input
stringlengths
600
32.7k
label
stringclasses
3 values
"GFR PCR test required macrodissection only if the tumor content was <10% and can be performed in one day using a single 5 µm section. Furthermore the EGFR PCR test is a commercially available kit-based assay that provides an automated result rather than a manual process subject to interpretation and which can be perfo...
Lung_Cancer
"Ectopic expression of BANCR was achieved through pCDNA-BANCR transfection with an empty pCDNA3.1 vector used as a control. The expression levels of BANCR were detected by qPCR. Cell transfection Plasmid vectors (pCDNA3.1-BANCR and pCDNA3.1) for transfection were prepared using DNA Midiprep or Midiprep kits (Qiagen Hil...
Lung_Cancer
"30 These findings prompted us to investigate the possible presence of SETDB1 gene amplification and its associated overexpression in lung cancer cells and primary tumors. Extra copies of an oncogene may give tumor cells a growth advantage as well as being a mechanism associated with different sensitivity to therapies....
Lung_Cancer
"The lower replication rate of adipose meQTLs in whole-blood samples6 might be explained by the heterogeneity of different cell types in whole blood and by their more liberal P-value threshold (8.6—10?4) which led to the identification of a large number of weak cis-meQTLs. Compared with cis-regulation trans-eQTL regula...
Lung_Cancer
" Furthermore 40% of the F1 mice contained the construct reflecting a very efficient transmission. Compared to the classic approach where many crosses are required to obtain a particular genotype the F1 approach still provides a considerable time gain since it only adds ˜10 weeks to the chimeric GEMM-ESC approach. In ...
Lung_Cancer
"ssed during the entire study period with a calendar on which participants in the MBSR condition fill out on a daily basis whether they adhere to the mindfulness exercises: either formal practice (e.g. meditation exercise like the bodyscan) informal practice (e.g. activity with awareness) or no exercise. Adherence to M...
Lung_Cancer
"Methylnaltrexone was developed at the University of Chicago and licensed to Progenics Pharmaceuticals subsequently sub-licensed to Salix Pharmaceuticals. Dr. Moss was a paid consultant for Progenics Pharmaceuticals and currently is a paid consultant for Salix Pharmaceuticals. He receives royalties through the Universi...
Lung_Cancer
" 12 or 13 at a time when there were no FDA-approved diagnostic assays for KRAS mutations.[5] Only later in July 2012 did a KRAS mutation assay receive FDA approval based on the results of a prospective randomized trial highlighting the challenges of retrospectively validating a companion diagnostic assay after the piv...
Lung_Cancer
"Immunostaining was performed by the streptavidin-peroxidase (S-P) method. The tissue sections were incubated with a p120ctn mouse monoclonal antibody (1?100 cat. 610134 BD Transduction Laboratories Lexington KY USA) E-cadherin rabbit monoclonal antibody (1?100 cat. SC-7870; Santa Cruz Biotechnology Santa Cruz CA USA) ...
Lung_Cancer
"As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (A“T) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM protein is a m...
Lung_Cancer
" in Japanese families [19]. A FTSJ2 locus in the genome gene amplification and mRNA over-expression were discovered in several non-small cell lung cancer (NSCLC) tissue samples [20] and FTSJ3 was revealed to function in pre-rRNA processing [21] [22]. However little is known about these three homologs in mammals. Thus ...
Lung_Cancer
"(a) shows a frame from the 4D acquisition from Patient number 2. A surface rendered tumor-inclusive volume-of-interest in four different respiratory phases is shown in (b). Both the tumor as well as the surrounding anatomy exhibit significant deformation from phase to phase. shows motion trajectories extracted from t...
Lung_Cancer
".0091577.g004 The peripheral mu opioid receptor antagonist methylnaltrexone (MNTX) inhibits EGF-induced phosphorylation of Src PI3 kinase and STAT3 in human lung cancer cells. Panel A: Human H358 non-small cell lung cancer (NSCLC) cells were either untreated (control) or treated with 100 nM MNTX alone 10 ng/ml EGF fo...
Lung_Cancer
"The interpretation of the test result relative to the clinical referral was reviewed with laboratories receiving comments on their performance but no marks assigned. Overall 46 (50.5%) of the laboratories had a score ?18 in the second round and passed the EQA. All laboratories received a certificate of participation t...
Lung_Cancer
"atment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Publication bias Publication bias might exist when nonsignificant findings remain unp...
