input
stringlengths
600
32.7k
label
stringclasses
3 values
"The presence of 3R/3R polymorphism seemed to predict a higher ORR (100%) compared to the rest of the genotypes with a trend toward statistical significance (p =?0.055). In the subgroup analysis a significantly higher ORR to pemetrexed for wild-type EGFR patients showing a 3R/3R genotype (100%) compared to the 2R/2R (7...
Lung_Cancer
"Data from the Colorado Plateau uranium miners cohort. Interestingly even though model 8 is produced from the flexible definition in (5)“(7) Figures 2 and 3 suggest that the assumption of independency holds here with shapes of the exposure-response and lag-response curves at different values of ?p and xp respectively b...
Lung_Cancer
"Competing interests The authors declare that they have no competing interests. Authors™ contributions JK PD and OR were responsible for the study design and implementation. JK and PD performed the data analysis. JK PD IC and OR contributed to the implementation and manuscript writing. All authors read and approved the...
Lung_Cancer
"contributed to collection of the data. NI: contributed to interpretation of the study data. SI: contributed to interpretation of the radiological data. KW: contributed to the development of the analytic concept data analyses. KI: contributed to interpretation of the study data. KY: contributed to critical revision of ...
Lung_Cancer
"Background A gene-based estimate of lung cancer risk in smokers has been shown to act as a smoking cessation motivator in hospital recruited subjects. The objective of this trial is to determine if this motivator is as effective in subjects recruited from an NHS primary care unit. Method/Design Subjects will be recrui...
Lung_Cancer
"MBSR is an 8-week group-based training consisting of meditation practices such as the bodyscan gentle yoga sitting and walking meditation. By repeatedly bringing attention back to the current experience participants gradually learn to disengage from dysfunctional thoughts and directly experience the emotions and bodil...
Lung_Cancer
"assessed by ROC curves. The AUC value was 0.892 Relationship between serum KLK11 levels and clinicopathologic factors The relationships between KLK11 levels and clinicopathologic factors of lung cancer patients are shown in . The serum KLK11 levels did not differ significantly with age (P?=?0.569) sex (P?=?0.505) or h...
Lung_Cancer
"MassArray analysis 1 Sequencing+pyrosequencing 1 Sequencing+pyrosequencing+high-resolution melting 2 Sequencing+restriction fragment length polymorphism 1 Sequencing+single-strand conformational analysis 1 Sequencing+Taqman+PNA clamp 1 Sequencing+Therascreen kit 5 Sequencing+Therascreen kit+CAST PCR 1 SNaPshot+single-...
Lung_Cancer
"The formal evaluation consists in the computation of different ?ci at each ith iteration given an exposure history qhi evaluated at a random time t between 41 and 100 for a random individual among the ns subjects. Indices of relative bias coverage and relative RMSE are derived from the following: (13) where I is an in...
Lung_Cancer
"25 Thus our results of a 2-year DFS rate of 80% and OS rate of 96% appear favorable by comparison. However it is prudent to be cautious because we lost 20 of 81 patients from the survival analysis because of consent withdrawal and a direct comparison of outcomes data among trials cannot account for differences in stud...
Lung_Cancer
" In short EGFR activating mutations in exons 19 and 21 were initially identified by Sanger sequencing and confirmed by fragment length analysis for exon 19 deletions (FAM-labelled primer in an ABI prism 3130 DNA analyser (Applied Biosystems Foster City CA USA) and by Taqman assay for exon 21 (L858R) mutation. All tumo...
Lung_Cancer
"This CTL clone specifically recognized peptide-pulsed T2 cells and H2228 cells expressing HLA-A*02:01 and EML4-ALK that had been treated with IFN-? 48 h prior to examination. CTL activity was inhibited by an anti-HLA-class I monoclonal antibody (W6/32) consistent with a class I-restricted mechanism of cytotoxicity. Th...
Lung_Cancer
"Human Genome Variation Society (HGVS) (Human Genome Variation Society (HGVS) 2014). For example we considered that it was not acceptable to report the amino acid change only as redundancy in the genetic code means that different changes at the nucleotide level can result in the same change at the amino acid level. In ...
Lung_Cancer
" Total patient questionnaire scores by the multidisciplinary team in the intervention group at baseline (pre) and at the end of the study (post). A low score indicates better experience. Each symbol represents the mean score for each trust in the intervention group. The maximum possible score for the questionnaire is ...
