source
stringlengths 32
209
| text
stringlengths 18
1.5k
|
|---|---|
https://en.wikipedia.org/wiki/Charles%20Cantor
|
Charles R. Cantor (born August 26, 1942) is an American molecular geneticist who, in conjunction with David Schwartz, developed pulse field gel electrophoresis for very large DNA molecules. Cantor's three-volume book Biophysical Chemistry, co-authored with Paul Schimmel, was an influential textbook in the 1980s and 1990s.
Career
Charles Cantor received his AB from Columbia University in 1963 and PhD from University of California, Berkeley in 1966.
He is Director of the Center for Advanced Biotechnology at Boston University. While on a two-year sabbatical acting as Chief Scientific Officer at Sequenom, Inc. he maintained his research laboratory at Boston University. He is also a co-founder and Director of Retrotope, a US-based company using heavier isotopes of carbon (13C) and hydrogen (2H, deuterium) to stabilize essential compounds like amino acids, nucleic acids and lipids to target age-related diseases.
Cantor held positions at Columbia University (1981–1989) and the University of California, Berkeley (1989–1992), before moving to Boston University in 1992. In 2017 he became Professor Adjunct in Molecular Medicine at Scripps Research.
He has been director of the Department of Energy Human Genome Project and Chairman of the Department of Biomedical Engineering at Boston University.
He is a consultant to more than 16 biotech firms, has published more than 400 peer reviewed articles, been granted 54 US patents, and co-authored a three-volume textbook on Biophysical Che
|
https://en.wikipedia.org/wiki/White%20British
|
White British is an ethnicity classification used for the native white population identifying as English, Scottish, Welsh, Cornish, Northern Irish, or British in the United Kingdom Census. In the 2011 census, the White British population was 49,997,686, 81.5% of Great Britain's total population. For the United Kingdom entirely, due to different reporting measures within Northern Ireland which includes all those who identified as British with those who identified as Irish, an amalgamated total of 52,320,080 including those who identified as White Irish in Great Britain is given making up 82.8% of the population.
Census classifications
For the 2011 census, in England and Wales, the White self-classification option included a subcategory of "English/Welsh/Scottish/Northern Irish/British". In Scotland, the White category included "Scottish" and "Other British" options. In Northern Ireland, the White British classification did not appear, the only choice being 'White'.
The 2011 census for England, Wales and Scotland also included additional White ethnic classifications of White Irish, White Gypsy/Irish Traveller and White Other. There were calls for the 2011 national census in England and Wales to include an extra subcategory so people could identify their ethnic group as Cornish.
Demographics
Population and distribution
The White British census classification have their ages more evenly distributed in their population pyramid and have the highest per cent female population of
|
https://en.wikipedia.org/wiki/Bush%20bread
|
Bush bread, or seedcakes, refers to the bread made by Aboriginal Australians by crushing seeds into a dough that is then baked. The bread is high in protein and carbohydrate, and forms part of a balanced traditional diet. It is also sometimes referred to as damper, although damper
is more commonly used to describe the bread made by non-Indigenous people.
With the arrival of Europeans and pre-milled white flour, this bread-making process has almost disappeared (although women were still recorded to be making seedcakes in Central Australia in the 1970s). The tradition of cooking bread in hot coals continues today.
Bread-making was a woman's task. It was generally carried out by several women at once, due to its labour-intensive nature. It involved collecting seasonal grains, legumes, roots or nuts, and preparing these into flour and then dough, or directly into a dough. One of the traditional ingredients was the seeds of kangaroo grass.
Bread-making from seeds
Collecting the seed
Seeds varied depending on the time of year and the area in Australia that the people lived. In Central Australia, native millet (Panicum decompositum; Panicum australianse) and spinifex (Triodia) were commonly used. Wattleseed could also be used in the flour mix.
Women harvested the fully ripe, dry seeds of the plant by beating the grass (or pod-laden trees in the case of wattleseed) with sticks to dislodge the seeds. Some species were eaten at the green stage and, when ground, would produce a ju
|
https://en.wikipedia.org/wiki/Normal-inverse%20Gaussian%20distribution
|
The normal-inverse Gaussian distribution (NIG, also known as the normal-Wald distribution) is a continuous probability distribution that is defined as the normal variance-mean mixture where the mixing density is the inverse Gaussian distribution. The NIG distribution was noted by Blaesild in 1977 as a subclass of the generalised hyperbolic distribution discovered by Ole Barndorff-Nielsen. In the next year Barndorff-Nielsen published the NIG in another paper. It was introduced in the mathematical finance literature in 1997.
The parameters of the normal-inverse Gaussian distribution are often used to construct a heaviness and skewness plot called the NIG-triangle.
Properties
Moments
The fact that there is a simple expression for the moment generating function implies that simple expressions for all moments are available.
Linear transformation
This class is closed under affine transformations, since it is a particular case of the Generalized hyperbolic distribution, which has the same property. If
then
Summation
This class is infinitely divisible, since it is a particular case of the Generalized hyperbolic distribution, which has the same property.
Convolution
The class of normal-inverse Gaussian distributions is closed under convolution in the following sense: if and are independent random variables that are NIG-distributed with the same values of the parameters and , but possibly different values of the location and scale parameters, , and , respectively, t
|
https://en.wikipedia.org/wiki/DCL%20Technology%20Demonstrator%20programme
|
The US DCL (Detection Classification and Localisation) demonstrator program is aimed at proving that an active torpedo detection system is able to resolve a salvo of torpedoes with sufficient time and accuracy that an anti-torpedo torpedo may be fired back to hit and destroy the threat.
Overview
The DCL systems consist of an active source emitter which sends high-frequency pings into the water. Reflections from in-water objects are received by a towed array tuned to those frequencies. By processing the reflections it is possible to determine whether objects are torpedoes, or non-threat objects.
The system is also combined with a passive acoustic towed array specifically designed for torpedo detection. The passive acoustic array is able to analyse the structured sound emanating from a torpedo and thereby classify the weapon type and mode of operation.
Two teams are currently building alternative DCL demonstration systems, the first to test was Ultra Electronics who in 2006 successfully resolved a salvo of torpedoes. The second company APC has yet to undergo tests.
The aim of the programme is to resolve threats sufficiently well that an anti-torpedo torpedo may be fired at the threat to neutralise it (a hard-kill solution). This differs from the UK S2170 Surface Ship Torpedo Defence solution which utilises soft-kill.
DCL
DCL
|
https://en.wikipedia.org/wiki/Variance-gamma%20distribution
|
The variance-gamma distribution, generalized Laplace distribution or Bessel function distribution is a continuous probability distribution that is defined as the normal variance-mean mixture where the mixing density is the gamma distribution. The tails of the distribution decrease more slowly than the normal distribution. It is therefore suitable to model phenomena where numerically large values are more probable than is the case for the normal distribution. Examples are returns from financial assets and turbulent wind speeds. The distribution was introduced in the financial literature by Madan and Seneta. The variance-gamma distributions form a subclass of the generalised hyperbolic distributions.
The fact that there is a simple expression for the moment generating function implies that simple expressions for all moments are available. The class of variance-gamma distributions is closed under convolution in the following sense. If and are independent random variables that are variance-gamma distributed with the same values of the parameters and , but possibly different values of the other parameters, , and , respectively, then is variance-gamma distributed with parameters , , and .
The variance-gamma distribution can also be expressed in terms of three inputs parameters (C,G,M) denoted after the initials of its founders. If the "C", here, parameter is integer then the distribution has a closed form 2-EPT distribution. See 2-EPT Probability Density Function. Under
|
https://en.wikipedia.org/wiki/Pentraxins
|
Pentraxins (PTX), also known as pentaxins, are an evolutionary conserved family of proteins characterised by containing a pentraxin protein domain. Proteins of the pentraxin family are involved in acute immunological responses. They are a class of pattern recognition receptors (PRRs). They are a superfamily of multifunctional conserved proteins, some of which are components of the humoral arm of innate immunity and behave as functional ancestors of antibodies (Abs). They are known as classical acute phase proteins (APP), known for over a century.
Structure
Pentraxins are characterised by calcium dependent ligand binding and a distinctive flattened β-jellyroll structure similar to that of the legume lectins. The name "pentraxin" is derived from the Greek word for five (, pente) and axle (axis) relating to the radial symmetry of five monomers forming a ring approximately 95Å across and 35Å deep observed in the first members of this family to be identified. The "short" pentraxins include Serum Amyloid P component (SAP) and C reactive protein (CRP). The "long" pentraxins include PTX3 (a cytokine modulated molecule) and several neuronal pentraxins.
Family members
Three of the principal members of the pentraxin family are serum proteins: namely, CRP, SAP, and hamster female protein (FP). PTX3 (or TSG-14) protein is a cytokine-induced protein that is homologous to CRPs and SAPs.
C-reactive protein
C-reactive protein is expressed during the acute phase response to tissue in
|
https://en.wikipedia.org/wiki/I.%20M.%20Dharmadasa
|
I.M. Dharmadasa is Professor of Applied Physics and leads the Electronic Materials and Solar Energy (solar cells and other Semiconductor Devices) Group at Sheffield Hallam University, UK. Dharme has worked in semiconductor research since becoming a PhD student at Durham University as a Commonwealth Scholar in 1977, under the supervision of the late Sir Gareth Roberts. His interest in the electrodeposition of thin film solar cells grew when he joined the Apollo Project at BP Solar in 1988. He continued this area of research on joining Sheffield Hallam University in 1990.
Career and research
He has published over 200 refereed and conference papers, has six British patents on thin film solar cells and has made over 175 conference presentations. He has made five book contributions and is the author of the book Advances in Thin Film Solar cells, which was published in 2012. Dharmadasa has also successfully supervised 20 Ph.D. and M.Phil. candidates and 14 years of PDRA support. He has gained research council and international government funding, and was included in the 2001 Research Assessment Exercise for Metallurgy and Materials which gained the top rating of five.
His recent scientific breakthroughs [1-2], which are fundamental to describing the photovoltaic activity of cadmium telluride/cadmium sulfide solar cells, were summarised in a "new theoretical model for CdTe”. Based on these novel ideas he has reported a higher efficiency of 18% for cadmium telluride/cadmium sulfid
|
https://en.wikipedia.org/wiki/LORAX
|
The Life On ice: Robotic Antarctic eXplorer or LORAX is an experimental robotics project being developed by the Robotics Institute of Carnegie Mellon University, supported by NASA. The intent of the project is to create an autonomous rover to survey the distribution of microbes on Antarctica's ice sheets. It is unknown whether it intentionally shares a name with The Lorax, the environmentalist Dr. Seuss character.
The goal is to create a robotic platform with full navigational autonomy and clean, sustainable power systems. This complete isolation will allow the robot to operate unattended and avoid any possible contamination of its results. The project aims for the robot to be able to operate for one month without human intervention. The rover's power systems incorporate a combination of solar power and wind power. Several solar panels are mounted on the shell of the rover. It also has a deployable wind turbine for generating further power.
A working model of the LORAX rover called Nomad was tested in 2005 on the frozen Mascoma Lake in New Hampshire. The rover completed a ten kilometer test run, traversed ice obstacles and conducted a successful test of its wind turbine. The rover, independent of any human guidance, traveled over fourteen kilometers in all on the frozen lake and returned to its starting point. The test also yielded further calibrations to many of the rover's systems.
See also
Scarab (rover)
References
Notes
Sources
External links
Project Page at th
|
https://en.wikipedia.org/wiki/Restriction%20map
|
A restriction map is a map of known restriction sites within a sequence of DNA. Restriction mapping requires the use of restriction enzymes. In molecular biology, restriction maps are used as a reference to engineer plasmids or other relatively short pieces of DNA, and sometimes for longer genomic DNA. There are other ways of mapping features on DNA for longer length DNA molecules, such as mapping by transduction.
One approach in constructing a restriction map of a DNA molecule is to sequence the whole molecule and to run the sequence through a computer program that will find the recognition sites that are present for every restriction enzyme known.
Before sequencing was automated, it would have been prohibitively expensive to sequence an entire DNA strand. To find the relative positions of restriction sites on a plasmid, a technique involving single and double restriction digests is used. Based on the sizes of the resultant DNA fragments the positions of the sites can be inferred. Restriction mapping is a very useful technique when used for determining the orientation of an insert in a cloning vector, by mapping the position of an off-center restriction site in the insert.
