instruction
stringlengths
161
2.29k
input
stringlengths
80
650
response
stringclasses
6 values
<Instruct>: Given the context 'The P2Y2 receptor has been specifically localized to the apical membrane of fresh bovine RPE cells, and addition of ATP to this membrane transiently elevates Ca2+, activates a basolateral Cl- conductance, inhibits an apical K+ conductance, and increases the apical to basolateral flow of fluid [43].', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options.
<Options>: A: bos bubalis bubalis (aka bubalus bubalis bubalis) B: bovidae C: dairy cow (aka bos taurus) D: bos taurus x bos indicus (aka bos indicus x bos taurus) E: bos (cattle) (aka bos) F: None of the above.
C
<Instruct>: Given the context 'ATP, UTP, and the P2Y2 receptor agonist INS37217 decrease the size of subretinal fluid blebs when injected into subretinal space of rats [44].', select the correct biomedical concept corresponding to 'rats'. Answer using one of the provided options.
<Options>: A: black rat (aka rattus rattus) B: rattus norvegicus albus C: rats (aka rattus norvegicus) (aka rattus norvegicus) D: rattus (rats (aka rattus)) E: rattus pyctoris (rattus rattoides) (aka rattus pyctoris) F: None of the above.
C
<Instruct>: Given the context 'In both normal and rds +/- mice with experimentally induced detachment, INS31217 improves the ERG recovery and decreased cell death [45].', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options.
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>)) B: house mouse (aka mus musculus) C: mus sp. (mice (aka mus sp.)) D: mus domesticus (aka mus musculus domesticus) E: mus castaneus (aka mus musculus castaneus) F: None of the above.
B
<Instruct>: Given the context 'INS37217 also reduces subretinal blebs in rabbits [46].', select the correct biomedical concept corresponding to 'rabbits'. Answer using one of the provided options.
<Options>: A: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus) B: cattle (aka bos) C: swamp rabbit (aka sylvilagus aquaticus) D: bovidae E: lepus cuniculus (aka oryctolagus cuniculus) F: None of the above.
E
<Instruct>: Given the context 'NMDA also triggers a release of ATP when applied to the intact bovine RPE eyecup [51].', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options.
<Options>: A: bovinae B: bovidae C: bos (cattle) (aka bos) D: bos taurus indicus (aka bos indicus) E: domestic cattle (aka bos taurus) F: None of the above.
E
<Instruct>: Given the context 'The NMDA receptors and the ATP release sites have been functionally identified to the apical membrane of the bovine RPE, suggesting the neurotransmitter interactions could amplify the signal from any glutamate reaching subretinal space. ', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options.
<Options>: A: bos taurus x bos indicus (aka bos indicus x bos taurus) B: bos primigenius taurus (aka bos taurus) C: bos taurus indicus (aka bos indicus) D: bos sp. E: bovidae F: None of the above.
B
<Instruct>: Given the context 'While the precise mechanisms by which CFTR contributes to this release are not yet known, a role for CFTR in ATP release into subretinal space is consistent with the reduction of certain ERG components in cftr -/- mice [58] and with the ability of apical ATP to activate conductances associated with these ERG components [43].', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options.
<Options>: A: mouse (aka mus <genus>) B: mus castaneus (aka mus musculus castaneus) C: eastern european house mouse (aka mus musculus musculus) D: mouse (aka mus musculus) E: mus musculoides (mus musculoides enclavae) (aka mus musculoides) F: None of the above.
D
<Instruct>: Given the context 'While the precise mechanisms by which CFTR contributes to this release are not yet known, a role for CFTR in ATP release into subretinal space is consistent with the reduction of certain ERG components in cftr -/- mice [58] and with the ability of apical ATP to activate conductances associated with these ERG components [43].', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options.
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>)) B: mus cricetus (aka cricetus cricetus) C: peromyscus D: mus musculoides (mus musculoides enclavae) (aka mus musculoides) E: mus domesticus (aka mus musculus domesticus) F: None of the above.
F
<Instruct>: Given the context 'Degradation of ATP by the apical membrane of the fresh bovine eyecup and by ARPE-19 cells is inhibited by ARL67156 or βγmATP.', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options.
<Options>: A: bovinae B: domestic cattle (aka bos taurus) C: bos taurus indicus (aka bos indicus) D: bos bubalis (aka bubalus bubalis) E: bos sp. F: None of the above.
B
<Instruct>: Given the context 'The production of adenosine from ATP at the apical membrane of the bovine RPE eyecup is inhibited by the ecto-5′-nucleotidase inhibitor αβmADP, confirming a role for this enzyme [63].', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options.
<Options>: A: bos bubalis (aka bubalus bubalis) B: dairy cow (aka bos taurus) C: bos sp. D: bovidae E: boveria F: None of the above.
B
<Instruct>: Given the context 'The enzyme is localized to rat RPE and ARPE-19 cells immunohistochemically.', select the correct biomedical concept corresponding to 'rat'. Answer using one of the provided options.
<Options>: A: rattus norvegicus albus B: rattus pyctoris (rattus rattoides) (aka rattus pyctoris) C: rats (aka rattus sp.) (aka rattus sp.) D: rat (aka rattus norvegicus) (aka rattus norvegicus) E: roof rat (aka rattus rattus) F: None of the above.