Lung_Cancer
"METHODS These experiments were conducted on left lungs (n = 6) taken from freshly slaughtered pigs. The laser and the monopolar cutter were fixed in a hydraulic mover. The laser was focused at a distance of 3 cm to the lung tissue and the monopolar cutter was fixed in pressure-free contact with the lung surface. Both ...
Lung_Cancer
"Activation of the NLRP3 inflammasome is dependent on the generation of ROS [33]. Verifying the inhibitory effect of luteoloside on the proliferation and metastasis of HCC cells was accomplished by inhibiting the NLRP3 inflammasome; the levels of NLRP3 inflammasome protein of different treatment groups were determined....
Lung_Cancer
"The proband™s father (II-5) and sister (III-5) were both unaffected and peripheral blood samples were obtained from these individuals. Some family members who were not considered as critical for this study were excluded from the pedigree chart to preserve confidentiality. Whole-exome sequencing was performed for indiv...
Lung_Cancer
"Methods: We updated a case“cohort study nested within a cohort of 267?400 female textile workers in Shanghai China. We compared exposure histories of 1456 incident lung cancers cases diagnosed during 1989“2006 with those of a reference subcohort of 3022 workers who were free of lung cancer at the end of follow-up. We ...
Lung_Cancer
"In the liver lymphatic vessels run parallel to the interlobular vessels and bile duct. Lymphatic vessels can be classified as deep or superficial lymphatic collecting ducts. Superficial lymphatic collecting ducts are often found in the connective tissues of the liver capsule and the lymph is transferred into the paras...
Lung_Cancer
"We retrospectively reviewed 91 patients with stage III NSCLC treated with definitive chemoradiation. All patients underwent a pretreatment diagnostic contrast enhanced CT (CE-CT) followed by a 4D-CT for treatment simulation. We used the average (average-CT) and expiratory (T50-CT) images from the 4D-CT along with the ...
Lung_Cancer
"Here we report a case of solitary lung metastasis of eyelid sebaceous carcinoma and discuss the clinical implication of surgery for a solitary pulmonary metastasis from sebaceous carcinoma. Case presentation A 77-year-old woman underwent left upper lid resection in April 2006 for sebaceous carcinoma of the eyelid. The...
Lung_Cancer
"In current study a semi-Markov model along with two-parametric Weibull and Log-logistic distribution were used for measuring the time-dependency transition probabilities and calculating the direct medical costs LYGs and QALYs gained of the practice presented in the trial [15]. A cost-effectiveness evaluation was perfo...
Lung_Cancer
"We found a similar result in H1299 PAX6 KD cells (A). Another relevant cyclin regulating G1/S progression is cyclin E [17]. We also determined whether cyclin E was regulated by PAX6 expression. As a result cyclin E expression was not affected by the stable shRNA-mediated knockdown of PAX6 in lung cancer cells (data no...
Lung_Cancer
"observed depth in DNA-WGS and an alternate probability of the predicted DNA MAF. The number of true positives and false positives were tabulated at each model discrimination threshold i.e. P-value or score. The step function of these points (number of false positives versus number of true positives) generated a perfor...
Lung_Cancer
"Accordingly the protease inhibitor E-64d partially suppressed TFP-induced cell death. Moreover we demonstrate that lysosomal targeting of TFP was critical for its cytotoxic activity because inhibition of vacuolar adenosine triphosphatase by BafA1 which dissipates the lysosomal pH gradient and prevents intra-lumenal en...
Lung_Cancer
"or paclitaxel (200 mg/m2)/carboplatin (area under the curve 6.0) on day 1 every 3 weeks. Chemotherapy was continued for at least three cycles. Gefitinib was administered until the disease progressed intolerable toxicities developed or consent was withdrawn. The protocol recommended that the crossover regimen be used a...
Lung_Cancer
"The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opac...
Lung_Cancer
"Toxicity was not significantly correlated with a specific TS genotype. Thymidylate synthase Polymorphisms Epidermal growth factor receptor Predictive factors Prognostic factors Non-small cell lung cancer Background Lung cancer represents the most frequent cause of cancer deaths. More than 225000 new cases were diagnos...
Lung_Cancer
".0087629.g002 Example of a progressive patient on PET (mP) and conventional imaging. Progressive patient with right upper lobe NSCLC associated with mdiastinal lymphadenopathy lung and bone metastases (patient #2). Sum of the SUVmax of the 5 most hypermetabolic lesions (2 lung lesions 2 mediastinal lymph nodes one hi...