Method
The experimental procedure first requires an aliquot of purified plasmid DNA (see appendix) for each digest to be run. Digestion is then performed with each enzyme(s) chosen. The resulting samples are subsequently run on an electrophoresis gel, typically on agarose gel.
The first step following
|
https://en.wikipedia.org/wiki/Stowers%20Institute%20for%20Medical%20Research
|
The Stowers Institute for Medical Research is a biomedical research organization that conducts basic research on genes and proteins that control fundamental processes in living cells to analyze diseases and find keys to their causes, treatment, and prevention. It is located in Kansas City, Missouri adjacent to the University of Missouri–Kansas City main campus.
The Institute has spent over 1 billion $US on research.
Structure
The Institute was incorporated with an initial donation of $500 million in 1994 by James E. Stowers founder of American Century Investments and his wife Virginia Stowers, both cancer survivors. Over the next decade, the couple endowed the institute with gifts totaling almost $2 billion. The Institute opened its doors in November 2000 on the former site of Menorah Hospital. In 2008, there were 25 independent research programs plus core facilities in bioinformatics, proteomics, microarray, molecular biology, flow cytometry, and microscopy. In total, the organization employs more than 550 scientists, research associates, technicians and support staff, including more than 140 postdoctoral research associates and graduate students.
The Institute is recognized by the IRS as a medical research organization. It is a Missouri not-for-profit corporation, and is a 501(c)(3) charitable organization.
References
External links
Stowers Institute
Medical research institutes in the United States
Biomedical research foundations
Research institutes in Missouri
1994 e
|
https://en.wikipedia.org/wiki/Gene%20Tools
|
Gene Tools, LLC is a limited liability company located in Philomath, Oregon, United States that manufactures Morpholino antisense oligos and delivery reagents. Gene Tools was founded in 1997 and began regularly shipping custom-sequence Morpholino oligos in 2000. Current products include Morpholino oligos and Vivo-Morpholinos (for improved delivery into cells).
The manager and general partner, Jim Summerton, is a pioneer in antisense research, conceived of and was co-inventor of the Morpholino antisense oligo structural type and founded the first antisense therapeutics company, Sarepta Therapeutics Inc. (formerly AntiVirals Inc., renamed AVI BioPharma Inc., renamed Sarepta Therapeutics Inc.).
References
External links
Gene Tools
Companies based in Oregon
Benton County, Oregon
Privately held companies based in Oregon
American companies established in 1997
1997 establishments in Oregon
|
https://en.wikipedia.org/wiki/List%20of%20Jamaican%20backing%20bands
|
This is a list of Jamaican backing bands.
A
Aggrovators (The)
Amalgamated Allstars (The)
Arabs (The)
B
Baba Brooks Band (The)
Black Slate
C
Clue J & His Blues Blasters
Crystalites (The)
D
Daley Allstars (The)
Dynamites (The)
Dragonaires (The)
Duke Reid Group (The)
G
GG Allstars (The)
Gladdy's All-Stars
H
Harry J Allstars (The)
Hippy Boys (The)
I
Inner Circle
J
Jets (The)
Joe Gibbs Allstars (The)
M
Matador Allstars (The)
Mudies Allstars (The)
Mystic Revelation Of Rastafari (The)
P
Phil Pratt Allstars (The)
Professionals (The)
Prince Buster Allstars (The)
R
Randy's Allstars (The)
Revolutionaries (The)
Rhythm Rulers (The)
Roots Radics (The)
Rupies Allstars (The)
Rupie Edwards Allstars (The)
S
Skatalites (The)
Sons Of Negus (The)
Soul Brothers (The)
Soul Syndicate (The)
Soulettes (The)
Soul Vendors (The)
Sound Dimension (The)
Studio One Orchestra (The)
Supersonics (The)
T
Taxi Gang
U
Upsetters (The) 2
W
Wackies Rhythm Force (The)
Wailers (The)
Z
Zap Pow
Jamaican backing bands
|
https://en.wikipedia.org/wiki/Diagnostic%20peritoneal%20lavage
|
Diagnostic peritoneal lavage (DPL) or diagnostic peritoneal aspiration (DPA) is a surgical diagnostic procedure to determine if there is free floating fluid (most often blood) in the abdominal cavity.
Indications
This procedure is performed when intra-abdominal bleeding (hemoperitoneum), usually secondary to trauma, is suspected. In a hemodynamically unstable patient with high-risk mechanism of injury, peritoneal lavage is a means of rapidly diagnosing intra-abdominal injury requiring laparotomy, but has largely been replaced in trauma care by the use of a focused assessment with sonography for trauma (FAST scan) due to its repeatability, non-invasiveness and non-interference with subsequent computed tomography (CT scan). Abdominal CT and contrast duodenography may complement lavage in stable patients, but in an unstable or uncooperative persons, these studies are too time-consuming or require ill-advised sedation. Magnetic resonance imaging is extremely accurate for the anatomic definition of structural injury, but logistics limit its practical application in acute abdominal trauma.
The procedure was first described in 1965 by Hauser Root.
Procedure
After the application of local anesthesia, a vertical skin incision is made one third of the distance from the umbilicus to the pubic symphysis. The linea alba is divided and the peritoneum entered after it has been picked up to prevent bowel perforation. A catheter is inserted towards the pelvis and aspiration of material at
|
https://en.wikipedia.org/wiki/Drop%20Art
|
In 1961, filmmaker Gene Bernofsky and artist Clark Richert, art students from the University of Kansas, developed an art concept they called Drop Art or droppings. Informed by the "happenings" of Allan Kaprow and the impromptu performances a few years earlier of John Cage, Robert Rauschenberg and Buckminster Fuller at Black Mountain College, Drop Art began when Richert and Bernofsky started painting rocks and dropping them from a loft roof onto the sidewalk of Lawrence Kansas's main drag — watching the reactions of passersby. Early Drop Art included such pieces as Egg Drop and Pendulum (pictured) .
Drop Art eventually led to the creation of Drop City, an experimental artist's community founded in 1965 near Trinidad, Colorado. The intention was to create a live-in work of Drop Art.
References
External links
Ruins of Drop City, Trinidad, Colorado a print by Joel Sternfield
Clark Richert Website Clark Richert Website
Avant-garde art
|
https://en.wikipedia.org/wiki/Glia%20limitans
|
The glia limitans, or the glial limiting membrane, is a thin barrier of astrocyte foot processes associated with the parenchymal basal lamina surrounding the brain and spinal cord. It is the outermost layer of neural tissue, and among its responsibilities is the prevention of the over-migration of neurons and neuroglia, the supporting cells of the nervous system, into the meninges. The glia limitans also plays an important role in regulating the movement of small molecules and cells into the brain tissue by working in concert with other components of the central nervous system (CNS) such as the blood–brain barrier (BBB).
Location and structure
The perivascular feet of astrocytes form a close association with the basal lamina of the brain parenchyma to create the glia limitans. This membrane lies deep to the pia mater and the subpial space and surrounds the perivascular spaces (Virchow-Robin spaces). Any substance entering the central nervous system from the blood or cerebrospinal fluid (CSF) must cross the glia limitans.
The two different classifications of glial limiting membrane, the glia limitans perivascularis and the glia limitans superficialis, have nearly identical structures, however, they can be distinguished from each other by their location within the brain. The glia limitans perivascularis abuts the perivascular space surrounding the parenchymal blood vessels and functions as a supportive constituent of the blood–brain barrier. In contrast, the non-parenchymal
|
https://en.wikipedia.org/wiki/Moni%20Nag
|
Moni Nag (1925 – 7 December 2015) was an Indian anthropologist specialising in the politics of sexuality.
Education and career
Born in India, Nag earned a master's degree in statistics from the University of Calcutta in 1946 and a PhD in anthropology from Yale University in 1961. He started his career in the Indian Statistical Institute and worked on the Anthropological Survey of India before joining the Department of Anthropology at Columbia University in New York in 1966; he was a lecturer and later an adjunct professor and headed the social demography section in the International Institute for the Study of Human Reproduction. He was also a senior associate in the Population Council in New York and a patron and vice president of the Elmhirst Institute of Community Studies at Santiniketan, and served as chair of the population commission in the International Union of Anthropological and Ethnological Sciences.
Research and publications
Nag was a pioneer of demographic anthropology. He researched and published in the fields of human sexuality, fertility, family planning, HIV prevention, and sex work, with a focus on India, and both studied and worked for the rights of prostitutes in the Kolkata red-light district of Sonagachi; he was one of several academics working with the Durbar Mahila Samanwaya Committee there.
Selected books
Factors Affecting Human Fertility in Nonindustrial Societies: A Cross-Cultural Study (Yale University, 1962)
Population and Social Organization
|
https://en.wikipedia.org/wiki/GCC
|
GCC commonly refers to:
Gulf Cooperation Council, an organization of Arab states
GNU Compiler Collection, a free and open-source cross-platform compiler
GCC may also refer to:
Education
Good Counsel College, Innisfail, Queensland, Australia
Greenwich Community College, England
Gazipur Cantonment College, Bangladesh
Grace Christian College, Quezon City, Philippines
Galahitiyawa Central College, Ganemulla, Sri Lanka
Canada
Garden City Collegiate, a high school in Winnipeg, Manitoba
Grenville Christian College, near Brockville, Ontario
United States
Genesee Community College, Batavia, New York
Germanna Community College, Virginia
Gila Community College, Arizona
Girls Catholic Central High School, in Detroit, Michigan
Glendale Community College (Arizona)
Glendale Community College (California)
Gloucester County College, former name of Rowan College at Gloucester County, New Jersey
Gogebic Community College, Michigan
Greenfield Community College (Massachusetts)
Greensburg Central Catholic High School, Pennsylvania
Grove City College, a private college in Pennsylvania
Guam Community College, Guam
Organizations
Gauhati Cine Club, a film society in Assam
Grand Challenges Canada, a Canadian non-profit organization
Global China Connection, a student-run non-profit organization
Companies
Gene Codes Corporation, a bioinformatics software company
General Cinema Corporation, a former theater chain acquired by AMC Theatres
General Computer Corporation, a com
|
https://en.wikipedia.org/wiki/Syrinx%20%28medicine%29
|
A syrinx is a rare, fluid-filled neuroglial cavity within the spinal cord (syringomyelia), in the brain stem (syringobulbia), or in the nerves of the elbow, usually in a young age.
Presentation
Symptoms usually begin insidiously between adolescence and age 45. Syringomyelia develops in the center of the spinal cord, causing a central cord syndrome. Pain and temperature sensory deficits occur early but may not be recognized for years. The first abnormality recognized may be a painless burn or cut. Syringomyelia typically causes weakness, atrophy, and often fasciculations and hyperreflexia of the hands and arms; a deficit in pain and temperature sensation in a capelike distribution over the shoulders, arms and back is characteristic. Light touch and position and vibration sensation are not affected. Later, spastic leg weakness develops. Deficits may be asymmetric.
Syringobulbia may cause vertigo, nystagmus, unilateral or bilateral loss of facial sensation, lingual atrophy and weakness, dysarthria, dysphagia, hoarseness, and sometimes peripheral sensory or motor deficits due to medullary compression.
Cause
A syrinx results when a watery, protective substance known as cerebrospinal fluid, that normally flows around the spinal cord and brain, transporting nutrients and waste products, collects in a small area of the spinal cord and forms a pseudocyst.
A number of medical conditions can cause an obstruction in the normal flow of cerebrospinal fluid, redirecting it into the spi
|
https://en.wikipedia.org/wiki/Syringobulbia
|
Syringobulbia is a medical condition in which syrinxes, or fluid-filled cavities, affect the brainstem (usually the lower brainstem). The exact cause is often unknown, but may be linked to a widening of the central canal of the spinal cord. This may affect one or more cranial nerves, resulting in various kinds of facial palsies. Sensory and motor nerve pathways may be affected by interruption or compression of nerves. This disorder is associated with syringomyelia, a syrinx limited to the spinal cord. It can be diagnosed using magnetic resonance imaging. Symptoms may be treated with tricyclic antidepressants.