D
<Instruct>: Given the context 'Degradation of 5′AMP is highest near the subretinal space of rat retina', select the correct biomedical concept corresponding to 'rat'. Answer using one of the provided options.
<Options>: A: mus norvegicus (aka rattus norvegicus) B: rattus pyctoris (rattus rattoides) (aka rattus pyctoris) C: rattus sp. (rats (aka rattus sp.)) D: rattus (rats (aka rattus)) E: rattus rattus (rattus wroughtoni) (aka rattus rattus) F: None of the above.
A
<Instruct>: Given the context '[63], although localization in mouse indicated larger amounts of ecto-5′-nucleotidase at the tips of adjacent Müller cells', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options.
<Options>: A: house mouse (aka mus musculus) B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus) C: mus molossinus (aka mus musculus molossinus) D: mus cricetus (aka cricetus cricetus) E: mice (aka mus sp.) (aka mus sp.) F: None of the above.
A
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria ', select the correct biomedical concept corresponding to 'solanum tuberosum'. Answer using one of the provided options.
<Options>: A: solanum florulentum B: potato (aka solanum tuberosum) C: solanum hirtum D: solanum glabratum E: solanum trifolium F: None of the above.
B
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria ', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum insanum (solanum melongena var. insanum) (aka solanum insanum) B: solanum annuum C: potatoes (aka solanum tuberosum) D: solanum rugosum E: solanum F: None of the above.
C
<Instruct>: Given the context 'Gene expression studies in isolated mitochondria: Solanum tuberosum rps10 is recognized by cognate potato but not by the transcription, splicing and editing machinery of wheat mitochondria ', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum vulgare (aka triticum aestivum) B: one-grained wheat (aka triticum monococcum) C: triticum aethiopicum (aka triticum turgidum) D: triticum x secale (aka x triticosecale) E: wild emmer wheat (aka triticum dicoccoides) F: None of the above.
A
<Instruct>: Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum) B: solanum glutinosum C: tuberaria D: solanum rugosum E: sweet potato (aka ipomoea batatas) F: None of the above.
A
<Instruct>: Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: bread wheat (aka triticum aestivum) B: triticum C: triticum strictum (aka secale strictum) D: triticum aegilops (aka aegilops tauschii) E: one-grained wheat (aka triticum monococcum) F: None of the above.
A
<Instruct>: Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: wild emmer wheat (aka triticum dicoccoides) B: one-grained wheat (aka triticum monococcum) C: triticum tauschii (aka aegilops tauschii) D: rivet wheat (aka triticum turgidum) E: triticum x secale (aka x triticosecale) F: None of the above.
F
<Instruct>: Given the context 'Our aim was to compare processing and editing of potato small ribosomal protein 10 gene (rps10) transcripts in heterologous (wheat mitochondria) and homologous (potato mitochondria) contexts.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: potato (aka solanum tuberosum) B: solanum rugosum C: tuberaria D: solanum insanum (solanum melongena var. insanum) (aka solanum insanum) E: chilean potato-tree (aka solanum crispum) F: None of the above.
A
<Instruct>: Given the context 'rps10 is a suitable model because it contains a group II intron, is absent in wheat mitochondria but is actively expressed in potato mitochondria, where transcripts are spliced and undergo five C-to-U editing events.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum B: wild emmer wheat (aka triticum dicoccoides) C: one-grained wheat (aka triticum monococcum) D: durum wheat (aka triticum turgidum subsp. durum) E: triticum sativum (aka triticum aestivum) F: None of the above.
E
<Instruct>: Given the context 'rps10 is a suitable model because it contains a group II intron, is absent in wheat mitochondria but is actively expressed in potato mitochondria, where transcripts are spliced and undergo five C-to-U editing events.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera) B: solanum rugosum C: solanum ipomoeoides D: potato (aka solanum tuberosum) E: sweet potato (aka ipomoea batatas) F: None of the above.
D
<Instruct>: Given the context 'For this purpose, conditions for electroporating isolated potato mitochondria were established.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum crispum (chilean potato-tree) (aka solanum crispum) B: potatoes (aka solanum tuberosum) C: chinese-potato (aka dioscorea polystachya) D: potato yam (aka dioscorea bulbifera) E: chaco potato (aka solanum chacoense) F: None of the above.
B
<Instruct>: Given the context 'rps10 was placed under the control of either potato or wheat cox2 promoters.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum crispum (chilean potato-tree) (aka solanum crispum) B: chinese-potato (aka dioscorea polystachya) C: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera) D: potatoes (aka solanum tuberosum) E: solanum ipomoeoides F: None of the above.
D
<Instruct>: Given the context 'rps10 was placed under the control of either potato or wheat cox2 promoters.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: wild emmer wheat (aka triticum dicoccoides) B: triticum C: triticum x secale (aka x triticosecale) D: bread wheat (aka triticum aestivum) E: triticum strictum (aka secale strictum) F: None of the above.
D
<Instruct>: Given the context 'In wheat mitochondria, rps10 transcripts were neither spliced nor edited while they are correctly processed in potato mitochondria.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum tauschii (aka aegilops tauschii) B: wild emmer wheat (aka triticum dicoccoides) C: common wheat (aka triticum aestivum) D: poulard wheat (aka triticum turgidum) E: triticum strictum (aka secale strictum) F: None of the above.