Lung_Cancer
"Non-Small-Cell Lung Cancer J Exp Clin Cancer Res 2012 31 77 22992338 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24887068 4041776 PONE-D-14-02596 .0098621 Research Medicine and Health Sciences Oncology Cancer Treatment Radiation Therapy Feasibility of Proton Transmission-Beam Stereotactic Ab...
Lung_Cancer
"Tumor markers play a key role in patient management for many malignancies. The potential uses of serum tumor markers include aiding early diagnosis determining prognosis prospectively predicting response or resistance to specific therapies and monitoring therapy in patients with advanced disease. Kallikrein-related pe...
Lung_Cancer
"Methods A literature search was undertaken until July 2013 to identify the comparative studies evaluating disease-free survival rates and survival rates. The pooled odds ratios (OR) and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect models. Results Six retrospective studies were ...
Lung_Cancer
"Overexpression of GFP-Sp1 decreased FOXO3 mRNA and protein levels in a dose-dependent manner (C panel a) whereas knockdown of Sp1 expression increased FOXO3 mRNA and protein levels (C panel b). These results indicate that Sp1 negatively regulates FOXO3 expression. Sp1 negatively regulates FOXO3 expression through reg...
Lung_Cancer
"Therefore in depth studies should be still needed to enhance its antitumor and antimetastatic activities in vivo. Fortunately the in vivo results also exhibited that niclosamide can reduce expression of Ki67 and increase expression of cleaved caspase-3 in tumor cells compared with vehicle treated group. Furthermore ac...
Lung_Cancer
"The associations between BMI and total mortality appeared to be stronger with increasing HRs beginning at lower BMI values in whites compared to blacks and the racial difference was more pronounced in women ( ). For the highest compared to the reference category of BMI the magnitudes of the HRs were similar between wh...
Lung_Cancer
"CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a ...
Lung_Cancer
"Here we report a case of solitary lung metastasis of eyelid sebaceous carcinoma and discuss the clinical implication of surgery for a solitary pulmonary metastasis from sebaceous carcinoma. Case presentation A 77-year-old woman underwent left upper lid resection in April 2006 for sebaceous carcinoma of the eyelid. The...
Lung_Cancer
" discrete and compact nodular opacity (arrowheads) (B) focal neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E —12.5) (C) scattered small nodular opacities of lipiodol (long arrows) and faint nodular opacity (arrowheads) (D) focal hemorrhage and necrosis (arrowheads) with diffuse neutrophil infiltratio...
Lung_Cancer
" In the current study how miR-21 interplays with PI3K/Akt signaling pathway under our experimental conditions is not clear. However it is reported that molecules such as PTEN have been proposed to be involved in NSCLC cells' radioresistance [36 37] and miR-21 is related to PTEN with high possibility [30 38]. In additi...
Lung_Cancer
"In this study we identified a novel pathway for Sp1-mediated activation wherein miR-182 expression downregulated the expression of FOXO3 a known miR-182 target gene [35]. Sp1 activated miR-182 and FOXO3 at the transcriptional level; however FOXO3 protein expression decreased. These results suggest that post-transcript...
Lung_Cancer
"The recurrence rate Q is used to evaluate the reliability of logic relationships as follows:(5)where represents the number of recurrance times of a logic relationship in all random trials and is the number of all random trials. Mapping probe-phenotype relationships to gene-phenotype relationships On the basis of lower...
Lung_Cancer
"materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaque markers. Each marking method has strong and weak points. Localization with a hook wire is e...
Lung_Cancer
"protein is a member of phosphoinositide 3-kinase (PI-3 kinases) and can be activated by DSBs caused by ionizing radiation or reactive oxygen intermediates [6] [7]. Once activated ATM can phosphorylate various downstream substates that function in cell cycle arrest apoptosis and DNA repair such as p53 NBS1 BRCA1 and Ch...
Lung_Cancer
"s/Design A parallel group randomized controlled trial is conducted to compare MBSR with TAU. Lung cancer patients who have received or are still under treatment and their partners are recruited. Assessments will take place at baseline post intervention and at three-month follow-up. The primary outcome is psychological...