Signs and symptoms
Syringobulbia usually causes pain. It may also cause a loss of sense of temperature. Alveolar hypoventilation (insufficient breathing, a type of central hypoventilation syndrome) may occur, with hypercapnia (excess blood CO2), stridor (an unusual breathing sound), and irregular breathing.
Cause
Syringobulbia may be caused by a birth defect, trauma or tumor growth. The exact trigger is unknown, but may be linked to a widening of the central canal of the spinal cord.
Mechanism
Syringobulbia affects the lower part of the brainstem. The central canal of the spinal cord may be widened. A fluid-filled lesion forms, known as a syrinx. This can vary in size significantly between patients. Nerve fibres may be compressed where they cross the midline, or in other parts of the spinal cord. Cranial nerves may be affected.
Syringobulbia may be associated with
|
https://en.wikipedia.org/wiki/Antigen%20presentation
|
Antigen presentation is a vital immune process that is essential for T cell immune response triggering. Because T cells recognize only fragmented antigens displayed on cell surfaces, antigen processing must occur before the antigen fragment can be recognized by a T-cell receptor. Specifically, the fragment, bound to the major histocompatibility complex (MHC), is transported to the surface of the cell, a process known as presentation. If there has been an infection with viruses or bacteria, the cell will present an endogenous or exogenous peptide fragment derived from the antigen by MHC molecules. There are two types of MHC molecules which differ in the behaviour of the antigens: MHC class I molecules (MHC-I) bind peptides from the cell cytosol, while peptides generated in the endocytic vesicles after internalisation are bound to MHC class II (MHC-II). Cellular membranes separate these two cellular environments - intracellular and extracellular. Each T cell can only recognize tens to hundreds of copies of a unique sequence of a single peptide among thousands of other peptides presented on the same cell, because an MHC molecule in one cell can bind to quite a large range of peptides. Predicting which (fragments of) antigens will be presented to the immune system by a certain MHC/HLA type is difficult, but the technology involved is improving.
Presentation of intracellular antigens: Class I
Cytotoxic T cells (also known as Tc, killer T cell, or cytotoxic T-lymphocyte (CTL)) ex
|
https://en.wikipedia.org/wiki/Dameon%20Clarke
|
Dameon Clarke is a Canadian actor who has done work for anime, films, TV shows and video games. His voice acting roles have been with Funimation, where he voiced Cell in the Dragon Ball series, Younger Toguro in Yu Yu Hakusho, Scar in Fullmetal Alchemist, Proxy One in Ergo Proxy, Victor Hilshire in Gunslinger Girl, and George Kaminski in Case Closed. In video games, he voices Handsome Jack in the Borderlands series. On camera, he has appeared in TV shows such as Graceland, 24, Castle, Supernatural and Prison Break.
Clarke, who was born in Mississauga, Ontario, also starred in the indie film How to Be a Serial Killer, for which he won several awards at film festivals.
Filmography
Voice acting
Anime
Anime films
Video games
Live-action
Awards and nominations
References
External links
Living people
Canadian expatriate male actors in the United States
Canadian male film actors
Canadian male television actors
Canadian male video game actors
Canadian male voice actors
Male actors from Dallas
Male actors from Los Angeles
Male actors from Ontario
People from Mississauga
20th-century Canadian male actors
21st-century Canadian male actors
Year of birth missing (living people)
Spike Video Game Award winners
|
https://en.wikipedia.org/wiki/Cyclic%20pump
|
A Cyclic pump is an apparatus which moves a fluid in a periodic uni-directional direction from one containment system to another while overcoming static conditions that would, without intervention, not move. The intervention predicated by the pump alters pressures, volumes and sometimes temperatures of fluids (gaseous, liquid, colloidal, plasmic, etc.) in such a way that the fluids are transported to other chambers or enclosures (including pipes), thus "flowing" in a consistent direction, usually having characteristics of pulsation (as is the case with the Human heart) or of uniform motion (as is the case with an Automobile motor oil pump). Cyclic pumps are generally incorporated into machines to deal with all sorts of fluids associated with that machine's functionality.
References
See also
Water hammer
Hydraulic ram
Fluid dynamics
Switched-mode power supply
Boost converter
Buck converter
Buck–boost converter
Pumps
Articles containing video clips
|
https://en.wikipedia.org/wiki/Panick%C3%A9%20Dravce
|
Panické Dravce () is a village and municipality in the Lučenec District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Panické Dravce na stránke Novohradu
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/Podre%C4%8Dany
|
Podrečany () is a village and municipality in the Lučenec District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/Star%C3%A1%20Hali%C4%8D
|
Stará Halič () is a village and municipality in the Lučenec District in the Banská Bystrica Region of Slovakia.
References
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/%C5%A0urice
|
Šurice () is a village and municipality in the Lučenec District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/%C5%A0%C3%A1vo%C4%BE
|
Šávoľ () is a village and municipality in the Lučenec District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/%C5%A0%C3%ADd
|
Šíd () is a village and municipality in the Lučenec District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/Tom%C3%A1%C5%A1ovce%2C%20Lu%C4%8Denec%20District
|
Tomášovce () is a village and municipality in the Lučenec District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/Trebe%C4%BEovce
|
Trebeľovce () is a village and municipality in the Lučenec
District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/Vidin%C3%A1
|
Vidiná () is a village and municipality in the Lučenec District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/Ve%C4%BEk%C3%A1%20nad%20Ip%C4%BEom
|
Veľká nad Ipľom () is a village and municipality in the Lučenec District in the Banská Bystrica Region of Slovakia.
External links
https://web.archive.org/web/20080111223415/http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/To%C4%8Dnica
|
Točnica () is a village and municipality in the Lučenec District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/Tren%C4%8D
|
Trenč () is a village and municipality in the Lučenec District in the Banská Bystrica Region of Slovakia.
References
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Lučenec District
|
https://en.wikipedia.org/wiki/Duodenal%20cytochrome%20B
|
Duodenal cytochrome B (Dcytb) also known as cytochrome b reductase 1 is an enzyme that in humans is encoded by the gene.
Dcytb CYBRD1 was first identified as a ferric reductase enzyme which catalyzes the reduction of Fe3+ to Fe2+ required for dietary iron absorption in the duodenum of mammals. Dcytb mRNA and protein levels in the gut are increased by iron deficiency and hypoxia which acts to promote dietary iron absorption. The effect of iron deficiency and hypoxia on Dcytb levels are medicated via the HIF2 (Hypoxia inducible factor 2) transcription factor which binds to hypoxia response elements within the Dcytb promoter and increases transcription of the gene. DCYTB protein has also been found in other tissues, such as lung epithelial cells and in the plasma membrane of mature red blood cells of scorbutic species (unable to make ascorbate) such as human and guinea pig but not in other species which have retained the ability to synthesise ascorbate like mice and rat. This has led to the notion that Dcytb may have an additional role in ascorbate metabolism in scorbutic species. DCYTB protein has also been found in breast tissue (epithelial and myoepithelial cells) and high DCYTB levels are associated with a favourable prognosis in patients with breast cancer. A single nucleotide polymorphism (SNP) within the DCYTB promoter (SNP rs884409) which reduced functional DCYTB promoter activity was also associated with reduced serum ferritin levels in a patient cohort with C28
|
https://en.wikipedia.org/wiki/Ratkovsk%C3%A9%20Bystr%C3%A9
|
Ratkovské Bystré () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Mur%C3%A1nska%20Huta
|
Muránska Huta () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Rev%C3%BAcka%20Lehota
|
Revúcka Lehota () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Scoulerine
|
Scoulerine, also known as discretamine and aequaline, is a benzylisoquinoline alkaloid (BIA) that is derived directly from (S)-reticuline through the action of berberine bridge enzyme. It is a precursor of other BIAs, notably berberine, noscapine, (S)-tetrahydropalmatine, and (S)-stylopine, as well as the alkaloids protopine, and sanguinarine. It is found in many plants, including opium poppy, Croton flavens, and certain plants in the genus Erythrina.
Studies show that scoulerine is an antagonist in vitro at the α2-adrenoceptor, α1D-adrenoceptor and 5-HT receptor. It has also been found to be a GABAA receptor agonist in vitro.
References
Isoquinolinoisoquinolines
Natural opium alkaloids
Phenols
Catechol ethers
Methoxy compounds
|
https://en.wikipedia.org/wiki/NCCS
|
NCCS may refer to:
National Cancer Centre Singapore, a Cancer specialist medical centre in Singapore
National Catholic Community Service
National Center for Charitable Statistics
National Center for Computational Sciences, at Oak Ridge National Laboratory
National Center for Constitutional Studies, American conservative organization
National Centre For Cell Science, University of Pune, India
National Coalition for Cancer Survivorship, American cancer survivor advocacy organization
New Canaan Country School, a K-9 school in New Canaan, Connecticut
North County Christian School, K-12 Christian school in Florissant, Missouri
North Cow Creek School, K-8 public school in Palo Cedro, California
National Center for Cyber Security (Pakistan)
See also
NCC (disambiguation)
|
https://en.wikipedia.org/wiki/Parker%E2%80%93Sochacki%20method
|
In mathematics, the Parker–Sochacki method is an algorithm for solving systems of ordinary differential equations (ODEs), developed by G. Edgar Parker and James Sochacki, of the James Madison University Mathematics Department. The method produces Maclaurin series solutions to systems of differential equations, with the coefficients in either algebraic or numerical form.
Summary
The Parker–Sochacki method rests on two simple observations:
If a set of ODEs has a particular form, then the Picard method can be used to find their solution in the form of a power series.
If the ODEs do not have the required form, it is nearly always possible to find an expanded set of equations that do have the required form, such that a subset of the solution is a solution of the original ODEs.
Several coefficients of the power series are calculated in turn, a time step is chosen, the series is evaluated at that time, and the process repeats.
The end result is a high order piecewise solution to the original ODE problem. The order of the solution desired is an adjustable variable in the program that can change between steps. The order of the solution is only limited by the floating point representation on the machine running the program. And in some cases can be either extended by using arbitrary precision floating point numbers, or for special cases by finding solution with only integer or rational coefficients.
Advantages
The method requires only addition, subtraction, and multiplicatio
|
https://en.wikipedia.org/wiki/Prokhorov%27s%20theorem
|
In measure theory Prokhorov's theorem relates tightness of measures to relative compactness (and hence weak convergence) in the space of probability measures. It is credited to the Soviet mathematician Yuri Vasilyevich Prokhorov, who considered probability measures on complete separable metric spaces. The term "Prokhorov’s theorem" is also applied to later generalizations to either the direct or the inverse statements.
Statement
Let be a separable metric space.
Let denote the collection of all probability measures defined on (with its Borel σ-algebra).
Theorem.
A collection of probability measures is tight if and only if the closure of is sequentially compact in the space equipped with the topology of weak convergence.
The space with the topology of weak convergence is metrizable.
Suppose that in addition, is a complete metric space (so that is a Polish space). There is a complete metric on equivalent to the topology of weak convergence; moreover, is tight if and only if the closure of in is compact.
Corollaries
For Euclidean spaces we have that:
If is a tight sequence in (the collection of probability measures on -dimensional Euclidean space), then there exist a subsequence and a probability measure such that converges weakly to .
If is a tight sequence in such that every weakly convergent subsequence has the same limit , then the sequence converges weakly to .