Lung_Cancer
"The remaining 24 (25.3%) were not differentiated beyond NSCLC NOS. The median tumor size was 2.15 cm (range: 0.8-5.0 cm). Tumor T-stage distribution was according to the AJCC 7th edition as follows: T1a: 46 (48.4%) T1b: 30 (31.6%) and T2a: 19 (20%) (). The median pretreatment SUVmax was 6.6 (range: 1.2-26.1). Among th...
Lung_Cancer
"The presence of 3R/3R polymorphism seemed to predict a higher ORR (100%) compared to the rest of the genotypes with a trend toward statistical significance (p =?0.055). In the subgroup analysis a significantly higher ORR to pemetrexed for wild-type EGFR patients showing a 3R/3R genotype (100%) compared to the 2R/2R (7...
Lung_Cancer
"These data indicate that HDAC3 knockdown induced BANCR increase may be due to the inhibition of HDAC3 enzymatic activity. BANCR inhibits NSCLC cell viability and induces apoptosis To assess the biological role of BANCR in NSCLC we investigated the effects of BANCR over-expression on the viability and apoptosis of SPCA...
Lung_Cancer
"The DNA repair hub module is linked to a module associated with response to DNA damage. It contains five genes: CTF4 ESC4 MMS1 MMS22 and Rt101. The last four genes are part of the cullin-RING ubiquitin ligase complex (GO:0031461). The last three genes were shown to form a complex that stabilizes the replisome during r...
Lung_Cancer
"As these series of processes maintained the normal cell-cell adhesion connection and inhibited EMT there was increased E-cadherin expression and decreased N-cadherin vimentin and snail expression as well as inhibited cell invasiveness in H1299 cells. Previous studies have shown that although p120ctn isoform 1A could b...
Lung_Cancer
"DNA methylation is an early event in bronchial carcinogenesis and increased DNA methyltransferase (DNMT)1 protein expression is a crucial step in the oncogenic transformation of epithelia. Here we investigate the role of class I histone deacetylases (HDACs) 1“3 in the stabilization of DNMT1 protein and as a potential ...
Lung_Cancer
"Background Ocular sebaceous carcinoma is an uncommon aggressive ocular neoplasm with potential for regional and distant metastasis. Case presentation A 77-year-old woman was found to have a solitary pulmonary lesion 6 years after the initial treatment of sebaceous carcinoma of the eyelid. Video-assisted lung wedge res...
Lung_Cancer
"The categories were significantly associated with the sensitivity to Ad-REIC treatment (p<0.01). .0087900.t002 Ad-REIC sensitivity and categories based on predictive factors. (n) Category A (8) Category B (12) Category C (5) Highly sensitive (13) 8 5 0 Resistant in 20 MOI (12) 0 7 5 JNK and GRP78 expression in NSCLC ...
Lung_Cancer
"Complete surgical excision was impossible due to the nodules™ diverse sites. Palliative treatment using 2 mg/kg tramadol (tramadol Dongkwang Pharm Seoul Korea) and 2.2 mg/kg carprofen (rimadyl Pfizer New York NY U.S.A.) was applied to the dog twice per day for 3 months. Finally after respiratory distress began to emer...
Lung_Cancer
"The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opac...
Lung_Cancer
" (see Table IV and second column). This pattern is confirmed by the results in Table V showing the average df in each dimension and the empirical rejection rates for the hypotheses of linearity and constant risk. The AIC selection is affected by moderate overfitting sometimes suggesting flexible models in scenarios o...
Lung_Cancer
" have indicated that there is a significant correlation between decreased KLK11 mRNA expression level and poor prognosis in lung cancer. This study supports the increasing body of literature demonstrating the expression of kallikrein family gene involvement in the prognosis of human cancers. The most striking associat...
Lung_Cancer
" <0.001* Ia + Ib 25(47.2) 9(15.0) IIa + IIb 17(32.1) 21(35.0) IIIa 11(20.7) 30(50.0) Tumor size 0.001* ?5cm 35(66.0) 21(35.0) >5cm 18(34.0) 39(65.0) Lymph node metastasis 0.001* Negative 34(64.2) 20(33.3) Positive 19(35.8) 40(66.7) Smoking History 0.127 Smokers 39(64.2) 36(60.0) Never Smoke...
