input stringlengths 600 32.7k | label stringclasses 3
values |
|---|---|
"We have previously reported that the MOR is upregulated in lung tissue from patients with NSCLC [12] and that overexpression of MOR promotes tumor growth and metastasis in human NSCLC xenograft models [13]. Further data from Fujioka et al. indicate that the MOR regulates EGF-induced signaling events in NSCLC [35]. Con... | Lung_Cancer |
"When we analyzed the effects conferred by ibuprofen on the translocation of Bax to mitochondria in cisplatin-treated cells we observed an approximately 1.3-fold increase in the amount of translocated Bax (b). To exclude an effect of ibuprofen unrelated to the inhibition of Hsp70 we performed RNAi for a selective knock... | Lung_Cancer |
"The limitations of available data for cost effectiveness analysis are currently unknown so we are taking a practical approach in conducting an exploratory/pilot costing analysis as the first step. Recruitment for qualitative interviews is always challenging but we have identified a lead key informant at each site who ... | Lung_Cancer |
"As these series of processes maintained the normal cell-cell adhesion connection and inhibited EMT there was increased E-cadherin expression and decreased N-cadherin vimentin and snail expression as well as inhibited cell invasiveness in H1299 cells. Previous studies have shown that although p120ctn isoform 1A could b... | Lung_Cancer |
"A Splenocytes harvested from mice treated with scFvMTBHsp70 fusion protein equimolar mixture of MTBHsp70 plus P4 scFv or saline (n = 10 per group) were re-stimulated with Her2/neu peptide or MSLN Ld1 peptide. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed ... | Lung_Cancer |
"A Splenocytes harvested from mice treated with scFvMTBHsp70 fusion protein equimolar mixture of MTBHsp70 plus P4 scFv or saline (n = 10 per group) were re-stimulated with Her2/neu peptide or MSLN Ld1 peptide. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed ... | Lung_Cancer |
" Furthermore 40% of the F1 mice contained the construct reflecting a very efficient transmission. Compared to the classic approach where many crosses are required to obtain a particular genotype the F1 approach still provides a considerable time gain since it only adds Ë10 weeks to the chimeric GEMM-ESC approach. In ... | Lung_Cancer |
"MBSR is an 8-week group-based training consisting of meditation practices such as the bodyscan gentle yoga sitting and walking meditation. By repeatedly bringing attention back to the current experience participants gradually learn to disengage from dysfunctional thoughts and directly experience the emotions and bodil... | Lung_Cancer |
"Pten occurred in the majority of murine SCLC studied and engineered Pten deletion accelerated murine SCLC and abrogated loss of Chr19 in Trp53; Rb1; Pten compound mutant tumors. Finally we found evidence for polyclonal and sequential metastatic spread of murine SCLC by comparative sequencing of families of related pri... | Lung_Cancer |
"Methods A literature search was undertaken until July 2013 to identify the comparative studies evaluating disease-free survival rates and survival rates. The pooled odds ratios (OR) and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect models. Results Six retrospective studies were ... | Lung_Cancer |
"The remaining 24 (25.3%) were not differentiated beyond NSCLC NOS. The median tumor size was 2.15 cm (range: 0.8-5.0 cm). Tumor T-stage distribution was according to the AJCC 7th edition as follows: T1a: 46 (48.4%) T1b: 30 (31.6%) and T2a: 19 (20%) (). The median pretreatment SUVmax was 6.6 (range: 1.2-26.1). Among th... | Lung_Cancer |
"Diagnostic assessment programs (DAPs) appear to be a promising model for enabling ICC. The purpose of this study was to explore how DAP structure and function enable ICC and whether that may be associated with anizational and clinical outcomes. Methods A case study approach will be used to explore ICC among eight DAPs... | Lung_Cancer |