Extension
Prokhorov's theorem can be extended to consider complex me
|
https://en.wikipedia.org/wiki/Braithwaite%20%28surname%29
|
Braithwaite, Brathwaite, or Brathwait is an English surname of Old Norse origin. At the time of the British Census of 1881, the relative frequency of the surname Braithwaite was highest in Westmorland (37.3 times the British average), followed by Cumberland, Yorkshire, Linlithgowshire, Lancashire, County Durham, Nottinghamshire, Leicestershire, Anglesey and Flintshire. Notable people with the surname include:
Sir Albert Braithwaite (1893–1959), British politician
Althea Braithwaite (1940–2020), English children's author, illustrator, publisher and glass artist
Anna Braithwaite (1788–1859), English Quaker minister
Bob Braithwaite (1925–2015), British trap shooter
Brenda Brathwaite (born 1966), American video game designer and developer
Carlos Brathwaite (born 1988), Barbadian cricketer
Charles Braithwaite (1850–1910), Canadian politician and agrarian leader
Chris Braithwaite aka Chris Jones (1885–1944), Barbadian seaman, leader of the Colonial Seamen's Association
Darren Braithwaite (born 1969), British sprinter
Daryl Braithwaite (born 1949), Australian pop singer
Diana Braithwaite, Canadian singer-songwriter
Donald Braithwaite (1936–2017), Welsh boxer
Doug Braithwaite British comic book artist
Edward Kamau Brathwaite (1930–2020), Barbadian poet
E. R. Braithwaite (1912–2016), Guyanese novelist, writer, teacher, and diplomat
Errol Brathwaite (1924–2005), New Zealand author
Fred Brathwaite (born 1972), Canadian ice hockey player
George Braithwaite (disambiguation)
Gregory Brat
|
https://en.wikipedia.org/wiki/International%20Conference%20on%20Rewriting%20Techniques%20and%20Applications
|
Rewriting Techniques and Applications (RTA) is an annual international academic conference on the topic of rewriting. It covers all aspects of rewriting, including termination, equational reasoning, theorem proving, higher-order rewriting, unification and the lambda calculus. The conference consists of peer-reviewed papers with the proceedings published by Springer in the LNCS series until 2009, and since then in the LIPIcs series published by the Leibniz-Zentrum für Informatik. Several rewriting-related workshops are also affiliated with RTA.
The first RTA was held in Dijon, France in September 1983. RTA took part in the federated conferences Federated Logic Conference (FLoC) and Rewriting, Deduction, and Programming (RDP). In 2016, RTA merged with the International Conference on Typed Lambda Calculi and Applications to form the International Conference on
Formal Structures for Computation and Deduction (FSCD).
External links
Official website
List of the 26 RTA conferences, 1985-2015
List of the six FSCD conferences, 2016-2021
Rewriting Techniques and Applications
International Conference on Formal Structures for Computation and Deduction
Theoretical computer science conferences
Logic conferences
|
https://en.wikipedia.org/wiki/The%20Less%20Deceived
|
The Less Deceived, first published in 1955, was Philip Larkin's first mature collection of poetry, having been preceded by the derivative North Ship (1945) from The Fortune Press and a privately printed collection, a small pamphlet titled XX Poems, which Larkin mailed to literary critics and authors. Larkin was unaware that postal rates had gone up, and most recipients, when asked to pay the difference for delivery of a pamphlet by a little-known writer, turned them away; only around 100 copies were printed.
Despite this setback, 13 of the 20 poems, together with 16 new poems, were finally published to much acclaim in 1955 as The Less Deceived, which was selected as a book of the year by the Times Literary Supplement and immediately went through several impressions. Put out by The Marvell Press, a small operation run by George Hartley and his wife Jean Hartley in Hessle, East Yorkshire, the book through the depth of its appeal, the formal skill of its verse, and its consistent striking of Larkin's distinctive tone gained wide readership. By the end of 1955 The Less Deceived was recognized as one of the outstanding collections of the year.
History
The first poem in it, chronologically, to be written was "Going," of February 1946. It is about death, and, according to Andrew Motion, is the kind of poem for which Larkin "is so often regarded as an unrelievedly pessimistic poet" Its concluding lines, "What is under my hands, / That I cannot feel? / What loads my hands down?", p
|
https://en.wikipedia.org/wiki/Outline%20of%20calculus
|
Calculus is a branch of mathematics focused on limits, functions, derivatives, integrals, and infinite series. This subject constitutes a major part of contemporary mathematics education. Calculus has widespread applications in science, economics, and engineering and can solve many problems for which algebra alone is insufficient.
Branches of calculus
Differential calculus
Integral calculus
Multivariable calculus
Fractional calculus
Differential Geometry
History of calculus
History of calculus
Important publications in calculus
General calculus concepts
Continuous function
Derivative
Fundamental theorem of calculus
Integral
Limit
Non-standard analysis
Partial derivative
Infinite Series
Calculus scholars
Sir Isaac Newton
Gottfried Leibniz
Calculus lists
List of calculus topics
See also
Glossary of calculus
Table of mathematical symbols
References
External links
Calculus Made Easy (1914) by Silvanus P. Thompson Full text in PDF
Calculus.org: The Calculus page at University of California, Davis – contains resources and links to other sites
COW: Calculus on the Web at Temple University - contains resources ranging from pre-calculus and associated algebra
Online Integrator (WebMathematica) from Wolfram Research
The Role of Calculus in College Mathematics from ERICDigests.org
OpenCourseWare Calculus from the Massachusetts Institute of Technology
Infinitesimal Calculus – an article on its historical development, in Encyclopaedia of Mathemat
|
https://en.wikipedia.org/wiki/Never%20%28Heart%20song%29
|
"Never" is a song by American rock band Heart, released as the second single from the band's eponymous eighth studio album (1985). It was written by Holly Knight, Gene Bloch and "Connie" (a pseudonym for Ann Wilson, Nancy Wilson, and Sue Ennis).
"Never" is a rock song with an uplifting lyric to a person who has been discouraged by love. Like the preceding "What About Love", the music video for "Never" received heavy rotation on MTV.
"Never" peaked at number four on the Billboard Hot 100, marking the first time that Heart earned consecutive top ten entries, and the first time a Heart album generated two top ten singles.
A reworking of the song appears on the Japanese version of Heart's live album The Road Home. "Only in that version of 'Never'," observed Nancy Wilson, "did the song get the rootsy vibe that stands up to time."
Reception
Cash Box said it is "a slow driving ballad" that has "a succinct arrangement and production." Billboard called it "crisply buoyant power rock."
Remixes
Alternate mixes of "Never" and "Nothin' at All" appear in their music videos and on their seven-inch single incarnations. These mixes were included in some early releases of the Heart album, on LP, CD, or cassette. One may get a copy with both songs in their original mixes; both in their alternate mixes, or only one song in a different mix. Copies with serial No. SL-12410, for example, features the alternate mix for "Never", but the original mix for "Nothin' at All". The two versions of "No
|
https://en.wikipedia.org/wiki/AMT%20Skipper
|
The AMT Skipper was a stainless steel copy of the .45 ACP Colt Combat Commander made by Arcadia Machine and Tool.
Statistics
SKIPPER
Chambering: .45 ACP., .40 S&W
Barrel Length: 4 inches.
Overall Length: 7.5 inches.
Weight: ?
Magazine: 6-round single-column box magazine.
Sights: Adjustable for windage and elevation
Finish:
Furniture:Plastic
Features: Adjustable Trigger & Sights
Production: 1978-79 (Very limited ) Manufactured in El Monte, CA.
COMBAT SKIPPER
Chambering: .45 ACP, .40 S&W
Barrel Length: 4.5 inches
Overall Length: 8 inches
Weight: 32 ounces
Magazine: 6-round single-stack magazine
Sights: Adjustable
Finish: Stainless Steel
Stocks: Plastic or Redwood
Production: 1978-79 ( Very Limited ) Manufactured in El Monte, CA.
See AMT Hardballer for additional info
External links
AMT Skipper Owners Manual
AMT semi-automatic pistols
.45 ACP semi-automatic pistols
Semi-automatic pistols of the United States
|
https://en.wikipedia.org/wiki/Social%20media%20optimization
|
Social media optimization (SMO) is the use of a number of outlets and communities to generate publicity to increase the awareness of a product, service brand or event. Types of social media involved include RSS feeds, social news, bookmarking sites, and social networking sites such as Facebook, Instagram, Twitter, video sharing websites, and blogging sites. SMO is similar to search engine optimization (SEO) in that the goal is to generate web traffic and increase awareness for a website. SMO's focal point is on gaining organic links to social media content. In contrast, SEO's core is about reaching the top of the search engine hierarchy. In general, social media optimization refers to optimizing a website and its content to encourage more users to use and share links to the website across social media and networking sites.
SMO is used to strategically create online content ranging from well-written text to eye-catching digital photos or video clips that encourages and entices people to engage with a website. Users share this content, via its weblink, with social media contacts and friends. Common examples of social media engagement are "liking and commenting on posts, retweeting, embedding, sharing, and promoting content". Social media optimization is also an effective way of implementing online reputation management (ORM), meaning that if someone posts bad reviews of a business, an SMO strategy can ensure that the negative feedback is not the first link to come up in a lis
|
https://en.wikipedia.org/wiki/Curonian%20Spit%20National%20Park%20%28Lithuania%29
|
Kuršių Nerija National Park is one of the five national parks in Lithuania. It was established in 1991 to protect the unique ecosystems of the Curonian Spit and Curonian Lagoon.
Kuršių Nerija National Park is protected by the state, under the Lithuanian law of Protected Areas. Since 1997 it is a member of EUROPARC Federation. The Park has Category II in the classification of the IUCN.
Nagliai nature reserve
Nagliai nature reserve protects the Dead dunes. Dead (Mirusios), or Gray (Pilkosios) dunes are large sand hills built by strong winds, with ravines and erosions. Nagliai nature reserve is a place for habitats of rare plants, included in the Red Book, four villages and two old cemetery sites that are hiding under the sand. Any human activity is prohibited in the reserve except for scientific observations. The cognitive trail of Nagliai is the only place from which you can explore the reserve's objects.
In 1675–1854 four Nagliai villages here were covered in sand.
See also
List of national parks in the Baltics
Curonian Spit National Park (Russia)
Parnidis Dune
References
External links
Official Web page of the Park
The Trail of Nagliai Nature Reserve
National parks of Lithuania
Protected areas established in 1991
1991 establishments in Lithuania
Tourist attractions in Klaipėda County
|
https://en.wikipedia.org/wiki/Ham-Nord
|
Ham-Nord, Quebec is a township municipality in the Centre-du-Québec region of Quebec, Canada.
Demographics
In the 2021 Census of Population conducted by Statistics Canada, Ham-Nord had a population of living in of its total private dwellings, a change of from its 2016 population of . With a land area of , it had a population density of in 2021.
References
(Google Maps)
External links
Township municipalities in Quebec
Incorporated places in Centre-du-Québec
|
https://en.wikipedia.org/wiki/Allelic%20exclusion
|
Allelic exclusion is a process by which only one allele of a gene is expressed while the other allele is silenced. This phenomenon is most notable for playing a role in the development of B lymphocytes, where allelic exclusion allows for each mature B lymphocyte to express only one type of immunoglobulin. This subsequently results in each B lymphocyte being able to recognize only one antigen. This is significant as the co-expression of both alleles in B lymphocytes is associated with autoimmunity and the production of autoantibodies.
Many regulatory processes can lead to allelic exclusion. In one instance, one allele of the gene can become transcriptionally silent, resulting in the transcription and expression of only the other allele. This could be caused in part by decreased methylation of the expressed allele. Conversely, allelic exclusion can also be regulated through asynchronous allelic rearrangement. In this case, both alleles are transcribed but only one becomes a functional protein.
In B-lymphocytes
Allelic exclusion has been observed most often in genes for cell surface receptors and has been extensively studied in immune cells such as B lymphocytes. Allelic exclusion of immunoglobulin (Ig) heavy chain and light chain genes in B cells forms the genetic basis for the presence of only a single type of antigen receptor on a given B lymphocyte, which is central in explaining the ‘one B cell — one antibody’ rule. The variable domain of the B-cell antigen receptor is
|
https://en.wikipedia.org/wiki/Molecular-weight%20size%20marker
|
A molecular-weight size marker, also referred to as a protein ladder, DNA ladder, or RNA ladder, is a set of standards that are used to identify the approximate size of a molecule run on a gel during electrophoresis, using the principle that molecular weight is inversely proportional to migration rate through a gel matrix. Therefore, when used in gel electrophoresis, markers effectively provide a logarithmic scale by which to estimate the size of the other fragments (providing the fragment sizes of the marker are known).
Protein, DNA, and RNA markers with pre-determined fragment sizes and concentrations are commercially available. These can be run in either agarose or polyacrylamide gels. The markers are loaded in lanes adjacent to sample lanes before the commencement of the run.
