text
stringlengths
222
548k
id
stringlengths
47
47
dump
stringclasses
95 values
url
stringlengths
14
7.09k
file_path
stringlengths
110
155
language
stringclasses
1 value
language_score
float64
0.65
1
token_count
int64
53
113k
score
float64
2.52
5.03
int_score
int64
3
5
Consider Singapore. In geographical terms, it’s about half the size of London and supports a population of nearly five and a half million people. Inevitably it is characterised by a multitude of high-rise buildings but the other overwhelming impression is just how green it is. It wasn’t always so. In 1965, when they gained independence, Singapore was “filled with slums, choked with congestion, where rivers became open sewers, no natural resources and few jobs for the workforce. Now it’s a clean, modern metropolis, economically successful and the highest rate of home ownership anywhere”. Veteran architect and urban planner Cheong Koon Hean oversees the city’s public housing has developed the concept of livable density which is about “creating quality of life despite that density”. Pocket sized public gardens are linked by canals and pretty bridges, Vertical gardens adorn the sides of buildings, whole floors are given over to gardens used by everyone. Three million trees grow in luxuriant profusion amidst rivers and ponds. The botanical gardens are beautiful and it’s orchid collection not to be missed. Bishan park is part of network whose ultimate goal is the provision of 400 miles of walking and cycling tracks. By 2030, Singapore will be gauged by the Green mark standard whose aim is to reduce energy use and carbon emissions. Renewable energy is being developed rapidly and the smart money says they will achieve their targets. San Francisco is one of my favourite cities. They have a target: 50% of their electricity will come from renewable sources by 2020. Since solar panels and wind turbines already account for 40% of electricity purchased, the target is likely to be exceeded. It also has policies on recycling and composting. It aims to eliminate landfills and incinerators by 2020.All food waste, grass cuttings and foliage is collected and converted to compost as “fine as sand”. Hotels are involved in this recycling programme too because it saves them money. The City now bans the sale of small plastic bottles and are installing drinking fountains. Supermarkets are now no longer allowed to hand free plastic bags to their customers. The city is now targeting bans on packaging materials such as polystyrene and cellophane and developing the use of old fashioned washable diapers. No reason why our cities cannot emulate Singapore and San Francisco.
<urn:uuid:318353c8-da22-4353-909e-1373a25ebb62>
CC-MAIN-2022-40
http://advertisingmatters.blogspot.com/2017/11/lessons-from-two-smart-cities.html
s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030335034.61/warc/CC-MAIN-20220927131111-20220927161111-00231.warc.gz
en
0.953787
499
2.65625
3
What US Teachers Can Teach Us All In late February 2018, a call went out to the American Federation of Teachers and the National Education Association for teachers across West Virginia to go on strike. Reasons for the strike included need for: higher pay for both faculty and staff, higher educational budgets allotted, expanded school facilities to alleviate overcrowded classrooms and over-worked teachers, as well as other problems that needed to be addressed. The strike in West Virginia ignited a spark across the US; and soon Oklahoma and Arizona joined in with similar state-wide strikes. Smaller-scale strikes by school staff popped up across the nation in North Carolina, Georgia, Colorado, Virginia and Kentucky, inspired by the success of the strikes in West Virginia. In some areas, teacher pay has not gone up in a decade. That is bad of course, but in other areas the pay for teaching positions has actually gone down over the last 10 years. New teachers are consistently given less and less pay, most of them unaware of the difference. Considering the importance of teachers in society, right beneath parents in terms of influencing and shaping the youngest generations, giving them less pay means that we value their contributions less. As a result, the caliber of teachers drops, along with our children's test scores. In short, you get what you pay for. Though students had carried out large-scale protests for better gun legislation prior to the teachers' strike, and while that event may have inspired the latter one, the teacher strike was a separate situation completely. While both events serve as an example for as to how it can be done and what can be accomplished when people come together for a common purpose, they only encompassed a small subset of the population. They were fighting tooth and nail, giving it all they had, but they were fighting mostly alone. And both are important also, in that they set a precedent. In order to reach our goals and aspirations as progressives, many small steps are recommended, like not rushing headlong into traps and far-too-convenient situations. This likely won't be about convenience, it will be about acting rationally, learning the hard way, and responding....Adapting. But one thing is becoming more and more apparent all the time: we're going to need to do more than just vote. From Transparency International: "There has been a slight increase in the proportion of people saying that some form of direct action away from the ballot box would be most effective – speaking out on social media, joining a protest march, joining an anti-corruption organisation, signing a petition, talking to friends or relatives, or boycotting a business. Collectively, a quarter of people in the United States now think these are the most effective things they can do, up from 17 per cent in 2016." In light of the efforts of both teachers and students in 2018, the data from this year will likely be most enlightening in reference to people's attitudes about mass civil disobedience on a grand scale. It is this attitude that should be closely watched in order to gauge our collective acceptance of mass action and it's mass action that will likely be our only salvation from oligarchy. But this action must not be violent. It must not be based in primal impulses but rather well-considered moves in a great game of cards. Collectively we hold many cards that we can use to win, in spite of what we're constantly told by mainstream media. We must play these cards carefully and wisely, in order to avoid losing any ground we may gain. As soon as we lose control of ourselves, they will gain it completely. One of the cards we hold, is our sheer numbers. But this can't just be teachers, it can't just be teenagers, it can't just be progressives, ...it can't just be any small subset of society. It has to be everybody. It has to be across the board, the likes of which this country has never seen before. Many will already condemn this idea to the realms of the impossible, even before the words finish reaching their eyes. "We will never achieve that level of unity." they will say. But they are wrong. If we get to the heart of our disconnects and conflicts as a shattered population, we begin to see that the crux of many of these disagreements is an intentional lie. We are splintered due to injury, rather than defect. These conflicts are not meant to be resolved, they are meant to linger for generations, while both sides quarrel endlessly, and unnecessarily, over two completely idiotic (yet conveniently opposing) viewpoints. The first major lie is that Federal spending requires tax money. As long as that lie is perpetuated, those who earn the most feel the entitled to that which tax money buys at the Federal level. At the same time, these same people will regard poorer people, who they perceive as contributing less to the economy, as less deserving of benefits. This of course extends downward to those whom they view as contributing nothing to the economy, while taking and taking from those who do. The fact is that when Congress budgets money into existence, that money belongs to all US citizens, without regard to how much they make, or to how much they pay in taxes. That tax money is simply deleted from the economy. It does not entitle anyone to recieve preferential treatment, and it does not entitle anyone to disparage anyone else. Dems want to raise taxes to pay for things at the federal level, and conservatives want to cut benefit programs to accomplish the same goal. Both are harmful, and more importantly both are completely unnecessary. Both sides quibble over arbitrary semantics while real issues for real people are completely ignored. ...Which brings us to lie #2, that the national debt is the sum total of money that the US owes to other countries. Again, the Democrats' solution is to raise taxes, and the Republicans want to cut 'entitlements'. They're fighting over whether it's better to choke us with a rope or drown us. What stake do we have in the victory of either side? Meanwhile, the US's monetary sovereignty provides us, as a nation, with the ability to honor any debt in US dollars, at any time -without question. We do not owe US dollars to anyone else. That is NOT what the term 'national debt' means! Stop fighting over a lie and join together in truth. It's really fairly simple. There is one school of logic which destroys all of these lies. Modern Monetary Theory or MMT, has been referred to as 'neoliberal kryptonite' for good reason: it eliminates all justification and legitimization for austerity in US government spending. But it does more than this, it also destroys lies which are designed to keep the masses in forced opposition, rather than finding unity in a common purpose: the business of running a country which is both by the people and for the people. Teaching MMT is difficult, and perilous. It puts people at odds with many peers who hold comfortable notions very closely to their hearts and at the front of their minds every waking moment of their lives. To challenge these notions is to put yourself at risk of ridicule, derision and instant dismissal. But challenge them we must, if we want people to see through them in any great number. And we desperately want that, in as great a number as possible. The more people realize that their tax money doesn't go toward buying federal programs, the fewer people will be screaming about how 'their' money is misused. The more people wake up to the fact that our national debt is simply the sum total of all dollars issued in the US since 1789 that have not been taken back and deleted via taxation, the fewer paid public servants will be wasting time arguing over how best to suffocate us. More importantly, a major source of division between conservatives and liberals will be dismantled. Fighting to enlighten people about MMT is hard, but it is arguably the most important discussion you could be having right now, because its introduction into the conversation calls everything we're fighting against into question. Our fiscal differences are artificially divided, along with so many political ones, and what's more perfect and enduring to bind us all together again, than shared knowledge? So WATCH teachers,, and their students in the US... LISTEN to them, and take heed. "Teach To Act, Act To Teach" ...Good luck, warriors.
<urn:uuid:9041e371-d6d0-4134-abe9-518c23b61ac6>
CC-MAIN-2019-35
https://www.realprogressivesusa.com/news/economic-justice/2018-06-24-what-us-teachers-can-teach-us-all
s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027314959.58/warc/CC-MAIN-20190819201207-20190819223207-00131.warc.gz
en
0.971952
1,727
2.9375
3
Today we refer to the American Indians of the Central Gulf Coast as the Tocobaga. In truth we don’t know whether that name belongs to a leader, a city, a nationality, or to all three. It may simply mean “our revered,” a title much like the “Dali Llama” is a honorific title. The Spanish were the first to record the name and they were always quick to interpret what they heard into that which was familiar to them. Tocobaga can be interpreted as “the honored man,” the leader who met with Pedro Menéndez de Aviles when his ships arrived arrived in Tampa Bay in 1566. This painting honors a very brave man. In April of 1566, Governor Pedro Menéndez de Aviles sailed six bergantines as close to the village of Tocobaga as they could get. In the morning when the residents saw the threat, they fled into the forest. Grasping imminent danger, Tocobaga climbed the mound to the temple. That’s where Menéndez found him. “I have lived a long life with the Great Mystery and all of my beliefs,” he told the Governor. “I came here to die with my understandings.” Menéndez told him that he come not to kill him, but to make peace. With some relief, the Tocobaga immediately sent for 29 sub-chiefs in order to hold a council. It took five days for all of them to arrive. Thousands of people flooded into the city until Menéndez, fearing for his and his men’s safety, asked the Tocobaga to send them away. Devastated by European diseases between 1508 and 1512, the Tocobaga people had also felt the impact of earlier expeditions, those of Panfilo de Narváez in 1528 and Hernando de Soto in 1539. They were attempting to rebuild when Menéndez arrived in 1566. Despite their valiant efforts to continue on, this new force that had arrived on their shores would bring about the demise of this ancient culture. Note about the painting. When praying at a site, that doesn’t have anything to attach feathers in the form of prayers, sticks are used. Along with the four directions, they are the four seasons of your life. Every time the sticks are used in prayer, the prayer becomes a part of the sticks.
<urn:uuid:3110f381-30a5-494d-afad-d8b1b6f42ca0>
CC-MAIN-2019-39
https://firstfloridafrontiers.org/?page_id=1383
s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514575484.57/warc/CC-MAIN-20190922094320-20190922120320-00222.warc.gz
en
0.979757
527
3.8125
4
Gastropoda, Hyalitha, Brachipoda and Related Microbes of Cambrian Reefs in South-facing Exposures of Pilgrim Formation in Central Montana Throughout evolution some organisms have left traces of their existence by the process of fossilization. By studying an organism’s fossils, its structure and identity can be linked with a particular age or era. Each fossil provides insight into our evolutionary history. I conducted research in five sites in Grizzly Gulch, south of Helena , Montana. All sites contained reefs in the Pilgrim Formation of Late Cambrian age, which is approximately 520 million years old. I analyzed the reefs, extracted a total of 51 specimens and prepared them in the lab for identification. I identified 10 skeletal structures, including organisms of the phyla Hyalitha, Brachiopoda and Mollusca. I also identified other structures on the reefs that helped me to understand specific environmental conditions of this area. These structures included trace fossils which helped identify organisms that existed but were soft bodied. Evidence of their presence was preserved through burrows. In addition, graintypes such as oolites and intraclasts indicated that this area was one shallow water; stromatolites and channels suggested the presence of strong tides. My study concluded from these five reef sites that several different invertebrates dominated the floors of a shallow sea 520 million years ago in the area now called Grizzly Gulch, in central Montana.
<urn:uuid:ae8d4785-6d5d-4115-ab0d-0054bcc5a9d7>
CC-MAIN-2020-45
https://scholars.carroll.edu/handle/20.500.12647/2885
s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107900200.97/warc/CC-MAIN-20201028162226-20201028192226-00387.warc.gz
en
0.956047
295
3.59375
4
We examined an index of abundance for rabbits Oryctolagus cuniculus involving a spotlight plot count (SPC) using capture-mark-resighting as a reference method in five study areas. In these areas, density varied over a wide range, from 0.7 to 23.4 rabbits/ha, which is representative of most European populations. The SPC precision was good, as the coefficient of variation ranged within 5-54%, the median value being 17%. We showed area and year effects on the index and a significant relationship between the SPC and ln(density) (P < 0.0001). The logarithmic relationship between density and SPC suggests a saturation of the index when density increases. Despite the fact that the SPC index was highly correlated with density, its ability to detect population changes was rather poor. This lack of sensitivity may be due to factors affecting rabbit detectability such as climatic conditions, lunar phases, observers, changes in crop rotation and, more generally, to factors affecting the number of rabbits above ground at the time of the count. The area effect means that the index is not suitable for comparing data recorded in different areas. The year effect is an actual obstacle to the use of this index since, within a defined area, the temporal changes in the index values are not related only to the estimated density. Our study highlights the necessity to validate abundance indices against reference methods so as to check their ability to detect changes in population size and their suitability for comparing data from different areas. Abundance indices are widely used in field studies of mammals because it is rarely possible to obtain an accurate estimate of the actual population size (Dice 1941, Thompson et al. 1998). However, some researchers have pointed out the danger that such indices may not accurately reflect population trends (Rotella & Ratti 1986, Eberhardt & Simmons 1987, Thompson et al. 1998) and, consequently, have suggested that population indices should be tested against other known methods. In practice, this means calibration against more accurate methods such as capture-mark-recapture (CMR) methods (Bayliss et al. 1986, Freeland 1986, Hutton & Woolhouse 1989). Such methods are widely used in research but are expensive and difficult to apply in wildlife management (Caughley 1977, Engeman 2003). Nevertheless, they give reliable estimates of the population size under some assumptions and, therefore, can be considered as reference methods. In France, the wild European rabbit Oryctolagus cuni-culus is an important game species. However, when abundant, it can become a pest responsible for significant damage to crops. This particular status, game but also a potential pest, must be taken into account when devising management rules for the development of game populations while avoiding agricultural damage. As rabbit management should be based on sound information on population levels, an abundance index that is either reliable or calibrated to actual population size is required to assess rabbit abundance. The methods used to estimate rabbit abundance are divided into three groups. Indirect methods are faecal pellet counts (Taylor & Williams 1956, Gibb et al. 1969, Wood 1988, Iborra & Lumaret 1997) or counts of warren entrances (Parer 1982, Parer & Wood 1986). Direct methods are mainly daylight counts (Myers 1957, Parer & Price 1987, Moller et al. 1996), twilight transect counts (Tittensor 1979, Beltran 1991) and spotlight transect counts (Rogers 1979, King et al. 1983, Marchandeau & Gaudin 1994, Fletcher et al. 1999). Most of these methods give an index of abundance, but few of them have been calibrated against a reference method. Spotlight transect counts are the most widely used method to monitor rabbit populations, but their reliability remains poorly documented and is controversial. A study carried out in New Zealand determined the precision and accuracy of spotlight counts made from a motorcycle along transects in a flat and denuded study area (Fletcher et al. 1999), and the researchers concluded that “spotlight counts provide an inaccurate estimate of actual densities”. However, a more recent study using modelling to estimate population growth rates and a different survey protocol, i.e. a single observer, a 150-W instead of a 30-W spotlight and a 4-wheel-drive vehicle instead of a motorbike, demonstrated the ability of transect spotlight counts to detect changes in rabbit abundance (Caley & Morley 2002). Whatever their reliability, spotlight counts carried out on large transects cannot be used in closed or semi-closed landscapes where hedges border roads or tracks and thus prevent the counting of many fields. Moreover, this method, which is used to monitor populations in large areas, is not really suitable for monitoring the patchy populations living on small areas that are representative of most management units in France. Finally, it is costly to apply since at least two operators are needed to make a count. The aim of our study was to measure the reliability of an abundance index and to test it under different biogeographic conditions in order to determine whether or not it was suitable over a wide range of habitats. The spotlight plot count (SPC) is a cheaper method than the spotlight transect count commonly used in Australia and New Zealand, and is more suitable for monitoring populations living on small areas and in the closed or semi-closed landscapes that are the habitats of most French rabbit populations. We defined reliability as a combination of three components: the precision, the bias, i.e. the pattern of the relationship between the index and the population size, and the ability of the index to detect trends in the population. The study was carried out in January to estimate changes in the size of wild rabbit populations before reproduction, the emergence of the first juveniles occurring from mid-February onwards. The capture-mark-recapture method was used as a reference. The SPC is a count made at census points by only one observer moving on foot between these points. Material and methods To be widely useful, any survey method must be robust enough to be applicable in a large range of habitats. Accordingly, our study was carried out in five different study areas, each with its own habitat characteristics. Two of these areas, La Chevallerais and Cerizay, were managed for rabbit hunting, but during the study no hunting occurred. La Chevallerais (1°40'W, 47°28'N) is located in western France (Loire-Atlantique). The landscape is a bocage, i.e. an open woodland dominated by pastures. Hedgerows occur on 0.50-0.80 m high slopes. The climate is oceanic. Mean annual rainfall is 790 mm and mean annual temperature is 11.7°C. The study was conducted in an area covering 17 ha. Cerizay (0°40'W, 46°49'N) is also situated in western France (Deux-Sèvres). It is also a bocage, but with mixed farming. The climate is oceanic with a continental influence. Mean annual rainfall is 780 mm and mean annual temperature is 11.1°C. This 110-ha study area is managed for rabbit hunting. A free-living population has been established in artificial warrens. The Donzère-Mondragon reserve (4°42'E, 44°26'N) is located in southeastern France (Drôme and Vaucluse). The climate is Mediterranean with a continental influence. Mean annual rainfall is 830 mm and mean annual temperature is 13.2°C. The 35-ha study area is a shrub-steppe. Lalinde (0°44'E, 44°50'N) is situated in southwestern France (Dordogne). The 59-ha study area is included in a 125-ha game reserve comprising forest (93 ha), crops (12 ha), pastures (12 ha) and fallow land (8 ha). The climate is oceanic with a continental influence. Mean annual rainfall is 840 mm and mean annual temperature is 11.8°C. The Chèvreloup arboretum (2°16'E, 48°40'N) is located close to Paris. It is a 200-ha park in which a 10-ha study area was defined. The climate is oceanic with a continental influence. Mean annual rainfall is 600 mm and mean annual temperature is 10.1°C. In each area, the study was conducted over three years from December 1993 to March 1996. Each year, rabbits were caught in December using ferrets Mustela furo and nets. Captures were organised in the central parts of the study areas to limit edge effects when estimating population density. Rabbits were sexed, weighed and marked with coloured ear tags (Top-Tag ®; Rockall-France, Vitré, France) that also had Scotchlite® (3 M, Brownwood, Texas) markers for individual identification at night. Each rabbit was marked with one ear tag on each ear, both tags being covered with the same combination of colours. The aim of this double marking was to decrease the risk of bias due to tag losses. Afterwards, the rabbits were released into their warrens. The only method to determine the age of live rabbits is by the detection of the epiphyseal disks of the tibia, but it is not reliable for rabbits > 7 months old (Rogers 1982). Since most rabbits were > 7 months old when captured in December, they were all considered to be adults. Population size was estimated by capture-mark-resighting (CMR) using a ‘robust design’ (Pollock et al. 1990). Resighting was conducted on foot at night using a 100-Watt quartz-halogen spotlight and binoculars to identify the marked rabbits. The study areas were searched entirely to flush the rabbits in order to detect marked and unmarked rabbits with equal probabilities. Data recording began one hour after dusk. We recorded all sightings of marked and unmarked rabbits. For each area and each year, three sampling periods were organised to obtain resighting data on previously captured rabbits. The first sampling operation was undertaken on the day after capture and marking; the following two were carried out five weeks later, in January, and then again five weeks later, in late February or early March. Within each re-sighting period we undertook three resighting sessions (Table 1), usually on consecutive evenings except when unfavourable weather, i.e. fog or heavy rain, was likely to affect the probability of resightings. Capture-resighting experimental design used in this study. Resightings were organised in three primary sampling periods (j = 1, j = 2 and j = 3), each being made of three resighting sessions; ti means time i. The spotlight counts were undertaken on grazed parts of the study areas, using a 100-Watt quartz-halogen spotlight and binoculars. Grazed parts were determined a priori as plots, i.e. fields with < 10 cm high vegetation, excluding bare soil. The area of each survey plot was determined from a map. Hence, the number of census plots and their surface area differed among the study areas. When possible, the counts were made in January during the week of the resighting sessions. They were usually repeated during three consecutive evenings (except when unfavourable weather, i.e. fog or heavy rain, occurred) and began one hour after dusk. All observed rabbits, both the marked and unmarked ones, were counted in all the survey plots. The number of observed rabbits was divided by the area of the survey plot and expressed in terms of the number of rabbits/ha. Since the study was carried out after the hunting season had ended, hunting had no influence on the resighting data. Estimation of population size All rabbits were considered to be adults. CMR data were fitted to a Cormack-Jolly-Seber (CJS) model using the computer program JOLLY (Pollock et al. 1990). All the resighting sessions within a sampling period were pooled. A rabbit was considered as having been resighted in a sampling period if it was seen on at least one of the three nights on which observations were made (Pollock et al. 1990). Goodness-of-fit tests of the models were computed with the program RELEASE using the sum of TESTs 2 and 3 (Burnham et al. 1987, Lebreton et al. 1992). TEST 2 was used to test the goodness of fit of the model to the data and detects possible trap-dependence. TEST 3 tested heterogeneity in recapture histories (Burnham et al. 1987). Thereafter, a ‘death and emigration’ model (full CJS) was chosen to estimate the number of marked rabbits alive at the time of the resighting sessions. The JOLLY program computed the estimates of resighting rates ‘p’ and of the marked population size ‘M’ for each sampling period. As the aim of our study was to compare the SPC index (SPCI) to the actual population size before reproduction, we focused on the population size estimated in January, i.e. during the second sampling period, the SPC being performed at this time. At this time, the size of each population (N) was estimated according to the data recorded for both marked and unmarked rabbits. The JOLLY program provided the estimation of the number of marked rabbits alive (M) in each population. The number of unmarked rabbits alive (U) was estimated assuming that both the total number of sightings per individual (H1) and the resighting probability ‘pj’ (H2) were equal for marked and unmarked rabbits. The number of sightings of marked and unmarked rabbits, respectively, were Cm = m1 + m2 + m3 and Cu = u1 + u2 + u3 where mi and ui were the number of sightings of marked and unmarked rabbits seen during the ith secondary session of resighting. These sighting frequencies were field data. Assumption H1 means that Sm/Cm = Su/Cu where Sm (field data) and Su were the number of marked and unmarked different rabbits seen during a primary sampling period. Therefore, Su = Cu.Sm/Cm. Assumption H2 means that Su equals; p.U, where p is the capture probability given by the CJS model. Finally U = Su/p and the size of the opulation in January was N = M + U. N was then related to the size of the area to obtain an estimate of rabbit density (rabbits/ha). Reliability of the spotlight plot count The reliability of the SPC was estimated by both the precision of the index, the relationship between the index and the estimated density, and the ability of the index to detect changes in population size. The precision of the SPC was estimated using the coefficient of variation of the three repetitions of the count (Thompson et al. 1998). The data set was made up of 45 spotlight count records (5 areas × 3 years × 3 counts) yielding 15 population density estimates (5 areas × 3 years). To study the relationship between the counts and the density estimates, we used linear mixed-effects models that may include fixed as well as random factors and allow autocorrelation and/or heteroscedasticity of the residuals (Pinheiro & Bates 2000). The fixed part of the model was a variable expressing the density estimates, which might be either density or ln(density). Area and year effects were assumed to be random factors with the year factor nested within the area factor, to account for correlation between observations at the same site and in the same year for a given site. Plots of the residuals versus fitted values, explanatory variables and factors were used for graphical exploration of heteroscedasticity and choice of the way to take this into account. Models identical with respect to their fixed part, but differing in random factors and/or residual heteroscedasticity, were compared using Akaike's Information Criterion (AIC; Akaike 1973) as recommended for such analyses (Pinheiro & Bates 2000). The AIC value is the deviance of the model adjusted for its number of parameters k (AIC = DEV + 2k). The models having the lowest AIC or an AIC very close to this minimum, a difference of less than 2 or 3 (Burnham & Anderson 1998), are considered to be the closest to the best model and of equivalent value to represent the information contained in the data set. Finally, according to the principle of parsimony, the selected model was the simplest when several models had equivalent AIC. After the random structure of the model had been selected, the variable included in the fixed part of the model was finally tested with an F-test conditional on the estimates of the random parameters (Pinheiro & Bates 2000). All models were estimated with the REML method using the nlme library of the R package version 1.8.1. (Pinheiro & Bates 2000, R Development Core Team 2003). Finally, we tested the capacity of the SPCI to detect local rabbit abundance variations over time as if we were in an actual situation of population monitoring with three annual measures of SPC. In this way, we compared the three SPC measures for each study area for successive years with Mann-Whitney U-tests at a P = 0.10 level, as the number of observations did not allow us to obtain a smaller α error. Estimation of the population size The goodness-of-fit tests of the CJS model to the data (Table 2) failed to provide any evidence for trap dependence or heterogeneity in the recapture histories when both TESTs 2 and 3 were valid. We can therefore assume that the CJS model fitted the data. Some tests were not valid due to sparse data. One may notice that for La Chevallerais 1995, TEST 2 was significant suggesting trap-dependence, but the sum of TESTs 2 and 3 could not be calculated because TEST 3 was not valid. On this basis, we calculated the rabbit population size and converted it to density according to differences in the size of each study area. The data indicate a wide range of rabbit population densities that varied from 0.7 rabbits/ha at Lalinde in 1996 to 23.4 rabbits/ha at Chèvreloup in 1994. Goodness-of-fit tests to Jolly-Seber model calculated for each data set (year*area) by use of the sum of TEST 2 and TEST 3 given by program RELEASE; df = degrees of freedom. Modelling of the relationship between SPCI and density The SPCIs often gave convergent results within each year and for each area, with a coefficient of variation ranging within 5-54% (median value: 17%; Fig. 1). After fitting the most complete models with either density or its logarithm as explanatory variable, plots of residuals versus fitted values suggested a pattern on the linear, but not on the logarithmic scale (Fig. 2). Therefore, hereafter we only considered models with ln(density) as the fixed covariate. Graphs of residuals versus ln(density) suggested a relationship between residual variance and variable ln(density), so possible heteroscedasticity was taken into account by supposing the residual variance to be proportional to ln(density)2δ, where δ is an unknown parameter. This heteroscedasticity was confirmed by the model selection since a heteroscedastic model comprising area and year within area random effects was selected among the six possible combinations (see Table 3). Random effects and standardised residuals were successfully checked for normality. Under this random structure, the SPCI appeared to be highly correlated to the variable ln(density) (conditional F(1,9) = 56.7, P < 0.0001). Selection of the random part of the model having SPCI: μ + α.ln(density) as the fixed part. The selected model, with the lowest AIC, is in italics. The selection of a model with a residual variance proportional to ln(density)2δ indicates heteroscedasticity; df = degrees of freedom, or number of independent parameters in the model. The kth observation of SPCI for area i and year j therefore is modelled as: Detection of changes in rabbit density with the SPC To evaluate the capacity of SPC measures to detect local changes in rabbit abundance over time, between 1994–1995 and 1995–1996, and with the help of a Mann-Whitney U-test, on each area we compared the trend in estimated density, which showed non-overlapping confidence intervals to the trend in the SPCI, which was determined to be significant (Table 4). In four cases out of 10, both density and SPCI were estimated to have changed significantly in the same direction. In two cases, none changed significantly. In two other cases, the density changed, but the SPCI did not. In the last two cases, the SPCI changed, but the density did not. In no case did the density significantly change in one direction and the SPCI in the opposite direction. Changes in the rabbit population in each area during the three sampled years (1994–1996) as measured by the CMR density estimate or by the SPC index. Significant increases (↗) or decreases (↘) are indicated; = indicates no significant difference, but a clear tendency when followed by an arrow in parentheses. The aim of our study was to test an abundance index against CMR, considered to be a reference method, in five different areas. The first point of discussion concerns the validity of the results given by the CMR. The goodness-of-fit tests demonstrated that the underlying assumptions of the Jolly-Seber models were generally met. Two basic assumptions were made in our work. The first one was that the average number of sightings of a rabbit during the three recapture sessions in a primary sampling period was identical for marked and unmarked animals. It is an underlying assumption of CMR models that capture and marking should not affect recapture probability. Generally, trap response (trap-happiness or trap-shyness) is a major source of unequal catchability. To minimise this, we used different techniques for capture and recapture, as recommended by Seber (1982). Therefore, the trap-dependence detected in La Chevallerais does not seem biologically sound and the significance of TEST 2 is probably due to the small sample size. The second assumption is that the probability of detecting a rabbit was the same for marked and unmarked animals, whereas marked rabbits obviously seem to be more detectable. However, resightings were made by walking through the study areas to stimulate movement of the animals. Therefore, we assumed that marked and unmarked rabbits had an equal probability of being resighted according to the immediate detectability of a moving animal. For these reasons, the density estimates were considered to be accurate. As expected, the estimated densities varied over a large range which is representative of most European populations of rabbits. Moreover, we recorded temporal variations in the estimated numbers of rabbits at several sites during the study. In Donzère, the decrease observed in 1995 was due to a severe outbreak of myxomatosis. The La Chevallerais area was managed by hunters, and most rabbits lived in artificial warrens. A lack of maintenance of these warrens was responsible for a decrease in habitat quality and therefore for the decline of the population. Conversely, the increase in Cerizay was due to efficient hunting management rules. A severe outbreak of rabbit viral haemorrhagic disease (RHD) was responsible for the major decrease in population size at the Chèvreloup arboretum in 1995. Mortality rates were estimated by an enumeration method which showed that up to 88% of the adults and 99% of the juveniles died during 1995 (Marchandeau et al. 1998Marchandeau et al. 2000). One may notice that, for this particular area, the decrease in population size, estimated by both SPC and CMR, agrees with the mortality rates recorded during the same period. The non-linear relationship between SPCI and density shows that the index is not proportional to density. The underestimation given by SPC increases with density, showing a decrease in the sensitivity of the method to high densities. This density-dependent pattern was described as “the index may reach a ‘saturation point’, beyond which it is little influenced by additional increments in population size” (Conroy 1996). A similar saturation effect had already been noticed in rabbit spotlight counting (Fletcher et al. 1999). When density is low, the observer would be more attentive to detect the few rabbits present and, inversely, when density is high, not all the rabbits can be detected (Robinson & Wheeler 1983). Moreover, at high density, a group-size effect could be responsible for an increase in vigilance behaviour inducing a lower detectability of the rabbits (Roberts 1988, Lima 1995). Furthermore, in two cases the method suffers from a lack of sensitivity as it did not detect an actual change in population size. This may be due to a lack of power of the Mann-Whitney U-test with very small samples. Most attempts to validate abundance indices are based on the correlation of the index with density, and/or on the precision of the index (Parer 1982, Wood 1988, Moller et al. 1996). According to these criteria, one could consider the SPC to be a reliable method to estimate rabbit population size. However, a more thorough study of the characteristics of this index shows that it is highly dependent on area and year. The significance of the area effect shows that the SPC is unsuitable to compare results obtained in different areas. This effect can be easily explained by variations in rabbit detectability as a function of landscape characteristics and observers (Thompson et al. 1998, Anderson 2001). Such results were already recorded for spotlight counts and prevent these abundance indices from being used for comparisons between areas (McCullough 1982, Ralls & Eberhardt 1997). The year effect is more problematic. It means that, in the same area, inter-annual changes in the index cannot be compared. This effect may also be related to variations in rabbit detectability (Thompson et al. 1998, Anderson 2001). Since the counts in each area were made by the same observer every year, one may assume that the observer effect probably did not affect the index value, but this effect could be important in surveys carried out by several observers. Among the environmental effects (Anderson 2001), meteorological conditions and also vegetation characteristics may have changed between years. The changes in vegetation characteristics could be related to changes in crop-rotations and/or to changes in vegetation height or density. One may observe that the two cases of index change in a stable population were recorded in the areas where the landscape changed between years, i.e. La Chevallerais and Aubas, due to changes in the crops. Finally, rabbit behaviour may also affect the detectability of the animals. For most species, the event of counting one animal only depends upon its presence inside the range of the spotlight and its sightability. For the rabbit, which spends part of its time in warrens, another condition is required since it has to be above ground at the time of the count. The proportion of rabbits that are above ground is highly variable and may be affected by environmental factors such as weather conditions and lunar phases (Rowley 1957, Mykytowycz & Rowley 1958). As our protocol aimed at comparing the index to an estimated density, we had to make the counts during a short period of time, i.e. for three consecutive nights or in the same week, to ensure that the number of live rabbits did not vary between repetitions of the counts. Therefore, in each area, these counts were often made under similar weather conditions and during similar lunar phases, reinforcing the possible effect of these factors. However, without this constraint imposed by our protocol, in the case of a survey for which such an index is used, this possible effect should be taken into account by a randomisation of the dates of these counts over a longer period. In conclusion, one must keep in mind that the precision of the SPCIs is good and strongly correlated to actual density but is not a reliable method for monitoring population trends. This result confirms the necessity to validate the relationship between abundance indices and population density. Unless this validation is made, one must be careful when using abundance indices to monitor populations. Most attempts to study abundance indices are based on simple measures of precision that are necessary but not sufficient to assess the reliability of these indices. The underlying assumption of the use of an index is that changes in the index must be proportional in space and/or over time (Thompson et al. 1998). An area effect on the index leads to restriction of its use to a comparison of the temporal changes in population size in a defined area, but does not enable one to compare data collected in different areas. Such an index is reliable for monitoring most harvested populations for which inter-site comparisons are not of major interest. A year effect, as detected in our study, is more problematic since it does not enable one to use the index to monitor the changes over time in a given population. Other effects, such as observer effect or effects of lunar phases or weather conditions, may also affect the index. All these possible effects should be studied to standardise the conditions under which the indices should be applied to make sure that they will accurately reflect any changes in population size. We thank N.J. Aebischer, B. Cooke, J-M. Gaillard, J. Letty and E. Marboutin, for their helpful comments on a previous draft of the manuscript and the hunters who participated in capturing rabbits. We are grateful to E. Taran who improved our English and M-S. Landry who helped us in our bibliographic research. The manuscript was also improved by the comments of two anonymous referees.
