text
stringlengths
8
5.77M
How to make a telescope’s control room a happy place When building a optical telescope, there’s more to consider than just lenses and high-end processors. The human element – the people that will actually work with it – also needs to be considered, for instance when designing the telescope’s control room. Christopher Justin Hendrickse, a lecturer in Product/Industrial Design at the Cape Peninsula University of Technology shares his experiences in doing so in an article from The Conversation Africa. The stars are an incredible source of information. Their patterns indicate when seeds should be sown or crops harvested. Their movements tell us that the seasons are changing. But it’s not just amateur enthusiasts or farmers with no scientific training who watch the stars. Technology has redefined the professional field of astronomy. Pioneering telescope designs have allowed professional astronomers to unravel ever more complex questions about the universe and its mysteries. These complicated telescopes require extremely complex control rooms. A control room is usually located in the same building as the telescope, though it is separate from the actual telescope. It tends to feature multiple computers, each with at least one screen, a mouse and a keyboard; radio monitors; weather instrument displays; comfortable chairs; a bathroom and sometimes a small kitchen. This is where the telescope operator and one or more astronomers will spend their days (and, given the nature of their work, nights too). SALT is located on a remote plateau with a high altitude and dark unpolluted skies, not far from the town of Sutherland in the Karoo. During the late 1980s, astronomers in South Africa found it increasingly difficult to keep up with the international astronomy community because the largest South African Astronomical Observatory telescope was only 1.9m. Spectroscopic investigations of Cepheids and stars belonging to open clusters and associations Then some South African stakeholders had the unique opportunity to review the completed Hobby-Eberly Telescope (HET) at the McDonald Observatory in Texas. This lead to the construction of the SALT: a larger, revised version of the HET with an 11m primary mirror. It’s been fully operational since 2011. What I discovered during my research was that there are two different professional communities involved with SALT – and neither understands the other’s needs. Engineers developed the hardware that makes the SALT control room tick. They also provide ongoing maintenance. But the research emerging from that control room is conducted by astronomers. While the control room is very technically functional, the astronomers find it complex and counter-intuitive to their needs. These insights confirm why the role of technical infrastructure and its impact on work flow require coherent design approaches. Designers develop intelligent adaptive systems that take users’ expectations into account, support individual differences and capture the users’ intent. There are entire companies dedicated to control room design – but very little research about how design can be applied to telescopes’ control rooms. A new approach My research aimed to improve the SALT control room’s usability. These sorts of practical interventions are important. We need to understand how people interact with the new technologies entering human work spaces so that efficient and productive control rooms can be designed. The project had two sections. The first was a design ethnographic study. I wanted to observe work flows and talk to astronomers to understand their concerns and problems. This meant spending approximately 300 hours in the SALT control room. After many hours observing and speaking with different astronomers and telescope operators in the control room, I identified some common complaints. The astronomers found it difficult to manage the use of multiple screens and input devices like keyboards and mouses. This set up made technical sense to the engineers, but resulted in a confusing, cluttered work area for the astronomers. I explored different ways to address the problem. First, we combined all the elements into single units (so one monitor, keyboard and mouse per work station). Some people really liked this approach and found it worked for them. Others struggled to adapt. I then tried a really simple approach: I colour coordinated each computer screen, mouse and keyboard with self-adhesive vinyl. This helped the astronomer to quickly identify which computer they were working on; before, they often grabbed the incorrect keyboard or mouse or tried to work across computer screens that were not connected. Everyone was very happy with the results, and told me the colour coordination had dramatically reduced their frustration and actually improved productivity in the control room. I made a few other small changes in consultation with the astronomers. We improved the telescope’s notification system, which is the software used to give the user an audio alert when it has completed a procedure. Some of the astronomers found it annoying and wanted the option to mute it in favour of an alternate notification method. We also mounted computer screens on adjustable brackets so that users of different heights could set the monitor to their liking. This helped improve posture, which also contributed to productivity and satisfaction at work. Happier work spaces Much of what I did was rather intuitive and simple. But the result, in the long term, is an improved work space. It was also driven by the astronomers and that contributes to their sense of owning and enjoying the space they occupy every day. Control rooms – whether they’re linked to nuclear power plants, air traffic centres or telescopes – are the interfaces of technology and human decision making. They work best when those working in them don’t have to worry about what’s happening on their desks and can focus on their work – and, in the case of the SALT astronomers, keep searching the stars for secrets. SciBraai, a proudly South African NPO dedicated to science journalism, communication and outreach. SciBraai began on Heritage Day 2013 - Anina Mumm and Engela Duvenage in 2013 launched the website, scibraai.co.za, to feature stories about South African research, technology and innovation, and the people behind the discoveries. This blog welcomes all South Africans to go behind the scenes of local science and exploration endeavors. It’s a place to share stories about the scientists themselves and the interesting, little-known activities that are often left out of research journals. A place to learn more about the stuff that makes South African science and its people tick. A place to feel inspired about what South Africans are discovering on home soil and abroad. Because local is lekker, no matter what language you use. SciBraai's following has grown in the past years, and we are now on Facebook, Twitter and Instagram. We've also begun organising real-life braai's where we share round-the-fire stories about South African science and scientists. SciBraai on Social Media: Add SciBraai to your RSS Reader: Permissions beyond the scope of this license may be available at scibraai.co.za. Where images and material are supplied by rights holders outside of SciBraai, original publishing licences are indicated and unaffected. For more information on CC in South Africa or to implement a CC license for your site, contact Kelsey Wiens (@bella_velo), Creative Commons Lead for SA.
3-D Coordinate Vector Transformation Date: 8/27/96 at 1:37:56 From: Anonymous Subject: 3-D Coordinate Vector Transformation What is the approach to take for transforming one coordinate system to another where it isn't just a translation transformation but also rotations and even reflections? The general case is where one would have two coordinate systems, each defined by its origin, and three orthogonal vectors defining x,y,z axes.
Q: Button Click from JS after page reload only works does not work consistently I have an ASP.Net web app and a part I'm working on is made up three pages: Main Page, Search User Page and Edit User Page. The workflow is as follows: Login and go to the Main Page. (Works Fine!) Go to Search User Page and search for users based on some criteria. (Works Fine!) Click on a user on the search result table and go to the Edit User Page with the user info populated. (Works Fine!) Press a "Save and Go Back" button and go back to the search results. The expected behavior is for the search page to reload the search results (and hence if the user attributes are changed in a way that they do not meet the search criteria they are not displayed. (This works Funky!) This is how the logic works: In EditUserInfo.aspx.cs I have: public partial class EditUserInfo: basePage{ protected void Page_Load(object sender, EventArgs e) { } protected void btnSaveAndGoBack_Click(object sender, EventArgs e) { //Save/Update User Data Session["SearchAfterLoad"] = true; ClientScript.RegisterStartupScript("string".GetType(), "goBack", "<script type=\"\"text/javascript\"\" language=\"\"javascript\"\">window.history.go(-2);</script>"); } In SearchUsersPage.aspx.cs I have: public partial class SearchUsersPage: basePage{ public string SearchAfterLoad{ get { if (Session["SearchAfterLoad"] != null) { return Session["SearchAfterLoad"].ToString();} else { return String.Empty; } } } } protected void Page_Load(object sender, EventArgs e) { } protected void btnSearch_Click(object sender, EventArgs e) { /*all the logic to use the UI elements to search and populate the users in a table*/ Session["SearchAfterLoad"] = false; } in SearchUsersPage.aspx I have: <script type="text/javascript"> $(document).ready(function () { var clickButton = document.getElementById("<%= btnSearch.ClientID %>"); if ("<%=SearchAfterLoad%>" == "True") { clickButton.click(); } }); </script> My issue is: When debugging through Visual Studio (2019, 16.4.0), the logic works perfectly. However! When I open the browser and navigate to my localhost (running on local iis) to test this, it will NOT click that search button and the search results do not get updated. Other observations: This works fine on my colleague's PC with the same windows and the same VS fine no matter if we are debugging or just visiting the localhost. However it does not run when deployed to our test server. It seems the first time we navigate to the search page, the if statement in the document.ready() function translates to: if ("" == "True") and never gets updated/re-rendered to if("True" == "True") when we go back to that page from the edit user page. P.S. Session["SearchAfterLoad"] is preserved and not lost when I move back and forth between the pages (but to be honest I have only verified it when in debug mode) Things That I have tried: In the btnSaveAndGoBack_Click() function called the URL directly by putting it into Response.Redirect() or by assigning it to window.location.href but then the search page is loaded fresh with no search criteria populated in its UI (just like visiting it the first time ever) Play with SessionStateServer and ASP.Net Session Manager, These dont have any effect. Looking forward: Any good hint as to what the problem could be. Or, Or get the iis/ or whoever in charge to rebuild that page when we go back to it so I get my if("True" == "True") . For all other fool-proof ways to trigger that button click. Or, Any alternate way of going back and forth between the pages that saves me all the headache! A: The problem in my code was calling go back right after assigning a session variable which caused the session variable to reset.
Hospital women On Thursday, “Grey’s Anatomy” premiered its latest episode, “Silent All These Years.” Inspired by the current conversation on sexual violence and Christine Blasey Ford’s testimony during Brett Kavanaugh’s confirmation hearings in 2018, the hit medical TV show put rape survivors and consent front and center. The story follows Abby (Khalilah Joi), who arrives at the hospital after being sexually assaulted outside of a bar. When she arrives at the hospital, resident doctor Teddy (Kim Raver) must administer a rape kit, which includes taking photos, swabs and collecting other samples from the survivor. Initially, the extensive details of the rape kit were met with pushback from ABC’s Standards and Practices department, according to the episode’s writer Elisabeth Finch and “Grey’s” showrunner Krista Vernoff. After a rebuttal from Shonda Rhimes, ABC changed its stance. Vernoff explained in a Hollywood Reporter interview: They give these standard notes: ‘don’t be too gory’; ‘don’t be too explicit in your language’; ‘no side boob.’ But the ones we got on this script included, ‘Please don’t show any fluid on the Q-tips’ and ‘Please don’t show any body fluids under the blue lights.’ Shonda wrote back a pretty passionate response of the myriad ways that networks are willing to show actual violence but that what we were doing here was the medical process that happens in the wake of violence and they were trying to tell us we couldn’t show it. She said, ‘Respectfully, I decline these notes.’ Ultimately, ABC understood that she was right. Related:​ We Need to Talk About Sexual Harassment on Flights According to The Hollywood Reporter, the episode is one of the most comprehensive depictions of what it’s like to get a rape kit ever shown on TV. Following legal protocol, Teddy gets Abby’s affirmative consent before each step in the process, asking “Are you ready?” As Abby is wheeled off to surgery to repair a tear in her diaphragm, the result of her assault, women of Grey Sloan Memorial Hospital line the walls of the hallway in a silent salute to Abby and her experience. Story continues Finch said she titled the episode after a Tori Amos song that reminded her of a friend’s experience with sexual violence. “I named this episode ‘Silent All These Years’ bc when my friend was raped in college I didn’t know how to help,” Finch said. “But days before I’d gone to a @toriamos concert and took a @RAINN bumper sticker they were handing out. Thank you RAINN and Ms. Amos for helping my friend.” Related:​ The Alternative to Calling People With Mental Illness ‘Attention Seekers’ I named this episode “Silent All These Years” bc when my friend was raped in college I didn’t know how to help. But days before I’d gone to a @toriamos concert and took a @RAINN bumper sticker they were handing out. Thank you RAINN and Ms.Amos for helping my friend. #GreysAnatomy https://t.co/aolkZKbPm6 — Elisabeth R. Finch (@erfinchie) March 29, 2019 From there, Finch reflected on her experience watching Blasey Ford testify about her alleged assault. “I felt that the most damaging thing that happened in all that is that young women and men everywhere were told that consent was irrelevant,” Finch told The Hollywood Reporter. She then wrote the episode and its ground-breaking rape kit scene. Related:​ 7 Tips for Getting Started With Mindfulness (Without Meditating) Finch also revealed that the hallway scene was inspired by what she had seen doctors do when an organ donor is wheeled through the hospitals — the doctors line the hallways in their honor. She wanted to do something similar in this episode to honor Abby’s experience and by extension, all sexual assault survivors. Vernoff said the female staff members of the “Grey’s Anatomy” production team and production company Shondaland wanted to be involved. “That hallway contains nearly the entire female writing staff [of “Grey’s”]. It contains exec producers on the show, exec producers in Shondaland, most of our female crewmembers,” Vernoff said. “That entire hallway is Shondaland women and that is because they wanted to do it. So many women came up to us … and asked if they could be in that scene.” The episode wove the theme of sexual assault and its many impacts throughout the rest of the episode as well. “Grey’s” doctor Jo Wilson (Camilla Luddington) learns her mother abandoned her because she was raped. Jo had an abortion while in an abusive relationship. Doctor Ben Warren (Jason Winston George) teaches his stepson about consent. Creators also made it clear that people of all genders are assaulted. According to Vernoff and Finch, the goal was to illustrate the impact of trauma on survivors, their loved ones and the importance of consent in relationships. “We have to do something about consent and try to do our part to explain what consent is and how impactful rape is and how it can damage people for years, decades and generations,” Vernoff said. “I hope viewers walk away with a greater understanding of what consent means.” If you or a loved one is affected by sexual abuse or assault and need help, call the National Sexual Assault Telephone Hotline at 1-800-656-4673 to be connected with a trained staff member from a sexual assault service provider in your area. Read more stories like this on The Mighty: When Gaslighting Abuse Happens in What You Think Is a Healthy Relationship Why Big Sean Sought This 'Traditional' Mental Health Treatment Over Meditation How Growing Up Without a Sense of Identity Affects My Mental Health
Indie film "Beasts" a fearless success Christine Kearney 5 Min Read NEW YORK (Reuters) - On the first day newcomer director Benh Zeitlin began shooting his mythical, apocalyptic low-budget film, “Beasts of the Southern Wild,” he had a real life disaster to deal with - the 2010 BP oil spill in the Gulf of Mexico. Film director Benh Zeitlin poses for a portrait in New York, June 27, 2012. REUTERS/Keith Bedford The sense of impending danger only served to heighten the rugged, mystical tension Zeitlin was aiming for in his acclaimed indie film that stars non-actors as a father and daughter facing environmental threats on the impoverished watery fringes of southern Louisiana. “The oil spill happening created this sort of strange, life imitates art on set that was going on as we were shooting,” Zeitlin told Reuters in an interview for the film that opens in the United States on Wednesday. “The whole time you would wake up in the morning and check the oil and it would get closer and closer ... it was really eerie.” But the struggles to make Zeitlin’s debut feature film have clearly paid off. “Beasts” has had a dream run this year, coming from nowhere to win best film at the Sundance Film Festival to the Cannes festival where it won best debut. And just last week, it won the audience award for best narrative feature at the Los Angeles Film Festival. Influential American critic Todd McCarthy initially called it “one of the most striking films ever to debut” at Sundance, adding that “Zeitlin’s directorial debut could serve as a poster child for everything American independent cinema aspires to be but so seldom is.” Zeitlin, 29, who co-wrote and directed the feature after his 2008 25-minute short film “Glory at Sea” was made in reaction to Hurricane Katrina, likened all the praise to “just like falling off a cliff.” “It was a great feeling when we sort of started to realize that the film was speaking; people were understanding what it was trying to do,” he said. “The farther away from Louisiana you go, the more it plays as a fantasy movie.” HUSHPUPPY A FEARLESS HERO “Beasts,” filmed in a poetic, cinematic style that has been compared to Terrence Malick, follows a 6-year-old heroine called Hushpuppy, played by a charismatic unknown, Quvenzhane Wallis. With her father, Wink - depicted by fellow newcomer Dwight Henry - they struggle to survive in a town of poor, hard-drinking outcasts called The Bathtub. The film, made with a budget of around $1.5 million, includes striking images of the Ice Age melting and extinct giant aurochs coming to life. Zeitlin dispelled reports they were computer generated, saying he relied on 1980s’ style special effects using miniatures because, “we wanted everything to be organic and we used a minimum of technology.” Adding to the film’s hardships was that “it was always an impossible film to explain or pitch,” said Zeitlin. He made the film with the help of an art collective he helped form and after basing himself in New Orleans following a stint in Europe. “It’s about a little girl and her father living cut off from the world by a giant levee, living in this off-the-grid town called ‘The Bathtub’,” he said. “It is about a series of mythological and environmental catastrophes that she has to learn how to survive and he has to teach her.” The film has been called both an exploration of contemporary Americana and an environmental statement, but Zeitlin said it is not “an issue-based call to action.” Rather he wanted to make a universal movie for people who can relate to “the idea of their home being taken off the map and their culture being gone from the planet.” And in the face of traditional heroes that Zeitlin sees “getting bastardized” in Hollywood films - including that fictional British detective Sherlock Holmes - the young filmmaker wanted to create an authentic modern hero in the character of Hushpuppy. “She is about standing by her culture, standing by her family, both being totally defiant but absolutely sweet and caring,” he said. “She is a hero that represents fearlessness and I think so much of America is controlled by fear.” Apart from the film’s visual and sensory style, it is Wallis’ turn as Hushpuppy, cast at the age of 5 from nearly 4,000 auditions, that has also caught the eyes of critics. “From the first moment we saw her - we have the footage of that first audition - you can see this look in her eyes that is so intense and so focused with so much wisdom behind it and poise,” said Zeitlin. Both Wallis and Henry, who initially turned down his role to run his bakery shop, have now attracted the attention of big Hollywood producers. But Zeitlin says, “they are both extremely grounded people and neither are trying to run away to Hollywood.” As for Zeitlin, who was born in Queens, New York, and raised by folklorist parents, he hopes to start shooting an unannounced feature film later this year. “It will be in the same cannon as this film. Not a sequel, but we are trying to preserve the method. We want to shoot it in Louisiana. It’s going to be another folk tale.”
Transient and Non-Transient Intussusceptions of the Large Bowel in Adults: Two Case Reports. Intussusception of the large bowel in adults is a very rare pathological condition. However, it has its clinical importance because intussusception is very often associated with an intraluminal lesion. We report two cases of the large bowel intussusception, ileocolic and colorectal. Both intussusceptions were associated with a malignant tumor. However, the clinical presentation was different. One of the intussusceptions was of non-transient character, while the second one resolved spontaneously before operation. Both patients underwent surgery and malignant tumors were found and removed. The purpose of the article is to draw attention to intussusception and emphasize that intussusception, either transient or non-transient, should be further examined. The intussusception may be the first and the only signal of the existence of a malignant tumor, very often colorectal carcinoma.
Introduction {#Sec1} ============ Historically, cancer care has been conducted based on the multifaceted evaluation of a case, such as the pathological diagnosis and staging of the disease, benefits and risks of treatments, and the patient\'s preference. The identification of the primary site and determination of histological type are important clinical information that forms the basis for determining treatment strategy. A recent advance in molecular biology has revealed the various biological characteristics of tumors and has enabled clinical development of tumor-agnostic drugs beyond the organ specificity of diseases. In tumor-agnostic therapy, drugs are selected on the basis of biology beyond the primary site and type of cancer. In December 2018, in Japan, an anti-programmed cell death protein 1 (PD-1) antibody drug, pembrolizumab, was approved for advanced/recurrent deficient DNA mismatch repair (dMMR) solid cancers. This is the first drug in Japan for tumor-agnostic indications. Moreover, the efficacy of tropomyosin receptor kinase (TRK) inhibitors against *neurotrophic receptor tyrosine kinase (NTRK)* fusion gene-positive advanced solid cancers was demonstrated, and the U.S. Food and Drug Administration (FDA) approved larotrectinib in November 2018 and entrectinib in August 2019. Larotrectinib was also approved by European Medicines Agency (EMA) in September 2019. In Japan, entrectinib was approved in June 2019, which was earliest in the world. Entrectinib was the second tumor-agnostic drug approved in Japan. The present guidelines systematically describe the items to be considered when selecting tumor-agnostic drugs including the timing and methods of testing, the positioning of each drug, and clinical care systems. This article is a summary of the part describing *NTRK* in \"Clinical Practice Guidelines for Tumor-Agnostic Treatments in Adult and Pediatric Patients with Advanced Solid Tumors toward Precision Medicine (*in Japanese*)\". The part regarding dMMR has already been reported elsewhere \[[@CR1]\]. The present guidelines provide a guide to diagnosis and treatment and should be utilized in clinical practice according to the recommendation levels described and by adjusting them for individual patients. They are expected to contribute to improving treatment outcomes in patients with solid cancer by utilizing them to perform appropriate tests and treatments on appropriate patients at appropriate timing. Materials and methods {#Sec2} ===================== The current guidelines systematically describe items to be considered when treating patients with *NTRK* fusion-positive solid tumors, including the timing and methods of testing *NTRK* fusions, as well as the positioning of TRK inhibitor therapy. In the clinical setting in Japan, if appropriate tests are performed on appropriate patients and the patients receive appropriate treatment at appropriate timing based on the recommended levels described in the present guidelines, treatment outcomes in patients with solid tumors are expected to be improved. In the preparation of the guidelines, clinical questions (CQs) were formulated, and evidence for recommendation to each CQ was gathered by literature search for PubMed and Cochrane database (from January 1980 to August 2019). Moreover, critical publications and presentations in the international conferences not included above were added manually. Each search term and result for literature search appeared in each CQ. Based on the systematic review conducted according to the collected evidence, the committee members voted to determine a recommended level for each CQ (Table [1](#Tab1){ref-type="table"}). The recommended levels were determined according to the strength of evidence for each CQ, potential benefit, demerit of patients, and other factors. In voting, whether the contents of medical care (including tests and indications) are approved or covered by health insurance in Japan was not considered. However, relevant information was described in the remarks column as needed. The committee\'s opinions were determined in the following manner: (1) if strong recommendation (SR) accounted for at least 70% of the vote, the committee\'s opinion was SR; (2) if (1) was not met, but SR + recommendation (R) accounted for at least 70% of the vote, the committee\'s opinion was R; (3) if (1) or (2) was not met, but SR + R + expert consensus opinion (ECO) accounted for at least 70% of the vote, the committee\'s opinion was ECO; (4) if not recommended (NR) accounted for at least 50% of the vote, the committee\'s opinion was NR, irrespective of the results of (1)--(3); and if none of (1)--(4) was met, there was \"no recommended level.\"Table 1Degrees of recommendation and decision criteriaDegree of recommendationDecision criteriaStrong recommendation \[SR\]There is sufficient evidence and the benefits of testing outweigh the losses for patientsRecommendation \[R\]There is certain evidence, considering the balance between benefits and losses for patientsExpert consensus opinion \[ECO\]A certain consensus has been obtained although evidence and information that shows patient benefits cannot be said to be sufficientNot recommended \[NR\]There is no evidence At present, some recommendations for CQs are not based on sufficient strength of evidence. It is also possible that the accumulation of new evidence in the future will lead to substantial changes in the descriptions in the text and recommended levels. Results {#Sec3} ======= Neurotrophic receptor tyrosine kinase (*NTRK*) {#Sec4} ---------------------------------------------- The *NTRK* 1 gene was discovered in a gene transfer assay using colorectal cancer tissue and reported as a cancer gene, *OncB*, by Pulciani, Barbacid, et al. in 1982 \[[@CR2]\]. *NTRK* gene family members known to date are *NTRK1--3* (Table [2](#Tab2){ref-type="table"}). *NTRK1--3* encode tyrosine receptor kinases, tropomyosin receptor kinase (TRK) A, TRKB, and TRKC, respectively. TRKA is expressed in the nervous system and gets phosphorylated when neurotrophin nerve growth factor (NGF) binds to it \[[@CR3], [@CR4]\]. Known ligands are brain-derived neurotrophic factor (BDNF) and neurotrophin (NT)-4 for TRKB and NT-3 for TRKC. Although NT-3 binds to other TRKs, it has the highest affinity with TRKC. TRKA regulates pain and body temperature, TRKB controls movement, memory, emotion, appetite, and body weight, and TRKC affects proprioception. The binding of a ligand to TRK induces the autophosphorylation of intracellular tyrosine residues, which activates downstream pathways including the phospholipase C (PLC)-γ, mitogen-activated protein kinase (MAPK), and phosphoinositide 3-kinase (PI3K)/AKT pathways, resulting in the differentiation, survival, and proliferation of cells \[[@CR5], [@CR6]\].Table 2*NTRK* gene familyGene*NTRK 1NTRK 2NTRK 3*SynonymsMTC; TRK; TRK1; TRKA; TRK-A; p140-TRKAOBHD; TRKB; TRK-B; EIEE58; GP145-TRKBTRKC; GP145-TRKC; gp145(TRKC)Locus1q23.19q21.3315q25.3NCBI Entrez Gene<https://www.ncbi.nlm.nih.gov/gene/4914><https://www.ncbi.nlm.nih.gov/gene/4915><https://www.ncbi.nlm.nih.gov/gene/4916>Both NTRK and TRK are used to describe either the name of gene or protein; in the current guideline, we describe *NTRK* for gene name and TRK for protein Among various alterations of the *NTRK* genes, missense variants of the *NTRK* genes and *NTRK fusion*s are important in terms of the treatment of malignant tumors. Alteration and amplification {#Sec5} ---------------------------- The alteration of the *NTRK* genes has been reported in tumors such as colorectal cancer, lung cancer, malignant melanoma, and acute leukemia. However, TRK activity of these altered genes is similar to or lower than that of the wild type (Table S1) \[[@CR5], [@CR7], [@CR8]\]. Although association between the alteration of the *NTRK* genes and the development of malignant tumors has not been elucidated, it has been reported that if a tumor has the alteration of the *NTRK* genes (such as solvent front mutation, gatekeeper mutation, and glycine mutation of Asp-Phe-Gly (DFG) at the beginning of the activation loop), it becomes resistant to TRK inhibitors, larotrectinib, and entrectinib (Table [3](#Tab3){ref-type="table"}). Moreover, an *NTRK1* splice variant, TRKA III, and an inframe deletion mutant (ΔTRKA) were reported in neuroblastoma and acute myeloid leukemia. These alterations are tumorigenic \[[@CR8], [@CR9]\]. As for the association between the *NTRK* genes and diseases other than malignant tumors, congenital insensitivity to pain with anhidrosis type IV, a hereditary disease, has a pathological variant of the *NTRK1* gene. The amplification of the *NTRK* genes has been reported in tumors such as breast cancer, cutaneous basal cell cancer, lung cancer, and neuroblastoma. Although it has been reported that TRKA and TRKC expression in neuroblastoma indicate a good prognosis \[[@CR10]\], its tumorigenicity or significance as a target of treatment has not yet been elucidated.Table 3TRK inhibitors and resistant mutations*WT* wild type, *S* sensitive, *R* resistant Rearrangement {#Sec6} ------------- *NTRK fusion*s (rearrangement) are tumorigenic genetic alterations reported in many cancer types \[[@CR11]\]. Through intrachromosomal or interchromosomal translocation, a fusion gene is formed with a 3′ part of the *NTRK1--3* genes encoding the kinase region and a 5′ part of a partner gene (various genes have been reported). A ligand-independent kinase activation induced by the formation of a fusion gene is considered to contribute to carcinogenesis. Frequency of *NTRK* fusions by cancer type {#Sec7} ------------------------------------------ *NTRK fusion*s are found in a wide variety of cancer types (Table [4](#Tab4){ref-type="table"}) \[[@CR12]-[@CR15]\]. However, the frequency of *NTRK fusion*s is low in general, being 0.31% in the analysis result of The Cancer Genome Atlas (TCGA) database (*n* = 9966) \[[@CR6]\]. On the other hand, there are rare cancer types in which *NTRK fusion*s are found at a high frequency, such as secretory carcinoma of the salivary gland (mammary analogue secretory carcinoma: MASC) \[[@CR16], [@CR17]\], secretory breast carcinoma \[[@CR18]-[@CR20]\], infantile fibrosarcoma (congenital fibrosarcoma) \[[@CR21]-[@CR24]\], congenital mesoblastic nephroma, and pediatric high-grade glioma (younger than 3 years old) \[[@CR25]\].Table 4Reported frequency of NTRK fusion in various types of tumorsTumorReported frequencyFrequency by TCGA databaseInfantile fibrosarcoma (congenital fibrosarcoma)90--100%86--91%Secretory breast carcinoma80--100%92%Mammary analogue secretory carcinoma of the salivary gland80--100%93--100%Congenital mesoblastic nephroma83%Pediatric high-grade glioma40% (\< 3 years)40% (\< 3 years), 5.3%^a^Melanoma16% (Spitzoid tumors)0.21% (1/476)Cholangiocarcinoma4%Gastrointestinal stromal tumor (GIST)0.5--3%Inflammatory myofibroblastic tumor (IMT)3%Thyroid cancer2%2.34% (12/513)Colorectal cancer1%0.97% (3/310)Sarcoma1%0.76% (2/263)Head and neck squamous cell carcinoma \< 1%0.38% (2/522)Non-small cell carcinoma (NSCLC) \< 1%0.18% (1/541)Pancreatic adenocarcinoma \< 1%0.56% (1/179)Low-grade glioma0.94% (5/534), 2.5% (3/120)^a^Glioblastoma multiforme0.56% (1/180)Cervical cancer0.33% (1/306)Breast cancer0.18% (2/1119)Melanoma (pediatric)11.11% (1/9)^a^B-cell acute lymphoid leukemia0.14% (1/716)^aa^Data from St. Jude PeCan Data Portal (<https://pecan.stjude.cloud/#!/about>) As for secretory carcinoma of the salivary gland (mammary analogue secretory carcinoma), Skalova et al. in the Czech Republic reported the presence of ETS translocation variant 6 (*ETV6*)*-NTRK3* fusion genes in tumors that developed in the salivary gland histologically resembling secretory breast carcinoma in 2010 \[[@CR26]\]. It has been reported that MASC is more frequently found in men, and the mean age of onset is 44 years \[[@CR27]\]. Secretory breast carcinoma is a very rare breast cancer; its frequency is \< 0.15% among all breast cancers, with the median age of onset of 25 years, and it is found in both sexes \[[@CR28]\]. Secretory breast carcinoma is triple-negative in many cases and has *ETV6-NTRK3* fusion genes. Although the prognosis is good, there have been reports of very late recurrence. Infantile fibrosarcoma accounts for 12% of infantile malignant tumors. It has also been reported that 36--80% of infantile fibrosarcomas are congenital. It is rare that children 2 years of age or older develop infantile fibrosarcoma. Infantile fibrosarcoma frequently develops in limbs and has *ETV6-NTRK3* fusion genes. It has a better prognosis than adult fibrosarcoma. The efficacy of chemotherapy and cases of spontaneous regression has been reported \[[@CR29]\]. Congenital mesoblastic nephroma is the most frequent renal tumor in infants 3 months of age or younger. It is recognized as a low-grade tumor with a good prognosis. It infrequently develops in both kidneys and is sometimes accompanied by hypercalcemia. High-grade gliomas in children, particularly in infants younger than 3 years old, have better life prognoses than high-grade gliomas in older children and adults, and do not have alterations of the histone *H3.1* or *H3.3* gene, which are found in tumors in older children at a high frequency, or of the *isocitrate dehydrogenase* (*IDH*) *1* or *IDH2* gene, which are found in tumors in young adults at a high frequency. Recently, it has been reported that *NTRK fusion*s are found at a high frequency in tumors in infants \[[@CR25]\]. As for lung cancer, in a study in 4872 patients at 7 institutions, *NTRK fusion*s were found in 11 patients (0.23%). Of them, six patients (55%) were male, eight patients (73%) were non-smokers/light smokers, and the median age was 47.6 years \[[@CR30]\]. Nine of the 11 patients had adenocarcinoma. *NTRK fusion*s were also detected in squamous cell carcinoma and neuroendocrine carcinoma. In most gastrointestinal stromal tumors (GISTs), genetic alterations of *KIT* or *platelet-derived growth factor A* (*PDGFRA*) gene that activate their functions are detected, while wild-type GIST, in which these genetic alterations are not detected, accounts for approximately 10% of all GISTs. *NTRK fusion*s are found in wild-type GISTs. According to the Cancer Information Service (\"Cancer Registration and Statistics in Japan\" by the Cancer Information Service, National Cancer Center Japan; <https://ganjoho.jp/public/index.html>), the number of patients with breast cancer was 76,257 (women) in 2014, that with lung cancer 112,618, and that with colorectal cancer 134,453. Assuming that *NTRK fusion*s are found in 0.18% of breast cancers, 0.18% of lung cancers (non-small cell lung cancers), and 0.97% of colorectal cancers on the basis of data from the TCGA, the numbers of patients with *NTRK fusion*-positive breast cancer, lung cancer, and colorectal cancer are calculated to be 137, 202, and 1304, respectively, per year. Assuming that secretory breast carcinomas account for 0.15% of all breast cancers, the number of patients with secretory breast carcinomas is calculated to be 114 per year. It should be noted that, although the frequency of *NTRK fusion*-positive cancers is generally low among major cancers, the absolute number of *NTRK fusion*-positive major cancers is not small due to the high morbidity of major cancers even when compared to rare cancer types in which *NTRK fusion*s are found at a high frequency. At this point, there are no sufficient data to determine whether the frequency of *NTRK fusion*s differs between early cancers and advanced cancers. Further study on this issue is required in the future. NTRK testing methods {#Sec8} ==================== Methods for detecting *NTRK fusion*s include testing by next-generation sequencing (NGS) methods, reverse transcription polymerase chain reaction (RT-PCR), fluorescence in situ hybridization (FISH), and immunohistochemistry (IHC) \[[@CR31], [@CR32]\]. The NGS tests use not only DNA sequencing but also RNA sequencing. Most methods using DNA sequencing also analyze genetic alterations other than *NTRK fusion*s at the same time. In Japan, the OncoGuide™ NCC Oncopanel System and FoundationOne® CDx Cancer Genomic Profile have been approved for cancer genomic profiling. In addition to these, Oncomine™ Target Test and Todai OncoPanel are currently being used as advanced medical care. Some NSG tests are set to detect only known fusion partners and cannot detect unknown partners. They also have problems with repetitive regions and the tiling of entire introns. Therefore, it is suggested that they have lower sensitivity for detecting chromosomal translocation and inversion. There are some RNA sequencing methods that can detect *NTRK fusion*s irrespective of fusion partners. However, they have problems such that the use of panels specific to the fusion genes is required. FISH and RT-PCR have been used commonly for the detection in previous reports. However, these methods can analyze only single or a few genetic alterations. FISH can easily detect the presence of fusion genes irrespective of fusion gene partners, while RT-PCR cannot detect fusion gene partners other than known ones, which is a problem. Although IHC does not detect fusion genes themselves, there has been a report that when no TRK protein expression was detected by IHC using an antibody cocktail, no *NTRK fusion*s were found.\[[@CR33]\] Therefore, the validity of IHC as a screening test is being examined. A gene expression analysis developed by NanoString Technologies, Inc. (hereinafter referred to as \"NanoString\") uses probes with unique molecular fluorescent barcodes that are specific to the sequences of target molecules. The probes are hybridized with target nucleic acid and then fixed on the surface of a cartridge. The sequence of the color barcodes bound to each target sequence is digitally counted using a fluorescent scanner. This gene expression analysis is expected to obtain good counting results of RNA samples prepared from formalin-fixed paraffin-embedded (FFPE) specimens. Since there are no sufficient data regarding the detection of *NTRK fusion*s, further studies are required in the future. TRK inhibitors {#Sec9} ============== Examples of drugs with TRK inhibitory activity are shown in Table [5](#Tab5){ref-type="table"}. Currently, the clinical development of entrectinib and larotrectinib is underway in Japan. Entrectinib is an oral tyrosine kinase inhibitor that inhibits ROS1, TRK, and ALK. At the European Society for Medical Oncology (ESMO) 2018 Congress, results from a pooled analysis of three studies in patients with *NTRK fusion*s, STARTRK-2, STARTRK-1, and ALKA-372--001 studies, were presented \[[@CR34]\]. The response rate among 54 patients with soft tissue sarcoma, non-small cell lung cancer, secretory carcinoma of the salivary gland, and other tumors was 57.4%. Major adverse events included taste disorder (47.1%), constipation (27.9%), fatigue (27.9%), diarrhea (26.5%), peripheral edema (23.5%), dizziness (23.5%), and increased creatinine (17.6%). Entrectinib was approved for *NTRK fusion*-positive solid cancers by the FDA in August 2019, was granted PRIME (PRIority MEdicines) designation by the European Medicines Agency (EMA) in October 2017, and was also approved for *NTRK fusion*-positive advanced/recurrent solid cancers in Japan in June 2019.Table 5Examples of drugs with TRK inhibitory activityIC50 (nM)Target other than TRK\ (IC50 \< 500 nM)TRKATRKBTRKCEntrectinib20.10.1ALK, ROS1Larotrectinib944---CabozantinibNA7NAALK, AXL, BLK, BTK, EPHA4, EPHB4, FAK, FLT1, FLT3, FLT4, FYN, KDR, KIT, LYN, MAP2K1, MET, PDGFRB, RAF1, RET, RON SAPK4, TIE2, YESCrizotinib11NAABL, ALK, ARG, AXL, FES, LCK, LYN, MER, MET, RON, ROS1, SKY, TIE2, YESAltiratinib0.94.60.8MET, TIE2 VEGFR2Belizatinib \< 3 \< 3 \< 3ALKBMS-75480774NAAURKA, AURKB, FLT3, IGF1R, INSR, MET, RONDanusertib31NANAABL, AURKA, AURKB, AURKC, FGFR1, RETDS-6051b \< 2 \< 2 \< 2ALK, ROS1LOXO-195421---Merestinib15--32015--32015--320AXL, DDR1, DDR2, FLT3, MET, MERTK, MKNK1, MKNK2, MST1R, ROS1, TEKMK-5108213NAABL, AURKA, AURKB, AURKC, AXL, BRK, EPHA1, EPHA2, FLT1, FLT4, GSK3A, JNK3, KDR, LOK, MER, PTK5, ROS, TIE2, YESPLX-7486 \< 10 \< 10 \< 10AURKA, AURKB, CSF1R, MAP3K2, MAP3K3Sitravatinib59NARET, CBL, CHR4q12, DDR, AXL, DDR1, DDR2, EPHA2, EPHA3, EPHA4, EPHB2, EPHB4, FLT1, FLT3, FLT4, KDR, KIT, MER, MET, PDGFRA, RET, RON, ROS, SRC Larotrectinib is a selective oral TRK inhibitor. At the ESMO 2018 Congress, combined results from clinical studies in patients with *NTRK fusion*s, a phase 1 study in adults, a phase 1/2 study in children, and a phase 2 basket study, were reported \[[@CR35]\]. Most of the patients had salivary gland tumor, soft tissue sarcoma, or thyroid cancer. The results of the pooled analysis of 109 patients showed the response rate of 81%. Major adverse events included fatigue, nausea, dizziness, vomiting, increased aspartate aminotransferase, and cough. Larotrectinib was approved by the FDA in November 2018. In July 2019, the Committee for Medicinal Products for Human Use (CHMP) issued a recommendation for conditional marketing authorization. In Japan, clinical trials are currently underway. Global status of approval of TRK inhibitors for patients with *NTRK* fusion-positive solid tumors (as of October 2019) {#Sec10} ====================================================================================================================== The approval status in Japan and by the FDA and EMA are shown in Supplemental Table S2. Recommendations in various guidelines {#Sec11} ===================================== The descriptions of *NTRK fusion* testing and TRK inhibitors in the National Comprehensive Cancer Network (NCCN) guidelines are summarized in Table S3 (as of November 2019). Among the ESMO guidelines, the 4th ESO-ESMO International Consensus Guidelines for Advanced Breast Cancer (ABC 4) state \"If an ABC patient presents with a tumor with an *NTRK* fusion, treatment with a TRKi is a possible consideration.\" (Expert opinion/C). The ESMO recommendations on the standard methods to detect *NTRK* fusions in daily practice and clinical research \[[@CR36]\] propose the following algorithm (Fig. S1). Algorithm for NTRK testing {#Sec12} ========================== Figure [1](#Fig1){ref-type="fig"} summarizes the implementation of a rational approach for the detection of *NTRK1/2/3* fusions. To avoid the useless testing, we employed the algorithm of "mutually exclusive"; however, it should be noted that since the data regarding which mutation is mutually exclusive to *NTRK* fusions are limited, it is encouraged that the treating physician pay attention to the latest data.Fig. 1Algorithm for NTRK testing. §: Tumors such as secretory carcinoma of the salivary gland (mammary analogue secretory carcinoma), secretory breast carcinoma, infantile fibrosarcoma (congenital fibrosarcoma), congenital mesoblastic nephroma, and pediatric high-grade glioma (younger than 3 years old). \*: Refer to CQ1. *NB* At this point, the optimal antibodies for TRK immunostaining have not been identified CQs (Table [6](#Tab6){ref-type="table"}) {#Sec13} ======================================== ###### Summary of recommendations Recommendations Level ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ------- CQ1: Targets of *NTRK* fusion testing CQ1-1. Is *NTRK* fusion testing recommended for patients with metastatic/recurrent solid cancers?  1. *NTRK* fusion testing is not recommended for patients with solid cancers that have genetic alterations mutually exclusive with *NTRK* fusions NR  2. *NTRK* fusion testing is strongly recommended for known cancer types in which *NTRK* fusions are detected at a high frequency SR  3. *NTRK* fusion testing is recommended for all patients with metastatic/recurrent solid cancers other than those described above in order to determine the applicability of TRK inhibitors R CQ1-2. Is *NTRK* fusion testing recommended for patients with early solid cancers?  1. *NTRK* fusion testing is recommended for patients with known cancer types in which *NTRK* fusions are detected at a high frequency even when their solid cancers can be radically treated R  2. *NTRK* fusion testing is considered for all patients with early solid cancers other than those described above to determine the applicability of TRK inhibitors ECO CQ1-3. When should *NTRK* fusion testing be performed?  It is strongly recommended that *NTRK* fusion testing should be performed before the start of the standard treatment or during the standard treatment SR CQ2: Testing methods for detecting *NTRK* fusions CQ2-1: Are NGS tests recommended for determining the applicability of TRK inhibitors?  For determining the applicability of TRK inhibitors, NGS tests for which analytical validity has been established are strongly recommended SR CQ2-2: Are FISH and PCR recommended for the detection of *NTRK* fusions?  1. FISH is not recommended as a screening test for *NTRK* fusions NR  2. At this point, it is not possible to determine whether PCR is recommended as a screening test for *NTRK* fusions None  3. Testing for *NTRK* fusions (particularly *ETV6-NTRK3* fusion genes) using FISH or PCR may be performed for known cancer types in which *NTRK* fusions are detected at a high frequency ECO CQ2-3: Is IHC recommended for the detection of *NTRK* fusions?  1. IHC is recommended as a screening test for *NTRK* fusions R  2. IHC is not recommended for determining the applicability of TRK inhibitors NR CQ3: Treatment for *NTRK* fusions CQ3-1: Are TRK inhibitors recommended for unresectable/metastatic/recurrent solid cancers possessing *NTRK* fusions?  The use of TRK inhibitors is strongly recommended SR CQ3-2: When should TRK inhibitors be used?  The use of TRK inhibitors from the initial treatment is recommended R *NR* Not recommended, *SR* Strong recommendation, *R* Recommendation, *ECO* Expert consensus opinion, *NGS* next-generation sequencing, *FISH*: fluorescence in situ hybridization, *PCR* polymerase chain reaction, IHC: immunohistochemistry In recent years, clinical trials have reported the efficacy of TRK inhibitors for the treatment of advanced solid tumors with *NTRK* fusion gene-positive advanced solid tumors. In Japan, a TRK inhibitor in adult and pediatric patients with *NTRK* fusion-positive advanced solid tumors, regardless of the primary tumor site, has been approved. This has made it necessary to develop reference manuals, including guidelines, which enable smooth implementation of testing and treatment in the clinical setting. The clinical recommendations propose the following 15 requirements in 3 CQs regarding the *NTRK fusion* testing performed to select patients who are likely to benefit from TRK inhibitors.li*NTRK fusion* testing is not recommended for patients with solid cancers that have genetic alterations mutually exclusive with *NTRK fusion*s.*NTRK fusion* testing is strongly recommended for known cancer types in which *NTRK fusion*s are detected at a high frequency.*NTRK fusion* testing is recommended for all patients with metastatic/recurrent solid cancers other than those described above to determine the applicability of TRK inhibitors.*NTRK fusion* testing is recommended for patients with known cancer types in which *NTRK fusion*s are detected at a high frequency even when their solid cancers can be radically treated.*NTRK fusion* testing is considered for all patients with early solid cancers other than those described above to determine the applicability of TRK inhibitors.It is strongly recommended that *NTRK fusion* testing should be performed before the start of the standard treatment or during the standard treatment.For determining the applicability of TRK inhibitors, NGS tests for which analytical validity has been established are strongly recommended.FISH is not recommended as a screening test for *NTRK fusion*s.At this point, it is not possible to determine whether PCR is recommended as a screening test for *NTRK fusion*s.Testing for *NTRK fusion*s (particularly *ETV6-NTRK3* fusion genes) using FISH or PCR may be performed for known cancer types in which *NTRK fusion*s are detected at a high frequency.IHC is recommended as a screening test for *NTRK fusion*s.IHC is not recommended for determining the applicability of TRK inhibitors.NanoString is not recommended as an *NTRK fusion* testing method for determining the applicability of TRK inhibitors.The use of TRK inhibitors is strongly recommended.The use of TRK inhibitors from the initial treatment is recommended. Please keep in mind that these clinical recommendations will be revised in a timely manner, along with continuously and steadily advancing cancer treatment and new knowledge on biomarkers. We will explain each CQ in detail. CQ1: targets of *NTRK fusion* testing {#Sec14} ===================================== PubMed was searched with the keywords \"NTRK or neurotrophic tropomyosin receptor kinase,\" \"neoplasm,\" and \"tested or diagnos\* or detect\*.