DNA markers
Development
Although the concept of molecular-weight markers has been retained, techniques of development have varied throughout the years. New inventions of molecular-weight markers are distributed in kits specific to the marker's type.
An early problem in the development of markers was achieving high resolution throughout the entire length of the marker. Depending on the running conditions of gel electrophoresis, fragments may have been compressed, disrupting clarity. To address this issue, a kit for Southern Blot analysis was developed in 1990, providing the first marker to combine target DNA and probe DNA. This technique took advantage of logarithmic spacing, and could be used to
|
https://en.wikipedia.org/wiki/T7%20RNA%20polymerase
|
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction.
Activity
T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa.
Promoter
The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is:
5' * 3'
T7 TAATACGACTCACTATAGGGAGA
T3 AATTAACCCTCACTAAAGGGAGA
K11 AATTAGGGCACACTATAGGGAGA
SP6 ATTTACGACACACTATAGAAGAA
bind------------
-----------init
Transcription begins at the asterisk-marked guanine.
Structure
T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and transcribes it. The N-terminal domain moves around as the elongation complex forms. The ssRNAP holds a DNA-RNA hybrid of 8bp. A beta-hairpin specificity loop (residues 739-770 in T7) recognizes the promoter; swapping it out for one found in T3 RNAP makes the polymerase recognize T3 promoters instead.
Similar to other viral nucleic acid polymerases, including T7 DNA polymerase from the same phage, the conserved C-terminal of T7 ssRNAP employs a fold whose organization has been likened to the shape of a right hand
|
https://en.wikipedia.org/wiki/Born%20Too%20Slow
|
"Born Too Slow" is the first single released from The Crystal Method's third studio album, Legion of Boom. The song features the vocals of Kyuss lead singer John Garcia and guitar by Limp Bizkit's Wes Borland. The song was first featured on EA's Need for Speed: Underground in 2003, with the single being released later that year. The song has also been featured in Gran Turismo 4 and Donkey Konga 2. In 2006, it was featured in the movie Annapolis. It is also in the drama The O.C.
Music video
The music video was directed by Gore Verbinski, director of such films as The Mexican, The Ring, and the Pirates of the Caribbean series. Mr. Verbinski liked the song so much, he asked The Crystal Method if he could direct the video for it. Wes Borland makes a cameo appearance as a man using a pay phone. Fitness expert Billy Blanks Jr. starred in the video as the silver man. Scott Kirkland and Ken Jordan also cameo as the two men in line after the silver man gets his drink.
Track listing
CD
(Released December 9, 2003)
Erick Morillo Main Mix (7:03)
Erick Morillo Dub Mix (7:03)
Deepsky's Green Absinthe Dub Mix (8:12)
NuBreed Remix (6:58)
EK's Spider in the Corner Alt. Dub Mix (6:11)
Vinyl 12"
(Released November 25, 2003)
Erick Morillo Main Mix (7:03)
Erick Morillo Dub Mix (7:03)
Vinyl 12" (Remixes)
(Released December 9, 2003)
Deepsky's Green Absinthe Dub Mix (8:12)
NuBreed Remix (6:58)
EK's Spider in the Corner Alt. Dub Mix (6:11)
2003 singles
The Crystal Method songs
2003 songs
Song
|
https://en.wikipedia.org/wiki/CCNU
|
CCNU can refer to:
Cyclin U, a human gene that now has an official symbol of CCNO
Lomustine, a chemotherapeutic agent
Central China Normal University, a Chinese Ministry of Education university in Wuhan, China.
|
https://en.wikipedia.org/wiki/CD3%20%28immunology%29
|
CD3 (cluster of differentiation 3) is a protein complex and T cell co-receptor that is involved in activating both the cytotoxic T cell (CD8+ naive T cells) and T helper cells (CD4+ naive T cells). It is composed of four distinct chains. In mammals, the complex contains a CD3γ chain, a CD3δ chain, and two CD3ε chains. These chains associate with the T-cell receptor (TCR) and the CD3-zeta (ζ-chain) to generate an activation signal in T lymphocytes. The TCR, CD3-zeta, and the other CD3 molecules together constitute the TCR complex.
Structure
The CD3γ, CD3δ, and CD3ε chains are highly related cell-surface proteins of the immunoglobulin superfamily containing a single extracellular immunoglobulin domain.
A structure of the extracellular and transmembrane regions of the CD3γε/CD3δε/CD3ζζ/TCRαβ complex was solved with CryoEM, showing for the first time how the CD3 transmembrane regions enclose the TCR transmembrane regions in an open barrel.
Containing aspartate residues, the transmembrane region of the CD3 chains is negatively charged, a characteristic that allows these chains to associate with the positively charged TCR chains.
The intracellular tails of the CD3γ, CD3ε, and CD3δ molecules each contain a single conserved motif known as an immunoreceptor tyrosine-based activation motif, or ITAM for short, which is essential for the signaling capacity of the TCR. The intracellular tail of CD3ζ contains 3 ITAM motifs.
Regulation
Phosphorylation of the ITAM on CD3 renders the CD3
|
https://en.wikipedia.org/wiki/Name%20of%20the%20Game%20%28The%20Crystal%20Method%20song%29
|
"Name of the Game" is the first single from The Crystal Method's second studio album, Tweekend. Despite the popularity of the song, The Crystal Method almost never play it live. The track features guitars by Tom Morello, vocals by Ryan "Ryu" Maginn, and scratching by DJ Swamp; it also contains samples from "Calling All Freaks" (1974) by Tina Dixon. The song enjoyed mainstream success as well as remixes by popular artists.
Music video
The music video for the song (directed by Marcos Siega) features the exploits of the character Nosey, who is named so because his entire face is covered up by a giant nose. Scenes in the video depict Nosey participating in sports, breakdancing, and a relationship that falls apart quickly. He gets back to his friends to breakdance and they get to do some until the police arrive and arrest him for unknown reasons. At the end of the video, the words "to be continued ..." are shown. However, no known continuation of the "Nosey" story has yet to be produced.
Track listing
CD
Radio Edit
Album Version
Instrumental
Vinyl
Eric Kupper's Deep Pump Mix
Hybrid's Blackout In L.A. Mix
Vinyl promo
Eric Kupper's Electrosphere Mix
Hybrid's L.A. Blackout Mix
In popular culture
To date, the song has been featured in numerous different forms of media, including:
Used in the 2001 Malcolm in the Middle episode "Charity"
Used in the soundtrack for the film adaptation Resident Evil
Used in one of the climactic scenes in the 2002 film Blade II and its 2004 sequel
|
https://en.wikipedia.org/wiki/Comin%27%20Back
|
"Comin' Back" is a song by American electronic music duo The Crystal Method, featuring American vocalist Trixie Reiss. It was released on July 27, 1998, as the fourth and final single from their debut studio album Vegas. It is their most successful release, reaching number one on the Billboard US Dance Club Chart in 1998.
The song also reached number 73 on the UK Singles Chart, and number 38 on the Billboard Dance/Electronic Songs chart.
Music video
A music video for "Comin' Back" was released in 1998. It was digitally rereleased on their website on January 10, 2007, on their YouTube channel on 25 September 2007, and on their Vevo channel on 16 June 2009.
The video was directed by Peter Christopherson and features The Crystal Method members Scott Kirkland and Ken Jordan riding a cross-country high speed express train across the US.
Track listing
Charts
References
1997 singles
1997 songs
Breakbeat songs
The Crystal Method songs
S2 Records singles
|
https://en.wikipedia.org/wiki/%28Can%27t%20You%29%20Trip%20Like%20I%20Do
|
"(Can't You) Trip Like I Do" is a reworking of "Trip Like I Do", a song featured on The Crystal Method's debut album Vegas. The track was recorded for the 1997 film adaptation of the Spawn comic book series. The song was co-written by Richard Patrick and co-produced by Brian Liesegang, both from Filter who also appeared in the song's video. "(Can't You) Trip Like I Do" is the opening song on the film's soundtrack release, Spawn: The Album and is heard in the end credits. The song was also used for the theatrical trailer of The Matrix and promotional trailers for the Enter the Matrix video game but it does not appear in the film or on the soundtrack.
Inspiration for the song came from a friend of Scott Kirkland who was using ecstasy and leaving voice mail messages telling him "I wish you could trip like I do."
Track listing
"(Can't You) Trip Like I Do" (album version) – 4:25
"(Can't You) Trip Like I Do" (Danny Saber Remix) – 3:39
"(Can't You) Trip Like I Do" (instrumental) – 4:25
"(Can't You) Trip Like I Do" – 7:35
Credits
Tracks 1–3 written, recorded and produced by The Crystal Method and Filter
Mixed by Ben Grosse
Track 1 executive producer: Richard Bishop for 3 A.M.
Track 2 remix and additional production by Danny Saber
Track 4 written by K. Jordan/S. Kirkland; produced and mixed by The Crystal Method
Chart positions
References
1997 singles
1997 songs
Epic Records singles
Filter (band) songs
Music videos directed by Floria Sigismondi
The Crystal Method songs
|
https://en.wikipedia.org/wiki/Flying%20Tiger%2010%20M
|
The Flying Tiger 10 M is a Chinese trailerable sailboat that was designed by American Robert Perry as a one design racer and first built in 2005.
A smaller and lighter derivative is the Perry-designed Flying Tiger 7.5.
Production
The design was built by Hansheng Yachtbuilding in Xiamen, China, starting in 2005, with 110 boats completed, but it is now out of production.
Early production was marred by quality control issues, but these were later resolved with modifications and production line updates.
Design
The boat's concept was created by Bill Steven, an American racing sailor and boatbuilder from the west coast, who had boats built in China in the past. He commissioned Perry to do a preliminary design for a simple and inexpensive sportboat that would fit in a shipping container. Perry's design was then circulated though sailing internet forums for feedback and then orders. The concept was well received and Steven was able to collect 50 US$1000 deposits and that enabled production to begin in China.
It was specifically designed to be ground transported on a boat trailer and therefore uses a lifting keel, an easily removable rudder and carbon fiber spars for lightness.
The Flying Tiger 10 M is a racing keelboat, built predominantly of vinylester resin fiberglass over a foam core. It has a fractional sloop rig, with a deck-stepped mast, two sets of swept spreaders and carbon fiber spars. The hull has a plumb stem with a retractable bowsprit, a slightly reverse transom,
|
https://en.wikipedia.org/wiki/Lev%C3%A1re
|
Levare () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
https://web.archive.org/web/20061230185723/http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Polina%2C%20Rev%C3%BAca%20District
|
Polina () is a hamlet in the Revúca District, Banská Bystrica Region, Slovakia.
External links
https://web.archive.org/web/20071027094149/http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Cylinder%20set%20measure
|
In mathematics, cylinder set measure (or promeasure, or premeasure, or quasi-measure, or CSM) is a kind of prototype for a measure on an infinite-dimensional vector space. An example is the Gaussian cylinder set measure on Hilbert space.
Cylinder set measures are in general not measures (and in particular need not be countably additive but only finitely additive), but can be used to define measures, such as classical Wiener measure on the set of continuous paths starting at the origin in Euclidean space.
Definition
Let be a separable real topological vector space. Let denote the collection of all surjective continuous linear maps defined on whose image is some finite-dimensional real vector space :
A cylinder set measure on is a collection of probability measures
where is a probability measure on These measures are required to satisfy the following consistency condition: if is a surjective projection, then the push forward of the measure is as follows:
Remarks
The consistency condition
is modelled on the way that true measures push forward (see the section cylinder set measures versus true measures). However, it is important to understand that in the case of cylinder set measures, this is a requirement that is part of the definition, not a result.
A cylinder set measure can be intuitively understood as defining a finitely additive function on the cylinder sets of the topological vector space The cylinder sets are the pre-images in of measurable sets in :
|
https://en.wikipedia.org/wiki/John%20Panaretos
|
John Panaretos (; born 1948 in Kythera) is a Greek educator and statistician. He is Professor of Probability and Statistics at the Athens University of Economics and Business. He was Deputy Minister of Education, Lifelong Learning and Religious Affairs (6 October 2009 – 17 June 2011). He has also been appointed by the Prime Minister to be in charge of the Open Government project.
