost least per health gain. Although efficiency criteria override equity ones, major health threats in China would be targeted. Multicriteria decision analysis makes explicit important trade-offs between efficiency and equity, leading to explicit, transparent and rational policy making. |
COMBO-FISH: specific labeling of nondenatured chromatin targets by computer-selected DNA oligonucleotide probe combinations.
Here we present the principle of fluorescence in situ hybridization (FISH) with combinatorial oligonucleotide (COMBO) probes as a new approach for the specific labeling of genomic sites. COMBO-FISH takes advantage of homopurine/homopyrimidine oligonucleotides that form triple helices with intact duplex genomic DNA, without the need for prior denaturation of the target sequence that is usually applied for probe binding in standard FISH protocols. An analysis of human genome databases has shown that homopurine/homopyrimidine sequences longer than 14 bp are nearly homogeneously distributed over the genome, and they represent from 1% to 2% of the entire genome. Because the observation volume in a confocal laser-scanning microscope equipped with a high numerical aperture lens typically corresponds to an approximate 250-kb chromatin domain in a normal mammalian cell nucleus, this volume should contain 150-200 homopurine/homopyrimidine stretches. Using DNA database information, one can configure a set of distinct, uniformly labeled oligonucleotide probes from these stretches that is expected to exclusively co-localize within a 250-kb chromatin domain. Due to the diffraction-limited resolution of a microscope, the fluorescence signals of the configured oligonucleotide probe set merge into a typical, nearly homogenous FISH spot. Using a set of 32 homopyrimidine probes, we performed experiments in the Abelson murine leukemia region of human chromosome 9 as some of the very first proofs-of-principle of COMBO-FISH. Although the experimental protocol currently contains several steps that are incompatible with living cell conditions, the theoretical approach may be the first methodological advance toward the long-term but still elusive goal of carrying out specific FISH in high-resolution fluorescence microscopy of vital cells. |
We are all about connecting to God and with each other. We do life together in groups, ministry in teams, and serve our community in partnership with others. Whether you are a kid, student, or adult, we have a variety of ways to engage and get connected.
We are all about connecting to God and with each other. We do life together in groups, ministry in teams, and serve our community in partnership with others. Whether you are a kid, student, or adult, we have a variety of ways to engage and get connected.
Having kids is one of the greatest joys, but not every day, as a parent, is roses and daisies. In fact, most days look like cheerios and snot, which is a reality we might forget about when dreaming about parenthood. Whether you’re a new parent or a seasoned mom or dad, having kids can be [...]
By Sucely De León, LPC-Intern at Lifeologie Counseling| 2019-09-04T14:49:51+00:00 September 4th, 2019|
Being a teenager is so hard. Really, being human is hard, period. Whether you are a teen or involved in a teen's life, you can attest to the fact that teen years are some of the most difficult to navigate. Being the parent, teacher, mentor, or even friend of a teenager has unique challenges. There [...]
The first day of school is around the corner. And it can be an exhausting time for parents! While parents are welcoming the return to routines, there is a lot to do to prepare your children to go back to school. No matter what this time of year looks like for you and your family, we [...]
Parenting. It strikes fear in the hearts of some, joy in others. Everyone has heard the old saying, “There are two things you don’t talk about at parties, politics and religion.” Parenting could easily be added to that list. Parenting styles change from generation to generation. They can be drastically different, even between siblings as they [...]
My husband, Tom, and I have had the privilege of raising three amazing daughters. We started “parenthood” in our early 20s and made plenty of mistakes along the way. To say we didn’t have a clue of what we were doing is a fair statement, and we remain in awe of the amazing women Brittney [...]
With nearly 400,000 children in our foster care system, there is a great need for foster parents who are willing to provide a safe, loving, and nurturing environment for children from broken homes. According to the Human Rights Campaign, children placed in foster care have experienced various issues such as the death of a parent/legal [...]
Many would describe our foster care system as broken. In the media, we hear about the abuse children face in foster care. Although some children in foster care experience abuse and neglect, there are a lot of amazing foster parents who are doing great things in the lives of the children who come from broken [...]
Single Parenting Struggles Only God knows what the future holds. We often find ourselves engulfed in unforeseen storms we never imagined possible. Single parenting is one of those storms we do not expect to face. That’s exactly what happened to me. One month into my forties—I found myself divorced with my two small girls—something I [...]