\" The Cochrane Library was also searched with similar keywords. The time range of the search was from January 1980 to August 2019. From PubMed, 70 papers were extracted, and from the Cochrane Library, 1 paper was extracted. Four papers were added by manual search. By the primary screening, 68 papers were extracted, and by the secondary screening, 68 papers were extracted. These papers underwent a qualitative systematic review. Clinical studies of entrectinib and larotrectinib, TRK inhibitors, have been conducted in patients with unresectable or metastatic solid cancers irrespective of the line of treatment and have demonstrated high efficacy. *NTRK fusion*s have been observed irrespective of cancer types, although at a low frequency. Moreover, no reliable biomarkers that can determine the presence or absence of *NTRK fusion*s in clinical settings have been established. Therefore, we strongly recommend the testing for all metastatic/recurrent solid cancers in which the presence of *NTRK fusion*s has been reported, to determine the applicability of TRK inhibitors \[[@CR37]\]. We also strongly recommend the testing for tumors such as secretory carcinoma of the salivary gland (mammary analogue secretory carcinoma), secretory breast carcinoma, infantile fibrosarcoma (congenital fibrosarcoma), congenital mesoblastic nephroma, and pediatric high-grade glioma (younger than 3 years old), because *NTRK fusion*s (in particular *ETV6-NTRK3* fusion genes) are detected at a high frequency in these diseases. Because *NTRK fusion*s are mutually exclusive with other driver mutations, if mutually exclusive genetic alterations \[e.g., *epidermal growth factor receptor* (*EGFR*) gene mutations, *anaplastic lymphoma kinase* (*ALK*) fusion genes, and *ROS1* fusion genes in non-small cell lung cancers; *rapidly accelerated fibrosarcoma* (*RAF*) gene mutations in malignant melanoma and colorectal cancer; and *KIT* gene mutations in GIST\] of mitogenic pathways (groups of genes encoding the growth factor receptor, RAS, and MAPK pathways) are detected, a search for *NTRK fusion*s is not necessary. During the voting, it was pointed out that whether testing is performed should be determined at the discretion of the attending physician and patient taking into account the cost and frequency. At present, the significance of TRK inhibitors as neoadjuvant/adjuvant therapy for patients with solid cancers possessing *NTRK fusion*s has not been established. However, in a phase 1 study of larotrectinib in pediatric patients \[[@CR38]\], a partial response was obtained following the administration of larotrectinib in five patients and resection was subsequently performed. In three of them, tumors were completely resected. Because it has been reported that patients with metastatic/recurrent solid cancers possessing *NTRK fusion*s had a high response rate to TRK inhibitors, *NTRK fusion* testing is recommended for patients with known cancer types in which *NTRK fusion*s are detected at a high frequency. *NTRK fusion* testing may also be considered for radically treatable solid cancers other than the abovementioned types, taking into consideration the applicability of neoadjuvant therapy. If the use of TRK inhibitors is considered to reduce the long-term effects (late complications) of curative standard treatment particularly in children, the accumulation of long-term follow-up data of patients treated with TRK inhibitors is necessary, in addition to *NTRK fusion* testing. At this point, there has been no study report that compared the effectiveness of the standard treatment and that of TRK inhibitors in patients with metastatic/recurrent solid cancers possessing *NTRK fusion*s. The efficacy of TRK inhibitors was shown in the first line, and a high response rate has been reported. To prevent the loss of therapeutic opportunity for a patient who should be treated with TRK inhibitors because of the progress of the disease, we strongly recommend that *NTRK fusion* testing should be performed before the start of the standard treatment or during the standard treatment. CQ2: testing methods for detecting *NTRK fusion*s {#Sec15} ================================================= PubMed was searched with the keywords \"NTRK or neurotrophic tropomyosin receptor kinase,\" \"neoplasm,\" \"NGS,\" \"In Situ Hybridization,\" \"IHX,\" \"NanoString,\" and \"Polymerase Chain Reaction.\" The Cochrane Library was also searched with similar keywords. The time range of the search was from January 1980 to August 2019. From PubMed, 129 papers were extracted, and from the Cochrane Library, 5 papers were extracted. One paper was added by manual search. By the primary screening, 13 papers were extracted, and by the secondary screening, 13 papers were extracted. These papers underwent a qualitative systematic review. During the development of entrectinib and larotrectinib, various methods including NGS, FISH, and RT-PCR were used to determine the applicability of TRK inhibitors. Because reported *NTRK fusion*s vary over *NTRK1--3* genes and have various fusion partners, NGS tests that can detect fusion genes of all *NTRK1--3* genes are recommended. When a genetic test panel is used, it is necessary to check the range of *NTRK fusion*s the panel can detect. Some panels can only detect *NTRK fusion*s with known fusion partners, but other panels can detect *NTRK fusion*s irrespective of fusion partners. The analytical validity of tests is also important. In daily clinical practice, FFPE specimens are expected to be used. When fixing and storing specimens, and extracting DNA and RNA from them, it is desirable to follow guidelines established separately (Guidelines on the Handling of Pathological Tissue Samples for Genomic Research and Medicine, edited by the Japanese Society of Pathology). As for the detection of *NTRK fusion*s, FoundationOne® CDx Cancer Genome Profile is approved as a companion diagnostic for entrectinib and can detect *NTRK1* fusion genes, *NTRK2* fusion genes, and *ETV6-NTRK3* fusion genes. Companion diagnostics for larotrectinib, which is approved in overseas countries, are being developed. In both cases of a companion diagnosis and a comprehensive genetic analysis such as cancer genomic profiling, the use a test whose analytical validity has been established is recommended. In addition, because cancer genomic profiling, also examined factors other than *NTRK fusion*s, \"Guidelines on the Development of Designated Core Hospitals for Cancer Genomic Medicine\" (partially revised on July 19, 2019) and guidelines issued by relevant academic societies need to be referred to in the latter case. Because *NTRK fusion*s vary over *NTRK1-3*, FISH and PCR have limitations in detecting them. Although break-apart probes for *NTRK1-3* have been reported for FISH, performing three FISH assays in screening causes problems in cost and convenience. Regarding PCR, because the preservation of RNA in FFPE is problematic and the ranges of partner genes are unknown, it is not possible to judge what degree of detection accuracy can be ensured for PCR. Therefore, PCR cannot be recommended. However, if single gene tests that can solve these problems are developed, the PCR method needs to be reexamined. Although amplicon sequencing is based on the same principle as the PCR method, it can detect other genetic alterations and the detection accuracy has been specified. Therefore, amplicon sequencing will be discussed along with NGS. Because almost all fusion genes detected in secretory carcinoma of the salivary gland (mammary analogue secretory carcinoma), secretory breast carcinoma, infantile fibrosarcoma (congenital fibrosarcoma), congenital mesoblastic nephroma, pediatric high-grade glioma (younger than 3 years old), etc., are *ETV6-NTRK3* fusion genes, the use of FISH or PCR may be considered. In addition, it has been reported for other fusion genes that some of them cannot be detected by any of IHC, FISH, and NGS \[[@CR39]\]. Therefore, careful attention should be paid to the false-positive and false-negative results of each testing method and close cooperation between clinicians and pathologists is required \[[@CR40]\]. In particular, if *NTRK fusion*s are not detected in known cancer types in which *NTRK fusion*s are detected at a high frequency, it is desirable to confirm the results by other testing methods. Conditions for approval of entrectinib include the provisions, \"entrectinib should be administered to patients who are confirmed to be positive for the *NTRK fusion* by an experienced pathologist or testing facility. Approved in vitro diagnostics should be used for testing.\" Therefore, attention to these provisions is required. Although IHC is a method for detecting TRK protein, a positive IHC result does not mean the presence of an *NTRK fusion*. Therefore, IHC is not recommended as a test for determining the applicability of TRK inhibitors. However, there has been a report of a study using an antibody cocktail, in which *NTRK fusion*s were not detected when IHC was negative. Therefore, NGS or other tests can be omitted when IHC was negative, and IHC is expected to be valid as a screening test. It has been reported that in 33,997 patients, the sensitivity and specificity of DNA-based panel sequencing were 81.1% and 99.9%, respectively, and those of IHC (clone EPR17341) were 87.9% and 81.1% when an RNA-based panel (MSK-Fusion) was used as a control \[[@CR41]\]. In this report, the sensitivity and specificity for sarcoma were not good, and the RNA-based panel was recommended. At this point, the optimal antibodies for IHC have not yet been identified, and sensitivity and specificity vary depending on the antibodies used. Therefore, care should be taken for false-positive and false-negative results when interpreting the test results. However, because test results can be obtained rapidly, further development in the future is expected. \*: A gene expression analysis developed by NanoString Technologies, Inc. (referred to as \"NanoString\") uses probes with unique molecular fluorescent barcodes that are specific to the sequences of target molecules. The probes are hybridized with target nucleic acid and then fixed on the surface of a cartridge. The sequence of the color barcodes bound to each target sequence is digitally counted using a fluorescent scanner. Because the validity of NanoString in detecting *NTRK fusion*s has not been demonstrated, NanoString is not recommended as a *NTRK fusion* testing method for determining the applicability of TRK inhibitors. CQ3: treatment for *NTRK fusion*s {#Sec16} ================================= PubMed was searched with the keywords \"NTRK or neurotrophic tropomyosin receptor kinase,\" \"neoplasm,\" \"treatment,\" and \"TRK inhibitor.\" The Cochrane Library was also searched with similar keywords. The time range of the search was from January 1980 to August 2019. From PubMed, 132 papers were extracted, and from the Cochrane Library, 6 papers were extracted. Two papers were added by manual search. By the primary screening, 38 papers were extracted, and by the secondary screening, 11 papers were extracted. These papers underwent a qualitative systematic review. The efficacy of entrectinib and larotrectinib, TRK inhibitors, for solid cancers possessing *NTRK fusion*s has been demonstrated. Although studies comparing TRK inhibitors and other drugs have not been conducted at this point, response rates of TRK inhibitors are high. Moreover, adverse events by TRK inhibitors are mild in severity. Thus, the benefit of TRK inhibitors is considered to far outweigh the risk. It is also unlikely that the preference of patients varies. From these considerations, the use of TRK inhibitors is strongly recommended for solid cancers possessing *NTRK fusion*s. At this point, no studies comparing the standard treatment and TRK inhibitors have been conducted. Therefore, if the standard treatment is available, whether a patient should be treated with the standard treatment or TRK inhibitors should be determined individually, taking into consideration anticipated effects, expected adverse events, and late toxicity of respective treatments. The efficacy of entrectinib, a TRK inhibitor, for solid cancers possessing *NTRK fusion*s has been demonstrated in patients who received the initial treatment, and, although studies comparing TRK inhibitors and other drugs have not been conducted, response rates of TRK inhibitors are high. Moreover, adverse events by TRK inhibitors are mild in severity. Thus, the benefit of TRK inhibitors is considered to far outweigh the risk. Therefore, the use of TRK inhibitors from the initial treatment is recommended. At this point, no studies comparing the standard treatment and TRK inhibitors have been conducted. Therefore, if the standard treatment is available, whether a patient should be treated with the standard treatment or TRK inhibitors should be determined individually, taking into consideration the anticipated effects, expected adverse events, and late toxicity of respective treatments. Cost effectiveness {#Sec17} ================== An agency that evaluates the cost effectiveness of certain drugs and reflects such information in determining whether the drug can be used in the public healthcare system (whether it should be covered by benefits) and in adjusting reimbursement prices (price control) is called a health technology assessment (HTA) agency. Many evaluations have been performed about the cost effectiveness of immune checkpoint inhibitors in patients with existing indications, i.e., non-small cell lung cancer, melanoma, kidney cancer, and other diseases by HTA agencies in many overseas countries. In Japan, where an HTA pilot program was introduced in 2016, the cost effectiveness data of nivolumab (Opdivo) and pembrolizumab (Keytruda) have been examined. As of September 2019, among TRK inhibitors, only entrectinib (Rozlytrek) is included in the National Health Insurance price list. However, entrectinib was not selected as the drug whose cost effectiveness data are to be submitted. At this point, there has been no paper that has evaluated the cost effectiveness of entrectinib and larotrectinib, which are approved and unapproved drugs in Japan, respectively. As for evaluation by HTA agencies, the British NICE \[[@CR42], [@CR43]\] and the Canadian Agency for Drugs and Technologies in Health (CADTH) \[[@CR44], [@CR45]\] are currently evaluating these drugs, but at present, these evaluations have not yet been finalized. At any rate, the cost effectiveness evaluation is definitely important. In the future, the evaluation of the cost effectiveness of TRK inhibitors for *NTRK* fusion gene-positive patients is desired, as well as that of immune checkpoint inhibitors for MSI-H patients. Genomic medicines that we have focused on in the present paper often target patients with diseases for which no other treatments exist. When evaluating such drugs, decision making based not only on the value of cost effectiveness (i.e., whether ICER is large or small) but also on the evaluation of other ethical/social factors and the effect on the entire finances is important. (Because an ICER value is independent of the number of patients, the effect on finances needs to be evaluated separately. This point is often misunderstood.) Previously, orphan drugs were outside the scope of cost effectiveness evaluation. However, extremely expensive therapeutic drugs \[Kymriah, a chimeric antigen receptor T (CAR-T) cell therapy, and Zolgensma for spinal muscular atrophy\] have become widely known and it has now become essential to quantitatively evaluate cost effectiveness for determining the values of such therapies. Unlike efficacy and safety data, it is essential to incorporate domestic data (particularly for costs) into cost effectiveness data. It is highly desired to perform a cost effectiveness evaluation using the data incorporating Japanese data at an appropriate time after the launch of a drug. Discussion {#Sec18} ========== Regarding the cancer genome profile by NGS, the appropriate number of tests and the timing of the tests have not been determined by randomized controlled trials. However, as shown in the current guidelines, considering that tumor-agnostic treatment will become more widely used, it is strongly recommended that *NTRK* fusion be tested at the start of systemic therapy. Regarding the number of tests, it is necessary to consider the purpose and implication of repeated tests and what method to use. It is known that specific *NTRK* mutations at the kinase domain bring resistance to TRK inhibitors. Therefore, *NTRK* mutations will be examined when the tumor which has been originally sensitive to TRK inhibitors become resistant following the administration of TRK inhibitors. It seems reasonable to consider second-generation TRK inhibitors which could overcome first-generation TRK inhibitor resistance; however, further investigation is needed. Currently, investigation of mechanism for secondary resistance to certain molecular targeted therapy has been widely performed across cancers. From this point of view, it is not appropriate to limit the examination to only once in lifetime, but the appropriate timing and number of examinations are yet determined as they should be balanced with medical resources and costs. Tumor-agnostic approach will become more common and the accompanying drug will be developed in near future. Potential examples of such tumor-agnostic targets other than *NTRK* include (but not limited to) *ALK*, *BRAF*, BRCAness, *FGFR*, *HER2*, *HER3,* homologous recombination deficiency (HRD), *KRAS*, *RET*, *ROS1*, tumor mutation burden (TMB) high. Conclusion {#Sec19} ========== *NTRK* fusion is a rare but significant target for treatment across the tumor type. Clinicians must properly identify such rare but critical therapeutic targets to avoid missing the chance to provide therapeutic agents at the right time, through the right way, and to the right patients. In the *NTRK* guideline, the panel recommends the requirements for performing *NTRK* testing properly to select patients who are likely to benefit from TRK inhibitors. Electronic supplementary material ================================= {#Sec20} Below is the link to the electronic supplementary material. Supplementary file1 (TIF 179 kb)Supplementary file2 (DOCX 22 kb) **Publisher\'s Note** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This guideline was led by Japan Society of Clinical Oncology (JSCO)/Japanese Society of Medical Oncology (JSMO) collaboration, cooperated by The Japanese Society of Pediatric Hematology/Oncology (JSPHO). The authors would like to thank Prof. Y. Kitagawa, the president of JSCO, Mr. S. Akimoto, and Mr. Y. Yamamoto as the JSCO secretariat for their on-site assistance. The authors would like to thank Prof. Y. Ishioka, the president of JSMO, Mr. D. Kawashima, and Ms. H. Nishizawa as the secretariat of JSMO for their on-site assistance. The authors would like to thank Prof. H. Hosoi, the president of JSPHO for support. The authors would like to thank BIC ([www.bic.co.jp](http://www.bic.co.jp)) for the English language review. This guideline was supported by following funds: JSCO and JSMO Funds, including the Ministry of Health, Labour, and Welfare General Research Enterprise for Promoting Cancer Measures"Improvement in the quality of systems for providing medical treatment through the creation of guidelines for diagnosing rare forms of cancer" (Research Representative---Yasuhiro Kodera, (H29 -measures against cancers- public-013). All committee members and peer review members were nominated by each Society, and the conflict of interest (COI) control is conducted by each Society's regulation.
The importance of supportive periodontal therapy for molars treated with furcation tunnelling. Degree III furcation involvement (FI) represents a risk of molar tooth loss. A limited number of studies have assessed the survival of molars with degree III FI treated with tunnelling procedures. The aim of the present study was to assess periodontal disease progression and tooth loss in a cohort of patients with degree III FI treated with tunnelling by two periodontists in a private practice setting in the UK and in a hospital setting in Sweden. A retrospective study was conducted on 102 consecutive surgically created tunnelled molars in 62 periodontitis patients and followed up at least 5 years later (average 7-year and 9-month follow-up). Overall tooth loss for tunnelled molars was 29.4%. Multivariate analysis revealed statistically significant associations with tooth loss for 'irregular supportive periodontal therapy (SPT'; p = .039) and age (p = .037). Tooth loss occurred only in the Swedish sample, not undergoing regular SPT. A high rate of tooth loss was observed following tunnelling surgery, mainly in patients not undergoing regular supportive therapy. Clinical studies should be carried out to compare tunnelling with other treatment options for advanced furcation involvement in patients on SPT.
[The relapse rate in patients with bronchial asthma remission and the risk factors of relapse]. To investigate the relapse rate in patients with bronchial asthma remission, a questionnaire study was performed. The answer sheets from 450 of 865 patients who first visited Saitama Medical School Hospital before the age of 16 were obtained. 281 patients had been in asthma remission more than one year after the last their attack. Among them, 31 patients (14 males and 17 females) relapsed. Their average age of last attack was 15.1 +/- 3.6 years old. While the average age of the last attack in patients who did not relapse was 12.9 +/- 4.1. The average age of relapse was 20.8 +/- 4.2 and their duration of remission was 5.8 +/- 2.9 years. No relapse was observed after 14 years of remission. The most of the patients relapsed within 10 years. The relapse rate calculated by life table method was 13.5%. Relapse retes were calculated in various characteristics: females; 24.9%, patients who had severe symptoms at the first visit and moderately severe; 22.4%, 23.1%, respectively, positive history of steroid therapy; 25.1%, IgE level of more than 500 IU/ml; 19.7%, patients whose last attack was after the age of 13; 21.2%. Those figures are significantly higher than the opposite characteristics. The environmental factors significantly contribute to the relapse of remitted asthmatics. They are apartment house, ferroconcrete and aluminum-framed house, carpet in bedroom, pets, maternal or self-smoking. The asthmatic children who have those risk factors should be followed to prevent relapse and their environment controls should be adequately stressed even in asthma remission.
2012-13: Chipe was named to the All-Conference second team this season, after posting a singles record of 11-9. She was also awarded team MVP honors. High School: In 2010, Daniela competed in the absolute national games where she earned bronze as a singles player and helped her double team to a silver medal. Chipe also graduated from Colegio Americano de Guayaquil as a dean's list student. Personal: Daughter of Rodolfo Chipe and Julia Flor de Chipe, and has three siblings Rodolfo, Chantal, and Julia.
Amyloidogenesis induced by diet cholesterol and copper in a model mouse for Alzheimer's disease and protection effects of zinc and fluvastatin. Alzheimer's disease (AD) is one of the severe chronic diseases characterized with amyloid beta (Aβ) aggregation and formation of senile-plaque (SP) like structures. Numerous risk factors including trace metals and cholesterol in diet have been identified as potential players for the onset of Aβ aggregation. To further illustrate the effects of copper and cholesterol in AD pathology, we employed an AD model mouse strain (Tg2567) and examined the histological and biochemical changes in the mouse brains and blood. When supplied with 0.1 mg/L copper in drinking water and 2% cholesterol in the food, the mice showed significant deposit of amyloid beta (Aβ) and SP plaque formation in hippocampus and temporal cortex regions in their brains. These mice also showed elevated superoxide dismutase (SOD) activity and increased ceruloplasmin (CP) concentration, and reduced glutathione peroxidase (Gpx) activity in the blood. The physiological function tests indicated these mice were significantly impeded on learning and memory. We further examined the counteracting effects of 0.1 mg/L zinc and 1.0 mg/L fluvastatin (Cholesterol-lowering drug). The combination of zinc and fluvastatin effectively reversed the copper/cholesterol caused memory loss, anatomic amyloid deposits and the biochemical changes in the blood. This work provides more evidence of high-level cholesterol and copper as risk factors to trigger amyloid aggregation and mental dementia; zinc and reduction of food cholesterol levels can protect the animals from amyloid accumulation and learning impairment. The beneficial outcomes of zinc and fluvastatin could hint some potential usages in preventive measures for high-risk AD individuals, but further rigorous test are needed.
Intravesical combined chemoimmunotherapy with epirubicin and bacillus Calmette-Guérin is not indicated for superficial bladder cancer. The short-term effects of intravesical chemoimmunotherapy with epirubicin and bacillus Calmette-Guérin (BCG) administered repeatedly for prophylaxis of recurrence of superficial bladder cancer (pTa, pT1) were investigated in 24 patients aged a median of 70 years between March 1996 and February 1999, and were compared with those of BCG monotherapy in 50 patients from March 1990 to February 1999. The patients underwent intravesical instillation of the Tokyo strain BCG with or without epirubicin after transurethral resection (TUR) of bladder cancer. For the combined treatment, at 1-2 weeks after TUR, epirubicin (40 mg) and BCG (80 mg) were istilled into the bladder by turns once a week for 12 weeks. For the group receiving only BCG, 80-mg instillations were done with the same schedule. Thereafter, the patients were followed by cystoscopy and urinary cytology every 3 months for up to 3 years after intravesical therapy. At 2 years after treatment, the simple recurrence rate was 26.1% (6/23) in patients with chemoimmunotherapy and 32.0% (16/50) in BCG-treated patients. Adverse reactions, including increased frequency of urination, urgency and miction pain, were observed in 18 patients (85.7%) undergoing chemoimmunotherapy and 58.0% undergoing BCG monotherapy. One patient receiving chemoimmunotherapy was withdrawn from treatment because of symptoms of severe bladder irritation due to the instillation. Intravesical chemoimmunotherapy using epirubicin and BCG was finally found to be inferior in comparison with BCG monotherapy for the prophylaxis of recurrence of superficial bladder cancer.
Main menu Daily Archives: August 1, 2017 The COMME Des GARÇONS version of the Nike VaporMax is no doubt the most sought-after version of the shoe yet, and it looks like there may be another version on the way. Images recently leaked of a second VaporMax by CDG, which also appears to feature a laceless slip-on design, but modifies a few details. As you can see, the main difference is an additional synthetic film wrapping the upper that extends up the midfoot with a Swoosh in negative space. This brief look is all the info we have so far, so stay tuned to Sneaker News for more details on the possible new VaporMax collaboration by COMME Des GARÇONS. In other VaporMax news, check out the upcoming VaporMax Strap in a multi-color edition. The Nike VaporMax has been a stellar addition to Nike’s lineup and has been one of the most relevant Swoosh models since being introduced. The restructured visible air outsole takes a 30-year-old technology and alters it like never before getting rid of the midsole entirely so you can ‘walk on air’. Nike then added their signature Flyknit to the upper for a futuristic ride that anybody can get behind. Now the original VaporMax “Pure Platinum” colorway, one of the most popular installments to date given its fairly new “OG” status, is returning to European retailers on August 23rd. The cleanNike VaporMax Pure Platinum released to reset the whole Nike signature colorway palette, replacing the vibrant Volt of the 2010s with a simpler, more refined aesthetic. If you missed out on the Pure Platinum VaporMax, next month will be the perfect time to try again. One of the most anticipated releases of the year thus far is headed to Los Angeles early. The CLOT Nike VaporMax features a near Infrared colorway featuring that dynamic Flyknit upper and visible air unit and will be available today and tomorrow at a special LA pop-up location known as Back Alley Void at 801 Mateo St. There are only limited quantities available throughout the two day stretch according to Edison Chen, so if you’re in Los Angeles, you better act fast. The CLOT x Nike VaporMax will then drop in Europe on July 28th with a later US release coming shortly there after. Stay tuned for more details to come right here on Sneaker News.
The story is one that you and I will construct together in your memory. If the story means anything to you at all, then when you remember it afterward, think of it, not as something I created, but rather as something that we made together.
Reforms at TVETs will boost growth aspirations. Kenya’s higher education, science and technology sector is set for major reforms aimed at promoting a knowledge-based economy to improve national prosperity and global competitiveness. This would involve interaction of institutions and processes to enable the generation and conversion of knowledge into goods, processes and services. The move by the government to ensure trainers at Technical and Vocational Education and Training (TVET) institutions join the public service is aimed at boosting their performance and make the sector attractive. The scheme, which is undergoing the final review by the Public Service Commission, will see the technical training tutors leave the Teachers Service Commission. In the new system, TVET trainers will have their own terms of service unlike in the past when they were lumped together with primary and secondary school colleagues. Technical education training would also not be assessed in the same way as formal education, with teaching skewed towards competence rather than on theory. The latest developments come in the wake of the government’s recent move to establish TVET Authority to manage technical training institutions as part of the efforts to reposition technical and vocational education. The renewed focus on vocational and technical education is one of the strategies aimed at addressing youth unemployment. Building quality institutions that would develop the required manpower to enhance the capacity of Kenyan youths to contribute to the expansion of the economy is a move in the right direction. This goal of equipping the youth with relevant skills is being pursued through a two-pronged approach, the first being the requirement that all secondary schools must have skills acquisition content introduced in their curricula. The second approach is what used to be called village polytechnics will be renamed vocational training centres whose personnel must have been trained at the Technical Training Centre in Nairobi. There is no doubt that this level of commitment and investment in the technical education has never been witnessed in Kenya before. The current shortage of artisans, plumbers and technologists is due to failure by previous governments to prioritise the development of technical education. But with more emphasis on technical education, youths are going to get the right type of training that would empower them to become job creators and active players in the economy. What the government is doing is to redefine education and give the youths the knowledge and skills to effectively compete and face the challenges in the job market. Currently, many youths complain of lack of employment opportunities, even though majority of them lack the relevant skills. Meanwhile, the proposal that students joining technical training institutions will have an option of taking subjects related to their careers is also a step in the right direction. This is aimed at ensuring that students exploit their talents and attain specialisation in their areas. Once this is fully effected, students wishing to join technical training institutes would have a curriculum that is flexible and learner-friendly. It would be tailored to offer functional subjects and will be simplified to meet learners’ needs. This basically aims at offering skills that are important for day-to-day life and work as opposed to expansive and complex content that may not add value to learners’ lives. The system has proved successful in both developed and developing countries where students specialise as early as possible to prepare for careers of choice. In some countries, students start specialisation in secondary school. By the time they join university or technical institutes, the students emphasise on research work and less on class work because they are already equipped with the knowledge about their respective careers. The renewed focus on vocational and technical education by the government is one of the best strategies in making the sector attractive to Kenyans besides meeting the needs of the youth in the job market.
Q: NTAG 424 - how to diversify the key? I am currently working with the NXP NTAG 424 chips, which feature AES-128 encryption. In the end, one will be able to read an NDEF message; for example, with a smartphone, the backend server will then verify whether the message was delivered. However, NXP often implies that the UID should not be communicated in the clear. They even have a setting that disables the communication of the UID in the clear (it is then replaced with a fake UID). NXP also states the following in their application note: " Therefore verification side does not have immediate info on UID, which is usually used as input for key derivation function. In this case, KSDMMetaRead key shall not be UID diversified and high attention on secure storage on the system level of this key is required. " Why is the open communication of the UID such a problem? Can the UID be used to crack the key? How should one diversify the key instead? A: Why is the clear communication of the UID such a problem? Problem is that most RFID tags can be read at a distance, without the holder knowing. Since the UID is readable, and if it is fixed, that can help track the holder. That's why there is a trend¹ in modern RFID tags towards random UIDs (RID), and making it necessary for the tag reader to hold a key in order to be able to read any tag-identifying information. As explained in the question's quote, that key must be non-diversified, except when there is another tag identifier available thru a different channel². Can the UID be used to crack the key? No. The tag's UID is an arbitrary public number: fixed at manufacturing (often sequential or random), or drawn randomly³ at each power-up or reset of the tag (see NFC's AN10927). In a system with non-diversified key³, the UID has no relation to the key. In a system with diversified tag key $K_D$ derived from a master key $K$ (not in the tag), the UID has no relation with $K$. If the tag key is diversified per the UID, it holds the relation $K_D=\operatorname{KDF}(K,\text{UID})$. However, not knowing $K$, knowing the UID does not allow finding the tag key $K_D$, for proper $\operatorname{KDF}$. And even if $K_D$ is somehow extracted from some tag(s), then for proper $\operatorname{KDF}$ that does not allow finding the master key $K$ (which would allow to find $K_D$ for other tags). How should one diversify the key instead? In some tags, when the tag-identifying information (other than UID) has been read using the first non-diversified key, it can then be used to diversify another key, bringing back the security of diversified tag keys. I have no idea about if this is possible on this particular tag. As already explained, in some application it could be possible to diversify the key using a different information read thru an other mean, e.g. optical. ¹ That's currently marginal. In France, practice is that legitimate readers are required not to keep identifying information beyond the requirement of the application, and identifying information kept by unrelated applications should be protected against reconciliation (for example, a serial number read from an RFID tag could be be encrypted by an application-unique key before being entered in a database). ² In many modern passports/MRTDs that can be read per ISO/IEC 14443, the design is such that there is no identifying information (personal or not) readable directly by that channel, including a mere serial number/(U)UID/PUPI. Reading such information only becomes possible after reading data on the optically readable strip inside the passport, which (after a public transformation) acts as a key to unlock reading more thru the RF channel. I heard that one of the design rationale was to defeat a device that performs a nefarious action (explosion, toxic spray…) when a specific person approaches. If someone has a reference for the true design rationale, please leave comment. ³ In this case, the (U)UID has no cryptographic role and is only used for addressing purposes when there are several tags in the operating field of a reader.
Two blocks from home, there is a house for sale since 4-5 months. 7 bedrooms, 7 bathrooms, just a small thing, really. Newly constructed, it had been put on the market at $5M. Yes, yes, five million dollars. Well, it makes me feel better, they've failed to sell it so far. It *only* costs 4 million and a half now. Times are tough.PS FYI, the median home price (50% of homes cost more, 50% cost less) in Palo Alto is $1.6M nowadays.
Finding what's on! This may take a moment... BH90210 The original cast members of the groundbreaking teen drama "Beverly Hills, 90210" get back together to play heightened versions of themselves in this serialized drama that is inspired by their real lives and relationships with each other. Having gone their separate ways since the original series ended, Shannen, Jason, Jennie, Ian, Gabrielle, Brian, and Tori reunite when one of them suggests it's time to get a "Beverly Hills, 90210" reboot up and running. The iconic cast tries to continue from where they left off, but old romances, friends and frenemies return to create more drama than ever before.
IN THE COURT OF APPEALS OF THE STATE OF IDAHO Docket Nos. 38410 & 38411 STATE OF IDAHO, ) 2012 Unpublished Opinion No. 317 ) Plaintiff-Respondent, ) Filed: January 12, 2012 ) v. ) Stephen W. Kenyon, Clerk ) PAUL EUGENE McBRIDE, ) THIS IS AN UNPUBLISHED ) OPINION AND SHALL NOT Defendant-Appellant. ) BE CITED AS AUTHORITY ) Appeal from the District Court of the Fifth Judicial District, State of Idaho, Twin Falls County. Hon. Randy J. Stoker, District Judge. Judgment of conviction and concurrent unified sentences of thirty years, with minimum periods of confinement of twenty-five years, for two counts of sexual exploitation of a child, affirmed; order revoking probation and reinstating previously suspended unified six-year sentence with four-year determinate term for possession of a controlled substance, affirmed. Molly J. Huskey, State Appellate Public Defender; Eric D. Fredericksen, Deputy Appellate Public Defender, Boise, for appellant. Hon. Lawrence G. Wasden, Attorney General; Kenneth K. Jorgensen, Deputy Attorney General, Boise, for respondent. ________________________________________________ Before GRATTON, Chief Judge; LANSING, Judge; and MELANSON, Judge PER CURIAM In Docket No. 38410, Paul Eugene McBride pled guilty to two counts of sexual exploitation of a child. I.C. § 18-1507. In exchange for his guilty plea, other charges and an allegation that McBride was a persistent violator were dismissed. The district court sentenced McBride to concurrent unified terms of thirty years, with minimum periods of confinement of twenty-five years. McBride appeals. In Docket No. 38411, McBride pled guilty to one count of possession of a controlled substance. I.C. § 37-2732(c)(1). The district court suspended the sentence and placed McBride 1 on probation. He was serving this probation when he pled guilty to the charges in Docket No. 38410. Following the admission that he violated the terms of probation, the district court revoked probation and ordered execution of McBride’s original sentence. The district court ordered that McBride’s original sentence of six years, with a minimum period of confinement of four years, for possession of a controlled substance run concurrent with the sentences in Docket No. 38410. McBride argues that his sentences for sexual exploitation of a child are excessive. Sentencing is a matter for the trial court’s discretion. Both our standard of review and the factors to be considered in evaluating the reasonableness of the sentence are well established and need not be repeated here. See State v. Hernandez, 121 Idaho 114, 117-18, 822 P.2d 1011, 1014-15 (Ct. App. 1991); State v. Lopez, 106 Idaho 447, 449-51, 680 P.2d 869, 871-73 (Ct. App. 1984); State v. Toohill, 103 Idaho 565, 568, 650 P.2d 707, 710 (Ct. App. 1982). When reviewing the length of a sentence, we consider the defendant’s entire sentence. State v. Oliver, 144 Idaho 722, 726, 170 P.3d 387, 391 (2007). Applying these standards, and having reviewed the record in this case, we cannot say that the district court abused its discretion. McBride also argues that the district court should have sua sponte reduced his sentence for possession of a controlled substance upon the revocation of probation. Upon revoking a defendant’s probation, a court may order the original sentence executed or reduce the sentence as authorized by I.C.R. 35. State v. Hanington, 148 Idaho 26, 28, 218 P.3d 5, 7 (Ct. App. 2009). When we review a sentence that is ordered into execution following a period of probation, we will examine the entire record encompassing events before and after the original judgment. State v. Hanington, 148 Idaho 26, 29, 218 P.3d 5, 8 (Ct. App. 2009). We base our review upon the facts existing when the sentence was imposed as well as events occurring between the original sentencing and the revocation of probation. Id. Applying these standards, and having reviewed the record in this case, we cannot say that the district court abused its discretion. The record in this case shows that the district court properly considered the information before it and determined that probation or modification of the sentence was not appropriate. McBride has failed to show that the district court abused its discretion. Therefore, McBride’s judgment of conviction and sentence and the order revoking probation and directing execution of McBride’s previously suspended sentence are affirmed. 2
In the previous post in this series, we learned how the pets vs. cattle metaphor teaches us a new way of approaching cloud server architecture. Instead of unique pets which require constant, individual care, we focus instead on cattle which are identical, homogenous units that can be added en masse and removed with ease. Cattle servers are, in other words, fungible resources. "It takes a family of three to care for a single puppy, but a few cowboys can drive tens of thousands of cows over great distances." This post explains more about the cattle mindset, sometimes called the noflake approach. In contrast to a pet server, which is looked after by an administrator beavering away at a console, we want cattle servers to be configured with no intervention at all. Configuration Management Tools Pet servers are administered manually. We ssh into them, tweak configurations, download and install new packages, and perform maintenance tasks such as checking memory or network usage to make sure there aren’t any runaway processes. Not so with cattle servers. The difference is that with pet servers, configuration is done afterwards, or post facto. We create the server, and then administer it, changing the state of the server over a period of time. Whereas with cattle servers, configuration is done beforehand, or ex-ante. We write down, before the server is created, all the things we would like to be done on the server after it boots. We then send that configuration to the server, and the actions are executed on our behalf. The actions will be executed by a configuration management (CM) tool such as Puppet or Chef. The list of things that we want to be done after booting take the form of configuration files that the CM tools understand, and are written in specialised, sometimes declarative, domain specific languages. If you are familiar with the Ruby programming language, you will be at home with either Puppet or Chef, as both allow a Ruby syntax option for their domain specific languages. You can, for example, use Chef at Engine Yard, so take a look at our open source Chef recipes on Github to get a feel for what a Chef recipe looks like. Pros and Cons To recap quickly: Deployment Configuration point Server model Manual Post facto Pet Automatic Ex-ante Cattle There are advantages and disadvantages to each approach. An obvious advantage of post facto administration is that it is reactive. If something went wrong during the setup process, the admin could rectify the problem interactively, in real time. On an ex-ante cattle server, the actions in the CM configuration files have to be correct before they are sent to the machine. But once the configuration is correct, suddenly the cattle servers have a huge advantage: because the config is standardised, you can feed it to many servers, and the results should be identical across all servers, barring hardware malfunctions. This means that you can have high-speed, efficient replicability. With replicability also comes scalability and, should a server need to be replaced, easy reprovisioning. Another advantage of using CM is that a team can work on the config files together. Files can be commented on, shared, versioned, diffed, and attributed. If you keep them under version control using Git, for example, you can even track the history of changes. These features of CM allow the collaborative management of your production configuration across a team of arbitrary size. And because the configuration is independent of the present, arbitrary, state of a specific pet server, it’s much easier to debug. Configuration Lifecycle Even if you’re using CM, there are a variety of options as to how you apply it. If you’re using virtualisation, there are two primary places where configuration can be applied: before or after the machine image is compiled. After Compilation One approach is to start out with a very basic machine image as a base for all of your servers. If you’re using something like AWS, there are plenty of these available already. If you’re rolling your own setup, you could use one of the many available OS images. (Most UNIX-like distros provide bootable ISOs which can effectively serve as base images.) Your CM configuration is then responsible for updating all of the local packages, installing the new packages you need, and configuring the rest of the system. This sort of approach makes life easier for your development team, because the base image will very rarely change. New configurations can be tested locally, pushed to a repository, and you’re done. But each time you boot an instance the configuration needs to be run. This can be brittle and hard to debug if it goes wrong. And depending on how much configuration is needed, it may be a while before the new instance is ready to start accepting requests. Before Compilation To take the opposite approach, you could apply the configuration to the base image once, and then compile a new image. Whenever you want to spin up an instance, you can then boot that image. Each instance spun up in this way will be byte-for-byte identical, and good to go without the need for any additional configuration. Naturally, instances booted like this are going to be able to start serving requests much faster, which is important if you’re scaling out a cluster to deal with a sudden surge of traffic. One of the drawbacks of this method is that each change to your configuration requires a new image to be compiled and installed into your VM management system. And this can introduce delays and cause additional work for your development team. Additionally, if you already have a running cluster of instances that use an old image, you will need to replace them all so that they are using the new image. This can become very complex to manage. Hybrid Approach These are just two examples. There’s a whole spectrum of techniques that lie in between these two points. For instance, if your boot times are very slow, you can “warm” your cluster by spinning up new instances ahead of time. This can be especially useful before a big announcement, or in any other situation where you know that traffic will surge. At Engine Yard, we take a hybrid approach. The bulk of our standard configuration is done before the image is compiled. And after the machine boots, we handle customer specific configuration, which can’t be done ahead of time. In fact, this whole process is neatly abstracted away behind an Apply button on your dashboard, which will re-run all of the Chef configurations across your cluster. Fortunately, Chef configurations are designed to be idempotent, meaning you can re-run them as many times as you like, and there should be no side-effects; the results will always be the same. Conclusion The configure before you boot method may seem unusual to those who are used to the pet model of server maintenance. In a cloud computing environment, however, clusters containing many server instances need to be spun up quickly and homogeneously. This shows obvious benefits to using a CM for ex-ante server configuration. And as well as the benefits that are required to make a cloud architecture seamless, you get additional advantages from keeping your configs in version control. Configuration management can be complex to set up, depending on the size of your app. Fortunately, most platform providers automate this for you. It’s one of the benefits of going with a PaaS instead of an IaaS. A significant chunk of the hard work is done for you. In the next post in this series, we’ll look at the constraints that are placed on app developers as they attempt to design for deployment on cattle servers. Are you more used to the pet model, or the cattle model? And which form of deployment do you prefer: pre-baked images, post-boot configuration, or something else entirely? We’d love to hear from you in the comments. Give us your opinions! About Noah Slater Noah Slater is a Briton in Berlin who’s been involved with open source since 1999. They’ve contributed to Debian, GNU, and the Free Software Foundation. They currently serve as a member of the Apache Software Foundation. Their principal project is Apache CouchDB, the document database that kicked off the NoSQL movement. They also help out in the Apache Incubator, where they mentor new projects in the ways of community and open source. CHECK OUT OUR CURATED COLLECTIONS Look through our specially curated posts to get focused, in-depth information on a single topic.