Education and career
Before joining the Athens University of Economics and Business, he taught at the universities of Patras and Crete in Greece, University of Iowa and University of Missouri in the United States, and at Trinity College, Dublin in Ireland.
He has been Director of the Institute of Statistical Documentation Research and Analysis since 1996, a life member of the Scientific Council of the Greek Parliament since 1987, and a member of the governing board of the Institute of Strategic and Development Studies (ISTAME) - Andreas Papandreou (2005–2008). Since 2004, he is the education adviser of George Papandreou, leader of Panhellenic Socialist Movement (PASOK, the main opposition party of Greece) and the Socialist International. He was a member of the National Council of Education, the Council of University Education, the Council of Technical Education and the Council of Primary and Secondary Education.
He has acted as Chairman of the Department of Statistics (1993–1996 & 2000-2002) and as member of the research committee of the University (1993–1996). At the University of Patras, he ser
|
https://en.wikipedia.org/wiki/Gaussian%20measure
|
In mathematics, Gaussian measure is a Borel measure on finite-dimensional Euclidean space Rn, closely related to the normal distribution in statistics. There is also a generalization to infinite-dimensional spaces. Gaussian measures are named after the German mathematician Carl Friedrich Gauss. One reason why Gaussian measures are so ubiquitous in probability theory is the central limit theorem. Loosely speaking, it states that if a random variable X is obtained by summing a large number N of independent random variables of order 1, then X is of order and its law is approximately Gaussian.
Definitions
Let n ∈ N and let B0(Rn) denote the completion of the Borel σ-algebra on Rn. Let λn : B0(Rn) → [0, +∞] denote the usual n-dimensional Lebesgue measure. Then the standard Gaussian measure γn : B0(Rn) → [0, 1] is defined by
for any measurable set A ∈ B0(Rn). In terms of the Radon–Nikodym derivative,
More generally, the Gaussian measure with mean μ ∈ Rn and variance σ2 > 0 is given by
Gaussian measures with mean μ = 0 are known as centred Gaussian measures.
The Dirac measure δμ is the weak limit of as σ → 0, and is considered to be a degenerate Gaussian measure; in contrast, Gaussian measures with finite, non-zero variance are called non-degenerate Gaussian measures.
Properties
The standard Gaussian measure γn on Rn
is a Borel measure (in fact, as remarked above, it is defined on the completion of the Borel sigma algebra, which is a finer structure);
is equivalent to Lebe
|
https://en.wikipedia.org/wiki/Cameron%E2%80%93Martin%20theorem
|
In mathematics, the Cameron–Martin theorem or Cameron–Martin formula (named after Robert Horton Cameron and W. T. Martin) is a theorem of measure theory that describes how abstract Wiener measure changes under translation by certain elements of the Cameron–Martin Hilbert space.
Motivation
The standard Gaussian measure on -dimensional Euclidean space is not translation-invariant. (In fact, there is a unique translation invariant Radon measure up to scale by Haar's theorem: the -dimensional Lebesgue measure, denoted here .) Instead, a measurable subset has Gaussian measure
Here refers to the standard Euclidean dot product in . The Gaussian measure of the translation of by a vector is
So under translation through , the Gaussian measure scales by the distribution function appearing in the last display:
The measure that associates to the set the number is the pushforward measure, denoted . Here refers to the translation map: . The above calculation shows that the Radon–Nikodym derivative of the pushforward measure with respect to the original Gaussian measure is given by
The abstract Wiener measure on a separable Banach space , where is an abstract Wiener space, is also a "Gaussian measure" in a suitable sense. How does it change under translation? It turns out that a similar formula to the one above holds if we consider only translations by elements of the dense subspace .
Statement of the theorem
Let be an abstract Wiener space with abstract Wiener measu
|
https://en.wikipedia.org/wiki/Masoud%20Zarei
|
Masoud Zarei (, born August 25, 1981, in Tehran, Iran) is an Iranian footballer, currently a member of the IPL club Mes Kerman.
Club career
Club career Statistics
Last Update 16 December 2009
Assist Goals
Honours
Azadegan League
Winner: 1
2003/04 with Saba Battery
Hazfi Cup
Winner: 1
2005 with Saba Battery
Iran's Premier Football League
Winner: 1
2007/08 with Persepolis
External links
1981 births
Living people
Saba Qom F.C. players
Iranian men's footballers
Persepolis F.C. players
Sanat Mes Kerman F.C. players
Men's association football defenders
Footballers from Tehran
Persepolis F.C. non-playing staff
|
https://en.wikipedia.org/wiki/Ebrahim%20Asadi
|
Ebrahim Asadi (, born June 8, 1979) is a retired Iranian footballer who played for Persepolis.
Club career
Club Career Statistics
Last Update 18 September 2010
Assist Goals
Honours
Club
Persepolis
Iranian Football League (2) : 1999–2000, 2001–02
References
External links
Persian League Profile
1979 births
Living people
Zob Ahan Esfahan F.C. players
Steel Azin F.C. players
F.C. Nassaji Mazandaran players
Iranian men's footballers
Persepolis F.C. players
Men's association football midfielders
Footballers from Tehran
|
https://en.wikipedia.org/wiki/Motorsport.tv
|
Motorsport.tv is a global streaming OTT platform specialized in motor racing and motoring content, live and on demand launched in September 2018. It is a fully integrated video ecosystem developed and operated by Motorsport Network to specifically cater to different motor racing and automotive audiences.
Motorsport.tv distributes globally over many different digital platforms. It offers both subscription content (SVOD) under the label Motorsport.tv Premium, and free to view ad-supported content (AVOD). As of 2023, Motorsport.tv contains 14,000+ hours long and short form on demand videos 35,000+ video titles available online and livestream more than 1,200 events yearly.
History
In November 2016, Motorsport Network had acquired Motors TV. On 1 March 2017, Motors TV was rebranded to become Motorsport.tv. On that same day, the HD version of the channel was launched.
In September 2018 it became clear that the Motorsport.tv linear channel would close on 30 September 2018 in both SD and HD versions. From that date, the service switched to online-streaming only. In September 2018, Motorsport.tv launched its version 1 on the web, as a subscription OTT service only, with 800 hours of VOD content and 12 racing series live. It started its partnership with the Automobile Club de l'Ouest to stream the full archive of the famed 24 Hours of Le Mans.
October 2018, it launched its version 1 on mobile devices with both iOS and Android applications. In January 2019, it presented its first
|
https://en.wikipedia.org/wiki/Smallest%20organisms
|
The smallest organisms found on Earth can be determined according to various aspects of organism size, including volume, mass, height, length, or genome size.
Given the incomplete nature of scientific knowledge, it is possible that the smallest organism is undiscovered. Furthermore, there is some debate over the definition of life, and what entities qualify as organisms; consequently the smallest known organism (microorganism) is debatable.
Microorganisms
Obligate endosymbiotic bacteria
The genome of Nasuia deltocephalinicola, a symbiont of the European pest leafhopper, Macrosteles quadripunctulatus, consists of a circular chromosome of 112,031 base pairs.
The genome of Nanoarchaeum equitans is 491 Kbp nucleotides long.
Pelagibacter ubique
Pelagibacter ubique is one of the smallest known free-living bacteria, with a length of and an average cell diameter of . They also have the smallest free-living bacterium genome: 1.3 Mbp, 1354 protein genes, 35 RNA genes. They are one of the most common and smallest organisms in the ocean, with their total weight exceeding that of all fish in the sea.
Mycoplasma genitalium
Mycoplasma genitalium, a parasitic bacterium which lives in the primate bladder, waste disposal organs, genital, and respiratory tracts, is thought to be the smallest known organism capable of independent growth and reproduction. With a size of approximately 200 to 300 nm, M. genitalium is an ultramicrobacterium, smaller than other small bacteria, including ri
|
https://en.wikipedia.org/wiki/Human%20evolutionary%20genetics
|
Human evolutionary genetics studies how one human genome differs from another human genome, the evolutionary past that gave rise to the human genome, and its current effects. Differences between genomes have anthropological, medical, historical and forensic implications and applications. Genetic data can provide important insights into human evolution.
Origin of apes
Biologists classify humans, along with only a few other species, as great apes (species in the family Hominidae). The living Hominidae include two distinct species of chimpanzee (the bonobo, Pan paniscus, and the chimpanzee, Pan troglodytes), two species of gorilla (the western gorilla, Gorilla gorilla, and the eastern gorilla, Gorilla graueri), and two species of orangutan (the Bornean orangutan, Pongo pygmaeus, and the Sumatran orangutan, Pongo abelii). The great apes with the family Hylobatidae of gibbons form the superfamily Hominoidea of apes.
Apes, in turn, belong to the primate order (>400 species), along with the Old World monkeys, the New World monkeys, and others. Data from both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) indicate that primates belong to the group of Euarchontoglires, together with Rodentia, Lagomorpha, Dermoptera, and Scandentia. This is further supported by Alu-like short interspersed nuclear elements (SINEs) which have been found only in members of the Euarchontoglires.
Phylogenetics
A phylogenetic tree is usually derived from DNA or protein sequences from populations. Often
|
https://en.wikipedia.org/wiki/External%20limiting%20membrane
|
The external limiting membrane (or outer limiting membrane) is one of the ten distinct layers of the retina of the eye. It has a network-like structure and is situated at the bases of the rods and cones.
Additional images
See also
Retina
External links
https://web.archive.org/web/20050313111150/http://www.med.uiuc.edu/histo/small/atlas/objects/126.htm
Slide at uc.edu
http://www.kumc.edu/instruction/medicine/anatomy/histoweb/eye_ear/eye12.htm
https://web.archive.org/web/20070518033845/http://education.vetmed.vt.edu/Curriculum/VM8054/EYE/RETINA.HTM
Human eye anatomy
|
https://en.wikipedia.org/wiki/Internal%20limiting%20membrane
|
The internal limiting membrane, or inner limiting membrane, is the boundary between the retina and the vitreous body, formed by astrocytes and the end feet of Müller cells. It is separated from the vitreous body by a basal lamina.
External links
Human eye anatomy
|
https://en.wikipedia.org/wiki/Outer%20plexiform%20layer
|
The outer plexiform layer (external plexiform layer) is a layer of neuronal synapses in the retina of the eye. It consists of a dense network of synapses between dendrites of horizontal cells from the inner nuclear layer, and photoreceptor cell inner segments from the outer nuclear layer. It is much thinner than the inner plexiform layer, where amacrine cells synapse with retinal ganglion cells.
The synapses in the outer plexiform layer are between the rod cell endings or cone cell branched foot plates and horizontal cells. Unlike in most systems, rod and cone cells release neurotransmitters when not receiving a light signal.
References
External links
Human eye anatomy
ca:Retina#Capes de la retina
|
https://en.wikipedia.org/wiki/Ganglion%20cell%20layer
|
In the anatomy of the eye, the ganglion cell layer (ganglionic layer) is a layer of the retina that consists of retinal ganglion cells and displaced amacrine cells.
The cells are somewhat flask-shaped; the rounded internal surface of each resting on the stratum opticum, and sending off an axon which is prolonged into it.
From the opposite end numerous dendrites extend into the inner plexiform layer, where they branch and form flattened arborizations at different levels.
The ganglion cells vary much in size, and the dendrites of the smaller ones as a rule arborize in the inner plexiform layer as soon as they enter it; while those of the larger cells ramify close to the inner nuclear layer.
References
External links
Human eye anatomy
|
https://en.wikipedia.org/wiki/Islet%20cell%20transplantation
|
Islet transplantation is the transplantation of isolated islets from a donor pancreas into another person. It is a treatment for type 1 diabetes. Once transplanted, the islets begin to produce insulin, actively regulating the level of glucose in the blood.
Islets are usually infused into the person's liver. If the cells are not from a genetically identical donor the person's body will recognize them as foreign and the immune system will begin to attack them as with any transplant rejection. To prevent this immunosuppressant drugs are used. A study from 2005 showed that islet transplantation has progressed to the point that 58% of the people were insulin independent one year after the operation. A review published 2016 reported a 50 – 70% rate of insulin independence after five years, in five studies from leading transplant centers published 2005 – 2012.
In the period from 1999 to 2004, 471 people with type 1 diabetes received islet transplants at 43 institutions worldwide.