"The price of gefitinib is the most significant parameter that could reduce the incremental cost per QALY. Probabilistic sensitivity analysis indicated that the cost-effective probability of maintenance gefitinib was zero under the willingness-to-pay (WTP) threshold of $16349 (3per-capita gross domestic product of Chi... | Lung_Cancer |
"Validation of samples The primary aim of this scheme was to develop a flexible scalable EQA scheme designed to assess issues related to techniques and minimum detection limits used in standard laboratory practice focusing exclusively on the analytical (that is sample processing genotyping) and reporting phases (interp... | Lung_Cancer |
"25 Thus our results of a 2-year DFS rate of 80% and OS rate of 96% appear favorable by comparison. However it is prudent to be cautious because we lost 20 of 81 patients from the survival analysis because of consent withdrawal and a direct comparison of outcomes data among trials cannot account for differences in stud... | Lung_Cancer |
"However the production and administration of these tailor-made DC vaccines are costly and labor-intensive [5]. As a next-step in the development of DC vaccines we designed a recombinant protein that contains a Mycobacterium tuberculosis heat shock protein 70 (MTBHsp70) fused to a single chain variable fragment (scFv) ... | Lung_Cancer |
"Methods Lung flooding was performed in four human lung lobes which were resected from non-small cell lung cancers. B-mode imaging and temperature measurements were simultaneously obtained during high-intensity focused ultrasonography of centrally located lung cancers. The tumour was removed immediately following inson... | Lung_Cancer |
"assessed by ROC curves. The AUC value was 0.892 Relationship between serum KLK11 levels and clinicopathologic factors The relationships between KLK11 levels and clinicopathologic factors of lung cancer patients are shown in . The serum KLK11 levels did not differ significantly with age (P?=?0.569) sex (P?=?0.505) or h... | Lung_Cancer |
".0087629.g002 Example of a progressive patient on PET (mP) and conventional imaging. Progressive patient with right upper lobe NSCLC associated with mdiastinal lymphadenopathy lung and bone metastases (patient #2). Sum of the SUVmax of the 5 most hypermetabolic lesions (2 lung lesions 2 mediastinal lymph nodes one hi... | Lung_Cancer |
"Background Complement receptor 1 (CR1) the receptor for C3b/C4b complement peptides plays a crucial role in carcinogenesis. However the association of genetic variants of CR1 with susceptibility to lung cancer remains unexplored. Methods This case-control study included 470 non-small cell lung cancer (NSCLC) patients ... | Lung_Cancer |
"TP53 17(22.4%) 7(41.2%) 1(16.7%) 9(17.3%) 0(0.0%) VHL 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) Missense mutation distribution in the exons and functional domains of EGFR Out of 76 sequenced lung cancer samples 36.1% of EGFR mutations were missense along exon 19 50.0% were missense along exon 21 5.6% along exon 20 and 8... | Lung_Cancer |
"Complete surgical excision was impossible due to the nodules diverse sites. Palliative treatment using 2 mg/kg tramadol (tramadol Dongkwang Pharm Seoul Korea) and 2.2 mg/kg carprofen (rimadyl Pfizer New York NY U.S.A.) was applied to the dog twice per day for 3 months. Finally after respiratory distress began to emer... | Lung_Cancer |
"The rates of assignment of patients to observation (22%) and chemotherapy (78%) were as expected. S Gene expression analysis for treatment assignment is feasible. Survival results are encouraging and require future validation. Real-time performance of quantitative in situ ERCC1 and RRM1 analysis requires further devel... | Lung_Cancer |
"Overexpression of GFP-Sp1 decreased FOXO3 mRNA and protein levels in a dose-dependent manner (C panel a) whereas knockdown of Sp1 expression increased FOXO3 mRNA and protein levels (C panel b). These results indicate that Sp1 negatively regulates FOXO3 expression. Sp1 negatively regulates FOXO3 expression through reg... | Lung_Cancer |