In a recent interview, I was asked to share top advice I believe helps children feel secure with their parents. If you had been asked, what might you have said? I answered that the way parents respond to children's dreams is key. I want children of all ages to dream. I want them to dream [...]
The United States Census Bureau reports that approximately 23% of children under the age of 18 live with a single mother. This is the second most common family arrangement in the U.S. (behind two-parent households). Although almost one-quarter of our children are living with a single mom, we often overlook them in our neighborhoods, in [...] |
With the ever increasing number of published manuscripts reporting peptide characterisation by reversed-phase chromatography coupled with mass spectrometric analysis, there is a pressing need to precisely define the instrument conditions used for these analyses. At present, instrument calibration and optimisation is performed on a laboratory-by laboratory basis, with no two facilities using the same criteria for instrument set-up. Many laboratories using multiple mass spectrometers for analysis of the same sample also use different standards for calibration and optimisation of the different instruments. In addition, the chromatographic conditions like solvents, solid-phase and elution gradient used for separation of peptides by reverse-phase are seldom the same. This makes both intra- and inter-laboratory comparisons of proteomics data almost impossible to perform with any degree of consistency.
EP 1 736 480 A1, Beynon et al., 2005 and Pratt et al., 2006 describe a Qcon-CAT methodology for the construction of tryptic peptide sequences but do not disclose a single polypeptide standard for optimising separation of peptides by reversed-phase chromatography and their detection and fragmentation by mass spectrometry, in addition to maintaining reproducibility in proteomics experiments, which requires that instrument parameters be optimised and standardised according to defined criteria. No single standard currently exists which can be used to assess instrument performance in this manner.
Thus there is still an existing need for such a single polypeptide standard. |
Partial resistance of low density lipoprotein to oxidation in vivo after increased intake of berries.
The health-promoting effects of fruit- and vegetable-based diets are known to be associated with their antioxidative components. We found in our preliminary in vitro laboratory tests that extracts of many common Finnish edible berries are potent scavengers of peroxyl radicals and inhibitors of lipid peroxidation. We therefore designed the current study to evaluate both the long-term (8 weeks) and short-term (5 hours) effects of increased intake of three berries on antioxidant potential and lipid peroxidation. Healthy 60-year-old men were randomized to berry, supplement and control groups (20 men in each group). The berry group ate, in addition to their normal diet, a 100 g portion of deep-frozen berries (bilberries, lingonberries, or black currants) daily for 8 weeks. The other groups ingested daily 100 mg of alpha-tocopherol and 500 mg of ascorbic acid (supplement group) or 500 mg of calcium gluconate (control group). In the short-term experiment 6 men ate 80 g of each of the three berries in one go. Serum ascorbate concentrations increased significantly in both the berry and the supplement group. Serum alpha-tocopherol levels and the antioxidant potential (TRAP) in low density lipoprotein (LDL) increased in the supplement group only. In the berry group, slightly lowered LDL diene conjugation (p = 0.074) and slightly increased total serum TRAP (p = 0.084) values were observed. No changes were found in these measures in the supplement or the control group. In the short-term experiment, LDL TRAP showed a small increase (about 10%, p = 0.039) during five hours after the intake of 240 g berries. The effects of consumption of berries on antioxidant potential and diene conjugation in LDL particles in vivo appear to be small. |
Donovan progressing from injury, status in question for LA's final two games
Donovan progressing from injury, status in question for LA's final two games
CARSON, Calif. -- Landon Donovan was back on the training ground on Friday for the first time since suffering a bone bruise in an Oct. 6 match against Real Salt Lake, but don't expect him to appear this Sunday against the San Jose Earthquakes.
On Friday, Donovan was admittedly on his own in training performing fitness work as he looks to return to action.
Following practice, Donovan admitted that while his condition is improving, it remains an ongoing process-- one that may prevent him from playing against San Jose.
"I'm getting better, progressing, it's a slow process, but I have a goal of being ready by the playoffs whenever that may start and that's what we're going to go," said Donovan. "This week, I would say is unlikely, but next weekend is TBD [To be determined] and after that we'll see.
