instruction stringlengths 161 2.29k | input stringlengths 80 650 | response stringclasses 6 values |
|---|---|---|
<Instruct>: Given the context 'Of particular interests is the presence of highly conserved sequences in the 5' -flanking region of the human and mouse IL-2 gene (Fig. 4). ', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus cricetus (aka cricetus cricetus)
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: mice (aka mus sp.) (aka mus sp.)
D: mus molossinus (aka mus musculus molossinus)
E: mus musculus (house mouse) (aka mus musculus)
F: None of the above. | E |
<Instruct>: Given the context 'Since we have not yet determined the nucleotide sequence further upstream of the mouse gene, we do not know whether or not this similarity extends further. ', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus molossinus (aka mus musculus molossinus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus cricetus (aka cricetus cricetus)
D: mus musculus (house mouse) (aka mus musculus)
E: mus sp. (mice (aka mus sp.))
F: None of the above. | D |
<Instruct>: Given the context 'Our preliminary results indicate that the 5 '-flanking sequence of the human IL-2 gene mediates mitogen induced expression of the gene in T-lymphocytic cells (Fujita & Taniguchi, unpublished observation).
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: this
B: eutherian mammals (aka eutheria)
C: mammals (aka mammalia)
D: primate (aka primates)
E: human (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'We thank Dr. T. Honjo for mouse gene library. ', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
B: mus molossinus (aka mus musculus molossinus)
C: house mouse (aka mus musculus)
D: mus cricetus (aka cricetus cricetus)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: None of the above. | C |
<Instruct>: Given the context 'We thank Dr. T. Honjo for mouse gene library. ', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus (aka mus <genus>) (aka mus <genus>)
C: peromyscus
D: eastern european house mouse (aka mus musculus musculus)
E: mus cricetus (aka cricetus cricetus)
F: None of the above. | F |
<Instruct>: Given the context 'More than half of human genes are known to have alternative polyadenylation (31).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: genus
B: kingdom
C: suborder
D: macrobiotus sapiens
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Over two-thirds of human genes are thought to undergo alternative splicing (32).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: biota (aka cellular organisms)
B: kingdom
C: homo sapiens (human) (aka homo sapiens)
D: primate (aka primates)
E: probles
F: None of the above. | C |
<Instruct>: Given the context 'Although, G-quadruplexes have been surveyed in the human genome with such techniques (34,35), there are no known user-friendly computational tools easily accessible to the public.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: biota (aka cellular organisms)
C: primate (aka primates)
D: macrobiotus sapiens
E: species
F: None of the above. | A |
<Instruct>: Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: mammals (aka mammalia)
B: this
C: human (aka homo sapiens)
D: species
E: kingdom
F: None of the above. | C |
<Instruct>: Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: peromyscus
B: house mouse (aka mus musculus)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: mice (aka mus sp.) (aka mus sp.)
E: mus (aka mus <genus>) (aka mus <genus>)
F: None of the above. | B |
<Instruct>: Given the context 'For example, entering the gene ID 403437 results in downloading the Brca1 gene sequence for Canis familiaris.', select the correct biomedical concept corresponding to 'canis familiaris'. Answer using one of the provided options. | <Options>: A: canis canis (aka canis lupus familiaris)
B: canis lupus nubilus
C: canis lupus (grey wolf) (aka canis lupus)
D: canis vulpes (aka vulpes vulpes)
E: canidae (dog, coyote, wolf, fox) (aka canidae)
F: None of the above. | A |
<Instruct>: Given the context 'For example, the mouse version of the gene PTPRU, which is 69822 bases long, contains 94681 QGRS of length up to 45 bases.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus (aka mus <subgenus>) (aka mus <subgenus>)
C: mus sp. (mice (aka mus sp.))
D: mus (aka mus <genus>) (aka mus <genus>)
E: mouse (aka mus musculus)
F: None of the above. | E |
<Instruct>: Given the context 'As an example, the Gene View for the human GREB1 is displayed in Figure 2, showing the table of gene information and product information for the first product (the output for all products may be seen in the supplementary material).