Lung_Cancer
"We lack biomarkers for identifying aggressive primary tumor subsets that give rise to metastases and impact early cancer detection and treatment. Many solid tumors are known to accumulate hyaluronan (HA) a glycosaminoglycan which is also produced by the tumor cells themselves. We report a quantitative approach for unc...
Lung_Cancer
"However as in the phase I study a stabilisation of median haemoglobin values for multiple cycles as well as low rate of all-grade anaemia was observed. The result provides some support for the hypothesis that VEGF is a negative regulator of erythropoiesis and its inhibitors may have a role in the management of anaemia...
Lung_Cancer
"These results indicate that FTSJ2 is involved in the inhibition of cancer cell migration and invasion. .0090818.g006 Inhibition of cell migration and invasion upon the over-expression of hFTSJ2 in TE671 cancer cells. (A) The wound healing assay showing that the TE671-hFTSJ2 cells had a reduced migration compared with...
Lung_Cancer
"ne 78-diol 910-epoxide (BPDE) which involved in inducing DNA adducts and thus made a predisposition to lung adenocarcinoma [32]“[34]. Besides the method of cooking and throat or eyes irritation the interviewers also asked each woman the information on cooking oil fumes exposure such as the types of cooking oils she us...
Lung_Cancer
"Among biomarkers genes have been used to distinguish AC from SCC in practice and other six genes were newly discovered biomarkers for distinguishing subtypes. Furthermore NKX2-1 has been considered as a molecular target for the targeted therapy of AC and other genes may be novel molecular targets. By gene ontology ana...
Lung_Cancer
"The VATS approach is a safe and feasible treatment in terms of the survival rate for metastatic lung cancer compared with the thoracotomy. The 3-year disease-free survival rate in the VATS group is inferior to that of open thoracotomy. The VATS approach could not completely replace open thoracotomy. The authors have n...
Lung_Cancer
"Diagnostic assessment programs (DAPs) appear to be a promising model for enabling ICC. The purpose of this study was to explore how DAP structure and function enable ICC and whether that may be associated with anizational and clinical outcomes. Methods A case study approach will be used to explore ICC among eight DAPs...
Lung_Cancer
"Actin was probed by antibody from Sigma (catalog no. 1978). The gene expression nucleosome positioning and ChIP-seq data have been submitted to Gene Expression Omnibus (http:/www.ncbi.nlm.nih.gov/geo/) under accession numbers GSE40194 GSE40300 GSE40363 and GSE18182. RESULTS We analyzed expression of 1722 regulatory fa...
Lung_Cancer
"or paclitaxel (200 mg/m2)/carboplatin (area under the curve 6.0) on day 1 every 3 weeks. Chemotherapy was continued for at least three cycles. Gefitinib was administered until the disease progressed intolerable toxicities developed or consent was withdrawn. The protocol recommended that the crossover regimen be used a...
Lung_Cancer
"Therefore the development of novel approaches for the treatment of NSCLC including targeted gene treatment as a radiosensitizer to treat this lethal disease is urgently needed to enhance the survival rate in patients. microRNAs (miRNAs) [11] are a class of short noncoding RNAs that function as a regulation for gene ex...
Lung_Cancer
"Adenocarcinoma including cases with bronchioloalveolar carcinoma. Expression of miR-182 and correlations miR-182 was homogenously expressed mainly in the cytoplasm of tumor cells. There was also some unspecific nuclear staining (). The scoring was based on cytoplasmic staining. There was no staining of stromal cells e...
Lung_Cancer
"Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene inte...
Lung_Cancer
"associated with lung cancer with squamous differentiation. J Clin Oncol. 2013;31(10):e161“e16423358982 5. PaoWGirardN New driver mutations in non-small-cell lung cancer. Lancet Oncol. 2011;12(2):175“18021277552 6. ShigematsuHTakahashiTNomuraM Somatic mutations of the HER2 kinase domain in lung adenocarcinomas. Cancer ...
Lung_Cancer
"In this study we identified a novel pathway for Sp1-mediated activation wherein miR-182 expression downregulated the expression of FOXO3 a known miR-182 target gene [35]. Sp1 activated miR-182 and FOXO3 at the transcriptional level; however FOXO3 protein expression decreased. These results suggest that post-transcript...
Lung_Cancer
"NSCLC and 40 healthy controls were collected. The concentration of KLK11 was measured by enzyme-linked immunosorbent assay (ELISA). The concentration of KLK11 in NSCLC was significantly higher compared to that in the controls (P?<?0.01). The serum KLK11 levels decreased with stage presence of lymph node and distant me...