"I've never had a bruise, but a bone bruise can be pretty painful and it's really just now letting it heal and dealing with the pain threshold," added Donovan. "I think that if we were in different circumstances, I'd just play through the pain, but the goal now is the playoffs and if it takes a missing a couple of games at the end of the season then it's better to be ready for the playoffs."
The Galaxy captain discusses more of his injury as well as the impact on the U.S. National Team below...
DONOVAN: "Well, the play happened and I had been dealing with that injury for about a month and I was kind of playing through the pain and figured that it was just similar. It subsided a little bit after the game, I had Sunday to rest and I thought that I would go and see how it was, so I got there and Ivan looked at me and he said, let's just be sure and get an MRI just to be sure. When he went in, we found there was pretty significant damage to the knee so I'm glad that we did it. I likely, could have tried to get better and played, but I'm glad that we had something to look at so that we could know that there was some pretty serious damage there."
(On what the previous injury was...)
DONOVAN: "Same, there was a bone bruise and also a PCL tear so that's been what has bothered me for the last couple of months."
(On when the injury surfaced…)
DONOVAN: “No, we were trying to pinpoint where it's from, but I've been in pain for a couple months and we weren't quite sure when any of those happened. One could have happened before the other, they could have happened simultaneously, it's hard to know."
(On whether he’ll require surgery in the offseason…)
DONOVAN: “We'll see, we're not sure yet."
(On where he experienced the injury and whether or not it happened during the Mexico friendly in August...)
DONOVAN: “Since the injury in the Mexico game, I've had all sorts of stuff with this leg...It's possible, I don't think it did, I think that it was probably on the way back from that and then as I recovered from that, something probably happened so hard to know." |
The ladies masters athletes from the SMTFA competing at the Flash Athletic Meet in Oct at the Bishan Stadium.
11/05/2008
Melamine in our backyard?
While the world is engrossed in the melamine scare, do we have the same problem in our backyard? I am not too sure. From some of the snippets that I have heard, the story goes like this. In order to keep goreng pisang and fried chicken wings from turning limp after hours on the shelf, the hawkers just throw a plastic bottle into the boiling oil before throwing in the pisang and chicken wing. And the melted plastic, probably melamine, will coat these foodstuff with a layer of plastic to keep them hard and firm. When you bite into them you know that it is not the natural crispyness, but hardness.
The AVA should take a look at the pasar malam stalls selling such products and ensure that they are not plastic or melamine coated.
1 comment:
Anonymous
said...
Ah, the AVA will tell Singaporeans everything is safe because we have a world class system in place etc etc. Did they not tell us that the recent melamine scare in China did not affect products sold in Singapore, when it was first reported.
Luckily I did not swallow that assurance. Just trust yourself and avoid such stuff when rumours swirl around them. Quite often the rumours turn out to be true. Only thing is we still live in a world of denial.
The happenings in the Ang Mo Kio Town Council are outrageous. I am not going to elaborate as the details are everywhere. The similarities be...
Headphones
Electronics
ebay
Disclaimer
As owner of this blog, I bear no responsibility to what other contributors/bloggers may post. I encourage all to speak freely without indulging in libel or defamatory content. Anyone who feels offended by any posting can email me and I will remove the offending article if appropriate. Contact me at redbeansg@yahoo.com |
Immunoglobulin-induced hemolysis, splenomegaly and inflammation in patients with antibody deficiencies.
IgG replacement for primary antibody deficiencies is a safe treatment administered to prevent recurrent infections and reduce mortality. Recently, several reports described acute hemolytic episodes following IgG administration due to a passive transfer of blood group alloantibodies, including anti-A, anti-B, as well as anti-Rh antibodies. Here, we reviewed and discussed the consequences of passively transferred RBCs antibodies. The chronic passive transfer of alloantibodies might also cause a subclinical condition due to a compensated extravascular chronic hemolysis with poorly understood consequences. This phenomenon might possibly represent an unrecognized cause of splenomegaly and might contribute to inflammation in patients with primary antibody deficiencies. |
Q:
Node.js socket ended by other party
I have a TCP server based on Node.js. When new sockets are connected, I wrap them in a client object:
net.createServer(function(socket){
socket.setEncoding("utf8");
socket.name = socket.remoteAddress + ':' + socket.remotePort;
var client = cm.create(socket);
}).listen(this.settings.port);
When the client disconnects, how can I prevent myself from writing to the socket? I know there are events such as 'close', 'error', and 'end', but I cannot figure out how these will help me.