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: human (aka homo sapiens)
B: avian (aka aves)
C: macrobiotus sapiens
D: animals (aka metazoa)
E: kingdom
F: None of the above. | A |
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces hansenii (aka debaryomyces hansenii)
B: candida/saccharomycetales (aka candida/saccharomycales clade)
C: brewer's yeast (aka saccharomyces cerevisiae)
D: true yeasts (aka saccharomycotina)
E: saccharomyces cf. cerevisiae
F: None of the above. | C |
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept corresponding to 'saccharomyces cerevisiae'. Answer using one of the provided options. | <Options>: A: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
B: saccharomyces sp.
C: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
D: saccharomyces cerevisiae x saccharomyces mikatae
E: saccharomyces cerevisiae x saccharomyces paradoxus
F: None of the above. | A |
<Instruct>: Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis
Abstract
ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', select the correct biomedical concept corresponding to 'saccharomyces cerevisiae'. Answer using one of the provided options. | <Options>: A: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
B: saccharomyces cerevisiae x saccharomyces mikatae
C: saccharomyces cerevisiae x saccharomyces uvarum
D: saccharomyces paradoxus
E: saccharomyces lactis (aka kluyveromyces lactis)
F: None of the above. | F |
<Instruct>: Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces albicans (aka candida albicans)
B: budding yeasts & others (aka saccharomycotina)
C: saccharomyces cerevisiae x saccharomyces mikatae
D: baker's yeast (aka saccharomyces cerevisiae)
E: candida/saccharomycetales (aka candida/saccharomycales clade)
F: None of the above. | D |
<Instruct>: Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', select the correct biomedical concept corresponding to 'saccharomyces cerevisiae'. Answer using one of the provided options. | <Options>: A: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
B: saccharomyces lactis (aka kluyveromyces lactis)
C: saccharomyces cf. cerevisiae
D: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
E: saccharomyces paradoxus
F: None of the above. | D |
<Instruct>: Given the context 'In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces cf. cerevisiae
B: saccharomycodes
C: saccharomyces hansenii (aka debaryomyces hansenii)
D: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
E: saccharomyces cerevisiae x saccharomyces mikatae
F: None of the above. | D |
<Instruct>: Given the context 'The yeast protein was localized to the nucleus in a previous study (18).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
B: saccharomycodes
C: saccharomyces lactis (aka kluyveromyces lactis)
D: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
E: saccharomyces cerevisiae x saccharomyces mikatae
F: None of the above. | A |
<Instruct>: Given the context 'On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19).
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: kingdom
B: species
C: placental mammals (aka eutheria)
D: homo sapiens (human) (aka homo sapiens)
E: humans (aka homo)
F: None of the above. | D |
<Instruct>: Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved.
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: genus
B: macrobiotus sapiens
C: human (aka homo sapiens)
D: birds (aka aves)
E: animals (aka metazoa)
F: None of the above. | C |
<Instruct>: Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved.
', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
B: saccharomyces lactis (aka kluyveromyces lactis)
C: saccharomyceta
D: saccharomyces cf. cerevisiae
E: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
F: None of the above. | A |
<Instruct>: Given the context 'MATERIALS AND METHODS
Yeast strains and media
The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyceta
B: saccharomyces hansenii (aka debaryomyces hansenii)
C: brewer's yeast (aka saccharomyces cerevisiae)
D: saccharomyces sp.