Lung_Cancer
"About half (49%) of UNCeqRMETA mutations had no RNA evidence and were based only on DNA evidence. Surprisingly among UNCeqRMETA expressed somatic mutations (those with RNA and DNA mutant read evidence) the MAF in RNA was often significantly greater than in DNA (lung: 21% of expressed mutations breast: 17% fdr < 0.05) ...
Lung_Cancer
"ChIP assays were performed with anti-acetyl-H3 (panel b) and anti-Sp1 antibodies (panel c). DNA was extracted for PCR with miR-182 and p21 primers. Data were quantified after three independent experiments (panel d). (F) A549 cells were harvested for DAPA with a biotin-conjugated p21 and miR-182 promoter probes and sam...
Lung_Cancer
"Division of Anatomic and Molecular Pathology Division of Laboratory and Genomic Medicine 660 Euclid Ave. #8118 St. Louis MO 63110. eduncavagepath.wustl.edu 1 7 2015 7 2014 16 4 405 417 6 3 2014 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. Al...
Lung_Cancer
"The overfitting characterizing AIC-selected models in scenarios of simple exposure“lag“response dependencies does not seriously affect its performance a result in line with previous findings 18. However AIC-selected models also suffer from bias and undercoverage of confidence intervals to some extent. Part of this see...
Lung_Cancer
"Discussion A previous study on metastatic RCC by Yuasa et al. demonstrated that: 1) smaller initial tumor size predicted a good response to TKIs; 2) the greatest response was achieved in patients with lung lesions; and 3) there was no difference in tumor response between patients treated with sorafenib and sunitinib [...
Lung_Cancer
"TP53 17(22.4%) 7(41.2%) 1(16.7%) 9(17.3%) 0(0.0%) VHL 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) Missense mutation distribution in the exons and functional domains of EGFR Out of 76 sequenced lung cancer samples 36.1% of EGFR mutations were missense along exon 19 50.0% were missense along exon 21 5.6% along exon 20 and 8...
Lung_Cancer
"All the experiments were repeated three times. The data are presented as means ± SEM. Colony formation assay Cells were seeded in triplicate at 300 cells/well in a 6-well plate. After 7 days of culture the cells were washed twice with NaCl (0.9%) stained with 2% gentian violet for 20 min washed with water and air-drie...
Lung_Cancer
"The overfitting characterizing AIC-selected models in scenarios of simple exposure“lag“response dependencies does not seriously affect its performance a result in line with previous findings 18. However AIC-selected models also suffer from bias and undercoverage of confidence intervals to some extent. Part of this see...
Lung_Cancer
"Urology 1471-2490 BioMed Central 24612599 3975282 1471-2490-14-26 10.1186/1471-2490-14-26 Research an-specific and tumor-size-dependent responses to sunitinib in clear cell renal cell carcinoma Tsuchiya Norihiko 1 tsuchiyamed.akita-u.ac.jp Yuasa Takeshi 2 takeshi.yuasajfcr.or.jp Maita Shinya 1 yamightyyahoo.co.jp Nar...
Lung_Cancer
" DLA and TTN contributed equally to this manuscript. # AJW and MVG share senior position authorship 15 7 2014 02 12 2013 1 2014 01 1 2015 12 1 111 118 Activated ALK and ROS1 tyrosine kinases through gene fusions has been found in lung adenocarcinomas and are highly sensitive to selective kinase inhibitors. This study ...
Lung_Cancer
"Acute phase reactants are plasma proteins that are synthesized by hepatocytes as a nonspesific response against tissue damage infection inflammation trauma or cancer. Acute phase reactants are frequently used in the evaluation of chronic inflammation in diseases such as inflammatory bowel disease or rheumatoid arthrit...
Lung_Cancer
"A. Proliferation assay in Mero-14 cells. The graph shows the effect of the treatments with 5 µM cisplatin and 40 nM siMSLN-1 used as single agents or in combination. On day 6 MANOVA shows a statistically significant effect both for cisplatin (P?=?0.0168) and siMSLN-1 (P<10?4) in reducing proliferation. However the int...
Lung_Cancer
"They are designed to determine which subjects have quit smoking or cut down and which subjects who have failed to quit still plan to do so. There is a section that asks about general motivators and components of the smoking cessation programme. The subjects will be asked to score these motivators and smoking cessation...