As far as I understand, these events will only trigger when I try to write data to the closed socket. But by that time, the error is thrown....
A:
It seems that just handling the error event itself prevents the unhandlered error exception. Who would have thought?
client.socket.on('error', function(){
console.log("CLIENT HAS ERRORED")
});
This prevents the node app from dying.
|
Dispatchers for the Evansdale police and Black Hawk County Sheriff's Office said crews would renew efforts to find the girls on Monday. Authorities have been dredging the lake and interviewing family, friends and registered sex offenders who live in the area.
The mothers of both girls said they were trying to stay strong.
"Today I'm feeling pretty good," Misty Cook-Morrissey said Sunday. "Sometimes, when you think about it, you wonder if they're dead somewhere, but you try to push those thoughts out of your mind."
Cook-Morrissey said she was grateful for the community support in Evansdale, a Waterloo suburb in northeast Iowa.
"It's been good talking to people," she said. "It keeps your mind off of what's happening."
Black Hawk County Sheriff's deputy Rick Abben said officials were "grasping for straws."
Cook-Morrissey said her daughter might have tried to swim at the lake, despite a swimming ban. She said the family swims at another nearby lake regularly, and described Lyric as a good swimmer.
Elizabeth's mother, Heather Collins, said it's rare for her daughter to venture too far from home, but she may have been persuaded by her older cousin.
"We've talked about that before," Collins said "We've told them they're too young to go far."
Misty Cook-Morrissey and Heather Collins are sisters.
Have you found an error or omission in our reporting? Is there other feedback and/or ideas you want to share with us? Tell us
here. |
Q:
How do I figure out the balance of an individual address on Bitcoin for Android?
I have just installed the bitcoin wallet for android on my device and created two addresses.
I transferred some BTC to one address and some to the second one. I thought the wallet will show the individual balance associated with each of those addresses, but I was wrong. Bitcoin wallet is now showing me one single balance for the BTC associated with these two addresses.
My question is, I assume that since I cannot send BTC out of each address for more than what it owns in the address (for example, address A - 0.5 BTC, address B - 1.5 BTC), I cannot send 1 BTC out of address A. But now since bitcoin wallet is mixing the two together I am unable to find out how much BTC each of them own...
Or there is some other way that I am not aware of?
A:
You are trying to use addresses for accounting, but they aren't designed for that.
What you actually want is the accounts feature of bitcoind, though I doubt any mobile wallet implements such a thing.
If you say explicitly why do you think you need to do that, someone might have an answer. Meanwhile, just use the whole balance, and create a new address for each incoming payment, without worrying about specific address balances.
|
Leonardo Fernández (Uruguayan footballer)
Leonardo Cecilio Fernández López (born 1 October 1998) is a Uruguayan footballer who plays as an attacking midfielder for Mexican side Toluca on loan from Tigres UANL.
Club career
Born in Montevideo, Fernández joined Fénix's youth setup in 2011, from lowly CSyD Amanecer. On 31 May 2015, aged just 16, he made his first team – and Primera División – debut, coming on as a late substitute for Martín Ligüera in a 2–0 away loss against Peñarol.
After spending his first two seasons as a backup, Fernández started to appear regularly from the 2017 campaign onwards. He scored his first professional goal on 25 March of that year, netting the winner in a 2–1 home defeat of El Tanque Sisley.
On 4 March 2018, Fernández scored a brace in a 3–2 defeat to Defensor Sporting. On 29 July, he scored a hat-trick in a 5–0 away routing of Cerro, and finished the campaign with 11 goals, playing a key part as his side narrowly avoided relegation.
On 24 June 2019, he joined Tigres UANL for the pre-season but was later loaned to Club Universidad de Chile.
On 12 December 2019, Fernández joined Mexican club Toluca on loan from Tigres UANL without a right to buy the footballer.
On 2020, he won player of the month of January in the Liga MX.