E: saccharomyces cf. cerevisiae
F: None of the above. | C |
<Instruct>: Given the context 'MATERIALS AND METHODS
Yeast strains and media
The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', select the correct biomedical concept corresponding to 's.cerevisiae'. Answer using one of the provided options. | <Options>: A: saccharomyces albicans (aka candida albicans)
B: saccharomyces cf. cerevisiae
C: mycoderma cerevisiae (aka saccharomyces cerevisiae)
D: saccharomyces hansenii (aka debaryomyces hansenii)
E: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
F: None of the above. | C |
<Instruct>: Given the context 'Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18).', select the correct biomedical concept corresponding to 'schizosaccharomyces pombe'. Answer using one of the provided options. | <Options>: A: schizosaccharomyces osmophilus
B: schizosaccharomyces pombe oy26
C: sphaerospermum (aka sphaerospermopsis)
D: schizosaccharomyces japonicus var. japonicus (aka schizosaccharomyces japonicus)
E: schizosaccharomyces pombe (schizosaccharomyces malidevorans) (aka schizosaccharomyces pombe)
F: None of the above. | E |
<Instruct>: Given the context 'Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18).', select the correct biomedical concept corresponding to 'schizosaccharomyces pombe'. Answer using one of the provided options. | <Options>: A: schizosaccharomyces
B: sphaerospermopsis (sphaerospermum) (aka sphaerospermopsis)
C: schizosaccharomyces japonicus var. japonicus (aka schizosaccharomyces japonicus)
D: schizosaccharomycetes (archiascomycota) (aka schizosaccharomycetes)
E: zygosaccharomyces
F: None of the above. | F |
<Instruct>: Given the context '[MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: mammals (aka mammalia)
B: homo sapiens (human) (aka homo sapiens)
C: animals (aka metazoa)
D: suborder
E: primate (aka primates)
F: None of the above. | B |
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: human (aka homo sapiens)
B: kingdom
C: birds (aka aves)
D: species
E: cellular organisms (biota) (aka cellular organisms)
F: None of the above. | A |
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
B: brewer's yeast (aka saccharomyces cerevisiae)
C: saccharomyces cf. cerevisiae
D: saccharomyces cerevisiae x saccharomyces mikatae
E: saccharomyces lactis (aka kluyveromyces lactis)
F: None of the above. | B |
<Instruct>: Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: biota (aka cellular organisms)
B: probles
C: mammals (aka mammalia)
D: human (aka homo sapiens)
E: avian (aka aves)
F: None of the above. | D |
<Instruct>: Given the context 'The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118.
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: genus
B: homo (humans) (aka homo)
C: suborder
D: eutherian mammals (aka eutheria)
E: human (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: house mouse (aka mus musculus)
B: mouse (aka mus <genus>)
C: mus <subgenus> (mus (aka mus <subgenus>))
D: mus cricetus (aka cricetus cricetus)
E: mice (aka mus sp.) (aka mus sp.)
F: None of the above. | A |
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept corresponding to 'donkey'. Answer using one of the provided options. | <Options>: A: equus asinus x equus caballus (hybrid of male donkey and female horse) (aka equus asinus x equus caballus)
B: equus ferus (equus caballus ferus) (aka equus ferus)
C: equus africanus (aka equus asinus africanus)
D: donkey (aka equus asinus)
E: equus subg. asinus (aka equus)
F: None of the above. | D |
<Instruct>: Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mice (aka mus sp.) (aka mus sp.)
C: mus cricetus (aka cricetus cricetus)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
F: None of the above. | A |
<Instruct>: Given the context 'Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: mus cricetus (aka cricetus cricetus)
C: western european house mouse (aka mus musculus domesticus)
D: mouse (aka mus musculus)
E: mus molossinus (aka mus musculus molossinus)
F: None of the above. | D |
<Instruct>: Given the context 'RESULTS
Construction and analysis of ENP1 temperature-sensitive alleles
ENP1 is an essential yeast gene conserved among eukaryotes (18).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: true yeasts (aka saccharomycotina)
B: saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (aka saccharomyces cerevisiae)
C: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
D: saccharomyces lactis (aka kluyveromyces lactis)
E: saccharomyces sp.