Our Enduring Legacy Circle As an Enduring Legacy Circle member, your planned gift ensures that individuals with moderate to profound developmental disabilities and autism will continue to have access to a safe, secure, and welcoming facility that enables each person to discover and expand his or her capabilities to the highest possible level. Donors may plan for important personal financial objectives while providing a future legacy gift to the Las Trampas Endowment. For further information, please contact Brooke Burns, Interim Development Director, at (925) 310-2362 or bburns@lastrampas.org. This tax break lets individuals 70 1/2 years or older donate up to $100,000 a year directly from their Individual Retirement Accounts to qualified charities without having the distribution from the IRA added to their adjusted gross income. This distribution can also count toward their required minimum distribution. If a taxpayer files a joint return, the spouse can also have a QCD and exclude up to $100,000. Here’s How It Works: You must be 70 1/2 or older at the time of distribution. Distributions to be credited to your 2014 minimum required distribution must be completed by December 31, 2014. Your IRA administrator must make the distribution directly to the charity, or you may write a check payable to the charity from your IRA checkbook. For a sample letter of instruction to your IRA administrator requesting a distribution to Las Trampas, click here If you make a gift to Las Trampas, Inc., please include written instructions on how you would like to designate your gift by making a note on your IRA check, or you can call (925) 284-1462 x.239 Interim Development Director Brooke Burns, or email bburns@lastrampas.org with your gift designation. Before proceeding, you should also consult your tax advisor to discuss your particular situation, including any impact of your state’s tax laws. For example, the following transfers do not qualify: distributions to private foundations, to donor advised funds, for life income gifts (e.g., charitable remainder trusts), and for any purpose that entitles you to receive a benefit, such as tickets to an event. Donations of Stock Wish List Items by Program You can help us to meet budgetary restrictions and sponsor our programs by purchasing any of the items listed below. Items should be in good repair and working condition. For clarification on items needed, contact the associated director at the email addresses listed below:
Hold-Up! (2012 film) ¡Atraco! is a 2012 Spanish-Argentine film directed by :es:Eduard Cortés, filmed in Spain. The script was written by the director with Pedro Costa. The film stars Guillermo Francella, Nicolás Cabré, and Amaia Salamanca. References Category:2012 films Category:Argentine films Category:Spanish films
1. Field of the Invention The present invention is directed to methods and systems for introducing additives to the combustion chamber of an engine via the air-intake system. 2. Description of the Related Technology Additives are traditionally added to fuel before the fuel is pumped into fuel tanks of vehicles or other devices. An additive package formulated in this manner commonly experiences a full range of environmental conditions over an extended storage period. The fuel/additive Mixture must remain essentially homogeneous throughout the transport, handling and storage period and thus must be formulated to endure extreme heat and cold, varying levels of humidity, etc. Further, the additive package must deliver a wide variety of components, which must be compatible with each other in order to be formulated in the fuel. Further, some additives may cause harm to fuel tanks or the fuel delivery system, e.g. damage to seals and gaskets. These problems often place significant constraints on an additive destined for use in fuel. Other limitations on formulation of fuel additives also exist. For example, fuel formulators may not want to include certain additives in a particular fuel due to the increased cost of the fuel as a result of including the additive. Further, fuel formulators may introduce their own components into a fuel or particular fuels may contain potentially reactive species raising further compatibility problems for introduction of other additives which may potentially react with such components. For example, fuels may contain reactive species such as ethanol, ethers, fatty acid esters, acidic corrosion inhibitors, drag-reducing polymers, phenol antioxidants, wax anti-settling additives, cloud point reducers, aromatic amines, organic nitrates, organometallic octane enhancers and reactive dienes, thiophenes, peroxides and polynuclear aromatics. Also, additives can be rejected by fuel formulators when the desired treat rate in the fuel exceeds the capacity of the fuel additive addition systems located at a fuel terminal. As discussed above, some very desirable additives are less than optimal when used in fuel additive formulations. These fuel additives or blend agents have yet to realize their full potential. Some examples of such restrictions are discussed for example in U.S. Pat. No. 7,846,224 where it is indicated that some friction modifiers may be incompatible with, or insoluble in the fuel or other additives likely to be in the fuel at low temperature. Wax-like materials are excellent friction modifiers, but have limited solubility in fuels. There are some known methods that involve the introduction of certain compositions into the air-intake system of engines. Examples of such methods can be found, for example, in U.S. Pat. Nos. 4,377,135; 7,146,938; 5,282,445; 6,152,099; and 6,523,530. These prior art methods are, for the most part, not directed to solving or avoiding the compatibility or solubility problems that may be encountered when formulating fuel additives into a fuel. In addition, the control mechanisms used in many of these prior art methods suffer from significant drawbacks and thus are not generally suitable for controlling the amount, aerosol particle size and/or timing of the additives being introduced into air-intake system in order to provide the most benefit.
The Tufts Hybrid Racing Team was pleased and excited to head up to the 2012 Formula Hybrid Competition. We joined 25 teams who made it to New Hampshire, out of the 39 teams who had signed up ahead of time. After that, life became challenging. We had some technical issues with our motor controller and battery management system that slowed us down, and we were not able to pass through the tech inspections in time. It may be cold comfort, and the weather was certainly cold and wet, but we weren’t the only ones with problems: just nine hybrid teams passed all the inspections and raced. Despite the disappointing turn of events, all of our team members, especially those who had not been to the competition before, learned a ton, and we are all hungry to return as a stronger team next year. You can see all the photos of us at the completion here.
Comparison of activation of corticospinal neurons and spinal motor neurons by magnetic and electrical transcranial stimulation in the lumbosacral cord of the anaesthetized monkey. To illuminate the action of non-invasive stimuli on the human cerebral cortex, responses of corticospinal axons and of plantar alpha-motor neurons following transcranial magnetic (TMS) and electrical stimulation (TES) were recorded in the lumbosacral cord in the anaesthetized macaque monkey. A round coil was used for TMS, and the anode was located at the vertex for TES. The responses of 175 identified corticospinal axons (conduction velocities of 24-95 m/s) were recorded from the lateral corticospinal tract at the T12-L3 spinal level. A single magnetic or electrical stimulus could evoke an early spike corresponding to the direct (D) wave in surface recorded volleys and was termed a D response. In the same axon, up to four further spikes, termed indirect (I) responses, could also be evoked. At a given intensity of stimulation, D responses had clear thresholds and fixed latencies, whereas I responses were labile in both respects. For TMS and TES, the thresholds of both D and I responses were inversely correlated with axonal conduction velocity. For TMS, fast conducting axons (> 75 m/s) had lower thresholds for D responses, while more slowly conducting axons (< 55 m/s) had lower thresholds for I responses. Very few of the axons with a conduction velocity of < 40 m/s (three out of 23) gave a D response to TMS. For TES, the majority of axons had lower thresholds for D responses or a similar threshold for both D and I responses. At threshold, the latencies of D responses evoked by TMS and TES were consistent with activation within the cortex, while TES also excited some corticospinal axons deep to the cortex. At 2.5 times threshold for the D response, TMS still excited axons mostly within the cortex, but with TES the site of activation shifted by as much as 65 mm below the cortex (mode 20 mm). Intracellular responses were recorded in 23 plantar alpha motor neurons supplying intrinsic muscles of the foot. All showed monosynaptic excitatory post-synaptic potentials (EPSPs) to both TMS and TES with no significant differences in the rise times of the evoked EPSPs. At threshold for a surface corticospinal volley, the average EPSP to TES began 0.5 ms earlier than that to TMS, and 1.0 ms earlier at 2.5 times this threshold. The different sites of activation of corticospinal neurons by TMS and TES, as well as the different distribution of D and I responses that they evoke, may both contribute to the differences in the onset latencies of the EMG responses evoked by these methods in human subjects.
Background {#bjhp12362-sec-0006} ========== Context matters: It shapes the way we perceive pain so that an identical noxious stimulus in one situation will be painful, while in a different context, it will not. Early in the history of pain research, Beecher ([1946](#bjhp12362-bib-0002){ref-type="ref"}) underscored its relevance in describing how soldiers reacted differently to injuries incurred at war compared to in a safe environment. Context is defined as the collection of cues that signal the probable outcome of a given response (Klein, [1996](#bjhp12362-bib-0011){ref-type="ref"}; Linton, Flink, Schrooten, & Wicksell, [2016](#bjhp12362-bib-0015){ref-type="ref"}). Thus, context is important in learning how to respond to pain in the most advantageous way. Although the context is readily acknowledged as important, there is a lack of research in the field of pain, especially regarding the social context and the link between context‐(in)sensitive responding to social cues and pain. Responding to social cues seems to be important for adaptation to pain. For example, in some situations social support may be obtained by talking about the pain, while in others, the same behaviour might be punished (Martel, Wideman, & Sullivan, [2012](#bjhp12362-bib-3002){ref-type="ref"}; Shaw, Campbell, Nelson, Main, & Linton, [2013](#bjhp12362-bib-0020){ref-type="ref"}). The term *context sensitivity* refers to whether a response is in tune with the social context, involving both attending to cues and an ongoing awareness of reinforcement contingencies, while *insensitivity* is the lack of responding to these cues and an ignorance of current contingencies. Several studies indicate that context sensitivity may be a key in the development of emotional disturbances (Bonanno & Burton, [2013](#bjhp12362-bib-0003){ref-type="ref"}; Coifman & Bonanno, [2010](#bjhp12362-bib-0006){ref-type="ref"}). Similarly, pain coping strategies may be most advantageous when they are sensitive to contextual cues (Linton, [2013](#bjhp12362-bib-0013){ref-type="ref"}; Linton *et al*., [2016](#bjhp12362-bib-0015){ref-type="ref"}). To date however, we know little about how well patients with pain respond to changes in the social context, that is, how context (in)sensitive they are and if this is related to problem severity. While research on context (in)sensitivity in pain has been hampered by methodological problems, recent advances from psychopathology now allow for its direct study. The technique was developed in psychological investigations of bereaved adults. Participants who recently lost a loved one were asked to talk about four different topics (loss topic, negative non‐loss topic, positive topic, and current events), each clearly cued by the interviewer (Coifman & Bonanno, [2010](#bjhp12362-bib-0006){ref-type="ref"}). The session was recorded, and sensitivity was determined by studying the correspondence between topic and the participants' emotional responses. This technique has been tweaked and successfully employed in a sample of medical patients (Harvey, Coifman, Ross, Kleinert, & Giardina, [2016](#bjhp12362-bib-0010){ref-type="ref"}). We draw from these studies, with the purpose of preliminary testing, the value of the concept for understanding pain. We invited people suffering from subacute and chronic pain to talk openly about three different topics consecutively in a counterbalanced order: (1) the pain; (2) a negative non‐pain topic; and (3) a positive topic. In line with the earlier used paradigm (Coifman & Bonanno, [2010](#bjhp12362-bib-0006){ref-type="ref"}), we estimate context sensitivity based on whether participant\'s expressions of pain and positive/negative affect were congruent with the valence of the cued context. Next, we explored the link between context sensitivity and current levels of pain‐related problems. The purpose of this study then was to test a method for determining levels of context sensitivity in patients suffering from pain and to explore the relationship between context sensitivity, as the predictor variable, and concurrent levels of pain‐related problems, as the outcome. Method {#bjhp12362-sec-0007} ====== Overview {#bjhp12362-sec-0008} -------- In this study, participants suffering from subacute and chronic pain were cued to talk openly about three different topics consecutively, in a counterbalanced order: (1) their pain, (2) a negative non‐pain topic, and (3) a positive non‐pain topic (with the order of topics randomized across participants). We measured participants' emotional responses (observed facial expressions and self‐reported affect) and pain bothersomeness (self‐reported pain) across these experimental conditions. The degree to which the responses and the valence of the cued topic were in (dis)accordance was used as a proxy for participants' degree of context (in)sensitivity. In other words, we assumed that the more the responses were in line with the cued topic, the higher the degree of context sensitivity was. Table [1](#bjhp12362-tbl-0001){ref-type="table"} gives an overview of assumed context‐sensitive and context‐insensitive responding (based on Coifman & Bonanno, [2010](#bjhp12362-bib-0006){ref-type="ref"}) as a reference when analysing the results. First, we analysed the associations between responses and topic. Second, we explored the association between context‐sensitive responding and pain‐related problems while controlling for baseline levels of pain and affect. The study was approved by the Regional Ethical Review Board. ###### Overview of assumed context‐sensitive and context‐insensitive responding -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pain topic Positive non‐pain topic Negative non‐pain topic ----------------------------- ---------------------------- ---------------------------- ---------------------------- ------------------------------------- ---------------------------- ---------------------------- Observed facial expression Negative facial expression Positive facial expression Positive facial expression Negative facial expression Negative facial expression Positive facial expression Subjective rated experience Pain bothersomeness Positive affect Positive affect Negative affect Pain bothersomeness Negative affect Positive affect\ Pain bothersomeness -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- In the pain topic context, we did not have any assumptions regarding negative affect, as that could both be viewed as context‐sensitive (i.e., part of the pain experience) or context‐insensitive (i.e., not related to pain). John Wiley & Sons, Ltd Participants {#bjhp12362-sec-0009} ------------ Figure [1](#bjhp12362-fig-0001){ref-type="fig"} displays the recruitment process. The study was advertised in local newspapers. Individuals interested in participating contacted the researchers by phone or e‐mail and were informed about the study\'s general purpose and procedure. Interested individuals underwent a structured screening interview. Inclusion criteria were as follows: (1) sufficient language skills; (2) age = 18--70 years; (3) subacute or chronic back, shoulder, and/or neck pain (\>3 weeks); (4) pain intensity the past week ≥ 3 on a scale from 0 (*no pain*) to 10 (*unbearable pain*); and (5) pain frequency the past 3 weeks ≥ 5 on a scale from 0 (*never*) to 10 (*always*). Exclusion criteria were as follows: (1) severe psychiatric illness that could interfere with participation (e.g., psychosis, substance abuse), (2) severe psychiatric or medical condition at high risk of deterioration in the coming year (e.g., malign cancer), and (3) a planned treatment or surgery in the coming year (e.g., disc surgery). Decisions about eligibility were communicated by phone. Participants were offered snacks and vouchers worth 20 Euros as incentives. Table [2](#bjhp12362-tbl-0002){ref-type="table"} presents characteristics of the sample. ![Recruitment process and reasons for exclusion.](BJHP-24-443-g001){#bjhp12362-fig-0001} ###### Background variables and pain characteristics of the sample (*N *=* *62) ------------------------------------------------- -------------- Age, *M* (*SD*) 55 (12.9) Pain intensity, *M* (*SD*) 5.8 (2.0) ÖMPSQ, *M* (*SD*) 111.3 (29.4) Born in Sweden 95% Gender, women/men 77%/23% Married or in a relationship 71% Pain location (more than one location possible) Neck 51% Shoulder 61% Upper back 30% Lower back 72% Arms/legs 38% Head 27% Stomach 15% Pain duration 1--12 months (acute/subacute) 8% \>12 months (chronic) 92% Occupation Employed 43% Sick leave 16% Unemployed 5% Other (e.g., retired) 36% ------------------------------------------------- -------------- ÖMPSQ = Örebro Musculoskeletal Pain Screening Questionnaire (range 3--210). John Wiley & Sons, Ltd Procedure {#bjhp12362-sec-0010} --------- The protocol was based on the procedure used by Coifman and Bonanno ([2010](#bjhp12362-bib-0006){ref-type="ref"}) and was tested in a pilot study (*N *=* *16). The participants were randomly assigned to one of six possible experimental orders (e.g., pain topic -- negative non‐pain topic -- positive topic, or pain topic -- positive topic -- negative non‐pain topic) and were contacted by an experiment leader with whom they agreed on a date and a time for participation. The experiment leaders were three female students in clinical psychology who were blind to the hypotheses of the study. All experiments were carried out at the research centre within 3 months after inclusion. When arriving at the centre, the experiment leader repeated the information about the study and described the experiment more in detail. The participants filled out informed consents, provided demographical data, and completed the self‐ratings regarding pain‐related problems, baseline pain bothersomeness, and positive/negative affect. Subsequently, the experiment leader initiated the video recording and announced the beginning of the first experimental condition (i.e., either the pain topic, the negative non‐pain topic, or the positive topic). The experiment leader read a script informing the participants that they would soon be asked to speak in an open‐ended manner about a certain topic for 2 min. The participants were informed that the experiment leader would remain silent during 2 min and that a timer would announce the end of the 2 min. The experiment leader encouraged the participants to take breaks for reflection if needed. The participants were told to stop talking when the timer signalled, regardless of whether or not they had finished telling their story. As soon as the participants indicated that they were ready, the experiment leader started a timer set on 2 min and prompted the participants to begin talking. When the timer signalled, the experiment leader thanked the participants for sharing their story. Directly thereafter, the participants rated their experience of pain bothersomeness and positive/negative affect during talking. The second and third experimental conditions were carried out identically to the first experimental condition except for a change in the way interview topics were cued (the independent variable). In between the different topics, there was a short break (5--10 min). The experiment leaders were instructed to communicate a neutral stance through facial expressions and body language throughout the experiment. The experiment leaders were trained in how to handle typical difficulties during the experiment (e.g., questions, intense emotions, inability to choose a topic to speak about, non‐adherence to the time frame) in a standardized manner. In general, the participants did not have any trouble finding topics, and the experiment leaders did not have to be active during the interviews. The topics varied in content, from more personal ones (e.g., a loss of a loved one, an injury) to daily hassles or positive events (e.g., birthday party, a nice vacation). ### Independent variable (cued interview topics) {#bjhp12362-sec-0011} To create three different controlled social contexts, we varied the verbal instructions (i.e., cues) in the interview situations, based on the paradigm used by Coifman and Bonanno ([2010](#bjhp12362-bib-0006){ref-type="ref"}). In the pain topic interview, the general instruction was followed by an invitation to 'speak about your pain and how it affects your life'. In the negative non‐pain topic interview, the participants were asked to speak about 'an event or a topic that affects you personally and that is not related to your pain'. Moreover, the participants were told that 'the event or topic is supposed to be an event or a topic that elicits negative emotions when you think and speak about it. I want you to focus specifically on the aspects eliciting negative emotions'. Finally, the positive topic interview was identical to the negative non‐pain interview except for the fact that the participants were encouraged to speak about a positive event or topic instead of a negative. Measures and materials {#bjhp12362-sec-0012} ---------------------- All self‐report instruments were administered through a web‐based survey facility provided by the university. The survey also included demographic questions about age, sex/gender, occupation, country of birth, and civil status. ### Experimental assessment of emotional responses and pain bothersomeness {#bjhp12362-sec-0013} #### Facial expressions {#bjhp12362-sec-0014} The system for assessing and coding facial expressions of pain and emotions was based on Coifman and Bonanno ([2010](#bjhp12362-bib-0006){ref-type="ref"}). The experiments were video recorded using a Sony Handycam HDR‐CX220 (Sony Corporation, China). The camera was positioned 1 m from the participants and captured the participants from the waist up. The recordings were later viewed by four students in clinical psychology who were blind to the hypotheses and specifics of the study. The coders viewed each experimental condition without sound on a 24‐in. computer screen, according to a randomized order. They were instructed to take into account their total impression of the participant\'s facial expressions and upper body language. The coders used a 7‐point Likert scale to estimate the participants' degree of negative affect and positive affect. The inter‐rater reliability was considered as sufficient (intraclass correlation coefficient, .40--.80), except for in the pain interview context where the inter‐rater reliability of negative facial expression was too low. Therefore, facial expressions in this context were excluded from the analyses. #### Subjective positive affect and negative affect {#bjhp12362-sec-0015} Self‐rated positive affect and negative affect were assessed with an instrument specifically developed for the current study in line with the approach used by Coifman and Bonanno ([2010](#bjhp12362-bib-0006){ref-type="ref"}), and Coifman, Bonanno, and Rafaeli ([2007](#bjhp12362-bib-0007){ref-type="ref"}). The respondents were cued to report on their emotional experience at baseline ('Reflect on how you are feeling *right now* and answer the questions below') as well as immediately after each of the three interview conditions (thinking back and rating how they felt during the interview). They answered eight questions about the extent to which they experienced negative emotions (fear, guilt, distress, and sadness) and positive emotions (happiness, enjoyment, relief, and amusement) (0 = *not at all* to 7 = *very much*). Ratings were aggregated for an overall negative affect score and an overall positive affect score (both ranging from 0 to 28). We checked the correspondence between this measure and the Positive and Negative Affect Schedule (PANAS; Watson, Clark, & Tellegen, [1988](#bjhp12362-bib-0023){ref-type="ref"}). As there was satisfactory agreement (correlations between .28 and .63 on negative affect and between .57 and .80 on positive affect), our measure was used in the subsequent analyses. The internal consistency on the items measuring positive affect was good (Cronbach\'s alpha .89--.95). On the measure of negative affect, it was somewhat lower and questionable (Cronbach\'s alpha .65--.76), due to a certain degree of floor effect. #### Pain bothersomeness {#bjhp12362-sec-0016} Pain bothersomeness was assessed using an instrument specifically developed and pilot tested for the current study, containing six items. Participants were asked to report their experience at baseline as well as immediately after each of the three interview conditions: They rated five items formulated either as questions ('How much pain do you have?' and 'How much does your pain distract you?') or statements ('I find it difficult focusing on anything else than the pain', 'I\'m restlessly waiting for the pain to decrease', and 'The pain I\'m experiencing is distressing me'). Items were reformulated to past tense for reporting backward, after each interview condition (e.g., 'How much pain did you experience?'). The items were rated on a scale from 0 (*Not at all* or *Not true at all*) to 7 (*Very much* or *Completely true*), resulting in a total score ranging from 0 to 42. The internal consistency of these items was good (Cronbach\'s alpha .84--.88 depending on condition). ### Dependent variable {#bjhp12362-sec-0017} #### Pain‐related problems {#bjhp12362-sec-0018} Problem severity was assessed with the Örebro Musculoskeletal Pain Screening Questionnaire (ÖMPSQ; Linton & Halldén, [1998](#bjhp12362-bib-0016){ref-type="ref"}). The ÖMPSQ was developed to identify patients at risk for developing persistent pain‐related problems, but has also been used to predict future sick leave and perceived health in chronic pain populations (Westman, Linton, Öhrvik, Wahlén, & Leppert, 2008). The instrument consists of 25 items covering various aspects of pain‐related problems such as localization, intensity, frequency, coping behaviour, stress, pain‐related beliefs, and disability. The items are formulated as questions (e.g., 'Based on all the things you do to cope, or deal with your pain, on an average day, how much are you able to decrease it?') or statements (e.g., 'Physical activity makes my pain worse') and are rated on a scale ranging from 0 (e.g., *Can\'t decrease it at all* or *Completely disagree*) to 10 (e.g., *Can decrease it completely* or *Completely agree*). The total score ranges from 3 to 210. A total score between 90 and 105 is commonly interpreted as indicative of a moderate risk for persistent pain and functional impairment, whereas a total score above 105 is interpreted as indicative of a relatively high risk (Linton, [2002](#bjhp12362-bib-0012){ref-type="ref"}). The ÖMPSQ has demonstrated good psychometric properties (Linton & Boersma, [2003](#bjhp12362-bib-0014){ref-type="ref"}). Data analyses {#bjhp12362-sec-0019} ------------- Positive and negative affect and pain bothersomeness in the three different contexts were considered independent variables in the analyses, and Örebro Musculoskeletal Pain Screening Questionnaire (ÖMPSQ) scores were treated as the outcome, as a proxy for pain‐related problems and risk for future disability. This experimental ordering was applied to minimize the risk of demand characteristics, although it deviates from the usual temporal experimental order (i.e., the 'outcome' was assessed before the predictors). Due to skewness on the subjective ratings of emotions and pain bothersomeness, data were summarized using median and interquartile range. As a manipulation check, differences in pain and positive/negative affect were compared across the three interview topics using non‐parametric statistics (Friedman\'s ANOVA with Wilcoxon signed rank test as *post hoc* test). To investigate the relation between responses and pain‐related problems, we performed stepwise multiple linear regressions with the ÖMPSQ as dependent variable. Baseline levels of pain bothersomeness, positive affect, and negative affect were controlled for in step 1, and context‐related pain bothersomeness, positive affect, and negative affect were added in step 2 for each interview topic separately. Due to the skewness of the subjective ratings, median splits were used on these variables. Results {#bjhp12362-sec-0020} ======= The overall aim was to explore the impact of social‐emotional responding above and beyond the known links between negative affect, pain, and pain‐related problems. To this end, baseline levels were controlled for in the analyses. Manipulation check {#bjhp12362-sec-0021} ------------------ Table [3](#bjhp12362-tbl-0003){ref-type="table"} shows the associations between interview topics and emotional responses (observed facial expressions and self‐reported affect) and pain bothersomeness on a group level. There were significant differences in emotional responses between the interview topics, except for negative facial expression. The responses were topic congruent, which indicates that overall the manipulation worked, that is, the three contexts triggered different responses. Specifically, pain bothersomeness was significantly higher during the pain topic interview compared to during the positive topic interview. Self‐reported negative affect was significantly higher during the negative non‐pain topic interview compared to during the positive topic, as well as compared to during the pain topic interview. Finally, self‐reported positive affect as well as positive facial expression during the positive topic interview was significantly higher compared to during the negative non‐pain topic interview. Taken together, on average there was congruency between cued topic and response, which indicates that the manipulation worked as intended. ###### Participants' median (interquartile range) emotional responses during the interviews with different topics Pain topic^a^ Negative non‐pain topic^b^ Positive non‐pain topic^c^ Test statistic -------------------------------------------------------------------- --------------- ---------------------------- ---------------------------- ---------------- ----- ------- ------------------------------------------------------------- ------------------------ Pain bothersomeness 8 9.0 6 10.50 4.5 10.25 χ^2^ *F*(2) = 17.62[b](#bjhp12362-note-0005){ref-type="fn"} a \> c Self‐rated negative affect 3 7.0 6 7.0 0 0 χ^2^ *F*(2) = 62.13[b](#bjhp12362-note-0005){ref-type="fn"} a \< b; b \> c; c \< a Self‐rated positive affect 3 8.0 1 3.0 20 13.0 χ^2^ *F*(2) = 91.43[b](#bjhp12362-note-0005){ref-type="fn"} b \< c; a \< c Negative facial expression[a](#bjhp12362-note-0004){ref-type="fn"} 4.63 2.25 4.5 1.5 *T *=* *608.0 Positive facial expression 1.75 1.25 1.75 1.19 3 2.19 χ^2^ *F*(2) = 64.19[b](#bjhp12362-note-0005){ref-type="fn"} b \< c; a \< c χ^2^ *F* = Friedman\'s ANOVA; *T* = Wilcoxon signed rank test. No data on negative facial behaviour during the pain topic due to low intraclass correlation coefficient. *p* \< .001. John Wiley & Sons, Ltd The relationship between context sensitivity and pain‐related problems {#bjhp12362-sec-0022} ---------------------------------------------------------------------- To explore the relationship between the degree of context sensitivity and pain‐related problems, Table [4](#bjhp12362-tbl-0004){ref-type="table"} shows the predictive value of self‐reported pain and affect during the pain topic interview in explaining variance in pain‐related problems as measured by the ÖMPSQ. As can be seen, controlling for baseline pain bothersomeness, positive affect, and negative affect, high levels of negative affective responding during the pain topic interview were related to higher levels of pain‐related problems. ###### Prediction of pain‐related problems based on emotional responding and pain bothersomeness during the pain topic interview Pain topic (PaT) analysis for subjective emotional responses and pain bothersomeness, *F*(6, 51) = 4.71[\*\*](#bjhp12362-note-0007){ref-type="fn"} ---------------------------------------------------------------------------------------------------------------------------------------------------- -------------------------------------------------- ------ ------ ----- --------------------------------------------- Step 1 Baseline pain bothersomeness 1.22[\*\*](#bjhp12362-note-0007){ref-type="fn"} 0.43 .36 .23 Baseline negative affect −0.25 0.86 −.04 Baseline positive affect −1.66[\*\*](#bjhp12362-note-0007){ref-type="fn"} 0.58 −.36 Step 2 Baseline pain bothersomeness 0.74 0.51 .22 .28 .5[\#](#bjhp12362-note-0007){ref-type="fn"} Baseline negative affect −1.04 0.94 −.16 Baseline positive affect −1.98[\*\*](#bjhp12362-note-0007){ref-type="fn"} 0.73 −.42 PaT pain bothersomeness 13.55 8.73 .23 PaT negative affect 16.01[\*](#bjhp12362-note-0007){ref-type="fn"} 7.38 .27 PaT positive affect 9.20 9.33 .16 Dependent variable is Örebro Musculoskeletal Pain Screening Questionnaire. No facial behaviour is analysed due to low intraclass correlation coefficient on negative facial behaviour during the pain topic interview. ^\#^ *p* \< .10; \**p* \< .05; \*\**p* \< .01. John Wiley & Sons, Ltd Table [5](#bjhp12362-tbl-0005){ref-type="table"} shows the predictive value of emotional responding (observed facial expressions and self‐reported pain and affect) during the negative non‐pain topic interview in explaining variance in pain‐related problems. As can be seen, while controlling for baseline pain bothersomeness, positive affect, and negative affect, higher levels of self‐reported pain bothersomeness as well as self‐rated and observed negative affect were associated with higher levels of pain‐related problems. Note however that the change in explained variance when adding self‐reported negative affect (step 2) was only significant at *p* \< .10. ###### Prediction of pain‐related problems based on pain bothersomeness and emotional responding during the negative non‐pain topic interview Variable *B* *SE B* β *R* ^2^ Δ*R* ^2^ ---------------------------------------------------------------------------------------------------------------------------------------------------------------- -------------------------------------------------- -------- ------ --------- ---------- Negative non‐pain topic (NT) analysis for subjective emotional responses and pain bothersomeness, *F*(6, 52) = 5.67[\*\*](#bjhp12362-note-0009){ref-type="fn"} Step 1 Baseline pain bothersomeness 1.17[\*\*](#bjhp12362-note-0009){ref-type="fn"} 0.43 .35 .22 Baseline negative affect −0.50 0.84 −.08 Baseline positive affect −1.78[\*\*](#bjhp12362-note-0009){ref-type="fn"} 0.57 −.38 Step 2 Baseline pain bothersomeness 0.17 0.56 .05 .33 .11\* Baseline negative affect −0.92 0.85 −.15 Baseline positive affect −2.01[\*\*](#bjhp12362-note-0009){ref-type="fn"} 0.58 −.43 NT pain bothersomeness 26.73[\*\*](#bjhp12362-note-0009){ref-type="fn"} 9.04 .46 NT negative affect 12.64[\#](#bjhp12362-note-0009){ref-type="fn"} 7.04 .21 NT positive affect 1.74 7.19 .03 NT analysis for facial behaviour, *F*(5, 53) = 5.62[\*\*](#bjhp12362-note-0009){ref-type="fn"} Step 1 Baseline pain bothersomeness 1.14[\*\*](#bjhp12362-note-0009){ref-type="fn"} 0.43 .34 .22 Baseline negative affect −0.52 0.83 −.08 Baseline positive affect −1.76[\*\*](#bjhp12362-note-0009){ref-type="fn"} 0.57 −.38 Step 2 Baseline pain bothersomeness 1.26[\*\*](#bjhp12362-note-0009){ref-type="fn"} 0.42 .38 .29 .7\* Baseline negative affect −1.05 0.82 −.17 Baseline positive affect −2.16[\*\*](#bjhp12362-note-0009){ref-type="fn"} 0.56 −.46 NT negative facial behaviour 17.67[\*\*](#bjhp12362-note-0009){ref-type="fn"} 6.77 .30 NT positive facial behaviour 6.41 6.74 .11 Dependent variable is Örebro Musculoskeletal Pain Screening Questionnaire. ^\#^ *p* \< .10; \*\**p* \< .01. John Wiley & Sons, Ltd Finally, Table [6](#bjhp12362-tbl-0006){ref-type="table"} shows the predictive value of emotional responding (observed facial expressions and self‐reported pain and affect) in explaining variance in pain‐related problems during the positive topic interview, while controlling for baseline pain bothersomeness, positive affect, and negative affect. As can be seen, high levels of negative affective responding and higher experience of pain bothersomeness were related to higher levels of pain‐related problems. No association was found with facial expressions. ###### Prediction of pain‐related problems based on emotional responding and pain bothersomeness during the positive topic interview Variable *B* *SE B* β *R* ^2^ Δ*R* ^2^ -------------------------------------------------------------------------------------------------------------------------------- -------------------------------------------------- -------- ------ --------- ---------------------------------------------- Positive topic (PoT) analysis for subjective emotional responses, *F*(6, 48) = 6.11[\*\*](#bjhp12362-note-0011){ref-type="fn"} Step 1 Baseline pain bothersomeness 1.18[\*\*](#bjhp12362-note-0011){ref-type="fn"} 0.43 .35 .26 Baseline negative affect −0.60 0.87 −.09 Baseline positive affect −1.99[\*\*](#bjhp12362-note-0011){ref-type="fn"} 0.59 −.42 Step 2 Baseline pain bothersomeness 0.51 0.49 .15 .36 .10[\*](#bjhp12362-note-0011){ref-type="fn"} Baseline negative affect −1.31 0.90 −.20 Baseline positive affect −2.51[\*\*](#bjhp12362-note-0011){ref-type="fn"} 0.63 −.53 PoT pain bothersomeness 17.15[\*](#bjhp12362-note-0011){ref-type="fn"} 8.22 .29 PoT negative affect 21.23[\*](#bjhp12362-note-0011){ref-type="fn"} 9.48 .27 PoT positive affect 14.13\# 7.69 .24 PoT analysis for facial behaviour, *F*(5, 53) = 4.31[\*\*](#bjhp12362-note-0011){ref-type="fn"} Step 1 Baseline pain bothersomeness 1.16[\*\*](#bjhp12362-note-0011){ref-type="fn"} 0.43 .34 .22 Baseline negative affect −0.54 0.86 −.08 Baseline positive affect −1.78[\*\*](#bjhp12362-note-0011){ref-type="fn"} 0.58 −.38 Step 2 Baseline pain bothersomeness 1.25[\*\*](#bjhp12362-note-0011){ref-type="fn"} 0.43 .37 .22 Baseline negative affect −0.51 0.87 −.08 Baseline positive affect −1.91[\*\*](#bjhp12362-note-0011){ref-type="fn"} 0.58 −.41 PoT negative facial behaviour 5.46 7.09 .09 PoT positive facial behaviour 8.87 7.06 .15 Dependent variable is Örebro Musculoskeletal Pain Screening Questionnaire. \**p* \< .05; \*\**p* \< .01; ^\#^ *p* \>.10. John Wiley & Sons, Ltd To clearly picture the association between self‐reported emotional responding and pain‐related problems, it is also graphically depicted in Figure [2](#bjhp12362-fig-0002){ref-type="fig"}. As can be seen, more negative emotional reactivity and pain bothersomeness in social encounters where it was *not* prompted were clearly related to pain problem level signalling risk for chronicity (ÖMPSQ \> 105). ![Levels of pain coping problems for participants with context‐sensitive (CS) and context‐insensitive (IS) emotional responses (baseline levels controlled for). *Note*. The numbers on the *y*‐axis refer to scores on the Örebro Musculoskeletal Pain Screening Questionnaire (ÖMPSQ; range 3--210), as a proxy for pain‐related problems. Total score 90--105 = moderate risk; \>105 = high risk.](BJHP-24-443-g002){#bjhp12362-fig-0002} This indicates that a larger tendency for context‐insensitive responding was related to high levels of pain‐related problems. As a summary, all significant associations between context sensitivity versus insensitivity and pain‐related problems are highlighted in Table [7](#bjhp12362-tbl-0007){ref-type="table"} (typed in bold). ###### A summary of the identified associations between emotional responding/pain bothersomeness and pain‐related problems in each of the three contexts ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pain topic Positive non‐pain topic Negative non‐pain topic ----------------------------- --------------------- ------------------------- ---------------------------- ---------------------------- -------------------------------- ---------------------------- Observed facial expression Positive facial expression Negative facial expression **Negative facial expression** Positive facial expression Subjective rated experience Pain bothersomeness Positive affect Positive affect Negative affect\ Negative affect Positive affect\ **Pain bothersomeness** **Pain bothersomeness** ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- All significant associations are typed in bold. In addition to the associations highlighted in this table, self‐rated negative affect during the pain topic was also significantly related to outcome. John Wiley & Sons, Ltd Discussion {#bjhp12362-sec-0023} ========== This is the first study demonstrating a link between emotional responding in a social context and the degree of a pain problem in people suffering from subacute and chronic pain, using an experimental paradigm from the psychopathology literature. Taken as a whole, our findings indicate that context‐insensitive responding to social cues was related to higher levels of pain‐related problems, at least when dealing with negative affect. Context‐insensitive pain bothersomeness was related to more problems in both the positive and the negative non‐pain interviews. As all participants were selected on the basis of pain, and not on basis of emotional problems, it seems logical that specifically the context‐insensitive pain bothersomeness was important. This corresponds with the extensive literature highlighting the interruptive function of pain and the importance of being able to disengage from pain to cope with it (Eccleston & Crombez, [1999](#bjhp12362-bib-0008){ref-type="ref"}). It has been suggested that catastrophizing may hamper disengagement from pain (Van Damme, Crombez, & Eccleston, [2004](#bjhp12362-bib-0022){ref-type="ref"}). When considering catastrophizing as a feature of inflexibility (Flink, Boersma, & Linton, [2013](#bjhp12362-bib-0009){ref-type="ref"}), it is reasonable that individuals who catastrophize are also context insensitive. However, the link between catastrophizing and context insensitivity needs to be explored empirically to unravel the relationship between these constructs. When talking about a positive topic, context‐insensitive negative affect was related to more pain‐related problems. This means that individuals with high levels of pain‐related problems were not able to detach from negative feelings when asked to focus on a positive subject. It should be noted that baseline levels of pain and negative affect were controlled for, which strengthens the conclusion that context insensitivity in and of itself was linked to more problems. These results are in line with findings from research on psychopathology, where context‐insensitive expressions of current issues have been related to more psychological problems (Coifman & Bonanno, [2010](#bjhp12362-bib-0006){ref-type="ref"}; Harvey *et al*., [2016](#bjhp12362-bib-0010){ref-type="ref"}; Southward & Cheavens, [2017](#bjhp12362-bib-0021){ref-type="ref"}), and encourage further research on the importance of context sensitivity in a pain setting. Context sensitivity is closely related to the theory around *discriminative facility*, stemming from the field of personality research. Discriminative facility refers to an individuals' appraisal of situational demands and their ability to adjust behavioural responses depending on present cues (Cheng, Chiu, Hong, & Cheung, [2001](#bjhp12362-bib-0004){ref-type="ref"}; Chiu, Hong, Mischel, & Shoda, [1995](#bjhp12362-bib-0005){ref-type="ref"}). Observations of the value of including situations in the assessment of personality go back to the work of Mischel ([1969](#bjhp12362-bib-0018){ref-type="ref"}). Today, this aspect is integrated in the contextualized personality psychology (Mischel, [2004](#bjhp12362-bib-0019){ref-type="ref"}). Discriminative facility is a prerequisite for *coping flexibility,* conceptualized as a good fit between applied coping strategies and the nature of stressful events (Aldwin, [1994](#bjhp12362-bib-3001){ref-type="ref"}). The importance of behavioural flexibility has been further developed in the theoretical underpinnings of *Acceptance and Commitment Therapy (ACT),* summarized in the model of *psychological flexibility,* which has been put forward as central for adaptive coping with pain (McCracken & Morley, [2014](#bjhp12362-bib-0017){ref-type="ref"}). Taken together, context sensitivity clearly overlaps with concepts from personality psychology as well as contemporary learning theories, and more research is required to explore the intricate relation and the unique contribution of these constructs. Our findings add to the existing literature indicating that particular regulatory strategies are not consistently beneficial or maladaptive; the key is rather to have a flexible use of strategies that respond to the ever changing environment. *The regulatory flexibility model* (Bonanno & Burton, [2013](#bjhp12362-bib-0003){ref-type="ref"}) identifies three central components of flexibility: sensitivity in reading and evaluating the context, availability of a diverse repertoire of regulatory strategies, and responsiveness to feedback. In our study, we did not isolate the specific components in this model; this may be a mission for future research. Although the literature may suggest that context sensitivity is linked to a better prognosis and less pain‐related problems (Linton *et al*., [2016](#bjhp12362-bib-0015){ref-type="ref"}), our findings provide important nuances. Indeed, our findings indicate that individuals with higher levels of pain‐related problems specifically more easily access negative emotional responses, irrespective of social cues. One possibility is that these individuals have a general tendency to easily access negative affect and difficulties in down‐regulating it. This goes in line with the *dynamic model of affect,* which states that individuals experiencing worsening pain adopt simpler representations of their affective experiences, resulting in easier access to negative experiences as negative affects tend to outcompete positive ones (Zautra, Smith, Affleck, & Tennen, [2001](#bjhp12362-bib-0025){ref-type="ref"}). In other words, pain‐related problems might be linked to emotion regulation difficulties. However, if emotion regulation difficulties explain the identified links, it is not the negative affect *per se* which is undesirable, but rather that the individuals need to be able to down‐regulate it when it is cued. It is important to note that there was no link whatsoever between context‐insensitive positive affect and pain‐related problems. This corresponds with the findings from Coifman and Bonanno ([2010](#bjhp12362-bib-0006){ref-type="ref"}), who found that positive emotions were beneficial regardless of context. One drawback in the current study is the lack of longitudinal outcome data. Because the study is cross‐sectional in nature, we cannot draw conclusions about causality or the direction of identified links. Another shortcoming is that data on negative facial behaviour in the pain context are missing. Although we based the procedure on an earlier used paradigm (Coifman & Bonanno, [2010](#bjhp12362-bib-0006){ref-type="ref"}), it might have been too difficult for students to code the participants' facial behaviour resulting in a fairly modest inter‐rater reliability. The difficulties in coding facial behaviour may also explain the evident lack of correspondence between facial behaviour and subjective ratings. Coding verbal content would have been an alternative strategy for exploring context sensitivity and insensitivity. However, as the participants were extremely compliant in following our instructions, detecting differences in verbal content would have required more sophisticated measures and analytical approaches than this study allowed. An additional limitation is the lack of a neutral topic which could have been used as a comparison condition and a more reliable baseline. Future studies would preferably include that. The data in this study were analysed within each context separately. A shortcoming of this analytical approach is that it precludes conclusions on patterns of responding within individuals. As it is likely that more generalized forms of context insensitivity (e.g., subgroup of persons responding insensitive across several contexts) are more highly related to negative outcome, future, more well‐powered studies, could make use of person‐oriented analytical approaches such as latent profiling or cluster analyses to discern within person patterns of responding. Despite these shortcomings, this study contributes to unique knowledge, emphasizing the link between pain‐related problems and context‐insensitive responding to social cues. Although the results are quite complex, the overall picture indicates that individuals with higher levels of pain‐related problems more easily respond with negative emotionality and pain bothersomeness, irrespective of social cues. A further step is to explore the clinical implications and possibly develop methods for context‐insensitive patients with pain, to facilitate adaption to pain within an interpersonal context. Taken together, these findings indicate that context sensitivity *does* matter, at least when dealing with negative affect. Although the longitudinal links need to be explored, this adds to the existing literature, pointing towards context sensitivity as a central feature of adaptation to pain. Future research should explore how context sensitivity is related to development of pain over time, to reveal differences between acute and chronic problems, and delve into the relation between context sensitivity and other well‐known risk factors such as catastrophizing and psychological flexibility. Conflict of interest {#bjhp12362-sec-0024} ==================== All authors declare no conflict of interest. Funding {#bjhp12362-sec-0025} ======= This research was supported by a grant from The Swedish Foundation for Humanities and Social Sciences, grant number P14‐0799:1.