"These suggest that the three aspects are genetically connected but the cause and effect relationships are still unknown. For example physiologic TF binding studies involve many TFs consequently it is difficult to assign nucleosome reanization to the binding site occupancy of any particular TF. Therefore several aspect... | Lung_Cancer |
"The clinical data for all patients were summarized in Additional file 1: Table S1. Relative BANCR expression in NSCLC tissues and its clinical significance. (A) Relative expression of BANCR in NSCLC tissues (n?=?113) compared with corresponding non-tumor tissues (n?=?113). BANCR expression was examined by qPCR and no... | Lung_Cancer |
" The map is constructed based on both networks simultaneously and thus can capture and reveal structures that are not identifiable when analyzing each data type separately. Our novel algorithms recovered the planted map structure in simulated data even when the noise level in the data was high. We tested our methods i... | Lung_Cancer |
"There are two kinds of localizing procedures: marking with thoracoscopically directly visible materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaq... | Lung_Cancer |
"The overfitting characterizing AIC-selected models in scenarios of simple exposurelagresponse dependencies does not seriously affect its performance a result in line with previous findings 18. However AIC-selected models also suffer from bias and undercoverage of confidence intervals to some extent. Part of this see... | Lung_Cancer |
"Log-rank test determined that the PFS and OS in high KLK11 group were significantly longer than those in the low KLK11 group (P?=?0.003; P?=?0.018) Discussion During the last few years numerous studies have been published which attempt to refine our understanding of determinants of prognosis in lung cancer by analyzin... | Lung_Cancer |
"for use in lung cancer clinical trials Eur J Cancer 1994 30 5 635 642 10.1016/0959-8049(94)90535-5 8080679 Osoba D Zee B Pater J Warr D Kaizer L Latreille J Psychometric properties and responsiveness of the EORTC Quality of Life Questionnaire (QLQ-C30) in patients with breast ovarian and lung cancer Qual Life Res 1994... | Lung_Cancer |
" Clinics will be randomised to have the gene-based test for estimation of lung cancer risk or to act as controls groups. The primary endpoint will be smoking cessation at eight weeks and six months. Secondary outcomes will include ranking of the gene-based test with other smoking cessation motivators. Discussion The r... | Lung_Cancer |
"ChIP assays were performed with anti-acetyl-H3 (panel b) and anti-Sp1 antibodies (panel c). DNA was extracted for PCR with miR-182 and p21 primers. Data were quantified after three independent experiments (panel d). (F) A549 cells were harvested for DAPA with a biotin-conjugated p21 and miR-182 promoter probes and sam... | Lung_Cancer |
"As this was designed to ascertain proof of principle we did not apply a measure of successful laboratory performance. The pilot established that the scheme design and methods used were acceptable for use in a larger scheme. Second round One hundred and seventeen laboratories from 30 countries registered and 101 partic... | Lung_Cancer |
"assessed by ROC curves. The AUC value was 0.892 Relationship between serum KLK11 levels and clinicopathologic factors The relationships between KLK11 levels and clinicopathologic factors of lung cancer patients are shown in . The serum KLK11 levels did not differ significantly with age (P?=?0.569) sex (P?=?0.505) or h... | Lung_Cancer |
".0091811.g002 Heterogeneity of lymphatic vessel density (LVD) microvessel density (MVD) and amount of cancer-associated fibroblasts (CAFs) with respect to tumor location. The LVD (A) MVD (B) and CAF area (C) was significantly different according to each tumor location. .0091811.g003 LVD MVD and CAF area at different... | Lung_Cancer |