Lung_Cancer
"This may be the reason why this pathway is universally aberrant in all the LUAD samples we assessed. Our analysis of this pathway in other cancer types demonstrated less of a role for this pathway suggesting that it is more LUAD specific. We believe that the common disruption of this pathway is a novel discovery as th...
Lung_Cancer
" The questionnaire domain-specific scores did not change significantly during the study. Of the individual questions a significant improvement was seen in the rating of the quality of information provided as excellent which rose from 53%“59% P<0.05. Qualitative evaluation Participants' experiences were overwhelmingly ...
Lung_Cancer
"However these results raised several specific questions. First tumor histology and progression risk may affect the response to TKIs. TKIs are associated with a good response in patients with CCRCC but are less effective against non-CCRCC [10]. Similarly patients with favorable risk factors have a greater chance of a g...
Lung_Cancer
"y activation induced by inhibitor-mediated release of negative feedback loops and resulted in a significant tumor growth inhibition. Thus coinhibition of both pathways has shown use in reducing tumor growth in a variety of xenograft models [1314] and clinical trials of such combinations are under way in adults. BEZ235...
Lung_Cancer
"Radon is the exposure of interest and is modeled with different combinations of bases for f(x) and w(?) in the cross-basis sx(xt). Given the limited information on smoking histories in this analysis the cross-basis sz(zt) is a priori defined with a natural cubic B-spline with one knot at the median of 2.5 yearly packs...
Lung_Cancer
".0091811.g002 Heterogeneity of lymphatic vessel density (LVD) microvessel density (MVD) and amount of cancer-associated fibroblasts (CAFs) with respect to tumor location. The LVD (A) MVD (B) and CAF area (C) was significantly different according to each tumor location. .0091811.g003 LVD MVD and CAF area at different...
Lung_Cancer
"More sophisticated models with splines or other functions such as those illustrated in publications cited in only require the application of different bases for deriving C but are nevertheless represented by 3). 2.2. Extension to nonlinear exposure“response relationships The extension to the nonlinear case presents fu...
Lung_Cancer
" when only a subset of normal samples are served as nRef. (a) ˜amino acid synthesis and interconversion and transamination™ (b) ˜unwind of DNA™3.4 Validation of the discovered pathwayThe ˜amino acid synthesis and interconversion and transamination™ pathway consists of 17 genes involved in three major reactions as it i...
Lung_Cancer
"developed by Coussens and Werb [8]. In this method hydroxyl radical which is the most potent radical is produced via Fenton Reaction. In the classical Fenton reaction the hydroxyl radical is produced by mixing ferrous ion solution and hydrogen peroxide solution. In the recently developed assay by Erel the same reactio...
Lung_Cancer
"Transfection of all cells with expression vectors was done using Lipofectamine 2000 (Invitrogen) according to the manufacturer's directions. Reverse transcription-polymerase chain reaction (RT-PCR) and stem-loop RT-PCR Total RNA was isolated using the Trizol reagent (Invitrogen) and 3 ?g of RNA were reverse-transcribe...
Lung_Cancer
" <0.001* Ia + Ib 25(47.2) 9(15.0) IIa + IIb 17(32.1) 21(35.0) IIIa 11(20.7) 30(50.0) Tumor size 0.001* ?5cm 35(66.0) 21(35.0) >5cm 18(34.0) 39(65.0) Lymph node metastasis 0.001* Negative 34(64.2) 20(33.3) Positive 19(35.8) 40(66.7) Smoking History 0.127 Smokers 39(64.2) 36(60.0) Never Smoke...
Lung_Cancer
"Introduction Lung cancer is the leading cause of cancer-related deaths worldwide [1] whereas non-small cell lung cancer (NSCLC) represents the most frequent type of lung cancer [2]. NSCLC accounts for approximately 80% of all lung cancer cases and has a 5-year overall survival rate of less than 15% [3 4]. Approximatel...
Lung_Cancer
"Finally because there is no head-to-head clinical trial comparing maintenance gefitinib with other maintenance drugs (eg erlotinib) after the standard chemotherapy of four chemotherapeutic cycles we have not conducted a cost-effectiveness analysis of gefitinib in comparison with other maintenance therapies. Although t...
Lung_Cancer
"Therefore the development of novel approaches for the treatment of NSCLC including targeted gene treatment as a radiosensitizer to treat this lethal disease is urgently needed to enhance the survival rate in patients. microRNAs (miRNAs) [11] are a class of short noncoding RNAs that function as a regulation for gene ex...