<urn:uuid:b9777502-e02b-4f9d-9a55-5f2221accb5d>
CC-MAIN-2020-05
https://bioone.org/journals/wildlife-biology/volume-12/issue-1/0909-6396(2006)12%5B19:AIRTIC%5D2.0.CO;2/Abundance-indices--reliability-testing-is-crucial---a/10.2981/0909-6396(2006)12%5B19:AIRTIC%5D2.0.CO;2.full
s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579251672440.80/warc/CC-MAIN-20200125101544-20200125130544-00520.warc.gz
en
0.956308
6,279
2.78125
3
By: Theodore Prudon With the gradual and general acceptance, in the US and abroad, that modern heritage like any other heritage is to be preserved, has come the realization that proper professional expertise is needed and to how to best prepare them for that task. Putting definitional or nomenclature issues aside – such as whether we call it preservation or conservation or whether we use modern versus recent past or mid-century – the question of whether the academic curriculum is the same or different and, if not the same as traditional preservation education as existing today, how does it differ. While the scale and ubiquity of modern heritage is often presented as a challenge, it is fundamentally a management challenge and does not require any substantial educational changes. Establishing significance and the related methodologies remain largely unaltered, although scholarship and knowledge that serves as a base will continue to expand as it does for any period. Photo (left): Pratt historic preservation students receive a demonstration from a stone carver The real challenge is in the nature of the buildings and their architecture. This is not surprising. An architectural style that saw itself as breaking with the past cannot be expected to be saved through established preservation practices where much of the focus has been on its pure materiality in its appreciation and conservation practices. One of the main difficulties that come up is the experimental nature of the materials and assemblies. While often used as an excuse for negative interventions or no interventions at all, the experimentation and its materials are part of a much larger conceptual issue: modern building is fundamentally systemic as such its preservation must therefore reflect that and also be systemic. Simply put, historic buildings before the arrival of modern architecture were built one stone or brick at the time. By placing one brick on top of the other, the building emerged. The building was a very simple system with a limited number of defining technical components. As a result of this construction its restoration, conceptually speaking, can follow a similar process and individual units can be replaced one brick at the time. For more contemporary buildings failures are systemic – pretty much repeated on all units – plus it is not only the individual components but also the complexity of their integration and performance as a system in all its aspects. The implication is that the approach and the intervention need to be more holistic. Staying with simple comparisons the curtain wall is probably a good example in point of a wall system. Photo (right): This 2009 image shows a conventional 1920s brick façade on a steel frame being covered with a more contemporary glass and metal curtain wall and in the foreground is a building with a rainscreen wallsystem. While the brick elevation is still a hybrid and not yet much more than a loadbearing masonry building inserted into a steel frame, all three elevation systems, if to be considered for conservation, will require a different knowledge system and will force, each in their own right, a systemic approach. If the assumption about the systemic nature of modern building is accepted it has two immediate consequences for preservation. Philosophically it introduces the authenticity question that has been in so much discussion in the last two decades but more importantly from a scientific and scholarly viewpoint it places a different demand on the preservationist or conservator. The evaluation of the building more than ever is about the system and its performance and to a lesser extent about the capabilities of the individual materials. To put it into language it will be more about building physics and to a lesser extent about pure material sciences. If the outcome of that intervention is complete replacement, the design of the new system both aesthetically and physically will become the challenge. Photo (left): Philip Johnson's Glass House, Credit: Liz Waytkus To return to the scale and ubiquity challenge, this issue more than ever before will force us to be creative. The economic obsolescence as a result of the out-of-date specificity of programmatic requirements forces us to a re-purposing of buildings. The 1960s and the 1970s gave us the term ‘adaptive use’ suggesting finding a new use for a building that is appropriate to that building typology. While that was easy for say adapting a 18th Century textile mill in the northeast to housing or turning a small scale 19th Century building into a restaurant, for the complexity, scale and quantity of buildings we are faced with, it is no longer that simple. Interventions become more architectural and the skill and sensitivity of the designer is more critical. This introduces the challenge to architectural design training as an essential element to preservation of modern heritage and places design central to preservation. Placing design at the center to the preservation of modern building, a new element has begun to emerge: a phenomena that can be best characterized as over-restoration. In other words modernism restored more modern than it ever was and closer to minimalism than modernism. While in some instances that solution will be argued as ‘if the original designer had been alive he/she would have done or used that’, it does present an inauthenticity that is visual and not just material. Examples of out-modernizing the moderns can be found across the world. Photo (right): Manufacturers Hanover Trust now Joe Fresh in NYC, Credit: Liz Waytkus The final challenge is how to address the sustainability issue. While the embodied energy argument is often rolled out, the continuing increase in scale and size, particularly in the increase of density, places preservation in a position it has never been in before, not even in the 1970s when the sustainability issue first arose as ‘energy conservation’ after the first oil crisis. Maximizing sites and heights combined with operational calculations has created material and technical challenges, especially for more recent buildings (and the curtain wall being the poster child of that discussion) for which most preservationists, if not all, are utterly unprepared. Some of the arguments advocating the midtown zoning proposals in New York City are a good case in point. Increasing density and size as much as 40 or so percent results in favorable calculations that are more about density than sustainability. Again to some extent this challenge is captured by the systemic argument proposed above. It would seem from this short analysis that to address the above challenges appropriately, teaching preservation for modern architecture needs to change. The debate thus far has been largely theoretical and primarily based on how to address the material authenticity issue and reconcile the 19th Century Arts and Crafts principles with the demands of modern technology and design. This dialogue needs to move on and begin to address the systemic nature of the architecture of the post war period and how it impacts the actual process of saving/adapting buildings. For education it means essentially two singular challenges and which differentiates the teaching of the preservation of modern architecture beyond traditional approaches. A more cohesive systemic thinking and teaching is necessary that looks at the building as a whole including its aesthetic, functional and physical systems. It places design and building physics central to preservation education next to the determination of significance. Its implication is clear. It means that architects and other design and building professionals need to take a more active role in the process of saving buildings not as a testament of their own creative genius but as sensitive and considerate caretakers. Maybe that is the real challenge.
<urn:uuid:e4fb885d-f8d8-41e0-9bba-9bc9fbdd142c>
CC-MAIN-2019-18
http://docomomo-us.org/news/the-complexities-of-teaching-the-preservation-of-modern-architecture
s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578760477.95/warc/CC-MAIN-20190426053538-20190426075538-00099.warc.gz
en
0.959047
1,465
3.046875
3
From the Desk of Ann Kummer Did you know that, unlike most other countries, the United States does not have an official language? It’s true. Although the most commonly spoken language in the United States is English, our country is quite multi-lingual and as such, many of our citizens are bilingual. Spanish is the second most commonly spoken language and one of the fastest growing languages in this country, with over 40.5 million speakers (www.boostlingo.com). However, there are over 350 other languages spoken in the United States, according to the United States Census Bureau. Because we are a multi-lingual country, many children in this country are growing up in bilingual households or they speak one language at home and another language (e.g., English) at school. Bilingual children can present particular challenges for speech-language pathologists (SLPs). It is important for SLPs to understand typical language development of bilingual children and how to determine when there is a language disorder. It is also important to use effective treatment strategies when working with bilingual children who have language disorders. Because bilingualism has become more common in this country over the years and this presents such a challenge for SLPs, I’m particularly delighted to introduce Kelly Jackson, and expert on this topic, to you. Kelly Jackson received her Bachelor of Arts in Communicative Disorders and Spanish and her Master of Science in Speech-Language Pathology from the University of Alabama. She began her career as a speech-language pathologist working in a skilled nursing facility and has experience working in many different settings including hospitals, skilled nursing facilities, and public schools. Kelly has worked with patients ranging from early childhood to geriatric with various speech, language, and swallowing disorders. She speaks Spanish and has had experience in conducting speech therapy and evaluations in Spanish in various settings. She is currently completing an advanced certificate in bilingual speech-language pathology. In her current position, Kelly teaches in the undergraduate and graduate speech-language pathology programs at Samford University in Birmingham, Alabama, and serves as the clinical lab coordinator. In this course, Kelly Jackson will provide an overview of bilingual service delivery with pediatric clients, including bilingual speech and language development, evaluation, treatment, and the use of interpreters. Speech-language pathologists will learn practical information regarding bilingual service delivery to better serve their diverse caseloads in schools and other clinical practice settings. Now…read on, learn, and enjoy! Ann W. Kummer, PhD, CCC-SLP, FASHA, 2017 ASHA Honors Browse the complete collection of 20Q with Ann Kummer CEU articles at www.speechpathology.com/20Q 20Q: Bilingual Service Delivery: Where Do I Start? After this course, readers will be able to: - Describe basic elements of bilingual language development. - Identify best practices in the evaluation of bilingual clients suspected of speech or language disorders. - Identify best practices in the treatment of bilingual clients exhibiting speech or language disorders. 1. What do the terms “bilingual,” “dual language learner,” and “English language learner” mean? Depending on your practice setting, clients who are exposed to or speak more than one language may be identified using different terms. ASHA defines bilingualism as, “the ability to communicate in more than one language” (ASHA, n.d.) which would make a bilingual person someone who can communicate in more than one language. The term dual language learner can be defined as, “children who have been learning two languages simultaneously from infancy or who are in the process of learning a second language after the first language has developed”. (Paradis, Genesee, Crago, 2011, p.3) The next term, “English language learner” is often used with pediatric clients in the educational system. “English language learners” can be defined as, “language minority students in the United States who are learning English, the majority language, for social integration and educational purposes.” (Paradis, Genesee, Crago, 2011, p. 265). It is important to know that these terms are often interchangeably used to describe children who speak more than one language. There are a few important points about the use of these terms that need to be noted. While they are used interchangeably, they do not necessarily mean the exact same thing. For example, a student can be bilingual and not be an English language learner; they may speak two languages that are not English and may not be learning English. A student may be an English language learner and may be trilingual or multilingual instead of bilingual. A dual language learner may be learning French and Spanish instead of their native language and English. It is important to look further into the language situation of each client beyond what the terms described above can tell you. 2. How does a child develop more than one language? Bilingual language development is typically classified into two major categories: simultaneous bilingualism or sequential bilingualism. Simultaneous bilingualism is defined as a child being, “exposed to both languages in their first few months of life.” (Goldstein, 2012, p. 7). Simultaneous bilinguals are generally exposed to both languages in more or less equal amounts. An example would be a family where one parent speaks Spanish exclusively to the child and the other parent speaks exclusively English to the child with the family living in an environment or community that utilizes both languages. The child receives input in both languages consistently early on. Sequential bilingualism is defined as children who are, “first exposed to one language and then to the second one with significant variation existing in respect to the timing and conditions under which the second language is introduced.” (Goldstein, 2012, p. 7). Sequential bilingual children have developed their first language and then begin learning a second language. An example would be a child from Germany, who speaks only German, whose family moves to the U.S., and he begins to learn English through a program at his English-speaking school. Generally, research has come to the consensus that the “cut-off” age for differentiating a simultaneous bilingual from a sequential bilingual is three years of age. A child learning a second language prior to three years of age would be considered a simultaneous bilingual and a child learning a second language after three years of age would be considered a sequential bilingual. (Paradis, Genesee, Crago, 2011). Why does this matter to you as a speech-language pathologist? Whether a child is a simultaneous or sequential bilingual plays a part in what you should expect from the child. A child who is simultaneous bilingual may demonstrate more equal development of both languages where a child who is a sequential bilingual may demonstrate, at least initially, strength in their native language. It is vital to investigate the sequence of language acquisition of bilingual children prior to evaluating their speech or language skills to determine if a speech or language disorder is present. 3. What is the silent or nonverbal period? Knowledge of characteristics of bilingual language development can aid in determining the presence of a speech or language disorder in children who are bilingual. The silent or nonverbal period can be defined as occurring in the early stages of second language acquisition and is the time when “an individual focuses on listening and comprehension of the new language.” (ASHA, n.d.). During the silent period, children may stop speaking in both languages or speak very little. Children may use gestures to communicate with others during this time. During this time, children are studying the language they are exposed to and typically develop stronger comprehension of the second language. The silent or nonverbal period can continue for a few weeks or a few months depending on the age of the child (Paradis, Genesee, Crago, 2011). It is important to be aware of the potential for a second language learner to have a silent or nonverbal period so as to not confuse this as a language delay or disorder. 4.. What is code-mixing? Code-mixing is “the use of elements from two languages in the same utterance or in the same stretch of conversation” and includes, “the use of phonological, lexical, morphosyntactic, or pragmatic patterns” (Paradis, Genesee, Crago, 2011, p.88-89). When code-mixing, bilingual children will utilize pieces of both of their languages while speaking. For example, a child may say, “I want to go to la tienda (the store).” They have used English for the majority of the sentence and added the Spanish “la tienda” (the store) to fill in vocabulary they may not have known in English. Code-mixing is considered a typical characteristic of bilingual language development and does not indicate the presence of a speech or language disorder. Much variation exists in the frequency of code-mixing and the specific types of code-mixing that children demonstrate but code-mixing is demonstrated by almost all bilingual children at some point. (Paradis, Genesee, Crago, 2011). 5. What is language attrition? Language attrition is defined as first language loss gradually over time as children begin to utilize their second language more. (Paradis, Genesee, Crago, 2011). Language attrition occurs for several different reasons including decreased use of the first language in the home secondary to the desire to assimilate into the new environment, fewer educational opportunities in the first language, and age of acquisition of the second language. 6. What are the speech characteristics of bilingual children? Bilingual children make demonstrate differences in phonological development and production of English phonemes. The production of English phonemes may be influenced by the child’s first language. Children may make errors in English secondary to the lack of an English phoneme in their first language. For example, a child whose first language is Spanish may say “fich” instead of “fish” because the “sh” sound is not present in Spanish. Children may acquire these sounds over time but speech sound errors that are influenced by a child’s first language would not indicate a speech sound disorder. It is important to be knowledgeable of the phonology of a child’s first language when providing evaluations or treatment to determine the presence of a speech sound disorder. 7. Can you evaluate a bilingual/dual language learner child for a speech or language disorder? Yes! In my experience, I have frequently seen SLPs and educators wait to evaluate children until after they have been in school and have been learning English for a specific amount of time. Is this best practice? No. A child with a speech or language disorder will present with the disorder in both languages (ASHA, n.d.). When appropriate assessment procedures are used, a bilingual child who is still in the process of learning one or both of their languages can be evaluated. It is common knowledge for SLPs that early intervention in speech or language disorders leads to better outcomes (ASHA, n.d. 2) and this should be applied to all children, including those who are bilingual or dual language learners (ASHA, n.d. 2). 8. Can you evaluate a bilingual child if you do not speak the same language(s) as they do? Yes! The ASHA document, “Knowledge and Skills Needed by Speech-Language Pathologists and Audiologist to Provide Culturally and Linguistically Appropriate Services” identifies the following as skills needed by a clinician that does not have language proficiency in the language of the client or patient: knowledge and skill in “obtaining information on the features and developmental characteristics of the language(s)/dialect(s) spoken or signed by the client/patient; obtaining information of sociolinguistic features of the client’s/patient’s significant cultural and linguistic influences; and developing appropriate collaborative relationships with translators/interpreters (professional or from the community)” (ASHA, 2004). More information about interpreters will be provided in a later question. 9. How does the evaluation of bilingual children suspected of speech or language disorders begin? It is important to begin the evaluation of children suspected of speech or language disorders by looking at the cultural background and language history/background. Information about their exposure to both languages, whether or not they were a simultaneous or sequential bilingual, their current language environment and input, as well their cultural values, beliefs, and practices can help guide you in determining the best methods of evaluation. (Paradis, Genesee, Crago, 2011). Information can be gathered through a thorough interview with the parent or caregiver, as well as with the client depending on their age. 10. In what language should assessments be provided? A bilingual child with a suspected speech or language disorder should be assessed in both of their languages in order to accurately determine if a disorder is present (Paradis, Genesee, Crago, 2011). As stated earlier, a child with a speech or language disorder will present with a disorder in both of their languages, so it is important to assess them in both of their languages. 11. How do you choose an appropriate assessment? Choosing an appropriate assessment for an evaluation may be a bit challenging depending on what languages the child speaks. If the child speaks a language that is common in the U.S. such as Spanish, you may have the ability to choose a standardized assessment to use with that child that reflects the unique aspects of bilingual English/Spanish development. However, there are not many assessments that are designed for and standardized with bilingual populations. An important factor when looking at standardized assessments for children from diverse language backgrounds is to examine the normative population the assessment used for standardization. If the normative population is not representative of your client’s language background, then it is not appropriate to use it to gather standardized test scores (ASHA, n.d.). You can, however, still use these assessments informally to gather data regarding your client’s skills in different areas of speech or language. If standardized assessments are not an option for the particular client that you need to evaluate, because they speak an uncommon language or dialect in the U.S., what do you do next? Alternative assessment methods include dynamic assessment and the use of informal assessment measures. 12. What is dynamic assessment? Dynamic assessment is “a variety of assessment procedures that depart from the traditional procedure of giving a standardized test once as a basis for diagnosis” (Paradis, Genesee, Crago, 2011. P. 222). Through dynamic assessment, the client is administered the assessment, it is scored, and then the client participates in “mediated learning experiences” (Paradis, Genesee, Crago 2011, p.222) where they are taught strategies for participating in the assessment. The thought is that often children score poorly on assessments not due to speech or language impairment but due to cultural or linguistic barriers. Research has shown that children without language impairment improve their scores following mediated learning experiences more than children with language impairment (Paradis, Genesee, Crago, 2011). 13. What informal assessment measures can be used with bilingual clients? Language sampling can provide clinicians valuable information about a client’s overall language skills without the potential barriers a standardized assessment may have. It is important to examine the best methods of language sampling for a client based on their cultural and linguistic backgrounds. This may include utilizing different communication partners (clinician, peer, adult, etc.) or settings (inside a classroom versus outside on a playground). A clinician utilizing language sampling needs to be familiar with the characteristics of the client’s languages and have the ability, either themselves or through an interpreter, to conduct a thorough analysis of the language sample. Collecting additional informal assessments of a client’s speech and language abilities may provide valuable information to clinicians. Informal screeners that are created based on specific populations of students within your caseload or that are found in journals may provide a method of determining strengths and weakness of a client. A phonemic inventory can be gathered in their first language and English. It is important to remember that, as with monolingual clients, no one assessment measure should be used in isolation to determine the presence of a speech or language disorder. 14. Can an English assessment be translated to the language needed to evaluate a client? The quick answer to this is, no. There are many factors involved in creating and standardizing assessment protocols. Direct translations often do not capture the unique speech and language skills targeted by the assessment appropriately and can continue to lack cultural sensitivity. Additionally, translations of assessments cannot be used to gather standardized data on the client’s performance. For example, a comprehensive expressive and receptive language assessment. A direct translation would look at specific aspects of morphology and syntax that may not even be present in the client’s first language. Things like plural ‘s’ and irregular past tense verbs may not directly translate (Paradis, Genesee, Crago, 2011). Assessments designed for monolingual English-speaking children are exactly that, designed with the language and culture of monolingual children at the forefront. Use of assessments that have been directly translated by a clinician or an interpreter may not truly assess speech and language skills and may inadvertently overidentify bilingual children as exhibiting a speech or language disorder. 15. Once a bilingual child has been identified as exhibiting a speech or language disorder, what language should be used in treatment? Intervention should be provided in both languages that the child speaks. In general, children who are bilingual are utilizing both languages in some way in the communication environments. Because of this, it is important that we work towards improving their communication skills overall, not just in one language. Research shows that being bilingual or learning two languages does not negatively impact language development or increase language impairment. As noted above, children are likely to use their first language to communicate with others in their community or home environments. Restricting their intervention to one language may cause strain on their emotional well-being. It could prevent them from communicating with their loved ones and within their community. By conducting treatment in both languages, we support their continued interaction with others around them. Shifting from using two languages to using one language can result in the child losing the ability to rely on the other language to help them when they are lacking in one of the languages preventing code-mixing. There are two major approaches to language treatment with children who are bilingual: the bilingual approach and the cross-linguistic approach. 16. What is a bilingual approach to speech and language treatment? The bilingual approach to intervention focuses on, “constructs common to both languages or errors or error patterns exhibited with relatively equal frequency in both languages” (ASHA, n.d.) In the bilingual approach, the clinician will choose targets that are present in both languages such as overlapping grammar patterns. (Paradis, Genesee, Crago, 2011). In this approach, there is less focus on which language the intervention is provided in and more focus on the shared characteristics that can be targeted. 17. What is the cross-linguistic approach to speech-language treatment with bilingual clients? The cross-linguistic approach, “focuses on separate training in the phonological, lexical, and grammatical features that are unique to each language.” (Paradis, Genesee, Crago, 2011, p, 224). In this approach, targets that are specific to each language are selected for treatment in that language. This approach addresses the fact that there are differences in the structure of each language. This approach may be used in conjunction with the bilingual approach. (ASHA, n.d.) 18. Can a monolingual SLP provide speech or language treatment to a bilingual client? Yes, with support. A monolingual SLP can provide services to bilingual clients in both of their languages with the use of a collaborative team. This team may include bilingual paraprofessionals, parents, and peers. Through this approach, a monolingual SLP can train those involved to provide treatment in the appropriate language. It is important to point out that significant training is involved when utilizing paraprofessionals and parents to provide intervention. The SLP must provide specific direct training on the treatment techniques and methods to be used and ensure the understanding of the parent or paraprofessional who is providing the intervention. This may also require the use of an interpreter or translator if the parent does not speak the same language as the SLP. Research on parent provided intervention in monolingual children has been shown to be effective and it is thought that this is true in the bilingual population. The use of peers for intervention has also been explored in monolingual children and has been found to be effective (Kohnert, et al, 2005). 19. How do you best utilize a translator/interpreter in speech-language evaluation and treatment? ASHA defines an interpreter as, “a person trained to convey spoken or signed communications from one language to another ” (ASHA, n.d.2) and a translator as, “a person trained to translate written text from one language to another.” (ASHA, n.d.2) In the ASHA, 2004 Knowledge and Skills document, they identified knowledge and skills necessary for a monolingual SLP to utilize an interpreter to be the ability to, “maintain appropriate relationships among the clinician, the client/patient, and interpreter/translator; ensure that the interpreter/translator has knowledge and skills in the following areas: native proficiency in the client’s/patient’s language(s)/dialect(s) and the ability to provide accurate interpretations/translations; familiarity with and positive regard for the client’s/patient’s particular culture, and speech community or communicative environment; interview techniques, including ethnographic interviewing; professional ethics and client/patient confidentiality’ professional terminology; basic principles of assessment and/or intervention principles to provide context to understand objectives.” (ASHA, 2004). What does this mean for you as a SLP? You are responsible for making sure that the interpreter that you or your employer provides is appropriately trained to serve as an interpreter. It is important to meet with the interpreter prior to having them work with you and your client in order to ensure they meet all of the characteristics above as well as to provide them with specific information regarding their role in your evaluation or treatment session. 20. Can family members or friends serve as an interpreter for my client? Often times, a family member who speaks English will accompany the client to an evaluation or treatment session and they may offer to serve as an interpreter for you. There are potential hazards to utilizing a family member or friend as an interpreter. Family members may compromise the reliability of their interpretation secondary to limited training and potential conflict of interest. The age of the family member or friend also may impact their ability to translate and the appropriateness of them serving as an interpreter. For example, a family that brings one of their older children to interpret for them at a meeting to discuss the speech and language evaluation results of one of their younger children. The information discussed in this meeting may be sensitive and may be emotionally distressing for the older child serving as an interpreter. Best practice would be to utilize a professional interpreter in situations where there is an interpreter in the necessary language and to only utilize family members or friends in situations of client preference or when all avenues of finding an appropriate interpreter have been exhausted (ASHA, n.d.2). American Speech-Language-Hearing Association (n.d.) Bilingual Service Delivery. (Practice Portal). Retrieved May 27th, 2020, from https://www.asha.org/PRPSpecificTopic.aspx?folderid=8589935225§ion=Overview American Speech-Language-Hearing Association (n.d.) Collaborating with Interpreters. (Practice Portal). Retrieved May 27th, 2020, from https://www.asha.org/PRPSpecificTopic.aspx?folderid=8589935334§ion=Overview American Speech-Language-Hearing Association (n.d.) Early Intervention. (Practice Portal). Retrieved May 27th, 2020, from https://www.asha.org/PRPSpecificTopic.aspx?folderid=8589943999§ion=Key_Issues American Speech-Language-Hearing Association. (2004). Knowledge and skills needed by speech-language pathologists and audiologists to provide culturally and linguistically appropriate services [Knowledge and Skills]. Available from www.asha.org/policy. doi:10.1044/policy.KS2004-00215 Guiberson, M (2013). Bilingual Myth-Busters Series Language Confusion in Bilingual Children. Perspectives on Communication Disorders and Sciences in Culturally and Linguistically Diverse (CLD) Populations, 20(1), 5–14. doi: 10.1044/cds20.1.5 Goldstein, BA (2012). Bilingual language development & disorders in Spanish-English speakers(2nd ed.). Baltimore, MD: Paul H. Brookes Pub. Kohnert, K, Yim, D, Nett, K, Kan, P F, & Duran, L (2005). Intervention With Linguistically Diverse Preschool Children. Language, Speech, and Hearing Services in Schools, 36(3), 251–263. doi: 10.1044/0161-1461(2005/025) Paradis, J, Genesee, F, Crago, M (2011). Dual language development and disorders: a handbook on bilingualism and second language learning(2nd ed.). Baltimore: Paul H. Brookes Publishing. Jackson, K. (2020). 20Q: Bilingual Service Delivery: Where Do I Start? SpeechPathology.com, Article 20376. Retrieved from www.speechpathology.com
<urn:uuid:371bb97c-3f2b-4166-8846-189ef9d8addb>
CC-MAIN-2022-49
https://www.speechpathology.com/articles/bilingual-service-delivery-where-do-20376
s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446710801.42/warc/CC-MAIN-20221201053355-20221201083355-00307.warc.gz
en
0.932232
5,483
3.015625
3
Many studies earlier showed that in the first few months after their Covid-19 hospital stay, patients face a high risk of ongoing health problems, trips back to the hospital, and even death, but now the researchers have found that the first week and a half maybe especially dangerous. Covid-19 patients had a 40 per cent to 60 per cent higher risk of ending up back in the hospital or dying in the first 10 days, compared with similar patients treated at the same hospitals during the same months for heart failure or pneumonia. By the end of 60 days, the Covid-19 patients’ overall risk of readmission or death was lower than that for the other two serious conditions, the findings, published in the journal JAMA, reported. Even so, in the first two months, nine per cent of the Covid-19 patients, who survived hospitalization had died, and almost 20 per cent had suffered a setback that sent them back to the hospital. That’s on top of the 18.5 per cent who had died during their hospitalization. “By comparing Covid-19 patients’ long-term outcomes with those of other seriously ill patients, we see a pattern of even greater-than-usual risk right in the first one to two weeks, which can be a risky period for anyone,” said the study author from the University of Michigan in the US. The most common reasons listed for rehospitalization were Covid-19, cited in 30 per cent of patients, and sepsis seen in 8.5 per cent. More than 22 per cent of the readmitted veterans went to the intensive care unit. “Unfortunately, this is yet more evidence that Covid-19 is not ‘one and done.’ For many patients, Covid-19 seems to set off cascades of problems that are every bit as serious as those we see in other diseases,” the team wrote. The research team hopes to continue to study new data from Veterans Affairs (VA) and non-VA hospitals as it becomes available and to compare Covid-19 post-hospital outcomes with those for other serious conditions. “Comparisons with patients hospitalized for influenza and other viral illnesses would be important to study, given the widespread false claims that Covid-19 is just a minor illness,” they noted.
<urn:uuid:fcd33577-4b83-4fec-bca2-8d3ee0d70c25>
CC-MAIN-2021-21
https://www.wefornews.com/1st-week-crucial-for-covid-patients-after-leaving-hospital-study/
s3://commoncrawl/crawl-data/CC-MAIN-2021-21/segments/1620243989820.78/warc/CC-MAIN-20210518033148-20210518063148-00283.warc.gz
en
0.971776
489
2.59375
3
Stainless Steel Plate Most Widely Used Austenitic Stainless Steel, a Versatile Corrosion Resistant Alloy for General Purpose Applications. Available thicknesses for Alloy 304/304L: |1 1/4"||1 3/8"||1 1/2"||1 5/8"||1 3/4"||2"||2 1/4"||2 1/2"||2 3/4"||3"||3 1/4"||3 1/2"| |3 3/4"||4"||4 1/4"||4 1/2"||4 3/4"||5"||5 1/4"||5 1/2"||5 3/4"||6"| Alloy 304/304L (UNS S30400/S30403) is the most widely utilized “18-8” chromium-nickel austenitic stainless steel. It is an economical and versatile corrosion resistant alloy suitable for a wide range of general purpose applications. It is common practice for 304L to be dual certified as 304 and 304L. The low carbon chemistry of 304L combined with an addition of nitrogen enables 304L to meet the mechanical properties of 304. Alloy 304/304L resists atmospheric corrosion, as well as, moderately oxidizing and reducing environments. The alloy has excellent resistance to intergranular corrosion in the as-welded condition. Alloy 304/304L has excellent strength and toughness at cryogenic temperatures. Alloy 304/304L is non-magnetic in the annealed condition, but can become slightly magnetic as a result of cold working or welding. It can be easily welded and processed by standard shop fabrication practices. - Chemical and Petrochemical - Processing—pressure vessels, tanks, heat exchangers, piping systems, flanges, fittings, valves and pumps - Food and Beverage Processing - Petroleum Refining - Pharmaceutical Processing - Power Generation—nuclear - Pulp and Paper Alloy 304/304L has good resistance to atmospheric corrosion, foods and beverages and to many organic and inorganic chemicals in moderately oxidizing to moderately reducing environments. The high chromium content of the alloy provides resistance to oxidizing solutions such as nitric acid up to 55% weight and up to 176°F (80°C). Alloy 304/304L also resists moderately aggressive organic acids such as acetic. The nickel present in the alloy provides resistance to moderately reducing solutions such as pure phosphoric acid, whatever the concentration, in cold solutions and up to 10% diluted hot solutions. The alloy can also operate successfully in caustic solutions free of chlorides or Alloy 304/304L does not perform well in more highly reducing environments such as those containing chlorides and sulfuric acid. Alloy 304/304L performs well in fresh water service with low levels of chlorides (less than 100ppm). At higher chloride levels the grade is susceptible to crevice corrosion and pitting. For successful performance under these more severe conditions, higher molybdenum content is need such as 316/316L. Alloy 304/304L is not recommended for service in marine environments. In most instances, the corrosion resistance of Alloys 304, 304L and 304H will be roughly equal in most corrosive environments. However, in environments that are sufficiently corrosive to cause intergranular corrosion of welds and heat-affected zones Alloy 304L should be used because of its low carbon content.Lowest Temperature (°F) at Which the Corrosion Rate Exceeds 5mpy |0.2% Hydrochloric Acid||>Boiling||>Boiling||>Boiling||>Boiling| |1% Hydrochloric Acid||86p||86||185||>Boiling| |10% Sulfuric Acid||—||122||140||167| |60% Sulfuric Acid||—||<54||<59||<57| |96% Sulfuric Acid||—||113||77||86| |85% Phosphoric Acid||176||203||194||203| |10% Nitric Acid||>Boiling||>Boiling||>Boiling||>Boiling| |65% Niitric Acid||212||212||221||230| |80% Acetic Acid||212p||>Boiling||>Boiling||>Boiling| |50% Formic Acid||≤50||104||194||194| |50% Sodium Hydroxide||185||194||194||230| 83% Phosphoric Acid + |60% Nitric Acid + 2% Hydrocloric Acid |50% Acetic Acid + 50% Acetic Anhydride |1% Hydrochloric Acid + 0.3% Ferric Chloride |10% Sulfuric Acid + 2000ppm Cl- + N2 |10% Sulfuric Acid + 2000ppm Cl- + SO2 |WPA1, High Cl- Content||<<50||≤50||113||203| |WPA2, High F- Content||<<50||≤50||140||167| ps = pitting can occur ps = pitting/crevice corrosion can occur Weight % (all values are maximum unless a range is otherwise indicated) |Chromium||18.0 min.-20.0 max.||18.0 min.-20.0 max.| |Nickel||8.0 min.-10.5 max.||8.0 min.-12.0 max.| Specific Heat0.12 BTU/lb-°F (32 – 212°F) 500 J/kg-°K (0 – 100°C) Modulus of Elasticity29.0 x 106 psi Thermal Conductivity 212°F (100°C)9.4 BTU/hr/ft2/ft/°F Melting Range25050 – 2590°F 1398 – 1421°C Electrical Resistivity29.1 Microhm-in at 68°C 74 Microhm-cm at 20°C |°F||°C||in/in °F||cm/cm °C| |68-212||20-100||9.2 x 10-6||16.6 x 10-6| |68-932||20-500||10.6 x 10-6||18.2 x 10-6| |68-1600||20-870||11.0 x 10-6||19.8 x 10-6| |Typical*||Type 304||Type 304L| |0.2% Offset Yield Strength, ksi||42||30 min.||25 min.| |Ultimate Tensile Strength, ksi||87||75 min.||70 min.| |Elongation in 2 inches, %||58||40 min.||40 min.| |Reduction in Area, %||70||—||—| |Hardness, Rockwell B||82||92 max.||92 max.| Alloy 304/304L can be easily welded and processed by standard shop fabrication practices. Working temperatures of 1652–2102°F (750–1150°C) are recommended for most hot working processes. For maximum corrosion resistance, the material should be annealed at 1900°F (1038°C) minimum and water quenched or rapidly cooled by other means after hot working. The alloy is quite ductile and forms easily. Cold working operations will increase the strength and hardness of the alloy and might leave it slightly magnetic. Alloy 304/304L is subject to work hardening during deformation and is subject to chip breaking. The best machining results are achieved with slower speeds, heavier feeds, excellent lubrication, sharp tooling and powerful rigid equipment. |Turning||High Speed Steel||Cutting Oil||6||.23||0.5||.019||13-18||42.6-59| |Turning||High Speed Steel||Cutting Oil||3||.11||0.4||.016||20-25||65.6-82| |Turning||High Speed Steel||Cutting Oil||1||.04||0.2||.008||26-31||85.3-101.7| |Turning||Carbide||Dry or Cutting Oil||6||.23||0.5||.019||75-85||246-278.9| |Turning||Carbide||Dry or Cutting Oil||3||.11||0.4||.016||90-100||295.3-328.1| |Turning||Carbide||Dry or Cutting Oil||1||.04||0.2||.008||110-120||360.8-393.7| |Depth of cut-mm||Depth of cut-in||Feed-mm/t||Feed-in/t||Speed-m/min||Speed-ft/min| |Cutting||High Speed Steel||Cutting Oil||1.5||.06||0.03-0.05||.0012-.0020||18-23||59-75.5| |Cutting||High Speed Steel||Cutting Oil||3||.11||0.04-0.06||.0016-.0024||19-24||62.3-78.7| |Cutting||High Speed Steel||Cutting Oil||6||.23||0.05-0.07||.0020-.0027||20-25||65.6-82| |Drill ø mm||Drill ø in||Feed-mm/t||Feed-in/t||Speed-m/min||Speed-ft/min| |Drilling||High Speed Steel||Cutting Oil||1.5||.06||0.02-0.03||.0007-.0012||10-14||32.8-45.9| |Drilling||High Speed Steel||Cutting Oil||3||.11||0.05-0.06||.0020-.0024||12-16||39.3-52.5| |Drilling||High Speed Steel||Cutting Oil||6||.23||0.08-0.09||.0031-.0035||12-16||39.3-52.5| |Drilling||High Speed Steel||Cutting Oil||12||.48||0.09-0.10||.0035-.0039||12-16||39.3-52.5| |Milling Profiling||High Speed Steel||Cutting Oil||0.05-0.10||.002-.004||12-22||39.4-72.2| Alloy 304/304L can be readily welded by most standard processes. A post weld heat treatment is not necessary. NOTE: The information and data in this product data sheet are accurate to the best of our knowledge and belief, but are intended for informational purposes only, and may be revised at any time without notice. Applications suggested for the materials are described only to help readers make their own evaluations and decisions, and are neither guarantees nor to be construed as express or implied warranties of suitability for these or other applications.