"]a 2 (29) [4?71] 2 (15) [2?45] 4 (20) [6?44] No. of patients n 10 13 23 No. of PFS eventsf n (%) 8 (80) 11 (85) 19 (83) PFS weeks [95% CI] 8 [2?25] 9 [5?18] 8 [5?18] PFS probability at 6 months [95% CI] 14 [1?45] 6 [0?25] No. of deaths n (%) 6 (60) 12 (92) 18 (78) OS weeks 36 [2 ] 26 [8?36] 26 [10?47] Survival prob... | Lung_Cancer |
"MB was supported by the European Regional Development Fund grant number FKZ:005-111-0027. GVM was supported by the Victorian Cancer Agency grant TS10_01. KKW is supported by the NIH CA122794 CA140594 CA163896 CA166480 and CA154303 grants. PKP was supported by a Uniting Against Lung Cancer grant. RKT is supported by th... | Lung_Cancer |
" (see Table IV and second column). This pattern is confirmed by the results in Table V showing the average df in each dimension and the empirical rejection rates for the hypotheses of linearity and constant risk. The AIC selection is affected by moderate overfitting sometimes suggesting flexible models in scenarios o... | Lung_Cancer |
"requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materi... | Lung_Cancer |
"In the case of HCRT only one series was applied with 26 1.75 Gy?=?45.5 Gy delivered to the hemithorax with a simultaneous integrated boost of 26 2.15 Gy?=?55.9 Gy delivered to the R1/R2 region. Planning and dose calculation was performed on the Eclipse planning system (Varian Medical Systems Palo Alto CA) for a li... | Lung_Cancer |
"enough cancer cells etc. In this study two cores in TMAs were not identified with ALK+?in initial FISH analysis due to a lack of cancer cells. Similarly in biopsies the numbers of cancer cells is often very limited making an accurate FISH analysis difficult. With the IHC analysis in this study almost all of the cancer... | Lung_Cancer |
"CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a ... | Lung_Cancer |
"which was then transferred to a polyvinylidene difluoride membrane (Millipore Billerica MA) by using a transfer apparatus according to the manufacturer's protocols. Membranes were blocked with 3% nonfat milk in TBST buffer (10 mM Tris-HCl pH 8.0 150 mM NaCl and 0.05% Tween 20) for 1 h washed in the same buffer and inc... | Lung_Cancer |
"Later in the text we introduce the global improver which can often overcome both problems.Our global improver is based on the procedure in (17). Let M = {M1 ¦ Mn} be a collection of disjoint node sets (e.g. a set can be a single gene or not linked to any other set). Given sets (UV) U V M and x U the significance of... | Lung_Cancer |
"were a fraction of those needed for the photon plans (). This translates to a beam on time per field of between 5 and 10 seconds for the PT-SABR plans compared to 75 to 90 seconds for photon plan. This 5 to 10 second time estimate is based on a conservative 1 nC/sec dose rate however new proton centers may be able to ... | Lung_Cancer |
"However the production and administration of these tailor-made DC vaccines are costly and labor-intensive [5]. As a next-step in the development of DC vaccines we designed a recombinant protein that contains a Mycobacterium tuberculosis heat shock protein 70 (MTBHsp70) fused to a single chain variable fragment (scFv) ... | Lung_Cancer |
"Biological Sciences Cell Biology Analysis of the tumor-initiating and metastatic capacity of PDX1-positive cells from the adult pancreas PDX1-positive cells from adult pancreas Ischenko Irene a Petrenko Oleksi b 1 Hayman Michael J. a 1 Departments of aMolecular Genetics and Microbiology and bPathology Stony Brook Univ... | Lung_Cancer |
"BACKGROUND American Indians/Alaskan Natives (AI/ANs) have the worst 5-year cancer survival of all racial/ethnic groups in the United States. Causes for this disparity are unknown. The authors of this report examined the receipt of cancer treatment among AI/AN patients compared with white patients. METHODS This was a r... | Lung_Cancer |