C
<Instruct>: Given the context 'In wheat mitochondria, rps10 transcripts were neither spliced nor edited while they are correctly processed in potato mitochondria.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum nutans B: potatoes (aka solanum tuberosum) C: solanum ipomoeoides D: solanum annuum E: chilean potato-tree (aka solanum crispum) F: None of the above.
B
<Instruct>: Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: one-grained wheat (aka triticum monococcum) B: triticum tauschii (aka aegilops tauschii) C: triticum sativum (aka triticum aestivum) D: poulard wheat (aka triticum turgidum) E: triticum x secale (aka x triticosecale) F: None of the above.
C
<Instruct>: Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum durum (aka triticum turgidum subsp. durum) B: triticum strictum (aka secale strictum) C: bread wheat (aka triticum aestivum) D: one-grained wheat (aka triticum monococcum) E: triticum F: None of the above.
C
<Instruct>: Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: wild emmer wheat (aka triticum dicoccoides) B: one-grained wheat (aka triticum monococcum) C: rivet wheat (aka triticum turgidum) D: triticum x secale (aka x triticosecale) E: triticum F: None of the above.
F
<Instruct>: Given the context 'Interestingly, a wheat editing site grafted into rps10 was not recognized by wheat mitochondria but was correctly edited in potato mitochondria.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: air-potato (aka dioscorea bulbifera) B: potatoes (aka solanum tuberosum) C: sweet potato (aka ipomoea batatas) D: tuberaria E: solanum nutans F: None of the above.
B
<Instruct>: Given the context 'In Arabidopsis thaliana 456 C-to-U editing events have been described (6).', select the correct biomedical concept corresponding to 'arabidopsis thaliana'. Answer using one of the provided options.
<Options>: A: apophylia B: arabidopsis suecica (arabis thaliana subsp. suecica) (aka arabidopsis suecica) C: thale-cress (aka arabidopsis thaliana) D: arabidopsis thaliana x arabidopsis lyrata E: fabiana F: None of the above.
C
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria. ', select the correct biomedical concept corresponding to 'a.thaliana'. Answer using one of the provided options.
<Options>: A: land plants (aka embryophyta) B: australytta C: leguminaia D: arabidopsis thaliana (mouse-ear cress) (aka arabidopsis thaliana) E: arabidopsis thaliana x arabidopsis halleri F: None of the above.
D
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria. ', select the correct biomedical concept corresponding to 'sorghum bicolor'. Answer using one of the provided options.
<Options>: A: sorghum saccharatum (aka sorghum bicolor) B: sorghum bicolor x saccharum hybrid cultivar C: saccharum x sorghum D: sorghum (hemisorghum) (aka sorghum) E: sorghum hybrid cultivar F: None of the above.
A
<Instruct>: Given the context 'Using the same approach, Staudinger and Kempken (18) have reported that transcripts from A.thaliana cox2, but not Sorghum bicolor atp6, are edited when the genes are introduced into maize mitochondria. ', select the correct biomedical concept corresponding to 'maize'. Answer using one of the provided options.
<Options>: A: zea mexicana (aka zea mays subsp. mexicana) B: zea mays subsp. mays x zea mays subsp. mexicana C: zea mays subsp. mays x zea mays subsp. parviglumis D: zea mays var. mays (aka zea mays subsp. mays) E: zea mays (zea mays var. japonica) (aka zea mays) F: None of the above.
E
<Instruct>: Given the context 'Of particular interest is the situation of the small ribosomal protein 10 gene (rps10), a group II intron-bearing gene which is encoded in Solanum tuberosum mitochondrial DNA but is absent from the wheat mitochondrial genome (20).', select the correct biomedical concept corresponding to 'solanum tuberosum'. Answer using one of the provided options.
<Options>: A: solanum acuminatum B: solanum pyrifolium C: potato (aka solanum tuberosum) D: solanum arboreum E: solanum canense F: None of the above.
C
<Instruct>: Given the context 'Of particular interest is the situation of the small ribosomal protein 10 gene (rps10), a group II intron-bearing gene which is encoded in Solanum tuberosum mitochondrial DNA but is absent from the wheat mitochondrial genome (20).', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: poulard wheat (aka triticum turgidum) B: triticum aegilops (aka aegilops tauschii) C: one-grained wheat (aka triticum monococcum) D: wild emmer wheat (aka triticum dicoccoides) E: triticum sativum (aka triticum aestivum) F: None of the above.
E
<Instruct>: Given the context 'Using this model, we found that editing and splicing of cox2 transcripts were not linked in wheat mitochondria (15). ', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: wild emmer wheat (aka triticum dicoccoides) B: common wheat (aka triticum aestivum) C: triticum aegilops (aka aegilops tauschii) D: one-grained wheat (aka triticum monococcum) E: rivet wheat (aka triticum turgidum) F: None of the above.
B
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum succosum B: potatoes (aka solanum tuberosum) C: solanum luteum (aka solanum villosum) D: solanum hirtum E: solanum vicinum F: None of the above.
B
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: common wheat (aka triticum aestivum) B: english wheat (aka triticum turgidum) C: triticum strictum (aka secale strictum) D: wild emmer wheat (aka triticum dicoccoides) E: triticum durum (aka triticum turgidum subsp. durum) F: None of the above.