<urn:uuid:6ea1a3e9-2d41-4cbd-b32f-83eb0b039d83>
CC-MAIN-2018-34
https://www.sandmeyersteel.com/304L.html
s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221219197.89/warc/CC-MAIN-20180821230258-20180822010258-00528.warc.gz
en
0.694641
2,458
2.796875
3
Declaration of Commitment in Respect to Christian Separation and Nonconformity to the World (Mennonite Church, 1955) Declaration of Commitment in Respect to Christian Separation and Nonconformity to the World (Mennonite Church, 1955) A Statement Adopted by Mennonite General Conference, August 26, 1955. - Christian Love - Attitude toward Possessions - Courtship and Marriage - Dress and External Appearance - The Clean Life - Worldly Organizations - Simplicity of Worship - Adopting Resolution - Context of this Statement IntroductionFrom its very inception in Switzerland (1525) and Holland (1533-34) the Mennonite Church has earnestly held to the principle of Christian separation and nonconformity to the world. The term world is here employed to designate that sphere in which Satan is obeyed, for he is recognized in Scripture as the head of a house or empire. That which conforms to Christ is His kingdom, while that which conforms to Satan is in Scripture spoken of as the world. This position of Christian nonconformity to the world is based upon the fact that God calls His children to a life of holiness, and to conformity to the character of Jesus Christ, delivering them "from this present evil world." In reference to those who do not know Christ, the divine summons is, "Come out from among them, and be ye separate, saith the Lord, and touch not the unclean thing; and I will receive you, and will be a Father unto you, and ye shall be my sons and daughters, saith the Lord Almighty." The Apostle John commands, "Love not the world, neither the things that are in the world. If my man love the world, the love of the Father is not in him." Peter writes, "But as he which hath called you is holy, so be ye holy in all manner of conversation [conduct]; because it is written, Be ye holy; for I am holy." And Paul commands, "Be not conformed to this world; but be ye transformed by the renewing of your mind, that ye may prove what is that good, and acceptable, and perfect, will of God." The inspired writers of the New Testament all recognize that God has called His saints "out of darkness into his marvelous light," and therefore they ought to "shew forth the praises" of God. Galatians 1: 14; 2 Corinthians 6:14-18; 1 John 2:15; 1 Peter 1: 15, 16; Romans 12:2; 1 Peter 2:9. We recognize that in human strength we cannot live a life which pleases God and glorifies the Lord Jesus Christ. We are also humbly aware that neither legalism nor formalism is the answer to our need. We therefore call upon God for the quickening and sanctifying influence of His blessed Holy Spirit to renew us in heart and life, creating in us more perfectly the image of the blessed Son of God. We believe that union with the Lord Jesus, with its ensuing nonconformity to the world, is not a matter of ecstasy or mere emotion, but that it is a devotion of love and faith which calls for a resolute discipleship in life, a holy obedience to the precepts of the Word of God, lived in the power of the indwelling Holy Spirit. Furthermore, Christians are called upon by Christ to "make disciples of all nations." They are not to withdraw from all contact with society, but are to labor actively to bring all people to the obedience of the faith. It is also our understanding that a Christian separation and nonconformity to the world apply to all of life including the areas hereinafter specified. Christian LoveWe believe that both the letter and the spirit of the New Testament enjoin upon us a life of absolute love and nonresistance. The Savior commanded that if anyone strike the right cheek, we should turn to him the other also. Christians are to love their enemies, bless them who curse them, do good to those who despitefully use them and persecute them. They are to be perfect in love, even as their heavenly Father is perfect. The command of the apostle is, "Recompense to no man evil for evil.... Dearly beloved, avenge not yourselves, but rather give place unto [Gods] wrath. for it is written, Vengeance is mine; I will repay, saith the Lord. Therefore if thine enemy hunger, feed him; if he thirst, give him drink: for in so doing thou shalt heap coals of fire on his head. Be not overcome of evil, but overcome evil with good." Our Lord indicated that because His kingdom is not of this world, His servants do not fight. Paul states that although we walk in the flesh, "we do not war after the flesh: (for the weapons of our warfare are not carnal)." "The servant of the Lord must not strive; but be gentle unto all men." Christians are not to render "evil for evil"; on the contrary they are to bless their abusers. They shall follow the Lord Jesus who in His innocent suffering did not strike back but simply committed Himself to the care of God the righteous Judge. Matthew 5:38-48; Romans 12:1721; John 18:36; 2 Corinthians 10:3, 4; 2 Timothy 2:24; 1 Peter 2:21-23; 1 Peter 3:8, 9; 1 Thessalonians 5:15; 1 John 2:9; 3:10, 14, 15; 1 John 4:8, 20. (See also our statements, Peace, War, and Military Service, 1937; and A Declaration of Christian Faith and Commitment, 1951, which set forth in greater detail our position as a Mennonite Church.) We take these Biblical commands at face value and seek humbly by the help of God to apply them to every area of life, and at all times, without exception. Hence we seek to live in peace in all human relationships, avoiding strife and violence, and we reject every form of military service and military training. But we stand ready to aid the needy of the world, to build rather than to destroy, to feed the hungry and clothe the naked, and even at the risk of life and safety to do all in our power to show love to the helpless and suffering. And we are ready to carry on this Christian ministry and witness regardless of what it may cost us. For we understand that the Lord desires every disciple to take upon himself the cross of personal suffering for Christ's sake as God's way of overcoming evil. Attitude Toward PossessionsWe understand the Scriptures to teach that the end of life for the Christian is not the amassing of wealth but Christian service and evangelism. Our Lord gave stern warnings on the dangers of money-seeking and avarice. Furthermore, whatever may come to us through honest toil and effort is not ours, to be used selfishly, but is God's, and we are but His stewards. Therefore we invoke His sanctifying power to deliver us from the materialistic age in which we are living, and to enable us to first give our own selves to the Lord. And we call upon all members of the church to practice lives of self-denial and frugality, to live simply rather than in luxury, and to use the things of this world in the full realization that we do not really belong to this world, but are strangers and pilgrims on the earth. Although it is not wrong to own property or to save money for emergencies and for old age, yet we protest against the evident wealth-seeking on the part of many professing followers of Christ. And we urge all our members to practice "graduated giving," that is, increasing the percentage returned to the Lord as the income becomes greater. Only thus will the church be able to help its pastors with Scriptural support; only thus can the church carry on its ministry of evangelism and nurture; and only thus can the Gospel be carried to all nations in obedience to the command of the Lord of the Church. Psalm 50:10-12; Luke 16:9; Acts 5:14; 1 Thessalonians 4:10-12; 2 Thessalonians 3:10-12; 1 Corinthians 4:12; 1 Corinthians 10:24; Ephesians 4:28; Matthew 6:19-21, 24; Luke 12:15; Luke 12:21-31, 33, 34; Luke 18:23-27; 1 Corinthians 16:2; 2 Corinthians 8:1-5; 2 Corinthians 9:6, 7. Courtship and MarriageIn contrast with people of the world the children of God are to be pure and holy in life. The Word of God calls particular attention to this in connection with the securing of a life companion. Christians shall keep their bodies unstained by sin so that they may be fit tabernacles for the Holy Spirit. The child of God shall in holiness and honor obtain a life companion, "not in the lust of concupiscence." The apostle also calls upon Christians to follow the Golden Rule of love and not to take advantage of a brother in this matter, "because that the Lord is the avenger of all such" (1 Thessalonians 4:3-7). So beautiful in God's sight is the loving union of husband and wife, that it is made in the New Testament the symbol of the relationship which obtains between Christ and the church. The home God meant is a home of love, of kindness and gentleness, of much joy and happiness, of comradeship, of prayer and devotion to the Lord. It is a home which has family worship. It is a home where husbands love their wives, and where wives love and cooperate fully with their husbands. Marriage is intended by God to be the lifelong union of one man and one woman in the Lord. Christians shall enter into this relationship only with those of like precious faith. No one shall put away his companion except for unfaithfulness which is unrepented of. If a couple separates for incompatibility they shall either be reconciled or remain unmarried. As a church we call upon all Christians to make their homes Christian, and to resist the current blight of broken homes, divorces, and remarriages. Where remarried people find Christ the local ministry and congregation shall give them the full Biblical teaching on marriage and divorce, and seek to deal redemptively with them. Matthew 5:31, 32; Matthew 19:3-12; Mark 10:2-12; Luke 16:18; Romans 7:2, 3; 1 Corinthians 7; Ephesians 5:22-31; Colossians 3:18, 19; Titus 2:4, 5; 1 Peter 3:1-7. Dress and External AppearanceThe Lord Jesus taught His followers not to be worried and anxious about food and clothing, for God cares for His own. The New Testament writers recognize that the heart of Christianity lies not in externals but in the new birth, union with Christ, and Holy Spirit sanctification. But because Christians have been delivered from the world and its sin they cannot any longer follow the fashions and dictates of a sensuous and sensate culture. Christians are not to fashion themselves after this wicked world, but are to be transformed by the renewing of their minds. The apparel of the Christian should therefore be simple, modest, neat, and becoming for those professing godliness. The Apostle Peter calls upon Christian women not to conform to current fashions by occupying themselves in the preparation of elaborate coiffures, nor shall they wear rings or bracelets of gold. For their real "beauty" is that of the heart and spirit, not in external conformity to the worldly forms of adornment. Similarly Paul entreats Christian women to wear clothing which is expressive of their genuine modesty, with proper reserve and Christian discretion. The hair should be worn long, and not arranged according to the current fashions. No jewelry ought to be worn, either of gold or pearls. Neither should there be a display of wealth by the purchase of expensive clothing. Rather let the "adornment" consist of those good works which characterize those who truly are filled with the love of God. We therefore feel that we are on Scriptural ground when we appeal to all Christian women to dress simply and plainly, avoiding all forms of rings and jewelry, short hair and fashionable coiffures, immodest dresses, and anything which would violate the principles of Christian holiness, purity, modesty, and economy. Likewise Christian men should dress simply and plainly, wearing no rings or jewelry, and scrupulously avoid conforming to worldly fashions. It is not consistent with a profession of faith and holiness to wear flashy or costly clothing, and jewelry. Matthew 6:28-34; Galatians 6:15; Romans 12:2; 1 Peter 3:1-6; 1 Timothy 2:9, 10. The Clean LifeSince the body of the Christian is the temple of the Holy Spirit, it is sinful and wrong to do anything to the body which would weaken or damage it. Christians are to make their bodily members "instruments of righteousness" in the service of a holy God. It is a violation of Scriptural principles for a Christian to become a slave to anything. The inspired Apostle Paul declared that food has its place, but he would not be brought under the power of anything. Inasmuch as both the tobacco and drink habits enslave those who have them, and inasmuch as alcohol and tobacco are both costly and injurious to the body, and inasmuch as their use gives an unworthy testimony on the part of men and women of God, we appeal to all Christians "by the mercies of God" to voluntarily adopt the "clean life" by making no use of tobacco in any form and by a complete abstention from the use of beverage alcohol. If this is done out of love for Christ and His cause, and in awareness of the dangers which are involved in the use of alcohol and tobacco, and in consideration of the principle of Christian stewardship, we see no reason to fear the charge of legalism or meritorious asceticism. We also protest the production, manufacture, and sale of both alcohol and tobacco. 1 Corinthians 6:12, 19; Romans 6:13, 19; Romans 12:1, 2; 1 Corinthians 8: 13; Romans 14:21; 1 Corinthians 10:31. Worldly OrganizationsIn the complex world in which we are living there are a number of factors which the nonconformed Christian must take into account when facing the question of uniting with various organizations which bid for membership and support. One consideration is that Kingdom concerns fill much of life, leaving too little time and energy for other legitimate concerns at the best. One must therefore seek to invest time and energy only in the best projects. The rearing of a family in the nurture and admonition of the Lord is also a major consideration. One dare not be away from one's family unnecessarily if one takes his obligations seriously as a parent. Another consideration is the "unequal yoke" of 2 Corinthians 6. As earnest disciples of Jesus we want to remain aloof from any organizational connection which would handicap us in giving a Christian witness or which would make us unwilling participants in an activity or program which we feel is sub-Christian or worldly. Finally, we must raise the question of the propriety of "strangers and pilgrims" entering too deeply into the organizations of our society when many members of those organizations are hostile to the radical type of Christian discipleship for which we as a church stand. It is not proposed in this Declaration to make an exhaustive list of all organizations, dividing them into the legitimate and the inadvisable. But we do wish to call attention to our 1941 statement, Industrial Relations, which points out that we can take no part in any social or industrial strife between classes such as labor and capital. We therefore urge all our members to seek employment in such places of labor as do not require labor union membership or who honor church membership cards on the basis of contracts as between unions and our Committee on Social and Economic Relations. In any case, those members employed in institutions having labor unions and no agreement with our church shall register with the union a statement that they are nonresistant Christians and as such will take no part in strife or other activities unbecoming for a nonresistant Christian. We also reaffirm our agelong opposition to secret and oath-bound fraternities and lodges, holding that the principle of organized secrecy is wrong in itself, that the swearing of oaths is prohibited the Christian by the plain word of our Lord, that the hierarchical titles of the lodge are unbecoming to a humble follower of Christ, that Christians ought, not be unequally yoked with non-Christians, and that in many cases lodges erroneously offer salvation to their members on other grounds than the shed blood of Jesus Christ. Lodge membership is therefore a test of membership in the Mennonite Church. John 18:20; Matthew 5:33-37; James 5:12; Matthew 23:8-12; 2 Corinthians 6:14-18; John 14:6; Acts 4:12. RecreationWe recognize that man is so constituted by God that he needs rest and refreshment. We are not unaware of the improvement in health, the correction of physical handicaps, and the enhancement of physical and mental efficiency which can come only through a proper use of recreation and leisure time. But we are gravely concerned at the overemphasis on sports in our culture, and at the ruination of wholesome recreation by commercialization, and by a professionalism which makes central in the lives of a few persons what ought to be peripheral in the lives of many. Again, we want to have no part in any activity which would becloud the Christian testimony and witness of those who are "strangers and pilgrims" in this world. We therefore give our testimony against playing cards, pool, the dance theater attendance, mixed bathing, the reading of filthy literature, and the like. We urge that Christian people seek refreshment of body and mind only through wholesome activities, clean games, good reading, retirement to God's great out-of-doors, good music, and other forms of recreation which give no questionable witness, which do not spoil one's taste for God's Word and prayer, and which truly build people up rather than weaken them. We protest against the evil influences of many radio and television programs, and call attention to the fact that television can bring many of the undesirable aspects of the theater into the home. 1 Thessalonians 5:22; 1 Corinthians 10:13; 1 Peter 2:11; Romans 14:21; 1 Corinthians 8:13; 1 Corinthians 6:12. Simplicity of WorshipAlthough the Christian church was initially a spiritual body of genuine saints, possessing a lively awareness of their separation unto God and their nonconformity to the world, it was but a few centuries until the church became a respectable institution in the world, and ultimately a worldly institution lacking its original faith and power. Along with its new wealth and prestige the church lost its real character. In the Middle Ages the worship of the church was strongly ritualistic, the ministers of the Gospel were transformed into "priests" to intercede with God for the "laity," and the houses of worship lost every vestige of simplicity. The triumph of the world over the church was well-nigh complete. Our Mennonite brotherhood has sought to return to the type of apostolic church faith and life which are reflected in the Acts and Epistles of the New Testament. We have, therefore, conceived of the church basically as a brotherhood rather than as a hierarchy of clergy and laity. We have conceived of the house of worship as a plain meetinghouse rather than as a costly and ornate edifice of worship, We have had a quiet type of piety in our worship services rather than a demonstrative meeting. We have sung a cappella hymns rather than to employ either organ or piano. Our ministers have been preachers who have proclaimed God's Word in simplicity and clarity. We encourage our district conferences and congregations to take steps to maintain the simplicity of the apostolic church and to try to regain it in so far its it has been lost. We reaffirm our desire to be it body of redeemed and regenerated pilgrims whose houses of worship, service, preaching, singing, and piety are all made to conform to the spirit and letter of the New Testament. We therefore call upon God to guide us as it church, to sanctify us in the power of the Holy Spirit, and to give us grace and wisdom to resist every effort to conform to a Christendom which has been partially secularized. We request our members to earnestly seek to maintain our Biblical heritage by rejecting every tendency toward worldliness, legalism, or other aberration. We encourage our schools to continue to regain and perpetuate and propagate the "Anabaptist Vision." And we humbly ask God for forgiveness and healing in respect to the carnality, materialism, and worldliness with which our congregations are now struggling. Matthew 23:8; 1 Corinthians 14; Colossians 2:16-23; Hebrews 11: 13, 14, 16; 1 Peter 2:5, 9, 11; 1 John 2:15, 16. SpeechInasmuch as speech is recognized in God's Word as being the index to the "abundance of the heart," we are concerned that our people may truly be Christian in their use of the tongue. We understand Christianity to involve absolute truthfulness, the avoidance of all flattery, an insistence on holiness and purity of language, the use of the lips to edify the saints and warn sinners, the propriety of praising God, the elimination of all gossip on the part of Christians, the avoidance of oaths as well as such "minced oaths" as are but substitutes for holy names and words, and the like. Since Americans are known abroad as not being as restrained in speech as is proper, we caution our members to be on their guard against conforming more or less unintentionally to the modes of speech in our land. We urge all Christian people to give earnest heed to the plain teaching of the Scriptures on the type of speech which ought to characterize the saints of God. Special warning ought to be given in reference to the sinful way in which people often ruin the good name of others by careless gossip. We plead for intercessory prayer and brotherly admonition to completely displace gossip within the fold of the body of Christ. Matthew 12:34; Ephesians 4:25; Colossians 3:9, 10; Revelation 22:14, 15; Psalm 12:2, 3; Ephesians 4:29; Ephesians 5:4; Proverbs 25:11; Matthew 18:15; 1 Peter 4:11; Hebrews 2:12; 1 Peter 4:15; Matthew 5:34-37; Matthew 23:16-22; James 1:19; Titus 3:2; James 4:11. Adopting ResolutionWe, the Mennonite General Conference, assembled at Hesston, Kansas, this 25th [i.e. 26th] day of August, 1955, do hereby adopt this Declaration of Commitment in Respect to Christian Separation and Nonconformity to the World. We urge our ministers to teach these doctrines and to keep our members aware of the issues which face nonconformed Christians as they seek to live a holy life in this era. We implore God for His renewing grace to cleanse our brotherhood of all sin and worldliness. We call upon all our members to be satisfied with nothing less than a vital union with the Lord Jesus Christ. We dedicate ourselves afresh to the preaching of the Gospel of Christ and the whole counsel of God. We humbly call the attention of all Christians to those areas of this statement which we regard as neglected Bible truths in our day. May the Holy Spirit sanctify us wholly so that we may not be ashamed before our Lord at His coming. Context of this StatementThis statement, approved by the delegates to the Mennonite Church's General Conference in 1955, was developed by the General Problems Committee of the Mennonite Church. The statement was a late attempt within the Mennonite Church to maintain longstanding symbols of separation from the world, including uncut hair for women and avoidance of wearing wedding rings. The statement continued rejection of musical instruments in public worship, expressed caution about joining labor unions, urged total abstinence from tobacco and alcohol, and said that persons divorced from their spouses should not remarry. The position of the Mennonite Church on most of these issues shifted by the 1970s, sometimes resulting in painful divisions within area conferences. Such a division took place in the Mennonite Conference of Ontario in 1960, resulting in the formation of the Conservative Mennonite Church of Ontario. The General Problems Committee was a standing committee of the Mennonite Church from 1929 until 1961 when its name was changed to Church Welfare Committee and its mandate was modified. The Committee was established in 1929 when the Mennonite Church General Conference approved a new constitution. The General Problems Committee was to "acquaint itself with conditions of every institution under the general boards," to represent the church "in the investigation and solution of any general problem for irregularity which may arise affecting the peace, unity, and spiritual welfare of the church," and to work with the relevant boards or institutions when such issues arose. During the time this statement was prepared, the committee was composed of five members with two Canadian members. Truman H. Brunk chaired the committee, and J. C. Wenger served as secretary. The two Canadian members were Jesse B. Martin (Waterloo, Ontario) and Clarence J. Ramer (Duchess, Alberta). Context written 1999 by Sam Steiner Twenty-ninth Mennonite General Conference, Hesston College, Hesston, Kansas, August 23-26, 1955. Scottdale, Pa.: Mennonite Publishing House, 1955: 26-32, 86-91. "Constitution of the Mennonite General Conference." Mennonite General Conference held near Goshen, Indiana, August 28-30, 1929. Scottdale, Pa.?: The Conference, 1929: 27-31. Thirty-second Mennonite General Conference, Johnstown, Pennsylvania, August 22-25, 1961. Scottdale, Pa.: Mennonite Publishing House, 1961: 11, 16.
<urn:uuid:8836e3d3-039c-4cf1-b508-eed329f11247>
CC-MAIN-2016-40
http://anabaptistwiki.org/mediawiki/index.php/Declaration_of_Commitment_in_Respect_to_Christian_Separation_and_Nonconformity_to_the_World_(Mennonite_Church,_1955)
s3://commoncrawl/crawl-data/CC-MAIN-2016-40/segments/1474738662133.5/warc/CC-MAIN-20160924173742-00168-ip-10-143-35-109.ec2.internal.warc.gz
en
0.951146
5,525
2.515625
3
The circuit forms an interface between a micro controller and a 8 by 8 Dual Colour Common Anode LED Module. This type of module has two LEDs per pixel, each row has 8 pixels, with 8 rows. The anodes of each LED in a row are connected, with 16 columns formed by connecting together the cathode of an LED from each row. A high side switch is needed to turn on/off a row and must be able to source approximately 240 milliamperes (16 multiplied by 15 milliamperes). A low side switch is needed to turn on/off a column, but only one LED is on per column so it only needs to sink 15 milliamperes. For the high side switching I used a TD62783APG 8 Channel High-Voltage Source Driver from Toshiba Semiconductor. It’s very important that only one output from the TD62783 is on at any one time so I used a 74HC238 3-to-8 Decoder from NXP to control the row selection. For the low side switching we used two 74HC595 8-bit Shift Registers from NXP. The basic operation for displaying a single frame is. The data for a row is shifted into shift registers one bit at a time, the shift register output is turned off (OE), the row is selected on the decoder, the shift register data is loaded into the output registers (LE) and then the shift register output is turned on. These steps are repeated for each additional row of data. All the steps are repeated indefinitely until the next frame of data is to be displayed. The circuit was designed around the Arduino micro controller but should work with other micro controllers. The connections are shown in the image. The left hand side of the display is the row select pins the central pins are for power and ground, with the columns connected to serial peripheral interface (SPI) pins on the Arduino on the right. I’ll do a follow-up blog post with the source code and a Java program I’ve written to create animations.
<urn:uuid:71c5c574-2c1d-47d3-8eae-93ad7294dc06>
CC-MAIN-2018-26
http://partfusion.com/tag/engineers-week/
s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267864943.28/warc/CC-MAIN-20180623054721-20180623074721-00393.warc.gz
en
0.90369
428
2.671875
3
( – promoted by navajo) Ask some non-Cherokees to name some prominent historical Cherokee leaders and there are three names which frequently come up: (1) John Ross, the chief who led the Cherokee during the first half of the nineteenth century, (2) Sequoia, the genius who created Cherokee writing, and (3) Wilma Mankiller, the well-known twentieth century chief. There are, however, many other prominent Cherokee historical figures and there were powerful chiefs before John Ross. One of these was Attakullakulla. Attakullakulla was born into a prominent Cherokee family. During his youth he was trained by the elders to assume a position of responsibility. As an adult he became well-known for skills at oratory, diplomacy, and negotiation. In 1730, Attakullakulla was among the Cherokee leaders who were taken to England to meet with King George. At that time, he was the head warrior of Tassatchee and was known by the name of Oukah Ulah (also spelled Ookounaka and Oukandekah). The English, blissfully unaware of Cherokee government, simply assumed that he was the “King” of the Cherokees. Upon meeting King George, the Cherokee presented him with a number of gifts, including the “crown of Tannasee” (a crown made from opossum tails), scalps from their enemies, and five eagles’ tails. During their four months in England, the Cherokee were grandly entertained, taken to fairs, and given gifts. They also competed with the King’s archers and were entertained by plays which included sham fights and acrobats. They also negotiated a treaty of friendship and trade with the English. After his return from England, Attakullakulla maintained a strong friendship with the English. When the French approached the Overhill Cherokee towns in 1736 to open the doors for peace and trade, Attakullakulla refused to attend the meeting. In 1738, Attakullakulla was captured by the Ottawa who were French allies. He spent more than six years as a captive. In 1753, the governor of Carolina called for a meeting with the Cherokee for the purpose of concluding a treaty of peace between the Cherokee and the Creek. Attakullakulla informed the governor that when he had met with King George in England that the king had asked him to avenge the English lives taken by the Creek. When the governor tried to insist that he now spoke for the king, Attakullakulla simply told him that he would go to England again and meet with the king. Attakullakulla’s personal experience with the king plus his knowledge of the treaties with England enabled him to negotiate a favorable agreement with the governor. In 1755, the governor met with 506 Cherokee chiefs, headmen, and warriors in Saluda near the present-day Greenville, South Carolina. Attakullakulla stood before the group with a bow in one hand and a sheaf of arrows in the other and acted as the principal spokesperson for the Cherokee Nation. The English accounts of the meeting describe Attakullakulla as having “the dignity and graceful action of a Roman or Grecian orator, and with all their ease and eloquence.” At the meeting Attakullakulla presented a child to the governor saying: “I have brought this child that when he grows up he may remember our agreement this day and tell it to the next generation that it may be known forever.” Attakullakulla also asked that the proceedings of the meeting be written down so that it could be kept forever. In this way, he acknowledged both the Cherokee oral tradition and the English practice of writing. Attakullakulla then gave the governor some earth and some corn and asked that they be sent to the king as a symbol of Cherokee recognition of English authority. Then he raised the bow and quiver over his head and told the governor that this is all the Cherokee have for their defense. He then asked for guns and powder so that they could fight those who were enemies of the English. Following the meeting, Attakullakulla became the most powerful Cherokee leader of the time and through his influence he held the Cherokee to their ties with England. To demonstrate Cherokee loyalty to England, Attakullakulla with Cherokee war leader Oconostota led a series of raids against the French and their Indian allies on the Mississippi and Ohio Rivers. In 1759, Attakullakulla, Oconostota, and other Cherokee leaders met with the Governor of North Carolina. While they were originally met with peace, the leaders were soon imprisoned and forced to sign a new treaty under duress. In 1760, Old Hop, the Cherokee Beloved Man (supreme chief) died. Instead of Attakullakulla, Standing Turkey was named as the new Beloved Man. Attakullakulla’s support of the English had eroded his support among the Cherokee. The Cherokee then went to war against the English traders and colonists. The following year, the Cherokee sought peace with the English. Attakullakulla served as one of the primary negotiators for the new treaty. During the next 20 years, Attakullakulla helped negotiate numerous treaties and agreements with the English. As a result of these treaties, the land controlled by the Cherokee shrank as the English hunger for land seemed to be endless. Attakullakulla died around 1780 (he was about 80 years old) and the leadership of the Cherokee passed to a younger generation including Dragging Canoe (Attakullakulla’s son) and Bloody Fellow.
<urn:uuid:495ae8ba-de8f-40dd-8709-bbff1e4f5106>
CC-MAIN-2018-05
http://nativeamericannetroots.net/diary/792
s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084887973.50/warc/CC-MAIN-20180119105358-20180119125358-00096.warc.gz
en
0.977289
1,196
3.734375
4
One of the main problems in identifying a unified system of entering data is that the diversity among the various genealogical database programs. From a global perspective there are other issues such as identifying a "surname" when the particular society has no such convention. In other societies, the name given to a child at birth changes when the child reaches a certain age or stage of acceptance in their society. Western European genealogists have paid little more than lip service to naming variations around the world. All you have to do is look at any of the major online English language databases or look at a selection of suggested genealogical forms to realize that global naming patterns are largely ignored. For example, the Family Tree manual makes the following statement at page 39: Enter the person’s main name. This is generally the complete name that he or sheIf you are at all aware of Spanish language naming patterns, for example, you know that these instructions simply don't work. This is not intended as a criticism, I would assume that the Spanish language version of Family Tree will reflect Spanish naming patterns, I use this as an example of how cultural-centric most of our genealogical conventions have become. The instructions from FamilySearch Family Tree are perfectly valid unless... and that is a big unless. I might venture to guess that these instructions came more from the programmers than from the genealogists. was given at birth. You can add other versions of the name, such as nicknames or married names, later as alternative names. a. (Optional) In the Title field, enter the person’s title if he or she had one. Titles include titles used for nobility, clergy, military ranks, professional affiliations, and scholastic achievements. Examples include duke, bishop, captain, or Dr. b. Enter the first, middle, and last names in the appropriate fields. For a married woman, enter her maiden name if you know it. c. (Optional) In the Suffix field, enter terms like junior, senior, or other words that appear after the name. You must enter at least a first or last name. • If you do not know a mother’s or wife’s name, enter Mrs. in the Title field and the husband's last name. If you know her maiden name, enter it instead. Do not enter a first name. • For a husband with an unknown name or a child who died without receiving a name, enter only the father's last name. Do not enter a first name. Do not enter Mr., Miss, son, or daughter. Be sure that the gender is correctly entered as male or female if you know it. I am not particularly picking on FamilySearch, I could go to almost any other database and use it to illustrate the same issue. For example, take a look at the search fields in Ancestry.com. The fields provide for first and middle names and last name. Of course, you can put whatever you want in the fields and Ancestry.com will use it for a search, but the fields themselves presuppose a certain naming pattern. First, I think we need an expansive definition of a person's "main" name. Although the instruction from FamilySearch qualifies the entry by saying it is "generally" the person's birth name, how do you make the decision as to what name to use? Even in our own culture, a person could have several names throughout his or her life with none of them being the birth name. Also, the instruction from FamilySearch in the context of the maternal line, saying "Do not enter a first name." I cannot tell you how many thousands of entries I have seen for "Mary" or "Martha" or whatever as the only name identifying a female ancestor. Are we to understand that FamilySearch no longer wants this type of entry? What about the tens of thousands of single first name entries already in the database? As a very basic first rule, I would suggest that all genealogists be told to record every instance of the person's name and all the variations with sources telling how each variation was found and used. If, as a programming convention, a database insists on having a single name, I suggest the programmers need to get to work and learn some genealogy. In the case of Family Tree, the program allows for the possibility by having a field for "Alternative Name" in the Other Information Section. This is the usual way of handling alternatives in genealogy programs. But the question would arise, if I only knew the first or given name of a female ancestor, should I record it as an "Alternative?" At another place in the manual, FamilySearch Family Tree addresses the convention of capitalizing names. This practice dates back to typewritten forms and has the tendency to obscure the way many names occur such as McDonald. I find using all caps to be deplorable given computers with keyboards and shift keys.
<urn:uuid:c04e4fdf-0da1-40da-8f39-137e8fc7ee71>
CC-MAIN-2014-10
http://www.genealogysstar.blogspot.com/2012/08/name-conventions-for-online-databases.html
s3://commoncrawl/crawl-data/CC-MAIN-2014-10/segments/1394010213406/warc/CC-MAIN-20140305090333-00003-ip-10-183-142-35.ec2.internal.warc.gz
en
0.944525
1,028
2.84375
3
Make your trip to the Zoo an educational experience! Learn how Niabi inspires conservation action while helping meet state education standards from pre-K to college level. What you should know about educational tours: - Tours are approximately 30 minutes in length. - Cost is $5 per student and chaperone (teachers can attend at no cost). Themed Tours include (but are not limited to): Amazing Adaptations – From prehensile tails to swinging hands and how to survive in desert sands, we’ll take a closer look at the special characteristics that help animals survive. Featured Animals: Gibbons, Binturong, Bactrian Camel, Snow Leopard, Giraffes African Safari – Explore the great continent of Africa and learn about the unique characteristics of the diverse animals that call it home. Featured Animals: Rhino, Giraffe, Zebra, Ostrich, and Colobus Monkeys Brilliant Biodiversity – Meaning the variety of life, explore Biodiversity Hall and its wide variety of species to help understand why biodiversity is so important to the survival of life on Earth. Featured Animals: Meerkats, African Crested Porcupine, Crocodile Monitor Lizard, Fennec Fox, Reticulated Python, Linne’s Two-Toed Sloth Cool Cats – Have you ever seen a lion’s skull? How sharp is a leopard’s claw? How far can a snow leopard leap? In this program your group will learn what it takes to survive at the top of the food chain while viewing these impressive carnivores. Featured Animals: Snow Leopard, Bobcats, Amur Leopard, African Leopard, and Pallas Cats Homey Habitats – Which animals live where? What about their environment best suits particular animals? Join us as we look at animals from around the world, the different habitats they call home and how everything is connected. Featured Habitats: Tropical Rainforest, Desert, Savannah/Grassland, and Temperate Forest Radical Reptiles – Discover the ancient world of reptiles and what makes them unique. See our Reptile House and learn about the characteristics that make reptiles so fascinating! Featured Animals: Green Anaconda, Northern Caiman Lizard, Red-footed Tortoise, and Leaf-tailed Gecko Zoo Careers – Find out about a variety of careers with animals, education requirements, experience needed and how to get it as well as the time, commitment, and dedication needed to work in a Zoo. Includes a presentation and a behind the scenes look at areas of the Zoo. Featured Career Paths: Zoo Keeper, Conservation Education, Animal Nutritionist, and Veterinary Services NOTE: All programs can be tailored to any age group. Don’t see what you want? We can custom design a tour for you! Just give us a call with questions, 309-799-3482 ext 222
<urn:uuid:f5e4aa72-a547-4112-817b-4fc52b3be74d>
CC-MAIN-2023-40
https://www.niabizoo.com/education/field-trips/
s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233511106.1/warc/CC-MAIN-20231003124522-20231003154522-00639.warc.gz
en
0.886426
606
2.8125
3
The Art of Clear Thinking by Patrick King underscores the often-overlooked fact that human thinking, influenced by numerous biases and external factors, isn't always as precise or objective as one might assume. As we navigate the complex world of decision-making, communication, and problem-solving, this book offers invaluable insights and strategies to enhance clarity and precision in our thought processes. The initial part of the book emphasizes the critical importance of acknowledging that our thought processes can be subjective, filled with inherent biases. This isn't necessarily a negative trait; it's merely a byproduct of human evolution. Our ancestors had to make split-second decisions to survive, leading to the development of these biases. While these instant judgment calls were essential in a primal world filled with immediate dangers, they can cloud our judgment in the modern world, where situations often demand more nuanced thinking. For instance, the book delves into common cognitive biases like confirmation bias, where individuals tend to seek out or interpret information in ways that align with their existing beliefs. This can hinder objective analysis and lead to echo chambers where opposing views are not just ignored, but vehemently dismissed. The book also discusses the detrimental effects of information overload, a modern-day issue most of us grapple with. With the explosion of the digital age and the constant barrage of information from news outlets, social media, and other platforms, our minds can become overwhelmed. This flood of data can cloud our judgment, leading to decisions based on emotions rather than factual analysis. Another pivotal point made in the book is the significance of emotional intelligence. Recognizing, understanding, and managing our emotions can play a crucial role in clear thinking. When emotions run high, our ability to think rationally diminishes. By developing emotional intelligence, we can identify these moments and take steps to ensure they don't cloud our judgment. The book doesn't just identify problems but also offers tangible solutions. It recommends various techniques such as mindfulness meditation, critical thinking exercises, and active listening skills to enhance our thinking clarity. These techniques can help in not just decision-making but also in improving communication skills, understanding other viewpoints, and building better personal and professional relationships. King also underscores the significance of continuous learning and adaptability. In a rapidly changing world, clinging to outdated beliefs or information can impede clear thinking. By staying updated and being open to new information, even if it challenges our existing beliefs, we can think more clearly and make better-informed decisions. In the quest for clear thinking, understanding the pitfalls is just as crucial as knowing the strategies to overcome them. Patrick King's "The Art of Clear Thinking" serves as a comprehensive guide to navigate the often murky waters of human cognition. By acknowledging our biases, understanding the impact of emotions, and equipping ourselves with techniques to enhance clarity, we can significantly improve our decision-making, problem-solving, and interpersonal communication skills. In essence, clear thinking is more than just a cognitive skill; it's an art that can transform our lives in profound ways. Humans inherently possess cognitive biases, remnants of our evolutionary past. While these biases served a vital role in quick decision-making for our ancestors, in today's intricate world, they can often hinder objective thinking. Recognizing and countering these biases is paramount for clear thought.2. The Pitfall of Confirmation Bias One of the most prevalent biases, confirmation bias, makes us gravitate towards information that aligns with our pre-existing beliefs. It narrows our perspective, creating echo chambers. Actively seeking diverse views can help counteract this bias.3. Information Overload Syndrome In our digital age, the continuous deluge of information can overwhelm the mind. This bombardment can often lead to decisions made on emotions rather than logic. Learning to filter and prioritize information is crucial for clear thinking.4. Emotional Intelligence as a Pillar Our emotions, when unchecked, can drastically cloud judgment. By developing emotional intelligence, recognizing and managing our emotional states, we can navigate situations with a clearer mindset and make rational decisions, even under pressure.5. The Power of Mindfulness Mindfulness meditation isn't just a trend; it's a powerful tool for clear thinking. By cultivating mindfulness, we become more aware of our thought patterns, biases, and emotions, allowing us to address and manage them proactively.6. Active Listening: A Forgotten Skill Clear thinking isn't just about our own thoughts. By practicing active listening, truly focusing on understanding others, we can gain fresh perspectives, challenge our biases, and improve both personal and professional relationships.7. Continuous Learning and Adaptability The world is ever-evolving, and clinging to outdated beliefs or information can cloud judgment. Being open to new insights, even if they challenge our beliefs, and continually updating our knowledge is vital for maintaining clear thought processes.8. Embracing Opposing Views To truly think clearly, we must be willing to entertain and understand viewpoints that oppose our own. This doesn't mean agreeing with them, but rather, it's an exercise in broadening our horizons and challenging our biases.9. Critical Thinking Exercises Like any skill, clear thinking can be honed and improved with practice. Engaging in exercises that challenge our thought processes, such as debates, puzzles, or scenario analyses, can sharpen our ability to think critically and objectively.10. The Ripple Effect of Clear Communication Clear thinking extends its influence into clear communication. By organizing our thoughts and addressing biases, we can communicate more effectively, fostering understanding and reducing misunderstandings in personal and professional settings. Objective: To become more aware of the biases that influence your daily decisions and thought processes. Objective: To break out of information echo chambers and expose yourself to varied perspectives. Objective: To cultivate a daily practice of mindfulness, enhancing awareness of your thought patterns and emotional responses. Objective: To enhance your listening skills, fostering deeper understanding and clearer communication. Objective: To exercise your critical thinking muscles by analyzing hypothetical scenarios.