"an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderately positive association with percent change in post-treatment tumor diameter (R?=?0.341 ). There were fewer target lesions in the other three ans than in the lung and there was no association between liver lymph node... | Lung_Cancer |
" For the agreement analyses the positive percent agreement (PPA) negative percent agreement (NPA) and overall percent agreement (OPA) with their corresponding 95% confidence intervals (CIs) were calculated. In addition 3-way analyses using MPP as a second reference method was performed to resolve the discrepancy resul... | Lung_Cancer |
"days for untreated control and 59 days (p?=?0.03 Log rank test). B. A Kaplan-Meyer plot of time to pre-defined tumor volume endpoint for subcutaneous RS4 leukemia subcutaneous xenografts treated with thiaminase 850 units SC BIW or buffer control. The median time to endpoint was 16.5 days for the control group and not ... | Lung_Cancer |
"Then we need to calculate a tail probability for a heterogeneous Bernoulli process. For the calculation for gene sets with coordinate down-regulated differential expression we need to focus on the combination of different components with (j1 = 2 j2 = 2 . . . jK = 2). Then we need to change the formulas for uSi and CE... | Lung_Cancer |
"In addition at concentrations of 12 or 5 µM the JNK inhibitor SP600125 partially rescued cells from toxicity induced by 24 h incubation with ?-lapachone (C) showing that JNK plays an important role in lung cancer cell death induced by ?-lapachone. .0088122.g003 Signaling pathway components involved in ?-lapachone-ind... | Lung_Cancer |
"Implications This study provides a mechanistic basis for potential therapeutic interventions to prevent metastasis. NEDD9 invasion metastasis breast cancer MMP14 Int J Occup Environ Health Int J Occup Environ Health OEH International Journal of Occupational and Environmental health 1077-3525 2049-3967 Maney Publishing... | Lung_Cancer |
"These point mutations occur in the tyrosine kinase domain which plays an important role in oncogenesis. Our peptide array was selected from EML4 which has no correlation with these point mutations. It is possible that this treatment is effective for tumor cells resistant to ALK inhibitors. In this study we identified ... | Lung_Cancer |
"was connected to the scFv at its C-terminal using an overlap PCR approach. The PCR product scFv-linker was subcloned into pQE30-MTBhsp70 at the N-terminal of MTBhsp70. The DNA fragment for scFvMTBhsp70 was PCR amplified and cloned into pPMY5 (Promab) downstream of a human IgG1 Fc domain and separated from the Fc regio... | Lung_Cancer |
"(B) E-cadherin was membrane positive and vimentin was negative in p120ctn membrane-positive lung cancer cells. (C) E-cadherin was negative and vimentin was positive in p120ctn cytoplasmic-positive lung cancer cells. .0088064.t001 Correlation between E-cadherin vimentin and lymph node metastasis and p120ctn. p120ctn N... | Lung_Cancer |
"Using fluorescence microscopy we identified apoptotic cells by the presence of highly condensed or fragmented nuclei. Apoptotic cells were counted in 5 different fields under microscopic observation. Western blot analysis The detailed protocol for the Western blot analysis is described in Method S1. It was performed u... | Lung_Cancer |
"Nucleosome positioning: multiple mechanisms toward a unifying goal Molecular cell 2012 48 1 2 23062951 24. Hughes A.L. Jin Y. Rando O.J. Struhl K. A functional evolutionary approach to identify determinants of nucleosome positioning: a unifying model for establishing the genome-wide pattern Molecular cell 2012 48 5 15... | Lung_Cancer |
"Diagnostic assessment programs (DAPs) appear to be a promising model for enabling ICC. The purpose of this study was to explore how DAP structure and function enable ICC and whether that may be associated with anizational and clinical outcomes. Methods A case study approach will be used to explore ICC among eight DAPs... | Lung_Cancer |