A
<Instruct>: Given the context 'To challenge the ability of mitochondrial gene expression machinery to recognize genetic information which has been lost during evolution, we decided to introduce the S.tuberosum non-cognate rps10 gene into wheat mitochondria.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum strictum (aka secale strictum) B: triticum aegilops (aka aegilops tauschii) C: triticum x secale (aka x triticosecale) D: one-grained wheat (aka triticum monococcum) E: durum wheat (aka triticum turgidum subsp. durum) F: None of the above.
F
<Instruct>: Given the context 'Five C residues are changed to U in potato mitochondria rps10 transcripts by editing.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: potatoes (aka solanum tuberosum) B: solanum giganteum C: tuberaria D: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera) E: chinese-potato (aka dioscorea polystachya) F: None of the above.
A
<Instruct>: Given the context 'To test this hypothesis, it was necessary to set up the conditions for electroporation of foreign DNA into S.tuberosum mitochondria.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum vicinum B: tuberosum group C: solanum esculentum (aka solanum lycopersicum) D: potatoes (aka solanum tuberosum) E: solanum glutinosum F: None of the above.
D
<Instruct>: Given the context 'Here, we show that a potato rps10 construct is transcribed when introduced into wheat mitochondria, but transcripts are not recognized by the post-transcriptional processing machinery.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum glutinosum B: potatoes (aka solanum tuberosum) C: solanum D: chaco potato (aka solanum chacoense) E: solanum giganteum F: None of the above.
B
<Instruct>: Given the context 'Here, we show that a potato rps10 construct is transcribed when introduced into wheat mitochondria, but transcripts are not recognized by the post-transcriptional processing machinery.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: wild emmer wheat (aka triticum dicoccoides) B: triticum aegilops (aka aegilops tauschii) C: triticum D: triticum sativum (aka triticum aestivum) E: triticum x secale (aka x triticosecale) F: None of the above.
D
<Instruct>: Given the context 'In contrast, a rps10 construct is correctly expressed and processed in cognate potato mitochondria.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: potato yam (aka dioscorea bulbifera) B: solanum insanum (solanum melongena var. insanum) (aka solanum insanum) C: solanum glutinosum D: sweet potato (aka ipomoea batatas) E: potato (aka solanum tuberosum) F: None of the above.
E
<Instruct>: Given the context 'This is the first report on DNA electroporation into potato mitochondria. MATERIALS AND METHODS Plasmids All plasmids used in this study are based on the previously described pCOXII vector (14).', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: tuberaria B: potatoes (aka solanum tuberosum) C: solanum crispum (chilean potato-tree) (aka solanum crispum) D: solanum annuum E: solanum giganteum F: None of the above.
B
<Instruct>: Given the context 'An NsiI restriction site was introduced at the initiation codon of the wheat cox2 open reading frame (ORF).', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: wild emmer wheat (aka triticum dicoccoides) B: triticum aethiopicum (aka triticum turgidum) C: triticum sativum (aka triticum aestivum) D: triticum durum (aka triticum turgidum subsp. durum) E: triticum F: None of the above.
C
<Instruct>: Given the context 'Then, NsiI was used in combination with a SpeI restriction site present in the original vector after the stop codon, to produce the chimeric vectors. S.tuberosum cox2 gene, including a 727 bp non-coding upstream region, was isolated by PCR from total DNA using the primer A designed from partial sequences reported by Löessl et al. (22),', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum succosum B: solanum esculentum (aka solanum lycopersicum) C: solanum vicinum D: potatoes (aka solanum tuberosum) E: solanum insanum (solanum melongena var. insanum) (aka solanum insanum) F: None of the above.
D
<Instruct>: Given the context 'accession no. AF096321, containing the KpnI restriction sequence, and primer B derived from Triticum timopheevi cox2 (AF336134).', select the correct biomedical concept corresponding to 'triticum timopheevi'. Answer using one of the provided options.
<Options>: A: triticum urartu B: sanduri wheat (aka triticum timopheevii) C: triticum armeniacum (aka triticum timopheevii subsp. armeniacum) D: triticum x dimococcum E: triticum dicoccoides (triticum turgidum subsp. dicoccoides) (aka triticum dicoccoides) F: None of the above.
B
<Instruct>: Given the context 'The complete sequence of the S.tuberosum cox2 was determined (accession no. DQ18064).', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum glutinosum B: solanum trifolium C: potatoes (aka solanum tuberosum) D: solanum paludosum E: tuberosum group F: None of the above.
C
<Instruct>: Given the context 'The complete sequence of the S.tuberosum cox2 was determined (accession no. DQ18064).', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum glabratum B: solanum vicinum C: solanum barbisetum D: solanum trifolium E: solanum pallidum F: None of the above.
F
<Instruct>: Given the context 'To generate the plasmid pCOXIISt containing the S.tuberosum cox2 gene, a KpnI/SpeI fragment containing the 727 bp upstream region and the complete coding region was used to replace the wheat gene from pCOXII.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum lanceaefolium (aka solanum lanceifolium) B: solanum glabratum C: solanum paludosum D: solanum hirtum E: potato (aka solanum tuberosum) F: None of the above.