#! /bin/sh # #/******************************************************************************* #* Script Name: pscollect #* Date Created: 2009.01.27 #* Author: Calpont Corp. #* Purpose: capture system activity every x seconds #* #******************************************************************************/ # cd /var/log/prat/ps if [ ! -f /var/log/prat/ps/pslog ] then touch pslog echo Start `date +%R` >> pslog /bin/ps -leaf >> pslog echo End `date +%R` >> pslog else echo Start `date +%R` >> pslog /bin/ps -leaf >> pslog echo End `date +%R` >> pslog fi # End of script
[Curative laparoscopic surgery for early gastric cancer: eight years experience]. We have applied two different laparoscopic surgical techniques for early gastric cancer and have successfully treated 111 patients since March 1992. The indications are: 1) preoperative diagnosis of mucosal cancer; 2) lesion size of < 25 mm if the protruding type; and 3) lesion size < 15 mm and UI (-) if the depressed type. The first technique is laparoscopic wedge resection of the stomach using a lesion-lifting method (n = 93). The gastric wall around the cancerous lesion is exposed laparoscopically. The abdominal wall and gastric wall in the vicinity of the lesion are pierced using a 12-G sheathed needle. A small metal rod with a fine wire is introduced into the stomach through the outer sheath. By retracting the metal rod, the lesion can be lifted precisely (i.e., lesion-lifting method). Wedge resection at a sufficient distance from the metal rod is carried out using an endoscopic stapler. The second technique is referred to as laparoscopic intragastric mucosal resection (n = 18). Three balloon trocars are placed in the stomach laparoscopically. The stomach is then insufflated with CO2, and surgical instruments are introduced. The mucosal and submucosal layers around the lesion are resected with sufficient surgical margins. The selection of the laparoscopic technique depends on the site of the cancerous lesion. In our series of 111 patients, sufficient horizontal (mean 15 +/- 5 mm and 8 +/- 4 mm, respectively, using the first and second technique) and vertical surgical margins were achieved. There was no mortality and no major complications in patients undergoing either surgical technique. There have been two recurrences, both mucosal lesions found 2 years after the initial surgery, which were successfully treated with gastrectomy and laser irradiation. All patients have survived for 3 to 96 months, and there has been no trocar site recurrence. In conclusion, these laparoscopic procedures are curative and minimally invasive treatments for early gastric cancer.
package cn.netdiscovery.example.jd; import cn.netdiscovery.downloader.selenium.utils.SeleniumUtils; import cn.netdiscovery.downloader.selenium.action.SeleniumAction; import org.openqa.selenium.By; import org.openqa.selenium.WebDriver; /** * Created by tony on 2018/6/12. */ public class SearchAction extends SeleniumAction { @Override public SeleniumAction perform(WebDriver driver) { try { String searchBtn = "/html/body/div[2]/form/input[4]"; SeleniumUtils.clickElement(driver, By.xpath(searchBtn)); Thread.sleep(3000); } catch (InterruptedException e) { e.printStackTrace(); } return null; } }
Rogalands Arbeiderblad Rogalands Arbeiderblad was a Norwegian newspaper published in Stavanger in Rogaland county. History and profile Rogalands Arbeiderblad was started on 20 November 1926 as the Communist Party organ in the county. It was published weekly. However, the party struggled economically and the newspaper went defunct after its last issue on 3 October 1927. Editor-in-chief was Elias Gabrielsen. References Category:1926 establishments in Norway Category:1927 disestablishments in Norway Category:Communist Party of Norway newspapers Category:Defunct newspapers of Norway Category:Media in Stavanger Category:Norwegian-language newspapers Category:Publications established in 1926 Category:Publications disestablished in 1927
In the first example ਮਰਦੇ is used as a verb of the subject ਸਿਪਾਹੀ. Now contrast it with the second example where ਮਰਦੇ is used as a noun rather than a verb. In the third example the same word ਮਰਦੇ is used as an adjective of the noun ਸਿਪਾਹੀ. Finally ਮਰਦਿਆਂ, a derivative of the same root verb ਮਰ is used as an adverb. Thus a derivative from a verb may be used as a noun, an adjective or an adverb besides a verb. Rule 1. ਭਾਵਾਰਥ ਕਿਰਦੰਤ or infinitive participle is obtained from the root verb by adding ਨਾ or ਣਾ and though it coverys an action like a verb it has no tense i.e. it does not tell us the time of the action. See for example Here ਪੜਦੇ in ਪੜ੍ਹਦੇ ਬੱਚੇ is an adjective and therefore present participle. Rule 3. An important exception to the above rule is when the root verb ends in a vowel or a vowel followed by ਹ. In such cases the vowel gets nasalized to as in ਰੋਂਦਾ from ਰੋ, ਪੀਂਦਾ from ਪੀ, ਖਾਂਦਾ from ਖਾ, ਖੋਂਹਦਾ from ਖੋਹ, ਪੀਂਦਾ from ਪੀ etc. Rule 4. The present participle of some verbs ending in ਆ is formed by adding ਉ to the root verb, nasalizing it and then adding ਦਾ or its variants as in ਆਉਂਦਾ from ਆ, ਗਾਉਂਦਾ from ਗਾ, ਨ੍ਹਾਉਂਦਾ From ਨ੍ਹਾ, ਪਾਉਂਦਾ from ਪਾ etc. The present participle changes according to number/gender. Rule 5. When the root verb ends in ਆ past participle is formed by adding ਇਆ to the root verb as in ਗਾਇਆ from ਗਾ, ਪਾਇਆ from ਪਾ. Rule 6. If the root verb ends with a consonant the past participle is formed by adding sihari to the end consonant followed by ਆ as in ਸੁਣਿਆ from ਸੁਣ, ਲਿਖਿਆ from ਲਿਖ, ਤੁਰਿਆ from ਤੁਰ etc. Rule 7. Like present participle the past participle also changes by number/gender. A distinguishing feature however is that the past participle changes according to the number/gender of the subject if the verb is is intransitive or the object if it is transitive. See this example: ਵਿਦਿਆਰਥੀ ਨੇ ਪੜ੍ਹ ਕੇ ਸੁਣਾਇਆ - student narated by reading. Here ਪੜ੍ਹ ਕੇ indicates an action which is completed. It modifies the verb ਸੁਣਾਇਆ and therefore is participle. The participle which indicates a completed action is called perfect participle Rule 8. Perfect participle is formed by the adding ਕੇ to the root verb. Rule 9. Unlike the present and past participles perfect participle does not have number/gender variations. We have dealt with participles at some length. The reason is that besides the above uses of the participles, the same participle forms are used in verbs which we shall examine in tenses. We now give below some more examples.
A 2003 press release shows that a woman named "Deborah Ramirez" is listed as a "Soros Justice Senior Fellow." Christine Ford appears to have lied under oath about polygraph allegations against Kavanaugh. SIGN up for conservative daily post news alerts A new report presents credible evidence that one of the women who accused Supreme Court nominee Judge Brett Kavanaugh of inappropriate behavior at an alleged party in 1983 has a chilling connection to liberal billionaire George Soros. On the website archive, a press release shows that a woman named “Deborah Ramirez” is listed as a “Soros Justice Senior Fellow.” Here’s a screenshot of the press release from the website archive, which shows Ramirez’s name listed on the Open Society Initiative website: Reports that Ramirez appears to have been a senior fellow in a Soros-controlled initiative — which would signal that she’s a liberal who likely is against President Donald Trump, who nominated Kavanaugh — comes within days of her divulging to a liberal outlet that she all-of-a-sudden remembers a party she attended over 35 years ago. Especially given that Soros paid protesters were caught protesting Kavanaugh. On Sunday, the New Yorker published an exclusive piece covering an interview with Ramirez, who claims Kavanaugh exposed himself to her in 1983 during a party while they attended Yale University. In the piece, whichis already falling apart, the outlet notes that Ramirez admits having “significant gaps in her memories” regarding the alleged college party and that she could not remember specific information or the alleged person. However, after six days of consulting with a Democratic lawyer, Ramirez now believes Kavanaugh was the supposed man who exposed himself to her at the party. The New Yorker also reports that Ramirez’s best friend said she has “never heard of” the allegations against Kavanaugh. Ramirez claimed that she “became inebriated” and “was on the floor, foggy and slurring her words” during the party in question. “Ramirez acknowledged that there are significant gaps in her memories of the evening. Her memories contained gaps because she had been drinking at the time of the alleged incident.” All of the witnesses Ramirez said were present have denied seeing or being aware of what she alleges Kavanaugh did at the party. Buried deep in the article, the New Yorker admits that it “has not confirmed with other eyewitnesses that Kavanaugh was present at the party.” So, Ramirez hadn’t told anyone — including her best friend, who was at her wedding, along with an invited Kavanaugh — about the allegations from 1983, but happened to remember exactly what happened after meeting with a Democratic lawyer for nearly a week. With all of this considered, it’s also highly suspicious to many people that Ramirez was apparently a “Senior Fellow” in Soros’ OSI. This is a sign to many that Ramirez is a liberal being fueled by her own political ideology to try to take down Kavanaugh.
Remote monitoring of patients with implantable cardioverter-defibrillators: can results from large clinical trials be transposed to clinical practice? Remote monitoring (RM) is increasingly used to follow up patients with implantable cardioverter-defibrillators (ICDs). Randomized control trials provide evidence for the benefit of this intervention, but data for RM in daily clinical practice with multiple-brands and unselected patients is lacking. To assess the effect of RM on patient management and clinical outcome for recipients of ICDs in daily practice. We reviewed ICD recipients followed up at our institution in 2009 with RM or with traditional hospital only (HO) follow-up. We looked at the effect of RM on the number of scheduled ambulatory follow-ups and urgent unscheduled consultations, the time between onset of asymptomatic events to clinical intervention and the clinical effectiveness of all consultations. We also evaluated the proportion of RM notifications representing clinically relevant situations. We included 355 patients retrospectively (RM: n=144, HO: n=211, 76.9% male, 60.3±15.2 years old, 50.1% with ICDs for primary prevention and mean left ventricular ejection fraction 35.5±14.5%). Average follow-up was 13.5 months. The RM group required less scheduled ambulatory follow-up consultations (1.8 vs. 2.1/patient/year; P<0.0001) and a far lower median time between the onset of asymptomatic events and clinical intervention (7 vs. 76 days; P=0.016). Of the 784 scheduled ambulatory follow-up consultations carried out, only 152 (19.4%) resulted in therapeutic intervention or ICD reprogramming. We also found that the vast majority of RM notifications (61.9%) were of no clinical relevance. RM allows early management of asymptomatic events and a reduction in scheduled ambulatory follow-up consultations in daily clinical practice, without compromising safety, endorsing RM as the new standard of care for ICD recipients.
Q: OR condition using jQuery I am using the jquery function and it is not checking two conditions at once. I want to check for or condition.When I give only one condition in if statement it is working but after giving or it is not working. here is my code if($("input[title='Nature of the work']").val() != "Execute Business processes" || $("input[title='Nature of the work']").val() != "Deliver periodic reports") { $('nobr:contains("Is the work being currently done")').closest('tr').hide(); $('nobr:contains("Frequency of the Deliverables")').closest('tr').hide(); } else { $('nobr:contains("Is the work being currently done")').closest('tr').show(); $('nobr:contains("Frequency of the Deliverables")').closest('tr').show(); } A: please try the below code , i added the full script , try and let me know <script src="http://code.jquery.com/jquery-1.7.2.min.js" type="text/javascript&quot;"></script> <script type="text/javascript"> $(document).ready(function () { hideShow(); $("input[title='Nature of the work']").change(function () { hideShow(); }); }); function hideShow() { var txt = $("input[title='Nature of the work']").val(); if ((txt != "Execute Business processes") && (txt != "Deliver periodic reports")) { $('nobr:contains("IIs the work being currently done")').closest('tr').hide(); $('nobr:contains("Frequency of the Deliverables")').closest('tr').hide(); } else { $('nobr:contains("Is the work being currently done")').closest('tr').show(); $('nobr:contains("Frequency of the Deliverables")').closest('tr').show(); } } </script>
Jimmy Fallon butchers Killzone: Shadow Fall live on US television Guerrilla Games managing director Herman Hulst made an appearance on Late Night with Jimmy Fallon to demo Killzone: Shadow Fall. During his appearance, Hulst discussed the new DualShock 4 controller, stating that radio messages being broadcast in the game will come through the controller’s speaker. A bit of an interesting note, there. While the footage is from the same section as Wednesday night’s reveal, Fallon’s desire to try the game confirmed it is in a completely playable state. He is given the controller towards the end of the video and does an excellent job of butchering the ISA’s quest to eliminate the Helghast threat.
Monitoring Antigen Processing for MHC Presentation via Macroautophagy. Macroautophagy has recently emerged as an important catabolic process involved not only in innate immunity but also in adaptive immunity. Initially described to deliver intracellular antigens to MHC class II loading compartments, its molecular machinery has now also been described to impact the delivery of extracellular antigens to MHC class II loading compartments through the noncanonical use of the macroautophagy machinery during LC3-associated phagocytosis (LAP). Therefore, in pathological situations (viral or bacterial infections, tumorigenesis) the pathway might be involved in shaping CD4+ T cell responses.In this chapter we describe three basic experiments for the monitoring and manipulation of macroautophagic antigen processing toward MHC class II presentation through the canonical pathway. Firstly, we will discuss how to monitor autophagic flux and autophagosome fusion with MHC class II loading compartments. Secondly, we will show how to target proteins to autophagosomes in order to monitor macroautophagy dependent antigen processing via their enhanced presentation on MHC class II molecules to CD4+ T cells. And finally, we will describe how macroautophagy can be silenced in antigen presenting cells, like human monocyte-derived dendritic cells (DCs).
Q: Task environment is not working I am using a task environment but it is not working. My sample code is \begin{tasks}[label=(\arabic*)] \task 1 \task 2 \task 1 \task 3 \task 4 \end{tasks} But if I use the same code without [label=(\arabic*)] then it is working. Please do help. A: As Bernard said in his comment, the syntax for labels has changed since version 1.0 of package tasks. If you have a version older than 1.0 but at least 0.9 or newer, for example, if you're using Overleaf, which has tasks.sty 2016/08/13 v0.12 Horizontalcolumnedlists (CN), you should use counter-format={<counter specs>}. This option is now deprecated, it set a custom label in a peculiar way. The letters tsk are replaced with the task-counter. An optional argument directly following these letters specifies the counter format: 1: \arabic, a: \alph, A: \Alph, r: \roman and R: \Roman. You can find the old documentation of the package in its repository on GitHub. This works on Overleaf, I hope it works also for you: \documentclass{article} \usepackage{tasks} \begin{document} \begin{tasks}[counter-format=(tsk[1]), label-width=4em] \task 1 \task 2 \task 1 \task 3 \task 4 \end{tasks} \end{document}
Food Losing Weight Plan But people are really good at eating more food than they need, so the excess gets stored as fat. It doesnt really matter whether those extra calories come from cake, protein shakes, or spaghetti if you eat more than what your body can use, it gets stored. Dieting is the most difficult part of the fat-loss process for most people.As always, consult a healthcare professional before starting any weight loss program. ityou eat more. Research says to avoid plates that match the food served on them (think a deep red plate with a greasy slice of pizza), because there is less of a contrast, which prompt us to eat more.Diets that involve removing or severely limiting specific foods or food groups that are nutritionally important are not going to be a long-term solution. We bring out a brand-new Healthy Diet Plan twice a year, plus plenty of extra recipes, fitness tips and healthy eating inspiration and if you sign up, youll get this all sent. Food & Recipes And if youre trying not to fall off the bandwagon, heed to the meal plan to stave off unwanted weight. this 4-week plan will help you lose fat, boost your metabolism, and set you up to build musclewithout all the annoying hunger and cravings that tend to accompany a. 6 foods that could give you acne. Find what your weight loss eating plan can be, rapid and low in carbs and fat this is to ensure that most of the weight comes from fat. Here is a sample weight loss food table using 1200-1500 calories per day. For weight-loss plan customized to your specific needs, check out our custom meal. When I married I weighed 135 lbs. Ultra-Shake originally partenered with BadAss Vegan does lifting weights help lose body fat make a VeganLife Shake and they also have paleo varieties that appear to be dairy-free and hemp protein dense. This herb promotes histamine release, muscle relaxation, and stimulates thyroid functionality. I really hate to see the diet as a whole poo-pooed on, because it does work. 70 Pound Weight Loss Through Eating Real Food on 100 Days of Real Food. I had tried to lose weight several times throughout the years, trying every different diet plan out there. The problem was that nothing ever stuck. For some reason, this day in the mirror was different, and it changed everything. In the new Readers Digest book, The 2-Day Diabetes Diet, dieting just two days a week blasts fat and balances blood sugar. of us inherited various thrifty genes that cause us to conserve energy (hoard fat stores) when calories are scarce and swiftly store energy (plump up fat cells even more) when food is plentiful. Snacks Wholemeal Toast, Vegetable Soup. x 400g vegetable soup with 1 slice wholemeal toast (You can have the snacks at any time of day). You can swap things in the diet plan around, or choose new items in the wlr food diary. Take a free trial to try it out. Dieting is the most difficult part of the fat-loss process for most people. Instead, think of the food you put into your body as your nutrition, which is an essential. Food & Recipes Food & Recipes Food & Recipes how to lose weight with polycystic ovarian disease The very first tip you should implement to help you lose weight in a week is to start consuming plenty of water. Weight lose food plan make sure you start food lose plan weight drinking water for its plan food weight lose thermogenic effects on rapid fat loss. By taking food plan weight lose advantage of drinking plenty of cold. Wondering how to use the gluten-free diet to lose weight?. Theres a debate about whether ditching wheat and gluten actually does help you lose weight more easily than simply dieting. Take it from me Eating more calories just because theyre found in gluten-free foods wont help you lose weight. quite the opposite. Dowsing method is also used to perform specific analysis. I was addictedto laxatives within weeks. ]You will figure out what works for you food losing weight plan for anyone who is truly on a budget or who is truly in a constraint of resources, this should be manageable. For instance, when researchers from Harvard Medical School re-analysed eight major studies in 2007, they concluded there was no evidence statins worked as diet plan for weight loss in 7 days dailymotion prevention for women. Fat Blockers are manufactured in an environmentally friendly facility here in the United Kingdom.] I love the freedom and variety in recipes mental clarity and well-being, treat and cure these conditions is fully justified. Best diet pill for women Dendrobium Nobile Extract. Medication Effects Diets to treat swallowing disorders may be undesirable and over time cause weight loss. They were very responsive and warm-hearted. Adding resistance training to your exercise routine will help to increase does lifting weights help lose body fat loss long after your workout has finished. In times ofhowever my food losing weight plan disorder behavior did not start untilmy Sophomore year of college. Usually the result is visible after 1-2 days. It is in this context -- human bodies getting heavy not from behaving "badly" but from behaving as they always have, a bean.
Independent MP Sana Hassainia from Montreal is under fire for her work ethic, earning the worst vote attendance record in the House of Commons last year. Hassainia ran as a member of Parliament with the NDP in the Verchères riding. However, last August, she left the party over what she said was a disagreement on policy relating to Israel. But the NDP's press secretary said the falling out was due to Hassainia's attendance record. In 2014, she was present for just 16 of 269 votes in the House of Commons. Hassainia has two children and has said she has made a choice to be there for her family. I allowed myself to do this because it's not my little voice that makes a difference. - MP Sana Hassainia on being present for 16 of 269 votes "It's very, very rare that a vote passes with a majority government, so I allowed myself to do this because it's not my little voice that makes a difference," she told CBC News in French. Hassainia also said she didn't think her vote mattered as an Independent MP against the government. The annual base salary for an MP is $163,700. Hassainia was present in the House of Commons Tuesday. She rose during question period to ask the government what it was doing to reunite blogger Raif Badawi, who is jailed in Saudi Arabia, with his family in Canada. Absent in riding A former employee who worked at Hassainia's constituency office said the MP hasn't been visible in the riding either. Jonathan Pare said he would often meet with constituents in Hassainia's place. "The people tell us, 'It's you who is here, not her. How can that be?' She must be there," he said. Pare said he quit after he realized how uninvolved Hassainia was in her duties as an MP.
Q: Using View to Update Values of Original Table The title pretty much says it all. I have a view vPersonalInfo that is connected to table Customers, which queries a specific part of the original table. I want to be able to alter the view and get results in the Customers table. Is this possible? If not, are there alternatives? Thanks in advance. Note: I'm using Access to display the info from the vPersonalInfo view on a form. For example, I have this original table called Customers: +----+------+----------+ | id | name | isActive | +----+------+----------+ | 1 | Joe | 0 | | 2 | Mike | 1 | | 3 | Will | 1 | +----+------+----------+ I created a view called vPersonalInfo specifically located in Will's database: +----+--------+-----------+ | id | name | isActive | +----+--------+-----------+ | 3 | Will | 1 | +----+--------+-----------+ The form in Access is querying vPersonalInfo, and I want to alter the value of isActive to 0 through the form in Access, so that it will alter the original table's value. A: You can use a left join: select c.id, c.name, nz(pi.isActive, c.isActive) as isActive from customers as c left join vPersonalInfo as pi on c.id = pi.id;
# Spawning Game Objects In Unity, you usually “spawn” (that is, create) new game objects with `Instantiate`. However, in Mirror, the word “spawn” means something more specific. In the server-authoritative model of the Mirror, to “spawn” a game object on the server means that the game object is created on clients connected to the server, and is managed by the spawning system. Once the game object is spawned using this system, state updates are sent to clients whenever the game object changes on the server. When Mirror destroys the game object on the server, it also destroys it on the clients. The server manages spawned game objects alongside all other networked game objects, so that if another client joins the game later, the server can spawn the game objects on that client. These spawned game objects have a unique network instance ID called “netId” that is the same on the server and clients for each game object. The unique network instance ID is used to route messages set across the network to game objects, and to identify game objects. When the server spawns a game object with a Network Identity component, the game object spawned on the client has the same “state”. This means it is identical to the game object on the server; it has the same Transform, movement state, and (if Network Transform and SyncVars are used) synchronized variables. Therefore, client game objects are always up-to-date when Mirror creates them. This avoids issues such as game objects spawning at the wrong initial location, then reappearing at their correct position when a state update arrives. A game object Prefab must have a Network Identity component before trying to register it with the Network Manager. To register a Prefab with the Network Manager in the Editor, select the Network Manager game object, and in the Inspector, navigate to the Network Manager component. Click the triangle next to Spawn Info to open the settings, then under Registered Spawnable Prefabs, click the plus (+) button. Drag and drop Prefabs into the empty field to assign them to the list. ![Registered Spawnable Prefabs](SpawnObjects.PNG) ## Spawning Without Network Manager For more advanced users, you may find that you want to register Prefabs and spawn game objects without using the Network Manager component. To spawn game objects without using the Network Manager, you can handle the Prefab registration yourself via script. Use the `ClientScene.RegisterPrefab` method to register Prefabs to the Network Manager. ``` cs using UnityEngine; using Mirror; public class MyNetworkManager : MonoBehaviour { public GameObject treePrefab; // Register prefab and connect to the server public void ClientConnect() { ClientScene.RegisterPrefab(treePrefab); NetworkClient.RegisterHandler<ConnectMessage>(OnClientConnect); NetworkClient.Connect("localhost"); } void OnClientConnect(NetworkConnection conn, ConnectMessage msg) { Debug.Log("Connected to server: " + conn); } } ``` In this example, you create an empty game object to act as the Network Manager, then create and attach the `MyNetworkManager` script (above) to that game object. Create a prefab that has a Network Identity component attached to it, and drag that onto the `treePrefab` slot on the `MyNetworkManager` component in the Inspector. This ensures that when the server spawns the tree game object, it also creates the same kind of game object on the clients. Registering prefabs ensures that there is no stalling or loading time for creating the Asset. For the script to work, you also need to add code for the server. Add this to the `MyNetworkManager` script: ``` cs public void ServerListen() { NetworkServer.RegisterHandler<ConnectMessage>(OnServerConnect); NetworkServer.RegisterHandler<ReadyMessage>(OnClientReady); // start listening, and allow up to 4 connections NetworkServer.Listen(4); } // When client is ready spawn a few trees void OnClientReady(NetworkConnection conn, ReadyMessage msg) { Debug.Log("Client is ready to start: " + conn); NetworkServer.SetClientReady(conn); SpawnTrees(); } void SpawnTrees() { int x = 0; for (int i = 0; i < 5; ++i) { GameObject treeGo = Instantiate(treePrefab, new Vector3(x++, 0, 0), Quaternion.identity); NetworkServer.Spawn(treeGo); } } void OnServerConnect(NetworkConnection conn, ConnectMessage msg) { Debug.Log("New client connected: " + conn); } ``` The server does not need to register anything, as it knows what game object is being spawned (and the asset ID is sent in the spawn message). The client needs to be able to look up the game object, so it must be registered on the client. When writing your own network manager, it’s important to make the client ready to receive state updates before calling the spawn command on the server, otherwise they won’t be sent. If you’re using Mirror’s built-in Network Manager component, this happens automatically. For more advanced uses, such as object pools or dynamically created Assets, you can use the `ClientScene.RegisterSpawnHandler` method, which allows callback functions to be registered for client-side spawning. See documentation on Custom Spawn Functions for an example of this. If the game object has a network state like synchronized variables, then that state is synchronized with the spawn message. In the following example, this script is attached to the tree Prefab: ``` cs using UnityEngine; using Mirror; class Tree : NetworkBehaviour { [SyncVar] public int numLeaves; public override void OnStartClient() { Debug.Log("Tree spawned with leaf count " + numLeaves); } } ``` With this script attached, you can change the `numLeaves` variable and modify the `SpawnTrees` function to see it accurately reflected on the client: ``` cs void SpawnTrees() { int x = 0; for (int i = 0; i < 5; ++i) { GameObject treeGo = Instantiate(treePrefab, new Vector3(x++, 0, 0), Quaternion.identity); Tree tree = treeGo.GetComponent<Tree>(); tree.numLeaves = Random.Range(10,200); Debug.Log("Spawning leaf with leaf count " + tree.numLeaves); NetworkServer.Spawn(treeGo); } } ``` Attach the `Tree` script to the `treePrefab` script created earlier to see this in action. ### Constraints - A NetworkIdentity must be on the root game object of a spawnable Prefab. Without this, the Network Manager can’t register the Prefab. - NetworkBehaviour scripts must be on the same game object as the NetworkIdentity, not on child game objects ## Game Object Creation Flow The actual flow of internal operations that takes place for spawning game objects is: - Prefab with Network Identity component is registered as spawnable. - game object is instantiated from the Prefab on the server. - Game code sets initial values on the instance (note that 3D physics forces applied here do not take effect immediately). - `NetworkServer.Spawn` is called with the instance. - The state of the SyncVars on the instance on the server are collected by calling `OnSerialize` on [Network Behaviour] components. - A network message of type `ObjectSpawn` is sent to connected clients that includes the SyncVar data. - `OnStartServer` is called on the instance on the server, and `isServer` is set to `true` - Clients receive the `ObjectSpawn` message and create a new instance from the registered Prefab. - The SyncVar data is applied to the new instance on the client by calling OnDeserialize on Network Behaviour components. - `OnStartClient` is called on the instance on each client, and `isClient` is set to `true` - As game play progresses, changes to SyncVar values are automatically synchronized to clients. This continues until game ends. - `NetworkServer.Destroy` is called on the instance on the server. - A network message of type `ObjectDestroy` is sent to clients. - `OnNetworkDestroy` is called on the instance on clients, then the instance is destroyed. ### Player Game Objects Player game objects in the HLAPI work slightly differently to non-player game objects. The flow for spawning player game objects with the Network Manager is: - Prefab with `NetworkIdentity` is registered as the `PlayerPrefab` - Client connects to the server - Client calls `AddPlayer`, network message of type `MsgType.AddPlayer` is sent to the server - Server receives message and calls `NetworkManager.OnServerAddPlayer` - game object is instantiated from the Player Prefab on the server - `NetworkManager.AddPlayerForConnection` is called with the new player instance on the server - The player instance is spawned - you do not have to call `NetworkServer.Spawn` for the player instance. The spawn message is sent to all clients like on a normal spawn. - A network message of type `Owner` is sent to the client that added the player (only that client!) - The original client receives the network message - `OnStartLocalPlayer` is called on the player instance on the original client, and `isLocalPlayer` is set to true Note that `OnStartLocalPlayer` is called after `OnStartClient`, because it only happens when the ownership message arrives from the server after the player game object is spawned, so `isLocalPlayer` is not set in `OnStartClient`. Because `OnStartLocalPlayer` is only called for the client’s local player game object, it is a good place to perform initialization that should only be done for the local player. This could include enabling input processing, and enabling camera tracking for the player game object. ## Spawning Game Objects with Client Authority To spawn game objects and assign authority of those game objects to a particular client, use `NetworkServer.Spawn`, which takes as an argument the `NetworkConnection` of the client that is to be made the authority. For these game objects, the property `hasAuthority` is true on the client with authority, and `OnStartAuthority` is called on the client with authority. That client can issue commands for that game object. On other clients (and on the host), `hasAuthority` is false. Objects spawned with client authority must have `LocalPlayerAuthority` set in their `NetworkIdentity`. For example, the tree spawn example above can be modified to allow the tree to have client authority like this (note that we now need to pass in a NetworkConnection game object for the owning client’s connection): ``` cs void SpawnTrees(NetworkConnection conn) { int x = 0; for (int i = 0; i < 5; ++i) { GameObject treeGo = Instantiate(treePrefab, new Vector3(x++, 0, 0), Quaternion.identity); Tree tree = treeGo.GetComponent<Tree>(); tree.numLeaves = Random.Range(10,200); Debug.Log("Spawning leaf with leaf count " + tree.numLeaves); NetworkServer.Spawn(treeGo, conn); } } ``` The Tree script can now be modified to send a command to the server: ``` cs public override void OnStartAuthority() { CmdMessageFromTree("Tree with " + numLeaves + " reporting in"); } [Command] void CmdMessageFromTree(string msg) { Debug.Log("Client sent a tree message: " + msg); } ``` Note that you can’t just add the `CmdMessageFromTree` call into `OnStartClient`, because at that point the authority has not been set yet, so the call would fail.
I have worked with both a Parallel Quicksort algorithm and a PSRS algorithm that essentially combines quicksort in parallel with merging. With the Parallel Quicksort algorithm, I have demonstrated near linear speedup with up to 4 cores (dual core with hyper-threading), which is expected given the limitations of the algorithm. A pure Parallel Quicksort relies on a shared stack resource which will result in contention among threads, thus reducing any gain in performance. The advantage of this algorithm is that it sorts 'in-place,' which reduces the amount of memory needed. You may want to consider this when sorting upwards of 100M elements as you stated. I see you are looking to sort on a system with 8-32 cores. The PSRS algorithm avoids contention at the shared resource, allowing speedup at higher numbers of processes. I have demonstrated the algorithm with up to 4 cores as above, but experimental results of others report near linear speedup with much larger numbers of core, 32 and beyond. The disadvantage of the PSRS algorithm is that it is not in-place and will require considerably more memory. If you are interested, you may use or peruse my Java code for each of these algorithms. You can find it on github: https://github.com/broadbear/sort. The code is intended as a drop-in replacement of Java Collections.sort(). If you are looking for the ability to perform parallel sorting in a JVM as you state above, the code in my repo may help you out. The API is fully genericized for elements implementing Comparable or implementing your own Comparator. May I ask what you are looking to sort that many elements for? I'm interested to know of potential applications for my sorting package.
Expression of the 3-hydroxy-3-methylglutaryl coenzyme A-reductase and LDL-receptor genes in human embryonic tumours and in normal foetal tissues. The expression of the HMG-CoA-reductase and LDL-receptor genes was examined in primary human embryonic tumours and in normal human first trimester foetal tissues. All embryonic and extra-embryonic tissues examined contained RNA that hybridized with the HMG-CoA-reductase and LDL-receptor cDNA-probes. However, the transcript levels varied considerably between organs. By using Northern blotting, we confirmed that normal foetal tissues contained HMG-CoA-reductase and LDL-receptor transcripts of normal size (4.2 kB and 5.3 kB, respectively). All human developmental tumours examined were characterized by high levels of HMG-Co-A-reductase RNA. However, when the quality of this RNA was examined in greater detail it was found that the 4.2 kB band only accounted for a minor portion of the RNA. Instead we found a range of other transcripts (3.1, 1.1., 0.95, 0.78 and 0.55 kB) that hybridized with the probe. There was a qualitative difference in that only the non-seminomas contained high levels of the three smaller transcripts (0.95, 0.78 and 0.55 kB). In contrast, only one tumor--an embryonal carcinoma--contained increased levels of LDL-receptor transcript. This was found to be of the expected size (5.3 kB).
Emory to treat patient with suspected Lassa fever | News Title (Max 100 Characters) ATLANTA-- An American medical worker suspected of contracting a deadly virus in West Africa is headed to Emory's isolation unit for diagnosis and treatment. Emory University Hospital is working with the CDC and the Georgia Department of Health to transport the patient, suspected of having Lassa fever. The physician assistant was working in Togo, West Africa with a missionary group and had contact with an infected patient. The medical worker will be transported back to Atlanta by air transport this weekend. "Strick adherence to the same infection control procedures that our trained staff used when we cared for patients with ebola will be successful and will help maintain the safety for our health care workers," Emory's Dr. Jay Varkey said. Lassa fever has been prevalent in West Africa. Although Lassa and Ebola can have similar symptoms, a spokesperson for Emory University Hospital says Lassa is far less likely to spread from person to person. It's also far less deadly. According to the CDC, only 1 percent of people infected with Lassa virus die. "The symptoms early on are common to other viral infections So fever, occasionally a high fever a lot of aches, you can have GI symptoms like nausea or vomiting and then in very rare circumstances among patients who are hospitalized for Lassa fever, a small portion of patients can develop bleeding complications," Dr. Varkey said.
Your alluring well of time and space Pulls me through to the other side Gravity God-speeding me Into the great divide Thunder sounds and darkness fills my mind Silently making me insane Accelerate through the depths of your design Leaving memories in my wake
The impact of Donald Trump’s anti-immigrant broadsides appears to have veered dangerously far off the presidential campaign trail. Police in Boston say that one of two brothers who allegedly beat a homeless Hispanic man cited Trump’s message on immigration as a motivation for their attack. “Donald Trump was right, all these illegals need to be deported,” Scott Leader, 38, told officers, according to a police report cited by The Boston Globe. Leader and his brother, Steve, were arrested and charged with multiple assault charges after police said they urinated on and then assaulted a 58-year-old homeless man they found sleeping outside a T-station as they walked home from a Red Sox game. They allegedly beat him with a metal pole, breaking his nose and causing other injuries. According to the Globe, Scott Leader told police it was OK to assault the man because he was Hispanic and homeless. Both men, who have extensive criminal records, pleaded not guilty and said the homeless man started the confrontation. Officials in Boston immediately denounced the attack. But Trump, who has made no apology for suggesting some Mexican immigrants were “rapists” and calling for their mass deportation, appeared to brush off the incident when he was asked about it while campaigning Wednesday in New Hampshire. “I think that would be a shame,” he said, according to The Boston Herald, in reference to the report. He said he hadn’t heard about the incident but then defended his most ardent supporters as “passionate.” I will say, the people that are following me are very passionate. They love this country. They want this country to be great again. But they are very passionate. I will say that. For Latino leaders who repeatedly denounced Trump’s rhetoric against undocumented immigrants, the most disturbing part of the attack in Boston was how unsurprising it was. “It’s a pattern that we have seen over the last decade in the nation with enforcement only policies and this anti-immigrant rhetoric,” said Hector Sanchez, the chairman of the National Hispanic Leadership Agenda, in a phone interview, “I was not surprised.”
Ms Clark said she was most concerned that one of her children could have been poisoned by the bait and since reporting the incident twice to the Gracemere Police Station yesterday, they were yet to follow it up with her. Police Media was unfamiliar with the case but said that often pictures falsely circulated purporting to be dog baits in an area. They recommended Ms Clark contact both the police and the RSPCA regarding the situation. If you have information for police, phone Policelink on 131 444 or report information about crime anonymously to Crime Stoppers on 1800 333 000.
Bill proposes ISPs, Wi-Fi keep logs for police (PRISON PLANET) Republican politicians on Thursday called for a sweeping new federal law that would require all Internet providers and operators of millions of Wi-Fi access points, even hotels, local coffee shops, and home users, to keep records about users for two years to aid police investigations. The legislation, which echoes a measure proposed by one of their Democratic colleagues three years ago, would impose unprecedented data retention requirements on a broad swath of Internet access providers and is certain to draw fire from businesses and privacy advocates. “While the Internet has generated many positive changes in the way we communicate and do business, its limitless nature offers anonymity that has opened the door to criminals looking to harm innocent children,” U.S. Sen. John Cornyn, a Texas Republican, said at a press conference on Thursday. “Keeping our children safe requires cooperation on the local, state, federal, and family level.” Joining Cornyn was Texas Rep. Lamar Smith, the senior Republican on the House Judiciary Committee, and Texas Attorney General Greg Abbott, who said such a measure would let “law enforcement stay ahead of the criminals.” Two bills have been introduced so far–S.436 in the Senate and H.R.1076 in the House. Each of the companion bills is titled “Internet Stopping Adults Facilitating the Exploitation of Today’s Youth Act,” or Internet Safety Act. Each contains the same language: “A provider of an electronic communication service or remote computing service shall retain for a period of at least two years all records or other information pertaining to the identity of a user of a temporarily assigned network address the service assigns to that user.” Translated, the Internet Safety Act applies not just to AT&T, Comcast, Verizon, and so on–but also to the tens of millions of homes with Wi-Fi access points or wired routers that use the standard method of dynamically assigning temporary addresses. (That method is called Dynamic Host Configuration Protocol, or DHCP.) “Everyone has to keep such information,” says Albert Gidari, a partner at the Perkins Coie law firm in Seattle who specializes in this area of electronic privacy law. The legal definition of electronic communication service is “any service which provides to users thereof the ability to send or receive wire or electronic communications.” The U.S. Justice Department’s position is that any service “that provides others with means of communicating electronically” qualifies. That sweeps in not just public Wi-Fi access points, but password-protected ones too, and applies to individuals, small businesses, large corporations, libraries, schools, universities, and even government agencies. Voice over IP services may be covered too.
I downloaded VL64-7.1-STD-B1.iso, put it on a usb stick with unetbootin. It would not install on my Lenovo N586, a fairly new machine with 500G hard drive. In both automatic and expert it stopped at "Preparing package Install." This contrasts with VL64-7.1-STD-B0.51.iso, which installed via unetbootin just fine on the same machine. I will download it again, just in case it was a bad download, and report if that fixes it. Speaking of automatic, I think the loader should explain what partitions it creates. Happy Thanksgiving! What better way to start the day than testing out a new beta? So far I've done two installs in a vm and one on real hardware. VL 7.1 B1 is a huge improvement over previous releases.All CPUs are up and running.Setting XFCE4 background to solid color works as intended.Checking a single box during install disables boot splash, for those who prefer it that way. BTW, a new download of B1 on a different usb stick didn't help. I don't see a place to tell it which partition is boot. Just guessing, but that might be the problem. More likely its the video card in the Lenovo. ONLY DAUNTING side lies at "missing vliloconf" command, log in as root, no vliloconf command available....now still can't make another botloader for grub2 yet.....always have to edit at grub booting menu for booting to desktop....PLS SUGGESTED WHERE TO GET THE MISSING VLILOCONF PKG? Did n't find "menu.lst" file under /boot/grub at all, how to edit grub booting menu manually? So, though I don't understand this md5sum business, as Vincent2 suggests, data is apparently corrupted. However, I see no need to download it again. I have done so twice without success. Downloaded VL64-7.1-STD-B1.iso and got the same md5sum as sledgehammer.Downloaded VL64-7.1-STD-B0.51toB1.delta and applied it to B0.51. Different result, it matches the official posted md5sum. Does look like the B1 ISO file is corrupt.
Q: What are the most common data storage devices in small consumer electronics? What are the standard ways of data storage in small consumer electronics (routers, phones, etc.)? For simple devices I guess microcontrolles with in-system programmable flash are enough, but for example on a smartphone, would there be an internally mounted micro-SD card or similar? Where would OS, etc. be stored? A: For items such as you use as examples, there is usually a NAND flash chip (or more than one) hanging off the main processor. For smaller items (say microwaves), the code will either be in internal flash on the microcontroller, or in very cost-sensitive high-volume applications will be in ROM, again usually on the same die as the micro. A: There are three typical choices: internal flash, external NAND flash and micro-SD cards. Flash memory evolved from early EEPROM devices and has pretty much replaced them, being more dense (and thus cheaper per byte). Very high volume devices might use ROM, which I won't cover here since I don't have either pricing or specs for it. Functionally, it would act as either internal or external flash memory, except for their being read-only and have no endurance issues. NAND flash IC's are usually quite a bit more expensive than the comparatively-sized micro-SD card, just because the latter are manufactured in such large quantities the economies of scale bring the price down. For example, an 8 GB NAND flash (64 Gb) chip costs around $20, and an 8 GB SD card costs $6. (I couldn't even find an 8 GB EEPROM IC for comparison.) And of course internal flash memory almost comes for free, except microcontroller cost does increase with flash memory size. The access time for the SD-card though will be slower than the NAND flash, since the SD card is accessed using either a 2-wire (R/W) SPI interface, or a 4-wire proprietary interface, while the NAND flash chips typically have an 8-bit parallel interface. Internal flash will be the fastest, since no external interface is required. Since SD cards can be formatted in a PC, they often are set up with a file system such as FAT-32, which makes it easy to copy file fro the PC and then access them from a microcontroller containing the necessary FAT-32 library. (And of course the microcontroller can also write new files, create directories etc too if it wants.) Another difference is wear leveling. Brand-name SD cards typically include wear-leveling (all SD cards have a processor inside them), while NAND flash chips do not and your application needs to do wear-leveling to prolong the life of the device. (Erasing/writing is much slower than reading for all these devices.) SD cards will typically have the longest endurance in terms of erase/write cycles (typically 100,000). Internal flash and NAND flash chips typically have significantly fewer erase/write cycles, often measured in the thousands or tens of thousands. Thus they are not good substitutes for a hard drive. (added) SD cards can only be used for storing data; you cannot run code from them. However if the processor can execute code out of RAM (Von Neumann architecture), one could load programs as needed off the SD card into RAM and execute it there. (Note: most microcontrollers are Harvard architecture and cannot execute code from RAM.) External flash can be used to execute code only if the processor has an external memory interface that specifically allows this, such as many ARM microprocessors. If the access is just via a general purpose parallel port, then the external flash can only be used for data. Internal flash is just the other way around -- it is usually used for storing and executing program code, and most Harvard architecture microcontrollers have to have special means (such as a data "window") that allows access to the internal flash as a data area (not part of a program const area). To answer your last question, an OS would almost always be wholly contained in the internal program flash area of the microcontroller. But it could be contained on an external flash if the processor allows this. If the OS needs to load drivers on an as needed basis, these could be stored on an SD card (or external flash), and either loaded into RAM if there is enough room and the processor can execute out of RAM, or burned into an area of internal flash reserved for drivers.
If 2016 has shown us anything, it’s that America is more divided than ever. The presidential election has shown a stronger presence from the extremes of both the left and the right than ever before. Americans have grown disdain and anger for those who do not identify with their political party. As people move to the extremes, stubborn partisan idealism has prevented civil discourse and open-minded debate. A great divide has grown between a Democratic White House and a Republican Congress, and our government has gridlocked. Pure partisanship will only present a barrier to progress. This past week, I attended AIPAC’s Saban Leadership Seminar. AIPAC is a bipartisan organization with the goal of promoting the U.S.-Israel relationship through lobbying and activism. Participants at the conference held various political beliefs, and both Democrats and Republicans were well-represented. However, everyone came together around the one issue of Israel. Through open-minded discussion, I found that, although many of the participants did not identify with the same party as me, we agreed on more than we thought we ever would. There was not a complete consensus, and there never will be, but with open-mindedness and a willingness to compromise, we can settle our differences. This past week, President Obama refused to veto a UN Security Council Resolution condemning Israel’s occupation of land beyond “the 4 June 1967 lines, including with regard to Jerusalem.” This resolution calls the Old City, the holiest Jewish site, occupied territory, and demands that Israel cease all activity in the area. The U.S. has, in the past, vetoed such policies against Israel, and many pro-Israel advocates, including myself, are furious with Obama for refusing to do so. Some have gone so far as to say that Obama is against Israel (our only democratic ally in the Middle East), but I do not believe that is the case. Instead, I believe that the liberal Obama is at odds with conservative Israeli Prime Minister Netanyahu, who continues to push for expanded settlements. Obama has shown support for Israel in the past with actions such as giving Israel the largest military aid package ever. Obama's lack of action at the UN is simply his final blow in a long-standing conflict between him and Netanyahu, and this act of partisan bickering has disastrous consequences for both Israel's security and its relationship with the U.S. The partisan divide not only creates tensions in foreign affairs, but it also frequently hinders the operation of our government domestically. The most notable example is Congress’s failure to vote on Merrick Garland, President Obama’s nominee to fill the currently empty seat on the Supreme Court. Republican Senate Majority Leader Mitch McConnell promised that the Senate would not consider any Obama nominee, despite the fact that the seat has been vacant for nearly a year. I’m not saying that the Senate is required to confirm Garland, but by stalling the confirmation vote, Senate Republicans are lessening the effectiveness of the Court, one of the nation’s most important institutions. With a vacant seat, there is now an even number of members on the Court, creating the possibility of a tie vote that would prevent a ruling on a case. We have seen several cases this year that the Court could not decide, all because Senate Republicans refused to cross the aisle and work with President Obama on filling the ninth seat. While partisan divides bring governments to a halt, bipartisanship is a catalyst for achievement. AIPAC, for example, is one of the most powerful lobbying groups in the U.S., rivaling the NRA, despite having only nine lobbyists on staff. AIPAC succeeds where others fail because of its ability to reach both parties. Its supporters represent a wide range of political opinions, enabling it to influence legislators on both sides. AIPAC supporters do not agree on every issue, as I learned firsthand at Saban, but at the end of the day, we all come together to fight for the cause that unites us— Israel’s survival and perseverance. If America as a whole takes the same approach that AIPAC has on a broader scale, the nation will benefit greatly. At the end of the day, Democrats and Republicans both want to see America thrive; they just have different opinions on how to accomplish that goal. However, if we can make America a higher priority than our partisan agendas, we will make compromise much easier to reach, and we will push America forward.