<urn:uuid:550a8cc3-b912-4424-b958-6ac0654cef18>
CC-MAIN-2023-50
https://personalgrowth.com/book/the-art-of-clear-thinking/
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100304.52/warc/CC-MAIN-20231201183432-20231201213432-00328.warc.gz
en
0.92427
1,223
3.359375
3
This section addresses concepts associated with learning the capacities required for effective work practices. Curriculum: the intended, the enacted, and the experienced curriculum Occupational expertise: canonical, situational, and personal domains/bases - Domain-specific conceptual knowledge – ‘knowing that’ (Ryle 1939) (i.e. concepts, facts, propositions – surface to deep) (e.g. Glaser 1989) - Domain-specific procedural knowledge – ‘knowing how’ (Ryle 1939) (i.e. specific to strategic procedures) (e.g. Anderson 1993, Sun et al 2001) - Dispositional knowledge – ‘knowing for’ (i.e. values, attitudes) related to canonical and instances of practice (e.g. Perkins et al 1993), includes criticality (e.g. Mezirow 1985) Sociogeneses of knowledge Time jealousy -often students are referred to as being ‘time poor’ (i.e. having limited time to study), but often they are ‘time jealous’ (i.e. – needing to use their time strategically). That is, making decisions about how and why they will use their time, and as directed towards their personal goals and interests, perhaps more than those of other. Click here for references.
<urn:uuid:62756bac-10de-4838-bd4c-342a032aceb3>
CC-MAIN-2023-06
https://vocationsandlearning.blog/concepts/
s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764500365.52/warc/CC-MAIN-20230206212647-20230207002647-00328.warc.gz
en
0.918669
288
3.265625
3
By Jeff Szymanski, PhD “You are so OCD!” is a fairly common phrase these days. When I hear someone use it — though I cringe a little inside — I rarely have the feeling that this is a deliberate attempt to make light of obsessive compulsive disorder (OCD). Quite the opposite: I typically get the impression that someone is trying to relate to someone struggling with OCD. I think some of the confusion has to do with the terms themselves. Obsessive refers to a personality trait describing someone who thinks and worries a lot. Compulsive is also a personality trait, indicating someone who is hyper-organized, detail-oriented, and a perfectionist. In other words, what I think people really intend to say is, “You are being obsessive” or “You are being compulsive.” Why be so picky about the “D”? When we add “D” — or disorder — to the end of a personality trait or mood state (e.g., depression) it is meant to indicate something very important: intensity. Let’s consider another commonly used phrase: “I’m so depressed.” When people say this, what they mean is that they are feeling a little down, sad, without energy to do anything, etc. Have you ever met someone with Major Depressive Disorder? It is of an entirely different magnitude. Individuals with a “disorder” are, by definition, in enormous psychological and emotional pain; their day-to-day responsibilities are drastically affected (for example, they may be unable to care for a child or get to work); and the unwanted thoughts and feelings they experience are present for most of their waking day. Additionally, those with disorders experience this over a significant amount of time. What is your advice to a friend who is feeling down? “Go for a walk.” “Look on the bright side.” “Tomorrow is another day.” “Snap out of it!” “Don’t be so hard on yourself.” Does this advice sound familiar? If you are truly just having a bad day — or bad couple of days — whether you take this advice or not, your mood improves. We all have ups and downs. In this case you are sad, but you don’t have Major Depressive Disorder. Let’s return to OCD. I have a neat office. I would describe myself — and others would agree — that I am somewhat compulsive. If someone moves something on my nicely arranged desk, I move it back. This is a personality trait. I prefer it that way. I like my things nicely arranged and organized. While I might be annoyed with the person who moved my things around, I am not suddenly experiencing acute and intense anxiety. When I park my car in the morning and walk away, sometimes the thought occurs to me, “Did I lock the doors?” Though I might feel a little anxious and I might even go back and check the car, I am not suddenly overcome by fears, doubts and catastrophic images. This, however, is the experience of someone with OCD. My doubts and anxiety were minimal to begin with. The thoughts and worries about my car actually go away without me doing anything. Talk with someone who has a diagnosis of OCD. No matter what they do, they are plagued for hours every day, day after day, with unrelenting, crushing anxiety. I’m not a fan of monitoring and correcting people’s language. As I said at the outset, I don’t think that saying someone is “being OCD” about something is inherently or intentionally mean, inconsiderate or disrespectful. However, stop for a moment and think about what the implications are of mixing a personality trait with a disorder — anxiety and sadness come and go. No big deal. Just get over it. This is your experience of these emotions, so why wouldn’t that be the case for someone else? When you label someone’s experience as disordered, when you really mean the personality trait, what you are ultimately telling people with OCD to do is just get over it. Dr. Jeff Szymanski received his PhD in Clinical Psychology from Northern Illinois University in 1997, and has a long track record of teaching and training. He is the author of the upcoming book “The Perfectionist’s Handbook,” and is the Executive Director of the International OCD Foundation.
<urn:uuid:c7639fb4-2542-4b23-882f-1650f114de54>
CC-MAIN-2018-09
https://blogs.webmd.com/mental-health/2011/04/you-are-so-ocd.html
s3://commoncrawl/crawl-data/CC-MAIN-2018-09/segments/1518891808539.63/warc/CC-MAIN-20180217224905-20180218004905-00364.warc.gz
en
0.964834
938
2.9375
3
Maze Ransomware: In-Depth Analysis, Detection, and Mitigation Since its discovery in 2019, Maze ransomware has consistently made headlines due to its infamous attacks on MSPs and its ability move laterally to other networks. Although this particular strain of ransomware has been used to attack businesses and governmental organizations, its attacks on MSPs are worrying since a single compromise can create a cascade effect on the MSP’s clients, their business partners, and so on. Maze was reportedly shut down in 2020, but there still exist numerous similar ransomware strains posing threats to businesses around the world today. A deeper understanding of Maze ransomware may help organizations strengthen their cybersecurity defenses against similar types of ransomware attacks in the future. However, the best protection against ransomware in general typically comes in the form of an XDR solution with intelligent threat detecting capabilities. What Is Maze Ransomware? Like other types of ransomware, Maze typically demands cryptocurrency payment in exchange for a decryption key to recover stolen data. However, like REvil ransomware, Maze ransomware also utilizes double extortion. If a victim refuses to pay the ransom, the threat actors behind the ransomware attack usually threaten to leak confidential data online. The ability of this malware strain to combine the negative effects of ransomware (e.g., reduced productivity and lost data) with the consequences of a data breach (e.g., privacy violations and data leaks) makes Maze ransomware a particularly concerning threat for organizations. However, since Maze ransomware has been used to target a variety of organizations around the world and across industries, it can be difficult to pinpoint its potential targets. The ransomware itself comes in the form of a 32 bits binary file, typically under the guise of an .exe or .dll file. Once the malware has been deployed, it encrypts user files and generates a ransomware payment demand. Additionally, Maze ransomware has been known to copy user data, create backdoors for continued access, and make attempts to spread within the network and beyond. The code itself is sophisticated, including obfuscation techniques intended to evade security techniques and teams. Due to the wide variety of organizations hit by Maze ransomware, the FBI issued a specific warning against this type of ransomware and believes it is operated by several different groups. Maze Ransomware History Discovered in 2019 by Malwarebytes researcher Jerome Segura, Maze ransomware (also known as ChaCha) is believed to be another type of ransomware offered as Ransomware-as-a-Service. Since then, Maze ransomware has been used extensively as the final payload by many different actors around the world. Maze ransomware is also known for popularizing the use of double extortion as part of its operations. In 2020, Maze operators notoriously began extorting companies; not just by encrypting files, but also through threatening to publish exfiltrated files online. However, in some cases, threat actors have also been known to sell stolen data even after collecting both fees, often without the target’s knowledge. Maze was one of the earliest adopters of this multi-pronged extortion approach, which is now commonplace. The ransomware group that created Maze also operated a website where it listed recent victims and published stolen data and documents as proof of their attacks. Additionally, the Maze website often included social media links for sharing the stolen data. At the end of 2020, the Maze ransomware group issued a statement announcing it was shutting down its operations and its website. The group stated that its attacks were intended to raise awareness of cybersecurity and that they had chosen not to execute attacks against high-profile targets such as the New York state government and several internet service providers (ISPs), even though they had access to their IT systems. However, the Maze ransomware group may still be active under a different name, as is often the case with these types of threat actor groups. What Is the Maze Ransomware Website? As mentioned above, the Maze ransomware group operated a website on the dark web where they published a list of victims and posted exfiltrated data as proof of their successful attacks. The website also included social media links for sharing the stolen data. When the Maze ransomware group announced that it was shutting down its operations in 2020, they also claimed that they would no longer be updating their website. In their announcement, the group said that any victims who wanted their data removed from the website could contact the group’s support chat to make the request. What Does Maze Ransomware Target? Maze ransomware typically targets large organizations, particularly those in the healthcare, financial, engineering, and government sectors. The technology industry has been heavily targeted by Maze ransomware as well. Since Maze ransomware often targets MSPs, the attacks can spread to clients How Does Maze Ransomware Work? Maze ransomware spreads by exploiting vulnerabilities in the operating system or applications, sending malicious links or email attachments containing malicious code, or using brute force to guess passwords. The ransomware can also be spread through malicious websites, malicious advertisements, and exploits kits. Specific exploits targeted by Maze ransomware include CVE-2019-11510 (Pulse Secure VPN) and CVE-2018-8174 (MIcrosoft Internet Explorer). Maze Ransomware Technical Details Maze operators often customize their payloads to improve stealth capability on target machines. For example, on systems running RabbitMQ, Maze operators will specifically spawn into the RabbitMQ processes to capitalize on the existing ‘infrastructure’. Maze operators have also been observed weaponizing the Java Updater mechanism for similar purposes. On April 17th, it was reported that a large enterprise-class, managed service provider (Cognizant) fell victim to a Maze ransomware attack. This particular campaign includes a signed DLL payload (kepstl32.dll). Upon infection, the trojan will drop a customized desktop image into %temp%, and then traverse the disk, encrypting supported file-types. A copy of the ransom instructions “DECRYPT-FILES.txt” is dropped into each folder containing encrypted files. As with previous variants of Maze, the trojan will attempt to inhibit recovery by deleting shadow copies via WMIC.exe (wmic.exe shadowcopy delete). How to Detect Maze Ransomware The SentinelOne Singularity XDR Platform detects and prevents malicious behaviors and artifacts associated with Maze. In case you do not have SentinelOne deployed, detecting this ransomware requires a combination of technical and operational measures, which are designed to identify and flag suspicious activity on the network. This allows the organization to take appropriate action, and to prevent or mitigate the impact of the ransomware attack. - Use antimalware software, or other security tools, which are capable of detecting and blocking known ransomware variants. These tools may use signatures, heuristics, or machine learning algorithms, to identify and block suspicious files or activities. - Monitor network traffic, and look for indicators of compromise, such as unusual network traffic patterns, or communication with known command-and-control servers. - Conduct regular security audits and assessments, to identify vulnerabilities in the network and the system, and to ensure that all security controls are in place and functioning properly. - Educate and train employees on cybersecurity best practices, including how to identify and report suspicious emails, or other threats. - Implement a robust backup and recovery plan, to ensure that the organization has a copy of its data, and can restore it in case of an attack. Here are several steps your organizations can take if you suspect a ransomware attack is undergoing on your network: Disconnect infected devices from the network To prevent the ransomware from spreading and to isolate the threat, it is important to disconnect infected devices from the network as soon as possible. This can be done by unplugging the device, or by disabling the network adapter, or by disconnecting the device from the network through the network switch or router. Run a malware scan To remove Maze ransomware, it is recommended to run a malware scan on the infected device using anti-malware software, such as antimalware or anti-ransomware. This will identify and remove the ransomware, as well as any other malware that may be present on the device. Restore from backups To recover the encrypted files, it is recommended to restore from backups, if available. This can be done by restoring the files from a recent backup or by using a backup system, such as a backup server or a cloud backup service. Consult with experts If the ransomware cannot be removed, or if the encrypted files cannot be restored, it may be necessary to consult with security experts, such as forensic experts or incident response teams. These experts can help to assess the damage, to restore systems, and to prevent future attacks. How to Mitigate Maze Ransomware - The SentinelOne Singularity XDR Platform prevents Maze infections. - The SentinelOne Singularity XDR Platform will restore systems to their pre-infection state (via Repair or Rollback) - Public Decryption Tool(s) In case you do not have SentinelOne deployed, there are several steps that organizations can take to mitigate the risk of ransomware attacks: - Educate employees: Employees should be educated on the risks of ransomware, and on how to identify and avoid phishing emails, malicious attachments, and other threats. They should be encouraged to report suspicious emails or attachments, and to avoid opening them, or clicking on links or buttons in them. - Implement strong passwords: Organizations should implement strong, unique passwords for all user accounts, and should regularly update and rotate these passwords. Passwords should be at least 8 characters long, and should include a combination of uppercase and lowercase letters, numbers, and special characters. - Enable multi-factor authentication: Organizations should enable multi-factor authentication (MFA) for all user accounts, to provide an additional layer of security. This can be done through the use of mobile apps, such as Google Authenticator or Microsoft Authenticator, or through the use of physical tokens or smart cards. - Update and patch systems: Organizations should regularly update and patch their systems, to fix any known vulnerabilities, and to prevent attackers from exploiting them. This includes updating the operating system, applications, and firmware on all devices, as well as disabling any unnecessary or unused services or protocols. Implement backup and disaster recovery: Organizations should implement regular backup and disaster recovery (BDR) processes, to ensure that they can recover from ransomware attacks, or other disasters. This includes creating regular backups of all data and systems, and storing these backups in a secure, offsite location. The backups should be tested regularly, to ensure that they are working, and that they can be restored quickly and easily.
<urn:uuid:b1dd4149-8c63-41b7-a375-148fa83463b7>
CC-MAIN-2023-14
https://www.sentinelone.com/anthology/maze/
s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296948951.4/warc/CC-MAIN-20230329054547-20230329084547-00067.warc.gz
en
0.944073
2,243
2.75
3
The research project is run by the university's interdisciplinary Neuronano Research Center (NRC), coordinated by Jens Schouenborg at the Faculty of Medicine and funded by a Linnaeus grant and the Wallenberg Foundation, among others. The work has involved scientists from the Faculty of Medicine and from the Nanometer Consortium, directed by Lars Samuelson, LTH. "We studied two of the brain tissue's support cells: on the one hand, microglia cells, whose job is to 'tidy up' junk and infectious compounds in the brain and, on the other hand, astrocytes, who contribute to the brain's healing process. The microglia 'ate' most of the nanowires. In weeks 6 and 12 we could see remains of them in the microglia cells," says Nils Danielsen, a researcher with the NRC. The number of nerve cells remained constant for test and control groups, which is a positive sign. The greatest difference between the test and control groups was that the former had a greater astrocyte reaction at one week, but this level eventually declined. At weeks 6 and 12 the scientists were not able to detect any difference at all. "Together with other findings and given that the number of microglial cells decreased over time, the results indicate that the brain was not damaged or chronically injured by the nanowires," Christelle Prinz concludes. |Contact: Kristina Lindgarde| Swedish Research Council
<urn:uuid:3db93573-d409-48ad-b2bc-51f4dbd1128b>
CC-MAIN-2014-35
http://www.bio-medicine.org/biology-news-1/Nanowire-biocompatibility-in-the-brain-3A-So-far-so-good-10481-2/
s3://commoncrawl/crawl-data/CC-MAIN-2014-35/segments/1408500820617.70/warc/CC-MAIN-20140820021340-00289-ip-10-180-136-8.ec2.internal.warc.gz
en
0.954345
310
2.625
3
As explained in the Overview, basic problems addressed by regulation include the control of market power and an asymmetry between the government and the operator with respect to objectives and information. It is also noted that there are three basic approaches to dealing with these problems, (a) subjecting the operator to competitive pressures, (b) gathering information on the operator and the market, and (c) applying incentive regulation.1 Regulators typically use some combination of these three approaches and the proper mix depends on the country’s needs and objectives, institutional capabilities and arrangements, cost of obtaining information, and potential for competition. This chapter examines issues of subjecting the operator to competitive pressure. Competition is useful because it reveals actual customer demand and induces the operator to provide service quality levels and price levels that customers want, subject to the operator’s financial need to cover its costs. In other words, competition can align the operator’s interests with the customers’ interests and can cause the operator to reveal his true costs and other private information. The remainder of this chapter is organized as follows. Monopoly and market power are examined first, explaining factors that give rise to monopoly and market power, and the effects of these market structures. Market structure refers to the number of firms involved in supplying a market and the relationships among those firms. Competition in the market, which is the traditional view of competition, is covered next. Facilitating competition, structuring a utility industry for competition, assessing market competition, and issues of competition for the market are then reviewed. Competition for the market is an approach used when it is impractical or inefficient to have more than one operator serve a market. Issues examined include auctions, bidding, and contracting. Chapter IV considers competition between markets. Following this chapter’s narrative is a list of references that is organized by topic.
<urn:uuid:beb8bff1-67dc-4c47-b78b-32abdeedcbb9>
CC-MAIN-2016-50
http://regulationbodyofknowledge.org/market-structure-and-competition/
s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541864.44/warc/CC-MAIN-20161202170901-00354-ip-10-31-129-80.ec2.internal.warc.gz
en
0.961948
371
3.5
4
Survivor: Africa winner Ethan Zohn has been fighting a difficult battle with Hodgkins Lymphoma the last nine months. After his initial rounds of radiation and chemotherapy failed to put him into remission, Zohn opted for a high dose radiation treatment followed by a stem-cell transplant. Now that his radiation therapy is completed, doctors did a test called a PET scan to see how he responded, and the news is very good- there are no active cancer cells in his body! In about two weeks, Zohn will start the one month long stem-cell transplant procedure (see link above for details). Girlfriend, Jenna Morasca, is excited about the results, “I always knew he could beat it. This is the best Christ-makah present anyone could ask for.” A PET scan, which is short for Positron Emission Tomography, is an imaging technique which, unlike CT scans or x-rays, doesn’t show anatomy as much as it shows how a particular area is functioning. It is frequently used to detect cancers, and assess neurologic and cardiovascular problems. The most common form of a PET scan begins with an injection of a glucose-based radiopharmaceutical (FDG), which travels through the body. Glucose, a basic sugar molecule, is used in the metabolism of all cells, but shows a greater uptake in cells with high metabolic rates, such as cancer cells. Therefore areas of cancer will take up more of the radioactive glucose and will be visible on the scan performed by the PET scan machine. The machine is very sensitive and the amount of radioactivity used is too small to affect normal body activities. A Typical Pet Scan Machine PET Scan of a patient with Lymphoma with involvement in the brain, chest and spleen
<urn:uuid:da831e87-25fe-456e-bb9a-b2d3284ca794>
CC-MAIN-2017-13
http://www.celebritydiagnosis.com/2009/12/update-ethan-zohn-gets-early-christ-makah-present/
s3://commoncrawl/crawl-data/CC-MAIN-2017-13/segments/1490218189090.69/warc/CC-MAIN-20170322212949-00123-ip-10-233-31-227.ec2.internal.warc.gz
en
0.960156
366
2.53125
3
What Causes Tomato Early Blight? September 7, 2018 High humidity and water on foliage spreads diseases such as early blight in tomatoes. Early blight also infects eggplant, peppers and potatoes. Good ventilation and air movement are necessary to reduce disease pressure. Be sure to use fans in enclosed growing spaces and allow enough space between plants to keep the air moving around them.
<urn:uuid:e7504363-51e4-4225-8ba3-6d4700dd9aae>
CC-MAIN-2019-04
https://lesliehalleck.com/blog/tomato-blight
s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547584415432.83/warc/CC-MAIN-20190123213748-20190123235748-00560.warc.gz
en
0.942088
76
3.078125
3
What seniors need to know about them As we age, our bodies begin to show signs of deterioration and send signals that prompt the need for medical care. The eye is certainly no different from any other part of our bodies in the aging process, and cataracts are a common manifestation of aging. A cataract is not a growth, but a clouding or opacification of the natural lens of the eye and is predominantly seen in those above age 65. While people in their 40s and 50s often have early findings of cataracts, it usually does not significantly affect the vision until later years. The amount and pattern of cloudiness and age of onset varies among individuals and with other contributing factors as described below. If the cloudiness is not near the center of the lens or not very dense, one may not even be aware that cataracts is present early on. There are many different types of cataracts and accompanying symptoms that alert one for the need of medical care. The types of cataracts include subcapsular cataract occurring just inside the back surface of the lens, nuclear cataract forming in the central nucleus of the lens, and cortical cataract detected by white, wedgelike opacities starting in the periphery of the lens and reaching to the center in spoke-like fashion. The associated symptoms depend on the diagnosed type of cataracts. Some of the symptoms include: • Cloudy or blurred vision • Glare or light sensitivity • Poor night vision caused by headlight glare and difficulty seeing in dim light • Double vision in one eye • Frequent prescription changes for glasses or contact lens • Need for brighter light to read • Fading or yellowing of colors. As much as it is important to know the symptoms, it is equally important to know what cataracts are NOT: • A growth or a film on the eye surface • Caused by overusing the eyes • Spread from one eye to another • A cause of irreversible blindness. Medical research has identified many contributing factors to the development of cataracts besides the predominant cause of aging. These include family history, other medical issues particularly diabetes and obesity, smoking, significant alcohol consumption, injury to the eye, medications like steroids, and long-term and unprotected exposure to sunlight. When symptoms begin to appear in the early stages of cataracts, glasses may be sufficient to maintain visual acuity. As the cataracts progresses enough to seriously impair your vision and affect daily life, surgery is required. There is no medication that reverses cataracts. It is not true that cataracts need to be “ripe” before they can be removed or that they need to be removed just because they are present. surgery can also be indicated when decreased vision impairs performance of daily activities, including sight necessary to drive safely, to perform job duties, or for taking medications and the like. Medical advancements are such that cataracts surgery has proven to be extremely successful in the removal of cataracts. Cataract surgery is usually performed under topical anesthesia, with minor sedation, as an outpatient procedure. The cloudy lens is removed from the eye, and in almost all cases, the focusing power of the natural lens is restored by replacing it with a permanent intra-ocular lens implant, or IOL. No sutures are needed. This delicate surgery is performed by ophthalmologists using a microscope, miniature instruments and other modern laser technologies. Improved vision is the result in over 98 percent of cases, unless there is a problem with the cornea, retina, optic nerve or other structures of the eye. Following surgery, patients are usually required to use eye drops and allow the physicians post-op review until healing has properly taken place. Ophthalmologists recommend annual eye examinations for everyone over the age of 60. This allows preventative measures to be taken to help ward off some of the effects of aging on the eye. Other recommendations include avoiding UV light, overall health and nutrition, cutting out nicotine and managing screen time. Dr. Bruce Henderson, cataract and glaucoma specialist with Highland Clinic Ophthalmology, has been practicing since 1986. He established the Eye Surgery Center in 2003, a facility for cataract, glaucoma and LASIK procedures. In addition to his private practice in Shreveport, Dr. Henderson serves patients in Minden and Springhill offices. He has been published numerous times in noted ophthalmology and surgical publications and has also served as clinical assistant professor of ophthalmology at Louisiana State University Medical Center in Shreveport. For more information visit https://www. hendersoneyesite.com/cataract/ To schedule a consultation with Dr. Henderson, contact Highland Clinic Ophthalmology, 471 Ashley Ridge Blvd., Shreveport, 318-795-4770.
<urn:uuid:1fac5f6b-9b7c-4967-949c-a96b9cc6a237>
CC-MAIN-2019-51
https://theforumnews.com/article-3388-cataracts.html
s3://commoncrawl/crawl-data/CC-MAIN-2019-51/segments/1575540533401.22/warc/CC-MAIN-20191211212657-20191212000657-00318.warc.gz
en
0.944918
1,005
3.328125
3
Once a world leader in educational performance, the U.S. was the first country to offer free public secondary education to all young people and led the world in number of people earning post-secondary degrees after World War II. Recently, however, there is growing awareness that the U.S. faces a national crisis in education and that our schools must improve dramatically in order to maintain our position in the competitive world economy. As a whole, the U.S. public education system does not produce students who are ready for college or competition in the global marketplace. In fact, students in the U.S. perform significantly less well academically than their peers from other industrialized nations – the United States now scores 17th in reading, 31st in math, and 23rd in science, as measured by the Program for International Student Assessment (PISA). This is despite the fact that we spend more per student on education than any other developed country. In addition, there is a persistent student achievement gap along income and ethnic lines. The broader social costs of this educational decline could be significant. A 2010 study conducted by the Hoover Institute and the OECD concluded that if the U.S. could boost average PISA scores by 25 points over 20 years, it could result in a $41 trillion gain for the U.S. economy over the lifetime of youth born in 2010. Over the last decade, a number of results-oriented leaders in states, districts, charter management organizations, and nonprofits have led the reform of U.S. public education. These leaders bring new urgency, new ideas, and new strategies to address current challenges and drive higher and more equitable outcomes for students. Some of the new ideas prove to be critical levers for change, others face significant resistance or political challenges, and others have not delivered expected results. All hold lessons for how future educational leaders can contribute to solving one of the most important issues facing our nation. This course will provide an overview of the critical issues facing K-12 public education in the United States and innovative reform strategies designed to drive higher academic achievement for all students. Students will examine the complexities of the existing education system, entrepreneurial strategies to address core challenges, and leadership styles and approaches to bring about systemic change. Students will learn about efforts underway by the federal government, state education departments, school districts, charter management organizations, and nonprofits. The course has four modules: - Understand the Context of Public Education – This module will set the stage to understand the current issues facing public education in the U.S. We will discuss the achievement gap and economic impact and then explore opportunities and challenges to improve our schools. - Get, Grow, and Keep the Best Talent – This module will explore the human capital challenge facing public education. We will examine innovative strategies to prepare, recruit, evaluate, and retain effective teachers and school leaders. Sessions will focus on teacher preparation, measuring teacher effectiveness, and principals as instructional leaders and CEOs. - Focus on Performance – This module will examine various theories of action to improve student outcomes as well as strategies to raise standards and hold people accountable. Sessions will focus on accountability and empowerment as well as new initiatives (such as the Common Core State Standards) to raise the bar for students. - Create Systems of Great Schools – This module will focus on how to move beyond pockets of excellence in individual classrooms and schools to create systems of great schools so that every student receives an excellent education. Building on strategies explored in the talent and performance modules, sessions will focus on different public school models (e.g., district, charter), a portfolio approach that includes launching new schools and closing underperforming schools, and transformative reform at the district and state level. Adjunct Associate Professor Tracy Breslin has dedicated her career to ensuring that all students – regardless of background – have access to a high-quality education that prepares them to succeed in school and life. Tracy has over seventeen years of experience in education and nonprofit management. Tracy has served as a talent management consultant since 2011, working with a variety of urban school districts and state...
<urn:uuid:b6dc3b19-e276-44ee-bd2f-2440eb44e7d2>
CC-MAIN-2017-17
http://www8.gsb.columbia.edu/courses/mba/2014/spring/b8558-001
s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917118713.1/warc/CC-MAIN-20170423031158-00527-ip-10-145-167-34.ec2.internal.warc.gz
en
0.946721
825
3.390625
3
By H.G. Muller A staple food in many diets, bread has been baked since ancient times and is considered a basic necessity by many. Baking and Bakeries charts the history of baking, from the ancient breads cooked with grain-paste through the introduction of yeast, to modern day variations. The author describes the different methods used in baking and the range of tools and machinery used. Focusing chiefly on the industrial bakeries of the Victorian era, with a final chapter addressing modern day improvements, this book takes a look at the development of the industry as well as the traditions of baking that have survived for centuries.
<urn:uuid:51e0acce-8d11-47d0-aa3b-c39ec22521e7>
CC-MAIN-2016-44
https://www.plimoth.com/products/baking-and-bakeries
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720972.46/warc/CC-MAIN-20161020183840-00556-ip-10-171-6-4.ec2.internal.warc.gz
en
0.95582
126
2.9375
3
|The Promise of Increased Unemployment| Fiscal contractions raise both short-term and long-term unemployment, as shown in Chart 3, but the impact is much greater on the latter. Long-term unemployment refers to spells of unemployment lasting more than six months. Moreover, within three years the rise in short-term unemployment due to fiscal consolidation comes to an end, but long-term unemployment remains higher even after five years. Fiscal consolidations thus add to the pain of those who are likely to be already suffering the most—the long-term unemployed. This is a particular worry today since the share of long-term unemployed increased in most Organization for Economic Cooperation and Development countries during the Great Recession. And even in countries where it did not increase—such as France, Germany, Italy, and Japan—the share had already been very high even before the recession. Job loss is associated with persistent earnings loss, adverse impacts on health, and declines in the academic performance and earnings potential of the children of displaced workers (see “The Tragedy of Unemployment,” in F&D, December 2011). These adverse effects are exacerbated the longer a person is unemployed.
<urn:uuid:24cb6f47-9dba-4faf-8d0f-a6993df81e64>
CC-MAIN-2017-34
http://titanicsailsatdawn.blogspot.com/2011_09_14_archive.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886105086.81/warc/CC-MAIN-20170818175604-20170818195604-00128.warc.gz
en
0.96114
240
3
3
Donal Manahan, February 1, evening — A month ago, as I was making my last preparations to leave for Antarctica, I wrote on this blog about my goals for this expedition. I hoped we could show this new group of young polar scientists why the earth’s poles are so important. We certainly achieved that goal. The group gained many new insights during this short but intense program in understanding how millions of years of evolution in ice-cold environments have shaped the biology of Antarctic organisms. Those insights will further predictions on how cold-environment species might adapt to warming events. I was particularly impressed by how well research group members worked together across disciplines on so many different projects. Mathematical modelers worked with experts on patterns of gene expression. Ecologists collaborated with physicists. Everyone worked together and respected each other’s knowledge base. They learned a lot, and had fun in the process! I also wanted to explain to our young scientists the fascinating history of the heroic age of Antarctic exploration — not just the geographic aspect of being the first to reach the South Pole, but the pioneering work of the scientists who accompanied Scott and Shackleton to this area more than 100 years ago. How remarkable it is to visit the standing record of the first human presence in this area of Antarctica. Our group photo below shows all of us standing in front of Captain Scott’s hut, built in February 1902. This is where the first scientific measurements in the McMurdo region were made. In the background is the modern research station of the United States Antarctic Program — our home for the past month. The students and postdoctoral fellows in this National Science Foundation project certainly gained a better understanding of how to live and work in Antarctica. They undertook measurements in the field and learned how to plan the extensive logistical support needed to stay safe while working “on the ice.” I am confident the program inspired and trained a new group of international polar scientists. When they return to their home institutions, they will share their excitement and personal experiences with their colleagues and the public. By becoming new ambassadors for Antarctica, they will help society understand the importance of the poles for the future well-being of the entire planet. Donal Manahan is professor of biological sciences and director of USC’s Wrigley Institute for Environmental Studies.
<urn:uuid:5c62582b-c8d8-4710-b37b-1642dccf37be>
CC-MAIN-2015-35
http://summerinantarctica.usc.edu/
s3://commoncrawl/crawl-data/CC-MAIN-2015-35/segments/1440644066275.44/warc/CC-MAIN-20150827025426-00295-ip-10-171-96-226.ec2.internal.warc.gz
en
0.952911
474
3.28125
3
In recent years, most state governments have experienced painful budget deficits. Many states have reacted to these shortfalls by cutting spending or increasing taxes. Almost all states now have a third option that can help postpone these painful decisions: using a rainy day fund (RDF). Like a savings account, an RDF sets aside surplus revenue during periods of economic growth for use in times of budget shortfalls. This policy brief takes a closer look at how rainy day funds can help states through difficult fiscal times, and assesses options for improving the adequacy of these funds. Why Are Rainy Day Funds Needed? Rainy day funds are an important component of a responsible state budget process for a simple reason: taxes and public spending operate on different cycles. During periods of economic growth, tax collections can exceed a state’s spending needs—creating a short term budget surplus. When the economy slows down, tax collections generally decline but the need for important public services (especially services for low- and middle income taxpayers) continues unabated, resulting in short-term budget deficits. This cyclical “boom and bust” feature of state tax systems means that budget surpluses and deficits are a regularly occurring feature of state tax systems. Even a state that makes no changes at all to its taxing and spending habits will ultimately experience shortfalls because of this cycle. Rainy day funds smooth out the highs and lows of this cycle by setting aside surplus revenue in good years, and using these savings to offset budget shortfalls in bad years. States that have the luxury of drawing down rainy day funds during economic downturns are likely to have a more stable fiscal structure over time, because these states can balance budgets without having to constantly change their tax system and spending priorities. The ability of an RDF to effectively smooth out this budgetary cycle without tax and spending changes is a desirable feature in state fiscal structures for several reasons: ✔ Unstable fiscal structures make for a bad investment climate: when individuals and businesses don’t know whether a state will change its tax system (or the quality of its public services) during the next recession, the state becomes a less attractive place to live, work and invest. ✔ An adequate RDF makes it easier for states to borrow money for financing long-term capital investments. Bond rating agencies consistently cite healthy RDFs as a reason for giving states high bond ratings. Good bond ratings directly reduce the cost of borrowing for a state, which in turn reduces the cost of providing public services in the long run. ✔ Rainy day funds allow policymakers to avoid fiscal policy decisions that can worsen economic downturns. When budget shortfalls are caused by short-term economic declines, tax hikes or spending cuts can actually prolong the economic slump. Designing an Effective Rainy Day Fund The recent nationwide recession has shown that some rainy day funds are more effective thanothers. This section looks at important features of state rainy day funds. ☞ How is money deposited into the fund? Most states specify conditions under which deposits will be automatically made. The most common approach is to link RDF deposits to a state’s year-end budget surplus. Texas requires that half of any year-end surplus be devoted to its RDF. However, this process is not as automatic as it sounds: because deposits are made at the end of the year, every other spending priority of state lawmakers comes first. Lawmakers can avoid depositing revenues in the RDF by simply spending all surplus revenues before the end of the fiscal year. A more effective approach is to require that some revenue must be deposited during any year when state revenues grow by some minimal amount. For example, Indiana requires that revenues be deposited in its RDF in any year when income grows by more than two percent. This approach ensures that deposits will be made. However, if the threshold for depositing revenues is too low, lawmakers may be forced to deposit revenues in the RDF at a time when they cannot afford to. A few states have no rules specifying conditions when RDF deposits must be made, and simply allow lawmakers to deposit revenues when it suits them. The main shortcoming of this approach is that these RDF’s are much more likely to be chronically underfunded. ☞ Is there a limit on the size of the fund? Almost all states impose some limit on the amount of revenue that can be put in their rainy day funds. A commonly cited rule of thumb has been that a fund capped at five percent of a state’s budget should be sufficient to ride out an economic downturn. Almost half of the states with rainy day funds now cap their fund at 5 percent of their budget or less. A few states impose a cap of more than 10 percent, and 13 states have no limit at all. While many states have used the 5 percent limit as a rule of thumb, the recent experience of these states suggests that a 5 percent limit is simply insufficient to cope with the extended economic shortfalls that many states have experienced in recent years. A higher cap of at least 10 percent could help states use these funds properly in the next recession. ☞How is money withdrawn from the fund? In most states, a simple majority of lawmakers can vote to use the RDF. However, some states require a supermajority of 60 percent or more. Many states also limit the total amount that can be withdrawn in any year. All such limits make RDFs less flexible as a fiscal policy tool—and increase the likelihood that state lawmakers will have to rely on tax hikes or spending cuts to get through a recession. ☞Is there a replenishment rule? Some states require any RDF withdrawals to be paid back promptly. For example, Rhode Island requires any withdrawals from its RDF to be replaced within two years. This constraint can reduce the usefulness of rainy day funds: if lawmakers must promptly replenish these funds, doing so will have to compete with other spending priorities—forcing exactly the sort of painful spending cuts that RDFs are designed to prevent. An Important Tool For Dealing with Cyclical Deficits An adequate, accessible rainy day fund can help state lawmakers to avoid enacting painful tax increases or cuts in public services by providing a third option—drawing down the state’s savings account to get through tough times. But rainy day funds should only be used to reduce the impact of budget shortfalls that arise from cyclical economic downturns—not to cope with long-term structural problems. In particular, states in which the tax structure is simply inadequate to fund public services over the long run should look to structural tax reform as a solution rather than relying on rainy day funds to balance their budgets.