Career statistics
References
External links
Category:1998 births
Category:Living people
Category:Sportspeople from Montevideo
Category:Uruguayan footballers
Category:Uruguay youth international footballers
Category:Association football midfielders
Category:Uruguayan Primera División players
Category:Liga MX players
Category:Centro Atlético Fénix players
Category:Tigres UANL footballers
Category:Deportivo Toluca F.C. players |
When a Solaris server is overloaded, this is one way to check what actual memory each process is using. Here I am restricting the checks to one user (“steve”) but by omitting the “-u steve” flag to ps, the whole system will be checked.
Wow, it’s been nearly two months since I last made a post about the upcoming book on shell scripting. I’m really sorry, I had intended to give much more real-time updates here. The book focusses on GNU/Linux and the Bash shell in particular, but it does cover the other environments too – Solaris, Bourne Shell, as well as mentions for ksh, zsh, *BSD and the rest of the Unix family.
In terms of page count, it is currently 89% finished. There is still the proof-reading to be done, and whatever delivery details the publishers need to deal with, so the availability date of some time in August is still on schedule. I notice that http://amzn.com/1118024486 is already offering a massive discount on the cover price; I have no idea what that is about, I’m trying not to take offence – they can’t have dismissed the book already as I have not quite finished writing it yet! So hopefully you can get a bargain while it’s cheap.
The subject matter has the potential to be quite boring if presented as a list of tedious system administration tasks, so I have tried to make it light and fun whenever I can; it’s still with Legal at the moment, but I hope to have a Space Invaders clone written entirely in the shell published in the book. People don’t tend to see the Shell as being capable of doing anything interactive at all, so it is nice to write a playable interactive game in the shell. The main problem in terms of playability is in working out how much to slow it down, and at what stage! Of course, being a shell script, you can tweak the starting value, the level at which it speeds up, and anything else about the gameplay. If the game doesn’t make it in to the book, I’ll post it here anyway, and will welcome your contributions on gameplay.
Other than games, I’ve got recipes for init scripts, conditional execution, translating scripts into other (human) languages, even writing CGI scripts in the shell. There is coverage of arrays, functions, libraries, process control, wildcards and filename expansion, pipes and pipelines, exec and redirection of input and output; this book aims to cover pretty much all that you need to know about shell scripting without being a tedious list of what the bash shell can do.
There is a status page at http://sgpit.com/book which also has order information; you can pre-order your copy from there.
IBM’s DeveloperWorks has 10 Good Unix Habits, which apply to GNU/Linux at least as much as to Unix.
I would expect that most experienced admins can second-guess the content to 5-7 of these 10 points, just from the title (for example, item 1 is a reference to “mkdir -p”, plus another related syntax available to Bash users). I would be surprised if you knew all ten:
1. Make directory trees in a single swipe.
2. Change the path; do not move the archive.
3. Combine your commands with control operators.
4. Quote variables with caution.
5. Use escape sequences to manage long input.
6. Group your commands together in a list.
7. Use xargs outside of find .
8. Know when grep should do the counting — and when it should step aside.
9. Match certain fields in output, not just lines.
10. Stop piping cats.
http://www.tuxradar.com/content/command-line-tricks-smart-geeks has some useful tricks. A lot of it is presented as being bash-specific, but isn’t. Also, a lot seems Linux-specific, but isn’t. Lots of useful info for all Unix/Linux admins here. These hints go on and on; hardly any of them are the generic stuff you often see on Ubuntu forums, stumbleupon, and so on.
A serious publisher has contacted me about writing a serious book about Linux shell programming.
It is all really very serious. I’m not used to being serious, as you can probably tell from the fact that I have now used the word “serious” four times in this three-sentence post.
I am rather keen to write a book on the subject, not because I’m vain, or desperate for money, but because the stuff I have seen out there in dead-tree format has been of rather low quality. Also because of all the emails I’ve received over the years, they have all been positive, and none has said anything along the lines of “I didn’t need any of that because I bought Book[X]”, or indeed any book. People have emailed me, asking for advice as to what book to buy, and I have been unable to recommend any book that I have seen.
So:
What would you like to see in your ideal book about UNIX / Linux shell scripting, be it Bourne, Bash, ksh, tcsh, zsh, whatever?
Please don’t be timid; if you want to know how to work out how many nose-flutes can be fitted into the area of a Boeing 757, you won’t be anything like as strange as some of the correspondants I’ve had over the years, so please, tell me what is bugging you, what has bugged you, or even what you think might be likely to bug you in days / months / years to come.