Monthly Archives: December 2016 Post navigation It’s New Year’s Eve. Time to reflect, to look forward, to enjoy the moment. Reflecting….. Last year was a year of huge change for me. Never before have I had so many big changes in my life. Losing my mother. Retiring from a lifetime of work. Moving to Florida, to a completely different way of life. Moving my son away from me to Colorado. Ending a love affair that stopped bringing me pleasure a long time ago, and only brought me pain. And even so, it was a struggle to let go. But let go I finally have, completely. All these changes were good. Every one of them. Even though I miss my son so much. I know he’s doing well, and happy, and making his own way. Thank God for cell phones, we talk every day. There are new people in my life, new friends, the budding of new relationships that bring a smile to my face. I don’t deal with winter any more. That is such a blessing to me. I so hated being cold from the middle of October until the middle of April. Dressing in 4 or 5 layers, and still being cold. I hated dealing with snow, and the last few years we had mega amounts of snow up there, with only a few exceptional years. I hated driving in it, keeping the driveway clear and the walk ways, and being housebound. Now…..when it gets cold here, it’s in the 50’s. And so far, for not more than 2 days, til the temperature creeps back up to the 70’s or 80’s. I can walk every day along the beach. I can see the ocean every day. The water here on the Gulf coast is warm, and calm, and soothing. Usually I am dressed in one layer, and more often than not, it’s shorts, or skorts (the skirts with shorts under them). To be able to spend time with my sister on a regular basis is such a blessing. We are becoming so close. It has eased the pain of losing our mother last year. We joke all the time about how we channel her for each other. She and I have not lived close to one another since we moved out of the house around age 20. I’m going back there today, invited to her neighbor’s New Year’s Eve party which promises to be a blast, and it’s right across the street!. No driving with the drunks…. The future is looking bright. There is a possibility of a budding relationship. It is moving slowly, at a speed which, while sometimes frustrating for me, is a good thing really. I’m sitting back and let the universe drive the train. It’s fun to feel that way again, and actually have it reciprocated. Financially I feel secure. Avalon, my home, my place of new beginnings, is coming along. All the big work is now completed. There are some jobs like tree-trimming, putting up a shed, landscaping that need to be done, but they will be done over the next few months. Mostly, I have given up worry over things I cannot control. I have come to believe that the Universe has a grand design, which we cannot possibly understand in human terms, and that all will work out for the highest good of all. It’s not so much Pollyanna, it’s just that I agree with Marianne Williamson that the universe is self-organizing and self-correcting. It has been the way it’s worked for me, over and over again. I know that many people won’t agree with me, in fact, maybe most. It’s just the way it is from the perspective of my life. Not asking anyone else to believe it. This year, I think I will try to do more giving back. There are a few things I’ve discovered here which I can get involved with that might make a difference in someone else’s life. I mean, I have such a happy life here. So free of drama and pain, so full of joy. I want to spread that around as much as I can. Life is for living, for singing a joyful song. I’ve always known that, even though I’ve had a hard time singing so often. Through an abusive marriage, a failed love affair, a long period of terrible financial insecurity, I still always believed I could one day sing the song again. I’m singing it now. It’s in my head, lol, I still don’t sing in front of people. But those close to me can hear the song. I guess this is why I trust that the universe is on it, organizing and correcting for the higher benefit of all. Because it’s taken me from terrible darkness, to the sunlight of Florida. A blast from the past. I don’t watch much TV. I turn it on in the evening, and often pay no attention to it. It’s just for the noise. Tonight I’m watching the news, which is something even more rare than watching at all. I hate the news. At least, network news. But tonight there was a story about the CT Supreme Court reversing the decision on Michael Skakel and sending him back to prison for the murder of Martha Moxley. They showed the Supreme Court Room, and boy, did that bring me back to some difficult, yet triumphant memories. December 2, 2010, exactly 2 years after the first day of our trial in Superior Court. More than 3 1/2 years since I had left my ex. 2 years since my son had come to live with me. I remember sitting as a spectator, because that’s where the actual parties to the cases sit, in that auspicious room. The pomp and circumstance was palpable. Classrooms of students from local colleges filed in to watch the proceedings. The officer in charge of the courtroom gives all of us instructions. There was not an empty seat. Classrooms have to book it way ahead of time. The Supreme Court hears 2 cases a day. I had been waiting for 2 years to be heard. Two years from the 3 day trial my ex and I had, as he attempted to make sure I got less than 10% of the estate from a 32 year marriage. He lost that first Superior Court decision. He appealed, and then requested to have the appeal raised from the Appellate Court to the Supreme Court. Meanwhile, every asset from our 32 year marriage, every dime, was in his possession. I had a paycheck. That was it. (And just for added stress, my son was in a bad car accident 4 days before, broke his ankle, totaled 2 cars. Of course the man with all the money did not contribute one cent to the deductible for his health insurance, or on a replacement car.) 7 chairs at the bench in the front. Like 7 thrones. The people who sat there would decide my future. I hoped they were just, I hoped they could see the truth about what had been done to me. Each atty gets a certain amount of time to make their case. My son’s GAL (guardian ad litum) sat with my attorney, to help her if needed. Because, he got it. It took him awhile, but he finally got it, and for the last year, and during our initial trial sat on my side. When my atty made her case, she didn’t even need all the time allotted. The judge in our Superior Court decision could see my ex coming 100 miles away, and did a ton of research for us, since there was no law regarding our issue. He wrote 7 pages, citing cases in other states. It was all in our brief, not much needed to be said. The point was that for him to prevail would have done a grave injustice, I think is what it said. The justices argued with my ex’s atty. Not mine at all. They had some questions, but not many. They had a lot of questions of my ex’s and some actually argued with him, telling him that what the judge did, he was supposed to do. In the end, I won. The decision was released April 18, 1 day before my 60th birthday. I had been secretly asking the Universe to give me the decision for a birthday present. Really. They called my ex “unconscionable” 9 times in their lengthy decision. Unanimously. And, my case made case law in CT. No one will ever be able to do to their spouse what he tried to do to me again. That makes me proud, really. And really, eases some of the pain of waiting 4 years to finally be free of that man. A couple of years later, a Yale 1st year law student contacted my atty. His first assignment of the year in contract law had been to write a brief on my case, and could he come and see her for about an hour, and see some of the files. Imagine that. My case, my 4 year struggle ended up being a case which Yale University used to teach contract law. I could go on, about how my life changed that 60th birthday. How I went house hunting, and bought my dream house, and later segued that house into this lovely life I now have in Florida. How I didn’t even consider having a date until I was moved into my new house. I hadn’t wanted to embroil anyone else in that mess. I learned that avoidance of something doesn’t mean you’re ready for it. I fell in love with someone who devastated me emotionally as badly, if not worse, than my ex did as he tried to separate my son from me, and hurt me financially. What my ex never did to me, my first love after divorce did. No need to expound on that. It’s all in the pages of this blog. I’m pretty cautious now. I ended my 4 or 5 night streak of good sleep last night. My son began texting me at 11:30 last night that his car’s valve cover gasket is leaking. His service engine light had just come on. It will cost $500 to fix. 11:30 is way past my bedtime, I was in bed, and falling asleep. I was up kinda late, because I went to open mic, and then came home and wrote for awhile to unwind. After texting back and forth for awhile, I told him to call me this morning and we’ll talk about it. I went back to sleep for 2 more hours, and then woke up and was wide awake. So, I do what many of us do, I got up, got on the computer and wrote some more, to empty my head. Then at 3:30 went back to bed, took a half an Ambien and fell asleep til 8. Or so. Now my sleep schedule will be messed up. But really, does it matter, LOL. I’m retired. I don’t have to be anywhere at any time, except at the doctor today at 1:30 for a therapy treatment. Which is a back massage…… Had a good time last night at open mic, as always. Both of my good friends who go with me were sick, so I went alone, but knew I could hang out with my other friends. My friend P welcomed me with a hug, and walked me to my car at the end of the night. What a good guy. A man I’ve been messaging with has expressed a wish to go to open mic with me. He plays guitar and sings and also is a boater/sport fisherman. He said he could play a Buffett song. That crowd would love Buffett. So who knows, maybe. I like him a lot. He’s a sweet man, so far. I splurged and bought myself a leaf blower that also vacuums leaves to deal with the leaves from the banyan tree, which perpetually are falling off. Much easier to blow them than to try to rake them. I also bought a push broom and a rake. Push broom is to allow me to scrub my deck. I guess it’s time to take the Christmas tree down. I am usually anxious by about this time, to get the house back to normal. Even though, my house has not been “normal” really. I wish I had everything in it’s place but I still don’t. I need to though. My friends from high school will be here in 2 weeks, and I need it better organized than what it is now, since they are all staying here one night as we try to recreate our high school days. But, it will be the night of open mic, so we won’t be hanging here all night, which is something I’m glad about. It’s cool here this morning, 51 when I woke up. The house was cool. But the sun is out brightly though the high will only be 61. I love living in a place where “cold” is 60. LOL. It’s been snowing up north in my old home. Not missing it at all. I wrote a blog, and when I pasted it from word and looked at it, I thought, who cares? Who cares that you went to open mic again, and had a wonderful evening, and that it’s getting cooler and may not go above 60 tomorrow? It’s all so mundane. I mean, I’m happy. I’ve never been so consistently happy in my life. I’m content. I’ve left the drama behind me, I have the foundation laid for a lovely life here. My friend who took the walk with me the other day walked me to my car tonight, we remarked what a small world it is, both of us kind of running into people we knew long ago. The boyfriend of my bff in Iowa texted me that he was coming tonight, and he sat with us, though he left early, he has a longer drive because he doesn’t live in Gulfport. I think he feels safe with me, knowing my bff won’t get jealous of him hanging with me because she knows I have no designs on him, nor would I even if they weren’t together. Totally not my type. Then someone my walking friend, I’ll call him P, ran into someone who got him started singing karaoke. I also told him about meeting my jr. high school home ec teacher…. Really, what a small world. This man, P, is so dear to me. When he hugs me hello or goodbye he pulls me into him, and hugs tight. He used to do just the one armed hug, but we are pretty close now. So happy to have his friendship, I treasure it. So, that, friendship with him, is not mundane. The people I love are not mundane. Going through the motions of living are. My bff’s boyfriend said to me tonight, “We’re in paradise here….” Yes. Yes we are. Laid back, loving, friendly, no stress. Perfect weather almost every day. And the days that aren’t are a welcome change. Every day I try to express my gratitude for this. Life is an amazing adventure.
Friday, November 27, 2009 Czech Efforts to Reduce Dependence on Russian Energy Faltering Martin Roman, CEO of state-owned utility CEZ announced on November 3 that three companies submitted bids to construct the third and fourth reactor blocs for the Temelin nuclear power station along with options to construct a fifth reactor bloc at the Dukovany nuclear power station in a deal that will cost at least USD28 bn. The three were Russia’s Atomstroyexport, Westinghouse of the US and French company Areva. Roman said he expects a winner to be selected in 2011 and said the third and fourth blocs at Temelin would be scheduled to go online in 2019/20. What Roman didn’t tell the media is that the Russian government is placing, what some Czech diplomatic sources have described as an unprecedented amount of pressure on Czech officials to select the state-owned Atomstroyexport in what will undoubtedly be the largest nuclear power deal in history. Vaclav Bartuska, the Czech envoy for energy security issues publicly warned the Czech political elite about the consequences of selecting Russia as the prime contractor since such a decision would tie the Czech Republic’s energy security for at least the next 15 years to a country with an unstable political future. Czech diplomatic sources have said off-the- record that Bartuska was recently reprimanded by a member of cabinet of Prime Minister Jan Fischer’s caretaker government for what was described as “his excessively pro-Western views on matters concerning energy security.Officials from Atomstroyexport announced on October 30 that if selected the company would farm out up to 70 percent of the work on the Temelin and Dukovany projects to local companies such as reactor builder Skoda JS. Apart from dominating the Czech market, CEZ i also active in Slovakia, Poland, Hungary, Romania, Bulgaria, Ukraine, Albania, and Turkey. The management of CEZ which is the largest utility in CEE has recently come under fire for running the company as though it were a private fiefdom that finances the country’s largest political parties – the Civic Democratic Party (ODS) and the Social Democrats (CSSD) which ineffectively govern the country and split the economic spoils as a cartel together with a select group of other private equity companies including PPF and J&T. The latter two firms have been highly active in Russia since the early 1990s and their senior management is known to have links to the former Czechoslovak StB security service and the Soviet KGB. Over the years journalists have jokingly re-named the country the CEZ Republic. A Czech court, however, recently ruled that CEZ is a state company and must therefore comply with disclosure practices regarding its business activities. One of the key people who convinced the Czech government in 2004 to appoint Martin Roman CEO of CEZ was Vladimir Johanes, one of the most powerful lobbyists in the country and son of the last communist-era foreign minister Jaromir Johanes. Vladimir Johanes studies at MGIMO during the early 1990s. It was also Roman and the CEZ management team that opted to select Russian state-owned TVEL to supply Temelin with nuclear fuel cells beginning in 2010. The current Czech government has also launched an investigation into a company called CEEI which was selected by CEZ to construct a storage facility for spent nuclear fuel from the Temelin nuclear power station. The Czech media in September traced CEEI to a Liechtenstein-based company called U.B.I.E. One of the company’s directors is Markus Buchel, the Russian honorary consul to Liechtenstein. Buchel, however, claims that he is not the ultimate beneficiary officer (UBO) of U.B.I.E. and further claimed that he does not know the identity of the UBO. Since this mounting pile of evidence clearly demonstrates that the management of CEZ does not appear to be working in the best interests of the taxpayers of the Czech Republic which in 1999 joined NATO and in 2004 the EU. It begs the question: In whose interest is the management of CEZ really working for? About The Jamestown Foundation The Jamestown Foundation’s mission is to inform and educate policy makers and the broader community about events and trends in those societies which are strategically or tactically important to the United States and which frequently restrict access to such information. Utilizing indigenous and primary sources, Jamestown’s material is delivered without political bias, filter or agenda. It is often the only source of information which should be, but is not always, available through official or intelligence channels, especially in regard to Eurasia and terrorism.
Menu THE TRENCH COAT MAFIA | ICONIC OUTERWEAR THAT’S ALWAYS IN STYLE * “The trench coat is the only thing that has kept its head above water.” –Jack Lipman * Having spent years ridin’ the rails on the commuter train in-and-out of Manhattan, there are clearly two leading outerwear icons that are inescapable– the Barbour Beaufort, and the timeless Burberry Trench. Both are must-haves for the Northeastern climate in terms of their functionality, versatility and style. It’s not uncommon at all the see a Barbour over a sportcoat or suit, although I oft feel the length and proportions are somewhat off– not to mention I like to keep the Barbour waxed within an inch of it’s life, and therefore it’s not exactly the best companion for co-mingling with tailored clothing. For me, there’s nothing better than seeing a seasoned, well put-together professional sporting the old school classic essentials– Ghurka bag,Burberry trench, J. Press suit, and cordovans. The trench is tearin’ up the runway right now, but don’t buy it for the reviews– wear it for its epicmerits. Now, if only proper headwear would make a comeback– and I’m not talking about knit caps. I remember arguing with my mother, when I was a wee lad, the actual name of this article of clothing. You see, in my optimistic, wholesome mind, one which had not yet been tarnished by the images of war and violence, the name of this garment was a “drench coat.” What do you wear in the rain? A drench coat, that’s what. With a mother’s simple correction — the death of innocence. But, you know what? In my eyes… it’s always going to be a drench coat. I recently found a beautifully weathered, soft to the touch black Burberry trench coat at the thrift store. I’m lovin it! Someone else wore it long enough for that aged patina to reveal itself, now, I can enjoy it! I paid a paltry $10.00! Classics NEVER die! RL, YSL…TSY…Initials to last a millennium…and beyond if we’re lucky… I love this article almost as much as I love trenchcoats… And the shots of Belmondo, Marais, Parks et al…? Exquisite! BTW, I’m quite pleased to see that the style of Black men does not elude your keen eye… Bravo TSY…Bravo! Love Burberry trench coats. Looking at these photos, it is indeed a style that will never die. I still remember my elementary school principle’s trench coats worn with a newsboy cap. For myself, I love wearing my light pink Ralph Lauren trench. JP, Thanks for this quick and fascinating tour de trenchcoat. And I couldn’t agree more about the need for the “return of the hat” (to quote a great New Yorker cartoon). I have passed through many “seasons” of fashion over the past 35 years or so, resolutely wearing my Burberry and various fedoras all over the world. Both are eminently practical. The hats keep your head warm and dry and advance civility when removed at proper times. My faithful trenchies have borne the storms and provided handy pockets for notebooks, cameras, recorders, etc. They age with grace, and the more they are used the more their character grows. They ALWAYS look right — over an 12-ounce tweed sport jacket, a well-traveled BB Makers pinstripe or a tuxedo. Comments are closed. TRANSLATE THIS SITE SHOP TSY ONLINE NOW SHOP TSY END OF SEASON SALE SHOP TSY JEWELRY ONLINE Enter your email address to subscribe to this blog and receive notifications of new posts by email.
/* Copyright 2018 Mozilla Foundation * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ /* globals process */ // NW.js / Electron is a browser context, but copies some Node.js objects; see // http://docs.nwjs.io/en/latest/For%20Users/Advanced/JavaScript%20Contexts%20in%20NW.js/#access-nodejs-and-nwjs-api-in-browser-context // https://www.electronjs.org/docs/api/process#processversionselectron-readonly // https://www.electronjs.org/docs/api/process#processtype-readonly const isNodeJS = typeof process === "object" && process + "" === "[object process]" && !process.versions.nw && !(process.versions.electron && process.type && process.type !== "browser"); export { isNodeJS };
Circulatory dynamics during dental operations in patients with heart transplants. Twelve patients with heart transplants and who needed dental operations were studied. At the same time, a group of normal subjects was enrolled as control. Blood pressure and heart rate were recorded in all subjects when they sat in the chair, after 5 minutes of relaxation, 5 minutes after administration of local anesthetic, and immediately after each dental extraction or curettage. No statistically significant difference was found between the values recorded during the different situations and the basal values in transplanted patients. Conversely, in the normal subjects, the values recorded when they sat in the chair, at the end of curettage, and at the end of dental extractions were significantly different from the basal values. The slight and dulled cardiovascular reaction to stress in patients with heart transplants suggests that the management of these patients is relatively uncomplicated and certainly easier than treatment of subjects with heart disease.
I often keep to myself and rarely do I comment on the forums, including NationStates Gameplay. As you may have recently saw, a member of the Confederation of Corrupt Dictators proposed condemning the Civil Defence Siren. I rarely know what the Confederation of Corrupt Dictators is, other than the fact that they roleplay as totalitarians and that its founder, Jocospor, overspends on World Assembly campaigns. I am not a member of the World Assembly, so I didn't vote, and regardless I would've abstained. However, that's beside the point. The fact that Redlandia is still in the Civil Defence Siren suggests that most people view Redlandia as a region that supports fascism, which is not true. Now I understand that the Civil Defence Siren may be an in-character (or roleplaying) tool to combat in-character fascism, but every region on the list, it seems, shares real-life fascist views. Hence it's difficult to determine whether or not we're being generalized for our real-world political views or in-character views; it's very confusing. As a leftist who resides in Redlandia, when we were in Northern Redlands, all of us assumed that the political views of embassy regions didn't reflect the political views in real life. That suddenly changed after our older region was raided by Antifa. A few weeks after the downfall of Northern Redlands, The Reddington States and Ulrech discovered that such embassy regions, according to their experience off-site, legitimately held fascist views in real life. It prompted a few members, like Novum Vallis, to call for an end in interregional raiding against Antifa. During that same period, after fascists came into our region to commit election fraud, Novum Vallis proposed we should close down embassies with fascist regions. The majority of Redlandians voted to close down embassies with fascists, resulting in anger in the far-right NS community. Redlandia was called a "safe space" and/or a "puppet of Antifa". Vippertooth came into the region to congratulate us but many didn't appreciate that he invaded Northern Redlands to begin with, so a key member (Fereria), who like many others approved the vote to close down fascist embassies, banjected him. The founder privately told me that banjecting him was wrong, but reversing the ban would upset a lot of members. So the banjection remained. Reddington and Ulrech started to revamp the entire region. Reddington wrote multiple designed dispatches for the region, establishing the region's etiquette and features, while Ulrech overhauled our entire Discord server, which started off shoddy. The election also caused some people to leave, but those people were either extremely right-wing or cancerous to the RMB experience. We felt like that Redlandia was heading towards the right direction. Since we closed embassies with fascists, we gained a number of left-wingers entering the region. One of those new left-wing users, New Camelot of Avalonia campaigned for a spot in the administration and earned it in a fair, democratic election. Redlandia would have its first truly balanced government where its members have a variety of political views ranging from left to right (but neither communist nor fascist). This was completely unprecendented in regional history as Redlandia, a mostly right-leaning region, was experiencing left-wing influence. We did what the CCD failed to do and that was close embassies with fascists, increase leftist influence in our government, and encourage the condemnation of real-life fascism. Redlandia is perhaps the most left it's ever been, although I'm not saying it's a leftist region now. But if we've done all of the aforementioned, if members of our administration recently participated in a raid of Farkasfalka, and if we're actively criticizing fascism and Holocaust denial on our own RMB, then why are we still in CDS's list with a myriad of regions that have criticized our region including the founder and the commandant themselves? Why is it that when our members go into off-site platforms for different regions, they are removed from those platforms for being "fascist"? It happened to Charleotopia once, it happened to Ulrech once, and it happened to Reddington twice. Members of our region are being persecuted in other regions because of their affiliation with Redlandia and it's quite disgusting. What this is doing is creating tensions within Redlandia. Most of us want to make it clear that our region is against fascism, and yet a few members don't want that because the NSGP wouldn't accept them anyways. A former member who Ulrech banjected suggested that Redlandia's government should be working with fascists to resist Antifa. A fascist from The Iron Confederacy suggested that Redlandia should become fascist again. A region literally titled The Reich thought that Redlandia was a "bastion of fascism and Nazism" because the CDS said so. I want my peers at Redlandia to join any region without being labeled a "fascist". I want this "Redlandia is fascist" nonsense to end, now. I want people to actually communicate with us about our views rather than get their heresy from a member of Antifa. Nobody in Redlandia wants to be associated with digustingly racist and bigoted Nazis and fascists. Redlandia is perhaps the most left it's ever been, although I'm not saying it's a leftist region now. But if we've done all of the aforementioned, if members of our administration recently participated in a raid of Farkasfalka, and if we're actively criticizing fascism and Holocaust denial on our own RMB, then why are we still in CDS's list with a myriad of regions that have criticized our region including the founder and the commandant themselves? Why is it that when our members go into off-site platforms for different regions, they are removed from those platforms for being "fascist"? Honestly? I think think it's because the program has more to do with posturing then actually fighting fascism. There's a lot of people in the antifa movement because it's a way to gain some kind of moral legitimacy. In other words, it doesn't matter if you are actually fascist or not, only if they can make the label stick. A free society rests on four boxes: The soap box, the ballot box, the jury box, and the ammo box. That's good that you're making progress. But it has to be consistent. Maintain the left-wing leanings, go further and eventually that will become people's new memory. The far-right past will be forgotten. If you go back to fascism, it will only prove the skeptics correct, and any trust that was gained would be broken. Seeing your story now, it's nice, but the first thought that comes to my mind is "Is this a real change? Or is it temporary? After all, it still sounds like it has a lot of right-wingers in it. How do I know they're not prone to becoming fascist once again?" Keep doing what you're doing. Be consistent, show that this re-alignment is for real and the past will eventually be forgotten. It just takes time. And it sounds like you guys need to come to the table with the Civil Defense Siren. FT EcumenopolisUsed a base picture of the moon Titan, and made the changes to make it look like a planet-wide city. (Scroll to bottom of link for picture of planet) Redlandia is perhaps the most left it's ever been, although I'm not saying it's a leftist region now. But if we've done all of the aforementioned, if members of our administration recently participated in a raid of Farkasfalka, and if we're actively criticizing fascism and Holocaust denial on our own RMB, then why are we still in CDS's list with a myriad of regions that have criticized our region including the founder and the commandant themselves? Why is it that when our members go into off-site platforms for different regions, they are removed from those platforms for being "fascist"? Honestly? I think think it's because the program has more to do with posturing then actually fighting fascism. There's a lot of people in the antifa movement because it's a way to gain some kind of moral legitimacy. In other words, it doesn't matter if you are actually fascist or not, only if they can make the label stick. Are you saying that people who have been fighting for 15 years are doing it for extra street cred? Please clarify. Anyways a good showing from Redlandia. However I strongly advise you stop your association with your founder. I understand that he created that website and stuff, but he's the one that got embassies with NE and CCD and stuff. Also I'm extremely pleased you've raided FF, they are absolutely disgusting Not really entirely convinced but hopefully y'all are improving, even if by your description I still wouldn't personally associate. Best of luck! And yeah, Farkas is horrific. Good job. (Osiris, Malphe II, Citizen, Member of Community and Gameside Affairs)(The North Pacific, Malphe, Gameside Advocate | North Pacific Army General | Deputy Minister) Pinky and the Brain's moderately more successful cousin-- and apparently Rach's adopted son. Malphe is inspired - DarcaniaUr a thot malphe - SalvarityMalphe you could never disappoint - KyorgiaMalphe is a snitch - KyrusiaWe already knew you were scum Malphe - BadgerMalphe region exists! I'm not the only narcissist with a self titled region! - VandoosaThat darn Malphe guy is a real menace - ImkiI’m up for watching you get DOS’d, Malphe - Arkheard this nasty rumor that malphe was a udl plant - MallMalphe you disgust me - Jamiei want to be haunted by the gay ghost of malphe - Rach Aclion wrote:Honestly? I think think it's because the program has more to do with posturing then actually fighting fascism. There's a lot of people in the antifa movement because it's a way to gain some kind of moral legitimacy. In other words, it doesn't matter if you are actually fascist or not, only if they can make the label stick. Are you saying that people who have been fighting for 15 years are doing it for extra street cred? Please clarify. I'm saying that being in antifa is a group of illiberals with questionable OOC history who try to redeem themselves by appearing to fight against another group of illiberals with questionable OOC history. A free society rests on four boxes: The soap box, the ballot box, the jury box, and the ammo box. Cossack Khanate wrote:This shall forever be known as World War Sh*t: Newark Aggression. Now if I see one more troop deployed, I will call on the force of all the Hindu gods to reverse time and wipe your race of the face of the planet. Cease. The Black Party wrote:(TBP kamikaze's into all 99999999999 nukes before they hit our territory because we just have that many pilots ready to die for dah blak regime, we also counter-attack into your nation with our entire population of 45 million because this RP allows it.) El-Amin Caliphate wrote:Galatic Liberal Democracy short-circuits all of NS with FACTS and LOGIC You from yesterday:"The Reich, having received conflicting reports from various sources on Redlandia's political status, including one from Civil Defence Siren suggesting that the region remains a bastion of Nazism and Fascism, has decided to close our quiet embassy." The Black Party wrote:Neither is Farkasfalka but that doesn't stop people from spreading lies, does it? "Don't call me fascist without evidence, but I can call you fascists without evidence!" Kustonia: "No, I wouldn't actually. I would ban you for saying everyone is equal, deserves equal rights, and for advocating marriage equality, not for saying the government shouldn't allow discrimination based on sexual orientation." The Black Party wrote:Neither is Farkasfalka but that doesn't stop people from spreading lies, does it? "Don't call me fascist without evidence, but I can call you fascists without evidence!" Kustonia: "No, I wouldn't actually. I would ban you for saying everyone is equal, deserves equal rights, and for advocating marriage equality, not for saying the government shouldn't allow discrimination based on sexual orientation." Nobody in Redlandia, not even the previous founder, believes this. And it's my fault you don't believe this? Can I also assume it is your fault I don't believe the OP? LGBT Londontown wrote:Kustonia: "No, I wouldn't actually. I would ban you for saying everyone is equal, deserves equal rights, and for advocating marriage equality, not for saying the government shouldn't allow discrimination based on sexual orientation." Nobody in Redlandia, not even the previous founder, believes this. And it's my fault you don't believe this? Can I also assume it is your fault I don't believe the OP? As I told one of the members of your cabinet, I was fully aware that not all members of Farkasfalka held Kustonia's views. However, your region is virtually silent when Kustonia speaks, and it's pretty saddening that we have to criticize him for you. "A creative man is motivated by the desire to achieve, not by the desire to beat others."- Ayn Rand The Black Party wrote:And it's my fault you don't believe this? Can I also assume it is your fault I don't believe the OP? As I told one of the members of your cabinet, I was fully aware that not all members of Farkasfalka held Kustonia's views. However, your region is virtually silent when Kustonia speaks, and it's pretty saddening that we have to criticize him for you.
Mark Navin Senior Producer, WBUR Mark has been a part of the WBUR team for some 20 years now, serving the station in a variety of different roles. He got his start as a producer on WBUR’s Weekend Edition, and went on to fill such diverse roles as Director of Production, Morning Edition Senior Producer, and Executive Producer for News. Mark is currently the executive producer of Radio Boston. As Senior Producer of Here & Now for five years, Mark transformed the show from a regional program to a national one, and built audience and station carriage numbers while assembling a staff of talented and dedicated radio producers, editors and hosts. Over the last couple of years, Mark has worked on special projects and political coverage, most recently helping to coordinate WBUR’s coverage of the Democratic National Convention in Denver, and the Republican National Convention in St. Paul. Layoffs at Boston Medical Center have exposed a major budget crisis there. The hospital — the city’s leading health care facility for needy populations — will eliminate 119 jobs and is projected to lose $175 million this year. Boston’s firefighters union is now saying it will freeze a proposed 2.5 percent end-of-contract pay increase for one year — an offer that’s being called a major concession in the effort to negotiate a controversial new contract. We hear the latest.
Tuesday, October 19, 1999 Published at 14:08 GMT 15:08 UKWorld: EuropeLithuania in political crisisThe crisis was sparked by a disagreement over the oil industryTwo government ministers in the former Soviet republic of Lithuania have resigned following disagreement over what to do with its oil sector. Finance Minister Jonas Lionginas and the Minister for Economy Eugenijus Maldeikis submitted their resignations when the cabinet approved the sale of the country's oil complex to an American corporation, Williams International. The Prime Minister, Rolandas Paksas, is also opposed to the sale of a 66% stake in the state-owned Mazeikiai Oil, a deal two years in the making. Mazeikiai Oil is a cornerstone of the Lithuanian economy The two ministers had supported Mr Paksas, who said on Monday he would not sign the investment agreements with Williams, which would give the Americans operational control over Lithuania's only oil refinery, oil pipeline and oil export terminal. The prime minister said the US company had been pressing Lithuania to accept liabilities which were too large and which could put the country's economy in danger. Mr Paksas said the country was already struggling with a national budget deficit. Mazeikiai Oil is a cornerstone of the Lithuanian economy, and backers of the deal had hoped the American investment would revitalise the loss-making complex. Decision unpopular Speaker of the Parliament, Vytautas Landsbergis, and President Valdas Adamkus strongly backed the deal. Lithuania's parliament is divided over the sale Mr Landsbergis, a Conservative, cut short a trip to France and returned home as soon as he learned of the prime minister's decision. They were determined to have the agreement with Williams signed by the set deadline of 29 October. The company is located in the city of Mazeikiai, some 300 kilometres (185 miles) northwest of Vilnius, the Lithuanian capital. Reuters reported that the country's share index dropped 3% in the wake of the resignations.
Effects of chemically and electrochemically dosed chlorine on Escherichia coli and Legionella beliardensis assessed by flow cytometry. The present study reports the disinfection effects of chemically and electrochemically dosed chlorine on two models for typical water-borne bacteria (Escherichia coli and Legionella beliardensis) by plating and flow cytometry (FCM) in combination with different fluorescence dyes. The residual effect on various cell functions, including cultivability, esterase activity, membrane polarization, and integrity, was tested at different free chlorine concentrations. In comparison, chemical disinfection yielded on average 60% more E. coli cells entering the viable but nonculturable (VBNC) state than electrochemical disinfection. Here, VBNC is defined as those cells with intact cell membrane but which cannot be cultured on solid nutrient agar plates. L. beliardensis was about five times more resistant to chlorine disinfection than E. coli. The results also suggested the two methods result in different disinfection mechanisms on L. beliardensis, i.e., chemically dosed chlorine targeted cell membrane integrity before enzyme activity, while electrochemically dosed chlorine acted the other way round. In addition, both bacteria lost the integrity of their cell membranes at three times lower chlorine concentration over a longer contact time (i.e., 40 vs. 10 min) by the chemical method. Our results showed that FCM is an appropriate tool to evaluate the effects of water disinfection and the percentage of cells in VBNC in a matter of hours. Electrochemical disinfection is suggested to be a favorable alternative for chemical disinfection.
UNPUBLISHED UNITED STATES COURT OF APPEALS FOR THE FOURTH CIRCUIT No. 17-4502 UNITED STATES OF AMERICA, Plaintiff - Appellee, v. TRAVIS DONALD FENDER, Defendant - Appellant. Appeal from the United States District Court for the District of South Carolina, at Charleston. David C. Norton, District Judge. (2:14-cr-00642-DCN-1) Submitted: January 25, 2018 Decided: February 8, 2018 Before GREGORY, Chief Judge, and NIEMEYER and TRAXLER, Circuit Judges. Affirmed by unpublished per curiam opinion. Emily Deck Harrill, Assistant Federal Public Defender, OFFICE OF THE FEDERAL PUBLIC DEFENDER, Columbia, South Carolina, for Appellant. Beth Drake, United States Attorney, Nathan Williams, Assistant United States Attorney, OFFICE OF THE UNITED STATES ATTORNEY, Charleston, South Carolina, for Appellee. Unpublished opinions are not binding precedent in this circuit. PER CURIAM: Travis Fender pled guilty, pursuant to a written plea agreement, to two firearms offenses: possession and discharge of a firearm in furtherance of a drug trafficking offense, 18 U.S.C. § 924(c) (2012) (Count 2); and possession of a firearm and ammunition by a felon, 18 U.S.C. § 922(g) (2012) (Count 3). At sentencing, and over Fender’s objection, the district court applied the robbery cross-reference, U.S. Sentencing Guidelines Manual (2016) § 2B3.1 (“USSG”), resulting in a base offense level of 25. After a three-level reduction for acceptance of responsibility, Fender’s total offense level was 22. With a criminal history category of III, Fender’s applicable advisory Guidelines range was 51 to 63 months for Count 3, to run consecutive to a mandatory term of 10 years as to Count 2 (18 U.S.C. § 924(c)(1)(A)(iii) (2012)). The court imposed a total term of 171 months’ imprisonment: 120 months as to Count 2 and 51 months as to Count 3. Fender appeals, raising two arguments challenging the procedural reasonableness of his sentence. Finding no error, we affirm. Fender first argues that the district court erred in applying the robbery cross- reference, USSG § 2B3.1 (with a base offense level of 20), in calculating his base offense level because the evidence failed to support a finding that he robbed the victims. Although Fender concedes that he shot and injured the two victims, he argues that the court should have applied the aggravated assault cross-reference, USSG § 2A2.2 (with a base offense level of 14). We review a sentence, “whether inside, just outside, or significantly outside the Guidelines range[,] under a deferential abuse-of-discretion standard.” Gall v. United 2 States, 552 U.S. 38, 41 (2007). This review requires consideration of both the procedural and substantive reasonableness of the sentence. Id. at 51. In determining procedural reasonableness, this court considers whether the district court properly calculated the defendant’s advisory Guidelines range, gave the parties an opportunity to argue for an appropriate sentence, considered the 18 U.S.C. § 3553(a) (2012) sentencing factors, selected a sentence based on clearly erroneous facts, or failed to explain sufficiently the selected sentence. Id. at 49-51. We review the factual findings underlying the district court’s application of a Guidelines cross-reference for clear error. United States v. Ashford, 718 F.3d 377, 380, 384 (4th Cir. 2013). “In the event of a conviction for illegal possession of a firearm, USSG § 2K2.1(c) authorizes a district court to substitute the offense level for any criminal offense that the defendant committed or attempted to commit in connection with the possession of the firearm.” Id. at 381. Our review of the record reveals that the district court did not clearly err in concluding that Fender robbed the victims. Although there was conflicting testimony regarding the details of the shooting, Fender’s challenges to the district court’s credibility determinations are not subject to review. See United States v. Saunders, 886 F.2d 56, 60 (4th Cir. 1989). Second, Fender asserts that the district court failed to adequately explain the chosen sentence. The district court “must make an individualized assessment based on the facts presented when imposing a sentence, apply[ing] the relevant [18 U.S.C.] § 3553(a) factors to the specific circumstances of the case and the defendant, and must 3 state in open court the particular reasons supporting its chosen sentence.” United States v. Lymas, 781 F.3d 106, 113 (4th Cir. 2015) (citation and internal quotation marks omitted). “When imposing a sentence within the Guidelines, however, the explanation need not be elaborate or lengthy.” United States v. Hernandez, 603 F.3d 267, 271 (4th Cir. 2010) (citations and internal quotation marks omitted). We find that the district court satisfied these requirements and adequately explained the within-Guidelines sentence imposed. Accordingly, we affirm Fender’s sentence. We dispense with oral argument because the facts and legal contentions are adequately presented in the materials before this court and argument would not aid the decisional process. AFFIRMED 4
Rapamycin and mTOR-independent autophagy inducers ameliorate toxicity of polyglutamine-expanded huntingtin and related proteinopathies. The formation of intra-neuronal mutant protein aggregates is a characteristic of several human neurodegenerative disorders, like Alzheimer's disease, Parkinson's disease (PD) and polyglutamine disorders, including Huntington's disease (HD). Autophagy is a major clearance pathway for the removal of mutant huntingtin associated with HD, and many other disease-causing, cytoplasmic, aggregate-prone proteins. Autophagy is negatively regulated by the mammalian target of rapamycin (mTOR) and can be induced in all mammalian cell types by the mTOR inhibitor rapamycin. It can also be induced by a recently described cyclical mTOR-independent pathway, which has multiple drug targets, involving links between Ca(2+)-calpain-G(salpha) and cAMP-Epac-PLC-epsilon-IP(3) signalling. Both pathways enhance the clearance of mutant huntingtin fragments and attenuate polyglutamine toxicity in cell and animal models. The protective effects of rapamycin in vivo are autophagy-dependent. In Drosophila models of various diseases, the benefits of rapamycin are lost when the expression of different autophagy genes is reduced, implicating that its effects are not mediated by autophagy-independent processes (like mild translation suppression). Also, the mTOR-independent autophagy enhancers have no effects on mutant protein clearance in autophagy-deficient cells. In this review, we describe various drugs and pathways inducing autophagy, which may be potential therapeutic approaches for HD and related conditions.
This article describes the integration between SPSS and Cognos solutions. The integration with Cognos comes in the form of being able to directly connect to Cognos as a data source for SPSS modeler and also being able to export the results to Cognos directly to allow Cognos to report on the results. The benefits of using Cognos as a source is that your data is all in one place and its formatted and tidied up suitable for SPSS analytics. Exporting the results to Cognos has the benefit of being able to report on the results using the familiar. Cognos reporting formats and various different types of Cognos reports, such as dashboards and active reports. Below figure showcases one such context diagram and its integration with SPSS: To implement this is reasonably straight forward and involves selecting the Cognos source node or the Cognos export node and dragging it into your stream as shown below: You then have to edit the Cognos node and add the Cognos server IP address details and login credentials. As shown on Figure below – You also need to make an ODBC connection to the Cognos Data warehouse from the SPSS server. This needs to have the same name and details as the Cognos data source. If these details do not match on the Cognos and the SPSS server the integration will not work. Below figure shows the details: The benefits of using Cognos as a source is that your data is all in one place and its formatted and tidied up suitable for SPSS analytics. Exporting the results to Cognos has the benefit of being able to report on the results using the familiar reporting format and various different types of Cognos reports that the company uses. Note: To either export to Cognos or use Cognos as a data source an ODBC connection to the Cognos data warehouse must be established as well as the Cognos Server connection. Summary: In this way, we can integrate IBM Cognos BI with IBM SPSS product and get reporting data from prediction and analysis from SPSS.
The demand for weight reduction in the automotive industry has led to the development and implementation of lightweight materials or components, and related manufacturing processes and tools. The demand for weight reduction is especially driven by the goal of reduction of CO2 emissions. The growing concern for occupant safety also leads to the adoption of materials which improve the integrity of the vehicle during a crash while also improving the energy absorption. A process known as Hot Forming Die Quenching (HFDQ) uses boron steel sheets to create stamped components with Ultra High Strength Steel (UHSS) properties, with tensile strengths of e.g. 1.500 MPa or 2000 MPa or even more. The increase in strength allows for a thinner gauge material to be used, which results in weight savings over conventionally cold stamped mild steel components. There are several known Ultra High Strength steels (UHSS) for hot stamping and hardening. The blank may be made e.g. of a boron steel, coated or uncoated, such as Usibor® (22MnB5) commercially available from ArcelorMittal. Typical vehicle components that may be manufactured using the HFDQ process include: door beams, bumper beams, cross/side members, NB pillar reinforcements, and waist rail reinforcements. Hot forming of boron steels is becoming increasingly popular in the automotive industry due to their excellent strength and formability. Many structural components that were traditionally cold formed from mild steel are thus being replaced with hot formed equivalents that offer a significant increase in strength. This allows for reductions in material thickness (and thus weight) while maintaining the same strength. However, hot formed components offer very low levels of ductility and energy absorption in the as-formed condition. In order to improve the ductility and energy absorption in specific areas of a component, it is known to introduce softer regions within the same component. This improves ductility locally while maintaining the required high strength overall. By locally tailoring the microstructure and mechanical properties of certain structural components such that they comprise regions with very high strength (very hard) and regions with increased ductility (softer), it may be possible to improve their overall energy absorption and maintain their structural integrity during a crash situation and also reduce their overall weight. Such soft zones may also advantageously change the kinematic behaviour in case of a collapse of a component under an impact. Known methods of creating regions with increased ductility (“softzones” or “soft zones”) in vehicle structural components involve the provision of tools comprising a pair of complementary upper and lower die units, each of the units having separate die elements (steel blocks). A blank to be hot formed is previously heated to a predetermined temperature e.g. austenization temperature or higher by, for example, a furnace system so as to decrease the strength i.e. to facilitate the hot stamping process. The die elements may be designed to work at different temperatures, in order to have different cooling rates in different zones of the part being formed during the quenching process, and thereby resulting in different material properties in the final product e.g. soft areas. E.g. one die element may be cooled in order to quench the corresponding area of the component being manufactured at high cooling rates and by reducing the temperature of the component rapidly. Another neighbouring die element may be heated in order to ensure that the corresponding portion of the component being manufactured cools down at a lower cooling rate, and thus remaining at higher temperatures than the rest of the component when it leaves the die. The use of multistep press systems for manufacturing hot formed elements is known. The multistep press systems may comprise a plurality of tools configured to perform different operations on blanks simultaneously. With such arrangements, a plurality of blanks undergo different manufacturing processes simultaneously during one stroke using the tools forming the multistep press systems, thus the performance of the system may be increased. A multistep press system may include a conveyor or a transferring device which transfers the heated blank to a press tool which is configured to press the blank. Additionally, a furnace system that heats and softens the blank to be hot formed may be provided upstream from the multistep press machine. Furthermore, a separate laser process step or a separate cutting tool may also be provided, wherein the stamped blanks are discharged from the press system and are transferred and located into the laser process step or in the separate cutting tool in order to be manufactured e.g. cut and/or trimmed and/or pierced and/or punched. Generally, in such systems, an external pre-cooling tool is used in order to previously cool down the blank to be hot formed. Once the blank is cooled down, it is transferred from the external pre-cooling tool to the multistep press apparatus or system. WO2011115539 describes a contact-cooling press provided between a furnace and a press-hardening press. Preselected parts of a blank (18) are contact-cooled such that corresponding parts of the finished product are softer and display a higher yield point. The present disclosure seeks to provide improvements in multistep systems configured to create soft zones and methods.