Lung_Cancer
"We developed a novel immunotherapeutic agent that links a single-chain antibody variable fragment (scFv) targeting mesothelin (MSLN) which is overexpressed on ovarian cancer and mesothelioma cells to Mycobacterium tuberculosis (MTB) heat shock protein 70 (Hsp70) which is a potent immune activator that stimulates monoc...
Lung_Cancer
"We demonstrated in this study that the MSLN-targeted fusion protein elicited significant tumor-specific CD8+ T-cell immune responses in ovarian cancer-bearing mice and this adaptive antitumor response has an absolute requirement for tumor-specific CD8+ T cells. Although at the dosing schedule used in these studies tum...
Lung_Cancer
"More than 80% of the specimens tested in this study were small biopsy specimens. The overall invalid rate for Sanger sequencing was 15.6% (76/487) compared to the EGFR PCR assay at 9% (43/487). However the invalid rate for the subset of specimens derived from resected specimens was 0% (0/109) likely because of suffici...
Lung_Cancer
" Despite previous investigations it remains unclear how p120-catenin (p120ctn) isoforms 1A and 3A affect the EMT of tumor cells. Here we investigated expression of p120ctn E-cadherin and vimentin in 78 human non-small cell lung cancer (NSCLC) samples by immunohistochemistry and found that p120ctn membrane expression p...
Lung_Cancer
"We choose this system as it is successfully applied by others (Zhu et al 2009; Yilmaz et al 2012) allows for transgene induction in multiple somatic cell types (Carey et al 2010) and is compatible with a vector system for doxycycline-regulated fluorescence-linked shRNAs (McJunkin et al 2011; Premsrirut et al 2011; Dow...
Lung_Cancer
"In the present study however a subset of pure GGNs were pathologically diagnosed as invasive adenocarcinoma. This discrepancy between radiological and pathological findings could be explained by a partial volume effect which means that when the slice thickness is relatively high (2“2.5 mm) detection of small nonaerate...
Lung_Cancer
"We therefore envision that the effects of phenothiazines per se as well as its potential chemosensitizing properties can help improve the outcome for relapsed SCLC patients who no longer respond to conventional treatment. In summary the present work uncovered a novel activity of phenothiazines as agents capable of inh...
Lung_Cancer
"More sophisticated models with splines or other functions such as those illustrated in publications cited in only require the application of different bases for deriving C but are nevertheless represented by 3). 2.2. Extension to nonlinear exposure“response relationships The extension to the nonlinear case presents fu...
Lung_Cancer
"Among biomarkers genes have been used to distinguish AC from SCC in practice and other six genes were newly discovered biomarkers for distinguishing subtypes. Furthermore NKX2-1 has been considered as a molecular target for the targeted therapy of AC and other genes may be novel molecular targets. By gene ontology ana...
Lung_Cancer
"Vertical lines represent the 95% CIs (self-reported BMI alone). Models were adjusted for age education marital status remote smoking status previous pack-years and years since quitting smoking. a Healthy was defined as no self-reported history of cancer heart attack or stroke at baseline. b BMI adjusted for reporting ...
Lung_Cancer
"These point mutations occur in the tyrosine kinase domain which plays an important role in oncogenesis. Our peptide array was selected from EML4 which has no correlation with these point mutations. It is possible that this treatment is effective for tumor cells resistant to ALK inhibitors. In this study we identified ...
Lung_Cancer
"However the production and administration of these tailor-made DC vaccines are costly and labor-intensive [5]. As a next-step in the development of DC vaccines we designed a recombinant protein that contains a Mycobacterium tuberculosis heat shock protein 70 (MTBHsp70) fused to a single chain variable fragment (scFv) ...
Lung_Cancer
" The questionnaire domain-specific scores did not change significantly during the study. Of the individual questions a significant improvement was seen in the rating of the quality of information provided as excellent which rose from 53%“59% P<0.05. Qualitative evaluation Participants' experiences were overwhelmingly ...
Lung_Cancer
"Actin was probed by antibody from Sigma (catalog no. 1978). The gene expression nucleosome positioning and ChIP-seq data have been submitted to Gene Expression Omnibus (http:/www.ncbi.nlm.nih.gov/geo/) under accession numbers GSE40194 GSE40300 GSE40363 and GSE18182. RESULTS We analyzed expression of 1722 regulatory fa...