Donislecel (Lantidra) allogeneic (donor) pancreatic islet cellular therapy was approved for medical use in the United States in June 2023.
History
The concept of islet transplantation is not new. Investigators as early as the English surgeon Charles Pybus (1882–1975) attempted to graft pancreatic tissue to cure diabetes. Most, however, credit the recent era of islet transplantation research to Paul Lacy's studies dating back more than three decades. In 1967, Lacy's group described a novel collagenase-b
|
https://en.wikipedia.org/wiki/PHOX2B
|
Paired-like homeobox 2b (PHOX2B), also known as neuroblastoma Phox (NBPhox), is a protein that in humans is encoded by the PHOX2B gene located on chromosome 4.
It codes for a homeodomain transcription factor. It is expressed exclusively in the nervous system, in most neurons that control the viscera (cardiovascular, digestive and respiratory systems). It is also required for their differentiation.
Immunohistochemistry
Essential for the differentiation and survival of sympathetic neurons and chromaffin cells, the transcription factor PHOX2B is highly specific for the peripheral autonomic nervous system. Neuroblasts are derived from sympathoadrenal lineage neural crest cells and therefore require and constitutively express PHOX2B. PHOX2B immunohistochemical staining, as a marker of neural crest derivation, has been shown to be sensitive and specific for undifferentiated neuroblastoma, enabling identification where other markers fail to recognize neuroblastoma among various different small round blue cell tumors of childhood.
The diagnostic utility of PHOX2B staining extends to later stages of differentiation. Its strength and specificity can detect the small foci of neuroblastic tumors metastatic to the bone marrow, an identification critical for determining disease staging. PHOX2B staining also overcomes frequent obstacles to neuroblastoma detection in post-treatment samples, which frequently exhibit dense fibrosis, prominent inflammatory infiltrates, and/or diffuse calcif
|
https://en.wikipedia.org/wiki/Fotomaker
|
Fotomaker was a power pop group from Long Island, New York who released three albums between 1978 and 1979.
History
The band was formed in 1977 by bassist Gene Cornish and drummer Dino Danelli, former members of The Rascals (although Cornish was guitarist for the group). Soon, guitarist/vocalist Wally Bryson, formerly of the Raspberries was added, alongside guitarist/vocalist Lex Marchesi and keyboardist/vocalist Frankie Vinci. Fotomaker debuted at the newly remodeled Cleveland Agora in early 1978. The 1978 debut release, simply titled Fotomaker, was released on Atlantic Records.
The second album, Vis-a-Vis, was released in October, 1978. It was recorded at The Record Plant studios (used by the Raspberries) that summer on Wally Bryson's suggestion. Vis-a-Vis opened with Vinci's song "Miles Away", which was released as a single and peaked at number 63 on the Billboard Hot 100. Wally Bryson had already left the band before the band's third album, Transfer Station. Fotomaker did not tour in support of Transfer Station. The album failed to reach the charts, and the group disbanded shortly afterwards.
Post-Fotomaker careers
In 1997, Gene Cornish and Dino Danelli, along with former Rascals bandmates Felix Cavaliere and Eddie Brigati, were inducted into the Rock and Roll Hall of Fame.
Wally Bryson returned home to Cleveland early 1979, teaming up with Dann Klawon in his band "Peter Panic". Bryson has also collaborated with his son Jesse, in The Bryson Group.
Frankie Vinci has
|
https://en.wikipedia.org/wiki/R%C3%ADo%20Claro
|
Río Claro is a commune of the Talca Province in Chile's Maule Region. The municipal seat is the town of Cumpeo.
Demographics
According to the 2002 census of the National Statistics Institute, Río Claro spans an area of and has 12,698 inhabitants (6,716 men and 5,982 women). Of these, 2,651 (20.9%) lived in urban areas and 10,047 (79.1%) in rural areas. The population grew by 0.8% (107 persons) between the 1992 and 2002 censuses.
Administration
As a commune, Río Claro is a third-level administrative division of Chile administered by a municipal council, headed by an alcalde who is directly elected every four years. The 2008-2012 alcalde is Claudio Guajardo Oyarce.
Within the electoral divisions of Chile, Río Claro is represented in the Chamber of Deputies by Pablo Lorenzini (PDC) and Pedro Pablo Alvarez-Salamanca (UDI) as part of the 38th electoral district, together with Curepto, Constitución, Empedrado, Pencahue, Maule, San Clemente, Pelarco and San Rafael. The commune is represented in the Senate by Juan Antonio Coloma Correa (UDI) and Andrés Zaldívar Larraín (PDC) as part of the 10th senatorial constituency (Maule-North).
References
External links
Municipality of Río Claro
Communes of Chile
Populated places in Talca Province
|
https://en.wikipedia.org/wiki/Sagrada%20Familia%2C%20Chile
|
Sagrada Familia (Spanish meaning "Holy Family") is a Chilean town and commune in Curicó Province, Maule Region.
Demographics
According to the 2002 census of the National Statistics Institute, Sagrada Familia spans an area of and has 17,519 inhabitants (9,108 men and 8,411 women). Of these, 5,080 (29%) lived in urban areas and 12,439 (71%) in rural areas. The population grew by 3.7% (625 persons) between the 1992 and 2002 censuses.
Administration
As a commune, Sagrada Familia is a third-level administrative division of Chile administered by a municipal council, headed by an alcalde who is directly elected every four years. The 2008-2012 alcalde is Francisco Meléndez Rojas (PS).
Within the electoral divisions of Chile, Sagrada Familia is represented in the Chamber of Deputies by Roberto León (PDC) and Celso Morales (UDI) as part of the 36th electoral district, together with Curicó, Teno, Romeral, Molina, Hualañé, Licantén, Vichuquén and Rauco. The commune is represented in the Senate by Juan Antonio Coloma Correa (UDI) and Andrés Zaldívar Larraín (PDC) as part of the 10th senatorial constituency (Maule-North).
References
External links
Municipality of Sagrada Familia
Populated places in Curicó Province
Communes of Chile
|
https://en.wikipedia.org/wiki/Romeral
|
Romeral is a Chilean town and commune in Curicó Province, Maule Region. The commune spans and area of .
Demographics
According to the 2002 census of Population and Housing by the National Statistics Institute, the Romeral commune had 12,707 inhabitants; of these, 3,675 (28.9%) lived in urban areas and 9,032 (71.1%) in rural areas. At that time, there were 6,596 men and 6,111 women. The population grew by 10.6% (1,217 persons) between the 1992 and 2002 censuses.
Administration
As a commune, Romeral is a third-level administrative division of Chile administered by a municipal council, headed by an alcalde who is directly elected every four years. The 2008-2012 alcalde is Carlos Cisterna Negrete (PDC).
Within the electoral divisions of Chile, Romeral is represented in the Chamber of Deputies by Roberto León (PDC) and Celso Morales (UDI) as part of the 36th electoral district, together with Curicó, Teno, Molina, Sagrada Familia, Hualañé, Licantén, Vichuquén and Rauco. The commune is represented in the Senate by Juan Antonio Coloma Correa (UDI) and Andrés Zaldívar Larraín (PDC) as part of the 10th senatorial constituency (Maule-North).
References
Populated places in Curicó Province
Communes of Chile
|
https://en.wikipedia.org/wiki/Banach%E2%80%93Mazur%20theorem
|
In functional analysis, a field of mathematics, the Banach–Mazur theorem is a theorem roughly stating that most well-behaved normed spaces are subspaces of the space of continuous paths. It is named after Stefan Banach and Stanisław Mazur.
Statement
Every real, separable Banach space is isometrically isomorphic to a closed subspace of , the space of all continuous functions from the unit interval into the real line.
Comments
On the one hand, the Banach–Mazur theorem seems to tell us that the seemingly vast collection of all separable Banach spaces is not that vast or difficult to work with, since a separable Banach space is "only" a collection of continuous paths. On the other hand, the theorem tells us that is a "really big" space, big enough to contain every possible separable Banach space.
Non-separable Banach spaces cannot embed isometrically in the separable space , but for every Banach space , one can find a compact Hausdorff space and an isometric linear embedding of into the space of scalar continuous functions on . The simplest choice is to let be the unit ball of the continuous dual , equipped with the w*-topology. This unit ball is then compact by the Banach–Alaoglu theorem. The embedding is introduced by saying that for every , the continuous function on is defined by
The mapping is linear, and it is isometric by the Hahn–Banach theorem.
Another generalization was given by Kleiber and Pervin (1969): a metric space of density equal to an infinite c
|
https://en.wikipedia.org/wiki/San%20Rafael%2C%20Chile
|
San Rafael is a town and commune of the Talca Province in the Maule Region of Chile. The town serves as the communal capital.
Demographics
According to the 2002 census of the National Statistics Institute, San Rafael spans an area of and has 7,674 inhabitants (3,903 men and 3,771 women). Of these, 3,482 (45.4%) lived in urban areas and 4,192 (54.6%) in rural areas. The population grew by 6.5% (465 persons) between the 1992 and 2002 censuses.
Administration
As a commune, San Rafael is a third-level administrative division of Chile administered by a municipal council, headed by an alcalde who is directly elected every four years. The 2008-2012 alcaldesa is CLAUDIA ALEJANDRA DIAZ BRAVO. (UDI).
Within the electoral divisions of Chile, San Rafael is represented in the Chamber of Deputies by Pablo Lorenzini (PDC) and Pedro Pablo Alvarez-Salamanca (UDI) as part of the 38th electoral district, together with Curepto, Constitución, Empedrado, Pencahue, Maule, San Clemente, Pelarco and Río Claro. The commune is represented in the Senate by Juan Antonio Coloma Correa (UDI) and Andrés Zaldívar Larraín (PDC) as part of the 10th senatorial constituency (Maule-North).
References
External links
Municipality of San Rafael
Populated places in Talca Province
Communes of Chile
|
https://en.wikipedia.org/wiki/AP-1%20binding%20site
|
The AP-1 binding site, also known as the AP-1 promoter site, is a DNA sequence to which AP-1 transcription factors are able to bind. The AP-1 binding site, in humans, has a nucleotide sequence of ATGAGTCAT, where A corresponds to adenine, T corresponds to thymine, G corresponds to guanine, and C corresponds to cytosine.
External links
AP-1 nucleotide sequence
References
DNA
|
https://en.wikipedia.org/wiki/Theory%20of%20two-level%20planning
|
The theory of two-level planning (alternatively, Kornai–Liptak decomposition) is a method that decomposes large problems of linear optimization into sub-problems. This decomposition simplifies the solution of the overall problem. The method also models a method of coordinating economic decisions so that decentralized firms behave so as to produce a global optimum. It was introduced by the Hungarian economist János Kornai and the mathematician Tamás Lipták in 1965. It is an alternative to Dantzig–Wolfe decomposition.
Description
The LP problem must have a special structure, known as a block angular structure. This is the same structure required for the Dantzig Wolfe decomposition:
There are some constraints on overall resources (D) for which a central planning agency is assumed to be responsible, and n blocks of coefficients (F1 through Fn) that are the concern of individual firms.
The central agency starts the process by providing each firm with tentative resource allocations which satisfy the overall constraints D. Each firm optimizes its local decision variables assuming the global resource allocations are as indicated. The solution of the firm LP's yield Lagrange multipliers (prices) for the global resources which the firms transmit back to the planning agency.
In the next iteration, the central agency uses the information received from firms to come up with a revised resource allocation; for example if firm i reports a high shadow price for resource j, the agen
|
https://en.wikipedia.org/wiki/RK%20FM
|
RK FM (Radio Kuwait) also known as (SuperStation) is a radio station located in Kuwait City, Kuwait.
The station is broadcast on the FM band at a frequency of 99.7 MHz.
Radio Kuwait 99.7 broadcasts music, news, information, talk and live shows. However, RK FM is primarily considered a music station.
The most common types of music played are hip hop, rock, and rap, which are based on American, British and some middle-east music creators.