Introduction {#S1} ============ Preeclampsia is a special type of hypertensive disorders complicating pregnancy (HDCP) which is characterized by hypertension, proteinuria, hematological complications, and uteroplacental dysfunction ([@B26]). The fetal development is also significantly influenced by the pathogenesis of PE, such as amniotic fluid reduction, oxygenation defect, and growth restriction ([@B8]). During the pathogenesis of PE, the dysfunction in maternal vascular system and the abnormal activation of maternal-fetal immune system are proved to be the two main factors ([@B14]). The worldwide prevalence of PE in all pregnant women is from 3 to 8% and nearly 18% maternal deaths are caused by PE based on its high maternal morbidity and mortality ([@B4]). The primary prevention of PE is mainly performed through the treatment of aspirin, vitamin D, and low-dose calcium ([@B11]). The termination of pregnancy or fetus delivery is thought to be the only definitive treatment for PE ([@B27]). Although there has been great progress in the study of PE, the prediction and prevention of PE development is still a big challenge. PE is proved to be an anti-angiogenic state. Soluble fms-like tyrosine kinase 1 (sFLT-1) is a shorter form of FLT-1 which lacks the intra-cytoplasmic and transmembrane domain and thus can circulates freely in maternal circulation ([@B23]). The ability of binding with vascular endothelial growth factor (VEGF) and placental growth factor (PlGF) makes sFLT-1 to be the decoy receptor of these two factors in the maternal circulation ([@B21]). The sFLT1:PlGF ratio is proved to fluctuate during the normal pregnant. sFLT1 stays at a stable level till week 29--30 and then increases to a peak at week 40 ([@B20]). Meanwhile, The sFLT1:PlGF ratio decreases in week 9--12, stays at a low level from week 19--20 to 37--38, and then increases in week 39--40 ([@B20]). The tightly regulated sFLT1:PlGF ratio during pregnant is crucial for both placenta and fetal development. The elevated sFLT-1 level is observed in patients with PE ([@B15]). The pathogenesis of PE triggers the increasing of sFLT1 level in maternal circulation ([@B12]). The up-regulated sFLT-1 level in the maternal circulation decrease the levels of VEGF and PlGF and generates the endothelial dysfunction ([@B16]). It has been reported that sFLT-1 expression is up-regulated in the placenta and generated by villous and extravillous trophoblasts ([@B2]). Therefore, the overexpressed sFLT1 in placenta is considered to be a potential therapeutic target for PE. How to achieve efficient intervention of sFLT1 expression in the placenta is an urgent problem to be solved. In recent, it has been proved that the systemically delivered sFLT1 siRNAs which are cholesterol conjugated and full chemical stabilized can accumulate in placentas, inhibit the expression of sFLT1, and alleviate proteinuria and hypertension ([@B25]). Chondroitin sulfate A (CSA) is a protein which is proved to exist on the surface of placental syncytiotrophoblasts and P-CSA-BP is effective for targeting lipid-polymer nanoparticle to the placenta ([@B31]). This research indicates that sFLT1-siRNA-based PE therapy is a hopeful therapeutic strategy. The discovery of P-CSA-BP makes it possible to develop a placenta-specific sFLT1-siRNA delivery method, which is thought to be a great progression in the improvement of sFLT1-siRNA-based PE therapeutic strategy. In this research, we built up P-CSA-BP-conjugated nanoparticles loaded with sFLT1 siRNA to generate a new placenta-specific siRNA delivery method. We aimed to illustrate the effects of this method in placenta targeting and silencing of sFLT1 and analyze the toxic effect. Materials and Methods {#S2} ===================== Animals {#S2.SS1} ------- Pregnant CD1 mice were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Mice were caged in pathogen-free animal room with 12 h light/12 h dark cycle. The gestation of mice was determined by checking vaginal plugs formation (E0.5 = vaginal plug day). At 14 and 15 days of gestation, the mice were treated by siRNA, NP~siRNA~, or T-NP~siRNA~ through intravenous injection in the tail vein at the siRNA dosage of 2 mg/kg. The accumulation of Cy5-labeled si*sFLT1* in mice placenta was observed through *ex vivo* images. Placenta tissue samples and blood samples were collected for further investigation. The procedures of animal experiments in this research were approved by the Shandong Provincial Hospital Affiliated to Shandong University. Cell Culture {#S2.SS2} ------------ HTR-8/SVneo cell lines were obtained from the American Type Culture Collection (ATCC, VA, United States). RPMI-1640 medium (Gibco, New York, United States) with 10% fetal bovine serum (FBS) (Gibco) and 1% penicillin/streptomycin (Sigma, St. Louis, United States) was applied for the cell culture under the standard conditions. Preparation and Characterization of Nanoparticles {#S2.SS3} ------------------------------------------------- Lipid-polymer nanoparticles loaded with sFLT1 siRNAs (NP~si*sFLT1*~) were synthesized from carboxyl-polyethylene glycol-poly(D,L-lactide) (COOH-PEG~5K~-PLA~8K~), cationic lipid DOTAP (N-\[1-(2,3-dioleoyloxy)propyl\]-N,N,N-trimeth ylammonium chloride), and sFLT1 siRNAs using double emulsion method which was previously published in other research ([@B28]). Synthetic placental CSA-binding peptides (P-CSA-BP) were conjugated to NP~si*sFLT1*~ to generate the trophoblast-targeted nanoparticles (T-NP~si*sFLT1*~) based on the method from other study ([@B31]). Size distribution and zeta potential of nanoparticles were measured through dynamic light scattering (DLS) in triplicate with the help of Zetasizer Nano ZS (Malvern, United Kingdom). The morphology of nanoparticles was visualized through transmission electron microscopy (TEM) (JEOL-2010 microscopy, Tokyo, Japan). The colloidal stability was investigated by incubating in phosphate buffered saline (PBS) with 10% fetal bovine serum (FBS) and analyzing the size of nanoparticles. Gel Retardation Assay {#S2.SS4} --------------------- The integrity of nanoparticles after 7 days' incubation in PBS with 10% BSA was investigated by gel retardation assay. Naked siRNA was used as a control. Samples were mixed with gel loading buffer containing 1% SDS and separated by 2% agarose gel electrophoresis. The samples in gel were observed by ethidium bromide staining. Immunohistochemistry {#S2.SS5} -------------------- Immunohistochemistry was employed to evaluate CSA expression in placenta tissues. After being deparaffinized and rehydrated, slides were treated by antigen retrieval buffer. Then the tissue sections were incubated with BSA for 1 h at room temperature. Then the sections were incubated with mouse monoclonal anti-chondroitin sulfate antibody (Abcam, Cambridge, United Kingdom) or control IgG (Abcam) at 4°C overnight. After being washed, the sections were incubated with HRP-donkey anti-mouse IgG (ThermoFisher, Waltham, United States). The sections were observed under a light microscope. Immunofluorescence {#S2.SS6} ------------------ Cells were fixed by 4% paraformaldehyde for 30 min at room temperature and permeabilized by 0.05% Triton X-100 for 10 min. After being blocked by 5% BSA for 1 h at room temperature, cells were incubated with anti-chondroitin sulfate antibody (Abcam) at 4°C overnight. After being washed by PBS for three times, the cells were incubated with anti-mouse IgG FITC antibody (Abcam) for 1 h at room temperature. Cell nucleus were stained with DAPI. Cells were observed by confocal microscope. Flow Cytometry {#S2.SS7} -------------- 5 × 10^4^ HTR-8/SVneo cells were planted in each well of a 24-well plate. After 24 h, cells were incubated with free Cy5 labeled siRNA (Cy5-siRNA), NP~Cy5--siRNA~, or T-NP~Cy5--siRNA~ (100 nM) for 4 h. After incubation, cells were collected and analyzed by FACSCalibur (BD Biosciences, Bedford, United States). Mean fluorescence intensity of Cy5 was calculated by FlowJo 7.6.1 software. ELISA {#S2.SS8} ----- fms-like tyrosine kinase 1 protein levels in cell medium or serum were evaluated by ELISA kit (R&D Systems, Minneapolis, United States) based on the manufacturer's instructions. Experiments were done in duplicate, and the protein levels were calculated using a standard curve. The activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum of mice were analyzed by colorimetric assay kits (Sigma, St. Louis, United States) based on the manufacturer's instructions. Real-Time PCR {#S2.SS9} ------------- Trizol reagent (Invitrogen, Waltham, MA, United States) was used for the extraction of total RNA. First Strand cDNA Synthesis Kit (Sigma, St. Louis, MO, United States) was employed to synthesis cDNA from relative RNA. Real-time PCR was executed by SYBR Green Real-Time PCR Master Mixes (ThermoFisher, Waltham, MA, United States) following manufacturer's instruction. β-actin and GAPDH were employed as internal control. All the primers were shown here: 1. Human sFLT-1 F: GAAATGGTGAGTAAGGAAAGC 2. Human sFLT-1 R: TACTGTCCCAGATTATGCGTTT 3. Human β-actin F: CTGGTGCCTGGGGCG 4. Human β-actin R: AGCCTCGCCTTTGCCG 5. Mouse sFlt-1 F: CGACTCACTATAGGGAGACCC 6. Mouse sFlt-1 R: TGGCCTGCTTGCATGATGTGCTGG 7. Mouse GAPDH F: GTGGCAAAGTGGAGATTGTTGCC 8. Mouse GAPDH R: GATGATGACCCGTTTGGCTCC High-Performance Liquid Chromatography (HPLC) {#S2.SS10} --------------------------------------------- High-performance liquid chromatography was employed to evaluate the amount of si*sFLT1* accumulated in different tissues. Tissues were harvested 1 day after injection. The performance of HPLC was based on the standard method ([@B31]). One day after injection, relative tissues were collected and homogenized in PBS. 10% perchloric acid was added into the mixture and vortexed for 3 min. After being centrifuged at 14,000 × *g* for 20 min, supernatants were collected and filtered (0.45 μm). Mobile phase was composed of 40 mM potassium phosphate dibasic and acetonitrile. Flow rate was 1.0 mL/min. Ultraviolet absorbance at 313 nm was detected. Statistical Analysis {#S2.SS11} -------------------- Statistical analysis was performed by GraphPad PRISM 6.0 software. Data were presented as mean ± SD. Student's *t*-test, one or two-way ANOVA analysis with a *post hoc* test were used to calculate the differences. Statistical analysis was significant when *P* value \< 0.05. Results {#S3} ======= The Preparation and Characterization of Trophoblast-Targeted sFLT1 siRNA-Encapsulated Nanoparticles {#S3.SS1} --------------------------------------------------------------------------------------------------- As shown in [Figure 1A](#F1){ref-type="fig"}, NP~si*sFLT1*~ was constructed from COOH-PEG~5K~-PLA~8K~, DOTAP, and si*sFLT1* through double emulsion method and T-NP~si*sFLT1*~ was fabricated by conjugating P-CSA-BP to the surface of NP~si*sFLT1*~. DLS results shown that the resulted nanoparticles T-NP~si*sFLT1*~ had a relative larger particle size than NP~si*sFLT1*~ ([Figure 1B](#F1){ref-type="fig"}). The conjugation of P-CSA-BP enlarged the size of the nanoparticle. The morphology of these two nanoparticles was checked by TEM and the representative TEM images were shown in [Figure 1C](#F1){ref-type="fig"}. The P-CSA-BP could be observed on the surface of T-NP~si*sFLT1*~. Both of the nanoparticles had slightly positive zeta potentials ([Figure 1D](#F1){ref-type="fig"}). The incubation of siRNA-encapsulated nanoparticles in PBS demonstrated the colloidal stability of these two nanoparticles ([Figure 1E](#F1){ref-type="fig"}). Based on the results of agarose gel retardation assay, no significant siRNA release was observed, indicating that both nanoparticles were successfully protected the encapsulated siRNA ([Figure 1F](#F1){ref-type="fig"}). So, nanoparticles T-NP~si~*~*sFLT*1~* was successfully generated from NP~si~*~*sFLT*1~* and was proved to be stable. ![Preparation of trophoblast-targeted nanoparticles encapsulating sFLT1 siRNA. **(A)** Nanoparticles loaded with sFLT1 siRNA (denoted as NP~si*sFLT1*~) was constructed from COOH-PEG~5K~-PLA~8K~, cationic lipid DOTAP, and sisFLT1 using double emulsion method. Trophoblast-targeted nanoparticles (denoted as T-NP~si*sFLT1*~) was fabricated by conjugating peptides, which could specific bind with CSA on the trophoblasts, to the surface of NP~si*sFLT1*~. **(B)** Size distributions of NP~si*sFLT1*~ and T-NP~si*sFLT1*~ were examined by DLS. **(C)** Representative TEM images of NP~si*sFLT1*~ and T-NP~si*sFLT1*~. Scale bars = 100 nm. **(D)** Zeta potential of nanoparticles examined via DLS. **(E)** Effect of incubation in PBS on the particle size. **(F)** Gel retardation assay for examining the integrity of nanoparticles 7-day post construction.](fbioe-08-00064-g001){#F1} T-NP~siRNA~ Specifically Target Trophoblast Cells *in vitro* {#S3.SS2} ------------------------------------------------------------ Chondroitin sulfate A is a protein which is proved to exist on the surface of placental syncytiotrophoblasts. Through the immunohistochemistry, we proved the expression of CSA in the tissue of mouse placenta ([Figure 2A](#F2){ref-type="fig"}). HTR-8/SVneo cells were human trophoblast cells and the expression of CSA was observed through immunofluorescence ([Figure 2B](#F2){ref-type="fig"}). To investigate the uptake of these two kinds of nanoparticles into HTR-8/SVneo cells, siRNA was labeled with Cy5 and cells were analyzed by flow cytometry after incubating with nanoparticles. Based on the result of flow cytometry, trophoblast cells incubated with T-NP~Cy5--siRNA~ had a significantly higher Cy5 signal intensity than those incubated with NP~Cy5--siRNA~ ([Figures 2C,D](#F2){ref-type="fig"}). Furthermore, the internalized NP~Cy5--siRNA~ and T-NP~Cy5--siRNA~ in HTR-8/SVneo cells were observed by confocal microscopy ([Figure 2E](#F2){ref-type="fig"}). These results indicated that T-NP~siRNA~ had a higher efficiency than NP~siRNA~ in targeting to trophoblast cells *in vitro.* ![T-NP~Cy5--siRNA~ specifically target trophoblast cells *in vitro*. **(A)** The expression of CSA in mouse placenta was examined by immunohistochemistry. Scale bar = 20 μm. **(B)** The expression of CSA on HTR-8/SVneo cells was examined by confocal microscopy. CSA was stained with IgG isotype control antibody or anti-CSA primary antibody and anti-mouse IgG (whole molecule) FITC antibody. Scale bar = 10 μm. **(C)** Flow cytometry analyses of HTR-8/SVneo cells after 4 h incubation with free Cy5 labeled siRNA (Cy5-siRNA), NP~Cy5--siRNA~ and T-NP~Cy5--siRNA~, the siRNA concentration was 100 nM. **(D)** Mean fluorescence intensity of Cy5 in HTR-8/SVneo cells after treated with Cy5-siRNA, NP~Cy5--siRNA~ and T-NP~Cy5--siRNA~. **(E)** Intracellular uptake of Cy5-siRNA, NP~Cy5--siRNA~ and T-NP~Cy5--siRNA~ were examined by confocal microscopy. Cell nuclei were stained with DAPI; the cytoskeleton was stained with Alexa Fluor 488 Phalloidin. Scale bar = 20 μm. Data was shown as mean ± SD. \*\*\**p* \< 0.001.](fbioe-08-00064-g002){#F2} T-NP~sisFLT1~ Inhibit the Expression of sFLT1 *in vitro* {#S3.SS3} -------------------------------------------------------- To demonstrate the function of these two sFLT1 siRNA-encapsulated nanoparticles in the inhibition of sFLT1 expression *in vitro*, HTR-8/SVneo cells were treated with free si~sFLT1~, NP~si*sFLT1*~ or T-NP~si*sFLT1*~ for 48 h. The mRNA levels of sFLT1 in cells were evaluated through RT-PCR and the results were shown in [Figure 3A](#F3){ref-type="fig"}. When compared with cells treated by NP~si*sFLT1*~, those cells treated by T-NP~si*sFLT1*~ shown a significant lower sFLT1 mRNA level and this phenomenon was enhanced by the increasing dosage. The protein level of sFLT1 was evaluated by ELISA and shown the same tendency with mRNA ([Figure 3B](#F3){ref-type="fig"}). The protein levels of sFLT1 in HTR-8/SVneo cells were not altered by the treatment of nanoparticles encapsulating nonsense siRNA (NP~siNC~ and T-NP~siNC~) ([Figure 3C](#F3){ref-type="fig"}). T-NP~si*sFLT1*~ had a higher efficiency than NP~si*sFLT1*~ in the inhibition of sFLT1 expression in trophoblast cells *in vitro.* ![Efficient silencing of sFLT1 by T-NP~si*sFLT1*~ *in vitro*. **(A)** Silencing of sFLT1 by different formulations in a dose-dependent manner. HTR-8/SVneo cells were treated with free si*sFLT1*, NP~si*sFLT1*~ or T-NP~si*sFLT1*~ for 48 h and sFLT1 mRNA levels were examined via RT-PCR. The final concentration of si*sFLT1* was 100 nM or 200 nM in present study. **(B)** sFLT1 protein levels produced by HTR-8/SVneo cells treated with different formulations for 48 h. sFLT1 protein levels were measured by ELISA (*n* = 3). **(C)** sFLT1 protein levels produced by HTR-8/SVneo cells after treated with T-NP encapsulating nonsense siRNA (T-NP~si~*~*NC*~*). Data was shown as mean ± SD. \**p* \< 0.05, \*\**p* \< 0.01, \*\*\**p* \< 0.001. ns. no significant difference.](fbioe-08-00064-g003){#F3} T-NP~sisFLT1~ Selectively Accumulate in Placenta and Downregulate sFLT1 Expression in Mice {#S3.SS4} ------------------------------------------------------------------------------------------ The function of T-NP~si*sFLT1*~ was further checked in mouse model. Experimental design for testing accumulation ability of T-NP~Cy5--siRNA~ in pregnant CD1 mice was shown in [Figure 4A](#F4){ref-type="fig"}. To illustrate the accumulation of the nanoparticles, pregnant CD1 mice were intravenously injected with NP~Cy5--siRNA~ and T-NP~Cy5--siRNA~. Based on the *ex vivo* examination, the localization of T-NP~Cy5--siRNA~ in placenta was much higher than NP~Cy5--siRNA~ ([Figure 4B](#F4){ref-type="fig"}). HPLC was employed to quantitatively compare the accumulation of the nanoparticles in different organs. As shown in [Figure 4C](#F4){ref-type="fig"}, the amount of Cy5-siRNA in the placenta of mice treated by T-NP~Cy5--siRNA~ was significantly higher than in the placenta of mice treated by NP~Cy5--siRNA~. But the distribution of Cy5-siRNA shown no significant differences in other organs. So, P-CSA-BP on the surface of T-NP~si~*~*sFLT*1~* enhanced the nanoparticle's specific accumulation ability in mice placenta. Experimental design for testing silencing ability of T-NP~si*sFLT1*~ in pregnant CD1 mice was shown in [Figure 4D](#F4){ref-type="fig"}. We examined the mRNA levels of sFLT1 in the placenta of mice treated by different nanoparticles through RT-PCR. When compared with NP~si*sFLT1*~, the treatment of T-NP~si*sFLT1*~ significantly decreased the mRNA level of sFLT1 in the placenta of mice ([Figure 4E](#F4){ref-type="fig"}). Circulating sFLT1 levels in mice were evaluated by ELISA and shown the same tendency ([Figure 4F](#F4){ref-type="fig"}). So, P-CSA-BP on the surface of T-NPsisFLT1 also enhanced the nanoparticle's sFLT1 silencing ability in mice placenta. It was proved that T-NP~si*sFLT1*~ had a higher efficiency than NP~si*sFLT1*~ in accumulation in the placenta of mice and silencing sFLT1. ![T-NP~si*sFLT1*~ selectively accumulate in placenta and downregulate sFLT1 expression. **(A)** Experimental design for *in vivo* testing of T-NP~siRNA~ accumulation in pregnant CD1 mice. Pregnant CD1 mice treated with T-NP encapsulating Cy5-labeled si*sFLT1* at 14 days of gestation, and the injection dosage of Cy5-si*sFLT1* was 2 mg/kg. The biodistribution of T-NP~Cy5--siRNA~ was qualitatively and quantitively detected 1 day later. **(B)** *Ex vivo* images of placenta in the pregnant mice after Cy5-labled siRNA injection at 15 days of gestation. **(C)** Amount of Cy5 accumulated in indicated tissues 1 day after injection using HPLC. **(D)** Experimental design for *in vivo* silencing of sFLT1 via NP~si*sFLT1*~. Pregnant CD1 mice were intravenously injected with 2 mg/kg of si*sFLT1* on pregnancy days 14 and 15 days of gestation, and killed for examination on allowed to deliver pups on 19 days of gestation or allowed to delivery. Blood was collected on the indicated days. **(E)** sFLT1 mRNA expression in placenta on 19 days of gestation examined via RT-PCR (*n* = 8 biologically independent animals). **(F)** Circulating sFLT1 levels from mice injected with free si*sFLT1*, NP~si*sFLT1*~ or T-NP~si*sFLT1*~ measured by ELISA (*n* = 8 biologically independent animals). Data was shown as mean ± SD. \**p* \< 0.05, \*\**p* \< 0.01, \*\*\**p* \< 0.001.](fbioe-08-00064-g004){#F4} Conjugating P-CSA-BP to the Surface of NP~sisFLT1~ Does Not Enhance the Toxic Effect {#S3.SS5} ------------------------------------------------------------------------------------ We further investigated whether conjugating P-CSA-BP to the surface of NP~si~*~*sFLT*1~* enhanced the nanoparticle's toxic effect in mice. The changes of ALT and AST were widely used for illustrating the severity of the toxic effect on liver. The levels of the maternal liver transaminases ALT and AST in mice was analyzed after treatment. The normal ALT and AST levels indicated that the treatment of NP~si*sFLT1*~ or T-NP~si*sFLT1*~ had no obvious adverse effects ([Figures 5A,B](#F5){ref-type="fig"}). We also checked the influence of these nanoparticles on the fetus. Both newborn pup number and weight were not influenced by the treatment of NP~si*sFLT1*~ or T-NP~si*sFLT1*~ ([Figures 5C,D](#F5){ref-type="fig"}). Both of these two nanoparticles had low maternal and fetal toxic effect. Thus, conjugating P-CSA-BP to the surface of NPsisFLT1 did not enhance the nanoparticle's toxic effect in mice. ![Toxic effect analysis of T-NP~si*sFLT1*~. Enzyme activities of ALT **(A)** and AST **(B)** at day 19 of gestation in mice injected with free si*sFLT1*, NP~si*sFLT1*~ or T-NP~si*sFLT1*~ (*n* = 8 biologically independent animals). Newborn pup number **(C)** and weights **(D)** from mice injected with free si*sFLT1*, NP~si*sFLT1*~ or T-NP~si*sFLT1*~ (*n* = 8 biologically independent animals). ns. no significant difference.](fbioe-08-00064-g005){#F5} Discussion {#S4} ========== Based on previous research, the pathogenesis of PE can be divided into two different stages ([@B22]). The first stage is asymptomatic, but abnormal placenta formation and accumulation of placenta released factors in maternal circulation can be observed. The symptomatic second stage is characterized by placental oxidative stress, hypertension and proteinuria, that eventually result in angiospasm in brain which caused eclampsia ([@B13]). Since the molecular mechanism during the pathogenesis of PE is not fully understand, PE still lacks reliable method for prediction and diagnosis and effective therapeutic strategy ([@B3]). Untreated PE is life threatening and will develops into eclampsia with several severe complications ([@B5]). Till now, the only effective therapy for PE is the early delivery of the pregnancy. In recent years, the pathogenesis of PE is proved to have a strong correlation with the factors generated and released from placenta ([@B15]). Several different researches have demonstrated the abnormal increased level of anti-angiogenic molecule sFLT-1 in the circulation of women with PE ([@B10]; [@B18]). The accumulation of sFLT-1 has a strong correlation with the generation of hypertension through its function in antagonizing VEGF and PlGF ([@B9]). The sFLT-1/PlGF ratio is reported to be useful for the diagnosis and prognosis assessment of PE ([@B12]). sFLT-1 is also considered as a potential PE therapeutic target. [@B24], have proved that apheresis therapy is efficient in removing sFLT-1 in the circulation of women with PE and extends the pregnancies with no obvious adverse effects on both mother and fetus. [@B6], demonstrated that metformin inhibits the production of sFLT-1 in villous trophoblast and prevents the pathogenesis of PE. In both mouse and baboon PE model, systemically delivered modified sFLT1 siRNAs accumulate in placentas, inhibit sFLT1 expression, and alleviate hypertension and proteinuria ([@B25]). RNAi-based placental sFLT1 expression modulation is proved to be a novel therapeutic approach for PE. However, several limitations still exist in the development of this therapeutic strategy, such as siRNA degradation and difficulty in crossing cell membrane ([@B17]). Nanoparticles can act as delivery system and have several benefits, including enhanced permeability, retention effect, and extravasation ability and are widely used in the therapy of cancer and other disease ([@B7]). The transfer ability of nanoparticles to different organs is critical for the therapy. It is reported that molecular shape, surface modification, and particle size determine whether the nanoparticle can cross the placenta barrier ([@B19]). Poly-amidoamine (PAMAM) dendrimers are shown to be excellent nanocarrier for siRNA delivery and siRNA-sFLT1-PAMAM complex is proved to be effective in inhibition sFLT1 expression and improving pregnancy outcomes in PE rat model ([@B30]). PEG-PLA nanoparticle generated by double-emulsion methods is a novel siRNA delivery system which is proved in both *in vivo* and *in vitro* cancer models ([@B29]). We aimed to use this PEG-PLA nanoparticular system for the delivery of sFLT1 siRNA into placenta and inhibiting the pathogenesis of PE. Despite the placenta is unrestricted exposed to drugs in maternal circulation, only a small proportion of non-targeted nanoparticles are successfully transported into placenta ([@B31]). Thus, specific targeting the nanoparticles to placental tissues is critical for the development of nanoparticle-based therapeutic strategy for pregnancy-related disorders. CSA is a protein which exist on placental syncytiotrophoblasts. We confirmed the existence of CAS in both mice placenta tissues and human trophoblast HTR-8/SVneo cells. Synthetic placental CSA-binding peptide can specifically bind to trophoblasts in placenta but not to other cells expressing CSA in other tissues. It is reported that P-CSA-BP-conjugated nanoparticles is effective in targeting to the placenta and is a novel placenta-specific drug delivery option ([@B31]). Based on the PEG-PLA nanoparticular system, we synthesized P-CSA-BP-conjugated PEG-PLA nanoparticles encapsulating sFLT1 siRNA and analyzed its function both *in vivo* and *in vitro*. Conjugating P-CSA-BP enlarged the particle size and decreased the surface potential of PEG-PLA nanoparticles. Both NP~si*sFLT1*~ and T-NP~si*sFLT1*~ nanoparticles were proved to be stable in PBS and shown strong ability in the protection of encapsulated siRNA. HTR-8/SVneo cells were generated from isolated first trimester extravillous cytotrophoblasts through the infection with simian virus 40 large T antigen ([@B1]). In human trophoblast HTR-8/SVneo cells, the existence of P-CSA-BP on the surface of nanoparticles significantly enhanced its accumulation ability, which was shown by both flow cytometry analyses and immunofluorescence results. We also checked the efficiency of NP~si*sFLT1*~ and T-NP~si*sFLT1*~ nanoparticles in targeting to the placentas of pregnant CD1 mice. *Ex vivo* images and HPLC results demonstrated that nanoparticles with P-CSA-BP on the surface had a significantly stronger ability in accumulation in the placenta of mice. So, conjugating P-CSA-BP to the surface of PEG-PLA nanoparticles enhanced its ability in targeted delivery of drugs to the placenta. In this research, we aimed to decrease the expression of sFLT1 in placenta through the trophoblast-targeted nanoparticles encapsulating sFLT1 siRNA. In HTR-8/SVneo cells, T-NP~si*sFLT1*~ nanoparticles had a higher efficiency in inhibition of sFLT1 expression than NP~si*sFLT1*~ nanoparticles, which was shown in both mRNA and protein levels. Also, after being injected into pregnant CD1 mice, T-NP~si*sFLT1*~ nanoparticles significantly decreased the sFLT1 mRNA level in placenta and sFLT1 protein level in serum. Trophoblast-targeted sFLT1 siRNA-encapsulated T-NP~si*sFLT1*~ nanoparticles had a strong ability in the inhibition of sFLT1 expression in placenta and decreasing the amount of sFLT1 in circulation. Nanoparticles used as delivery system in the therapy of PE must be safe for both mother and fetus. It should have no adverse effects on tissues, do not cross the placenta into fetus, and show no apparent fetal toxicity. The injection of T-NP~si*sFLT1*~ nanoparticles did not influenced the enzyme activities of ALT and AST in pregnant mice. Meanwhile, the newborn pups number and weights were also not changed. These results illustrated that the utility of T-NP~si*sFLT1*~ nanoparticles as a sFLT1 siRNA placenta specific delivery system was safe in mice. In order for this placenta targeted nanoparticles to be adopted and accepted clinically, further research and development are required. The maximum dosage of this nanoparticles should be tested. The nanoparticles should be optimized to improve the efficiency in encapsulating and releasing sFLT1 siRNA. More toxicity tests should be performed in different animal models to ensure the safety of this nanoparticles. Although we had demonstrated sFLT1 silencing function of T-NPsisFLT1 nanoparticles in mouse placenta, but its effects in the prevention or therapy against PE in mice was not investigated. So, further studies should be done to demonstrate the function of T-NPsisFLT1 nanoparticles in PE therapy. In conclusion, the employment of T-NP~si*sFLT1*~ nanoparticles as a sFLT1 siRNA placenta specific delivery system significantly silenced sFLT1 in mice and was safe for both the mother and fetus. This nanoparticle might serve as a novel potential therapeutic strategy for PE. Data Availability Statement {#S5} =========================== The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation, to any qualified researcher. Ethics Statement {#S6} ================ The animal study was reviewed and approved by the Shandong Provincial Hospital Affiliated to Shandong University. Author Contributions {#S7} ==================== LL, HY, and PC conceived the study. TX, QZ, DW, and YZ designed the experiments and analyzed the data. SW secured the funding and supervised the project. Conflict of Interest {#conf1} ==================== The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. **Funding.** This study was supported by the Key Research & Development Project of Shandong Province (2019GSF108096), the National Natural Science Foundation of China (81801473, 81971409, 81741037, 81741038, and 81100447), the Shandong Medical and Health Technology Development Program of China (2016WS0412), the Chongqing Postdoctoral Research Special Funding Project (XmT2018077), the China Postdoctoral Science Foundation (2018M631067 and 2019T120814), the Open Project of NHC Key Laboratory of Fertility Control Technology (2018KF002), and the Jinan Science and Technology Program (201907011 and 201907012). sFLT-1 : fms-like tyrosine kinase 1 P-CSA -BP : Synthetic placental CSA binding peptide PE : preeclampsia. [^1]: Edited by: Larry D. Unsworth, University of Alberta, Canada [^2]: Reviewed by: Augustine Rajakumar, Emory University, United States; Akihide Ohkuchi, Jichi Medical University, Japan [^3]: This article was submitted to Biomaterials, a section of the journal Frontiers in Bioengineering and Biotechnology
Q: Google App Engine local development server SSL warning (Python 2.7) Each time I upload my app to Google App Engine, the logs always show this warning: WARNING appengine_rpc.py:435 ssl module not found. Without the ssl module, the identity of the remote host cannot be verified, and connections may NOT be secure. To fix this, please install the ssl module from http://pypi.python.org/pypi/ssl . I'm running a virtualenv with Python 2.7. When I'm in it, I try to run $ pip install ssl but this produces an error: ValueError: This extension should not be used with Python 2.6 or later (already built in), and has not been tested with Python 2.3.4 or earlier. If ssl is built in to Python 2.7, how do I tell the local development server to use the built in ssl module? A: It sounds like appcfg.py is not using your virtualenv correctly. You can try editing the appcfg.py script so that it prints sys.version and sys.path, to confirm that it's using your virtualenv correctly. (The shebang line is "#!/usr/bin/env python", so that should use your active environment, but it's worth checking.) If you're using the Launcher, you need to tell it explicitly where to look for your virtualenv's Python. Go to Preferences, and set the Python Path to your virtualenv's Python 2.7. The Launcher prints which Python path it is using in the Logs (at least when starting the dev server).
State law and influenza vaccination of health care personnel. Nosocomial influenza outbreaks, attributed to the unvaccinated health care workforce, have contributed to patient complications or death, worker illness and absenteeism, and increased economic costs to the health care system. Since 1981, the Advisory Committee on Immunization Practices (ACIP) of the Centers for Disease Control and Prevention (CDC) has recommended that all HCP receive an annual influenza vaccination. Health care employers (HCE) have adopted various strategies to encourage health care personnel (HCP) to voluntarily receive influenza vaccination, including: sponsoring educational and promotional campaigns, increasing access to seasonal influenza vaccine, permitting the use of declination statements, and combining multiple approaches. However, these measures failed to significantly increase uptake among HCP. As a result, beginning in 2004, health care facilities and local health departments began to require certain HCP to receive influenza vaccination as a condition of employment and annually. Today, hundreds of facilities throughout the country have developed and implemented similar policies. Mandatory vaccination programs have been endorsed by professional and non-profit organizations, state health departments, and public health. These programs have been more effective at increasing coverage rates than any voluntary strategy, with some health systems reporting coverage rates up to 99.3%. Several states have enacted laws requiring HCEs to implement vaccination programs for the workforce. These laws present an example of how states will respond to threats to the public's health and constrain personal choice in order to protect vulnerable populations. This study analyzes laws in twenty states that address influenza vaccination requirements for HCP who practice in acute or long-term care facilities in the United States. The laws vary in the extent to which they incorporate the six elements of a mandatory HCP influenza vaccination program. Four of the twenty states have adopted a broad definition of HCP or HCE. While 16/20 of the laws require employers to "provide," "arrange for," "ensure," "require" or "offer" influenza vaccinations to HCP, only four states explicitly require HCEs to cover the cost of vaccination. Fifteen of the twenty laws allow HCP to decline the vaccination due to medical contraindication, religious or philosophical beliefs, or by signing a declination statement. Finally, three states address how to sanction noncompliant HCPs. The analysis also discusses the development of a model legal policy that legislators could use as they draft and revise influenza prevention guidelines in health care settings.
The copper (Cu) exporter ATP7B is over-expressed in many tumors with acquired resistance to Cu, cisplatin (DDP) and carboplatin. The ability of ATP7B to mediate resistance to the platinum (Pt)-containing drugs has now been demonstrated in multiple experimental systems in this and other laboratories, and the importance of ATP7B expression to the survival of patients treated with the Pt drugs has been suggested by the results of several clinical studies. ATP7B is one of only 3 genes that unequivocally produce cisplatin (DDP) resistance when over-expressed, the others being another Cu exporter, ATP7A, and metallothionein II. The overall goal of this project is to determine the mechanism by which ATP7B mediates resistance to the platinum-containing drug in ovarian carcinoma cells and to identify strategies for overcoming this resistance. Our prior work has demonstrated that, at clinically relevant concentrations, the Pt drugs enter cells, are distributed to various subcellular compartments and exported from cells by transporters and chaperones that have evolved to control Cu homeostasis. These proteins protect Cu from oxidation and reaction with thiols and sequester it into subcellular compartments for loading onto Cu-dependent enzymes. We posit that they do the same thing for the platinum drugs, on the one hand protecting them from neutralization by reaction with thiols but on the other hand sequestering them into the secretory export pathway and thus limiting their toxicity. This is a novel concept that provides an explanation for several long-standing questions about how the Pt drugs escape detoxification by cytoplasmic thiols before they reach DNA and why the extent of Pt DNA adduct formation is not directly linked to the extent of whole cell Pt accumulation. Our hypothesis is that, as it does for Cu, ATP7B sequesters DDP into vesicles of the secretory pathway that are then exported from the cell. The specific aims are focused on 2 different approaches to validating this hypothesis that are based on new information about the ATP7B molecule. They are to: 1) identify the components of the ATP7B molecule that are essential to its ability to mediate DDP resistance in human ovarian carcinoma cells;and, 2) determine the extent to which ATP7B-mediated resistance to DDP relies on the interaction of ATP7B with proteins that regulate its ability to load Cu into the secretory pathway or control movement of vesicles to and from the cell surface in this pathway. This will include analysis of the participation of: the intracellular chloride channel ClC-4 that binds to ATP7B and is known to regulate vesicle pH and the loading of Cu onto ceruloplasmin by ATP7B, and dynactin that links vesicles to the motor protein dynein and microtubules and whose p62 subunit is known to interact with ATP7B in a Cu-dependent manner. A careful dissection of the mechanism by which ATP7B mediates the efflux of Pt drugs is expected to identify strategies for increasing the efficacy and selectivity of the Pt containing drugs which remain one of the most important and widely used class of anticancer agents. PUBLIC HEALTH RELEVANCE: The copper efflux transporter ATP7B is one of the few genes that when over-expressed unequivocally produces resistance in many types of tumor cells and while a good deal is known about the biochemistry of this transporter, how it mediates resistance to the Pt drugs remains unknown. We have developed a sharply focused hypothesis regarding this mechanism, and will use the extraordinarily powerful tool of molecular dissection of this single molecule to identify the key components required to produce the resistant phenotype. Our successful identification of strategies to increase the therapeutic index of cisplatin, based on a molecular level investigation of the copper influx transporter CTR1, indicates that through analysis of the mechanisms by which ATP7B mediates Pt drug resistance will yield strategies for increasing the efficacy and selectivity of this very important class of anticancer agents.
John Brett (bishop) The Most Reverend John Brett O.P. (?–22 June 1756) was an Irish Roman Catholic clergyman who served as the Bishop of Killala from 1743 to 1748 and as Bishop of Elphin from 1748 to 1756. References Category:1756 deaths Category:Roman Catholic bishops of Elphin Category:Roman Catholic bishops of Killala Category:Year of birth unknown Category:Irish Dominicans
The effect of potent iron chelators on the regulation of p53: examination of the expression, localization and DNA-binding activity of p53 and the transactivation of WAF1. Iron (Fe) chelators induce a G1/S arrest and several of these are undergoing clinical trials as anticancer agents. Despite this, little is known concerning the precise function of Fe in cell cycle progression and the role of p53 in this process. The aim of this study was to assess the effect of Fe chelators on p53 and the mechanism involved in the chelator-mediated increase in mRNA levels of the universal cyclin-dependent kinase inhibitor p21CIP1/WAF1. Cells were incubated with the potent Fe chelator 2-hydroxy-1-naphthylaldehyde isonicotinoyl hydrazone (311) and the results compared with those from cells treated with actinomycin D (Act D), which induces p53. Following incubation with 311, a 3- to 5-fold increase in nuclear p53 protein was observed in cells with wild-type p53. In addition, 311 increased p53 DNA-binding activity 2-fold, while Act D increased it 3- to 5-fold in cells with native p53. To determine the role of p53 in WAF1 transcription, a reporter construct was used consisting of a WAF1 promoter containing the p53-binding site. In cells with wild-type p53, chelators had no effect on luciferase activity, while the positive control, Act D, caused a significant increase. Hence, despite increased p53 protein expression and p53 DNA-binding activity following chelation, these latter results suggested it had no role in up-regulating WAF1 mRNA. Our experiments demonstrated: (i) that the elevated WAF1 mRNA expression after Fe chelation was due to increased transcription and also to a post-transcriptional mechanism that was sensitive to cycloheximide; and (ii) that Fe-chelation increased WAF1 expression through a p53-independent pathway.
Quiz begins Most people confuse these words at least once! Than is used to show a comparison (more than two; I’d rather go to the concert than see a movie). It is also used in the expression other than to show difference (I’ll go with anybody other than Fred). Then usually means at that time or next (Then I left). It may also be used to mean in addition (Then, there are several other reasons.) or therefore (If you feel ill, then you should stay home.). Then can also be used before a title to show that a person held a position in the past (the then manager). Try this quiz to see if you know the difference between than and then. A study by Statistics Canada says gasoline prices in Central and Eastern Canada are rising more quickly those in the West. First, beat the sugar with the butter, and fold in the egg whites. Roslyn would rather practice her flute study for exams. Other Mauricio, no one spoke fluent Spanish in the class. My brother is six years older I. The Massey Medal was established in 1959 by the governor general, Vincent Massey. Pasquale hasn’t blogged for two weeks because he has been very busy. , he was ill for a few days. If you don’t want to go to the party, just say so. Accessible Version - Recommend or share this page by e-mail, social bookmarking or social networking Share this page If you wish to recommend or share this page by e-mail, social bookmarking or social networking, click on the icon of your choice: Access to the proposed sites is free, but you must have a user account. Access to these sites may vary depending on your browser (for example, Internet Explorer 6 does not support all the sites). You must make sure that your browser is up to date. In addition, depending on which sharing method you have chosen, some characters (accented letters, apostrophes or other symbols) in the title of the page you are recommending may be displayed incorrectly or missing. You will need to make these corrections yourself before recommending the page to your contacts. Note: No e-mail or personal information will be retained. For more information on privacy policies and practices that apply to the Language Portal of Canada, see the Terms and conditions. Social bookmarking Social bookmarking allows you to save your favourite links on the Internet through social bookmarking sites such as Google Bookmarks or Reddit. These sites offer many advantages. You can: access your favourite links from any computer or mobile device connected to the Internet; search your favourite links easily using the keywords (commonly called "tags") you assign to each link; share your favourite links with an Internet community; discover the favourite links of other Web users who share your interests. Social bookmarking sites are usually free, but you must subscribe to use them. Social bookmarking is also known as collaborative tagging, social classification and social indexing. Social networking Social networking sites, such as Facebook and Linkedln, are Internet platforms that allow you to interact online and create interconnected Web communities. You can create personal profiles, establish lists of users with whom you have a common connection or establish new relationships. To exchange ideas with other members, you can post messages to your personal page, send e-mails and instant messages or share files.