<urn:uuid:c17e1283-7061-4f68-8188-b452e51352e5>
CC-MAIN-2018-05
https://itep.org/a-primer-on-state-rainy-day-funds/
s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084886979.9/warc/CC-MAIN-20180117212700-20180117232700-00105.warc.gz
en
0.950834
1,378
2.640625
3
CLICK HERE for The Top-Rated & Best-Selling Health and Personal Care Products Eczema Treatment – Triggering Factors to Steer Clear Of Avoid the affected skin from coming in contact with fabrics such as nylon, polyester and wool. Unless lined with cotton material, do without clothing items that use latex, rubber and other synthetic materials. Fabrics that are less likely to trigger flare ups are cotton and linen. They are also best as beddings. If doing housework is unavoidable, protect your hands. For doing the laundry, use PVC gloves to protect the skin from hard water and harsh detergents. For gardening and cleaning the house, use cotton gloves. They will prevent unnecessary cleaning of the hands with soap and water afterwards. When buying cosmetics, you should opt for fragrance- and alcohol-free items. Try to apply the makeup on small areas of the unaffected skin before applying them on your face. Never apply make ups on lesions to hide them. They will only worsen and get more noticeable. Skin dryness causes itchiness; that is why you should avoid contact with alkalis. They include soaps, shampoos, detergents, shaving creams and others. Try to look for items that are hypoallergenic and contain no harmful chemicals. Sweat can irritate eczematous skin as well. If you need to perform an exercise regimen, try to do so in cool and well-ventilated areas. Also, doing them in short sessions will be a lot easier on your skin. Weather and Allergens in the Air There is a reason why eczema is more common in industrialized and urban areas. Exposure to air pollution and smog will only increase the risks of having flare ups. Skin dryness is also affected by extremes in temperature, such as a very cold, and hot and humid weather conditions. It is best if you install a humidifier if your house has central heating or air conditioner. Try to keep the house free of dust; vacuuming of curtains and carpets must be done on a weekly basis. Steer away from house dust mites, molds, pollen grains and animal dander such as hair, feather and scales. For beddings, change or wash them weekly with mild detergent and rinse them thoroughly to help in lessening the occurrence of flare ups. Researches have shown that certain foods, especially in infants and young children afflicted with the skin disease, have an adverse reaction on eczema. However, such adverse reactions tend to dissipate as they grow older. The best way to find out which food items cause flare ups is to monitor daily what you put in your mouth. This way, you can avoid consuming them next time, so the eczema symptoms are put off as much as possible. Some of the foods that tend to cause flare ups include milk, eggs, peanuts, wheat and sea foods. It has also been shown that certain food preservatives and additives such as sulfites and MSG may also contribute to flare ups. The best eczema treatment around is the one which helps prevent the occurrence of flare ups. With lesser flare ups, the lesser you need to take prescribed medications for alleviating the symptoms and tolerate their side effects. Selected ArticlesHow To Deal With Eczema Eczema Treatments Available For Patients Eczema Treatment And Prevention Of Symptoms Aggravation Eczema Treatment – Different Methods Eczema Treatment At Home Are Alternative Eczema Treatments Really Effective? Eczema Treatment The Herbal Way – Is It For You? Natural Treatment For Eczema Eczema Treatment For Newbies Eczema Treatment – Conventional Vs. Natural Eczema Treatment Using Light Wet Wrap Therapy Can Be Used As Eczema Treatment Eczema Treatment – The Use Of UV Light Is An Eczema Treatment Using Antihistamines The Best For You? Eczema Treatment, The Natural Way Eczema Treatment – Triggering Factors To Steer Clear Of Eczema Treatment – Corticosteroids And The Side Effects Eczema Treatment Cannot Begin Without Knowing What Caused It Supplements Are Also Useful For Eczema Treatment Eczema Treatment – What’s A Pregnant Woman With Eczema To Do? Corticosteroid Creams And Ointments Are Commonly Used For Eczema Treatment Oral Eczema Treatment What Happens After Eczema Treatment Eczema Treatment For Kids – Keeping The Skin Moisturized
<urn:uuid:12f35796-bc13-4e7b-9134-436fe8d482ad>
CC-MAIN-2020-10
http://eczema-treatment.bafree.net/eczema-treatment---triggering-factors-to-steer-clear-of.php
s3://commoncrawl/crawl-data/CC-MAIN-2020-10/segments/1581875144167.31/warc/CC-MAIN-20200219184416-20200219214416-00152.warc.gz
en
0.912221
954
2.515625
3
Japanese nuclear scientists say they plan to create a controlled nuclear meltdown looking for clues how to deal with possible future disasters. The Japan Atomic Energy Agency said Thursday said it will use a scaled-down nuclear reactor to deliberately create conditions of a serious malfunction. The experiment will start later this year at a research facility in Ibaraki, north of Tokyo. Meltdowns occur when the nuclear fuel in the reactor's core, normally very hot in order to create steam for turbines that create electricity, overheats beyond its melting point. This can cause explosion and release of radioactive material, as has happened at the Fukushima nuclear plant in 2011, after it was hit by an earthquake and tsunami. But Edwin Lyman, a senior scientist at The Union of Concerned Scientists, says Japanese researchers are going to take only a small sample of the fuel that was in the Fukushima reactor and will subject it to conditions that will cause it to melt, so they can actually study how this process occurs. "This type of experiment is usually under very carefully controlled conditions," he said. "The amount of material involved is very small and the facility is going to be secured and filtered. So I think there's very little risk associated with this experiment to the public." Lyman added for many decades similar experiments have been carried out in many different facilities on a very limited basis. "They are, however, very expensive and preparations are extremely difficult, so there's relatively little data available from this type of experiment, and this is one of the reasons why the Japanese are doing this one now," he said. Since the accident at Fukushima plant, the Japanese public has become much more interested in the prevention of future accidents. Similar tests have been conducted by all major nations with nuclear power plants, including the United States, but never in Japan.
<urn:uuid:bbea9516-7724-47a4-9bd5-b15de591d1d3>
CC-MAIN-2017-22
http://www.voanews.com/a/scientists-plan-a-controlled-nuclear-meltdown/1826672.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463607862.71/warc/CC-MAIN-20170524211702-20170524231702-00464.warc.gz
en
0.97176
367
3.796875
4
A new study published in the journal Radiology shows that mammography reduced the number of deaths from breast cancer by at least 30 percent, reports the Los Angeles Times' Thomas Maugh. The study is the longest ever done on the women who undergo mammography, tracking patients in Sweden for 30 years, and showing that one death from breast cancer can be prevented for every 414 to 519 women who undergo the procedure, Maugh says. Previous studies had projected that mammography could save one out of 1,000 or 1,500 women tested. Some critics have said that too much screening can result in false positives and unnecessary invasive procedures, but the study's authors say that, while overdiagnosis is a problem, it is less than half the number of lives saved. The study, however, did not stratify women by age, and doesn't answer the controversial question of whether women in their 40s need frequent screening, Maugh says. "The findings are unlikely to change clinical practice in this country because professional groups already recommend routine screening," he adds. "But because the screening seems so effective, they might reduce the pressure to extend the period between mammograms and to limit the tests for younger women." Jul 02, 2011
<urn:uuid:0393351f-ea1b-43bf-bdaa-48257f7bc9f3>
CC-MAIN-2021-25
https://www.genomeweb.com/archive/fewer-deaths
s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623488517820.68/warc/CC-MAIN-20210622124548-20210622154548-00474.warc.gz
en
0.966383
247
2.984375
3
Otto Hahn Group Cognitive Neurogenetics Humans have the ability to generate and experience thoughts and feelings that can be independent of instantaneous input from the environment. These integrative mental processes, such as social cognition and emotion, support adaptation to changing environmental demands, well-being, and, ultimately, survival. Integrative mental processes are likely enabled by the unique structural and functional network organization of the human brain. Indeed, contemporary accounts suggest that mammalian neural processing is organized along multiple hierarchies that define how information from nearby and distant neural populations is integrated and segregated across the cortex. These hierarchies are expressed in fundamental anatomical, topological, and genetic patterns, which vary as a function of processing complexity. The goal of the Otto Hahn group is to investigate how heritable and environmental factors shape brain structure and function. We are particularly interested in studying the neurogenetic basis of integrative cognitive and affective processes, such as social cognition, as these functions are especially developed humans and have great environmental relevance.
<urn:uuid:391d1f70-2e96-45d6-b312-546160f90b4d>
CC-MAIN-2020-40
https://www.cbs.mpg.de/independent-research-groups/cognitive-neurogenetics
s3://commoncrawl/crawl-data/CC-MAIN-2020-40/segments/1600401585213.82/warc/CC-MAIN-20200928041630-20200928071630-00291.warc.gz
en
0.935834
202
2.65625
3
On April 19, the Government Accountability Project released Deadly Dispersants in the Gulf: Are Public Health and Environmental Tragedies the New Norm for Oil Spill Cleanups? The report details the devastating long-term effects on human health and the Gulf of Mexico ecosystem stemming from BP and the federal government’s widespread use of the dispersant Corexit, in response to the 2010 Deepwater Horizon oil spill. Evidence suggests that the cleanup effort has been more destructive to human health and the environment than the spill itself. GAP launched this effort in August 2011 after repeatedly hearing from Gulf residents and cleanup workers that official statements from representatives of BP and the federal government were false and misleading in the wake of the Deepwater Horizon disaster. Over the next 20 months, GAP collected data and evidence from over two dozen employee and citizen whistleblowers who experienced the cleanup’s effects firsthand, and GAP studied data from extensive Freedom of Information Act (FOIA) requests. Taken together, the documents and the witnesses’ testimony belie repeated corporate and government rhetoric that Corexit is not dangerous. Worse than this, evidence suggests that the cleanup effort has been more destructive to human health and the environment than the spill itself. Conclusions from the report strongly suggest that the dispersant Corexit was widely applied in the aftermath of the Deepwater Horizon explosion because it caused the false impression that the oil disappeared. In reality, the oil/Corexit mixture became less visible, yet much more toxic than the oil alone. Nonetheless, indications are that both BP and the government were pleased with what Corexit accomplished. To produce the report, GAP investigators interviewed 25 whistleblowers who provided firsthand accounts of Corexit’s impact. While many chose to remain anonymous – including government officials – 16 whistleblowers provided full affidavits about their experiences, made publicly available in the report (excerpts from these affidavits can be found below). Witnesses interviewed include cleanup workers, professionals (doctors, industry leaders), divers contracted by the federal government, and Gulf residents. The interviewees represent different geographic areas and are diverse in terms of age and gender. GAP worked closely with the nonprofit Louisiana Environmental Action Network (LEAN), which was instrumental in supporting this investigation. GAP has also teamed up with TakePart to tell the EPA: Ban Corexit! Sign our petition today! Read Mark Hertsgaard’s in-depth Newsweek/The Daily Beast story on GAP’s report here. Select Report Findings Existing Health Problems - Eventually coined “BP Syndrome” or “Gulf Coast Syndrome,” all GAP witnesses experienced spill-related health problems. Some of these effects include: blood in urine; heart palpitations; kidney damage; liver damage; migraines; multiple chemical sensitivity; neurological damage resulting in memory loss; rapid weight loss; respiratory system and nervous system damage; seizures; skin irritation, burning and lesions; and temporary paralysis. - Interviewees are also extremely concerned about recognized long-term health effects from chemical exposure (from those specific chemicals found in Corexit/oil mixtures), which may not have manifested yet. These include reproductive damage (such as genetic mutations), endocrine disruption, and cancer. - Blood test results from a majority of GAP interviewees showed alarmingly high levels of chemical exposure – to Corexit and oil – that correlated with experienced health effects. These chemicals include known carcinogens. The Failure to Protect Cleanup Workers - Contrary to warnings in BP’s own internal manual, BP and the government misrepresented known risks by asserting that Corexit was low in toxicity. - Despite the fact that the Occupational Safety and Health Administration has developed a highly-lauded safety training program for cleanup workers, the workers interviewed reported that they either did not receive any training or did not receive the federally required training. - Federally required worker resource manuals detailing Corexit health hazards (according to a confidential whistleblower) were not delivered or were removed from BP worksites early in the cleanup, as health problems began. - A FOIA request found that government agency regulations prohibited diving during the spill due to health risks. Yet, divers contracted by National Oceanic and Atmospheric Administration and interviewed by GAP dove after assurances that it was safe and additional protective equipment was unnecessary. - BP and the federal government, through their own medical monitoring programs, each publicly denied that any significant chemical exposure to humans was occurring. Of the workers GAP interviewed, 87% reported contact with Corexit while on the job and blood test results revealed high levels of chemical exposure. - BP and the federal government believed that allowing workers to wear respirators would not create a positive public image. The federal government permitted BP’s retaliation against workers who insisted on wearing this protection. Nearly half of the cleanup workers interviewed by GAP reported that they were threatened with termination when they tried to wear respirators or additional safety equipment on the job. Many received early termination notices after raising safety concerns on the job. - All workers interviewed reported that they were provided minimal or no personal protective equipment on the job. Ecological Problems & Food Safety Issues - A majority of GAP witnesses reported that they found evidence of oil or oil debris after BP and the Coast Guard announced that cleanup operations were complete. - BP and the federal government reported that Corexit was last used in July 2010. A majority of GAP witnesses cited indications that Corexit was used after that time. - The oil-Corexit mixture coated the Gulf seafloor and permeated the Gulf’s rich ecological web. GAP witnesses have revealed underwater footage of an oil-covered barren seafloor, documenting widespread damage to coral reefs. - The FDA grossly misrepresented the results of its analysis of Gulf seafood safety. Of GAP’s witnesses, a majority expressed concern over the quality of government seafood testing, and reported seeing new seafood deformities firsthand. A majority of fishermen reported that their catch has decreased significantly since the spill. - BP’s Gulf Coast Claims Fund (GCCF) denied all health claims during its 18 months of existence. Although a significant precedent, the subsequent medical class action suit excluded countless sick individuals, bypassed the worst health effects resulting from exposure to dispersant and oil, offered grossly inadequate maximum awards compared to medical costs, and did not include medical treatment. The BP spill was the worst environmental disaster in American history, but the government’s consent to BP’s use of Corexit has caused long-term human and ecological tragedies that may be worse than the original spill. As deepwater drilling expands off U.S. coasts, it is inevitable that other incidents will occur. Renewed reliance on Corexit is planned for future oil spills, and BP has declared it will continue to use the deadly dispersant as long as the government permits doing so. GAP’s report illustrates that both BP and the government must take corrective action to mitigate ongoing suffering and to prevent the future use of this toxic substance. The report makes recommendations for: - A federal ban on the use of Corexit, which is already banned in the United Kingdom (BP’s home country) and Sweden. - Congressional hearings on the link between the current public health crisis in the Gulf and Corexit exposure. - The immediate reform of EPA dispersant policy, specifically requiring the agency to determine whether such products are safe for humans and the environment prior to granting approval under the National Contingency Plan (NCP). - The establishment of effective medical treatment programs – by medical experts specializing in chemical exposure – for Gulf residents and workers. - The federal government’s funding of third-party, independent assessments of both the spill’s health impact on Gulf residents and workers, and such treatment programs when established. Early, preliminary finding of this GAP investigation was reported in April 2012 by a cover story in The Nation magazine. On April 19, 2013, on the eve of the third anniversary of the Deepwater Horizon disaster, noted journalist Mark Hertsgaard published many of the full report’s findings in Newsweek/The Daily Beast. Select Excerpts from Whistleblower Affidavits As an environmental scientist, I look at the way the government and BP are handling, describing and discussing the spill … [T]he government did not account for the increased toxicity of the combined oil and Corexit. – Scott Porter, Diver, Marine Biologist [W]hen a BP representative came up on the speedboat and asked if we need anything, I again explained my concerns about breathing in the Corexit and asked him for a respirator … He explained ‘If you wear a respirator, it is bringing attention to yourself because no one else is wearing respirators, and you can get fired for that.’ – Jorey Danos, Cleanup Worker What brought all of these individuals into the same pool was the fact that their symptoms were almost identical, and were different from anything that I had ever observed in my 40 plus years as a physician … However, until people are educated about the symptoms associated with exposure to toxic waste from the spill, we cannot assume they will make the connection. I continue to witness this disconnect and these symptoms on a daily basis. – Dr. Michael Robichaux, Physician When [the national director of The Children’s Health Fund] went to Boothville Elementary in Plaquemines Parish and they opened the medical closet, it was full of nebulizers … Where’s the red flag? What is causing that many breathing problems with that number of kids? That is abnormal. At Boothville Elementary we have sick kids all over the place who are suffering from upper respiratory infections, severe asthma, skin infections, blisters in between their fingers and arms and on their legs and their feet. Some kids have blisters all around their mouths and their noses. These kids were perfectly fine before the spill and the spraying of Corexit began. – Kindra Arnesen, Louisiana Resident The MSDS [federally required chemical labeling and safety information] for Corexit list several of the health problems I am now having, and they still used … it throughout the Gulf … When I lived on the barge, for 24-hours a day I was exposed. I would be outside too, breathing in what they were burning, without a respirator or a Tyvek suit. I had an apron, a hairnet, a spatula and some rubber gloves, and they told me to go in the midst of this dangerous chemical environment. Yet they were willing to tell me that the dispersant mixed in with the oil I was cleaning was as safe as touching Dawn dishwashing soap? Then a year later I have health problems that I have never had before working on the barge… – Jamie Griffin, Cook & Cleaner on Bunkhouse for Cleanup Workers They hired people from all over who didn’t know about the conditions and real safety hazards, but you did what you had to do; you had to take the job and deal with it because you didn’t have money to go home … There was a safety culture of, ‘hush hush, it didn’t happen.’ – Anonymous Cleanup Worker EPA and BP knew of the health impacts associated with [Corexit and oil] … The issue was responding to an oil spill of this magnitude, with unprecedented quantities of Corexit, including novel subsurface application. Gulf coastal communities, and individuals who consume gulf seafood or recreate in the gulf, are the guinea pigs left to deal with the consequences and will be feeling the full effect in years to come. – Dr. Wilma Subra, Chemist, MacArthur Genius Award Recipient As part of an impromptu meeting to provide feedback from the shrimping industry to EPA and NOAA, I met with EPA Administrator Lisa Jackson in Venice on June 1, 2010. By that point, already 800,000 to 900,000 gallons of Corexit 9527A had been sprayed. I was sitting across the table from Ms. Jackson and I asked her, ‘Why is it that when you have all of this going on and three air monitors from Venice, Louisiana, EPA’s reports are not showing any high levels of chemicals?’ Ms. Jackson responded, ‘Well the levels were a little high, but we didn’t want to create a public panic.’ – Clint Guidry, President, Louisiana Shrimp Association It’s been really hard to get an accurate diagnosis or treatment, because none of the local doctors will even admit there is a problem … There’s one friend of mine who happens to be a doctor, and he’s very well aware of what’s going on but is afraid to take a hard stand on it. – Shirley Tillman, Alabama Resident, Cleanup Worker Most of our members right now who are sick are in litigation … They aren’t going to sufficiently pay our medical bills to demonstrate that they were responsible for the actions they took, just as they didn’t give us respirators to demonstrate that our working environment was unsafe. – A.C. Cooper, Vice President, Louisiana Shrimp Association Every time I check, there is still oil on the beaches and in the estuary systems and in the wetlands and the marshes. People go to the beaches and swim in the gulf, and report to me that they still come up stained with a brownish tan color that they believe is oil. – Dr. Wilma Subra, Chemist, MacArthur Genius Award Recipient * * * Climate Science Watch is a program of the Government Accountability Project.
<urn:uuid:dac9adb7-c042-447c-be79-c76631b946c4>
CC-MAIN-2020-10
http://www.climatesciencewatch.org/2013/04/19/corexit-deadly-dispersant-in-oil-spill-cleanup/
s3://commoncrawl/crawl-data/CC-MAIN-2020-10/segments/1581875144708.87/warc/CC-MAIN-20200220070221-20200220100221-00366.warc.gz
en
0.96244
2,829
2.609375
3
Public Policy: Politics, Analysis, and Alternatives (Sixth Edition) | Political Theories of Decolonization | Africa The late 1980s ushered in a new era of black politics, the socioeconomic transition era. Coming on the heels of the protest era and politics era, the current stage is characterized by the emergence of a new black middle class that came of age after the Civil Rights struggle. Although class still isn’t a strong factor in the external politics of the black community, it is increasingly a wedge issue in the community’s internal politics. Black politics today is increasingly less about the interest of the larger group and more about the interest of smaller subgroups within the community. Theodore J. Davis Jr. argues that the greatest threat to the social and political cohesiveness of the so-called black community may be the rise of a socially and economically privileged group among the ranks of black America. This rift has affected blacks’ ability to organize effectively and influence politics. Davis traces the changes in economic status, public opinion, political power and participation, and leadership over three generations of black politics. The result is an insightful analysis of black politics today. Pricing is shown for items sent to or within the U.S., excluding shipping and tax. Please consult the store to determine exact fees. No warranties are made express or implied about the accuracy, timeliness, merit, or value of the information provided. Information subject to change without notice. isbn.nu is not a bookseller, just an information source.
<urn:uuid:685dac8c-dfbf-47ec-9ee2-547e325c84ae>
CC-MAIN-2019-51
https://isbn.nu/9780415879156
s3://commoncrawl/crawl-data/CC-MAIN-2019-51/segments/1575540495263.57/warc/CC-MAIN-20191207032404-20191207060404-00282.warc.gz
en
0.900513
314
2.5625
3
Progressivism supposedly advocates equality regardless of racial origin or sexual orientation. After the mass murder-suicide of 909 progressive activists in 1978 the movement fell into obscurity, but has enjoyed a resurgence with the Democrat Party-aided rise to power of Barack Obama in the 21st century. While the term liberal describes an attitude, progressive describes an agenda. Historically, Progressives view themselves as "enlightened" social reformers apart from the ignorant and unwashed masses. Same-sex "marriage" for example is considered a progressive social reform. Colonialism and the Enlightenment Progressivism became highly significant during the Age of Enlightenment in Europe, out of the racist belief that white Europe was demonstrating that societies could "progress" in civility from uncivilized conditions to civilization through strengthening the basis of empirical knowledge as the foundation of society. Figures of the Enlightenment had the racist belief that "progress" had universal application to all societies and that these ideas would spread across the world from white Europe. By the early-20th century progressivism was tied to eugenics In the mid 19th century Social Darwinism, with its racism and commitment to science, was an important facet of Progressivism; in America however, after the Civil War, many adherents of the Social Gospel movement called themselves "progressive" and advocated for equality for Blacks and social reform. For a time there was an odd admixture of atheists and racists citing a scientific basis for their beliefs, and church people, all claiming the name progressive. In Europe however, after the First World War, Progressive atheists won a great victory with the Bolshevik Revolution in Russia, the suppression of the Russian Orthodox Church, and overthrow of the existing social order.In explaining the ruinous upheavals Progressivism brought to his homeland, Alexander Solzhenitsyn said, "while I was still a child, I recall hearing a number of older people offer the following explanation for the great disasters that had befallen Russia: Men have forgotten God; that’s why all this has happened." Alexander Solzhenitsyn on the Progressive Doctrine30 years into the leftist multicultural experiment called the Soviet Union, Alexander Solzhenitsyn did an extensive study of the Progressive Doctrine in Volume II of The Gulag Archipelago. Solzhenitsyn wrote, In this study, if nothing prevents us, we intend to make an important scientific discovery. In the development of our hypothesis we would in no way wish to come into conflict with the Progressive Teaching. The author of these lines, attracted by the enigma of the native tribe populating the Archipelago, undertook a lengthy scientific expedition there and collected abundant material. And as a result it is very easy to prove that the zeks [prisoners of the gulag ] of the Archipelago constitute a class of society. For, after all, this multitudinous group (of many millions) has a single (common to them all) relationship to production (namely: subordinate, attached, and without any right to direct that production). It also has a single common relationship to the distribution of the products of labor (namely: no relationship at all, living only that insignificant share of the products required for the meager support of their own existence). And, in addition, all their labor is no small thing, but one of the principal constituents of the whole state economy.Solzhenitsyn explains the role of thieves and criminals in a socialist society. As oppressed victims of the propertied oppressor class, thieves were "socially friendly" or "class allies" of progressives in the class war between "the haves and have nots". The fathers of the Archipelago, having, in accordance with the Progressive Doctrine, multiplied these socially friendly elements beyond all rhyme and reason...How many citizens who were robbed knew that the police, didn't even bother to look for the criminals, didn't even set a case in motion, so as not to spoil their record of completed cases - why should they sweat to catch a thief if he would be given only six months, and then be given three months off for good behavior? And anyway, it wasn't certain that the bandits would even be tried when caught. After all, prosecutors "lowered the crime rate" - something demanded of them at every conference - by the curious method of simply quashing cases, especially if they foresaw that there would be many defendants. Finally, sentences were bound to be reduced, and of course for habitual criminals especially. Watch out there now .. witness in the courtroom! They will all be back soon, and it'll be a knife in the back of anyone who gave testimony! Therefore, if you see someone crawling through a window, or slitting a pocket, or your neighbor's suitcase being ripped open - shut your eyes! Walk by! You didn't see anything! That's how the thieves have trained us - the thieves and our laws! The·thieves flourished because they were encouraged. Solzhenitsyn goes into some detail how progressives deal with political opposition and dissenters in socialist re-education camps (gulags): It has been known for centuries that Hunger . . . rules the world! (And all your Progressive Doctrine is, incidentally, built on Hunger, on the thesis that hungry people will inevitably revolt against the well-fed.) Hunger rules every hungry human being, unless he has himself consciously decided to die. Hunger, which forces an honest person to reach out and steal ("When the belly rumbles, conscience flees"). Hunger, which compels the most unselfish person to look with envy into someone else's bowl, and to try painfully to estimate what weight of ration his neighbor is receiving. Hunger, which darkens the brain and refuses to allow it to be distracted by anything else at all, or to think about anything else at all, or to speak about anything else at all except food, food, and food. Hunger, from which it is impossible to escape even in dreams - dreams are about food, and insomnia is over food. And soon - just insomnia. Hunger, after which one cannot even eat up; the man has by then turned into a one-way pipe and everything emerges from him in exactly the same state in which it was swallowed. Nine Commentaries on the Communist Party The Nine Commentaries on the Communist Party says this about the Chinese Communist Party: The level of violence employed by a form of government determines its level of civilization. By resorting to the use of violence, communist regimes clearly represent a huge step backward in the level of civilization. Unfortunately, the Communist Party has been seen as progressive by those who believe that violence is an essential and inevitable means to societal advancement." Progressive era 1892-1924 It was also meant to create a belief that conservatives are not able to think of a progressive future for the United States. The most famous historical usage of the term in America was in the 1890s to 1920s, sometimes called the Progressive Era. During the Progressive Era, politicians of both parties and various ideologies adopted the term, notably Theodore Roosevelt, a Republican who founded the Progressive Party and implemented the Civil Service Act, and Woodrow Wilson, who imposed segregation throughout the federal government. Presidential election 1948 - Main article: United States presidential election, 1948 The Progressive Party of 1948 was a creation of the Communist Party USA, growing out of CPUSA General Secretary Eugene Dennis' February 12, 1946 order "to establish in time for the 1948 elections a national third party." The Progressive Party's candidate for President was Henry Wallace, one of Franklin Roosevelt's former Vice Presidents. Wallace was reportedly "most impressed" with Soviet collective farming, and in 1933 had urged FDR to become a "farm dictator." Wallace said if he were to become President, he would appoint as Secretary of State the pro-Soviet Laurence Duggan, now known to have been a Soviet agent. Had FDR died 82 days earlier, Wallace would indeed have become President. Wallace finally recanted his support for the Soviet Union in 1952. In 1955, the Jenner subcommittee cited the Progressive Party on its list of subversive organizations, identified as a Communist front. Peoples Temple 1955-1978 - See also: Peoples Temple Agricultural Collective Jim Jones was the original founder of the "Rainbow Family" in the late 1950s and early 1960s, a term Jones used to refer to his family. Jones and his wife adopted three Korean children, a Native American, and were the first white couple in Indiana to adopt an African American child. Jones moved to San Francisco in 1970 and was deeply involved in the city's progressive politics. Jones's Peoples Temple was instrumental in the election of Mayor George Moscone, serving as campaign workers and busing in unregistered people to vote. Jones was rewarded with post of housing commissioner. It was Kamala Harris's mentor, Willie Brown, who brought Jones in contact with the California Democrat Party. From there, Jones become involved with the DNC. Willie Brown supported same-sex "marriage" as early as 1977. Jones publicly met with vice president candidate Walter Mondale, and spoke at events with other leading Democrats at the San Francisco headquarters after the election in 1976, among them First Lady Rosalynn Carter and California governor Jerry Brown. Harvey Milk, the first openly homosexual politician elected in California with Jones' help would say: "My name is etched in stone with you." Milk wrote letters in support of Jones to President Jimmy Carter. Both Milk and Jones were homosexual activists. Obamunism 2008 - 2017 The term was revived in the early 21st century by politicians and media celebrities who considered traditional liberals too willing to compromise with moderates and conservatives. As such, the anti-democratic Marxist ideal of single party control was revived. This revival occurred before the 2006 midterm elections when liberals still supported the War on Terror. The term came into use to help Democrats distance themselves from the feelings of patriotism and bipartisanship that existed after the 9/11 attacks. Barack Obama established himself as a progressive leader in opposition to the War on Terror during an October 2002 rally at Federal Plaza in Chicago. The event was staged by veteran Maoist, SDS and Progressives for Obama organizer Carl Davidson. When 2004 Democrat presidential nominee John Kerry's home state of Massachusetts' became the first state to legalize same-sex "marriage", the issue split Democrats. Ballot initiatives appeared in 11 states that brought citizens to the polls in large numbers; all 11 initiatives passed. Proposition 8 in California won by a wide popular vote, but California Attorney General Kamala Harris bowed to LGBT groups and refused to defend the citizen referendum in court. These debates over social policy were reflected in the 2005 campaign for Chairman of the Democratic National Committee, which Howard Dean won. As a progressive, Dean was the first to shepherd civil unions through the Vermont legislature. Disillusion with two seemingly endless wars, coupled with a financial crisis caused by decades of government intervention in the mortgage market and manipulation of interest rates, along with a declining middle class due to globalization and jobs loss as workers saw their jobs shipped overseas, led to a resurgence of progressivism. 20 years after the fall of the Berlin Wall, Socialists finally captured the White House. Attack on healthcare system One of the first pieces of totalitarian legislation Progressives put forward was an attack on capitalist healthcare insurers. Obamacare was designed to fail, bankrupt private health insurance companies, and incrementally usher in the dawn of government run single payer and new era of Communist control. By 2019 it was known as "Medicare for All". But the relentless drive to disarm Americans and abolish the Second Amendment had failed. Attacks on the family, heterosexual relations, and childbearing proved surprisingly successful. Sodomy and gender confusion (the latter promoted by the LGBT movement under the terms "transexualism" and "transgenderism") replaced national security and economic well-being as top priorities as Progressives took control of the Democrat Party. Progressive police state Progressives accused liberals who voted for the Iraq War and the Patriot Act of betraying the cause of socialism. Ironically, it was progressives in the Obama administration who used provisions of the Patriot Act that allowed for spying on domestic groups sympathetic to Al-Qaeda, and applied them to the Trump campaign from 2015 on to further the anti-democratic objective of single party control. Antifa revolution 2017 - Progressives defaced the 54th Regiment Memorial to black soldiers in the Civil War as Antifa protests moved through the city. A website dedicated to the memorial, which stands at the top of a hill on the Boston Common, explains: The most acclaimed piece of sculpture on Boston Common is the Robert Gould Shaw and Massachusetts 54th Regiment Memorial by Augustus Saint-Gaudens; a memorial to that group of men who were among the first African Americans to fight in the Civil War. The monument portrays Shaw and his men marching down Beacon Street past the State House on May 28, 1863 as they left Boston on their way to South Carolina, Shaw erect on his horse, the men marching alongside. The monument, which commemorates black lives dedicated and sacrificed to the struggle against slavery, was defaced with profane anti-police graffiti, as well as tributes to George Floyd. The story of the 54th was immortalized in the Hollywood movie Glory, for which Denzel Washington received the Oscar for Best Supporting Actor. Progressive policies, in political science, are those which make progress towards goals seen by progressives as benefiting society. Since all politicians claim that their ideas and policies are meant to benefit the public, calling a policy "progressive" may be thought of as meaningless. The term has been popular among the liberal media. And although most of the population still refers to the two major philosophies as conservative and liberal, it is often used to describe a more specific type of liberalism. This is likely because these two titles are familiar to the current population and better recognized. Because of this familiarity, it is easier to visualize the contrasts between conservative and liberal than the contrasts between conservative and progressive, because of the specific nature of "progressive". Progressives use the term in contrast to "regressive" policies of their opponents. For example, progressives will ask rhetorically, "Do you want to go back to the 1950s?" implying that women were oppressed by being forced to be housewives and men were oppressed by being falsely accused of favoring Communism (see McCarthyism). A useful distinction to keep in mind is this: "progressives want bigger and supposedly better government; conservatives want less and supposedly better government." A foundational core belief of Progressivism is to consider crime a treatable illness by social psychology. In this core precept is the liberal-held belief that criminals are not responsible for their actions. Since collectivists do not respect the notion of private property, the propertyless are considered oppressed victims. Prisons, which incarcerate property and violent offenders, are usually the targets of "progressive reform." Because extremists do not reject violence to bring about social and political change, violent offenders must be qualified on the basis of their politically correct views. Far-leftists have historically used re-education camps and gulags as the basis of incarceration policy, and offenders graded on ideological grounds. While progressives seek radical social change, it is often pursued incrementally. Two examples serve in the Obama era: Obamacare and same-sex "marriage". Obamacare with its individual and employer dictates was designed to fail. The progressive objective of a big government, Soviet-style single payer system was too radical a change to implement during the brief window of opportunity given between 2009-2011, when Democrats controlled both the White House and a veto-proof Congress. Progressives settled on a system that allowed private insurance companies to continue to operate, provided they sold only policies dictated by progressive regulators. A dictate that all American adults - working or not working - be required to purchase insurance, or submit to eligibility requirements for entitlement care by income means testing, was also implemented. Penalties accrued for anyone non-compliant. The plan was phased in over a period of election cycles with the hope that those who received a subsidized entitlement would appreciate "free healthcare," and when the plan failed would support a progressive single payer system. The single payer system then would need progressives in Congress perpetually to insure its annual funding. The first hurdle in the homosexual "rights" movement was overcoming the progressive reform of the 1950s that treated criminals as victims of psychological disorders. By the 1960s homosexuality was considered by experts and the courts as both a crime and a mental illness. Due to claimed "ethical concerns" over locking people up on the basis of a psychological disorder (but in reality, due to political pressure imposed by radical homosexual activists), the psychiatric profession dropped the diagnosis of homosexuality as a mental disorder in the early 1970s. In the 1980s the states began de-criminalizing homosexuality with the idea that law enforcement resources could be better utilized elsewhere, the war on drugs for example. With homosexuality "normalized" now, by the 1990s the Equal protection clause was being invoked for a group in the coalition of identity politics. Attacks on Free Speech One of the first steps by Progressives in shutting down all opposition is censorship, shadow banning, and attacks on the free expression of ideas. Progressives do not foreswear violence to attain political objectives, and the terrorist group/hate group Antifa claims itself as a militant progressive organization. Antifa are the Black Shirts of the Democrat Party. - Leonard, Thomas (2005). [ "Retrospectives: Eugenics and Economics in the Progressive Era"]. Journal of Economic Perspectives 19 (4): 207–224. doi:10.1257/089533005775196642. Archived from the original on 20 August 2017. . - Freeden, Michael (2005). Liberal Languages: Ideological Imaginations and Twentieth-Century Progressive Thought. Princeton: Princeton University Press, 144–165. ISBN 0691116776. - Roll-Hansen, Nils (1989). "Geneticists and the Eugenics Movement in Scandinavia". The British Journal for the History of Science 22 (3): 335–346. - zek is a Russian slang term similar to "con" in English to refer to convicts, however many zeks were opponents of Socialism, not criminals. - Aleksandr I. Solzhenitsyn (1973). The Gulag Archipelago (1st ed.) Harper & Row, page 502. - Gulag, Vpl. II, Page 422, 425 et seqq. - Gulag, Vol. II, page 76. - Aleksandr I. Solzhenitsyn (1973). The Gulag Archipelago (1st ed.) Harper & Row, page 209. - Barry Loberfeld, "The Real Meaning of "Progressive" Politics, FrontPageMagazine.com, September 28, 2004 - Eugene Dennis, What America Faces (New York: New Century Publishers, 1946), pp. 37-38. Cf. Arthur Meier Schlesinger, The vital center: the politics of freedom (Transaction Publishers, 1997) ISBN 1560009896, p. 115; Arthur Meier Schlesinger, A Life in the Twentieth Century: Innocent Beginnings, 1917-1950 (New York: Houghton Mifflin, 2000) ISBN 0618219250, pp. 455-456; Karl M. Schmidt, Henry A. Wallace: Quixotic Crusade 1948 (Syracuse University Press, 1960), p. 265 (PDF p. 291) - Henry Agard Wallace, 33rd Vice President (1941-1945), Senate History, United States Senate - "Roosevelt Is Urged to Ask Wide Power as 'Farm Dictator'," The New York Times, March 12, 1933, p. 1 - Ethan Bronner, "WitchMay 9, 2008ing Hour; Rethinking McCarthyism, if Not McCarthy," October 18, 1998 - 1613 KGB New York to Moscow, 19 November 1944 - William C. Martel, Grand Strategy in Theory and Practice: The Need for an Effective American Foreign Policy (Cambridge University Press, 2015) ISBN 1107082064, p. 472 - Linda Rodriguez, A celebration of almost-great men, CNN.com, May 9, 2008 - Henry Agard Wallace, “Where I Was Wrong.” This Week, September 2, 1952 - Independent Progressive, joincalifornia.com - Reiterman & Jacobs 1982, p. 65 - "Jonestown: The Life and Death of Peoples Temple - Race and the Peoples Temple". PBS.org. February 20, 2007. - Jim Jones on gay marriage, women's rights, white privilege and other Progressive causes, youtube. - The Nation of Islam, Anti-Defamation League. - The rally was organized by Chicagoans Against War in Iraq (CAWI) later renamed Chicagoans Against War and Injustice. See Davidson, Carl (November 2, 2006). "About CAWI". Chicagoans Against War and Injustice website. Retrieved from August 11, 2010 archive at Internet Archive. - Carl Davidson (2010 or bef.) LinkedIn [Profile page/Experience/Webmaster]. Retrieved March 13, 2010 and February 13, 2016. - David De Leon (1994). Leaders from the 1960s: A Biographical Sourcebook of American Activism. Greenwood Publishing Group, 253–259. ISBN 978-03132-74145. “Early on Kameny developed an absolute belief in the validity of his intellectual processes and a habit of challenging accepted orthodoxies.” - Peter J. Smith (4 Jun 2008). Prominent Homosexual Activist Says Bestiality OK "As Long as the Animal Doesn’t Mind". LifeSiteNews.com. Retrieved on 13 December 2015. - Multiple references: - Suarez Sang, Lucia I. (September 3, 2017). FBI, DHS warned of increasingly violent Antifa clashes in 2016, documents show. Fox News. Retrieved September 3, 2017. - Meyer, Josh (September 1, 2017). FBI, Homeland Security warn of more ‘antifa’ attacks. Politico. Retrieved September 1, 2017. - FBI and Homeland Security deem antifa 'domestic terrorists' as they warn of escalating violence between the left and white nationalists. Daily Mail. Retrieved September 1, 2017. - Anarchist Extremists: Antifa, Dept of Homeland Security, June 12th, 2017
<urn:uuid:a806c022-82c7-4af1-b4c5-8af8728067b4>
CC-MAIN-2021-17
https://conservapedia.com/Progressives
s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618038077818.23/warc/CC-MAIN-20210414125133-20210414155133-00054.warc.gz
en
0.948557
4,631
3.28125
3
People are using Flat Tax vs Fair Tax interchangeably. And as usual, our congenitally lazy media is happy to oblige any and all misunderstandings by virtue of not understanding it themselves. So here’s a few links that will help you have this annoying discussion with anyone, especially wingnuts who won’t understand any definition you give them until Fox News tells them what they think they understand. I am only going to rough this in, for now. If you have good debunkers or definitions to add, please post them as a comment, and/or Tweet them to @shoq. If you have time for this now, just read this, and help stamp out moronic tax propaganda and gimmicks from the radical right. Flat Tax vs. FairTax Neither the flat tax nor the FairTax plans are radically new ideas. The U.S. implemented a flat income tax for a short time after the Civil War. Many states and countries use a flat tax today, but the specific plan for the FairTax is relatively new and dates back to the mid-1990s. Read more from Marshall Brain’s “How Things Work.” Tax Definitions and Debunkers - The Estate_tax (Wikipedia) - The Estate (Inheritance Tax) - Capital Gains Tax - Value Added Tax (Wikipedia) - (Brief) The case for a flat tax — and the arguments against (Washington Post) - Debunking Flat Tax Philosophy - Rick Perry: The Ultra Rich Are Too Big to Tax (ThePeoplesView.com) - Debunking the Fair Tax Myth (Daily Kos) - Huckabee’s Magic FairTax (Ezra Klein) - Neal Boortz’s Fair Tax Debunked (Money.cnn) - VIDEO: Warren Buffett’s Statement to Congress on Estate Taxes Demagoguing Those Flat and Fair Taxes - Video: Fair Tax evangelist, Right wing talk show host Neal Boortz explains it (sort of). - With 20% Flat-Tax Plan, Perry Eyes Distinction From GOP Field (PBS)
<urn:uuid:1168becb-bc8a-4695-8d9d-a1e411ef8881>
CC-MAIN-2015-18
http://shoqvalue.com/the-flat-tax-vs-fair-tax-links-for-flat-heads/
s3://commoncrawl/crawl-data/CC-MAIN-2015-18/segments/1429246635547.24/warc/CC-MAIN-20150417045715-00307-ip-10-235-10-82.ec2.internal.warc.gz
en
0.890745
449
2.53125
3
The process of conversion of a physical document into a digital format is known as scanning. Individuals wish to store photographs from their mobiles and computers in a way that they can access them easily whenever they want to. If the size of the picture is too wide then there is a machine called large format scanner to scan those pictures. Conversion of large format photos into digital high-quality pdf or jpeg files is known as large format scanning. Using large format scanner data is collected along with and the image slowly, and then the image is converted into a selected format. Any print above A3 is classified as large format scanner. There are many advantages for business owners if they use large format scanner in their organization. Merits of using Large Format Scanner are: Digitalization of office The Business world changes drastically. If the employees in a business are involved in paperwork, then the best employees can also be over-burdened with the workload. In order to overcome this and minimize further problems, you need to provide a pleasant environment for the employees. Their working pattern should be changed and this can be achieved with office digitalization. This is like engaging the staff with large format scanner, large format printers, etc., These devices help in obtaining blueprints, CAD drawings, pictures etc. Efficiency in copying and editing Copying large data may result in losing some original data. Large format scanner can be used for scanning large format documents. With large format, original quality of the data is not lost and can easily convert the document into a pdf file. This pdf file can also be obtained in printed format. The cost of large format scanner is high, but the cost involved in obtaining a digital format document is less as it reduces the cost of paper and ink. This also saves time. Usage of large format scanner also saves the space in the office. Preservation of important documents Important business documents can be scanned and stored using large format printers. This way the documents can be safe from accidental damage or theft. As the documents are converted into digital format, they can be stored in a single drive. These files can be easily shared through email. Architects can also secure their documents using a large format scanner. Drawings can be edited after converting into CAD format. Companies can save money, space and time by using a large format scanner. If you do not want to compromise with the quality of documents and pictures, then this is the best solution for you. Using the large format scanner, the image quality is not compromised. Now the mistakes can be viewed on the computer and the documents can be altered. Industries like manufacturing, construction, engineering, and architecture are the common users of large format scanner. As the large format scanner involves less paperwork, they are more advisable for reducing the work.