I’m likely to answer any specific questions here and now, whether or not they end up in the book, but anything you’d like to see in a book, too… post that here, and I’ll have a stab at it.
Also, I would of course be interested to know if you have found any useful books on or around the subject, and what they did particularly well. |
/*
* Copyright 2010 Facebook
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
#import "PF_FBLoginDialog.h"
#import "PF_FBRequest.h"
@protocol PF_FBSessionDelegate;
/**
* Main Facebook interface for interacting with the Facebook developer API.
* Provides methods to log in and log out a user, make requests using the REST
* and Graph APIs, and start user interface interactions (such as
* pop-ups promoting for credentials, permissions, stream posts, etc.)
*/
@interface PF_Facebook : NSObject<PF_FBLoginDialogDelegate>{
NSString* _accessToken;
NSDate* _expirationDate;
id<PF_FBSessionDelegate> _sessionDelegate;
PF_FBRequest* _request;
PF_FBDialog* _loginDialog;
PF_FBDialog* _fbDialog;
NSString* _appId;
NSString* _localAppId;
NSArray* _permissions;
}
@property(nonatomic, copy) NSString* accessToken;
@property(nonatomic, copy) NSDate* expirationDate;
@property(nonatomic, assign) id<PF_FBSessionDelegate> sessionDelegate;
@property(nonatomic, copy) NSString* localAppId;
- (id)initWithAppId:(NSString *)appId
andDelegate:(id<PF_FBSessionDelegate>)delegate;
- (void)authorize:(NSArray *)permissions;
- (void)authorize:(NSArray *)permissions
localAppId:(NSString *)localAppId;
- (BOOL)handleOpenURL:(NSURL *)url;
- (void)logout:(id<PF_FBSessionDelegate>)delegate;
- (PF_FBRequest*)requestWithParams:(NSMutableDictionary *)params
andDelegate:(id <PF_FBRequestDelegate>)delegate;
- (PF_FBRequest*)requestWithMethodName:(NSString *)methodName
andParams:(NSMutableDictionary *)params
andHttpMethod:(NSString *)httpMethod
andDelegate:(id <PF_FBRequestDelegate>)delegate;
- (PF_FBRequest*)requestWithGraphPath:(NSString *)graphPath
andDelegate:(id <PF_FBRequestDelegate>)delegate;
- (PF_FBRequest*)requestWithGraphPath:(NSString *)graphPath
andParams:(NSMutableDictionary *)params
andDelegate:(id <PF_FBRequestDelegate>)delegate;
- (PF_FBRequest*)requestWithGraphPath:(NSString *)graphPath
andParams:(NSMutableDictionary *)params
andHttpMethod:(NSString *)httpMethod
andDelegate:(id <PF_FBRequestDelegate>)delegate;
- (void)dialog:(NSString *)action
andDelegate:(id<PF_FBDialogDelegate>)delegate;
- (void)dialog:(NSString *)action
andParams:(NSMutableDictionary *)params
andDelegate:(id <PF_FBDialogDelegate>)delegate;
- (BOOL)isSessionValid;
@end
////////////////////////////////////////////////////////////////////////////////
/**
* Your application should implement this delegate to receive session callbacks.
*/
@protocol PF_FBSessionDelegate <NSObject>
@optional
/**
* Called when the user successfully logged in.
*/
- (void)fbDidLogin;
/**
* Called when the user dismissed the dialog without logging in.
*/
- (void)fbDidNotLogin:(BOOL)cancelled;
/**
* Called when the user logged out.