References
Radio stations in Kuwait
Mass media in Kuwait City
|
https://en.wikipedia.org/wiki/Lycorine
|
Lycorine is a toxic crystalline alkaloid found in various Amaryllidaceae species, such as the cultivated bush lily (Clivia miniata), surprise lilies (Lycoris), and daffodils (Narcissus). It may be highly poisonous, or even lethal, when ingested in certain quantities. Regardless, it is sometimes used medicinally, a reason why some groups may harvest the very popular Clivia miniata.
Source
Lycorine is found in different species of Amaryllidaceae which include flowers and bulbs of daffodil, snowdrop (Galanthus) or spider lily (Lycoris). Lycorine is the most frequent alkaloid of Amaryllidaceae.
The earliest diversification of Amaryllidaceae was most likely in North Africa and the Iberian peninsula and that lycorine is one of the oldest in the Amaryllidaceae alkaloid biosynthetic pathway.
Mechanism of action
There is currently very little known about the mechanism of action of lycorine, although there have been some tentative hypotheses advanced concerning the metabolism of the alkaloid, based on experiments carried out upon beagle dogs.
Lycorine inhibits protein synthesis, and may inhibit ascorbic acid biosynthesis, although studies on the latter are controversial and inconclusive. Presently, it serves some interest in the study of certain yeasts, the principal organism on which lycorine is tested.
It is known that lycorine weakly inhibits acetylcholinesterase (AChE) and ascorbic acid biosynthesis. The IC50 of lycorine was found to vary between the different species it ca
|
https://en.wikipedia.org/wiki/Software%20regression
|
A software regression is a type of software bug where a feature that has worked before stops working. This may happen after changes are applied to the software's source code, including the addition of new features and bug fixes. They may also be introduced by changes to the environment in which the software is running, such as system upgrades, system patching or a change to daylight saving time. A software performance regression is a situation where the software still functions correctly, but performs more slowly or uses more memory or resources than before. Various types of software regressions have been identified in practice, including the following:
Local – a change introduces a new bug in the changed module or component.
Remote – a change in one part of the software breaks functionality in another module or component.
Unmasked – a change unmasks an already existing bug that had no effect before the change.
Regressions are often caused by encompassed bug fixes included in software patches. One approach to avoiding this kind of problem is regression testing. A properly designed test plan aims at preventing this possibility before releasing any software. Automated testing and well-written test cases can reduce the likelihood of a regression.
Prevention and detection
Techniques have been proposed that try to prevent regressions from being introduced into software at various stages of development, as outlined below.
Prior to release
In order to avoid regressions being
|
https://en.wikipedia.org/wiki/Cytoplast
|
A cytoplast is a medical term that is used to describe a cell membrane and the cytoplasm. It is occasionally used to describe a cell in which the nucleus has been removed. Originally named by Rebecca Bodily.
See also
Cytoplast
References
Cell biology
|
https://en.wikipedia.org/wiki/Tech%20tabloid
|
A Tech tabloid is a type of news media that mainly concentrates on technology news: science, IT, semiconductors, telecoms and related issues, but also takes on a less formal and more humorous approach than traditional technology publications such as EE Times or EDN. They are professional in nature, though, rather than community-based technology news sites such as Digg or Slashdot.
Tabloid nature
Tabloid newspapers traditionally aim for sensationalist stories, celebrity news and aim for a down-market reader. The tabloid tag does not apply to the paper format, as many of these publications are web-based only, such as The Inquirer and The Register.
The sarcastic, iconoclastic and skeptic tones of these publications is often more akin to publication such as Private Eye, which would not usually be labelled a tabloid, than to the Page Three tabloid such as The Sun and the Daily Star.
The Inquirer even, in its 20000th article, refers to itself as "redtop tabloid rags like the INQUIRER", later in the same article calling itself "cheesy": determining the irony of this is left as an exercise to the reader. Both the Register and the Inquirer do generally have red banners at the top of their home pages.
References
External links
How Freefast cover technology News?
What is Tech tabloid?
News media
|
https://en.wikipedia.org/wiki/Austrian%20Sign%20Language
|
Austrian Sign Language, or Österreichische Gebärdensprache (ÖGS), is the sign language used by the Austrian Deaf community—approximately 10,000 people (see Krausneker 2006).
Classification
ÖGS and Hungarian Sign Language seem to be related for historical reasons (First School for the Deaf in Vienna), but HSL forms a cluster with neighboring languages rather than with ÖGS. Although there are no detailed studies of the extent of relatedness, ÖGS shares aspects of its grammar with German Sign Language and Swiss Sign Language, while the vocabulary differs (see Skant et al. 2002); Wittmann (1991) places it in the French Sign Language family).
Research
Linguistic research on ÖGS started in the 1990s and is primarily conducted at the University of Klagenfurt and University of Graz. The Alpen-Adria-Universität Klagenfurt (AAU) worked on the "Deaf learning" project (September 1, 2015 – August 31, 2018) financed under Erasmus+ as a cooperation for innovation and the exchange of good practices, strategic Partnerships for adult education aimed at deaf adults with Austrian Sign Language as their first natural language and the German written language as their second language with the aim of raising the level of literacy. The program was expanded by Eramus+ after its completion to promote achieving higher social, educational and financial positions through better access to the written language proficiency with the "Deaf language awareness" project (September 1, 2018 – July 7, 2021) b
|
https://en.wikipedia.org/wiki/Mask%20shop
|
A mask shop is a factory which manufactures photomasks for use in the semiconductor industry. There are two distinct types found in the trade. Captive mask shops are in-house operations owned by the biggest semiconductor corporations, while merchant mask shops make masks for most of the industry.
Merchant mask shops will produce photomasks for a variety of integrated device manufacturers (IDMs), foundries or optical device companies in addition to providing excess cavity work and re-pellicle for captive mask shops.
The company structure is similar to that of any medium-sized manufacture and has the
following unique departments or mask makers:
Sales Customer / customer services
Front end data prep
Facilities maintenance - plant & environment
Engineering - equipment maintenance
Engineering - process, inspection & metrology
Quality assurance
Shipping & dispatching
Photomask market
The worldwide photomask production market was $3.1 billion in 2013. Almost half of market attributed to captive mask shops (in-house mask shops of major chipmakers).
Infrastructure (technical and financial)
The costs of creating new mask shop for 180 nm processes were estimated in 2005 as $40 million, and for 130 nm - more than $100 million. In 2013 cost of new 28 nm mask shop was estimated at $110 – 140 million.
Future
As technology shrinks, the cost to mask shops increase and the product turn around time grow longer as well. The trend in this new decade is for manufacturing to migrate eastwar
|
https://en.wikipedia.org/wiki/Boucherot%20cell
|
This article relates to loudspeaker driving. See Zobel network for a more general description of telecommunications usage.
A Boucherot cell (or Zobel network) is an electronic filter, used in audio amplifiers to damp high-frequency oscillations that might occur in the absence of loads at high frequencies. Named after Paul Boucherot a Boucherot cell typically consists of a resistor and capacitor in series, usually placed across a load for stability.
It is commonly seen in analog power amplifiers at the output of the driver stage, just before the output inductor. The speaker coil inductance of a loudspeaker generates a rising impedance, which is worsened by the output inductor generally found in analog power amplifiers; the cell is used to limit this impedance.
The documentation for some power operation amplifiers suggests the use of a "Boucherot cell between outputs and ground or across the load".
Additionally, Boucherot cells are sometimes used across the bass driver (and mid-range) of a speaker system, in order to maintain a more constant driving point impedance as "seen" by a passive crossover. In this specific arrangement, the Boucherot cell is sometimes also known as a Zobel network.
Some loudspeaker crossover designs aim to stabilize impedance at high frequencies by including Zobel networks.
See also
RC snubber
References
Electronic circuits
Filter theory
de:Boucherot-Glied
|
https://en.wikipedia.org/wiki/Kirsch%20equations
|
The Kirsch equations describe the elastic stresses around the hole in an infinite plate in one directional tension. They are named after Ernst Gustav Kirsch.
Result
Loading an infinite plate with circular hole of radius a with stress σ, the resulting stress field is:
References
Kirsch, 1898, Die Theorie der Elastizität und die Bedürfnisse der Festigkeitslehre. Zeitschrift des Vereines deutscher Ingenieure, 42, 797–807.
Solid mechanics
|
https://en.wikipedia.org/wiki/Structure%20theorem%20for%20Gaussian%20measures
|
In mathematics, the structure theorem for Gaussian measures shows that the abstract Wiener space construction is essentially the only way to obtain a strictly positive Gaussian measure on a separable Banach space. It was proved in the 1970s by Kallianpur–Sato–Stefan and Dudley–Feldman–le Cam.
There is the earlier result due to H. Satô (1969) which proves that "any Gaussian measure on a separable Banach space is an abstract Wiener measure in the sense of L. Gross". The result by Dudley et al. generalizes this result to the setting of Gaussian measures on a general topological vector space.
Statement of the theorem
Let γ be a strictly positive Gaussian measure on a separable Banach space (E, || ||). Then there exists a separable Hilbert space (H, 〈 , 〉) and a map i : H → E such that i : H → E is an abstract Wiener space with γ = i∗(γH), where γH is the canonical Gaussian cylinder set measure on H.
References
Banach spaces
Probability theorems
Theorems in measure theory
|
https://en.wikipedia.org/wiki/Hewitt%E2%80%93Savage%20zero%E2%80%93one%20law
|
The Hewitt–Savage zero–one law is a theorem in probability theory, similar to Kolmogorov's zero–one law and the Borel–Cantelli lemma, that specifies that a certain type of event will either almost surely happen or almost surely not happen. It is sometimes known as the Savage-Hewitt law for symmetric events. It is named after Edwin Hewitt and Leonard Jimmie Savage.
Statement of the Hewitt-Savage zero-one law
Let be a sequence of independent and identically-distributed random variables taking values in a set . The Hewitt-Savage zero–one law says that any event whose occurrence or non-occurrence is determined by the values of these random variables and whose occurrence or non-occurrence is unchanged by finite permutations of the indices, has probability either 0 or 1 (a "finite" permutation is one that leaves all but finitely many of the indices fixed).
Somewhat more abstractly, define the exchangeable sigma algebra or sigma algebra of symmetric events to be the set of events (depending on the sequence of variables ) which are invariant under finite permutations of the indices in the sequence . Then .
Since any finite permutation can be written as a product of transpositions, if we wish to check whether or not an event is symmetric (lies in ), it is enough to check if its occurrence is unchanged by an arbitrary transposition , .
Examples
Example 1
Let the sequence of independent and identically distributed random variables take values in . Then the event that the serie
|
https://en.wikipedia.org/wiki/Periventricular%20nucleus
|
The periventricular nucleus is a thin sheet of small neurons located in the wall of the third ventricle, a composite structure of the hypothalamus. It functions in analgesia.
It is located in the rostral, intermediate, and caudal regions of the hypothalamus. The rostral region aids in the production of both somatostatin and thyroid releasing hormone. The intermediate portion aids in production of thyroid releasing hormone, somatostatin, leptin, gastrin, and neuropeptide y. In humans and primates it also produces GnRH. Lastly the caudal region aids in sympathetic nervous system regulation, and is regarded as the rage center. The periventricular nucleus does not have an effective blood–brain barrier.
11β-HSD2 expression turns cortisol into cortisone.
Role in LH and GnRH release
This nucleus has been shown to affect the release of GnRH (gonadotropin-releasing hormone) in several ways. One way is its expression of neuropeptide Y, which has an impact on the hypothalamic pathway responsible for GnRH secretion. The periventricular nucleus has also been shown to have many neurons that express kisspeptin, which generates a surge in LH, which ultimately leads to the release of GnRH. In female rats, there is a greater expression of estrogen receptor beta in the periventricular nuclear cells, which is thought to lead to different levels of LH secretion in males and females.
Role in GH release
This region has been shown to aid in the production of somatostatin and research shows
|
https://en.wikipedia.org/wiki/Identity%20theorem%20for%20Riemann%20surfaces
|
In mathematics, the identity theorem for Riemann surfaces is a theorem that states that a holomorphic function is completely determined by its values on any subset of its domain that has a limit point.
Statement of the theorem
Let and be Riemann surfaces, let be connected, and let be holomorphic. Suppose that for some subset that has a limit point, where denotes the restriction of to . Then (on the whole of ).
References
Theorems in complex analysis
Riemann surfaces
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.