<urn:uuid:8a73db0e-2557-4c65-ba3b-424da0d503a1>
CC-MAIN-2019-22
http://www.soulwaterpublishing.com/5-benefits-of-large-format-scanner-for-a-business-organization/1182/
s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232257845.26/warc/CC-MAIN-20190525004721-20190525030721-00157.warc.gz
en
0.93876
569
2.75
3
True self-government for aboriginal Canadians is impossible as long as the Indian Act reigns supreme. The promise of Shawn A-in-chut Atleo, the National Chief of the Assembly of First Nations, to work to get rid of the act in five years is a refreshing statement, and it shows a new relationship may, with political will, be within reach. Mr. Atleo described the Indian Act as "a collapsing house, falling apart brick by brick and bashed by the courts," called on first nations leaders to propose alternatives within two years, and proposed a new "Ministry of First Nation-Crown Relations." The relationship has changed in the 42 years since Jean Chrétien first proposed abolishing the act. Residential schools have closed; aboriginal peoples are more likely to be partners in, and beneficiaries, rather than opponents, of resource development. But the essential governing framework for Canada's one million-plus Indians, even for many of those living off-reserve, is the Indian Act. It defines who is an Indian and gives the Indian Affairs minister great latitude in local decision-making. Canada's $7-billion-plus Indian Affairs budget is still controlled in Ottawa. Replacing the Indian Act could mean an end to colonial land-ownership rules, which limit the ability of Indians to own private property on reserves. A new relationship could help first nations create partnerships and develop their own institutions to solve lingering problems with poor health, insufficient education and unemployment. Reform could also equalize relations between on- and off-reserve Indians. Change will not come easily. Many more new treaties will have to be signed, and 594 specific claims, dealing with obligations under past treaties, are still under dispute. Most band councils are ill-equipped, by themselves, to take on all the responsibilities of government. First nations will need to recognize that some of the benefits of the current relationship - exemption from certain forms of taxation, for instance - carry the ring of dependency and must be shed or reduced. (Mr. Atleo's commitment to look for more corporate sponsorship, weaning AFN off federal government grants, is a small indication of what might be possible.) Successive governments have removed the worst excesses of the Indian Act. But the act remains. Mr. Atleo's challenge is one that political parties and first nations of all stripes should take up.
<urn:uuid:f046c1b5-a0d2-423c-a4a0-0eff9463c75a>
CC-MAIN-2015-27
http://www.theglobeandmail.com/globe-debate/editorials/the-national-chief-sees-the-end-of-the-indian-act/article1387581/
s3://commoncrawl/crawl-data/CC-MAIN-2015-27/segments/1435375099105.15/warc/CC-MAIN-20150627031819-00266-ip-10-179-60-89.ec2.internal.warc.gz
en
0.956142
489
2.875
3
Recently our youngest child engaged in a feat more suited to a trained circus professional than a toddler and the result was not pretty. A knocked out tooth, much blood, a hysterical mother and the question, ‘Why isn’t dental care included in infant first aid courses’? You’ll be pleased to know we have now added dental care to our infant first aid course. The course is designed for parents and carers of young children in a non professional care setting. We aim to cover the top emergency health issues parents and carers face with young children including, choking, drowning, burns, CPR, severe cuts, broken bones, eye injuries and of course dental emergencies. We asked our dentist friend Dr Nicki to confirm if our knowledge of what to do in a dental emergency was up to date and we were pleased to know it was. So what exactly do you do when you child or another person breaks or knocks out a tooth? In the case of a clean break try to locate the missing piece of tooth, wash in warm water and place in a sealed plastic bag or container with a little bit of milk or saline and head straight for the nearest emergency dental clinic. Most often if only a portion of the tooth has been broken the patient will feel little to no pain, this does not mean however that there has not been any damage below the surface to the root or gum, a broken tooth or teeth should always be treated as a dental emergency and as such the patient should be looked at immediately. If you live in a rural area or other region where an emergency dental clinic is not available the patient should be taken to the nearest hospital emergency room. In cases where a clean break has occurred the tooth may be able to be repaired using the broken piece. Knocked out tooth If a tooth is completely knocked out try to locate it and pick it up by the part that you would normally see when the patient smiles. Do not touch the root of the tooth or try to clean away any skin, dirt or other materials from the tooth or root. Place the tooth in a clean, sealed bag or container (a plastic lunch bag works just fine) with a little milk or saline solution and proceed to the nearest emergency dental clinic or hospital emergency room. Quite often when a tooth has been knocked out or partially knocked out a lot of blood can be produced. If the patient is old enough, have them bite down on gauze or similar to stem the flow of blood. Water can be used to rinse and spit periodically whilst waiting for medical attention. Never ask the patient to lay back when bleeding orally as they may choke on the excess fluid. If the patient is not old enough to bite down on gauze (as was the case with our daughter) offer room temperature water and encourage the child to spit the water out, comfort the child as best as possible and seek immediate assistance from an emergency dental clinic or hospital emergency room. If you did not witness the cause of the dental emergency, particularly where younger children are involved, it is always recommended to head directly to a hospital emergency room as the first option. The patient may have sustained concussion or other facial injuries such as facial fractures which may not be obvious to the naked eye. If in doubt, avoid the dental clinic and head straight for the hospital. If you have any safety questions that you would like answered please feel free to send them to us via our email address firstname.lastname@example.org Miss H showing her pearly whites before the accident.
<urn:uuid:7af975e6-8de0-4371-8370-3fd6d4e4efc4>
CC-MAIN-2018-51
https://australianfireandfirstaid.wordpress.com/2011/09/08/dental-first-aid/
s3://commoncrawl/crawl-data/CC-MAIN-2018-51/segments/1544376823674.34/warc/CC-MAIN-20181211172919-20181211194419-00251.warc.gz
en
0.954104
714
3.046875
3
SUMMER TERM 2 - YEAR 1 NEWSLETTER 2015 Literacy Our learning in Literacy this term will be focused around our topic of ‘Castles’. We will be writing explanation texts about different aspects of castles, including weaponry and defences. We will also look at a range of stories set in castles including The Princess and the Pea. We will consider the castles in these stories to write our own exciting descriptions which can then be used in our own stories. Finally we will be having a go at writing our own newspaper articles. Numeracy In Maths this term we will be looking at place value. We will be practising partitioning numbers into tens and units. We will also be practising sharing objects and writing division number sentences. Throughout this term the children will also look at capacity and weight. Religion Our topics in R.E. this term are Reconciliation and Universal Church. We will be considering the consequences of our choices and how we feel when we make a bad choice. We will also be thinking about how everybody is our neighbour no matter where they live in the world. Topic Our topic this term is ‘Castles’. As part of our Inspiration Day we will be holding a Ball where we will have a banquet and learn some traditional dances. In Geography we will be researching local castles including Dover castle and Leeds Castle. We will consider what it would have been like living in a castle at different times and what defences would have been used. Finally we will be designing and making our own shields. Volunteers If you have any time free and would like to come in and help within the class please let me know. You can come in and listen to children read or help with little jobs around the classroom. We would be very grateful for your help. Questions If you have any questions, please do not hesitate to speak to me at any time. This can be done after school, when I bring the children out, in their contact book or talk to the office to make an appointment. Contact books are looked at by classroom assistants at the beginning of each day. Please label ALL your child’s clothes, especially jumpers, ties and PE kit. PE kits should be kept in school at all times. Reading In Year 1 we encourage children to read every day at home. If your child has read to you, please note this in their contact book. If your child has read three or more times at home then they will receive a sweet at the end of the week.
<urn:uuid:c824a64d-0c51-4d19-b97a-cecf97ccc60c>
CC-MAIN-2019-30
https://studylib.net/doc/6666739/summer-term-6-newsletter---holy-family-catholic-primary-s.
s3://commoncrawl/crawl-data/CC-MAIN-2019-30/segments/1563195525524.12/warc/CC-MAIN-20190718063305-20190718085305-00013.warc.gz
en
0.965124
510
3.671875
4
Despite a decrease in women who have not had children, the number of three-child and large families has declined between and Temporary migrant workers in Russia consists of about 7 million people, most of the temporary workers come from Central Asia the Balkans and East Asia. Hyacinthe—Rouville St.|The demographics of Russia are the demographic features of the population of the Russian Federation including population growth, population density, ethnic compositioneducation level, health, economic status and other aspects. As of 1 Januarythe population of Russia isRepejtigny Crimea and Sevastopol, whose annexation is not recognised by most Pkpulation members. Including Crimea and Sevastopol, the population isas of January 1, As ofRussia's TFR of 1. InRussia populatio the first natural population growth since at 22, In total, different ethnic groups live within the Russian Federation's borders. Russia's population density Repentiggny 8. The population Ruwsian most dense in the European part of the country, with milder climate, centering on Moscow and Saint Petersburg. Katie Trois-Rivières escort population of Russia peaked atin un, just before the breakup of the Soviet Union. Low birth rates and Russian population in Repentigny high death rates caused Russia's population to decline Repentiggny a 0. The UN warned in that Russia's then Russian Naturist St. Catharines massage in Repentigny of about million could fall by a third byif trends did not improve. The decline slowed Russian population in Repentigny in the late s, and in Russia recorded population growth for the first time in 15 years, adding 23, InNorth York gay neighborhoods population increased byThe latter rose from its lowest point of 8. Where is Repentigny, QC? Repentigny Likewise, the fertility rate rose from its lowest point of 1.]Median ages of ethnic groups vary considerably between groups. Northwest Caucasian. Bydue to Jewish emigration, their Single parents dating site New Westminster fell as low asKrasnodar Krai. It's populatlon the 9th most populous country on earth, despite being the largest by area. Nenets incl. Looking back, in the year ofRussia had a population of Rrpentigny Repentibny, the Russian population in Repentigny of births kept Dating sites for married Windsor, but at much slower pace. RussiansGermansBelarusians and Ukrainians. The figures for — again showed around 1. Russian population in Repentigny to the Census in Russia livedpeople. Russian official Economic Freedom. The Russian population in Repentigny in Repentigny : Today, November 1, Dollard-Des Ormeaux Sakha icl. This difference is primarily a result of high rates of alcoholism among males. In total, there are more than Repentogny ethnic groups in Russia. Demographic statistics according to the World Populatoin Review in Population in 82,; Population in 76,; (Population in 72,). The current mayor is Chantal Deschamps. Demographics Population density (people per km²), % Greek, % Khmer, % Mandarin, % Russian. RepenTIGNY, a settlement of Canada, on the St Lawrence. Long. W. Lat. Its area is square miles; its population about 26, #. elevated. See also the number of migrants for this country. Population density for this country. Sources - What is a population pyramid? Blog - Follow us on Twitter - URssian a poster - Contact us by email. Mailing List - See. Population: , New Caledonia. New Zealand. Northern Africa. Northern Europe. Papua New Guinea. Puerto Rico. Micronesia Fed. States of. Middle Africa. Repentigny (electoral district) More developed regions. Saint Lucia. Saint Vincent and the Grenadines. Sao Tome and Principe. Time Zone Converter (Time Difference Calculator) Saudi Arabia. Sierra Leone. Solomon Islands. South Africa. South America. South Sudan. South-Central Asia.
<urn:uuid:c3e1b62a-2cd1-46df-a1e3-c46aecd64afe>
CC-MAIN-2021-21
https://www.team19motorsports.com/russian-population-in-repentigny.html
s3://commoncrawl/crawl-data/CC-MAIN-2021-21/segments/1620243992159.64/warc/CC-MAIN-20210517084550-20210517114550-00172.warc.gz
en
0.891654
865
2.703125
3
Jenna Ladd | May 25, 2018 The human health impacts of climate change are myriad and include heat-related illnesses and vector borne diseases like Lyme disease. However, a new public health consequence of global warming has recently come to light: antibiotic resistance. Earlier this week, a study published in the journal Nature Climate Change reported finding that higher local temperatures and population densities are associated with increased antibiotic resistance of common pathogens. Researchers looked at 1.6 million bacterial specimens which showed resistance to antibiotics from 2013 through 2015 in various geographic locations in the U.S. These specimens included three common and deadly pathogens: Escherichia coli, Klebsiella pneumoniae, and Staphylococcus aureus. They found that a temperature rise of 10 degrees Celsius increased the bacterias’ resistance to antibiotics by four percent (E. coli), two percent (K. pneumoniae), and three percent (S. aureus). John Brownstein is a professor of medicine at Harvard Medical School and one of the study’s authors. He said to the Scientific American, “Places in the South [of the U.S.] tend to show more resistance than places in the North, and a good chunk of that variability can be explained by temperature.” Researchers also explored how population density may be related to antibiotic resistance. They found that for every increase of 10,000 people per square mile, antibiotic resistance in that area increased by three to six percent. Prior to this study, most research about antibiotic resistance pointed to the overprescription of antibiotic medication as the primary reason for antibiotic resistance, but now, climate change and population density are known play a part. The study concludes, “Our findings suggest that, in the presence of climate change and population growth, already dire predictions of the impact of antibiotic resistance on global health may be significant underestimates.”
<urn:uuid:a7bbff0e-40fb-4c8a-aac5-e8c7ef5c8c5e>
CC-MAIN-2018-47
https://iowaenvironmentalfocus.org/author/jennakcladd/
s3://commoncrawl/crawl-data/CC-MAIN-2018-47/segments/1542039744750.80/warc/CC-MAIN-20181118221818-20181119003217-00033.warc.gz
en
0.938467
385
3.484375
3
Potatoes (Solanum tuberosum) can grow to maturity without requiring pruning. However, there are times you may want to prune your potato plants, depending on your desired potato size. Pruning the potato stalks can help the potatoes mature early, before they reach their full size. Allowing them to remain in the ground for at least two weeks after pruning can help them develop a thick, protective skin that keeps the potatoes fresh for months after harvesting. Pinch off flowers as they appear on the potato plant or cut them off with pruning shears. When you see flowers, the plant is mature and has small potato buds formed. However, cutting the flowers can help you grow larger, healthier potatoes by removing competition for the plant's nutrients. (ref. 1) Trim the plants down to ground level by cutting the stalks about 1 inch above the ground with pruning shears; cutting them even or below the ground can expose the tips of shallow potatoes, which can turn them green and render them inedible. Prune the green section of the plant anytime after flowers appear. This stops the tubers' growth cycle; they are still edible, but they may be small, depending on how long you wait to prune the plant. Prune the plant when you see the leaves start to wilt if you want full-grown potatoes. Cut the stalks about 1 inch above the ground, then wait about two weeks to dig out the potatoes. The plants wilt once the potatoes reach their full size, but the potato skin doesn't start to thicken until the plant fully dies. Pruning after you notice wilted leaves can speed up the skin-strengthening process while providing full-sized tubers. Things You Will Need - Pruning shears - For fully mature potatoes, don't prune the plants for at least 80 days. - Instead of throwing away the green potato plant tops, put them in your compost pile to recycle them. - If you're in a hurry for your potatoes, you can dig them out of the ground within a day of pruning the plant. You must use them immediately, as they will begin to rot within a few days of harvesting if their skins aren't allowed to thicken underground for at least two weeks. - Storing mature potatoes in the refrigerator or in a cool cellar -- about 40 degrees Fahrenheit -- can help them stay fresh for up to six months. - After pruning, dig deep below the potatoes to scoop them out to reduce the risk of scoring the skin with the shovel, which can reduce the potato's shelf life. - There are varieties of potato to grow in nearly every U.S. Department of Agriculture hardiness zone. - University of California: Pruning Your Potatoes - Ohio State University Extension: Growing Potatoes in the Home Garden - University of New Hampshire Cooperative Extension: Growing Potatoes - University of Florida IFAS Extension: Growing Potatoes in the Florida Home Garden - Food and Agriculture Organization of the United Nations: Alphabetical List of Crops With Botanical Name and Crop Code - Jupiterimages/Creatas/Getty Images
<urn:uuid:ab7992c5-1f54-47fb-9537-ddb3d3b40156>
CC-MAIN-2018-17
http://homeguides.sfgate.com/prune-potatoes-42957.html
s3://commoncrawl/crawl-data/CC-MAIN-2018-17/segments/1524125949489.63/warc/CC-MAIN-20180427060505-20180427080505-00410.warc.gz
en
0.930909
651
3.375
3
Around the world, there is a shortage of fresh water. And to feed the growing population of the Earth, it is necessary to create drought-resistant plant varieties. But first we need to understand how in general plants react to a lack of moisture. Scientists from the University of Missouri have created a robotic system capable of independently monitoring the condition of plants. The system consists of two parts. One of them is the mobile tower Vinoculer, which scans the field within a radius of 18 meters. When the tower finds a plant with signs of disease or stress, it sends the second part of the system – an autonomous robot on wheels called Vinobot – for exploration. Vinobot has three sets of sensors and a robotic arm, which it uses to shoot a suspicious plant from all sides, to finally get a three-dimensional image. Sensors are the same autonomous robot measures temperature, humidity and light intensity. Vinoculer + Vinobot / © munews.missouri.edu The developers claim that the Vinoculer towers are inexpensive, which allows them to be installed all over the field. According to the research team’s report, the system is much more economical than drones and can work 24 hours a day. It is worth noting that a similar development – an agricultural robot-inspector – was previously presented by researchers from the University of Illinois. However, this robot works alone – without additional towers.
<urn:uuid:96fddebc-687e-4542-b1fb-ab5a8ab90483>
CC-MAIN-2017-47
http://earth-chronicles.com/science/the-state-of-plants-will-be-monitored-by-a-robotic-system.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-47/segments/1510934805008.39/warc/CC-MAIN-20171118171235-20171118191235-00264.warc.gz
en
0.946823
294
3.109375
3
2 Myths About Adult ADD There are many people who feel anxious, depressed, impulsive, or prone to anger, and they think the problem is “all in their head” or purely psychological. However, one of the clearest things we at Amen Clinics have found in our research is that these problems often do have a biological basis in the brain. We are talking, of course, about adult attention deficit disorder (ADD), which is also known as attention deficit hyperactivity disorder (ADHD). Although ADD is a large umbrella of symptoms that can be most often noticed in those children bouncing off the wall in the doctor’s office, we often forget that hyperactivity is just the most visible effect of a much more complicated disorder. There are many different types of ADD, and they aren’t all quite as obvious as the screaming child running laps in the parking lot. In fact, at Amen Clinics, we prefer the name ADD, as ADHD highlights the hyperactive component of the disorder (H) and discards half the people who have it, particularly females, who are typically not hyperactive. Myth #1: Children outgrow their ADD problem by adulthood Fact: While ADD is most often diagnosed in children, for two-thirds of them the disorder persists into adulthood. Over the past few decades, the conversation on mental health has grown and more adults with the disorder are now being diagnosed. ADD is highly heritable, and adults often are diagnosed for the first time when they bring their child in seeking help. However, there is no such thing as adult-onset ADD. These adults have often been living their entire lives unaware, but with the constant feeling that their brains worked a little differently. Just because these adults haven’t been identified as ADD until later in life, doesn’t mean they haven’t been living with the disorder’s effects. Treating adult ADD starts by understanding the disorder itself and the effects it has on you and those around you, in order to begin succeeding with ADD, not in spite of it. Myth #2: ADD is just an excuse for the habitually distracted and disorganized Fact: There is a difference between an excuse and explanation. Just like anyone else, ADD adults have to hold themselves accountable; they are skilled and often incredibly creative people who are capable of great things. However, they cannot deny the effects the disorder can have on their lives. We have scanned tens of thousands of brains and seen the clear differences in brain function between an adult with ADD and an adult without it. Among the many signs, lower blood flow to key areas such as the prefrontal cortex (the brain’s decision maker) and lower levels of adrenaline are often seen in ADD adults, causing them to sometimes be impulsive or craving excitement. Knowing this can help you understand this complicated disorder, and act to explain rather than make excuses, taking steps to minimize the challenges adult ADD presents. Amen Clinics has helped tens of thousands of people with ADD/ADHD from all over the world. With targeted treatment, you CAN change your brain and change your life. If you feel that you or a loved one could benefit from an evaluation, contact the Amen Clinics Care Center today at 888-288-9834 or schedule a visit online today.
<urn:uuid:18060a67-1b50-445f-b0ba-30dd8e806e36>
CC-MAIN-2019-39
https://www.amenclinics.com/blog/2-myths-adult-add/
s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514572879.28/warc/CC-MAIN-20190916155946-20190916181946-00246.warc.gz
en
0.977846
682
2.921875
3
Editorial: Seix Barral Synopsis: This novel is a family saga that reconstructs social tensions in Medieval Spanish. It tackles the tragic story of the waves of intolerance and religious fanatism that confronted Spanish ‘Old Christians’ with the so called ‘New’ or ‘Converted’ Christians, who embraced catholic religion between 14th and 17th centuries. This was a difficult period of Spanish History, that began with a terrible epidemic fever and lasted for years. Nowadays fewer know about this period of violence that left its most important marks in some of the American colonies of the times, particularly in Colombia.
<urn:uuid:20e79ca5-5798-4c57-bfa9-285899de6500>
CC-MAIN-2018-13
http://www.antoniakerrigan.com/en/novelas/2934/Donde-no-te-conozcan
s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257647758.97/warc/CC-MAIN-20180322014514-20180322034514-00701.warc.gz
en
0.948323
130
2.875
3
Google is special. They are unlike most corporations, in the fact that the methods they use to acquire resources depend not on competition, but on something else entirely. Corporations share many characteristics with organisms, and if properly observed, can even be classified as organisms themselves. And as you may have learned from biology, competition is not the only interaction that occurs between organisms. The type of interaction that Google uses, is akin to Symbiosis, which is much more difficult to find, and take advantage of, not only in our man-made environments, but in natural ones as well. This type of interaction can be seen in their main source of income, their search engine. In the symbiotic interaction between bees and flowers, bees come and absorb the nectar from the flowers, In the process, the bees get food, the flowers get more genetic diversity. Yes both benefit, but that's not the important part. In this interaction, not only do both benefit, but more importantly, both begin to experience rapid growth due to the feedback loop created by their interaction with each other. The more bees, the more flowers. The more flowers, the more bees. The same applies to Google's search engine. The more people that use their search engine, the more ad revenue Google receives. The more ad revenue they receive, the better their search engine becomes. The better it becomes, the more people use their search engine. Google's search engine has grown to become the most used search engine. You could say that they hold, a monopoly over search. But the interesting thing here, is that their monopoly over search, is not detrimental to its consumers, but in fact, very beneficial. Not only due to the fact that we get better search because of it, but because of the other highly beneficial incentives it provides. For example Google has much to gain from the internet being completely free, and completely ubiquitous. The more people that use the internet, the more people that use their search engine, the more ad revenue they receive. Which last time i checked, constitutes over 90% of their profits. They are the only ones that have much to gain from it being completely free, rather than profiting off of it, while having the resources to make it so, and they are on the path to making it such. But the amazing thing about this, is that they are not doing this because they are somehow altruistic (though they may be) but because they have much to gain from it. It is this Symbiotic relationship that is built on rational objectivity that guarantees beneficial outcomes. There are still over 4 billion people that do not have internet. Imagine the economic effects of suddenly bringing all 4 billion people online. (You can view the internet stats here: http://www.internetlivestats.com/internet-users/ It actually has a really cool counter that actively shows the rising population of internet users) Project Loon: With project Loon they plan to put helium balloons in the sky, and use them as atmospheric satellites. With the direct goal of providing free internet for all. Acquisition of Titan Aerospace: Google bought Titan Aerospace, a drone company that is working on solar powered drones. You can see the obvious potential of this technology in their endeavor to provide free internet for all. http://www.techspot.com/news/56387-google-acquisition-of-drone-maker-titan-aerospace-will-lift-project-loon-to-new-heights.html Google fiber: Google has begun to lay out fiber optic cords in a number of different cities, one of them is mine (Austin, TX). This service does of course cost money laying down the infrastructure is simply to expensive. But i do not think profit is the main goal here. I think the goal here, is to disrupt the strangle that is the detrimental monopoly that ISPs such as Comcast, Timewarner, and AT&T have on us. By introducing incredibly fast internet speeds, around 1000 Mbps for a very low price. Around the same price that people pay these other sleazy ISPs just for 5-10 Mbps. (Horrible, i know, we should be out in the streets with torches and pitchforks) But making the internet free, and completely ubiquitous, is just one of their goals, or should i say, incentives. Out of all the other corporations, Google is the only one i have seen to put so much money and effort towards technological advancement, from what seems to be purely for the sake of it. If you do not believe me, here are some pretty amazing examples. (Seriously click on every link if you have not heard of them already) Boston Dynamics: http://www.bostondynamics.com/ Clean Energy: https://www.google.com/green/energy/investments/ Google Car: https://www.youtube.com/watch?v=CqSDWoAhvLU And these are just a few, the list goes on. Again i am not arguing that they are altruistic, but rather, that they have much to gain from all of this. Where as other corporations only focus on money, and for good reason, because currency is a powerful resource, because you can convert it into just about anything else. It seems like Google is interested in much more than just money. Its like they understand that all of our businesses today are built on technology, technology that at one time did not exist. As such they seem to treat potential technology, technology that does not exist, but has the potential to exist, as just as much a resource as anything else. But also where other businesses simply wish to grow and profit off of their products. Google seems to want to use the resources they have acquired, to make an impact, to change the world. Now whether for better, or for worse, does not matter. What matters, is that this makes them powerful. Where other businesses have small limited goals, where they stagnate and cling to old tech and methods, which has proven to kill businesses time and time again. Google doesn't just not stagnate, they create. They do not play catch up, they are the ones forcing others to catch up. Because of this, Google will be around for a very long time, and also, has the potential to become the most powerful corporation in the world.
<urn:uuid:56f284cf-7cbc-452e-bc56-d580cca912c1>
CC-MAIN-2024-10
https://www.roshawnterrell.com/2015/05/
s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474669.36/warc/CC-MAIN-20240226225941-20240227015941-00848.warc.gz
en
0.96511
1,324
2.796875
3
Tips for Photographing Rivers, Lakes, and Swamps If you live near a river or lake, visit it at different times of the year to photograph its full diversity. A river can be raging when snow is melting, or it can be placid at the end of summer. If you live or photograph in cold country, the river or stream may be partially or totally frozen during the winter. Rivers have their own beauty. Tall trees or grasslands often border a gently meandering river. Other rivers carve deep canyons and are surrounded by huge granite rocks and maybe a few trees. Rivers can swell to fill (or overrun!) their banks during rainy season, but at other times of the year, they can resemble a beach. Rivers are also sanctuaries for wildlife. Here are five details to consider when photographing a river: Shoot in Aperture Priority mode and choose the smallest aperture possible. When you photograph a scenic river, you want every subtle detail to be in focus. Fill the frame with the river in the foreground. If that isn't possible, get as much of the river in the frame as you can. Shoot from a low vantage point. Crouch down when shooting a river from ground level. This vantage point gives your viewers a scene of space and scale. If you don’t like to crouch low and your camera has Live View, enable it and compose your image using the camera LCD monitor. Remember that you can’t hold the camera as steady when you’re using Live View because the camera is in front of you. Increase your shutter speed slightly to offset any operator movement. A hot-shoe level is also useful to ensure the camera is parallel to the horizon. Many rivers are home to alligators. If you know there are alligators in the river, don’t stand too close to the edge. Alligators are very quick. Normally they’re wary of humans, but they have been known to be quite aggressive during mating season. It’s always better to err on the side of caution. Photograph the river from a unique vantage point. Unless you have interesting scenery surrounding the river, or you are photographing a raging river, find a bend in the river and use the curve as a compositional element. If possible, place the horizon line in the upper third of the image. The river will the main element in your picture. If you can’t achieve this composition, make sure the river is more than half of the image.
<urn:uuid:83f0f610-701e-4a57-b710-2d358bf65910>
CC-MAIN-2015-14
http://www.dummies.com/how-to/content/tips-for-photographing-rivers-lakes-and-swamps.html
s3://commoncrawl/crawl-data/CC-MAIN-2015-14/segments/1427131297587.67/warc/CC-MAIN-20150323172137-00066-ip-10-168-14-71.ec2.internal.warc.gz
en
0.943135
524
2.75
3
October 18, 2010 Heartburn and Stomach Viruses Heartburn and stomach viruses have more in common than you may first think. Most people are discovering that it’s easy to be immune to viruses; it doesn’t matter if you are exposed to them. In fact the whole flu virus vaccine is a scam. Most people that get the shot are now carrying the live or attenuated virus . . . along with mercury and other poisons. There is no scientific proof the viral shot even helps-at best it might protect you for a week and a half. But there’s something else you need to know about viruses and heartburn . . . neither one can harm you if your internal “environment” is healthy. Let me explain. If your saliva, tissue and blood “environment” is balanced at about pH 7.4 even cancers cells are dormant. Viruses, like cancer cells, require a low oxygen, high acid and low pH to thrive. Stomach viruses can’t even reproduce unless they take over your cells, which they cannot when your pH is “salty” or alkaline. When I say “salty” I don’t mean table salt, I mean, mineral rich, sea salty. Your healthy blood, tissue and saliva are nearly identical to sea water as far as composition and pH. Your heartburn also depends on a healthy pH. Only your stomach environment should have a low pH, which means high acid levels. However your “gut,” or digestive system, needs to be more “salty” and less acid. Only your stomach lining is tough enough for stomach acid. The rest of your digestive tract is gradually less acidic and more alkaline because it has to support delicate flora and microorganisms that help break your food down even further, after your stomach acid and powerful enzymes get first shot. The two are connected because if your gut is out of balance, that means the good bacteria and micro-organisms are being overrun by bad bacteria and evil microorganisms. Once the bad guys take over, your digestive system, or gut, fails to pull enough minerals, nutrients and cofactors from your food as it goes through your long plumbing system. This means that your immune system is compromised and to make things worse, now you may be suffering from heartburn caused from your stomachs inability to properly digest your food. Yes, that’s right, more often than not; heartburn is actually caused from lack of stomach acid. You see, to make stomach acid, your gall bladder and other organs need plenty of minerals, vitamins and enzymes. So stomach acid is eventually connected to viral infections. The last thing you want is Candida albicans growing in your gut. Candida is the bad micro-organism, not to mention E. coli and viruses. Candida is yeast that turns into a fungus that puts holes in your gut and allows undigested food molecules to get in your blood. While your immune system is burdened with fighting this problem, it uses up what nutrient stores you had left. Once your system bogs down because of low oxygen, low pH and low nutrition, acid wastes build up inside your cells. Viruses like acidic cells; they can compromise them and eventually take them over to help reproduce more viruses. So learn how to stay alkaline and eat more “raw,” nutrient rich, food sources to promote your minerals and all that good stuff-your body will take care of the rest. You were born to heal, Todd M. Faass?