"A Splenocytes harvested from mice treated with scFvMTBHsp70 fusion protein equimolar mixture of MTBHsp70 plus P4 scFv or saline (n = 10 per group) were re-stimulated with Her2/neu peptide or MSLN Ld1 peptide. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed ... | Lung_Cancer |
" Apoptosis of NSCLC A549 cells after ionizing radiation (IR). Apoptosis in anti-miR-21- (or anti-miR-NC-) transfected A549 cells combined with (or without) IR (8.0?Gy) was detected through annexin V-FITC/PI staining by flow cytometric analysis. The data represent the means ± SD of three separate experiments. Student's... | Lung_Cancer |
"lung cancer patients undergoing radiation therapy. Before 4DCT-ventilation can be implemented clinically it needs to be validated against an established imaging modality. The purpose of this work was to compare 4DCT-ventilation to nuclear medicine ventilation using clinically relevant global metrics and radiologist ob... | Lung_Cancer |
"PAX6 expression was obviously weakened in A549 PAX6 KD and H1299 PAX6 KD cells. To elucidate whether PAX6 expression has any effect on the growth of lung cancer cells RNAi was used to generate pax6 knock-down (PAX6 KD) cell lines. We selected two target cell lines: H1299 which showed high levels of PAX6 expression and... | Lung_Cancer |
" Despite previous investigations it remains unclear how p120-catenin (p120ctn) isoforms 1A and 3A affect the EMT of tumor cells. Here we investigated expression of p120ctn E-cadherin and vimentin in 78 human non-small cell lung cancer (NSCLC) samples by immunohistochemistry and found that p120ctn membrane expression p... | Lung_Cancer |
"Overall survival (OS) curves were delineated by the Kaplan-Meier method and compared with log-rank test. For all tests p-values less than 0.05 were considered to be significant. All p-values given were results of two-sided tests. Results PDGF-BB and VEGF-C coexpression in primary human NSCLC In primary human NSCLC tis... | Lung_Cancer |
"Treatment using a mixture of MTBHsp70 plus P4 scFv for ovarian tumor or malignant mesothelioma-bearing mice did not increase survival or enhance tumor-specific immune responses suggesting that only through fusion of the two elements is the immune system effectively activated. We also demonstrated that this approach do... | Lung_Cancer |
"As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (AT) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM protein is a m... | Lung_Cancer |
"a biomarker we validated in BRAF inhibitor-resistant NSCLC clinical specimens. These data reveal the multifaceted molecular mechanisms by which NSCLCs establish and regulate BRAF oncogene dependence provide insights into BRAFEGFR signaling crosstalk and uncover mechanism-based strategies to optimize clinical response... | Lung_Cancer |
"This CTL clone specifically recognized peptide-pulsed T2 cells and H2228 cells expressing HLA-A*02:01 and EML4-ALK that had been treated with IFN-? 48 h prior to examination. CTL activity was inhibited by an anti-HLA-class I monoclonal antibody (W6/32) consistent with a class I-restricted mechanism of cytotoxicity. Th... | Lung_Cancer |
"an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderately positive association with percent change in post-treatment tumor diameter (R?=?0.341 ). There were fewer target lesions in the other three ans than in the lung and there was no association between liver lymph node... | Lung_Cancer |
"We have previously reported that the MOR is upregulated in lung tissue from patients with NSCLC [12] and that overexpression of MOR promotes tumor growth and metastasis in human NSCLC xenograft models [13]. Further data from Fujioka et al. indicate that the MOR regulates EGF-induced signaling events in NSCLC [35]. Con... | Lung_Cancer |
"Taken together our data suggests the MOR plays a crucial role in the fundamental cellular EMT changes that occur during lung cancer progression and provides a plausible explanation for the epidemiologic findings. Supporting Information Figure S1 The MOR antagonist naltrexone inhibits epithelial mesenchymal transition ... | Lung_Cancer |