F: None of the above. | B |
<Instruct>: Given the context 'RESULTS
Construction and analysis of ENP1 temperature-sensitive alleles
ENP1 is an essential yeast gene conserved among eukaryotes (18).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: candida/saccharomycetales (aka candida/saccharomycales clade)
B: saccharomyces hansenii (aka debaryomyces hansenii)
C: budding yeasts & others (aka saccharomycotina)
D: saccharomyces lactis (aka kluyveromyces lactis)
E: saccharomyces cf. cerevisiae
F: None of the above. | F |
<Instruct>: Given the context 'The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity.', select the correct biomedical concept corresponding to 'staphylococcus aureus'. Answer using one of the provided options. | <Options>: A: micrococcus epidermidis (aka staphylococcus epidermidis)
B: staphylococcus staphylolyticus (aka staphylococcus simulans bv. staphylolyticus)
C: staphylococcus sp. s
D: staphylococcus group (aka staphylococcaceae)
E: micrococcus pyogenes (aka staphylococcus aureus)
F: None of the above. | E |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: birds (aka aves)
B: homo sapiens (human) (aka homo sapiens)
C: mammals (aka mammalia)
D: kingdom
E: cellular organisms (biota) (aka cellular organisms)
F: None of the above. | B |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept corresponding to 'drosophila'. Answer using one of the provided options. | <Options>: A: melanogaster (aka melanogaster <flies>)
B: drosophila melanogaster (sophophora melanogaster) (aka drosophila melanogaster)
C: drosophila (aka drosophila <basidiomycete fungi>)
D: drosophila (aka drosophila <flies,subgenus>)
E: melanogaster <basidiomycete fungi> (melanogaster) (aka melanogaster <basidiomycete fungi>)
F: None of the above. | B |
<Instruct>: Given the context 'Comparison of Enp1 with homologs in other organisms
Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', select the correct biomedical concept corresponding to 'caenorhabditis elegans'. Answer using one of the provided options. | <Options>: A: caenorhabditis vulgaris (aka caenorhabditis remanei)
B: elegans subgroup (in: flies)
C: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans)
D: gongylostoma elegans elegans (clausilia elegans elegans) (aka gongylostoma elegans elegans)
E: enyo elegans (aka zodarion elegans)
F: None of the above. | C |
<Instruct>: Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: humans (aka homo)
B: genus
C: homo sapiens (human) (aka homo sapiens)
D: cellular organisms (biota) (aka cellular organisms)
E: suborder
F: None of the above. | C |
<Instruct>: Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces sp.
B: saccharomyces lactis (aka kluyveromyces lactis)
C: saccharomyces cf. cerevisiae
D: brewer's yeast (aka saccharomyces cerevisiae)
E: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
F: None of the above. | D |
<Instruct>: Given the context 'In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: primate (aka primates)
B: genus
C: macrobiotus sapiens
D: suborder
E: human (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: primate (aka primates)
C: kingdom
D: homo (humans) (aka homo)
E: animals (aka metazoa)
F: None of the above. | A |
<Instruct>: Given the context 'Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: macrobiotus sapiens
B: species
C: homo sapiens (human) (aka homo sapiens)
D: animals (aka metazoa)
E: primate (aka primates)
F: None of the above. | C |
<Instruct>: Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: cellular organisms (biota) (aka cellular organisms)
B: avian (aka aves)
C: suborder
D: probles
E: human (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: species
B: this
C: primate (aka primates)
D: homo (humans) (aka homo)
E: cellular organisms (biota) (aka cellular organisms)
F: None of the above. | F |
<Instruct>: Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: macrobiotus sapiens
B: animals (aka metazoa)
C: probles
D: human (aka homo sapiens)
E: suborder
F: None of the above. | D |
<Instruct>: Given the context 'Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: this
B: genus
C: animals (aka metazoa)
D: homo sapiens (human) (aka homo sapiens)
E: homo (humans) (aka homo)
F: None of the above. | D |
<Instruct>: Given the context 'Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: human (aka homo sapiens)
B: genus
C: suborder
D: kingdom
E: animals (aka metazoa)
F: None of the above. | A |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept corresponding to 's.pombe'. Answer using one of the provided options. | <Options>: A: dikarya
B: zygosaccharomyces sp.
C: schizosaccharomyces japonicus var. japonicus (aka schizosaccharomyces japonicus)
D: schizosaccharomyces pombe oy26
E: schizosaccharomyces pombe (schizosaccharomyces malidevorans) (aka schizosaccharomyces pombe)
F: None of the above. | E |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept corresponding to 'arabidopsis thaliana'. Answer using one of the provided options. | <Options>: A: thale-cress (aka arabidopsis thaliana)
B: (arabidopsis thaliana x arabidopsis arenosa) x arabidopsis suecica
C: apophylia
D: arabidopsis thaliana x arabidopsis lyrata
E: arabideae
F: None of the above. | A |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept corresponding to 'c.elegans'. Answer using one of the provided options. | <Options>: A: uronema elegans
B: myzomyia elegans (aka anopheles elegans)
C: caenorhabditis sp.