E
<Instruct>: Given the context 'To generate the plasmid pCOXIISt containing the S.tuberosum cox2 gene, a KpnI/SpeI fragment containing the 727 bp upstream region and the complete coding region was used to replace the wheat gene from pCOXII.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum B: english wheat (aka triticum turgidum) C: one-grained wheat (aka triticum monococcum) D: triticum durum (aka triticum turgidum subsp. durum) E: triticum sativum (aka triticum aestivum) F: None of the above.
E
<Instruct>: Given the context 'This 23 bp insertion provides a specific sequence allowing isolation of potato cox2 transcripts originating from the introduced DNA by RT–PCR.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum glutinosum B: solanum insanum (solanum melongena var. insanum) (aka solanum insanum) C: potato (aka solanum tuberosum) D: chaco potato (aka solanum chacoense) E: solanum F: None of the above.
C
<Instruct>: Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII. ', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum B: one-grained wheat (aka triticum monococcum) C: triticum tauschii (aka aegilops tauschii) D: triticum vulgare (aka triticum aestivum) E: poulard wheat (aka triticum turgidum) F: None of the above.
D
<Instruct>: Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII. ', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum rugosum B: solanum ipomoeoides C: solanum crispum (chilean potato-tree) (aka solanum crispum) D: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum) E: solanum F: None of the above.
D
<Instruct>: Given the context 'The chimeric wheat/potato cox2 gene was constructed by replacing 727 bp KpnI/NsiI promoter sequence from pCOXIISt with the 880 bp wheat upstream region from pCOXII. ', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: one-grained wheat (aka triticum monococcum) B: triticum strictum (aka secale strictum) C: triticum x secale (aka x triticosecale) D: triticum aethiopicum (aka triticum turgidum) E: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum) F: None of the above.
E
<Instruct>: Given the context 'The vectors pRPS10W and the pRPS10St derivative, containing wheat and potato cox2 promoters, respectively, were constructed by inserting the 1178 bp rps10 sequence containing two exons separated by a 777 bp intronic sequence [(23), accession no.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum strictum (aka secale strictum) B: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum) C: wild emmer wheat (aka triticum dicoccoides) D: triticum E: triticum aegilops (aka aegilops tauschii) F: None of the above.
B
<Instruct>: Given the context 'The vectors pRPS10W and the pRPS10St derivative, containing wheat and potato cox2 promoters, respectively, were constructed by inserting the 1178 bp rps10 sequence containing two exons separated by a 777 bp intronic sequence [(23), accession no.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum glutinosum B: chaco potato (aka solanum chacoense) C: sweet potato (aka ipomoea batatas) D: potato yam (aka dioscorea bulbifera) E: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum) F: None of the above.
E
<Instruct>: Given the context 'The coding region was isolated from total S.tuberosum DNA by PCR using primers D1 and D2 containing the restriction sites NsiI and SpeI, respectively.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum florulentum B: solanum vicinum C: solanum hirtum D: potatoes (aka solanum tuberosum) E: solanum barbisetum F: None of the above.
D
<Instruct>: Given the context 'Since all vectors used here were based on pCOXII, they contain the downstream region from the wheat cob gene (Ir-cob) (accession no. AF337547) (14).', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum B: wild emmer wheat (aka triticum dicoccoides) C: english wheat (aka triticum turgidum) D: triticum x secale (aka x triticosecale) E: bread wheat (aka triticum aestivum) F: None of the above.
E
<Instruct>: Given the context 'Since all vectors used here were based on pCOXII, they contain the downstream region from the wheat cob gene (Ir-cob) (accession no. AF337547) (14).', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: durum wheat (aka triticum turgidum subsp. durum) B: poulard wheat (aka triticum turgidum) C: triticum x secale (aka x triticosecale) D: wild emmer wheat (aka triticum dicoccoides) E: triticum strictum (aka secale strictum) F: None of the above.
F
<Instruct>: Given the context 'For constructs MA and MAB containing the wheat cox2 C259 editing site, two consecutive insertions were carried out using primers: GGAAGATTGGATTACTATCGAAATTGCCCTGAATCA and TACTATCGAAATTATTCGGACCATGCCCTGAATCA.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: rivet wheat (aka triticum turgidum) B: durum wheat (aka triticum turgidum subsp. durum) C: triticum strictum (aka secale strictum) D: triticum sativum (aka triticum aestivum) E: wild emmer wheat (aka triticum dicoccoides) F: None of the above.
D
<Instruct>: Given the context 'Mitochondria purification S.tuberosum cv.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum mammosum B: solanum esculentum (aka solanum lycopersicum) C: potato (aka solanum tuberosum) D: solanum glutinosum E: solanum paludosum F: None of the above.
C
<Instruct>: Given the context 'Potato mitochondria were prepared from 2 kg of tubers in batches of 200 g with 200 ml of a homogenization buffer containing 0.4 M mannitol, 25 mM MOPS (pH 7.8), 1 mM EGTA, 8 mM cysteine and 1 mg/ml fatty acid-free BSA.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum) B: solanum nutans C: solanum ipomoeoides D: solanum giganteum E: solanum annuum F: None of the above.