Lung_Cancer
" The blue nodes represent biomarkers identified in this work. The yellow nodes represent six genes which are not related with NSCLC on the NSCLC and normal specimens. The red nodes represent subtypes i.e. AC and SCC. Key gene pairs inferred by gene-subtype higher logic relationships We grouped together the gene-subtyp...
Lung_Cancer
"The occurrence of PLC is extremely rare in liver carcinoma. Herein we report the case of a patient with PLC after liver transplantation due to liver carcinoma. PLC was confirmed by clinical manifestations imaging studies and cytologic examination of exfoliated cells in the pleural effusion. Liver carcinoma Liver trans...
Lung_Cancer
"Overall survival (OS) curves were delineated by the Kaplan-Meier method and compared with log-rank test. For all tests p-values less than 0.05 were considered to be significant. All p-values given were results of two-sided tests. Results PDGF-BB and VEGF-C coexpression in primary human NSCLC In primary human NSCLC tis...
Lung_Cancer
"This study was supported by grants from National Basic Research Program of China (973 Program No. 2012CB967003 to S. Shao) Natural Science Foundation of China (NO. 20935004 81071784 to S. Shao and 81172028 to Z. Hou). The funders had no role in study design data collection and analysis decision to publish or preparati...
Lung_Cancer
"developed by Coussens and Werb [8]. In this method hydroxyl radical which is the most potent radical is produced via Fenton Reaction. In the classical Fenton reaction the hydroxyl radical is produced by mixing ferrous ion solution and hydrogen peroxide solution. In the recently developed assay by Erel the same reactio...
Lung_Cancer
"Lung cancer Background The complement system plays a critical role in the process of carcinogenesis. Despite of significant research controversial viewpoints remain on the exact relationship of complement system with cancer. Classically the complement system fights against cancer by exerting the effects of immunosurve...
Lung_Cancer
"The protein encoded by DSC3 is a calcium-dependent glycoprotein (Desmocollin 3) that is required for cell adhesion and desmosome formation. The protein encoded by PKP1 may be involved in molecular recruitment and stabilization during desmosome formation. The protein encoded by CLCA2 belongs to the calcium sensitive ch...
Lung_Cancer
"The same procedures were repeated at a distance of 1 cm creating parallel lesions in order to analyse the lung tissue in between the lesions for thermal damage. In addition two implanted capsules in the lung tissue simulating a lung nodule were resected with either the laser or the monopolar cutter. The resection surf...
Lung_Cancer
"TTP and 1-year survival were not different between the two dose groups indicating the dose-to-rash strategy failed to increase clinical benefit. Observed low incidence of toxicity and low erlotinib exposure suggest standardized and maximum allowable dosing may be suboptimal in African Americans. EGFR Erlotinib African...
Lung_Cancer
".0091811.g002 Heterogeneity of lymphatic vessel density (LVD) microvessel density (MVD) and amount of cancer-associated fibroblasts (CAFs) with respect to tumor location. The LVD (A) MVD (B) and CAF area (C) was significantly different according to each tumor location. .0091811.g003 LVD MVD and CAF area at different...
Lung_Cancer
"Luciferase activity driven by the miR-182 promoter increased in H1299 cells overexpressing GFP-Sp1 (C) whereas luciferase activity decrease in cells treated with an Sp1 inhibitor mithramycin A (D). These results suggested that Sp1 is involved in miR-182 transcriptional activation. Using the TFSEARCH software we analyz...
Lung_Cancer
"The amount of microvasculature measured by LVD and MVD was also heterogeneous in relation to the metastatic an examined. By Cox regression analysis center LVD and MVD periphery LVD and CAFs in distant metastasis were independently associated with patients' prognosis in addition to synchronous distant metastasis age an...
Lung_Cancer
"Accordingly the protease inhibitor E-64d partially suppressed TFP-induced cell death. Moreover we demonstrate that lysosomal targeting of TFP was critical for its cytotoxic activity because inhibition of vacuolar adenosine triphosphatase by BafA1 which dissipates the lysosomal pH gradient and prevents intra-lumenal en...
Lung_Cancer
"Nonetheless the tumor TS levels or its polymorphisms in each patient could explain these cases of severe toxicity as it has been suggested in other neoplasms treated with other antifolate drugs [9]. The potential association between different TS genotypes and the toxicity experienced by a European population of patien...