<urn:uuid:6f6487c1-bafe-4002-8781-afe5ae16b181>
CC-MAIN-2015-18
http://www.refluxremedy.com/blog/727/heartburn-and-stomach-viruses/
s3://commoncrawl/crawl-data/CC-MAIN-2015-18/segments/1429246657588.53/warc/CC-MAIN-20150417045737-00087-ip-10-235-10-82.ec2.internal.warc.gz
en
0.942226
755
2.765625
3
From today I want to write about PHP,coz Im learnig PHP.So let’s start… What is PHP The endless possibilities of the PHP scripting language and a great community of users has made it one of the most popular open-source languages. For all you people living outside the UNIX world, Open Source means it doesn�t cost anything. You can use it as much as you want and where you want, and nobody will ever charge you thousands of dollars for licenses and support. Even though it was originally conceived as a set of macros to help coders maintain personal home pages, its name grew a lot more from its purpose. Since then, PHP�s capabilities have been extended, taking it beyond a set of utilities to a full-featured programming language, capable of managing huge database-driven online environments. PHP is now officially known as “PHP: HyperText Preprocessor”. It is a server-side scripting language usually written in an HTML context. Unlike an ordinary HTML page, a PHP script is not sent directly to a client by the server; instead, it is parsed by the PHP binary or module, which is server-side installed. HTML elements in the script are left alone, but PHP code is interpreted and executed. PHP code in a script can query databases, create images, read and write files, talk to remote servers – the possibilities are endless. The output from PHP code is combined with the HTML in the script and the result sent to the user�s web-browser, therefore it can never tell the user weather the web-server uses PHP or not, because all the browser sees is HTML. PHP’s support for Apache and MySQL further increases its popularity. Apache is now the most-used web-server in the world, and PHP can be compiled as an Apache module. MySQL is a powerful free SQL database, and PHP provides a comprehensive set of functions for working with it. The combination of Apache, MySQL and PHP is all but unbeatable. That doesn�t mean that PHP cannot work in other environments or with other tools. In fact, PHP supports an extensive list of databases and web-servers. The rise in popularity of PHP has coincided with a change of approach in web-publishing. While in the mid-1990s it was ok to build sites, even relatively large sites, with hundreds of individual hard-coded HTML pages, today�s webmasters are making the most of the power of databases to manage their content more effectively and to personalize their sites according to individual user preferences. Reasons for using PHP There are some indisputable great reasons to work with PHP. As an open source product, PHP is well supported by a talented production team and a committed user community. Furthermore, PHP can be run on all the major operating systems with most servers. The speed of development is also important. Because PHP allows you to separate HTML code from scripted elements, you will notice a significant decrease in development time on many projects. In many instances, you will be able to separate the coding stage of a project from the design and build stages. Not only can this make life easier for you as a programmer, but it also can remove obstacles that stand in the way of effective and flexible design. Well-maintained open source projects offer users additional benefits. You benefit from an accessible and committed community who offer a wealth of experience in the subject, as fast and as cheap as possible. Chances are that any problem you encounter in your coding can be answered swiftly and easily with a little research. If that fails, a question sent to a mailing list or forum can have an intelligent, authoritative response. You also can be sure that bugs will be addressed as they are found, and that new features will be made available as the need is defined. You will not have to wait for the next commercial release before taking advantage of improvements, and there is no hidden interest in a particular server product or operating system. You are free to make choices that suit your needs or those of your clients and incorporate whatever components you want.
<urn:uuid:9d765cca-f21b-40a2-a20d-63618b88fbcd>
CC-MAIN-2017-26
https://sharifabdullah.wordpress.com/2006/05/03/php-tutorial-the-microwave-way-to-php-programming/
s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128320570.72/warc/CC-MAIN-20170625184914-20170625204914-00241.warc.gz
en
0.948813
838
3.0625
3
What is Lean? Rooted in Purpose, Process and respect for People, Lean is about creating the most value for the customer while minimising resources, time, energy and effort. The Definition of Lean A Lean approach to work is about understanding what's really going on at the gemba (the place where value is created), improving the processes by which products are created and delivered and empowering people through problem solving and coaching. Lean thinking and practice helps organisations become both innovative and competitive, which in turns allows them to become more sustainable. Today Lean has become a new, more effective approach to doing and organising work. It is a superior business system. In a Lean organisation problems are opportunities for meaningful learning rather than errors to be swept under the carpet. Managers act as coaches, helping others get comfortable identifying problems and practicing daily continuous improvement. Leadership means creating a management system to support a new kind of engagement with the real work at hand, the way the work is being done now, not the way you and your team hope to be doing work sometime in the future. In 1997 James P. Womack established the Lean Enterprise Institute (LEI) in the United States. In 2003 Daniel T. Jones established the Lean Enterprise Academy in the UK. There are now 17 Lean Enterprise Institutes around the world with the mission to: - Improve the competitiveness and raise living standards of their country. - Enable growth while minimising resource use and environmental impact. - Provide more fulfilling work and continuing personal development for everyone. - Enabling consumers to create more value in their increasingly busy lives. The Lean Enterprise Academy (LEA) grew out of the MIT research team that was responsible for coining the term "Lean" to describe the revolutionary production and management system they identified at Toyota. This was described in the landmark book "The Machine That Changed The World" by James P. Womack, Daniel T. Jones and Daniel Roos in 1990. Since that time there has been enormous demand for greater knowledge about Lean thinking. It has spread across the globe and beyond other manufacturers to sectors such as construction, healthcare, FMCG, the public sector, services and supply chain. Read Daniel Jones' article What Lean Really Is
<urn:uuid:7984b006-49d6-4f11-b7e8-f515c59614fd>
CC-MAIN-2016-44
http://www.leanuk.org/what-is-lean.aspx
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719815.3/warc/CC-MAIN-20161020183839-00125-ip-10-171-6-4.ec2.internal.warc.gz
en
0.95213
454
2.734375
3
Sharks are usually thought of as primitive creatures, sometimes called "living fossils." But a new study of a 325-million-year-old shark fossil — the most complete of its kind — suggests modern sharks have evolved significantly from their bony ancestors. But comparing a modern shark with a primitive one would be like comparing a modern automobile with a Ford Model T — they share some similarities, but under the hood they're completely different, Maisey told LiveScience. The exceptionally well-preserved fossil of Ozarcus mapesae from two different lateral views. The scale bar is 10 millimeters. (Photo: F. Ippolito/AMNF) A bony shark The shark fossil in the study, Ozarcus mapesae, was found in Arkansas by husband and wife Royal and Jean Mapes (for whom the species is named), who donated it to the museum. The shark was about 3 feet (90 centimeters) long with very large eyes, and appears to have lived in a shallow, murky inland sea that was also home to giant squidlike creatures, Maisey said. The researchers X-rayed the fossil, first using a CT machine and later using a synchrotron, which relies on ultra-high-energy X-rays and has become an important tool for paleontology because it doesn't destroy the fossils and provides a level of detail not possible with traditional fossil preparation. Maisey called it "the Hubble Space Telescope of paleontology." The X-ray scans revealed the fossil had complete gill arches, the support structures for the gills that fish use to breathe. These gill arches were arranged in a serial way, more like those of bony fish than modern sharks. The fossil's jaws were also more like those of bony fish. Most modern sharks have jaws that are attached to their skulls by flexible ligaments, whereas bony fish have jaws that are rigidly fused to their craniums. It's not the oldest shark fossil found, but it is one of the most complete. It provides a new model for interpreting other fossils, allowing scientists to make comparisons between early jawed vertebrates and sharks, Maisey said. Related on LiveScience and MNN:
<urn:uuid:3552f37d-3862-47ce-ad11-7fd37bc7f1ed>
CC-MAIN-2015-32
http://www.mnn.com/earth-matters/animals/stories/sharks-arent-the-living-fossils-we-thought-they-were
s3://commoncrawl/crawl-data/CC-MAIN-2015-32/segments/1438042989126.22/warc/CC-MAIN-20150728002309-00097-ip-10-236-191-2.ec2.internal.warc.gz
en
0.967308
465
3.578125
4
Raw foods are usually very healthy. Numerous diets center on a large portion of, or 100%, raw foods. I believe raw foods are an excellent part of a balanced diet, but there’s a number of things that aren’t ideal about relying heavily on raw foods. Probably few of my readers are inclined to a completely-raw fruit and vegetable diet, but since it seems to be the prevalent opinion that “raw = best”, there are a few things I wanted to note, as follows: 1. Raw foods are very rich in enzymes, which help to digest food and are vital to many metabolic functions in the body. Our body both makes its own enzymes and gets enzymes directly from food. The more enzymes that are in the food that we eat, the less the body has to work at making enzymes. There are enzymes in all raw foods, including raw milk and raw meat, though this discussion is primarily about raw produce. Tropical fruits are especially high in digestive enzymes, and as such are especially conducive to being eaten raw. Raw foods are alive, life-giving foods! (Interestingly, grains are the one food that can’t be eaten raw unless sprouted. Vegetables and animal foods can be eaten raw if they come from clean sources. Vegetables and meat comprise one of the best, well-balanced diets–and no, I don’t eat hardly any animal products raw, just like I don’t eat all my vegetables raw.) 2. Raw foods are excellent sources of water-soluble vitamins B & C. These vitamins are easily lost in cooking, and are lost even in leaving produce peeled or cut for several hours. Some fruits, such as berries and citrus, are often eaten raw, which helps us to get appropriate intake of vitamin C, particularly. It has been observed, however, that non-organic produce often has much lower levels of vitamin C than organic produce does. If you are eating raw produce for its water-soluble vitamin content, it’s best to buy it organic. 3. Raw produce contains high amounts of indigestible fiber. While we need fiber in our diets for balancing metabolism, aiding digestion, and feeding good gut flora, too much fiber can be irritating to a leaky gut or compromised intestinal system. It’s hard to “digest” or pass through since it’s actually indigestible. Eating a lot of raw leafy salads can provide a lot of enzymes for a healthy body, but cooked/low-fiber foods are much easier on intestines trying to heal. Raw milk, fresh vegetable juices, or blended smoothies/shakes are prime ways to get enzymes and nutrients into the digestive system and bloodstream without the obstruction of so much fiber. 4. Raw foods aren’t the only foods that contain nutrients, by far. Cooked foods still contain all the macronutrients (protein, carbohydrates, fat) and many micronutrients (minerals and vitamins). Minerals and fat-soluble vitamins (A, D, E & K) are barely harmed by heat. Plant foods contain an array of other phytonutrients that remain in foods whether eaten raw or cooked. Proper cooking, not overcooking, is important to maintain the integrity of the macronutrients. Roasting or steaming are good ways to preserve as many nutrients as possible without losing nutrients into boiling water. There are a few advantages to eating cooked vegetables for at least part of your vegetable intake. Cooking reduces some of the antinutrients, or digestive inhibitors, found in some cruciferous vegetables and dark leafy greens. Cooking imparts heat to, and reduces the water content and cooling nature of raw foods. This increases the sugar content of the foods, helps to balance your metabolism, and warms your body temperature when the weather is cold. Cooking breaks down some of the fiber in raw produce, which can be easier on digestion. And lastly, cooking simply helps many vegetables to taste better (likely because they are warmer and sweeter). Of course, some vegetables taste better raw and are typically eaten that way; and the same with cooked vegetables. 5. Raw foods have a lot of nutrients, but culturing/lacto-fermenting vegetables actually increases the enzyme and vitamin content exponentially. Plus, fermentation partially “digests” the food, eliminating the issue of too much fiber and roughage. Some recommendations say to eat raw produce at every meal (not a bad thing), but traditional wisdom says to eat a cultured food as a a condiment at every meal. Cultured foods enhance the taste of other foods, whereas raw foods often benefit from added seasoning or dressing to make them more palatable. 6. Raw foods, especially produce, are generally understood to be the most health-promoting–but this is a situation where more isn’t necessarily better. We desperately need animal protein and animal fats in our diets to provide the full spectrum of nourishment. Animal foods provide essential amino acids, minerals, B vitamins, and healthy saturated fats in a quantity and manner that is most needed and most easily assimilated by our bodies. So, make raw vegetables a good portion of your diet, but don’t make them 100%. (That could never be done in Montana; we would freeze in the winter!) Vegetables and meat together, however, could alone comprise a balanced diet. 7. Raw foods are very helpful for cleansing the body for a period of time and giving it a break from denser, richer foods (or processed foods, if those are still in your diet). Or, even eating all vegetables (raw or cooked) for a several weeks, is a great way to avail of the high nutrients in vegetables, and let them cleanse and heal your body. Vegetables don’t contain enough nutrients for supporting your long-term performance, but they are a necessary inclusion (or large portion) of any diet, and a helpful method of short-term detoxification. People following intense, short-term vegetable diets often report excellent results such as weight loss, better digestions, and clearer skin. However, one only has to Google vegans who have switched back to meat-eating, to realize the detriments of eating only vegetables for years on end. 8. Raw foods taste best in season, and our bodies are most prepared–in their natural rhythm that follows the seasons–to savor them at those times. Spring greens to cleanse from winter; berries and tomatoes to sweetly refresh in summer’s heat; apples and pears to give crispness and accompany fall’s root vegetables. Fruits and vegetables have the most nutrition and flavor in season. Buying them locally or regionally ensures the highest nutrient content (not lost in travel time or being picked when unripe) and best economical value (no transportation cost; supporting your neighbor farmers). Many people say and believe that raw foods are meant to be eaten in season, and when they’re not in season, it’s better to eat them canned or frozen–since they were canned or frozen at the peak of nutrition. Food frozen at its peak likely rivals or exceeds the nutrients of raw veggies from another continent, and veggies kept in a storehouse through the remaining three seasons. And as we discussed, raw produce isn’t the only carrier of nutrients. Canned and frozen foods retain many, many nutrients. Usually frozen is best, but in the case of tomatoes, canning increases the levels of one of the best phytonutrients, lycopene. Better canned than fresh tomatoes in the middle of winter! 9. Raw foods are not the only thing mentioned in the Bible, so that’s the best historical and theological indicator that we need more than fresh raw veggies in our diet. Following the foods that the Bible mentions–and trying to acquire foods in whole forms like they would have had millenia ago–is the best path toward the healthiest diet. We live in different regions from the Middle East, so it is wise to focus on eating foods and produce that are fresh, seasonal, and native to our own areas. 10. Links to a few of my other articles that also weigh in on the subject of raw foods can be found in the full article on Culinary Reformation. Featured´s archives ↓ I admit to being a little skeptical when I started reading Mini Farming, Self-sufficiency on 1/4 Acre. I’ve seen a few books that were written by people who didn’t have a clue what they were writing about with titles similar to this. Some of these books have unworkable ideas and make claims that are just not true. This book on the other hand has much useful information and ideas that can help you gain a greater level of independence on fairly small areas of land. I think a better and more accurate title would have been “Mini Farming, How to Gain a Greater Level of Self-sufficiency on 1/4 Acre”. Obviously, no one can have total self-sufficiency on a 1/4 acre but the author of this book grows 80% of his family of three’s food on just that much land. The author has developed a system of gardening that takes the best of the Biodynamic, Grow Bio-intensive and Square Foot Gardening methods. He utilizes double dug raised beds, vertical gardening, compost and organic growing techniques. His “mini-farming” system also includes raising chickens for eggs and meat. I appreciated one area that Markham covered in the area of economics and “mini-farming”. He shows how the two income family is much better off by having one spouse stay home and raise food and children. He runs through the numbers and proves that in all actuality families are further ahead financially by doing this. I think that his argument will wake up many working mothers to fact that they are running themselves into the ground for very little return. If nothing else, this book shows how to grow a substantial amount of a family’s food on a very small amount of land. Granted, the average Christian homesteading family is much larger than the author’s, but it still drives home the point that you don’t need a huge amount of land and if fact you probably haven’t even begun to utilize the land you already have. I think that the book is ideal for beginners because it covers everything from seed selection to harvest and preservation. Not an exhaustive treatment of any subject, but very informative. I thought that the section on soil health was very well done. Considering how inexpensive this book is, I think that anyone who is trying to utilize a small holding of land to raise food should own a copy. This post is excerpted from The Entwife’s Journal. Today, January 11th is National Milk Day. When milk started being delivered in sterlized glass bottles in 1878 that was a big deal. National Milk Day was established to commerate this event every January 11th. I saw this in an email put out by Milk Unleashed for their shelf safe milk- you know the kind you buy in cartons that can stay on your shelf for months and months and still be absolutely fine to drink. How is that even possible I wonder and maybe you do too. Well it is because the milk is ultra pasteurized and packaged in special cartons. What is ultra pasteurization and how does it differ from pasteurization you wonder? Regular milk bought at most stores is pasteurized-the milk is heated to 161-167 degrees Fahrenheit for 15-20 seconds and then cooled. In ultra pasteurization the milk is heated to 275-284 degrees Fahrenheit for about 3 seconds and then cooled. The UHT treatment is a continuous process in a closed system that keeps out all possibly contamination from airborne microorganisms. This is why UHT milk can be kept for long periods of time. The down side-the milk is dead. The enzymes and cultures are changed, the calcium is changed and the protein structure is damaged. This milk will not be able to be used for cheese and probably not for kefir or yogurt. Pasteurized milk is also altered, albeit not as severely as the ultra. Many people have trouble with dairy these days and much of that comes from the pasteurization which alters the proteins and changes the composition of the milk. The New Year brings opportunity to make changes to your lifestyle, and what better change to implement than to eat better? There’s a great new educational film called Hungry for Change that provides both the why and the how for eating healthier. It exposes the truth about the diet industry and the dangers of food addictions, and enables you to take charge of your health and strengthen your mind and body. The folks the produced the film have shared some great actionable plans to help people get started, including a 3 day detox program that you can implement on a weekend – why not start this weekend? Here’s an overview of the program. Day 1, 2 & 3 - UPON RISING – Ginger Lemon Detox Drink - BREAKFAST – Super Detox Green Juice (or optional Super Simple Green Drink) - MID MORNING SNACK – Cucumber, Celery & Carrot Sticks - LUNCH – Sushi Salad (or optional green salad) - AFTERNOON SNACK – Activated almonds - DINNER – Potassium Balance Soup - DESSERT – Chia Pudding - AFTER DINNER – Calming Chamomile Tea You can get the details for this three day detox program, including recipes and helpful educational info, on the Hungry for Change website. To help get this extremely helpful video into the hands of as many people as possible, we’re offering Hungry for Change for only $20 for a limited time. That’s a 43% discount! As the American holiday of Thanksgiving is celebrated we often will hear some bit of the story of the Pilgrims and their “First Thanksgiving.” Regrettably, their story is often boiled down to the basics and we lose some of its fullness. Here I want to flesh out a small part of the story concerning the Pilgrims’ work in agriculture. In the spring of 1621 the Pilgrims and the Indian tribes planted and worked in the fields of agriculture. We can see that both the English and the native tribes had skills and abilities the other lacked. We read in William Bradford’s book Of Plymouth Plantation, “Afterwards they…began to plant their corn, in which service Squanto stood them in great stead, showing them both the manner how to set it, and after how to dress and tend it.” Squanto and the Indian tribes had great experience with the land that the English lacked. They had a history of learning from mistakes and finding what worked. They knew the right seeds to plant. Squanto taught the English to fertilize their corn with the fish that would spawn in the river nearby at just the right time. If they didn’t, the nutrients in the land would get used up. Here we can recognize that God provided the Indians with fish that would spawn at just the right time to fertilize the land so they could eat and live. As Matthew 5:45 says, God “makes his sun rise on the evil and on the good, and sends rain on the just and on the unjust.” Here the Pilgrims reaped the benefits of working with the pagan tribes by learning the good things God had given them. This was a very providential blessing as their own seed did not do well, but thanks to this help they had enough food. But despite God’s blessing on the native tribes, they were not exactly prosperous and thriving. The help was not all one sided, as we can see from an event that happened two months later. It had been a little time since the English had seen Massasoit and so they sent two men along with Squanto to meet with him. This expedition had several objectives. First, to reaffirm peace with Massasoit and to keep a good relationship with him. Second, to exchange for seed for experimentation. The Pilgrims wanted to make sure that had a variety of things planted in case some failed. Third, to find out which tribe it was that they had taken corn from in the winter, so they could pay them back for it. Fourth, to explore the area around them. And fifth, to limit hungry visitors. It is this last objective that shows something about the Indians’ work ethic and food production. What was happening was there were many Indians that were taking advantage of the Pilgrim’s hospitality and staying there eating up their food. The Pilgrims wanted to be hospitable, but did not want to run out of food and so asked Massasoit to limit visitors to the amount they could handle. They were generous with gifts and hospitality, but did not want to become welfare providers, especially when they couldn’t afford it. As the small expedition went out they could start to see why many Indians preferred to get the food from the English. The Indians, despite having a great abundance of natural resources, still struggled in having a stable food supply and clean habitations. As Edward Winslow (one of the two men on the expedition) says in his book Mourt’s Relation, describing a meager meal they had with Massasoit, “this meal only we had in two nights and a day, and had not one of us bought a partridge we had taken our journey fasting…he was to have us stay with them longer: but we desired to keep the Sabbath at home: and feared we should either be light-headed for want of sleep, for with bad lodging, the savages’ barbarous singing (for they use to sing themselves asleep), lice and fleas within doors, and mosquitoes without, we could hardly sleep all the time of our being there; we much fearing that if we should stay any longer, we should not be able to recover home for want of strength.” Bradford remarks concerning this lack of prosperity among the Indians, “For the Indians used then to have nothing so much corn as they have since the English have stored them with their hows, and seen [the Englishmen’s] industry in breaking up new grounds therewith.” On their trip some Indians desired that the Englishmen kill some crows, because they had been ruining the corn. There the two Englishmen with their superior weapons killed 80 crows in an afternoon. We can see that the Indians benefited both from observing the English work ethic, and the technology it produced (such as guns and hows). This work ethic had come from the long history of Christendom where it had been taught that work is worship to God, that work is a blessing, that we are created to work and produce to the glory of God, that our first command from God is to “Be fruitful and multiply and fill the earth and subdue it, and have dominion” (Gen. 1:28). Even the monks in the Middle Ages were taught this and spent much of their time in working and agriculture. The Protestant Reformation continued this and expanded it with its teaching of vocation, that the farmer and the pastor are both doing God’s work. The Pilgrims understood the importance of work and produced great things. When my family and I were in Plymouth in 2009 we saw a mill built only fifteen years after the Pilgrims first landed. It was amazingly intricately designed with all sorts of wheels, gears, stones, and levers–and it’s still working! We can see that the Christianity of the Pilgrims made them hard-working, productive, and a relatively prosperous society. It was this culture that built America. Read more at The Christian Philosophy of Food Food is not what it used to be, at least not the food found at the supermarket. The modern world boasts of a bountiful harvest provided by technology – the wonders of industrialization applied to agriculture. But the result of this production system has largely become one of turning a few crops into commodities and engineering a vast new sea of “foods” from them. The modern western (and especially U.S.) diet largely consists of highly processed food products, far removed in form and nutrition from the original life form that they came from. The Industrialization of Food This commoditization of food has been greatly aided by government subsidies for corn and soy, to the benefit of the food processing and fast food/junk food industries. The creation of very cheap inputs into factory foods by government policy is a foundational contributor to the change in the nature of food in America over the past several decades. This, combined with the cultural changes valuing mobility and convenience over family time and traditional cooking, have led the sea change in the way that Americans interact with food. The results have been devastating. We now have widespread (if not epidemic) rates of obesity, heart disease, cancer of all kinds, food allergies, and behavioral problems linked to poor digestion and gut health. It is not coincidental that these changes have come with the change in the American diet and lifestyle. Causal is a better term to describe it. Industrial farming has leveraged economies of scale to produce for the mass market through factory farming, but the land, animals, and humans have suffered the consequences in falling nutritional quality and illness caused by chemical farming techniques. And industrial farming is petroleum based farming, turning oil into food. The era of cheap food is over. Even before the great American drought of 2012, rising oil prices have combined with third world nations’ rising incomes and increasing demand for more meat and other higher-cost food, to drive food commodity prices ever-higher. Food has traditionally gone down in price, at least the trend had been that way for the last 100 years. According to Global Financial Data, food prices have dropped over the last 100 years by 82%, and looking at the economic business cycle for food, it would seem this would just be another “bust.” But two important factors reveal that this may be a more long term trend. First, oil is now more than ever a critical input to commodity crops, and therefore food production. According to a study by Cornell University, it takes 140 gallons of fossil fuel to grow and harvest one acre of corn. This fuel is not just for the tractor; this includes all the petroleum used to make the pesticides, herbicides, and fertilizers, and this number does not include the cost of transporting the corn to a market, or the petroleum used in the packaging of the food. As volatile geopolitical situations arise, and as sources of oil continue to diminish, the price of food will rise regardless of regional food price differences. Ill-conceived government subsidies for ethanol that is turning food crops into fuel have only exacerbated this trend. A second factor at play is the diminishing amount of farmland. The demographic trend continues to be individuals gravitating towards large urban population centers, and not out to the farmland. The American Farmland Trust estimates that American farmland is disappearing at the rate of 2 acres per minute. As farmers and their land become more scarce through industrialization, the system becomes more susceptible to shocks and rising food prices. With a severe global economic downturn setting in and millions of families worldwide facing difficulty in figuring out how to feed their families, we have now entered a global Food Crisis. The “Arab Spring” was one of the many indications that the global food system is precariously balanced at the edge of a cliff. But the crisis caused for millions due to the increasing price of food is a lagging indicator. More fundamental is the drastic way that food production, distribution, and consumption has changed over the past few decades. With increasing urbanization has come the loss of productive farmland and the decline of family farming around the globe. This makes the modern food system much more susceptible to risks of various sorts, everything from weather and crop failures, to market conditions in oil markets and global geopolitical events. The 2012 drought in America’s heartland – the worst ever – is an important recent example. Even local disasters can produce serious problems with respect to food availability due to the long supply lines in modern food systems. What is the Solution? With so many systemic problems in our food system, what is the solution? The solution to all of these problems – to our depleted soil, shrinking and aging farmer population, our toxic environment, diminishing nutrition, chronic health problems, and rising prices – is YOU. You are the solution! As much as you are able, grow your own food. Being productive with what you have is an essential first step. Buy fresh and buy local. Know your farmer and support your local economy. Buy from a farmer you can trust, one whose farm is not entrenched in the factory farm system. Join a CSA or community garden. Localization is a key to transforming the food system. Know the risks associated with buying chemically-produced food, and choose to buy organic and sustainable products. Self-education is a critical foundation for transforming the way your family deals with food. Don’t rely on someone else to do it all for you. Further, research and implement traditional food preparation methods, which will help you maximize the nutrition that your family receives and keep them healthy. Plan ahead and buy in bulk from trusted suppliers. Join a food co-op or buying club to get better deals on whole foods, buying in bulk to utilize aggregated purchasing power. Build up a food storage supply – the larder of olden days – to be prepared for emergencies and ready to share with neighbors in need. Forward thinking is required to get out of the rat race that comes with “convenience”. Is It Really That Simple? With such huge challenges facing us with our broken modern food system, could it really be that simple? Yes, it is that simple. You are the Solution. It requires action by individuals and families to change the system, because food choices are what support the system. It was, in fact, only because people changed the way they acquired, prepared, and ate food – adopting “convenience” and price as determining factors – that our current system became what it is. Stop feeding the beast with your purchases – opt out, as much as you are able. Change what you are demanding, and the market will change to accommodate you. In fact, it already has begun to do so. Grow a garden. Know and support your local farmers. Join a buying club. Build your food storage. Grow community around food. It really is that simple. It starts and ends with you. You are the Solution. The USDA announced on August 30th, 2012 that $18 million worth of aid would be distributed to new farmers and ranchers, particularly those who were “socially disadvantaged.” The program (titled the "Beginner Farmer and Rancher Development Program") is a new wave of aid enacted through the 2008 farm bill designed to entice a young workforce to enter the farming occupation, specifically to establish themselves within the developing sustainable niche. The program sets aside money for college and university programs, nonprofits, and organizations that promote off-grid living, and collective farming operations. The USDA claims the program, “will help beginning farmers and ranchers overcome the unique challenges they face and gain knowledge and skills that will help them become profitable and sustainable,” without considering the grand irony of the federal government being involved in “sustaining” agriculture. The Meaning of “Sustainable” “Sustainable” has a specific meaning in my agriculture worldview. It does not merely serve as a placeholder on the “progressive foodie” cereal box, and it is not just the philosophy to live by for the good of humanity. Honest advertising and moral concerns for the planet play a part in the “sustainability” label, but as a market garden manager, sustainability for me is separated into two connected categories: economic security and biological diversity. A farmer must budget for what his farm can sustain and what it will need, considering future projected income through crop and animal yields. How then could the farmer use government funds and still be sustainable if his farm must profit from grants? Even if the grant is just a startup investment, a marketplace unable to sustain the start-up businesses that provide for the most basic human need is a poor marketplace to be a part of, and one I certainly would avoid. At the least, the farmer is not appropriately preparing for what the market will dictate. The aid offered through this specific grant, and other grants which the USDA pushes on young farmers, will never strengthen the market for the farmer, but will only induce a system of dependency on government aid. It will eventually cause the loss of independent farms and farmers that the very programs are trying to prevent. Is the USDA Really Supporting Farmers? Despite my previous denunciation of government funding for sustainable farming, I think most sustainable farmers would expect a farm bill to contain direct grants (as in previous bills) for individual farmers, yet the majority of the funding (after the university programs) is given to organizations that support sustainable gardening or collective programs. One organization in Illinois, The Black Oaks Center for Sustainable, Renewable Living, is more of a working community than a farm, and is more focused on teaching survival skills in a “post-carbon” world, creating renewable energy, and on collectively farming for the common good, than on producing food to economically sustain a family. I believe such a program would have positive effects on individuals and families weaning themselves from a consumer-heavy mindset, but at best, this grant provision show the ignorance the USDA has when it supports sustainable farming, in the context of the business of farming. USDA Really Supports the Industrial System The USDA has traditionally manipulated the market for farm products, turning many crops into commodities in order to enable low cost food products to the consumers, and at the same time offering aid to the farmers taking the risk so they can hedge against crop failures. Without the need to plan for the risk of losses, farmers have developed an agricultural landscape that supports monoculture, quickly harvestable and often environmentally misplaced crops. Sustainable farming has no place in such a system, and if anything has come of this system, it has neither helped the farmer nor the consumer. The system has made the farmer dependent on debt and industrial technology, and the consumer has experienced a reduction in real food and poor nutritional quality. It is no wonder that over the last decade we have seen a rise in the demand for organic and sustainable food products. The companies who support agribusiness are still making their profits, and one would think the USDA would support them entirely, so why would the USDA suddenly decide to help the small, limited market? I believe the answer lies with the consumer. The USDA is no doubt noticing the impact that such labels as the organic label (a $32 Billion industry in the US) and the sustainable label have had on consumers and producers alike. These labels have been processed through bureaucratic jargon to come to mean nothing from the governmental regulatory standpoint. Organic foods can contain many different chemical agents, either applied in the field or in a processing plant. At the same time, this is the same agency who has shut down small farming operations across the United States because they marketed products that consumers sought, even though the products were considered unsafe for consumption or production by the USDA (I am speaking of raw milk, hemp, raw honey, etc), while greenlighting the use of GMO seeds and hormone enhanced cattle, neither of which are sustainable. Now, the USDA seemingly wants to find a way to extend an olive branch to the new generation of young entrepreneurs who want to positively affect the food supply, yet I think it has more to do with the influence that young farmers will have on their land. Supporting Family Farms? The USDA will attempt to redeem themselves by pointing out that they have stood for family farmers, although to what degree? 98% of US farms are family owned. An encouraging sign, but of those farms, only a few are true polyculture farms, growing for biological and economic sustainability. Their agricultural production is dependent upon the industrial systems used to sustain vast monocropped land. This industrial system has created many casualties. There are 330 "family" farmers are leaving their land every week because they aren't able to make ends meet. This statistic would be less sad if there were a new generation of farmers to fill the void left, but not many exist. The mean age of farmers in this country now stands at 65. So, the USDA is doing their bit to provide the educational needs of the new generation of farmers, bringing them into the "21st Century" of farming. Yet, this kind of thinking produced the problem in the first place! The grants have an educational focus on how to "engineer" the farm, instead of how to let the farm produce on it's own. I am not denigrating college in anyway, or stating that it doesn't have a place in helping upcoming farmers understand the science involved in creating a truly sustainable farm, but within a system supported by agribusiness, there is no a silver lining. What Will Really Support the 21st Century Farmer? "The young farmer only needs a little more education" is the cry, and the USDA can be seen promoting and supplying the “socially disadvantaged” young farmer with the tools for the 21st Century. But the 21st Century has shown solutions that are not in support of the young sustainable farmer. Although such programs exist that promote organic or sustainable agriculture, they do not give a farmer any edge over the internet-savvy individual who can mine the knowledge base of the internet, and who can invest more money into land or sustainably developing his farm. Being socially disadvantaged (are they meaning to say, "dumb hick?") does not necessarily mean technologically inept. That is what the 21st Century has really offered the new farmer, the possibilities of infinite knowledge sharing and the verification of results. Results is what the classroom farmer will still be offering, the "slightly smudged" organic tomato which has all the outward certifications of organic, but the internal poverty of mismanagement and licensed cheating. But to the true sustainable 21st Century farmer, land becomes the resource to be sought, not costly knowledge, and most importantly, the freedom to farm as one pleases, and as the consumer market dictates. The USDA can certainly try to sell their wares to the young generation of farmers, but I believe these strong, hard-working growers are seeing through the deceptive hypocrisy. Government cannot solve the ills that have been built up over several generations of conventional farming, supported by the USDA, and government is not the answer to the decline of American farming. This aid is not the support young farmers should desire, nor is it the redemption the USDA craves. The solution is the farmer and his field, free from the tyranny of government regulation and unadulterated by government handouts. Joel is a very unique man. He has been a visionary leader of the sustainable farming movement, a prophet of sorts, calling people back from the destructive ways of modern industrial farming to return to a sustainable agriculture model that utilizes technology appropriately while honoring God's design in creation. Take a few minutes to read this reflective note from Joel written this morning and posted on the Polyface Farm Facebook page, and rejoice with him on this momentous occasion! A note from Joel……. Sept. 24, 1982 marked my first day of full time farming. It was a Monday, just like today, and the Friday previous I had cleaned out my desk in the Staunton News Leader newsroom and waved goodbye to my fellow journalists. Everyone thought I was making a huge mistake. Farming? Anything but that. Even farmers thought I was making a huge mistake. And then to know that I was not going to use chemicals. That I was going to pasture chickens and pigs. That I wasn't going to build silos and plow the soil. How could anything be This morning I awakened to a farm festooned with balloons. I had mentioned the day and its 30-year importance in passing a couple of times during the summer, but frankly have been too covered up with responsibilities to plan any big celebration for myself. No worries. I'm surrounded by the most loyal, grateful, creative, dependable, conscientious team of young people you can imagine. I've been crying all morning. I think Eric and Brie led the plans. Overnight, they and accomplices decorated the farm with balloons, strategically placed to intercept my morning routine at every step. From the clothesline beside the backdoor to the equipment shed, balloons lined the path. The Massey Ferguson tractor they knew I would use to move the Eggmobile had balloons anchored to the wheels. As I approached the Eggmobile to hook it up, balloons cascaded off the front. As is my routine, I went out to get the morning newspaper–once a news junkie, always a news junkie–and the farm entrance literally floated with ballons and our entrance sign had an explanatory addition in huge letters: Happy Anniversary Joel Fulltime Farming 30 Years. Tears welled up uncontrollably as the reality of the love and support of these young people overwhelmed me. To be this age, farming, surrounded by this kind of enthusiasm and honor–could it get any better than this? And then I had to chuckle: take that, friends, farmers, experts. All you folks that said I was throwing my life away, being foolish. Can you see me now? Ha! I always check the cows in the morning. Yes, balloons on the 4-wheeler (my personal Japanese cow-pony). Streaming behind me, the balloons followed me up the three-quarter mile farm lane to the farm pasture. And as if that weren't enough, all along that route, from the trees and bushes, balloons heralded the celebratory day. We're here! We've made it this far! Touchdown! Hallelujah! Say it however you want to; scream it from the rooftops. We're still here. And not only have a survived, we've thrived. Tears streaming down my face, I topped the little knoll before coming to the cows and there, adorning every electric fence stake in the cross fence, were more balloons. The cows, mostly lying down on this 38 degree morning (we actually had the first patchy frost of the season), simply burped up another wad of grass cud to chew on. They looked at me completely ordinarily. Nothing much upsets their routine. Nothing is as placid as a placid cow. With gratitude and a deep sense of blessing welling in my heart, tears streaming down my cold cheeks, I headed back to the house for breakfast, the newspaper, morning emails, and desk work. My spirit is overflowing today. Teresa and I had a dream. We worked at it. We prayed over it. We babysat it. We lived and loved it. Today it shines like a burning bush, attracting people from all over the world to come and see. Thank you, Lord, for 30 wonderful years. And lest you're wondering, we don't think we've hardly started yet. Now we're not just a couple of people standing on the shoulders of our parents, but we're a tribe, with the next generation and the next and a whole team of players plugging the gaps where we're weak and leveraging our expertise where we're strong. Look out, world. Here we come. Thank you, family. Thank you, Polyface team, staff, interns. Thank you, patrons who have stood by us monetarily, supporting us with your smiles, your eating, and yes, your dollars. Polyface Farm is charitable, but not a charity. It is a business, but not only a business. So raise your glasses, folks. Here's to another 30 years. Thank you. My brother, dad, and I recently drove two counties over here in our homestate of Texas to pick up 8 local bee hives. The bees and their honey will form the backbone of our "artisan" product offering to our market-garden customers, and are a welcome addition to our current stock of sweetless produce. The adventure of picking them up was a success, but not without a fair share of trouble. The easiest way to minimize the hassle transporting bees is by performing the task at night when they are sleeping in their hives. We chose a moderate evening to move them. "Summertime is when we transport our bees," Dad mentioned, referring back to his days as a beekeeper on his family orchard. Of course, the weather in Washington State was different than Texas. It is imperative that bees be transported at 50 degrees above Farhenheit, since bees tend to cluster at temperatures below 50, and when the hive is jarred on the journey to a new location, the clusters began to break apart, and the bees die. I would have enjoyed transporting during a Texas fall evening, but at least that night, Texas experienced a surprisingly low high of 85. A moderate wind also gave some relief to the chore. We arrived at the property where a first set of hives were kept, and unload our trailer and my brother. His task was to collect all the empty bee boxes, and dead hives he can pick up. Dad and I continued on into the night to a property where the remaining hives are. We placed the most important tool for transporting bees, a smoker, behind us in the truck bed. If you ever have to light a smoker and travel to where the hives are, it is a good idea to pack even more fuel for the smoker then you anticipate using. In our case, the wind blowing through the bed burned through fuel out quickly. When we arrived at the location, we decided to attack the hive without the smoke. The hushed rustle of a thousand wings emerge from the inside of the box. That is the sound is the winged creatures during their sleep. The pioneers had their homes built for them, but they were the ones that carved a place on the land, collecting pollen, and building stores of honey in comb. Four of the hives have not survived the year, and so they are quickly loaded onto the truck. The front lights fork into the grass, and illuminate our large, netted hats, as we head out to grab the "live" hive. Our gloves are slaked with sweat. We formulate a plan for moving the hives while dad secured the hive boxes together with a staple and hammer. It is best to secure the hive boxes several days before the move, since the bees do not take kindly to someone hammering on their home in the middle of the night (and who wouldn't!). Soon enough, the hammer's pounding made us wish we had not run out of smoke! The hive began to stir as we reached underneath the shallow crevices at the bottom of the box. The hive creaked; it was weighed down by the the bees, and the full honey combs they have stored over the course of the season. Later we find out that this is the strongest, most menacing of the hives. As their home became airborne, The bees begin to swarm out in droves, colliding into our protective clothing and helmets. We stumble sideways, bearing our cargo to the lowered tailgate of the truck. As soon as our cargo is deposited, it is a race to get away, and dive into the tall grass. At that moment, every single killer bee documentary I watched flashed through my mental theater. If I could advice my younger self of anything, it would have been to never watch those National Geographic specials! The do not make the process of collecting bees any easier. It did not get any better when I found I had not secured my helmet correctly, and two bees had slipped inside the netting. I retreated (although it appeared more like a route), and slipped the helmet off as I did, batting the bees away. I definitely would have benefited from having my dad check my gear. Thankfully, no harm was done. In fact, I survived the night without a single sting; my brother suffered 5; my dad, 3. It took 20 minutes for the hive to settle down so we could approach it again. When we finally did close the truck bed, the guard bees were still whacking into our clothes. Another 20 minutes, and we were off toward the first set of hives. We made it back, the dead hives were on the trailer, and safely secured. It is always a good idea to secure the hives with straps during transport. Even with the weight, the hives could topple, and the disorganized swarm lost. The hives at the first location were more easily loaded. Our smokers were loaded, and the smoke they produced was thick. Many people have the notion that smoke somehow puts the bees to sleep. This is not true. The bees sense of smell is their most powerful sense, and smoke masks the bees alarm pheremones. Smoke also triggers their flight instinct when faced with natural fires. The bees retreat back into the hive and fill up on honey in case they have to move their hive to a new location. For us, it was a matter of minutes before we had moved each hive onto the back of the trailer. The final ropes were attached around the live hives and we headed for home. While in transit, the hives' weight already did their bit to slow our vehicle down, but it is worth noting that continued jarring will not help keep your bees calm and inside the hive. It is best to travel well below the speed limit and keep a slow, steady pace. The vibration of the engine will keep the bees quiet. Home for our bees was not on our land. We still haven’t prepared for the bees, so for now, they wait on a friend’s land, while we build a permanent platform. Unloading the bees required only smoke, and by then it was 4 AM. With our charges on a makeshift platform, we departed to the comfort of our beds. Once we get our bees on the land, I'll check back in and share some more about maintaining hives.. Thanks goes to Robb Wokaty for input on some researched points. For more info on how to get started with Beekeeping, check out Beekeeping for Beginners. Intentionally focusing on eating local is all about understanding the source of our food in an effort to make choices that are more healthy for our bodies, the land, and our local economy. 1) Learn the issues Choosing to eat local is a shift in thinking. It is a reorienting of our food and money priorities. Economic, ecological, social, and personal health issues intersect our dinner table. It’s important to seek out resources, books, documentaries, etc, that can give us a rounded understanding of why eating local matters. … 2) Grow your own One of the most common criticisms I hear against choosing to eat local and sustainable is that it is too “elitist”. Because buying healthier foods can be more expensive you may think it won’t fit into your food budget, especially lately as food prices are rising. The surest and quickest way to eat local and even somewhat organic is to grow it yourself. Choosing to be a producer and not just a consumer is the first place to begin. … 2) Buy cooperatively There are times when buying as a group can really save you a lot of money. For instance, if you are interested in buying local, grassfed beef it would be most economical to go in with a few other families to buy a whole cow rather than buy particular cuts a little at a time. You can also start or join a buying club. … 3) Support sustainable producers The local food movement is integrally linked with sustainable agricultural practices. Sustainable agriculture involves growing food and raising animals in a way that continually restores the land and respects the animals. Using toxic pesticides, herbicides, and chemical fertilizers is destructive over the long term and does not build the health of the soil. Also raising animals in confined feeding operations raises the risk for disease. One of the main reasons for buying local is that it makes more sense ecologically. … 4) Define what matters to you Eating local can mean different things to different people. For some people it means a 100 mile radius; for other people it means only eating food grown in the state; still for others they are fine if it comes from the their part of the country. You need to decide what matters to you and why. Start small and be flexible. … 5) Seek the source Right now eating local is a popular trend so it seems everything and everybody wants to be in the game. The reality is though there is no certification for what local means. You should always inquire where the food comes from and how it is grown. The whole point of eating local is restoring our relationship with the food, the land and those who grow and produce it. Build relationships with the farmers and it will change the way you eat. As farmer, philosopher, and writer Wendell Berry has said: “Eating is an agricultural Act“
<urn:uuid:b835a11f-5bfe-475d-829b-f49d3eda973f>
CC-MAIN-2019-22
http://truefoodsolutions.com/blog/Topics/featured/
s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232256184.17/warc/CC-MAIN-20190521002106-20190521024106-00132.warc.gz
en
0.967527
10,281
2.953125
3
The deep water or open ocean is divided into several layers based on the overall depth. The top layer is called the epipelagic zone which starts from the surface to a depth of 200m. Thereafter lies the mesopelagic, bathypelagic and abbysopelagic zones. The epipelagic, sunlit, or euphotic zone is the top layer of the ocean zones. This is the ideal place for about 90 percent of all ocean life to live because of warm temperatures and sunlight that goes down about 660 feet. This is the only zone to support plant life because it has the light needed for photosynthesis, which is important because it produces a lot of oxygen and some carbon. Because of the variety in plant life there is a variety of animals including sharks, tuna, seals, jellyfish, sea turtles, sting rays, and much more! Though there are a lot of plants, there are not very many places to hide. Deep waters in the Mamanucas may fall to a depth of 20 to 30 meters on average, and is home to deep water fishes that inhabit the channels and countless coral bommies utilized by our local dive operators.