D: caenorhabditis drosophilae (rhabditis drosophilae) (aka caenorhabditis drosophilae)
E: caenorhabditis elegans (rhabditis elegans) (aka caenorhabditis elegans)
F: None of the above. | E |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept corresponding to 'drosophila melanogaster'. Answer using one of the provided options. | <Options>: A: melanogaster (aka melanogaster <basidiomycete fungi>)
B: drosophila (aka drosophila <flies,subgenus>)
C: melanogaster subgroup
D: fruit fly (aka drosophila melanogaster)
E: hawaiian drosophila
F: None of the above. | D |
<Instruct>: Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus molossinus (aka mus musculus molossinus)
C: mouse (aka mus <genus>)
D: mus cricetus (aka cricetus cricetus)
E: mouse (aka mus musculus)
F: None of the above. | E |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: probles
B: genus
C: species
D: human (aka homo sapiens)
E: primate (aka primates)
F: None of the above. | D |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces albicans (aka candida albicans)
B: saccharomycodes
C: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
D: saccharomyces hansenii (aka debaryomyces hansenii)
E: saccharomyces lactis (aka kluyveromyces lactis)
F: None of the above. | C |
<Instruct>: Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces sp.
B: saccharomyces lactis (aka kluyveromyces lactis)
C: saccharomyces hansenii (aka debaryomyces hansenii)
D: saccharomyceta
E: saccharomycodes
F: None of the above. | F |
<Instruct>: Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: suborder
B: eutherian mammals (aka eutheria)
C: species
D: animals (aka metazoa)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces sp.
B: saccharomyces lactis (aka kluyveromyces lactis)
C: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
D: baker's yeast (aka saccharomyces cerevisiae)
E: saccharomyces cerevisiae x saccharomyces mikatae
F: None of the above. | D |
<Instruct>: Given the context 'However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown).
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: eutherian mammals (aka eutheria)
C: genus
D: animals (aka metazoa)
E: suborder
F: None of the above. | A |
<Instruct>: Given the context 'DISCUSSION
ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: baker's yeast (aka saccharomyces cerevisiae)
B: saccharomycodes
C: saccharomyces lactis (aka kluyveromyces lactis)
D: saccharomyceta
E: saccharomyces hansenii (aka debaryomyces hansenii)
F: None of the above. | A |
<Instruct>: Given the context 'Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing.', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: budding yeasts & others (aka saccharomycotina)
B: mycoderma cerevisiae (aka saccharomyces cerevisiae)
C: saccharomyces cf. cerevisiae
D: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
E: saccharomycodes
F: None of the above. | B |
<Instruct>: Given the context 'Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomycodes
B: saccharomyces hansenii (aka debaryomyces hansenii)
C: saccharomyces albicans (aka candida albicans)
D: baker's yeast (aka saccharomyces cerevisiae)
E: saccharomyces cf. cerevisiae
F: None of the above. | D |
<Instruct>: Given the context 'A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: mammals (aka mammalia)
B: human (aka homo sapiens)
C: probles
D: genus
E: macrobiotus sapiens
F: None of the above. | B |
<Instruct>: Given the context 'Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: macrobiotus sapiens
C: primate (aka primates)
D: cellular organisms (biota) (aka cellular organisms)
E: genus
F: None of the above. | A |
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: eutherian mammals (aka eutheria)
B: humans (aka homo)
C: kingdom
D: primate (aka primates)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyces sp.
B: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
C: saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus) (aka saccharomyces cf. cerevisiae/paradoxus)
D: saccharomycodes
E: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
F: None of the above. | B |
<Instruct>: Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', select the correct biomedical concept corresponding to 'yeast'. Answer using one of the provided options. | <Options>: A: saccharomyceta
B: candida/saccharomycetales (aka candida/saccharomycales clade)
C: saccharomyces hansenii (aka debaryomyces hansenii)
D: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
E: saccharomyces albicans (aka candida albicans)
F: None of the above. | F |
<Instruct>: Given the context 'The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog.