"These studies demonstrate that RRM1 could be a predictive marker of the response to gemcitabine-based chemotherapy in patients with NSCLC [22]. The present study also showed that the DCR was higher in RRM1-positive patients that received docetaxel or vinorelbine rather than gemcitabine-based therapy. In addition docet... | Lung_Cancer |
"n methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriat... | Lung_Cancer |
"The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is repres... | Lung_Cancer |
"Sulindac is a ligand of the aryl hydrocarbon receptor (AhR) an xenobiotic-sensing nuclear receptor that can be activated by chemical structures containing planar aromatic hydrocarbons and thus evokes a cellular response that to detoxify xenobiotics. AhR activation leads to transcriptional upregulation of the NQO1 gene... | Lung_Cancer |
" Total patient questionnaire scores by the multidisciplinary team in the intervention group at baseline (pre) and at the end of the study (post). A low score indicates better experience. Each symbol represents the mean score for each trust in the intervention group. The maximum possible score for the questionnaire is ... | Lung_Cancer |
"and Cys-K-(PEG11-10mer-COCH3)2) peptide (3.0 mg 0.68 ?mol). Protected (tBu)2-AcD10 was obtained as a white solid (2.5 mg; yield: 73%). MALDI-TOF/MS: 5048.15 [M+H]+. Calc'd MS: 5047.49. After deprotection H2-AcD10 was obtained in quantitative yield. MALDI-TOF/MS: 4935.46 [M+H]+. Calc'd MS: 4934.85 Synthesis of H2(M10)2... | Lung_Cancer |
"A SNP is determined to be related with a regulatory region if the SNP or any LD-related SNP (r2?0.8) resides in the ChIP-Seq peaks of the regulatory regions. Enrichment for cis-meQTL SNPs without trans effects (cis only) trans-meQTL SNPs without cis effects (trans only) and SNPs with both trans and cis effects (c... | Lung_Cancer |
"This study utilized the high-performance computational capabilities of the Biowulf Linux cluster at the NIH Bethesda MD (http://biowulf.nih.gov). We are grateful to the EAGLE participants and the large number of EAGLE collaborators (listed in http://dceg.cancer.gov/eagle) The Cancer Genome Atlas project for the genoty... | Lung_Cancer |
"Thymidylate synthase (TS) gene expression in primary lung cancer patients: a large-scale study in Japanese population Ann Oncol 2011 22 1791 1797 10.1093/annonc/mdq730 21321092 Bosch-Barrera J Gazta±aga M Ceballos J Prez-Gracia JL Lpez-Picazo JM Garca-Foncillas J Ferrer M Sanz ML Pretel M Idoate MA Gil-Bazo I Toxic e... | Lung_Cancer |
"316 chips were used for sequencing on the Ion Torrent PGM for 65 cycles and the samples were barcoded. Ion PGM 200 Sequencing Kit was used for sequencing reactions as per the recommended protocol (Part # 4474004 Rev. B). The dataset has been deposited to the NIH Sequence Read Archive and the accession number is SRP028... | Lung_Cancer |
"This phenomenon which we did not observe in our previous cohorts might relate to the average quality of chimeras as for this experiment we induced tumors in chimeric mice with a wide range (595%) of coat-color chimerism (supplementary Fig S8B). Monitoring of Luciferase expression in individual mice from the F1 cohort... | Lung_Cancer |
"Human FTSJ2 GCTGGTGTGTGTTTCCTTTCA CAGAATCTGGTGCCTCTCGT HSP70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?-actin CCGTCTTCCCCTCCATCGTGGG CGCAGCTCATTGTAGAAGGTGTGG GAPDH GAGAAACCTGCCAAGTATGATG ACCTGGTCCTCAGTGTAGCC Pig Ftsj2 ACGAGTTCCCAGGAGAATCAGA TGCTTTGGCAACGACCTTTAA Hsp70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?... | Lung_Cancer |
"National Institutes of Health R01 DK082779 9005373 1697 Eur J Cancer Eur. J. Cancer European journal of cancer (Oxford England : 1990) 0959-8049 1879-0852 24780874 4155498 10.1016/j.ejca.2014.03.008 NIHMS621748 Genetic variants of the LIN28B gene predict severe radiation pneumonitis in patients with non-small cell lu... | Lung_Cancer |