Lung_Cancer
"Sulindac is a Food and Drug Administration (FDA)-approved non-steroidal anti-inflammatory drug (NSAID) for the treatment of osteoarthritis ankylosing spondylitis gout or rheumatoid arthritis [20]“[23]. Its anti-inflammatory activity is due to its inhibition of the synthesis of prostaglandins [24] which cause inflammat...
Lung_Cancer
"METHODS These experiments were conducted on left lungs (n = 6) taken from freshly slaughtered pigs. The laser and the monopolar cutter were fixed in a hydraulic mover. The laser was focused at a distance of 3 cm to the lung tissue and the monopolar cutter was fixed in pressure-free contact with the lung surface. Both ...
Lung_Cancer
"inhibitors by causing immediate and nearly complete intracellular and extracellular thiamine deprivation [6]. In previous studies we have shown that thiaminase has both in vitro and in vivo cytotoxicity activity further supporting the concept that TDEs could represent new targets for novel therapies [6] [7] [8]. We ha...
Lung_Cancer
"(5.9 versus 5.4 months; p = 0.847) (Fig. 3B). The objective response rate was significantly lower in patients with uncommon EGFR mutations compared with the objective response rate in those with common EGFR mutations when treated with gefitinib (20% versus 76%; p = 0.017) (supplementary Table S2 Supplemental Digital C...
Lung_Cancer
"n methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriat...
Lung_Cancer
"lung and liver cells. Genomic analyses identified two major DNase I hypersensitive regions (HS-1 and HS-2) within the ~15 kb intervening sequence separating E1b from the downstream E1 promoter. In BEAS-2B cells the Nrf2 effectors SFN and tBHQ selectively activated the more distal HS-2 through an antioxidant-response e...
Lung_Cancer
" distribution and reproduction in any medium provided the original author and source are credited. The epithelial mesenchymal transition (EMT) is an important process in tumor development. Despite previous investigations it remains unclear how p120-catenin (p120ctn) isoforms 1A and 3A affect the EMT of tumor cells. He...
Lung_Cancer
"BACKGROUND American Indians/Alaskan Natives (AI/ANs) have the worst 5-year cancer survival of all racial/ethnic groups in the United States. Causes for this disparity are unknown. The authors of this report examined the receipt of cancer treatment among AI/AN patients compared with white patients. METHODS This was a r...
Lung_Cancer
"This combination has two possible explanations. Firstly they might represent tumors which are not expressing ALK protein at detectable levels because of a false-positive FISH result or an absence of addiction to rearranged ALK protein despite presence of recombined ALK DNA. These tumors are unlikely to respond to criz...
Lung_Cancer
"Hypertension and renal insufficiency are two risk factors for RPLS. Twenty-four patients (57%) experienced hypertension (15 grade 3 but no grade 4) during the study 15 of whom had a history of hypertension and 12 had taken antihypertensive medications before entering the study. Eight patients with hypertension also ex...
Lung_Cancer
"Identifiability and constraints The tensor product structure of the cross-basis defined in (5)“(7) poses some identifiability issues. In particular each of the vx basis variables in R is multiplied by each of the v? basis variables in C. If an intercept is included in f(x) the related matrix of cross-basis variables W...
Lung_Cancer
"The ORs we found may be underestimated. Second the statistical power of the study may be limited by the relatively small sample size of subjects. In addition other SNPs in ATM gene and in this pathway may be involved in the risk of lung adenocarcinoma gene-gene interaction and haplotypes may offer more clues to clarit...
Lung_Cancer
"requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materi...
Lung_Cancer
"Ectopic expression of BANCR was achieved through pCDNA-BANCR transfection with an empty pCDNA3.1 vector used as a control. The expression levels of BANCR were detected by qPCR. Cell transfection Plasmid vectors (pCDNA3.1-BANCR and pCDNA3.1) for transfection were prepared using DNA Midiprep or Midiprep kits (Qiagen Hil...
Lung_Cancer
"Anchorage of tissue cells to their physical environment is an obligate requirement for survival which is lost in mature hematopoietic and in transformed epithelial cells. Here we find that a lymphocyte lineage-restricted transcription factor Aiolos is frequently expressed in lung cancers and predicts markedly reduced ...
Lung_Cancer
"However none of the previous studies have described the EGFR status of the patients analyzed and how that status impacted on the ORR to pemetrexed for certain TS polymorphisms. In terms of survival in the present series after a median follow-up of 21 months PFS was superior for those patients showing a 3R/3R genotype ...