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: genus
B: human (aka homo sapiens)
C: kingdom
D: animals (aka metazoa)
E: birds (aka aves)
F: None of the above. | B |
<Instruct>: Given the context 'Epigenetic inactivation and aberrant transcription of CSMD1 in squamous cell carcinoma cell lines
Abstract
Background
The p23.2 region of human chromosome 8 is frequently deleted in several types of epithelial cancer and those deletions appear to be associated with poor prognosis.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: primate (aka primates)
B: mammals (aka mammalia)
C: homo sapiens (human) (aka homo sapiens)
D: genus
E: avian (aka aves)
F: None of the above. | C |
<Instruct>: Given the context 'Background
CUB and Sushi Multiple Domains 1 (CSMD1) was cloned as a candidate tumor suppressor or progression gene from a region of human chromosome 8 deleted in tumors of the upper aerodigestive tract, prostate, ovary and bladder', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: genus
B: mammals (aka mammalia)
C: species
D: placental mammals (aka eutheria)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'RT-PCR of human fetal brain cDNA reveals very low levels of an RT-PCR product corresponding in size to that expected from the internally deleted transcript.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: genus
B: homo (humans) (aka homo)
C: human (aka homo sapiens)
D: biota (aka cellular organisms)
E: eutherian mammals (aka eutheria)
F: None of the above. | C |
<Instruct>: Given the context 'Normal oropharyngeal epithelium was isolated from discarded tissue from uvulopalatopharyngoplasties (UPPP) collected anonymously with the approval of the Washington University Human Studies Committee.
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: primate (aka primates)
B: human (aka homo sapiens)
C: species
D: biota (aka cellular organisms)
E: genus
F: None of the above. | B |
<Instruct>: Given the context 'Cell Culture and Tissue Preparation
Squamous cell carcinoma cell lines were grown in DMEM or DMEM:F-12, 1:1 Mixture (BioWhittaker) containing 10% fetal bovine serum (Sigma).', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options. | <Options>: A: bos bubalis bubalis (aka bubalus bubalis bubalis)
B: domestic cow (aka bos taurus)
C: bovidae
D: cattle (aka bos)
E: boveria
F: None of the above. | B |
<Instruct>: Given the context 'An amplicon from human 18S RNA was used as a basis for comparisons across cell lines (primers prm2396, ttcggaactgaggccatgat and prm2397, tttcgctctggtccgtcttg).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: kingdom
B: cellular organisms (biota) (aka cellular organisms)
C: species
D: human (aka homo sapiens)
E: macrobiotus sapiens
F: None of the above. | D |
<Instruct>: Given the context 'Cells were grown for 72 hours in media containing DMEM:F-12, 1:1 Mixture (BioWhittaker) with 1X MEM Nonessential Amino Acids (BioWhittaker) and 10% fetal bovine serum and then switched to media containing 5aza-dC at concentrations of 0 μm, 5 μM, 25 μM, or 100 μM. Cells were fed daily for 4–5 days and then both plates were harvested in 3 ml of Trizol (Invitrogen) for isolation of RNA and DNA according to the manufacturer's instructions.', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options. | <Options>: A: bos bubalis (aka bubalus bubalis)
B: bos primigenius taurus (aka bos taurus)
C: bos (cattle) (aka bos)
D: bos sp.
E: bovidae
F: None of the above. | B |
<Instruct>: Given the context 'Human growth hormone (GH1) gene polymorphism map in a normal-statured adult population
Abstract
Objective
GH1 gene presents a complex map of single nucleotide polymorphisms (SNPs) in the entire promoter, coding and noncoding regions.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: probles
B: homo sapiens (human) (aka homo sapiens)
C: kingdom
D: suborder
E: biota (aka cellular organisms)
F: None of the above. | B |
<Instruct>: Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them.
', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: circe
B: homo sapiens (human) (aka homo sapiens)
C: goes
D: subsection
E: other (aka unidentified)
F: None of the above. | B |
<Instruct>: Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them.
', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: subsection
B: species
C: cancer
D: aides
E: circe
F: None of the above. | F |
<Instruct>: Given the context 'Introduction
Human skeletal growth and final height attainment are a result of a multifactorial regulation involving systemic and local hormones, growth and nutritional factors, lifestyle and genetic factors.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: species
B: mammals (aka mammalia)
C: homo sapiens (human) (aka homo sapiens)
D: suborder
E: birds (aka aves)
F: None of the above. | C |
<Instruct>: Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: theraps
B: genus
C: goes
D: homo sapiens (human) (aka homo sapiens)
E: other (aka unidentified)
F: None of the above. | D |
<Instruct>: Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', select the correct biomedical concept corresponding to 'women'. Answer using one of the provided options. | <Options>: A: latina
B: chicken (aka gallus gallus)
C: eutherian mammals (aka eutheria)
D: homo sapiens (human) (aka homo sapiens)
E: gallus
F: None of the above. | D |
<Instruct>: Given the context 'To obtain normative data for subsequent analysis of GH1 gene contribution to IIGHD in children, a systematic GH1 gene structural analysis was designed in a normal adult control population to establish the GH1 gene SNP map in adults from our population with heights within the normal range, determine the genotype frequencies and analyse possible associations between individual and combined SNPs with height.