A
<Instruct>: Given the context 'The supernatant was centrifuged in a Sorvall SS-34 rotor at 15 000 g for 10 min, the pellet was resuspended in 12 ml of homogenization buffer and mitochondria were purified by centrifugation on a sucrose gradient essentially as described for wheat embryo mitochondria (14). ', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum strictum (aka secale strictum) B: triticum tauschii (aka aegilops tauschii) C: one-grained wheat (aka triticum monococcum) D: common wheat (aka triticum aestivum) E: triticum F: None of the above.
D
<Instruct>: Given the context 'Electroporation Electrotransfer experiments were carried out with 1 mg of purified wheat embryo or potato tuber mitochondria in 50 µl of 0.33 M sucrose and 1 µg of recombinant plasmid as described (14).', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: durum wheat (aka triticum turgidum subsp. durum) B: rivet wheat (aka triticum turgidum) C: common wheat (aka triticum aestivum) D: one-grained wheat (aka triticum monococcum) E: wild emmer wheat (aka triticum dicoccoides) F: None of the above.
C
<Instruct>: Given the context 'Electroporation Electrotransfer experiments were carried out with 1 mg of purified wheat embryo or potato tuber mitochondria in 50 µl of 0.33 M sucrose and 1 µg of recombinant plasmid as described (14).', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera) B: solanum nutans C: solanum crispum (chilean potato-tree) (aka solanum crispum) D: potato (aka solanum tuberosum) E: solanum F: None of the above.
D
<Instruct>: Given the context 'In the case of potato mitochondria the incubation mixture was supplemented with 1 mg/ml of fatty acid-free BSA.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum annuum B: dioscorea bulbifera (potato yam) (aka dioscorea bulbifera) C: solanum glutinosum D: sweet potato (aka ipomoea batatas) E: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum) F: None of the above.
E
<Instruct>: Given the context 'One microliter of 20% SDS was added to achieve mitochondrial lysis and the DNA was extracted with phenol/chloroform, precipitated with 0.1 vol of 3 M Sodium Acetate (pH 5.2), 3 vol of 100% ethanol and 100 ng of carrier yeast tRNA and left overnight at −20°C.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options.
<Options>: A: saccharomyces hansenii (aka debaryomyces hansenii) B: baker's yeast (aka saccharomyces cerevisiae) C: saccharomyces sp. D: candida/saccharomycetales (aka candida/saccharomycales clade) E: saccharomycodes F: None of the above.
B
<Instruct>: Given the context 'DNA sequencing Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem). RESULTS S.tuberosum rps10 transcripts are not processed in wheat mitochondria The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum pallidum B: potato (aka solanum tuberosum) C: tuberosum group D: solanum barbisetum E: solanum tuberosum var. boreale (aka solanum stoloniferum) F: None of the above.
B
<Instruct>: Given the context 'DNA sequencing Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem). RESULTS S.tuberosum rps10 transcripts are not processed in wheat mitochondria The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum durum (aka triticum turgidum subsp. durum) B: triticum x secale (aka x triticosecale) C: triticum sativum (aka triticum aestivum) D: poulard wheat (aka triticum turgidum) E: triticum F: None of the above.
C
<Instruct>: Given the context 'DNA sequencing Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem). RESULTS S.tuberosum rps10 transcripts are not processed in wheat mitochondria The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum x secale (aka x triticosecale) B: triticum C: rivet wheat (aka triticum turgidum) D: triticum strictum (aka secale strictum) E: wild emmer wheat (aka triticum dicoccoides) F: None of the above.
F
<Instruct>: Given the context 'DNA sequencing Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem). RESULTS S.tuberosum rps10 transcripts are not processed in wheat mitochondria The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: tuberosum group B: solanum glutinosum C: solanum pallidum D: potatoes (aka solanum tuberosum) E: solanum vicinum F: None of the above.
D
<Instruct>: Given the context 'DNA sequencing Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem). RESULTS S.tuberosum rps10 transcripts are not processed in wheat mitochondria The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: poulard wheat (aka triticum turgidum) B: bread wheat (aka triticum aestivum) C: one-grained wheat (aka triticum monococcum) D: triticum x secale (aka x triticosecale) E: triticum strictum (aka secale strictum) F: None of the above.
B
<Instruct>: Given the context 'DNA sequencing Sequence analyses were performed directly on the RT–PCR product using an automatic DNA sequencing equipment with the BigDye® Terminator Cycle Sequencing Kit (Applied Biosystem). RESULTS S.tuberosum rps10 transcripts are not processed in wheat mitochondria The S.tuberosum rps10 construct under control of a wheat cox2 promoter (Figure 1A) was incorporated into purified wheat mitochondria by electroporation as indicated in Materials and Methods.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum aestivum subsp. aestivum (aka triticum aestivum) B: triticum x secale (aka x triticosecale) C: triticum strictum (aka secale strictum) D: one-grained wheat (aka triticum monococcum) E: wild emmer wheat (aka triticum dicoccoides) F: None of the above.
A
<Instruct>: Given the context 'The primers used allowed detection of the transcripts generated by the constructs introduced and excluded any product from endogenous cox2 (or rps10 in the potato system).', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum crispum (chilean potato-tree) (aka solanum crispum) B: solanum glutinosum C: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum) D: solanum nutans E: air-potato (aka dioscorea bulbifera) F: None of the above.
C
<Instruct>: Given the context 'Previously, five C residues, two in exon 1, one in the intron and two in exon 2 have been reported to be changed to U by editing in potato mitochondria (23).', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum ipomoeoides B: tuberaria C: potato (aka solanum tuberosum) D: solanum E: solanum nutans F: None of the above.