Lung_Cancer
"Lung cancer Background The complement system plays a critical role in the process of carcinogenesis. Despite of significant research controversial viewpoints remain on the exact relationship of complement system with cancer. Classically the complement system fights against cancer by exerting the effects of immunosurve...
Lung_Cancer
"Price of gefitinib was reduced 20% and was fixed in probabilistic sensitivity analysis because it is a brand name drug. b Estimated according to local charges in China. c Varied by ±30%. Health state utility values of the PFS and PS states presented in were derived from the published literature by Nafees et al who as...
Lung_Cancer
"Nucleosome positioning: multiple mechanisms toward a unifying goal Molecular cell 2012 48 1 2 23062951 24. Hughes A.L. Jin Y. Rando O.J. Struhl K. A functional evolutionary approach to identify determinants of nucleosome positioning: a unifying model for establishing the genome-wide pattern Molecular cell 2012 48 5 15...
Lung_Cancer
" (see Table IV and second column). This pattern is confirmed by the results in Table V showing the average df in each dimension and the empirical rejection rates for the hypotheses of linearity and constant risk. The AIC selection is affected by moderate overfitting sometimes suggesting flexible models in scenarios o...
Lung_Cancer
"Therefore we will conduct a pilot study to explore the feasibility of estimating the ICER using person-level data from medical records and other sources. This will allow us to prepare for a future more comprehensive CEA of DAPs across multiple sites. Sampling Because this is a pilot study we will focus our efforts on ...
Lung_Cancer
"Henry Ford Health System Detroit MI 48202 USA 7 2 2014 13 12 2013 6 1 2014 06 1 2015 59 1 173 188 The direct dose mapping (DDM) and energy/mass transfer mapping (EMT) are two essential algorithms for accumulating the dose from different anatomic phases to the reference phase when there is an motion or tumor/tissue def...
Lung_Cancer
"non-small cell lung cancers (NSCLC) and the underlying molecular mechanism. A549 cells were transfected with anti-miR-21 or the negative control oligonucleotides and real-time PCR was applied to detect miR-21 expression level. After ionizing radiation (IR) the survival fractions proliferation apoptosis and expression ...
Lung_Cancer
"a biomarker we validated in BRAF inhibitor-resistant NSCLC clinical specimens. These data reveal the multifaceted molecular mechanisms by which NSCLCs establish and regulate BRAF oncogene dependence provide insights into BRAF“EGFR signaling crosstalk and uncover mechanism-based strategies to optimize clinical response...
Lung_Cancer
"Methods Data on cancer incidence were obtained from NCI CDC and NAACCR and on mortality from CDC. Long- (1975/92-2010) and short- (2001-2010) term trends in age-standardized incidence and death rates for all cancers combined and for the leading cancers among men and among women were examined by joinpoint analysis. Thr...
Lung_Cancer
"However none of the previous studies have described the EGFR status of the patients analyzed and how that status impacted on the ORR to pemetrexed for certain TS polymorphisms. In terms of survival in the present series after a median follow-up of 21 months PFS was superior for those patients showing a 3R/3R genotype ...
Lung_Cancer
"This phenomenon which we did not observe in our previous cohorts might relate to the average quality of chimeras as for this experiment we induced tumors in chimeric mice with a wide range (5“95%) of coat-color chimerism (supplementary Fig S8B). Monitoring of Luciferase expression in individual mice from the F1 cohort...
Lung_Cancer
"This represents a 160-fold preference for ?v?6. As a reference point the maximum concentration of the imaging probe in the blood of a mouse is ~5 nM; this is substantially below the Kd of the H2009.1-10mer dimeric peptide for ?v?3 and ?v?5 and no binding of the peptide to these purified integrins was detected at this ...
Lung_Cancer
"A decrease in Hsp70 by RNAi promoted cisplatin-dependent activation of Bax. A549 cells treated with Hsp70 or control siRNA were incubated in presence or absence of cisplatin; each cell extract was immunoprecipitated with an anti-active Bax antibody followed by immunoblotting with anti-Bax antibody. The data are repres...
Lung_Cancer
"The scFvMTBHsp70 fusion protein increases tumor antigen presentation and cross-presentation by DC in vitro In the current study we demonstrated that splenic CD8+ T cells from scFvMTBHsp70-treated tumor-bearing mice could produce cytokines upon specific tumor antigen stimulation ex vivo which was associated with their ...