', select the correct biomedical concept corresponding to 'children'. Answer using one of the provided options. | <Options>: A: genus
B: homo sapiens (human) (aka homo sapiens)
C: family
D: neonetus
E: chicken (aka gallus gallus)
F: None of the above. | B |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept corresponding to 'women'. Answer using one of the provided options. | <Options>: A: menetus
B: china
C: human (aka homo sapiens)
D: mouse (aka mus musculus)
E: this
F: None of the above. | C |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept corresponding to 'men'. Answer using one of the provided options. | <Options>: A: menoidium
B: menkeleon
C: menenotus
D: menetes
E: meneristes
F: None of the above. | F |
<Instruct>: Given the context 'Subjects and methods
Subjects
A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: other (aka unidentified)
B: mus musculus (house mouse) (aka mus musculus)
C: human (aka homo sapiens)
D: this
E: mus <genus> (mice (aka mus <genus>))
F: None of the above. | C |
<Instruct>: Given the context 'The protocol was approved by the Hospital Vall d’Hebron Ethics Committee and written informed consent was obtained from each participant.', select the correct biomedical concept corresponding to 'participant'. Answer using one of the provided options. | <Options>: A: interjectio
B: humans (aka homo)
C: this
D: suborder
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'women'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: this
C: probles
D: chicken (aka gallus gallus)
E: genus
F: None of the above. | A |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'men'. Answer using one of the provided options. | <Options>: A: menevia
B: menenotus
C: menura
D: menecles
E: menosoma
F: None of the above. | F |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'men'. Answer using one of the provided options. | <Options>: A: menenotus
B: menkeleon
C: menigrates
D: menaethius
E: menecles
F: None of the above. | F |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'women'. Answer using one of the provided options. | <Options>: A: probles
B: homo sapiens (human) (aka homo sapiens)
C: avian (aka aves)
D: this
E: homo (humans) (aka homo)
F: None of the above. | B |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'men'. Answer using one of the provided options. | <Options>: A: menetus
B: menosira
C: menura
D: menosoma
E: meneristes
F: None of the above. | F |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'women'. Answer using one of the provided options. | <Options>: A: homo sapiens (human) (aka homo sapiens)
B: this
C: china
D: avian (aka aves)
E: gallus
F: None of the above. | A |
<Instruct>: Given the context 'Only individuals with height SDS between −2 and +2 SDS were included in the study (mean −0·016; 32 women and 28 men between −2·000 and −1·010; 99 women and 80 men between −1·000 and +0·910; 33 women and 35 men between +1·010 and +1·980) and sample size was adjusted for normal sex and height SDS distribution.', select the correct biomedical concept corresponding to 'men'. Answer using one of the provided options. | <Options>: A: menevia
B: menosira
C: menosoma
D: menkeleon
E: menecleonus
F: None of the above. | F |
<Instruct>: Given the context 'Several sequence changes have been reported in patients with familial or idiopathic short stature,11,26,27 whereas P8, P19, P20 and P25 (at positions 5165, 5681, 5686 and 6358, respectively, in the Genebank accession GI 183148) located in the promoter, intron 2 and intron 4 regions, respectively, had not been previously described.
', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: subsection
B: mus <genus> (mice (aka mus <genus>))
C: probles
D: this
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'Discussion
Genetic variations within human GH1 gene have been described by several authors.9–12,21', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: primate (aka primates)
B: homo (humans) (aka homo)
C: probles
D: this
E: human (aka homo sapiens)
F: None of the above. | E |
<Instruct>: Given the context 'The populations described to date comprised small numbers of normal-stature individuals,9 male adults with narrow height range12 or growth-retarded patients with/without GHD before achievement of adult height.9,11,12 Our study was designed to characterize the GH1 gene sequence variation in individuals within the whole range of normal adult height (between −2 and +2 SDS) according to the standards for our population.', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: humans (aka homo)
B: kingdom
C: mus <genus> (mice (aka mus <genus>))
D: circe
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | E |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.