Lung_Cancer
"Non-Small-Cell Lung Cancer J Exp Clin Cancer Res 2012 31 77 22992338 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24887068 4041776 PONE-D-14-02596 .0098621 Research Medicine and Health Sciences Oncology Cancer Treatment Radiation Therapy Feasibility of Proton Transmission-Beam Stereotactic Ab...
Lung_Cancer
"trial in patients with advanced non-small-cell lung cancer. J Clin Oncol 2010 28 3076 3083 20479403 29. Miller VA Hirsh V Cadranel J Afatinib versus placebo for patients with advanced metastatic non-small-cell lung cancer after failure of erlotinib gefitinib or both and one or two lines of chemotherapy (LUX-Lung 1): a...
Lung_Cancer
"Human FTSJ2 GCTGGTGTGTGTTTCCTTTCA CAGAATCTGGTGCCTCTCGT HSP70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?-actin CCGTCTTCCCCTCCATCGTGGG CGCAGCTCATTGTAGAAGGTGTGG GAPDH GAGAAACCTGCCAAGTATGATG ACCTGGTCCTCAGTGTAGCC Pig Ftsj2 ACGAGTTCCCAGGAGAATCAGA TGCTTTGGCAACGACCTTTAA Hsp70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?...
Lung_Cancer
"As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (A“T) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM protein is a m...
Lung_Cancer
"IGFBP3 is known to block IGF-1 induced activation of IGF-1R1617. Overall these studies show that the IGF-1R signaling pathway is activated by multiple mechanisms in H3122 XR cells. We evaluated the effects of IGF-1R inhibition in ALK TKI resistant cells. The combination of X-376 with either MAb391 or OSI-906 (Fig. 4de...
Lung_Cancer
" In short EGFR activating mutations in exons 19 and 21 were initially identified by Sanger sequencing and confirmed by fragment length analysis for exon 19 deletions (FAM-labelled primer in an ABI prism 3130 DNA analyser (Applied Biosystems Foster City CA USA) and by Taqman assay for exon 21 (L858R) mutation. All tumo...
Lung_Cancer
"e commonest cause of cancer death in England and Wales with around 38?000 cases diagnosed each year and ?35?000 deaths. Data from the National Lung Cancer Audit (NLCA) demonstrate significant variation in process and outcome measures across England. In 2009 there was a three-fold difference in survival and active trea...
Lung_Cancer
" 3 further treatments at 4-day intervals. In the mesothelioma model C57BL/6 mice were treated 5 days after 40L tumor cell inoculation and injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereaft...
Lung_Cancer
"followed by intravenous tail vein injection of 1 — 106 MX-1 cells. Thirteen days after injection lungs were harvested and stained with Bouin's solution to visualise metastatic colonies. For survival analysis mice were monitored daily for signs of morbidity including body weight hydration level coat appearance mobility...
Lung_Cancer
"These point mutations occur in the tyrosine kinase domain which plays an important role in oncogenesis. Our peptide array was selected from EML4 which has no correlation with these point mutations. It is possible that this treatment is effective for tumor cells resistant to ALK inhibitors. In this study we identified ...
Lung_Cancer
"This may be the reason why this pathway is universally aberrant in all the LUAD samples we assessed. Our analysis of this pathway in other cancer types demonstrated less of a role for this pathway suggesting that it is more LUAD specific. We believe that the common disruption of this pathway is a novel discovery as th...
Lung_Cancer
"Background Complement receptor 1 (CR1) the receptor for C3b/C4b complement peptides plays a crucial role in carcinogenesis. However the association of genetic variants of CR1 with susceptibility to lung cancer remains unexplored. Methods This case-control study included 470 non-small cell lung cancer (NSCLC) patients ...
Lung_Cancer
"are associated with erythrocyte sedimentation rate Am J Hum Genet 2011 89 131 138 10.1016/j.ajhg.2011.05.019 21700265 Teeranaipong P Ohashi J Patarapotikul J Kimura R Nuchnoi P Hananantachai H Naka I Putaporntip C Jongwutiwes S Tokunaga K A functional single-nucleotide polymorphism in the CR1 promoter region contribut...
Lung_Cancer
"Phenothiazines elicit caspase-mediated and caspase-independent cell death To gain insight into the mechanistic basis of phenothiazine-associated cytotoxicity we analyzed in detail the mode by which these compounds induce cell death in human SCLC cells. While some studies have implicated apoptosis as a major cell death...
Lung_Cancer