*/
- (void)fbDidLogout;
@end
|
Feel as great as you look with new casual dresses from Vero Moda. The selection of dresses for women contains everything from stylish day dresses to casual maxi dresses. Explore the inspiring trends from the new collection and get ready for the new season in the most beautiful way. Let yourself be seduced by the floral maxi dress in bright colours and update your wardrobe with a comfortable black dress – a key item that's perfect for both everyday and weekend use. For the office and for your workwear wardrobe you can also find new must-haves. Our suggestion is the white dress, which can be dressed down or up according to your mood and the occasion. Wear it with one of our long cardigans for work and style it up with a few accessories if you’re planning a night out. Otherwise you can always visit our category of party dresses. These are our favourites. What styles do you plan on adding to your personal collection? |
Q:
Проверка логера на root в log4j2
Logger logger=LogManager.getLogger(Test.class);
Помогите реализовать проверку, получил ли я логгер с настройками Root, или нет
A:
Нашел следующий способ:
var root = LoggerContext.getContext().getConfiguration().getLoggerConfig(LoggerConfig.ROOT);
var log = LoggerContext.getContext().getConfiguration().getLoggerConfig(Test.class.getName());
root.equals(log);
И ещё один:
LoggerContext.getContext().getConfiguration().getLoggers().containsKey(Test.class.getName())
|
You are here
It's Official! Seventh Generation is a Rockstar!
Our fans have known all along that Seventh Generation rocks, but now we have the award to prove it! We are delighted to be one of only three companies nationally to be recognized as a 'Rockstar of the New Economy' by B Corps, earning their Lifetime Achievement Award.
"Rockstars inspire us; they make us think, 'That's awesome! I want to do that,'" says Jay Coen Gilbert, co-founder of B Lab, the nonprofit that chose this year’s 'Rockstars.' "These Rockstars paved the way for a growing community of green, responsible, and sustainable businesses who define their success not just by their financial growth, but also by their social impact."
Katie Kerr of B Lab explains that Seventh Generation was chosen because of its, "consistent commitment to mission despite ups and downs in the business cycle. By highlighting companies like yours, we hope to inspire the rest of the business community to measure their impact and work to improve our world."
You can read more about Seventh Generation and other Rockstars in a Fast Company article announcing the honor. Since it's Rockstars of the New Economy, Fast Company compared the companies to iconic rockstar legends. Seventh Generation was compared to The Who.
Our CEO, John Replogle, said of the honor, "This is a tremendous way to kick-off our twenty-fifth year in business. We only hope that we can continue to inspire a consumer revolution to nurture the health of the next seven generations, so we can see the environmental impacts of our products on an even larger scale."
The Fast Company article also noted that Seventh Generation product sales in 2011 alone helped save 77,000 trees, 28 million gallons of water, and enough energy to heat 1,700 U.S. homes for a year. We also prevented 35,000 pounds of chlorine and 52,000 pounds of volatile organic compounds (VOCs) from being released into the environment. Between 2010 and 2011 Seventh Generation decreased normalized greenhouse gas emissions by 8%, a change whose impact is equivalent to the removal of 283 cars from the road for a year. All told, since 1999, our product sales have saved nearly 523,000 trees or 1.8 million barrels of petroleum.
B Corps are a new kind of company using the power of business to solve social and environmental problems. Today, there is a growing community of more than 600 Certified B Corps from 15 countries and 60 industries working together toward 1 unifying goal: to redefine success in business.
By voluntarily meeting higher standards of transparency, accountability, and performance, Certified B Corps like Seventh Generation are distinguishing themselves in a cluttered marketplace by offering a positive vision of a better way to do business. |
click image Photo via Joe Shlabotnik on Flickr.
The results are in: Orlando is one of the fastest-growing metro areas in the country.According to, Orlando is No. 2 in the country, just behind Cape Coral, in its ranking of the country's fastest-growing metropolitan cities.Every year,compiles a list of America's fastest-growing cities in an effort to give a "holistic picture" of places on the upswing.The magazine uses data provided by Moody's Analytics to compare the country's 100 largest metropolitan statistical areas in measures such as population, employment, wages, economic output and home values, coming up with a ranking of the top 25.Florida cities dominate the list with nine out of 25, more than any other state. Six of those cities are included in the list's top 10.The Cape Coral-Fort Myers area took the top spot, with a population increase of 3.39 percent and a projected growth rate of 3.61 percent for 2017.The Orlando-Kissimmee-Sanford area ranks No. 2 on the list, but was No. 1 in job growth for 2016 at 4.57 percent. That growth is expected to decrease a bit this year however, with a projected rate of 3.54 percent.The Deltona-Daytona Beach-Ormond Beach area, Jacksonville, the North Port-Sarasota-Bradenton area, and the Tampa-St. Petersburg-Clearwater area also made the top 10. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.