C
<Instruct>: Given the context 'To determine if the non-cognate transcript could be recognized by the wheat RNA editing machinery, the 1204 bp RT–PCR product was sequenced.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum tauschii (aka aegilops tauschii) B: one-grained wheat (aka triticum monococcum) C: triticum aestivum subsp. aestivum (aka triticum aestivum) D: triticum strictum (aka secale strictum) E: durum wheat (aka triticum turgidum subsp. durum) F: None of the above.
C
<Instruct>: Given the context 'While wheat cox2 editing sites were correctly edited in control as expected (Figure 1C, only site C77 is shown), all five editable residues in potato rps10 transcript remain unchanged.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum x secale (aka x triticosecale) B: wild emmer wheat (aka triticum dicoccoides) C: triticum D: triticum aestivum subsp. aestivum (aka triticum aestivum) E: durum wheat (aka triticum turgidum subsp. durum) F: None of the above.
D
<Instruct>: Given the context 'While wheat cox2 editing sites were correctly edited in control as expected (Figure 1C, only site C77 is shown), all five editable residues in potato rps10 transcript remain unchanged.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: chinese-potato (aka dioscorea polystachya) B: solanum insanum (solanum melongena var. insanum) (aka solanum insanum) C: solanum annuum D: potatoes (aka solanum tuberosum) E: solanum crispum (chilean potato-tree) (aka solanum crispum) F: None of the above.
D
<Instruct>: Given the context 'cox2 C77 editing sites are identical in potato and wheat. ', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum rugosum B: sweet potato (aka ipomoea batatas) C: tuberaria D: solanum ipomoeoides E: potatoes (aka solanum tuberosum) F: None of the above.
E
<Instruct>: Given the context 'cox2 C77 editing sites are identical in potato and wheat. ', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: rivet wheat (aka triticum turgidum) B: triticum durum (aka triticum turgidum subsp. durum) C: wheat (aka triticum aestivum) D: wild emmer wheat (aka triticum dicoccoides) E: triticum F: None of the above.
C
<Instruct>: Given the context 'cox2 C77 editing sites are identical in potato and wheat. ', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: english wheat (aka triticum turgidum) B: triticum C: one-grained wheat (aka triticum monococcum) D: triticum x secale (aka x triticosecale) E: triticum tauschii (aka aegilops tauschii) F: None of the above.
F
<Instruct>: Given the context 'Failure of rps10 transcript splicing in wheat mitochondria is not linked to the absence of editing It has been suggested that residues C2 and C3 participate in the secondary structure of the intron necessary for splicing (23).', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: rivet wheat (aka triticum turgidum) B: common wheat (aka triticum aestivum) C: triticum aegilops (aka aegilops tauschii) D: durum wheat (aka triticum turgidum subsp. durum) E: triticum x secale (aka x triticosecale) F: None of the above.
B
<Instruct>: Given the context 'Electroporation of S.tuberosum mitochondria Since two important post-transcriptional processes, RNA editing and splicing, were inoperative when S.tuberosum rps10 was expressed in wheat mitochondria, we decided to verify whether the negative results were inherent to the rps10 chimeric constructs or due to the lack of trans-recognition elements in wheat mitochondria.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: potato (aka solanum tuberosum) B: solanum insanum (solanum melongena var. insanum) (aka solanum insanum) C: solanum mammosum D: tuberosum group E: solanum hirtum F: None of the above.
A
<Instruct>: Given the context 'Electroporation of S.tuberosum mitochondria Since two important post-transcriptional processes, RNA editing and splicing, were inoperative when S.tuberosum rps10 was expressed in wheat mitochondria, we decided to verify whether the negative results were inherent to the rps10 chimeric constructs or due to the lack of trans-recognition elements in wheat mitochondria.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum glabratum B: solanum ruvu C: solanum luteum (aka solanum villosum) D: potato (aka solanum tuberosum) E: solanum succosum F: None of the above.
D
<Instruct>: Given the context 'Electroporation of S.tuberosum mitochondria Since two important post-transcriptional processes, RNA editing and splicing, were inoperative when S.tuberosum rps10 was expressed in wheat mitochondria, we decided to verify whether the negative results were inherent to the rps10 chimeric constructs or due to the lack of trans-recognition elements in wheat mitochondria.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum) B: durum wheat (aka triticum turgidum subsp. durum) C: triticum x secale (aka x triticosecale) D: one-grained wheat (aka triticum monococcum) E: triticum strictum (aka secale strictum) F: None of the above.
A
<Instruct>: Given the context 'Electroporation of S.tuberosum mitochondria Since two important post-transcriptional processes, RNA editing and splicing, were inoperative when S.tuberosum rps10 was expressed in wheat mitochondria, we decided to verify whether the negative results were inherent to the rps10 chimeric constructs or due to the lack of trans-recognition elements in wheat mitochondria.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: wild emmer wheat (aka triticum dicoccoides) B: durum wheat (aka triticum turgidum subsp. durum) C: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum) D: triticum x secale (aka x triticosecale) E: triticum F: None of the above.