SEC CHECK WHOLE TRACK - HCO BULLETIN OF 19 JUNE 1961 SEC CHECK WHOLE TRACK - HCO BULLETIN OF 19 JUNE 1961 Добавлено: 27 авг 2018, 17:31 auditor Central OrgsHGCsTech StaffHUBBARD COMMUNICATIONS OFFICESaint Hill Manor, East Grinstead, SussexHCO BULLETIN OF 19 JUNE 1961Central OrgsHGCsTech StaffSEC CHECK WHOLE TRACK(HCO WW Sec Form 4)For processing use only. Use only about midway on Routine 3 and from thenon.(These questions have been contributed by Jan and Dick Halpern.)L. RON HUBBARDWhole Track Sec CheckHCO WW Sec Form 4.Have you ever enslaved a population?Have you ever implanted anyone?Have you ever sacked a city?Have you ever sunk, or otherwise destroyed, a non-combatant vessel?Have you ever abused hostages, or prisoners?Have you ever ordered, or yourself committed, genocide?Have you ever annihilated a population?Have you ever poisoned food or drinking supplies?Have you ever strangled anyone?Have you ever deliberately spread disease?Have you ever degraded a religion?Have you ever raped a child of either sex?Have you ever warped an educational system?Have you ever deprived people of hope?Have you ever committed murder?Have you ever destroyed a culture?Have you ever forced anyone into an undesired beingness?Have you ever stolen a body from another being?Have you ever destroyed an economy?Is anybody seeking to discover your whereabouts?Have you ever violated a nation's neutrality?Have you ever broken a treaty?Have you ever blanketed bodies for the sensation kick?Have you ever upset an ecology?Have you persecuted others for their religious or political beliefs?Have you ever interfered with the free flow of trade?337Have you ever been a crook?Have you ever obliterated a language?Have you ever stamped out a religion?Have you ever deliberately trained people in untruths for power, or profit?Have you ever defiled religious places, persons, or objects?Have you ever practised terrorism?Have you ever done anything you would not like to think of yourself as havingdone?Have you ever been a coward?Have you ever trapped a thetan?Have you ever prided yourself on your wickedness?Have you ever destroyed artistic productions, or creations?Have you burned literature?Have you ever forbidden people to practise their own customs?Have you ever perverted a people's customs?Have you ever done anything which you hoped would be wiped out by the passageof time?Do you deserve to be punished into eternity for something you've done?If so, what is it?Have you ever exposed infants?Have you ever bred bodies for degrading purposes?Is there anything you would have done differently if you had had more data?Have you ever forced beings into unwanted bodies?Have you deliberately prevented beings from exteriorizing?Have you done anything to a person, group, or thing that wasn't deserved?Have you ever deserted a just cause?Have you ever debased a nation's currency?Have you ever deliberately tortured someone?Have you ever enslaved another being?Have you ever gained, or maintained, a position by portraying yourself asvictimized?Have you ever undermined a people's trust?Have you driven anyone insane?Have you ever been a professional prostitute?Have you ever been a criminal?Have you ever trained people for criminal purposes?Have you ever been a pervert?Have you ever recruited anyone for an unworthy purpose?Have you ever traded in others' bodies for profit or power?Have you ever stolen a mock-up or facsimile?Have you ever usurped a location?338Have you ever made things scarce so that you might profit unfairly?Have you ever made a practice of creating emergencies?Have you ever practised human sacrifice?Have you ever assumed a beingness which was not rightfully yours?Have you ever killed the wrong person?Have you ever punished an innocent person?Is anybody looking for you?Have you ever systematically degraded an individual, or population, or mock-up?Have you ever unlawfully, or unethically, deserted a post?Have you betrayed someone, or something, which deserved your help?Have you ever set a poor example?Have you ever perverted the institutions of a culture for your own personalpower or profit?Have you ever denied yourself?Have you ever betrayed yourself?Did you come to Earth for evil purposes?Have you ever acted contrary to your own principles?Have you ever failed a friend?Have you ever sought to render others dependent on you?Have you ever abused those under your protection?Have you ever destroyed farmland, crops, or breeding stock?Have you ever despoiled a planet of its natural resources?Are you in hiding?Have you ever made a planet, or nation, radioactive?Have you ever wrecked a climate?Have you ever systematically set up mysteries?Have you ever made nothing of yourself?Have you made a profession of destruction?Have you ever enturbulated an orderly environment?Have you ever been a traitor?Have you ever deliberately lowered another's knowingness, or ability?Have you ever maimed, and crippled, other people's bodies?Have you ever pretended to a power you did not possess?Have you ever stolen ships, draft, vessels, or vehicles belonging to agovernment?Have you ever disappeared?Have you ever killed your own body?Have you ever pretended to a knowingness you did not possess?Have you ever caused a planet to disappear?Have you ever felt the ends justified the means?339Have you ever given cause a bad name?Have you ever discredited the creations of others?Have you ever been off post at a time when you were desperately needed?Have you ever convinced another that he has mocked up an unconfrontability?Have you ever deliberately mocked up an unconfrontability?Have you ever made a practice of confusing people?Have you perverted historical truths for any reason?Have you ever deliberately sent someone to the wrong place, or the wrongperson?Have you ever been a professional spy, or intelligence agent?Have you made a practice of worrying people?Have you consistently practised sex in some unnatural fashion?Have you demonstrated that control is impossible?Have you ever wrecked a vehicle, or vessel?Have you ever pretended to be dead?What question should be on this check for others?Have you ever convinced another of the injustice of his cause?Have you ever philosophized when you should have acted instead?Have you ever claimed it harmed you to do something?Have you ever deliberately disfigured another's body?Have you ever torn out someone's tongue?Have you ever blinded anyone?Have you ever destroyed another's hearing?Have you ever knocked someone's teeth out?Have you ever punished another by cutting off some part of his body?Have you ever been a parasite?Is there anything you have sworn off being?Is there anything you have sworn off doing?Is there anything you have sworn off having?Have you ever given a degraded, or debased, example of divinity?Have you ever perverted a communication system?Have you ever been a professional critic?Have you ever held others in pawn for profit?Have you ever presumed on the natural goodness of another?Have you ever caused another to mistrust you?Have you ever made a burden of yourself?Have you ever gone crazy?Have you ever sought to persuade another of your insanity?Have you ever deliberately mutilated bodies?340Have you ever deliberately mutilated objects?Have you heightened sexual sensation by inflicting pain?Have you ever caused something to appear at an unexpected time?Have you ever caused something to appear in an unexpected place?Have you ever maltreated a pregnant woman, or pregnant animal?Have you ever corrupted a child?Have you ever sought to convince others of their guilt?Have you ever started a war?Have you ever caused your own side to lose?Have you ever deliberately distorted others' ideas?Have you ever manipulated beings as though they were MEST?Have you ever deserted, or betrayed, a great leader?Have you ever sought to convince beings that they were MEST?Have you ever tried to persuade others there were thoughts they mustn't think?Have you ever sought to put another's thinkingness out of his control?Have you ever permitted a subordinate of yours to be punished for yourmistakes?Have you ever tried to shift blame on to a superior Of yours?Have you ever smothered a baby?Have you ever inflicted physical pain on an insane person for any reason?Have you ever taken pride in and cultivated a wrongness?Have you ever worshipped wrongness in others?Have you ever sought to make others unwilling to produce?Have you ever wiped out a family?Have you ever rewarded another, or a group, for a wrongness?Have you ever had sexual relations with an animal, or bird?Have you ever participated in a sexual relationship between a doll body and ahuman body?Have you ever destroyed a doll body?Have you ever lost a doll body entrusted to you?Have you ever punished another, or group, for a rightness?Have you ever permitted another to be punished for your misdeed?Have you ever perpetuated an injustice?Have you ever been brutal to animals?Have you ever denied others a means of existence?Have you ever deserted your own children?Have you ever refused to support your parents, or grandparents?Have you ever denied others a redressment of grievances?Have you ever caused another to distrust himself?Have you ever caused another to identify himself with a form in order toenslave him?341Have you ever given anyone the third degree?Have you ever validated the insanity of another being or group?Have you ever tried to give sanity a bad name?Have you ever warped, or distorted, bodies for sexual purposes?Have you ever wanted to disown a deed of yours?Do you deserve to have any friends?Have you ever castrated anyone?Have you ever wrongfully claimed another's deed as your own?Have you ever robbed a dead body?Have you ever made love to a dead body?Do you deserve to be free?Do you deserve to be enslaved?Is there any question on this check I had better not ask you again?Have you ever considered another didn't deserve to be sane?Have you ever considered another didn't deserve to be free?Have you ever considered another didn't deserve to be well?Have you ever considered another didn't deserve to be alive?Have you ever made MEST guilty of harming you?Have you ever made another guilty of doing you permanent harm?Have you ever forced another to compete?Have you ever pretended to be unable to repair a form?Have you ever refused to put back into order a disorder you created?Have you ever shot, or stabbed, someone in the back?Have you ever been disloyal?Have you ever been treacherous?Have you ever engaged in piracy?Have you ever made an outrageous, or preposterous, will?Have you ever thrown the ownership of property into doubt?Have you ever demonstrated that communication is impossible?Have you ever withheld useful data?Have you ever created chaos?Have you ever consistently made a practice of furnishing useless data?Have you ever tried to make the physical universe less real?Have you ever caused another to mistrust his judgement?Have you ever convinced another he was guilty of a crime, or misdeed, which hehad not in fact committed?Have you ever sought to convince another that there was something wrong withhim?Have you ever practised medicine unethically?Have you ever practised law, or jurisprudence, unethically?342Have you ever sought to convince another that everything was the same aseverything else, so it didn't matter what he did?Have you ever spread despair?Have you ever kept effective solutions from working?Have you ever sought to convince another that there was no difference betweenright and wrong?Have you ever been a pimp?Have you ever given families a bad name?Have you ever produced a criminal?Have you ever assisted an evildoer?Have you ever driven a population into criminality?Have you ever used criminality as a means of control of a population?Have you ever made sanity appear to be psychotic?Have you ever been a psychiatrist?Have you ever depopulated an area?Have you ever deprived another of a livelihood?Have you ever given God a bad name?Have you ever been a corrupt priest?Have you ever given spirits an evil reputation?Have you ever been an evil spirit?Have you ever sought to convince others that things were evil?Have you ever taught others that nothing can be done?Have you ever tried to convince others that knowing is bad? That perceiving isbad?That sensation is bad?Have you ever deliberately caused a sane person to be committed to a mentalinstitution?Have you ever performed unnecessary surgery on someone's body?Have you ever tried to convince others that things are bad? That there are badbeingnesses? That it is bad to do things?Have you ever mocked another's ability?Have you ever mocked another's knowingness?Have you ever mocked another's creativeness?Have you ever applied a hot iron to another person's body?Have you ever tortured another with electrical, or electronic, devices?Have you ever attacked others for causing effects that you secretly knew werebeneficial, or helpful?Have you ever deliberately caused others to feel less responsible?Have you ever beaten a child to death?Have you ever starved anyone to death?Have you ever left anyone to die of thirst?Have you ever misestimated an effort?343Have you ever misjudged another?Have you ever failed to save someone from drowning?Have you ever knowingly sponsored a swindle?Have you ever failed another?Have you ever wasted time when you ought not to have?Have you ever retreated from an area where you should have stayed, or advanced?Have you ever wasted men? Women? Children? Objects? An ability? Animals?Thoughts? Spaces? Energy?Have you ever made nothing of a worthy person? Of a group? Of a universe?Of a spirit?Have you failed in any way to live up to your own ideas of how you should be?Have you ever broken someone's body on a wheel?Have you ever stretched another's body on a rack?Have you ever put a criminal in a position of trust?Have you ever sold people on the idea that people are basically wicked?Have you ever boiled someone's living body in oil?Have you ever eaten a human body?Have you ever eaten the body of a member of your own species?Have you ever disfigured a beautiful thing?Have you ever exterminated a species?Have you ever let your past triumphs discourage you about your future?Have you ever flayed anyone alive?Have you ever been a professional executioner?Have you ever done a bad thing to win approval?Have you ever been a dishonest policeman?Have you ever been a brutal gaoler?Have you ever been a corrupt judge?Have you ever been a bad soldier?Have you ever done a bad thing to save yourself?Have you ever done a bad thing to save another?Have you ever been an ungrateful child?Have you ever been a wicked mother?Have you ever been a bad father?Have you ever convinced another that his goals were no good?Have you ever been an abortionist?Have you ever run a brothel?Have you ever had a body with a venereal disease? If so, did you spread it?Have you ever produced a bastard?Have you ever convinced another that he shouldn't confront someone, orsomething?344Have you ever failed to send, or deliver, a vital message?Have you committed rape?Have you employed poison gas against life forms?Have you ever put up a discreditable creation?Have you ever taught that it was bad for people to have things?Have you ever deliberately infected life forms with disease?Have you ever made a body disappear?Have you ever consistently made a practice of attacking people who helped you?Have you ever perverted an ethic?Have you ever consistently made a practice of attacking those who helpedothers?Have you ever abused, or tortured, life forms?Have you ever inflicted an unwarranted punishment?Have you ever enforced breeding?Have you ever desecrated burial places?Have you ever attacked helpless persons?Have you ever denied anyone a desired beingness?Have you ever caused another being to create against his own wishes orinterests?Have you ever zapped anyone?Have you deliberately set property afire?Have you ever created an effect for which there was no apparent cause?Have you ever interiorized a being into a machine?Have you ever forced a body to survive against its owner's wishes?Have you ever arrested the development of a culture?Is there any place you'd better not return to?Is there anything the people of Earth had better not find out about you?Is there any time you'd better not return to?Have you done anything that had better not happen again?Have you ever given creativeness a bad name?Have you given biological bodies a bad name?Have you given doll bodies a bad name?Have you given robots a bad name?What should others be warned about concerning you?What don't you trust yourself with?Is there anything you can't forgive yourself for?Is there anything others should not forgive you for?Have you ever caused equipment entrusted to your care to vanish?Have you ever acted as a double agent?Have you ever misappropriated equipment entrusted to your care?345Have you ever interrogated another under torture?Have you ever caused anyone to be burned alive?Have you ever misappropriated funds entrusted to your care?Have you ever violated the sanctity of a herald?Have you ever violated a flag of truce, or a period of truce?Have you ever caused someone to be flogged to death?Have you ever been a religious fanatic?Have you ever assassinated a prominent person?Have you ever blown anything up?Have you ever violated a sanctuary?Have you ever poisoned an atmosphere?Have you ever set a booby trap?Have you ever violated the established rules of warfare?Have you ever made yourself out to be weaker than you in fact were?Have you ever made yourself out to be stronger than you in fact were?Have you ever promised help without intending to give it?Have you ever abandoned your sick, or dead, to the enemy?Have you ever failed to rescue your leader?LRH:imj.rdCopyright $c 1961by L. Ron HubbardALL RIGHTS RESERVED
package Dancer2::Core::Role::Logger; # ABSTRACT: Role for logger engines use Dancer2::Core::Types; use Moo::Role; use POSIX 'strftime'; use Encode (); use Data::Dumper; with 'Dancer2::Core::Role::Engine'; sub hook_aliases { +{} } sub supported_hooks { qw( engine.logger.before engine.logger.after ); } sub _build_type {'Logger'} # This is the only method to implement by logger engines. # It receives the following arguments: # $msg_level, $msg_content, it gets called only if the configuration allows # a message of the given level to be logged. requires 'log'; has auto_encoding_charset => ( is => 'ro', isa => Str, ); has app_name => ( is => 'ro', isa => Str, default => sub {'-'}, ); has log_format => ( is => 'rw', isa => Str, default => sub {'[%a:%P] %L @%T> %m in %f l. %l'}, ); my $_levels = { # levels < 0 are for core only core => -10, # levels > 0 are for end-users only debug => 1, info => 2, warn => 3, warning => 3, error => 4, }; has log_level => ( is => 'rw', isa => Enum[keys %{$_levels}], default => sub {'debug'}, ); sub _should { my ( $self, $msg_level ) = @_; my $conf_level = $self->log_level; return $_levels->{$conf_level} <= $_levels->{$msg_level}; } sub format_message { my ( $self, $level, $message ) = @_; chomp $message; $message = Encode::encode( $self->auto_encoding_charset, $message ) if $self->auto_encoding_charset; my @stack = caller(8); my $request = $self->request; my $config = $self->config; my $block_handler = sub { my ( $block, $type ) = @_; if ( $type eq 't' ) { return POSIX::strftime( $block, localtime(time) ); } elsif ( $type eq 'h' ) { return ( $request && $request->header($block) ) || '-'; } else { Carp::carp("{$block}$type not supported"); return "-"; } }; my $chars_mapping = { a => sub { $self->app_name }, t => sub { POSIX::strftime( "%d/%b/%Y %H:%M:%S", localtime(time) ) }, T => sub { POSIX::strftime( "%Y-%m-%d %H:%M:%S", localtime(time) ) }, u => sub { POSIX::strftime( "%d/%b/%Y %H:%M:%S", gmtime(time) ) }, U => sub { POSIX::strftime( "%Y-%m-%d %H:%M:%S", gmtime(time) ) }, P => sub {$$}, L => sub {$level}, m => sub {$message}, f => sub { $stack[1] || '-' }, l => sub { $stack[2] || '-' }, h => sub { ( $request && ( $request->remote_host || $request->address ) ) || '-' }, i => sub { ( $request && $request->id ) || '-' }, }; my $char_mapping = sub { my $char = shift; my $cb = $chars_mapping->{$char}; if ( !$cb ) { Carp::carp "%$char not supported."; return "-"; } $cb->($char); }; my $fmt = $self->log_format; $fmt =~ s/ (?: \%\{(.+?)\}([a-z])| \%([a-zA-Z]) ) / $1 ? $block_handler->($1, $2) : $char_mapping->($3) /egx; return $fmt . "\n"; } sub _serialize { my @vars = @_; return join q{}, map +( ref $_ ? Data::Dumper->new( [$_] )->Terse(1)->Purity(1)->Indent(0) ->Sortkeys(1)->Dump() : ( defined($_) ? $_ : 'undef' ) ), @vars; } around 'log' => sub { my ($orig, $self, @args) = @_; $self->execute_hook( 'engine.logger.before', $self, @args ); $self->$orig( @args ); $self->execute_hook( 'engine.logger.after', $self, @args ); }; sub core { my ( $self, @args ) = @_; $self->_should('core') and $self->log( 'core', _serialize(@args) ); } sub debug { my ( $self, @args ) = @_; $self->_should('debug') and $self->log( 'debug', _serialize(@args) ); } sub info { my ( $self, @args ) = @_; $self->_should('info') and $self->log( 'info', _serialize(@args) ); } sub warning { my ( $self, @args ) = @_; $self->_should('warning') and $self->log( 'warning', _serialize(@args) ); } sub error { my ( $self, @args ) = @_; $self->_should('error') and $self->log( 'error', _serialize(@args) ); } 1; __END__ =head1 DESCRIPTION Any class that consumes this role will be able to implement to write log messages. In order to implement this role, the consumer B<must> implement the C<log> method. This method will receives as argument the C<level> and the C<message>. =head1 CONFIGURATION The B<logger> configuration variable tells Dancer2 which engine to use. You can change it either in your config.yml file: # logging to console logger: "console" The log format can also be configured, please see L<Dancer2::Core::Role::Logger/"log_format"> for details. =head1 METHODS =method core Log messages as B<core>. =method debug Log messages as B<debug>. =method info Log messages as B<info>. =method warning Log messages as B<warning>. =method error Log messages as B<error>. =method format_message Provides a common message formatting. =attr auto_encoding_charset Charset to use when writing a message. =attr app_name Name of the application. Can be used in the message. =attr log_format This is a format string (or a preset name) to specify the log format. The possible values are: =over 4 =item %h host emitting the request =item %t date (local timezone, formatted like %d/%b/%Y %H:%M:%S) =item %T date (local timezone, formatted like %Y-%m-%d %H:%M:%S) =item %u date (UTC timezone, formatted like %d/%b/%Y %H:%M:%S) =item %U date (UTC timezone, formatted like %Y-%m-%d %H:%M:%S) =item %P PID =item %L log level =item %D timer =item %m message =item %f file name that emit the message =item %l line from the file =item %i request ID =item %{$fmt}t timer formatted with a valid time format =item %{header}h header value =back =attr log_level Level to use by default.
Shielded electrical connectors are used in various applications for shielding electrical terminations from external electromagnetic interference, to prevent the systems which use the connectors from emitting electromagnetic signals and to prevent the connector from emitting electromagnetic signals. The shielded connectors usually continue the shielding of a shielded cable to another shielded cable or to an electronic device. In some applications involving the use of high frequency electrical signals, shielded electrical connectors actually are required, particularly in such applications as the telecommunications and computer industries. Such high frequency electromagnetic signals are very susceptible to interference from other electromagnetic signals and also generate electromagnetic signals of their own which may be undesirable and interfere with other electronic devices. In fact, various Federal Communication Commission requirements have caused a significant increase in the use of shielded electrical connectors. The present invention is directed to an improved shielded electrical connector of the type having a pair of mating metal shield members or halves each of which has a forward end engageable with a metal shell. Pivot means are provided for rotating rear ends of the shield halves into engagement with a shielded cable and, in turn, create a positive pressure ground connection between forward ends of the shield halves and the metal shell of the connector.
'Fiscal cliff' fracas: From smiles to distrust to rancour Last updated on: January 5, 2013 08:58 IST 'Fiscal cliff' fracas: From smiles to distrust to rancour It began so optimistically. On November 16, after their first "fiscal cliff" session with President Barack Obama, the four leaders of Congress had stood in the driveway of the White House shoulder-to-shoulder for what is a rare photo these days, Republicans and Democrats together, smiling. There they were at the microphone, talking about a "framework" for tax reform and deficit reduction. In hindsight, the shot of House Speaker John Boehner and Senate Minority Leader Mitch McConnell - the Republicans - with Senate Majority Leader Harry Reid and House Minority Leader Nancy Pelosi - the Democrats - seems like an old family photo, before things went bad. From that day on the driveway, things went downhill, rather quickly. There was a feeling on both sides that the other was not acting seriously to avert the "fiscal cliff" of tax hikes and spending cuts that were set to occur at the beginning of this month. That was inflamed by public comments from ranking Republicans and Democrats, poisoning the atmosphere. Many lawmakers and their aides fear that things may get more toxic through a series of bitter struggles expected in the next few months over the nation's debt and deficit burdens - fights not just between the parties but within them, and between the White House, the Senate and the House. At stake is not only the U.S. government's ability to get its finances under control but whether it might default on its debts, and suffer further downgrades in the nation's credit rating. While Obama is perceived the victor in the fiscal deal passed by Congress earlier this week, he did not come close to getting the one thing he demanded that could have headed off the next potential crisis: Freedom from a fight over the federal government's debt ceiling, which is likely to occur in February when the Treasury Department must ask Congress to increase the government's borrowing limit beyond the current $16.4 trillion. Any positive vibes started fading a few days after the photo. On November 20, at a meeting between Republican staffers and Rob Nabors, the White House director of legislative affairs. Nabors announced that he had a White House offer in hand but "didn't want to be laughed out of the room and implied he would skip it because it was a waste of time," according to one Republican source. The White House declined to comment. What the White House was offering was Obama's budget proposal from earlier in the year, long ago rejected by Republicans. A Democratic source familiar with the negotiations said it was merely an opening bid that should have come as no surprise, but Republicans saw it as a red flag, particularly after Treasury Secretary Timothy Geithner touted it again nine days later. Things didn't get better in the final weeks of the year. At a December 13 meeting between Obama, Boehner and their aides at the White House, Obama spoke for almost the entire 50-minute session, according to Republican sources. They said he warned that if he did not get an agreement to his liking, he would spend the next four years "campaigning against House Republicans," starting with his second-term inauguration speech on January 21. As far as the Republicans were concerned, Obama had effectively remained in campaign mode after his November 6 re-election, going on the attack in his "fiscal cliff" speeches. One of the clearest examples of this, occurred at a delicate point in negotiations on Monday, with a looming deadline and the risk growing that the Republican-controlled House would blow up any deal pulled together by the Senate. At a campaign-style event with "middle class" Americans in the background, Obama accused Republicans of trying to "shove spending cuts at us that will hurt seniors, or hurt students or hurt middle-class families." The move angered House Republicans who were already divided on how to proceed, leading to more bad blood. Republican Senator John McCain responded in the Senate, wondering "whether the president really wants this issue resolved." The people Obama was talking to, McCain said, "were laughing and cheering and applauding as we are on the brink of this collapse." By that time, Boehner had ceased to be a force in the negotiations, thanks to his own miscalculation on December 20. That's when he brought his own "Plan B" to the House - a bill to avoid the "fiscal cliff" with minimal tax hikes on the wealthy - and then had to pull the bill when he couldn't get enough Republicans to support it. The defeat humiliated Boehner and, by depriving him of the ability to deliver on any commitments he might make, sidelined him in the final stages of the negotiations. Accusations fly In the final days of the year, Republicans routinely accused the president of bad faith, saying he preferred to go over the 'cliff,' triggering the tax hikes and rattling the markets, because it would increase his ability to pressure them. The same was said of Boehner by Democrats, including Reid. "He's waiting until January 3 to get re-elected as speaker before he gets serious with negotiations because he has so many people over there that won't follow what he wants. That's obvious from the debacle that took place last week," Reid said in the Senate, referring to Boehner's failed effort to get his own caucus in line on December 20. He was operating the House as a "dictatorship," Reid added in his December 27 speech, by refusing to allow a vote on a Senate bill to avoid the automatic tax hikes and spending cuts. Boehner was reelected as speaker on Thursday. After that goading, Boehner let loose the next time he saw Reid. The occasion was the final White House meeting of the standoff, on Friday, December 28, as Obama and the congressional leaders were trying to figure out how to proceed. Reid said Boehner was just mouthing "talking points," according to a senior Democratic aide. "The other folks at the table were engaged in a meaningful discussion. Every time the conversation got back to Boehner, he'd say 'The House has acted; the Senate needs to act.' It was like he arrived with a very short leash," the aide said."Disheartening: for some Democrats Obama used the December 28 meeting to ask McConnell and Reid to work up a bipartisan bill in the Senate that might win approval in the House, and they agreed. McConnell made an offer to Reid, but grew impatient waiting for a response, according to a Republican aide. The Senate Republican left a message at 1:20 p.m. EST (1820 GMT) on Sunday, December 30 for Vice President Joe Biden: "Please call." "Does anybody down there know how to do a deal?," McConnell told Biden, a former colleague of McConnell's in the Senate. "There doesn't appear to be the level of understanding that you have about these negotiations" elsewhere in the administration, McConnell told Biden. "It's a lack of experience. Smart people but they don't have a good sense of the trip wires," he added. Despite Reid's 25 years in the Senate, he was out of the picture. After the November 6 election, Reid had wondered whether Obama would cave or use his re-election as a hammer. "We thought that it was a unique moment in time where we had enormous leverage over Republicans," a senior Democratic Senate aide said, "and we were ready to play hardball." "This was our best opportunity to get something that's acceptable at your point of maximum leverage in probably the eight years of his administration," this official said. The aide added that Wall Street experts were making a "strong case" that even if January 1 came and went without a deal, as long as negotiations were continuing, the stock market would hold fairly steady for a week or so into 2013. The week after the election, Reid had traveled to the White House to try to determine whether Obama had the "spine" to stick to his guns in the negotiations, according to the aide. Reid then assured his fellow Democrats that the president, buoyed by his election win, would stand firm. But by late December, Senate Democrats watched in amazement as Obama offered a higher, $400,000 income threshold for those who would see their taxes rise under his proposal compared to his original $250,000 figure, a willingness to cut cost-of-living benefits for retirees and a temporary instead of permanent increase in the debt limit. "It was disheartening to supporters. He just telegraphed to Republicans a willingness to move higher at the drop of a hat," the aide said. "We got nickeled and dimed on everything," he said.'Old bulls' get deal done Once Biden and McConnell cut their deal in the waning hours of 2012 - the one that kept lower taxes for everyone but those with high incomes - the White House leaked to reporters that Reid had signed off on the pact. According to the senior Senate Democratic aide, Reid had not given his backing yet. He simply told the White House that Biden was welcome to come to the Senate, meet with Democratic senators "and try and sell the deal." Reid promised that if the caucus was convinced by Biden, Reid would do everything he could to deliver a strong vote. But now he was out of the loop too. Why could McConnell and Biden bring off the deal when others couldn't? "They're experienced hands," said Trent Lott, a former Republican senator from Mississippi who was majority leader from June 1996 to January 2001. "They have respect for each others' abilities and truthfulness," he said in an interview with Reuters. ".... They're old bulls. They know how to get the deal done." Lott, who was a member of Congress for more than three decades, said it was "revisionist history" to see his era as some golden age of comity in Washington. But "clearly the atmosphere has changed over the years. I don't know when it started drifting to the point where it is," he said. Lott said he was struck by the fact that an agreement of such magnitude was ultimately the work not of the president or the House speaker, but of the Senate minority leader and the vice president.
Q: Google Maps Api Directions Can i mark two points on the google maps in my application and then calculate the direction on the map as well as turn by turn navigation ? A: I am create an application which are used to get the driving direction between two points in the map Step be step step1 First create a class MyOverlay.java which are used to draw a path import android.graphics.Bitmap; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Paint; import android.graphics.Point; import android.graphics.RectF; import android.util.Log; //import android.util.Log; import com.google.android.maps.GeoPoint; import com.google.android.maps.MapView; import com.google.android.maps.Overlay; import com.google.android.maps.Projection; public class MyOverLay extends Overlay { private GeoPoint gp1; private GeoPoint gp2; private int mRadius=6; private int mode=0; private int defaultColor; private String text=""; private Bitmap img = null; public MyOverLay(GeoPoint gp1,GeoPoint gp2,int mode) // GeoPoint is a int. (6E) { this.gp1 = gp1; this.gp2 = gp2; this.mode = mode; defaultColor = 999; // no defaultColor } public MyOverLay(GeoPoint gp1,GeoPoint gp2,int mode, int defaultColor) { this.gp1 = gp1; this.gp2 = gp2; this.mode = mode; this.defaultColor = defaultColor; } public void setText(String t) { this.text = t; } public void setBitmap(Bitmap bitmap) { this.img = bitmap; } public int getMode() { return mode; } @Override public boolean draw (Canvas canvas, MapView mapView, boolean shadow, long when) { Projection projection = mapView.getProjection(); if (shadow == false) { Paint paint = new Paint(); paint.setAntiAlias(true); Point point = new Point(); projection.toPixels(gp1, point); // mode=1¡Gstart if(mode==1) { if(defaultColor==999) paint.setColor(Color.BLUE); else paint.setColor(defaultColor); RectF oval=new RectF(point.x - mRadius, point.y - mRadius, point.x + mRadius, point.y + mRadius); // start point canvas.drawOval(oval, paint); } // mode=2¡Gpath else if(mode==2) { if(defaultColor==999) paint.setColor(Color.RED); else paint.setColor(defaultColor); Point point2 = new Point(); projection.toPixels(gp2, point2); paint.setStrokeWidth(5); paint.setAlpha(120); canvas.drawLine(point.x, point.y, point2.x,point2.y, paint); } /* mode=3¡Gend */ else if(mode==3) { /* the last path */ if(defaultColor==999) paint.setColor(Color.GREEN); else paint.setColor(defaultColor); Point point2 = new Point(); projection.toPixels(gp2, point2); paint.setStrokeWidth(5); paint.setAlpha(120); canvas.drawLine(point.x, point.y, point2.x,point2.y, paint); RectF oval=new RectF(point2.x - mRadius,point2.y - mRadius, point2.x + mRadius,point2.y + mRadius); /* end point */ paint.setAlpha(255); canvas.drawOval(oval, paint); } /* mode=4¡Gcar */ else if(mode==4) { if(defaultColor==999) paint.setColor(Color.GREEN); else paint.setColor(defaultColor); Point point2 = new Point(); projection.toPixels(gp2, point2); paint.setTextSize(20); paint.setAntiAlias(true); canvas.drawBitmap(img, point2.x, point2.y,paint); canvas.drawText(this.text, point2.x, point2.y, paint); // Log.d(TAG, "Draw the text="+this.text+ " at point="+point2.x + "," + point2.y); } else if(mode==5) { if(defaultColor==999) paint.setColor(Color.GREEN); else paint.setColor(defaultColor); Point point2 = new Point(); projection.toPixels(gp2, point2); paint.setTextSize(20); paint.setAntiAlias(true); canvas.drawBitmap(img, point2.x, point2.y,paint); // Log.d(TAG, "Draw the text="+this.text+ " at point="+point2.x + "," + point2.y); } } return super.draw(canvas, mapView, shadow, when); } } step 2: Create a class name DrivingDirectionActivity.java import javax.xml.parsers.DocumentBuilder; import javax.xml.parsers.DocumentBuilderFactory; import javax.xml.parsers.ParserConfigurationException; import org.w3c.dom.Document; import org.xml.sax.SAXException; import android.graphics.Color; import android.os.Bundle; import android.util.Log; import com.android.code.R; import com.google.android.maps.GeoPoint; import com.google.android.maps.MapActivity; import com.google.android.maps.MapView; /** * @author ashish * * * */ public class DrivingDirectionActivity extends MapActivity { public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.google_map_driving_direction_view); MapView mapView = (MapView) findViewById(R.id.myMapView1); double src_lat = 28.632808; double src_long = 77.218276; double dest_lat = 28.588535; double dest_long = 77.255130; GeoPoint srcGeoPoint = new GeoPoint((int) (src_lat * 1E6), (int) (src_long * 1E6)); GeoPoint destGeoPoint = new GeoPoint((int) (dest_lat * 1E6), (int) (dest_long * 1E6)); DrawPath(srcGeoPoint, destGeoPoint, Color.GREEN, mapView); mapView.getController().animateTo(srcGeoPoint); mapView.getController().setZoom(15); } /* (non-Javadoc) * @see com.google.android.maps.MapActivity#isRouteDisplayed() */ protected boolean isRouteDisplayed() { // TODO Auto-generated method stub return false; } private void DrawPath(GeoPoint src, GeoPoint dest, int color,MapView mMapView01) { // connect to map web service Document doc = getDocument(makeUrl(src,dest)); System.out.println(doc.toString()); try { if (doc.getElementsByTagName("GeometryCollection").getLength() > 0) { // String path = // doc.getElementsByTagName("GeometryCollection").item(0).getFirstChild().getFirstChild().getNodeName(); String path = doc.getElementsByTagName("GeometryCollection") .item(0).getFirstChild().getFirstChild() .getFirstChild().getNodeValue(); Log.d("xxx", "path=" + path); String[] pairs = path.split(" "); String[] lngLat = pairs[0].split(","); // lngLat[0]=longitude // lngLat[1]=latitude // lngLat[2]=height // src GeoPoint startGP = new GeoPoint((int) (Double.parseDouble(lngLat[1]) * 1E6), (int) (Double.parseDouble(lngLat[0]) * 1E6)); mMapView01.getOverlays().add(new MyOverLay(startGP, startGP, 1)); GeoPoint gp1; GeoPoint gp2 = startGP; for (int i = 1; i < pairs.length; i++) { // the last one would be crash lngLat = pairs[i].split(","); gp1 = gp2; // watch out! For GeoPoint, first:latitude, second:longitude gp2 = new GeoPoint((int) (Double.parseDouble(lngLat[1]) * 1E6), (int) (Double.parseDouble(lngLat[0]) * 1E6)); mMapView01.getOverlays().add(new MyOverLay(gp1, gp2, 2, color)); Log.d("xxx", "pair:" + pairs[i]); } mMapView01.getOverlays().add(new MyOverLay(dest, dest, 3)); // use // the // default // color } } catch ( Exception e) { e.printStackTrace(); } } private Document getDocument(String urlString) { // TODO Auto-generated method stub Document doc = null; HttpURLConnection urlConnection = null; URL url = null; try { url = new URL(urlString.toString()); urlConnection = (HttpURLConnection) url.openConnection(); urlConnection.setRequestMethod("GET"); urlConnection.setDoOutput(true); urlConnection.setDoInput(true); urlConnection.connect(); DocumentBuilderFactory dbf = DocumentBuilderFactory.newInstance(); DocumentBuilder db = dbf.newDocumentBuilder(); doc = db.parse(urlConnection.getInputStream()); } catch (Exception e) { // TODO: handle exception } return doc; } private String makeUrl(GeoPoint src, GeoPoint dest) { // TODO Auto-generated method stub // get the kml (XML) doc. And parse it to get the coordinates(direction // route). StringBuilder urlString = new StringBuilder(); urlString.append("http://maps.google.com/maps?f=d&hl=en"); urlString.append("&saddr=");// from urlString.append(Double.toString((double) src.getLatitudeE6() / 1.0E6)); urlString.append(","); urlString.append(Double.toString((double) src.getLongitudeE6() / 1.0E6)); urlString.append("&daddr=");// to urlString.append(Double.toString((double) dest.getLatitudeE6() / 1.0E6)); urlString.append(","); urlString.append(Double.toString((double) dest.getLongitudeE6() / 1.0E6)); urlString.append("&ie=UTF8&0&om=0&output=kml"); Log.d("xxx", "URL=" + urlString.toString()); return urlString.toString(); } } now execute.. If this is not good then you can pass the your current location as source loaction A: No the Map Activity doesn't provide such a feature. You have to request it via the Google Maps Web API.
Park Yoochun’s Brother Park Yoo Hwan to Have His Film Debut JYJ member Park Yoochun‘s brother Park Yoo Hwan will be having his big screen debut. According to film industry insiders, Park Yoo Hwan has been cast in an upcoming film titled “Musudan,” which will be directed by Gu Mo. The actor last appeared in tvN drama “I Need Romance 3” in early last year. Afterwards, he took a hiatus to focus on studying acting. This will be his first acting project in over a year and a half, and his first movie appearance. “Musudan” will be a mystery thriller set in a border outpost. Along with Park Yoo Hwan, Lee Ji Ah, Kim Min Joon, Do Ji Han, and Ki Dong Young have been confirmed for the cast of the movie.
--- title: "Faster Sites with Optimized Media Assets" date: 2020-03-02 author: William Imoh excerpt: "Introducing two new Gatsby-Cloudinary plugins for optimized media management in Gatsby apps" tags: ["media", "cloudinary", "performance", "image", "video"] --- Plugins are at the heart of developing software with Gatsby because they not only extend Gatsby’s robust features but also make available, data from multiple sources. I’m excited to introduce you to two Gatsby plugins: [gatsby-source-cloudinary](/packages/gatsby-source-cloudinary/) and [gatsby-transformer-cloudinary](/packages/gatsby-transformer-cloudinary/). Cloudinary is a cloud-based end-to-end media management platform for many of the world's top brands. With extensive product offerings from an Image management solution, Dynamic Video Platform, and a dynamic digital asset management solution. ## The Motivation Behind the Scenes The two open-source Gatsby-Cloudinary plugins combine the best of both worlds: - Gatsby builds high-performance sites with data from multiple sources and fetches declarative data with GraphQL, offering a superior developer experience and a rich ecosystem for developing in ReactJS. - Cloudinary is an advanced media-management service that offers three key features: - Optimized media storage and delivery - Media transformation on data query and on the fly with dynamic URLs - Digital-asset management for high performance For example, an image uploaded to Cloudinary can be retrieved with a dynamic URL that transforms the original image into a cropped circular image, with a fixed width and height. The final URL becomes: https://res.cloudinary.com/demo/image/upload/w_400,h_400,c_crop,r_max/w_200/lady.jpg Several transformation parameters can be included in the URL to modify the image on the fly. You can find more about [Cloudinary here](http://bit.ly/2GbkeT3). Using the Gatsby-Cloudinary plugins, optimized media assets from Cloudinary are bundled with the static files built by Gatsby. Those optimized assets can either be— - Sourced directly from Cloudinary with the source plugin. - Uploaded from local storage to Cloudinary with the transformer plugin. The returned images are transformed into file nodes that are compatible for use with the robust `gatsby-image` component. ## gatsby-source-cloudinary Plugin [gatsby-source-cloudinary](/packages/gatsby-source-cloudinary/) is a plugin that fetches media assets from Cloudinary. You must first specify the folder from which to query those assets. The plugin then transforms them into Cloudinary file nodes, which can be queried with GraphQL in a Gatsby project. Before file nodes are created, Cloudinary optimizes media files queried from its platform by applying the `f_auto` and `q_auto` transformation parameters. Impressively, those parameters optimize delivery format and quality for media assets by over 70 percent. ## gatsby-transformer-cloudinary Plugin [`gatsby-image`](/docs/using-gatsby-image/) is a React component that delivers optimized images in Gatsby apps through GraphQL queries. The gatsby-transformer-cloudinary plugin uploads local files to Cloudinary, which then creates `CloudinaryAsset` nodes that are compatible for use in `gatsby-image`. This plugin can also apply Cloudinary media transformations in the GraphQL queries for the queried media assets. ## Preliminary Steps The plugins can be used for various JAMstack applications built with Gatsby. The core goal is to store, optimize and deliver media assets with possible transformations. To get started on using the two Gatsby-Cloudinary plugins, follow these steps: 1. [Create a free account on Cloudinary](http://bit.ly/2v3sy4N). 2. [Create a Gatsby project](/tutorial/) with any of the Gatsby starters. 3. Configure either of the plugins in the `gatsby-config.js` file. 4. Refer to the [source plugin](http://bit.ly/2NHVshC) or [transformer plugin](http://bit.ly/2sMqe1u) documentation for the procedure on how to query Cloudinary images or upload and transform them with `gatsby-image`, respectively. ## Next in the Horizon Given the ever-growing demand for speedy and usable apps and the continual feature advancements of Cloudinary and Gatsby, maintenance and capability enhancements of the plugins are ongoing. Fork, clone, download, and try out the two plugins yourself. If you run into problems, create an issue in the relevant repository or send us pull requests (PRs) and be sure to check out my [blog on Cloudinary](https://cloudinary.com/blog/introducing_cloudinary_s_gatsby_plugins).