Lung_Cancer
"Identifiability and constraints The tensor product structure of the cross-basis defined in (5)“(7) poses some identifiability issues. In particular each of the vx basis variables in R is multiplied by each of the v? basis variables in C. If an intercept is included in f(x) the related matrix of cross-basis variables W...
Lung_Cancer
"Both FDR values for discovered pairwise and triplet combinations were zero therefore all of the discovered logic pairwise and triplet combinations were not generated by chance and all of them might represent real associations. In addition we calculated the recurrence rate of discovered logic pairwise and triplet combi...
Lung_Cancer
"Human FTSJ2 GCTGGTGTGTGTTTCCTTTCA CAGAATCTGGTGCCTCTCGT HSP70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?-actin CCGTCTTCCCCTCCATCGTGGG CGCAGCTCATTGTAGAAGGTGTGG GAPDH GAGAAACCTGCCAAGTATGATG ACCTGGTCCTCAGTGTAGCC Pig Ftsj2 ACGAGTTCCCAGGAGAATCAGA TGCTTTGGCAACGACCTTTAA Hsp70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?...
Lung_Cancer
"In addition at concentrations of 12 or 5 µM the JNK inhibitor SP600125 partially rescued cells from toxicity induced by 24 h incubation with ?-lapachone (C) showing that JNK plays an important role in lung cancer cell death induced by ?-lapachone. .0088122.g003 Signaling pathway components involved in ?-lapachone-ind...
Lung_Cancer
"Since no concordant integrative analysis has been conducted before for these two data sets it is necessary to investigate whether more significant results can be achieved by such an analysis. Lai et al. [15] and Lai et al. [16] have discussed that it is necessary to evaluate the genome-wide concordance before an integ...
Lung_Cancer
"In the liver lymphatic vessels run parallel to the interlobular vessels and bile duct. Lymphatic vessels can be classified as deep or superficial lymphatic collecting ducts. Superficial lymphatic collecting ducts are often found in the connective tissues of the liver capsule and the lymph is transferred into the paras...
Lung_Cancer
"Then we need to calculate a tail probability for a heterogeneous Bernoulli process. For the calculation for gene sets with coordinate down-regulated differential expression we need to focus on the combination of different components with (j1 = 2 j2 = 2 . . . jK = 2). Then we need to change the formulas for uSi and CE...
Lung_Cancer
"Additional information is provided in the Section B of the supporting information. The functions f(x) and w(?) composing sx(xt) for the model candidates are selected a priori among linear constant piecewise constant functions and quadratic B-splines with 36 models in total. Specifically the three cut-offs of a piecewi...
Lung_Cancer
"s/Design A parallel group randomized controlled trial is conducted to compare MBSR with TAU. Lung cancer patients who have received or are still under treatment and their partners are recruited. Assessments will take place at baseline post intervention and at three-month follow-up. The primary outcome is psychological...
Lung_Cancer
"reads in RNA-seq but only a few mutant reads in DNA-WES such as the example Luminal A tumor with a single DNA mutant read in the PIK3CA hotspot. This study's results support that RNA sequencing could be beneficial when added to DNA sequencing in clinical settings. Future studies could explore alternative ways to integ...
Lung_Cancer
"Genes involved in the carcinogenetic mechanisms underlying malignant pleural mesothelioma (MPM) are still poorly characterized. So far mesothelin (MSLN) has aroused the most interest. It encodes for a membrane glycoprotein frequently over-expressed in various malignancies such as MPM and ovarian and pancreatic cancers...
Lung_Cancer
"Methods Lung flooding was performed in four human lung lobes which were resected from non-small cell lung cancers. B-mode imaging and temperature measurements were simultaneously obtained during high-intensity focused ultrasonography of centrally located lung cancers. The tumour was removed immediately following inson...
Lung_Cancer
"Radon is the exposure of interest and is modeled with different combinations of bases for f(x) and w(?) in the cross-basis sx(xt). Given the limited information on smoking histories in this analysis the cross-basis sz(zt) is a priori defined with a natural cubic B-spline with one knot at the median of 2.5 yearly packs...
Lung_Cancer
"55% were male 86% Caucasian and 50% had Eastern Cooperative Oncology Group performance status (ECOG PS)=0. A median of four cycles of ziv-aflibercept was administered. The most common treatment-emergent adverse events (TEAEs) of any grade were nausea (69%) and fatigue (67%) with hypertension (36%) as the most common g...
Lung_Cancer