" The blue nodes represent biomarkers identified in this work. The yellow nodes represent six genes which are not related with NSCLC on the NSCLC and normal specimens. The red nodes represent subtypes i.e. AC and SCC. Key gene pairs inferred by gene-subtype higher logic relationships We grouped together the gene-subtyp... | Lung_Cancer |
"Low magnification image of the tumor (HE staining) revealed a subpleural tumor consisting predominantly of lepidic growth with a small (<5 mm) focus of invasion. (iv) Middle magnification image of the invasive area of the tumor (HE staining) revealed acinar-type growth pattern. (c) A 74-year-old female patient with le... | Lung_Cancer |
"Anchorage of tissue cells to their physical environment is an obligate requirement for survival which is lost in mature hematopoietic and in transformed epithelial cells. Here we find that a lymphocyte lineage-restricted transcription factor Aiolos is frequently expressed in lung cancers and predicts markedly reduced ... | Lung_Cancer |
"Thirty micrograms of WCL were resolved by SDS-PAGE (NuPAGE Invitrogen). Immunoblotting was performed with primary antibodies recognizing PARP LAMP-1 (both Santa Cruz Biotechnology Santa Cruz CA USA) LC3B (Cell Signaling Technology Danvers MA USA) p62 (BD Transduction Laboratories San Jose CA USA) D2R (Abcam Cambridge ... | Lung_Cancer |
"BACKGROUND American Indians/Alaskan Natives (AI/ANs) have the worst 5-year cancer survival of all racial/ethnic groups in the United States. Causes for this disparity are unknown. The authors of this report examined the receipt of cancer treatment among AI/AN patients compared with white patients. METHODS This was a r... | Lung_Cancer |
"We also evaluated chest CT findings to determine the involvement of emphysema. The percentage of the COPD group with involvement of emphysema in the chest CT findings was almost twice as high as that of the non-COPD group (38.8% vs 20.3% respectively). Patient characteristics among non-COPD and COPD patients All ca... | Lung_Cancer |
"The scFvMTBHsp70 fusion protein increases tumor antigen presentation and cross-presentation by DC in vitro In the current study we demonstrated that splenic CD8+ T cells from scFvMTBHsp70-treated tumor-bearing mice could produce cytokines upon specific tumor antigen stimulation ex vivo which was associated with their ... | Lung_Cancer |
"rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA rs6656401 G/A ACGTTGGATGAAA... | Lung_Cancer |
"adenocarcinoma in Chinese female non-smokers has not been well addressed. ATM rs189037 was a common polymorphism in the promoter of ATM gene. Studies have shown that this site possibly may regulate ATM protein activity due to regulation function of promoter as shown in most genes. And specific genotypes or haplotypes ... | Lung_Cancer |
"associated with lung cancer with squamous differentiation. J Clin Oncol. 2013;31(10):e161e16423358982 5. PaoWGirardN New driver mutations in non-small-cell lung cancer. Lancet Oncol. 2011;12(2):17518021277552 6. ShigematsuHTakahashiTNomuraM Somatic mutations of the HER2 kinase domain in lung adenocarcinomas. Cancer ... | Lung_Cancer |
"n methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriat... | Lung_Cancer |
"CC Bruns GA Weis JJ Klickstein LB Wong WW Fearon DT A complement receptor locus: genes encoding C3b/C4b receptor and C3d/Epstein-Barr virus receptor map to 1q32 J Immunol 1987 138 312 315 3782802 Wilson JG Wong WW Murphy EE 3rd Schur PH Fearon DT Deficiency of the C3b/C4b receptor (CR1) of erythrocytes in systemic lup... | Lung_Cancer |
"Taken together our data suggests the MOR plays a crucial role in the fundamental cellular EMT changes that occur during lung cancer progression and provides a plausible explanation for the epidemiologic findings. Supporting Information Figure S1 The MOR antagonist naltrexone inhibits epithelial mesenchymal transition ... | Lung_Cancer |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.