C
<Instruct>: Given the context 'For this purpose, it was necessary to set up an electroporation protocol adapted to S.tuberosum mitochondria.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum barbisetum B: solanum glutinosum C: potato (aka solanum tuberosum) D: solanum pallidum E: solanum mammosum F: None of the above.
C
<Instruct>: Given the context 'Purified organelles were prepared from potato tubers as indicated in Materials and Methods.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: solanum annuum B: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum) C: sweet potato (aka ipomoea batatas) D: chinese-potato (aka dioscorea polystachya) E: solanum insanum (solanum melongena var. insanum) (aka solanum insanum) F: None of the above.
B
<Instruct>: Given the context 'Potato mitochondria show a broad range response with a maximum around 13 kV (Figure 3).', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: chilean potato-tree (aka solanum crispum) B: solanum C: solanum tuberosum (solanum aracc-papa) (aka solanum tuberosum) D: tuberaria E: solanum annuum F: None of the above.
C
<Instruct>: Given the context 'This voltage setting was therefore used for further experiments. S.tuberosum mitochondria does not recognize the wheat cox2 promoter To ascertain the ability of electroporated mitochondria to perform expression of the exogenous gene construct, we used a plasmid containing the potato cox2 gene controlled either by T.aestivum or S.tuberosum promoters.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum luteum (aka solanum villosum) B: potatoes (aka solanum tuberosum) C: solanum lanceaefolium (aka solanum lanceifolium) D: solanum barbisetum E: solanum esculentum (aka solanum lycopersicum) F: None of the above.
B
<Instruct>: Given the context 'This voltage setting was therefore used for further experiments. S.tuberosum mitochondria does not recognize the wheat cox2 promoter To ascertain the ability of electroporated mitochondria to perform expression of the exogenous gene construct, we used a plasmid containing the potato cox2 gene controlled either by T.aestivum or S.tuberosum promoters.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: triticum durum (aka triticum turgidum subsp. durum) B: triticum aestivum (triticum aestivum subsp. aestivum) (aka triticum aestivum) C: one-grained wheat (aka triticum monococcum) D: triticum x secale (aka x triticosecale) E: triticum aegilops (aka aegilops tauschii) F: None of the above.
B
<Instruct>: Given the context 'This voltage setting was therefore used for further experiments. S.tuberosum mitochondria does not recognize the wheat cox2 promoter To ascertain the ability of electroporated mitochondria to perform expression of the exogenous gene construct, we used a plasmid containing the potato cox2 gene controlled either by T.aestivum or S.tuberosum promoters.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: one-grained wheat (aka triticum monococcum) B: triticum x secale (aka x triticosecale) C: triticum tauschii (aka aegilops tauschii) D: triticum E: wild emmer wheat (aka triticum dicoccoides) F: None of the above.
F
<Instruct>: Given the context 'This voltage setting was therefore used for further experiments. S.tuberosum mitochondria does not recognize the wheat cox2 promoter To ascertain the ability of electroporated mitochondria to perform expression of the exogenous gene construct, we used a plasmid containing the potato cox2 gene controlled either by T.aestivum or S.tuberosum promoters.', select the correct biomedical concept corresponding to 'potato'. Answer using one of the provided options.
<Options>: A: potato (aka solanum tuberosum) B: solanum nutans C: solanum crispum (chilean potato-tree) (aka solanum crispum) D: chaco potato (aka solanum chacoense) E: chinese-potato (aka dioscorea polystachya) F: None of the above.
A
<Instruct>: Given the context 'This voltage setting was therefore used for further experiments. S.tuberosum mitochondria does not recognize the wheat cox2 promoter To ascertain the ability of electroporated mitochondria to perform expression of the exogenous gene construct, we used a plasmid containing the potato cox2 gene controlled either by T.aestivum or S.tuberosum promoters.', select the correct biomedical concept corresponding to 't.aestivum'. Answer using one of the provided options.
<Options>: A: triticum aestivum var. aureum B: triticum sativum (aka triticum aestivum) C: triticum D: triticum vulgare var. miltura (aka triticum aestivum var. milturum) E: triticum turgidum subsp. pyramidale (triticum pyramidale) (aka triticum turgidum subsp. pyramidale) F: None of the above.
B
<Instruct>: Given the context 'This voltage setting was therefore used for further experiments. S.tuberosum mitochondria does not recognize the wheat cox2 promoter To ascertain the ability of electroporated mitochondria to perform expression of the exogenous gene construct, we used a plasmid containing the potato cox2 gene controlled either by T.aestivum or S.tuberosum promoters.', select the correct biomedical concept corresponding to 's.tuberosum'. Answer using one of the provided options.
<Options>: A: solanum pallidum B: solanum florulentum C: solanum trifolium D: potatoes (aka solanum tuberosum) E: solanum esculentum (aka solanum lycopersicum) F: None of the above.
D
<Instruct>: Given the context 'As shown in Figure 4, the construct containing the wheat or potato promoters was transcribed only in cognate mitochondria.', select the correct biomedical concept corresponding to 'wheat'. Answer using one of the provided options.
<Options>: A: wild emmer wheat (aka triticum dicoccoides) B: poulard wheat (aka triticum turgidum) C: triticum aestivum subsp. aestivum (aka triticum aestivum) D: triticum aegilops (aka aegilops tauschii) E: one-grained wheat (aka triticum monococcum) F: None of the above.
C