/******************************************************/ /* Demo automatique (Pour quitter taper une touche) */ /* Megamax Laser C DMOTOUCH.C */ /******************************************************/ #include <osbind.h> #define CONSOLE 2 int i; affichage (string) char *string; { while (*string != 0) Bconout (CONSOLE, *(string++)); } main() { while (!Bconstat (CONSOLE)) /* Poursuivre ex‚cution tant qu'aucune */ /* touche n'est tap‚e */ { affichage ("DEMONSTRATION. Touche = FIN... \n"); for (i=0; i<9999; i++) /* Boucle de ralentissement */ ; } Bconin (CONSOLE); /* Le caractŠre en attente doit ˆtre */ /* r‚cup‚r‚ dans le tampon du clavier */ }
It’s not an overstatement to say that Star Trek Beyond had its work cut out for it. With J.J. Abrams firmly entrenched in the new Star Wars trilogy, Beyond had to prove, under new director Justin Lin, that it could replicate the success of its predecessors while navigating some vicious critical headwinds over the choice of Lin. It had to prove that Trek was still relevant in an arena reinvigorated, and perhaps even usurped, by Star Wars. And it had to acknowledge the losses of Leonard Nimoy and, more recently, Anton Yelchin, who died just weeks before the movie’s release. For a movie facing these challenges and bowing on Trek’s 50th anniversary, Beyond may not be the classic Star Trek entry that fans had hoped for, but it is an entertaining, passable, summer sci-fi action film peppered with some welcome, sentimental nods to the original television series and movies. Beyond boasts a strengthened family chemistry among the crew, particularly with Kirk, Spock, and McCoy – adding glue to that classic triumvirate of these three popular characters. As you likely know by now, the crew is three years into its five-year mission when it is called to Starbase Yorktown and sent on assignment to rescue an alien ship in a nearby nebula. The ship then comes under attack by a warlord known as Krall, who is hell-bent on obtaining pieces of an ancient bio-weapon. Part of that weapon happens to be in Kirk’s possession and Krall wages war on the Enterprise to get it. Krall unleashes a swarm of drones in a breathtaking attack on Enterprise. Many of the crew take escape pods to the nearby planet Altamid, separating key members of the command crew. Bones and Spock are alone together, as are Kirk and Chekov, who work together to find a way to reunite everyone. The reunited command crew eventually gets help from a scavenger known as Jaylah, who is living in the USS Franklin – the first Starfleet vessel to achieve Warp 4 and which became stranded and abandoned on Altamid many years earlier. Jaylah helps them rescue the other crew members held prisoner by Krall and his henchman (using a motorcycle and some nifty holographic fake-outs). The action then heads back to the Yorktown, which Krall, now in full possession of the assembled weapon, intends to conquer for use in attacking the Federation at large. Now for the big question: Does Lin manage to pull all this off? Yes, and no. The movie begins with promise and some unexpected restraint on the part of his camerawork, but it takes a dizzying turn once action heads to the planet and then to the Yorktown in the climax. Yes, there’s a pretty ridiculous Indiana Jones-style, cliffhanging moment on the planet involving Scotty, and Kirk pulls off another superhero moment of rescue, this time with Jaylah. When Abrams staged Kirk’s rescue of Sulu (with help from Chekov) in the first film as they’re plummeting toward Vulcan, it was a genuine nail-biter. Here, the rescues just feel a little too routine and expected. To be fair, the CG work on Yorktown is incredible and it’s a beauty to behold. Lin lets the camera fly around for a bit so we can take in the spectacle of this place (which reminded me of the long shuttle flybys of the Enterprise during the ship’s first appearance in Star Trek: The Motion Picture). The problem is, the station’s circular architecture doesn’t lend itself to Lin’s frenetic, 360-degree camera moves, especially when the action picks up steam. Without some kind of stable reference point for your eye, the action photography just becomes a spinning, visual mess. The return of the Beastie Boys song “Sabotage” as the deux ex machina in the final battle with Krall that helps destroy his swarm army is hard to swallow. The song’s use is a stunning moment to witness and makes sense in the context of a Lin movie, but here the solution just seemed too easy and more akin to what you’d expect from an hour-long Trek episode looking to quickly wrap things up in its final act. On the whole, I wasn’t upset with Lin’s work. He delivers the movie and keeps the action moving. But in the end, that’s essentially all the movie is – an action film with a story of revenge we’ve seen over and over before. Again, we always come back to The Wrath of Khan – that North Star storytellers seem to point to when crafting a new Star Trek movie. Of course, Krall is no Khan, but both characters do argue their positions and invite the audience’s sympathies. The fact that Krall is in fact Balthazar Edison, the former captain of the forgotten USS Franklin, is an interesting twist. Like Khan, Edison shares enormous animosity toward the Federation because of abandonment. In the case of Edison, he was a member of M.A.C.O. who fought in both the Xindi and Romulan wars. When the wars ended and the Federation was formed, Edison – now a Starfleet officer — was given command of the USS Franklin on a mission of exploration. The Franklin became stranded on Altamid, and unable to muster a rescue from Starfleet, Edison became resentful toward Starfleet not only because of the abandonment but the broader impact of peace and diplomacy embraced by the new Federation. Edison over time transformed into the alien Krall by harnessing advanced technology on the planet and transferring the lifeforce of other beings to ensure his and his followers’ survival. We see this energy transference during the events of Beyond when Krall first attacks the Enterprise and again on the planet. Krall’s backstory is a compelling one and we see echoes of Star Trek VI: The Undiscovered Country and Kirk’s struggle with the new Klingon peace in that movie. Unfortunately, in the case of Krall, the revelation the Krall is Edison happens too abruptly and too awkwardly to offer any real significant sympathy for this guy. I’m also not sure I agreed with the decision to have Kirk so tired and conflicted about his purpose this early in the reboot franchise. Kirk’s similar struggle in The Wrath of Khan worked because he was a middle-aged man whose journeys and struggles were well-documented through an entire series. That movie so perfectly services the older character of Kirk and where he is at that point in his life – and how he’s able to reclaim his “youth” through his experiences with Khan. That sense of personal rediscovery in younger-Kirk doesn’t feel quite as satisfying in Beyond. It’s painful to see Anton Yelchin so alive and vibrant in this movie given his recent death, and I almost wish there were stronger moments of bonding with Kirk during their alone-time. The movie does do a nice job of showing just how close these characters have become in the overall, and enormous credit must given again to Abrams and company for finding the best actors for these characters. The choice to have Sulu married with husband and child may have provided some short-lived push-back among critics upset with changes to that character, but it felt organic to the movie and was a welcome, if fleeting, answer to calls for more diversity in the Trek universe. For those seeking stronger diversity in Star Trek, you may have to wait for the new television series. Serious credit needs to be given to Michael Giacchino’s score, which is certainly his best of the rebooted movies. His score complements Lin’s acrobatic direction and his campy fight-scene arrangements are nice winks to the original series scoring. Overall, Star Trek Beyond is an entertaining entry in the franchise that plays more like an overproduced episode than a standalone film. Nevertheless, it does offer some interesting technical insights, particularly with regard to the USS Franklin and its place in Star Trek chronology. Paramount has already greenlit a fourth movie in the Kelvin Timeline, which is expected to reunite Kirk with his father George, who was played by Chris Hemsworth in the first movie. Another time-travel story? Perhaps. That’s not necessarily a bad thing. Let’s just hope there aren’t any humpback whales.
0800 Best Deal If you really need convincing... Snap, crackle and pop is much more appealing coming from your breakfast bowl than your car radio. So if you want to listen to the FM radio in it’s full glory, it’s time to get the good guys at 0800 Best Deal onto your car audio. For just $39 they'll install an FM band expander, allowing you to access stations between 88-108 MHz without having to replace your stereo. Imported cars will often have a radio with a limited frequency range of 76-90 MHz, meaning you can't access some of your favourite radio stations. An FM band expander from 0800 Best Deal is an easy way to give you access to higher frequencies. Go on, enjoy some phat beats (people still say that, right?) while you're cruising the streets with this treat from 0800 Best Deal.
LASER INDUCED OPTICAL PUMPING Author GIBERSON, KARL WILLARD Date 1985 Degree Doctor of Philosophy Abstract Optical pumping is a very useful technique for the production of spin polarized particles. This thesis describes laser induced optical pumping in helium, argon, and neon metastable atoms. The laser used to optically pump helium is an (F(,2)+)* color center laser which was developed during the course of this work. Argon and neon were optically pumped with commercially available dye lasers. In the first experiment the color center laser was used to spin polarize a Doppler broadened ensemble of He 2('3)S metastable atoms contained in a flowing helium afterglow. The extracted chemi-ionized electron polarization was as high as 80%, indicating almost complete polarization of the 2('3)S atoms. A P('2)I quality factor of 8 x 10('-6) was obtained. The next set of experiments involved the optical pumping of metastable atoms contained in collimated beams. Although substantial polarizations were achieved, problems were encountered with laser frequency jitter as none of the lasers were frequency stabilized. In particular, the polarizations obtained in both helium and argon were unstable and not even a nominal polarization could be maintained consistently over any reasonable time interval. Stable optical pumping in neon was obtained with the DCM dye laser however, due to frequency jitter which essentially broadened the narrow spectral components in the laser lineshape. In an effort to improve on the limited performance obtained in the optical pumping of both helium and argon, a frequency modulation technique has been developed. By decomposing the very narrow spectral components present in typical laser radiation into a large number of closely spaced sidebands, this technique effectively fills in the gaps in the laser linewidth. This broad continuous linewidth enhances the ability of unstabilized lasers to optically pump very narrow atomic transitions by reducing the effects of laser detuning. In an initial experiment almost complete polarization of a beam of argon metastable atoms was obtained using a frequency modulated LD 700 dye laser. The polarization was stable on a time scale of several hours--more than adequate for proposed spin dependent studies.
Tonight as part of a massive week for Chelsea, we make the long trip up north to take on Gus Poyet's Sunderland. After Sunday's win against Southampton, how many changes if any should Jose Mourinho make? You pick the starting eleven! I believe that Jose Mourinho will make at least three changes to the side that started against Southampton with one being an enforced change due to the injury to Oscar that rules him out of this one. Kevin De Bruyne looks like finally being handed a start and I believe he will come in for Oscar and Ramires will revert back to central midfield. Next to Ramires and in place of Michael Essien, I believe that Mikel will come in to add some defensive stability in front of the back four which would be the second change. The third and final change could see Demba Ba start ahead of Fernando Torres. We need consistency but need to refresh one or two areas and those are the changes I would make. To reconfirm, my selection and the team I believe Jose will select tonight will be:
The present invention relates to a method and apparatus for making photographic color prints on color sensitive printing material, and more particularly to improvements in a method and apparatus for making color prints from color transparencies made on multiple-purpose film which was exposed by light of one of a plurality of different color temperatures, especially by daylight or artificial light. Still more particularly, the invention relates to improvements in a method and apparatus for making color prints by carrying out color corrections to deviate from gray in dependency on determination whether the exposure was made by daylight or artificial light. The determination involves ascertaining the ratio (difference or the quotient) of transmittances in two colors which are influenced by the color temperature of light by which the original was exposed, and comparing the resulting signal with a threshold value. U.S. Pat. No. 3,029,691 to Goddard et al. discloses an apparatus for making color prints wherein integrated red transmittance is compared with integrated blue transmittance. It has been found that such comparison is not a reliable way of distinguishing between exposures by daylight or artificial light. This is due to the fact that the color shifts between such types of exposures are not most pronounced in red and blue colors and also because, in the case of average ratio of these colors, the difference is less when the intensity of light by which the original was exposed is low. Thus, resort to a fixed threshold value does not invariably guarantee optimum results.
Quit smoking, lose weight! Studies have shown that obese and overweight women that smoke are more likely to be concerned about weight gain after they stop smoking which has a negative effect on their ability to quit as well as the incidence of relapse. Heavy smokers experience a greater weight gain after they stop smoking than lighter smokers, women tend to gain more then men. When you LOSE WEIGHT you improve your health in many ways When you STOP SMOKING you improve your health in many ways When you STOP SMOKING AND LOSE WEIGHT you improve your financial future in may ways Do this for yourself. Do this for your loved ones. Do this for your future. Call us now. Put down the smokes, pick up the phone today! 201-636-2143
Introduction ============ The aim of our study is to verify the usefulness of remifentanyl (R) in ventilated newborn (nw) evaluating the analgesic effect and how variation of R infusion maintains a level of analgesia according to different modality of ventilation (MV). Materials and methods ===================== Eighteen nw were admitted in ICU for RDS, GA \> 32, mean weight 2.250 ± 450 g. A modified scale, according to PIPP and Comfort, was used to evaluate \'comfort\'. According to the score (S) all patients were divided in three groups: A \< 5; B = 5; C \> 5. Data were collected at T0 (basal value), T1 (30 min after start infusion), Tn (every 4 hours), T-est (extubation time), and T post-est (30 min after extubation). R infusion was started at 0.25 µg/kg/min to obtain an \'ideal\' S 5 ± 1; and was modified to obtain an adequate analgesia during PCV. After \'critical\' phase R was reduced, evaluating the mean *t* to reach an adequate RD (respiratory drive) for weaning. S at this moment was \< 5 (max 7). Finally R was stopped and the mean *t* for extubation was calculated. For all parameters median value and SD were calculated. For HR, BP, PSO~2~ in A, B, C a Student *t* test was adopted for the significance (*P* \< 0.005) through the single value at T0 (T0 vs A, T0 vs B, T0 vs C) and also A, B, C (A vs B, A vs C, B vs C). Results ======= The mean *t* of R (T1-Tstop) was 66.94 ± 22 hours, with a mean dose of R 0.146 ± 0.038 µg/kg/min. The mean *t* to reach comfort (5 ± 1) was 20 ± 13.11 hours (T1-T5) with R 0.17 ± 0.14 µg/kg/min. R was 0.18 ± 0.04 µg/kg/min in PCV with a S of 4 ± 0.63. The mean *t*, to obtain a RD to change PCV to PAV, was 2.30 ± 0.56 hours with R 0.09 ± 0.04 µg/kg/min, comfort S 5 ± 0.53 referred to all the period of PAV. Stop-Test was 15 ± 3.4 min. The S at Tpost-est was 5.5 ± 1.03. Statistically significant is the fall of HR at T0 vs A (*P* = 0.003) and T0 vs B (*P* = 0.002) as a confirmation that an adequate level of analgesia brings a stabilization of hemodynamic changes to pain stimuli. SpO~2~ increased from T0 vs A (*P* = 0.005) and T0 vs B (*P* = 0.001) due to synchronization of the patients to MV since the good level of analgesia was reached. Conclusion ========== No adverse effects were observed: low dose of R maintained an analgesia with an assessment of patients to MV. Infusion *t* did not influence time of extubation. Although the S 5 ± 1 is an hypothetic \'ideal\' level of analgesia, we can assess that R could permit, in newborn, to reach a state of comfort during all \'MV therapy\' until extubation, when pain stimulus is removed.
Company Name:Soliant HealthSLI School Setting Opening in Dothan, AL Job Location: Dothan, AL Category: Schools - Sign Language Interpreter Apply Now! Back to ResultsSoliant Health has an opening for a SLI near Dothan, AL in a school setting working with an elementary aged student. This position is for the 2014-2015 school year. Full time hours, Monday-Friday, 37.5 hours per week. The Sign Language Interpreter must be fluent in American Sign Language, have educational environment experience, and be able to work on the school schedule. Interpreter also must be licensed as an SLI in the state of Alabama.Apply online here and please contact Ashley Viquez for further details: 770-225-317. Ashley.Most positions have option to extend or go permanent. Apply now!I look forward to hearing from you! By clicking 'Continue', I consent to be contacted regarding education opportunities at the phone number provided: , using an automated telephone dialing system and/or pre-recorded voice. I may be contacted by Career Advisor. Consent is not required as a condition of using this service.
162 SHARES Share Tweet Share Email Print Sen. Rand Paul’s expression of opposition to a $1.1 billion U.S. arms sale to Saudi Arabia — which has been brutally bombing civilian targets in Yemen using U.S.-made weapons for more than a year now — alarmed CNN’s Wolf Blitzer on Thursday afternoon. Blitzer’s concern: That stopping the sale could result in fewer jobs for arms manufacturers. “So for you this is a moral issue,” he told Paul during the Kentucky Republican’s appearance on CNN. “Because you know, there’s a lot of jobs at stake. Certainly if a lot of these defense contractors stop selling war planes, other sophisticated equipment to Saudi Arabia, there’s going to be a significant loss of jobs, of revenue here in the United States. That’s secondary from your standpoint?” Paul stayed on message. “Well not only is it a moral question, its a constitutional question,” Paul said. “Our founding fathers very directly and specifically did not give the president the power to go to war. They gave it to Congress. So Congress needs to step up and this is what I’m doing.” Watch the exchange: Saudi Arabia began bombing Yemen in March 2015, and has since been responsible for the majority of the 10,000 deaths in the war so far. The U.S.-backed bombing coalition has been accused of intentionally targeting civilians, hospitals, factories, markets, schools, and homes. The situation is so bad that the Red Cross has started donating morgue units to Yemeni hospitals. The war’s incredible humanitarian toll has generated an increasing outcry in the United States. Earlier this month, more than 60 members of Congress signed a letter asking the administration to delay the most recent arms shipment. Ordinarily, under the Arms Export Control Act, Congress has 30 days to block arms sales proposed by the administration — but by announcing the arms sale in August, most of those 30 days fell during Congress’s August recess. That 30-day window expired Thursday night and the White House has not granted the request for extra time. The Obama administration has sold more weapons to the Saudis than any other administration, pledging more than $115 billion worth of small arms, tanks, helicopters, missiles, and aircraft. So yes, it’s a legitimate moral issue. What it’s not is a legitimate economic issue. If you’re worried about jobs, military spending is not where you look. It’s an inefficient way to create jobs, because it has a lower multiplier effect — meaning how much it ripples in the wider economy. One study from 2011 found that $1 billion put into military spending would create approximately 11,200 jobs, but that same amount of money put into education creates 26,700 jobs. SOURCE
// Copyright 2014 The Chromium Authors. All rights reserved. // Use of this source code is governed by a BSD-style license that can be // found in the LICENSE file. #ifndef CHROME_BROWSER_CHROMEOS_NET_CERT_VERIFY_PROC_CHROMEOS_H_ #define CHROME_BROWSER_CHROMEOS_NET_CERT_VERIFY_PROC_CHROMEOS_H_ #include "crypto/scoped_nss_types.h" #include "net/cert/cert_verify_proc_nss.h" #include "net/cert/nss_profile_filter_chromeos.h" namespace chromeos { // Wrapper around CertVerifyProcNSS which allows filtering trust decisions on a // per-slot basis. // // Note that only the simple case is currently handled (if a slot contains a new // trust root, that root should not be trusted by CertVerifyProcChromeOS // instances using other slots). More complicated cases are not handled (like // two slots adding the same root cert but with different trust values). class CertVerifyProcChromeOS : public net::CertVerifyProcNSS { public: // Creates a CertVerifyProc that doesn't allow any user-provided trust roots. CertVerifyProcChromeOS(); // Creates a CertVerifyProc that doesn't allow trust roots provided by // users other than the specified slot. explicit CertVerifyProcChromeOS(crypto::ScopedPK11Slot public_slot); protected: ~CertVerifyProcChromeOS() override; private: // net::CertVerifyProcNSS implementation: int VerifyInternal(net::X509Certificate* cert, const std::string& hostname, const std::string& ocsp_response, int flags, net::CRLSet* crl_set, const net::CertificateList& additional_trust_anchors, net::CertVerifyResult* verify_result) override; // Check if the trust root of |current_chain| is allowed. // |is_chain_valid_arg| is actually a ChainVerifyArgs*, which is used to pass // state through the NSS CERTChainVerifyCallback.isChainValidArg parameter. // If the chain is allowed, |*chain_ok| will be set to PR_TRUE. // If the chain is not allowed, |*chain_ok| is set to PR_FALSE, and this // function may be called again during a single certificate verification if // there are multiple possible valid chains. static SECStatus IsChainValidFunc(void* is_chain_valid_arg, const CERTCertList* current_chain, PRBool* chain_ok); net::NSSProfileFilterChromeOS profile_filter_; }; } // namespace chromeos #endif // CHROME_BROWSER_CHROMEOS_NET_CERT_VERIFY_PROC_CHROMEOS_H_
Q: How do you change vbulletin's home page to the forums instead of the default (CMS or Activity Stream)? I have created a website using vbulletin i have installed CMS and BLOG modules in it in admin my default setting is forums but when we enter the homepage url it is redirecting me to http://www.demo.com/content/ content is my cms page Please help A: For vBulletin versions < 4.2. You need to modify the forum index page located in the top level of your vBulletin directory. Based on the URL in your question it's this file: http://www.demo.com/index.php Here is the contents of that file, you can choose whether the CMS or the Forum is the default home page. /** * You can choose the default script here. Uncomment the appropriate line * to set the default script. Note: Only uncomment one of these, you must * add // to comment out the script(s) that you DO NOT want to use as your * default script. * * You can choose the default script even if you do not plan to move this * file to the root of your website. */ /** * Use the CMS as the default script: */ require('content.php'); /** * Use the forum as the default script: */ // require('forum.php'); For vBulletin versions >= 4.2. There's a new "Navigation Manager". You'll find the control settings here: Admin Control Panel -> Settings -> Navigation Manager. Find the row for the Forum tab. On the right side of the row is a pull-down selector, click "Set Default" (you may need to click the "Go" button afterwards). The "Change Site Default" panel will appear. Verify that the Forum tab is the "Proposed Default" and that "Yes" is selected for "Confirm Change", then click "Save". The forum home page is now the forums listing.
Rory Bromley Rory Bromley is a professional rugby league footballer for the Toulouse Olympique team in the Co-operative Championship. He was formerly a player from the Redcliffe Dolphins in the Queensland Cup. His team position is full back. In his first season at the Toulouse Olympique in 2009, he ended up being the leading try scorer for the squad with the same number of tries as the centre Damien Couturier, for 18 matches played (versus 20 for Couturier). References External links Toulouse Olympique profile Category:1984 births Category:Redcliffe Dolphins players Category:Rugby league fullbacks Category:Living people
module MiqProvision::Genealogy def set_genealogy(child, parent) _log.info("Setting Genealogy Parent to #{parent.class.base_model.name} Name=#{parent.name}, ID=#{parent.id}") parent.add_genealogy_child(child) end end
Ten healthy reasons to drink a cup of tea Share This Drinking tea might stop you having a stroke. A meta-analysis of nine studies revealed that people who drank three or more cups of tea (black or green) had a 21% lower risk. You could lower your cholesterol. Drinking a brew has been shown to cut cholesterol in people with mildly raised levels. But it’ll take more than one cup – the study concerned had participants downing five cups a day of black tea over three weeks. You might cut your chances of dying from heart disease. Dutch researchers concluded that people who downed between three and six cups of black tea a day had a 45% reduced risk. Tea may bring down blood pressure. French research showed that heavy tea-drinkers had lower blood pressure than people who never touched the stuff. On average, systolic blood pressure was 4-5mmHg lower while the diastolic reading was 3mmHG lower. You’re less likely to die of non heart-related causes. Tea is stuffed with antioxidants, which prevent or delay cell damage in the body. This might explain why the same French study found that the risk of death from non-cardiovascular reasons dropped 24% among tea-drinkers. Hot tea helps you chill. When University College London researchers gave male volunteers stressful tasks, they found that cortisol levels dropped more quickly among the group which drank four cups of tea a day for six weeks than among volunteers drinking ‘fake’ tea. Green tea boosts brain power. In a recent Swiss study, researchers showed that volunteers who took green tea extract did better in working memory tasks and had improved brain connectivity on an MRI scan. Your brew could stop you going blind. Scientists found evidence that antioxidants in green tea penetrated the tissues of the eye, potentially protecting against glaucoma and other eye diseases. Go green to shed kilos. A compound in green tea has been found to slow down weight gain. Another tool in the battle against obesity, perhaps? Green tea may fight cancer. Different studies suggest that it may destroy cancer cells and block their growth, particularly in prostate, pancreas, bladder, colon and stomach tumours. It might also have a role in reducing your risk of developing, among others, skin, lung, mouth and bladder cancer.
Tuesday, July 29, 2014 Theo's Sawtooth Weekend Me and Theo and Uncle John headed up toward Stanley for a weekend of camping and fishing. Theo was pretty excited. He got really dirty and stayed that way. Dug holes, climbed rocks, ran around and had a ball. And we went fishing. Theo caught his first rainbow trout! (I hooked it and handed him my rod, which he thought was about the coolest thing ever--until the fish jumped out of the water, all 6" of it, and he handed it back and put some safe distance between him and that fish. It wasn't all fun and games. Theo got sick the first night, throwing up all over the inside of the tent. And it was in the low 20s F, very VERY cold. We had some gear, but we were prepared for summer camping, which made the night seem pretty long indeed. These pics don't tell the tale, but he was not feeling well on Saturday, and got sick a few more times, so we packed it in and headed home. All in all a good trip, and bailing was the right choice for the sake of excitement at future camping opportunities.
Q: finding if boolean is ever true by groups in R I want a simple way to create a new variable determining whether a boolean is ever true in R data frame. Here is and example: Suppose in the dataset I have 2 variables (among other variables which are not relevant) 'a' and 'b' and 'a' determines a group, while 'b' is a boolean with values TRUE (1) or FALSE (0). I want to create a variable 'c', which is also a boolean being 1 for all entries in groups where 'b' is at least once 'TRUE', and 0 for all entries in groups in which 'b' is never TRUE. From entries like below: a b ----- 1 1 2 0 1 0 1 0 1 1 2 0 2 0 3 0 3 1 3 0 I want to get variable 'c' like below: a b c ----------- 1 1 1 2 0 0 1 0 1 1 0 1 1 1 1 2 0 0 2 0 0 3 0 1 3 1 1 3 0 1 ----------- I know how to do it in Stata, but I haven't done similar things in R yet, and it is difficult to find information on that on the internet. In fact I am doing that only in order to later remove all the observations for which 'c' is 0, so any other suggestions would be fine as well. The application of that relates to multinomial logit estimation, where the alternatives that are never-chosen need to be removed from the dataset before estimation. A: A base R option would be df1$c <- with(df1, ave(b, a, FUN=any)) Or library(sqldf) sqldf('select * from df1 left join(select a, b, (sum(b))>0 as c from df1 group by a) using(a)')
Q: Changing the rendering resolution while maintaining the design layout I would like to increase the FPS of my project. Currently I would like to try reducing the resolution at which the scenes are rendered. Let's say I never want to draw more than 1280*720. What ever the real resolution is. How should I proceed? I tried pEGLView->setFrameSize(1280, 720); but only reduces the displayed size of the frame on screen (boxing). In my activity I tried setting the size of the "surface" but this seems to completely break the layout (as defined by setDesignResolutionSize). @Override public Cocos2dxGLSurfaceView onCreateView() { Cocos2dxGLSurfaceView surfaceView = new Cocos2dxGLSurfaceView(this); surfaceView.getHolder().setFixedSize(1280, 720); return surfaceView; } Is there a way to simply set the scene resolution and display the result full screen? A: Currently I draw into a texture (1280, 720) or adapted to the screen ratio. Then this texture is displayed upscaled.
A systematic review of duloxetine and venlafaxine in major depression, including unpublished data. To determine the short-term antidepressant efficacy and tolerability of duloxetine and venlafaxine vs. each other, placebo, selective serotonin reuptake inhibitors (SSRIs), and tri- and tetracyclic antidepressants (TCAs) in adults with major depression. Meta-analysis of randomised controlled trials identified through bibliographical databases and other sources, including unpublished manufacturer reports. Fifty-four studies including venlafaxine arms (n = 12,816), 14 including duloxetine arms (n = 4,528), and two direct comparisons (n = 836) were analysed. Twenty-three studies were previously unpublished. In the meta-analysis, both duloxetine and venlafaxine showed superior efficacy (higher remission and response rates) and inferior tolerability (higher discontinuation rates due to adverse events) to placebo. Venlafaxine had superior efficacy in response rates but inferior tolerability to SSRIs (OR = 1.20, 95% CI 1.07-1.35 and 1.38, 95% CI 1.15-1.66, respectively), and no differences in efficacy and tolerability to TCAs. Duloxetine did not show any advantages over other antidepressants and was less well tolerated than SSRIs and venlafaxine (OR = 1.53, 95% CI 1.10-2.13 and OR 1.79, 95% CI 1.16-2.78, respectively). Rather than being a first-line option, venlafaxine appears to be a valid alternative in patients who do not tolerate or respond to SSRIs or TCAs. Duloxetine does not seem to be indicated as a first-line treatment.
368 F.Supp. 426 (1974) UNITED STATES of America, Plaintiff, v. Clarence Joseph DeLEEUW, Defendant. No. 73-Cr-279. United States District Court, E. D. Wisconsin. January 7, 1974. David B. Bukey, U. S. Atty., by Steven C. Underwood, Milwaukee, Wis., for plaintiff. James C. Boll, Madison, Wis., for defendant. DECISION and ORDER MYRON L. GORDON, District Judge. This matter is before me on the defendant's motions to dismiss the instant three-count indictment and to suppress evidence obtained pursuant to a search warrant. On August 10, 1973, a security supervisor for the Wisconsin Telephone Company connected a dialed number recorder to the defendant's telephone line. That device recorded those numbers which were dialed following the application to the subscriber's line of a "blue box" frequency; such frequencies activate a telephone company's long-distance mechanisms while circumventing its billing mechanism. In addition, the telephone company recorded a one minute conversation of the defendant; the tape recorder was set up in such a fashion so that it was only activated by a "blue box" frequency. On August 14, 1973, a "blue box" was seized at the defendant's residence pursuant to a search warrant. The affidavits supporting that warrant and the charges contained in the instant indictment refer to the dialed number recorder's *427 finding that three "blue box" calls were allegedly placed from the defendant's line between August 10 and August 13, 1973. I. The defendant claims that the instant indictment does not state an offense under 18 U.S.C. § 1343. The statute reads as follows: "Whoever, having devised or intending to devise any scheme or artifice to defraud, or for obtaining money or property by means of . . . fraudulent pretenses, representations or promises, transmits or causes to be transmitted by means of wire, radio, or television communication in interstate or foreign commerce, any writings, signals, pictures, or sounds for the purpose of executing such scheme or artifice, shall be fined not more than $1,000 or imprisoned not more than five years, or both." The defendant's position is that § 1343 is only applicable to schemes to defraud third persons to whom communications are directed by means of wire, radio or television, and that it is not applicable to mere schemes to obtain free telephone service. In United States v. Beckley, 259 F. Supp. 567 (N.D.Ga.1965), a similar contention was rejected by the court, which noted that: "Defendants contend that the indictment fails to allege a scheme to defraud within the meaning of Title 18, U.S.Code, § 1343 because there were no false pretenses, representations or promises to the telephone company. "It is not necessary that there be false representations or promises. All that is necessary is that it be a scheme calculated to deceive. Silverman v. United States, 213 F.2d 405 (5th Cir.). "There may be a scheme to defraud by means other than express false representations. Suhushan v. United States, 117 F.2d 110 (5th Cir.). "If there be a scheme reasonably calculated to deceive and the wires are used in the execution of it there need not be misrepresentations of fact. Silverman v. United States, supra." 259 F.Supp. at 570-571. In United States v. Jaworski, 343 F. Supp. 406 (D.Minn.1972), the court held that the use of a "blue box" is a violation of 18 U.S.C. § 1343. Reliance was placed upon the reasoning of several cases, including Beckley, supra, and Brandon v. United States, 382 F.2d 607 (10th Cir. 1967), where a subscriber who used an electronic device to jam billing equipment, thus preventing bills from being rendered to him, was found to be guilty under § 1343. I join in the Jaworski court's observation that "(W)hile none of these cases are exactly in point, their rationale seems apposite." 343 F.Supp. at 407. Therefore, I conclude that the defendant's motion to dismiss the instant indictment should be denied. II. The defendant also seeks to suppress the evidence which was obtained as a result of the search warrant. He claims that the dialed number recorder evidence supporting that search warrant was obtained in violation of 47 U.S.C. § 605. The latter section deals with the unauthorized publication of communications by a carrier and refers to 18 U.S.C. § 2511(2)(a)(i), which provides that: "It shall not be unlawful under this chapter for an operator of a switchboard, or an officer, employee, or agent of any communication common carrier, whose facilities are used in the transmission of a wire communication, to intercept, disclose, or use that communication in the normal course of his employment while engaged in any activity which is a necessary incident to the rendition of his service or the protection of the rights or property of the carrier of such communications: Provided, That said communication common carriers shall not utilize service observing or random monitoring *428 except for mechanical or service quality control checks." I believe that the action taken by the telephone company security supervisor in attaching a "blue box" detector to the defendant subscriber's line, which device recorded the numbers dialed, and conversations had on such line in only those instances where a "blue box" frequency was actually applied thereto, constituted the type of nonrandom monitoring for the protection of property which is sanctioned by 18 U.S.C. § 2511(2)(a)(i). Accordingly, I conclude that there is no violation of 47 U.S.C. § 605 involved here and that the defendant's motion to suppress is without merit. Therefore, it is ordered that the defendant's motion to dismiss the instant indictment be and hereby is denied. It is also ordered that the defendant's motion to suppress the evidence obtained as a result of the search conducted pursuant to the challenged search warrant be and hereby is denied.
Ark’s Magical Modded Minecraft Misadventure 51 : Railcraft Watertanks Just a quick episode in which I fiddle around with setting up a Railcraft watertank, in order to top up my water network. Mods Encountered Railcraft 7.3.0.0 by CovertJaguar : I was pleased and surprised that the watertank automatically powered the output pipe. While it doesn’t provide that much water, it should more than compensate for any water my occasional Carpenter use takes out the system.
lify i**(-2)*i**(-3/4)*(i**(-4)/i)/(i*(i*i**4)/i*i) assuming i is positive. i**(-55/4) Simplify (b/(b/(b**(2/11)/b)))/((b*b*b/(b/b**(2/9)*b)*b)/b)*b**(-3/7)/b**(2/15) assuming b is positive. b**(-9017/3465) Simplify (k**(-3/2)/(k**(-1)*k))/(k**3/(k*k*k/(k/k**(-1/9)))) assuming k is positive. k**(-47/18) Simplify (n/(n*(((n/n**(-2))/n*n)/n)/n))**(16/3)*n**0/n*n**3*n assuming n is positive. n**(-7/3) Simplify (a/a**6*a/a**(2/7))**(1/2) assuming a is positive. a**(-15/7) Simplify (n**(2/5)/n)**(1/7)/(n*n*n**(2/3)*n**(-1/6)*n*n) assuming n is positive. n**(-321/70) Simplify i**(-4)*i/((i**(-1/8)/i*i)/i)*i*(i/((i**(-1/8)*i)/i))/i*i*(i**(-4/5)/i)/i assuming i is positive. i**(-51/20) Simplify (y**(3/7)*y*y)**26 assuming y is positive. y**(442/7) Simplify (h/(h**5/h*h*h*h)*h*h**(-4)*h)/(h**(2/3))**(-3) assuming h is positive. h**(-6) Simplify (z**(-3/5)*z*z**(2/3))/(z**(2/3)*z/(z/(z/(((z*z**(1/2)*z)/z)/z*z)))*z) assuming z is positive. z**(-1/10) Simplify ((x*x**(-8)/x)/((x*x/x**(-3)*x)/x))**5 assuming x is positive. x**(-65) Simplify c*((c*c**3*c)/c*c*c)/c*c**(2/5)*(((c*c**(-2/5)*c)/c)/c)/(c*c**(-2)) assuming c is positive. c**7 Simplify ((u**(-2))**(18/11))**(-11/3) assuming u is positive. u**12 Simplify ((m/(m**(-1/6)*m))/((m/(m/(m*m**(-6))))/m))/((m**1*m)/m)**(3/10) assuming m is positive. m**(88/15) Simplify (z/(z**(6/5)/z)*z)/(z/(z*z/(z*z**(-2/7))*z))*((z*z*z/(z/(z**6/z))*z*z)/z)/z**10 assuming z is positive. z**(38/35) Simplify ((v**(4/3)*v*v)/v)/v**0*(v/(v/(v*v**(-5))))/v**(-1) assuming v is positive. v**(-2/3) Simplify a**(26/5)*(a**14/a)/a assuming a is positive. a**(86/5) Simplify (a/(a/(a**(1/18)*a)))/(a*a**1) assuming a is positive. a**(-17/18) Simplify (l**(-1)/(l/l**(-2)))/(((l**(-3)/l)/l)/l*l*l*l*l*l*(l*l**3)/l) assuming l is positive. l**(-6) Simplify (z/z**(-2)*(z/z**(-2/17))/z)/(z**(-2/19)*z**(7/4)) assuming z is positive. z**(1903/1292) Simplify (a*a**(-9))**(4/37) assuming a is positive. a**(-32/37) Simplify (y**(2/25)*y)**(-3/5) assuming y is positive. y**(-81/125) Simplify ((y*y**(-2/23)*y)/y*y)**(-2/13) assuming y is positive. y**(-88/299) Simplify (w**1)**(2/19)*w/(w/(w*(w*w/w**0)/w)*w)*w**(-2)*w assuming w is positive. w**(2/19) Simplify (u*u*(u**26*u)/u)**(5/12) assuming u is positive. u**(35/3) Simplify (z**(2/3)/((z**(-3)/z*z)/z))/(z/(((z*z**1)/z)/z))**(-15/7) assuming z is positive. z**(143/21) Simplify u**(-5/6)*u*u**(-2/25) assuming u is positive. u**(13/150) Simplify w**(-2/11)/(((w*w/(w*((w**(-2/15)/w)/w)/w)*w)/w)/w) assuming w is positive. w**(-547/165) Simplify l*l*l**(1/13)/l*l**(-3) assuming l is positive. l**(-25/13) Simplify (i**19*i)**(1/9) assuming i is positive. i**(20/9) Simplify (k**5*k*k*k**(1/4)*k)/(k**(1/4))**(-1/46) assuming k is positive. k**(1519/184) Simplify (l**(5/2))**(24/11) assuming l is positive. l**(60/11) Simplify ((p/(p*p**(-2/9)/p)*p)**28)**(2/43) assuming p is positive. p**(1120/387) Simplify f/f**(-15)*f**(7/5) assuming f is positive. f**(87/5) Simplify j**11*j**(-1/22)/j assuming j is positive. j**(219/22) Simplify (p/p**(2/3))**(-12)*p/(p*p/(p**(-2/9)*p)*p*p)*p**(2/7) assuming p is positive. p**(-374/63) Simplify (d**6*d)**(2/21) assuming d is positive. d**(2/3) Simplify (x**(-1))**15/(x*x*(x*x/(x**7*x))/x*x/x**(-2)) assuming x is positive. x**(-13) Simplify u**23/u*u**(1/30) assuming u is positive. u**(661/30) Simplify (d**(-1/5)/d**(-6))**(3/8) assuming d is positive. d**(87/40) Simplify b**(-35)*b**(2/27)*b assuming b is positive. b**(-916/27) Simplify (d/(d**(-24)*d))/(((d*d/(d*d**(-5/8))*d)/d)/d*d*d) assuming d is positive. d**(171/8) Simplify (l*l**(3/2))**(2/29)*l*l**(2/11)*l**(-4/3) assuming l is positive. l**(20/957) Simplify (x**(-3/4)/x)/x**(-3/7) assuming x is positive. x**(-37/28) Simplify (l/(l*(l*l*l**(-24)*l)/l))/l**(2/13) assuming l is positive. l**(284/13) Simplify ((b/(b*b**1*b))/b)**42 assuming b is positive. b**(-126) Simplify (((b/(((b**(-23/2)/b)/b)/b)*b)/b)/b*b)**(-2/101) assuming b is positive. b**(-31/101) Simplify ((f/f**(-4))/f**(-1/2))/((f/(f/f**(-1/2))*f)/f**(-1/7)) assuming f is positive. f**(34/7) Simplify ((y*y/y**(-1/4))/y**(-1))**(1/18) assuming y is positive. y**(13/72) Simplify (g/(g/(g**(-9/2)/g*g*g))*g**(3/8)/g)**(-1/26) assuming g is positive. g**(33/208) Simplify ((o*o**2)/o*o)**(-10/9) assuming o is positive. o**(-10/3) Simplify c*c*c*c**3*c**7*(c/((c/((c/c**(2/7))/c))/c*c))**(2/107) assuming c is positive. c**(9733/749) Simplify z/(z/(z*z**(-7)))*z*z*z*z/(z/z**(-1/5))*(z**2*z)/(z/(z*z**(-4))*z) assuming z is positive. z**(-26/5) Simplify (f**(1/4))**(-41)/((f/(f*f*f**(2/17)))/(f/(f/((f*((f*f**0*f)/f)/f)/f)))) assuming f is positive. f**(-621/68) Simplify (j**(2/9)*j**(2/13))/(((j*j*j*j**(-3))/j)/j**(-1/6)) assuming j is positive. j**(283/234) Simplify (y*y*y*y**(-9)*y*y**(-1/3))/(((y**0/y)/y*y)/y*y)**37 assuming y is positive. y**(95/3) Simplify (u/u**34)**20 assuming u is positive. u**(-660) Simplify (n*n**(2/7))**48/(n/(n*n*n**(2/5)/n*n))**(-2/7) assuming n is positive. n**(2146/35) Simplify (s*s*s/s**(2/49))/(s/(s*s/((s/(s**(-14)/s))/s)*s)) assuming s is positive. s**(-492/49) Simplify (a*(a*a/(a*a*a/(a*a/((a*((a*a**2*a)/a)/a)/a*a)*a)*a))/a)/((a*a**8*a)/a)*(a*a/(a*(a*a*a**(-5)/a*a*a*a)/a*a))/(a*a/a**(2/3)) assuming a is positive. a**(-31/3) Simplify (a*a**(-2/7))/(a/(a**(-8)*a))*(a**(-1/2))**(4/15) assuming a is positive. a**(-779/105) Simplify r/(r/(r*(r*(r*(r*r**(1/5)*r)/r*r)/r)/r*r))*r*r**(1/45)*r*r*r*r assuming r is positive. r**(83/9) Simplify n**(-4)/n*n**9 assuming n is positive. n**4 Simplify ((n*n/n**(-7))/(n**(-3/10)/n*n))/(n**(2/3))**(-1/36) assuming n is positive. n**(1258/135) Simplify k**(-1/7)*k**(-2/25)*k assuming k is positive. k**(136/175) Simplify (r**(-33)*r)/(r*r*r**(3/7)) assuming r is positive. r**(-241/7) Simplify ((y**7*y)/y**4)/((y**(-3)*y)/(y/((y/(y**(-6/13)*y*y))/y))) assuming y is positive. y**(111/13) Simplify h**7*h/((h*h*h**(-2)/h)/h)*h assuming h is positive. h**11 Simplify (j**2/j*j/(j**(-4)/j*j))**(2/175) assuming j is positive. j**(12/175) Simplify ((m**0)**(2/23))**26 assuming m is positive. 1 Simplify (p**(2/3)/p**(1/4))**(-5) assuming p is positive. p**(-25/12) Simplify ((((c*c**1/c)/c)/c*c)**7)**(-11) assuming c is positive. 1 Simplify (s*s/(s/(s*s/s**(-1/3)*s)))**(7/3)/(s/s**1)**(-9) assuming s is positive. s**(91/9) Simplify f**(18/5)/(((f*f*f/(f*(f**(-20)*f)/f))/f)/f) assuming f is positive. f**(-82/5) Simplify (q**(-20)*q)**(-22) assuming q is positive. q**418 Simplify (((k**(-5/4)*k)/k)/k**(-2/15))**(-1/6) assuming k is positive. k**(67/360) Simplify (x**(1/2))**(7/2)/(x/(x*x**(-7))*x/(x/(x**4*x))) assuming x is positive. x**(-41/4) Simplify (x/(x**(25/3)*x))/(x/(x/(x*x*x/x**(-3/4)))) assuming x is positive. x**(-145/12) Simplify h**(-3)*h/(h/h**(-8)*h)*h/(h/(h**7/h))*h**(1/20) assuming h is positive. h**(-119/20) Simplify (v**(-2/7))**(-43)/(v/((v**(-2)/v)/v))**(-41) assuming v is positive. v**(1521/7) Simplify (b/b**8)/(b*b**(-2)*b*b)*b/(b*b*b**(2/17))*b*b/(b/b**(-2))*b assuming b is positive. b**(-155/17) Simplify (((((w/w**(-3))/w*w)/w*w)/w)/w)/w**(-2/3)*w**(-5/6)*w**5/w assuming w is positive. w**(35/6) Simplify (v**6/v**(-3))/(v**(1/8)/(v**(-1/5)*v)) assuming v is positive. v**(387/40) Simplify (i**(-2/21)/i*i/(i**(-3/8)/i))/(i**3/i*((i**(-8)*i)/i)/i) assuming i is positive. i**(1391/168) Simplify s**(-4)/s**(-7)*((s*(s**(1/7)/s)/s*s)/s)/((s/(s/(s/(s/(s/(s*s/s**(1/7))))))*s)/s) assuming s is positive. s**3 Simplify (s**(1/6)*s)/s*s**(1/6)*(s/((s**0*s)/s))**(-8/11) assuming s is positive. s**(-13/33) Simplify ((o*o**1)/o**(-5))**(-2/21) assuming o is positive. o**(-2/3) Simplify (w**0*w)**35/(w**(-2)/(w/((w**(2/11)/w)/w))) assuming w is positive. w**(438/11) Simplify f**29*f**(-8) assuming f is positive. f**21 Simplify j/j**(1/5)*j**0*j*(j*(j*j*j/(j**(1/3)/j))/j)/(j**(2/7)*j) assuming j is positive. j**(439/105) Simplify (k**(-6/11)/(k*(k/(k*k**3)*k)/k))/(k**(2/3)/(k**(2/11)*k)) assuming k is positive. k**(65/33) Simplify (k*k**0/k)**(-15)/(k**(3/2)/((k**(-1/9)/k)/k)) assuming k is positive. k**(-65/18) Simplify m*(m**(-24)*m)/m*m/(m/(((m**(-2/9)*m)/m)/m*m))*m assuming m is positive. m**(-200/9) Simplify (q**(-2/9)/q*q/q**5)**11 assuming q is positive. q**(-517/9) Simplify (p**(-11)*p*p