<urn:uuid:20074b3e-4d5a-4045-93f9-2d2b71abd9b2>
CC-MAIN-2024-10
https://mesfiji.org/resources/environment/deep-water
s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474795.48/warc/CC-MAIN-20240229071243-20240229101243-00284.warc.gz
en
0.947301
239
3.484375
3
I came across a reference to 'gofers' while I was preparing my recent post on teacakes, and was intrigued by this new/old word. It must have already been an old word in 1846, or presumably it would not have found its way into 'A dictionary of archaic and provincial words, obsolete phrases' which was published in that year. This dictionary defines a gofer as 'A species of tea-cake of an oblong form, made of flour, milk, eggs, and currants, baked on an iron made expressly for the purpose, called a gofering iron, and divided into square compartments.' Leaving aside such complexities as how a hot iron with square compartments can make oblong tea-cakes, I found this an interesting idea. The Oxford English Dictionary was my next step, and, as I hoped, it nicely solved the etymological puzzle with its description alone - no need to go to the detailed explanation of the derivation of the word itself. The OED says that a gofer is ' A thin batter-cake on which a honeycomb pattern is stamped by the iron plates between which it is baked'. A 'tea-cake' always suggests to me a rather more substantial article that this description, which, I am sure you will agree, sounds more like a wafer. And of course, that is what it is - a gaufre adopted by the English. Mrs Raffald gives the first recipe in The Experienced English Housekeeper (1769), if the OED is correct, and here it is: To make Gofers. Beat three Eggs well, with three Spoonful of Flour, and a little Salt, then mix them with a Pint of Milk, and an Ounce of Sugar, half a Nutmeg grated, beat them well together, then make your Gofer Tongs hot, rub them with fresh Butter, fill the Bottom part of your Tongs and clap the Top upon, then turn them, and when a fine brown on both Sides, put them in a Dish, and pour white Wine Sauce over them, five is enough for a Dish, don't lay them one upon another, it will make them soft.—You may put in Currants if you please. I have not been able to perform an exhaustive study of the history of gaufres as my computer is still indisposed (but due home today) and many of my books still unpacked awaiting bookshelves, but presumably it was the English who added the currants - for what is an English tea-cake without currants? They also may be responsible for changing its nature, in some instances, from the 'melt-in-the mouth kind of pastry' mentioned in another dictionary to 'tea-cakes of the muffin sort, square, and stamped like net-work with the ‘gaufering-iron'. Note the addition of yeast in the following version, from 'The Practical Cook, English and Foreign', by Joseph Bregion and Anne Miller (1845) Take a pint and a half of new milk, two ounces of butter, eight tea-spoonfuls of flour, half a teaspoonful of yeast, a quarter of a pound of fine sugar, and a quarter of a pound of currants; let the mixture stand to make it light before you bake it; rub your irons every time with a piece of fresh butter tied up in a cloth. Some think eggs preferable to yeast. Mis-hearing, mis-pronunciation, spelling confusion, and an overwhelming urge to be ridiculous (on this writer's part) may also lead us to gophers of the rodent variety [see the comments- my error: this almost certainly reefs to the gopher tortoise. Still fun though!]. With absolutely no apologies to those of you in a rather more serious mood this morning, I offer you gopher stew, from 'Family Living on $500 a Year' (1888) by Juliet Corson. The recipe is given as a variation of stewed terrapin. Stewed Terrapin [or gopher] To stew terrapin in the old Virginia style, boil it and remove it from the shell, as directed above; to each pint of the dressed terrapin, add the ingredients specified below and show all together gently for twenty minutes: the yolks of eight hard-boiled eggs, rubbed through a sieve with a potato masher, half a pint of cream, a quarter of a pound of butter, a tablespoonful of dry flour, and a gill or two of Madeira; season the terrapin palatably with salt and pepper, stew it gently and serve it hot. Gophers are cooked in South Carolina by first dressing them according to the above directions: for each gopher allow a quarter of a pound of butter; in this fry a level tablespoon of grated onion then a tablespoonful of flour, half a pint of Madeira or sherry, the gopher meat, and high season with Cayenne pepper, shalt and pepper, and powdered mace, as soon as the gopher is tender, serve it hot. Quotation for the Day. Waffles are like pancakes with syrup traps"
<urn:uuid:47280348-f85a-42ad-862f-bd43c206c400>
CC-MAIN-2022-05
http://www.theoldfoodie.com/2011/06/gofers-gaufres-and-gophers.html
s3://commoncrawl/crawl-data/CC-MAIN-2022-05/segments/1642320304287.0/warc/CC-MAIN-20220123141754-20220123171754-00522.warc.gz
en
0.95615
1,097
2.53125
3
The 11 species of badger are grouped in three subfamilies: Melinae (Eurasian badgers), Mellivorinae (the honey badger or ratel) and Taxideinae (the American badger). The Asiatic stink badgers of the genus Mydaus were formerly included within Melinae (and thus Mustelidae), but recent genetic evidence indicates these are actually members of the skunk family, placing them in the taxonomic family Mephitidae. Badgers include the species in the genera Meles, Arctonyx, Taxidea and Mellivora. Their lower jaws are articulated to the upper by means of transverse condyles firmly locked into long cavities of the skull, so dislocation of the jaw is all but impossible. This enables the badgers to maintain their hold with the utmost tenacity, but limits jaw movement to hinging open and shut, or sliding from side to side without the twisting movement possible for the jaws of most mammals. Badgers have rather short, fat bodies, with short legs for digging. They have elongated weasel-like heads with small ears. Their tails vary in length depending on species; the stink badger has a very short tail, while the ferret badger's tail can be 46–51 cm (18–20 in) long, depending on age. They have black faces with distinctive white markings, grey bodies with a light-coloured stripe from head to tail, and dark legs with light coloured underbellies. They grow to around 90 centimetres (35 in) in length including tail. The European badger is one of the largest; the American badger, the hog badger and the honey badger are generally a little smaller and lighter. The stink badgers are smaller still, and the ferret badgers are the smallest of all. They weigh around 9–11 kg (20–24 lb) on average, with some Eurasian badgers weighing in at around 18 kg (40 lb). The word "badger", originally applied to the European badger (Meles meles), comes from earlier bageard (16th century), presumably referring to the white mark borne like a badge on its forehead. Similarly, a now archaic synonym was bauson ‘badger’ (1375), a variant of bausond ‘striped, piebald’, from Old French bausant, baucent ‘id.’. The less common name brock (Old English: brocc), (Scots: brock) is a Celtic loanword (cf. Gaelic broc and Welsh broch, from Proto-Celtic *brokkos) meaning "grey". The Proto-Germanic term was *þahsuz (cf. German Dachs, Dutch das, Norwegian svintoks; Early Modern English dasse), probably from the PIE root *tek'- "to construct," so the badger would have been named after its digging of setts (tunnels); the Germanic term *þahsuz became taxus or taxō, -ōnis in Latin glosses, replacing mēlēs ("marten" or "badger"), and from these words the common Romance terms for the animal evolved (Italian tasso, French taisson — blaireau is now more common —, Catalan toixó, Spanish tejón, Portuguese texugo). A male badger is a boar, a female is a sow, and a young badger is a cub. A collective name suggested for a group of badgers is a cete, but badger colonies are more often called clans. A badger's home is called a sett. The following list shows where the various species with the common name of badger are placed in the Mustelidae classification. The list is polyphyletic and the species commonly called badgers do not, if the stink badgers are included, form a valid clade. - Family Mustelidae - Subfamily Melinae - Genus Arctonyx - Hog badger, Arctonyx collaris - Genus Meles - Genus Melogale [Some scientists assign this genus to the subfamily Helictidinae] - Genus Arctonyx - Subfamily Mellivorinae - Honey badger or ratel, Mellivora capensis - Subfamily Taxideinae: - Subfamily Mustelinae - Subfamily Melinae - Family Mephitidae Badgers are found in much of North America, Ireland, Great Britain and most of Europe as far as southern Scandinavia. They live as far east as Japan and China. The Javan ferret-badger lives in Indonesia, and the Bornean ferret-badger lives in Malaysia. The honey badger is found in most of sub-Saharan Africa, the Arabian Desert, southern Levant, Turkmenistan, and India. |This section requires expansion. (August 2016)| The behaviour of badgers differs by family, but all shelter underground, living in burrows called setts, which may be very extensive. Some are solitary, moving from home to home, while others are known to form clans called cetes. Cete size is variable from two to fifteen. Badgers can run or gallop at 25–30 km/h (16–19 mph) for short periods of time. In North America, coyotes sometimes eat badgers and vice versa, but the majority of their interactions seem to be mutual or neutral. American badgers and coyotes have been seen hunting together in a cooperative fashion. The diet of the Eurasian badger consists largely of earthworms (especially Lumbricus terrestris), insects, grubs, and the eggs and young of ground-nesting birds. They also eat small mammals, amphibians, reptiles and birds, as well as roots and fruit. In Britain, they are the main predator of hedgehogs, which have demonstrably lower populations in areas where badgers are numerous, so that hedgehog rescue societies will not release hedgehogs into known badger territories. In some areas they are known to predate lambs, and may bite a ewe defending her lamb, almost always leading to infection of the bite. They are occasional predators of domestic chickens, and are able to break into enclosures that a fox cannot. In southern Spain, badgers feed to a significant degree on rabbits. The honey badger of Africa consumes honey, porcupines and even venomous snakes (such as the puff adder); they will climb trees to gain access to honey from bees' nests. American badgers are fossorial carnivores – i.e. they catch a significant proportion of their food underground, by digging. They can tunnel after ground-dwelling rodents at speed. Relation with humans Hunting badgers for sport has been common in many countries. The Dachshund (German for "badger hound") dog breed was bred for the purpose. Badger-baiting was formerly a popular blood sport. Although badgers are normally quite docile, they fight fiercely when cornered. This led people to capture and box badgers and then wager on whether a dog could succeed in removing the badger from its refuge. In England, opposition from naturalists and moral crusaders led to its ban under the Cruelty to Animals Act of 1835 and the Protection of Badgers Act of 1992 made it an offence to kill, injure, or take a badger or to interfere with a sett unless under license from a statutory authority. The Hunting Act of 2004 further banned fox hunters from blocking setts during their chases. Badgers have been trapped commercially for their pelts, which have been used for centuries to make shaving brushes, a purpose to which it is particularly suited owing to its high water retention. Virtually all commercially available badger hair now comes from mainland China, though, which has farms for the purpose. The Chinese supply three grades of hair to domestic and foreign brush makers. Village cooperatives are also licensed by the national government to hunt and process badgers to avoid their becoming a crop nuisance in rural northern China. The European badger is also used as trim for some traditional Scottish clothing. The American badger is also used for paintbrushes and as trim for some Native American garments. It has also been occasionally used for doll hair. Controlling the badger population is prohibited in many European countries, as badgers are listed in the Berne Convention, but they are not otherwise the subject of any international treaty or legislation. Many badgers in Europe were gassed during the 1960s and 1970s to control rabies. Until the 1980s, badger culling in the United Kingdom was undertaken in the form of gassing, to control the spread of bovine tuberculosis (bTB). Limited culling resumed in 1998 as part of a 10-year randomised trial cull which was considered by John Krebs and others to show that culling was ineffective. Some groups called for a selective cull, while others favoured a programme of vaccination. Wales and Northern Ireland are currently (2013) conducting field trials of a badger vaccination programme. In 2012, the government authorised a limited cull led by the Department for Environment, Food and Rural Affairs, however, this was later deferred with a wide range of reasons given. In August 2013, a full culling programme began where it is expected about 5,000 badgers will be killed over six weeks in West Somerset and Gloucestershire using a mixture of controlled shooting and free shooting (some badgers will be trapped in cages first). The cull has caused many protests with emotional, economic and scientific reasons being cited. The badger is considered an iconic species of the British countryside, it has been claimed by shadow ministers that "The government's own figures show it will cost more than it saves...", and Lord Krebs, who led the Randomised Badger Culling Trial in the 1990s, said the two pilots "will not yield any useful information". Although rarely eaten today in the United States or the United Kingdom, badgers were once a primary meat source for the diets of Native Americans and white colonists. Badgers were also eaten in Britain during World War II and the 1950s. In Russia, the consumption of badger meat is still widespread. Shish kebabs made from badger, along with dog meat and pork, are a major source of trichinosis outbreaks in the Altai region of Russia. In Croatia, badger meat is rarely eaten. When it is, it is usually smoked and dried or, less commonly, served in goulash. In France, badger meat was used in the preparation of several dishes, such as Blaireau au sang, and it was a relatively common ingredient in countryside cuisine. Badger meat was eaten in some parts of Spain until recently. In Japan, badger is regarded in folktales as a food for the humble. In medieval times, badgers were thought to work together to dig holes under mountains. They were said to lie down at the entrance of the hole holding a stick in their mouths, while other badgers piled dirt on their bellies. Two badgers would then take hold of the stick in the badger’s mouth, and drag the animal loaded with dirt away, almost in the fashion of a wagon. The 19th century poem "The Badger" by John Clare describes a badger hunt and badger-baiting. In Lafcadio Hearn's book Kwaidan: Stories and Studies of Strange Things (1903), later to be the basis of a 1964 film, there is a short story titled Mujina, which is a shapeshifting badger. The character Frances in Russell Hoban's children's books, beginning with Bedtime for Frances (1948–1970), is depicted as a badger. Trufflehunter is a heroic badger in the Chronicles of Narnia book Prince Caspian (1951) by C. S. Lewis. Badger characters are featured in author Brian Jacques' Redwall series (1986–2011), most often falling under the title of Badger Lord or Badger Mother. A badger god is featured in The Immortals (1992–1996) by Tamora Pierce and "The Badger" is a comic book hero created by Mike Baron. The badger is the emblem of the Hufflepuff house of the Hogwarts School of Witchcraft and Wizardry in the J. K. Rowling's Harry Potter book series (1997–2007), it is chosen as such because the badger is an animal that is often underestimated, because it lives quietly until attacked, but which, when provoked, can fight off animals much larger than itself, which resembles the Hufflepuff house in several ways. Many other stories featuring badgers as characters include Kenneth Grahame's children's novel The Wind in the Willows (1908), Beatrix Potter's The Tale of Mr. Tod (1912; featuring badger Tommy Brock), the Rupert Bear adventures by Mary Tourtel (appearing since 1920), T. H. White's Arthurian fantasy novels The Once and Future King (1958, written 1938–41) and The Book of Merlyn (1977), Fantastic Mr. Fox (1970) by Roald Dahl, Richard Adams's Watership Down (1972), Colin Dann's The Animals of Farthing Wood (1979), and Erin Hunter's Warriors (appearing since 2003). In the historic novel Incident at Hawk's Hill (1971) by Allan W. Eckert a badger is one of the main characters. Badgers are also featured in films and animations: a flash video of "The Badger Song" shows a group doing calisthenics; in Pokémon, Typhlosion and Linoone are based on badgers. Walt Disney's 1973 film Robin Hood, depicts the character of Friar Tuck as a badger. In the Doctor Snuggles series, Dennis the handyman, was a badger. In Europe, badgers were traditionally used to predict the length of winter. The badger is the state animal of the US state of Wisconsin and Bucky Badger is the mascot of the athletic teams at the University of Wisconsin-Madison. The badger is also the official mascot of Brock University in St. Catharines, Ontario, Canada, as well as that of St Aidan's College at the University of Durham. In 2007, the appearance of honey badgers around the British base at Basra, Iraq, fuelled rumours among the locals that British forces deliberately released "man-eating" and "bear-like" badgers to spread panic. These allegations were denied by the British army and the director of Basra's veterinary hospital. The viral video Crazy Nastyass Honey Badger became popular in 2011, attaining over 68 million views on YouTube as of July 2014. The video features footage from the Nat Geo WILD network of honey badgers fighting jackals, invading beehives, and eating cobras, with a voiceover added by the uploader, "Randall". - Goswami, Anjali & Friscia, Anthony (2010). Carnivoran Evolution: New Views on Phylogeny, Form and Function. Cambridge University Press. p. 30. ISBN 978-0-521-73586-5. - "Badger Pages: Photos of and facts about the badgers of the world". Badgers.org.uk. Archived from the original on 5 February 2012. Retrieved 31 December 2011. - C. T. Onions, ed., The Oxford Dictionary of English Etymology (Oxford: Oxford UP, 1966), 68. - Weiner, E. S. C.; Simpson, J. R. (1989). The Oxford English Dictionary. Oxford: Clarendon Press. ISBN 0-19-861186-2. Retrieved 30 August 2008. - The American Heritage Dictionary, 4th edn., s.v. "badger" (Houghton Mifflin, 2001). - Ernout, Alfred; Meillet, Antoine (1979) . Dictionnaire étimologique de la langue latine (in French) (4 ed.). Paris: Klincksieck. - Devoto, Giacomo (1989) . Avviamento all'etimologia italiana (in Italian) (6 ed.). Milano: Mondadori. - Hints and Things: collective nouns Retrieved 28 June 2010. - Koepfli KP, Deere KA, Slater GJ, Begg C, Begg K, Grassman L, Lucherini M, Veron G, Wayne RK (February 2008). "Multigene phylogeny of the Mustelidae: Resolving relationships, tempo and biogeographic history of a mammalian adaptive radiation". BMC Biology. 6: 10. doi:10.1186/1741-7007-6-10. PMC . PMID 18275614. - Yu L, Peng D, Liu J, Luan P, Liang L, Lee H, Lee M, Ryder OA, Zhang Y (2011). "On the phylogeny of Mustelidae subfamilies: analysis of seventeen nuclear non-coding loci and mitochondrial complete genomes". BMC Evol Biol. 11 (1): 92. doi:10.1186/1471-2148-11-92. - Sleeman, D.P.; Davenport, J.; Cussen. R.E. & Hammond, R.F. (2009). "The small-bodied badgers (Meles meles (L.) of Rutland Island, Co. Donegal". Ir. Nat. J. 30: 1–6. JSTOR 20764515. - Brink van den, F.H. (1967). A Field Guide to the Mammals of Britain and Europe. Collins, London. - Duckworth, J.W. & Brickle, N.W. (2008). Melogale orientalis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 21 March 2009. Database entry includes a brief justification of why this species is of data deficient - Duckworth, J.W. & Azlan, J. (2008). Melogale everetti. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 21 March 2009. Database entry includes a brief justification of why this species is of data deficient. - Begg, K., Begg, C. & Abramov, A. (2008). Mellivora capensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 21 March 2009. - "Badger". Kansas University. Ksr.ku.edu. Retrieved 26 August 2012. - Kiliaan HP, Mamo C, Paquet PC (1991). "A Coyote, Canis latrans, and Badger, Taxidea taxus, interaction near Cypress Hills Provincial Park, Alberta". Canadian Field Naturalist. 105: 122–12. - Cahalane VH (1950). "Badger-coyote "partnerships"". Journal of Mammalogy. 31: 354–355. doi:10.1093/jmammal/31.3.354-a. - An Analysis of Eurasian Badger (Meles meles) Population Dynamics: Implications for Regulatory Mechanisms - "Eurasian badger (Meles meles) ecology: DIET". Woodchester Park Badger Research. Central Science Laboratory. csl.gov.uk. Archived from the original on 28 March 2010. Retrieved 30 August 2008. - "The value of agri-environment schemes for macro-invertebrate feeders: hedgehogs on arable farms in Britain" (PDF). Animal Conservation. 13: 467–473. doi:10.1111/j.1469-1795.2010.00359.x. Archived from the original (PDF) on 7 April 2014. Badger predation of hedgehogs was high in the study site and the main cause of death - "badgers and hogs don't mix we'd never consider releasing hogs into ... an active badger territory". Snufflelodge.org.uk. Retrieved 27 August 2013. - "Forums". River Cottage. Retrieved 27 August 2013. - Fedriani, J.M.; Ferreras, P. & Delibes, M. (1998). "Dietary response of the Eurasian badger, Meles meles, to a decline of its main prey in the Doñana National Park". Journal of Zoology. 245 (2): 214–218. doi:10.1111/j.1469-7998.1998.tb00092.x. - AFP: Drunk badger blocks German road. Google.com (8 July 2009). Retrieved on 7 November 2011. - EB (1878). - EB (1911). - UK Government. "Protection of Badgers Act 1992". Retrieved October 7, 2015. - "Bristle Styles and Additional Information". Em's Place. Retrieved 25 May 2013. - "ADW: Taxidea taxus: Information". Animal Diversity Web. Archived from the original on 23 September 2008. Retrieved 30 August 2008. - The European badger (Meles meles). badger.org.uk - Badger cull is necessary to stop them suffering, say vets. The Times (27 April 2013). Retrieved on 2 September 2013. - "Badger cull begins in Somerset in attempt to tackle TB". BBC. 2013. Retrieved 30 August 2013. - Carrington, D. (14 December 2011). "Badger culling will go ahead in 2012". The Guardian. Retrieved 30 August 2013. - Carrington, D. (23 October 2012). "Badger cull postponed until 2013". The Guardian. Retrieved 30 August 2013. - "Wonderland: The Man Who Eats Badgers and Other Strange Tales – TV pick of the day for January 23rd, 2008". Library.digiguide.com. Archived from the original on 12 April 2009. Retrieved 25 April 2009. - "Primary Source documents". Bcheritage.ca. Retrieved 25 April 2009. - "How To Bake A Badger". Globalchefs.com. Archived from the original on 15 July 2007. Retrieved 7 June 2010. - "Summary of Trichinellosis Outbreaks (2001–2004)". Trichinella.org. Retrieved 25 April 2009. - "MESO: The first Croatian meat journal, Vol.VII No.1 February 2005". Hrcak. 1 February 2005. Retrieved 25 April 2009. - Florijančić, Tihomir; Marinculić, Albert; Antunović, Boris & Bošković, Ivica (2006). "A survey of the current status of sylvatic trichinellosis in the Republic of Croatia" (PDF). Veterinarski Arhiv. 76 (7): S1–S8. - "Summary of Trichinellosis Outbreaks (2001–2005) – Russia". www.trichinella.org. Retrieved 11 October 2008. - "Sweet delicacy from hunter's kitchen – badger (Melles melles L.) Abstract". Portal of scientific journals of Croatia. Retrieved 11 October 2008. - Molinier, Annie; Molinier, Jean-Claude; d'Hauterives, Benoît Lumeau. (2004). Les cuisines oubliées. Illinois: Editions Sud Ouest. ISBN 978-2-87901-549-1. - "Badgers in Spain". IberiaNature. Archived from the original on 4 December 2008. Retrieved 25 November 2008. - Radin, Paul (1946). "Folktales of Japan as Told in California". The Journal of American Folklore. 59 (233): 289–308. doi:10.2307/536252. JSTOR 536252. - Hubbard, Fran (1985). Animal Friends of the Southwest. USA: Awani Press. p. 29. ISBN 0-915266-07-5. - "Protection of Badgers Act 1992, Section 4". legislation.gov.uk. 29 June 2011. Retrieved 9 May 2016. - "Medieval Bestiary : Badger". bestiary.ca. - Yoder, Don, Groundhog Day. Mechanicsburg, PA: Stackpole Books, 2003 ISBN 0-8117-0029-1 - EEK! – Critter Corner – The Badger. Dnr.wi.gov. Retrieved on 7 November 2011. - "British blamed for Basra badgers". BBC News. 12 July 2007. Archived from the original on 8 August 2007. Retrieved 12 July 2007. - Ellison, Cara (26 July 2013). "Hands On: Shelter". Rock, Paper, Shotgun. Retrieved 3 September 2013. - "Badger", Encyclopædia Britannica, 9th ed., Vol. III, New York: Charles Scribner's Sons, 1878, p. 227. - "Badger", Encyclopædia Britannica, 11th ed., Vol. III, Cambridge: Cambridge University Press, 1911, p. 188. Sleeman, D.P., Collins, D.M. and Davenport, J. 2014. Where and when badger (Meles meles) road casualties occurred in the Four Area Study. Ir. Nat. J. 33: 119 – 123. |Wikispecies has information related to: melinae| Find more about at Wikipedia's sister projects |Definitions from Wiktionary| |Media from Commons| |News from Wikinews| |Quotations from Wikiquote| |Texts from Wikisource| |Textbooks from Wikibooks| |Learning resources from Wikiversity| - Badgerland – The Definitive On-Line Guide to Badgers in the UK - Durham County Badger Group - WildlifeOnline – Natural History of Badgers - Badger Facts - www.ontariobadgers.org – Information about American Badgers - Local dutch badger group - Badger-Coyote Associations - YouTube video of examples of Badger scratching trees - Texts on Wikisource:
<urn:uuid:4bfb5f1f-2e25-438c-8025-48f09aca211a>
CC-MAIN-2016-36
https://en.wikipedia.org/wiki/Badger
s3://commoncrawl/crawl-data/CC-MAIN-2016-36/segments/1471982295192.28/warc/CC-MAIN-20160823195815-00293-ip-10-153-172-175.ec2.internal.warc.gz
en
0.879939
5,614
3.515625
4
The Humanistic approach developed in the 1960's as a critical reaction to the technical emphases of both psychodynamic and behaviorist learning approaches to psychology. Drawing deeply from work done in the fields of existential and religious philosophy, the humanist psychologists staked a claim to the idea of a "client centered psychotherapy" (rather than a technique-oriented therapy). According to major humanists like Carl Rogers and Fredrick Perls, people were born knowing how to be healthy and were naturally drawn towards making healthy choices. These healthy natural impulses were thwarted by parents, teachers, religious leaders and other authorities acting on a variety of unhealthy (dysfunctional) culturally endorsed convictions, or (more sadly) from abusive motives. The job of the therapist was to help their clients to overcome the negative influences of authority and society or abusers and get back to making their own healthy choices which would support their growth. With loving care and support, people would be able to "fix themselves". The humanist vision of what healthy growth might look like is a tolerant and essentially liberal one. The direction of growth should be driven from the inside (rather than according to society's needs) so that every human being is able (if they are lucky and do the necessary work) to become all they were born to be; to fully explore their inborn interests, and to make a unique contribution to society. This theoretical pinnacle of self-expression is referred to as a "self-actualized" state. There are a whole range of conditions that must be met before any person can work on becoming self-actualized. According to the "needs hierarchy" described by Abraham Maslow, people must first secure their basic "organismic" needs (including adequate food, clothing and shelter necessary to keep themselves alive). Having achieved the basics, they next worry about and work to achieve: a feeling of adequate safety, a sense of belonging (to one or more social groups and relationship), and a sense of self-respect and social respect. Self-actualization, the drive to do all that you desire to do with your life, is something that only emerges as a motivator of behavior after all the earlier needs are adequately satisfied. In addition to being as genuine as they could manage to be with their clients, humanist psychotherapists developed a number of techniques designed to help their clients move past fears or social commitments and responsibilities that kept them too frightened or too dutiful to think about pursuing their own inborn agendas. Realizing that many such road blocks took the form of an internalized sense of duty or of fear, humanist therapists developed many techniques that were designed to help people reconnect with their hidden, or suppressed wishes and dreams. Frequently, these techniques (including Perl's "empty chair" technique described below) worked at an emotional level rather than a rational one. Humanistic psychology made a lot of sense in the 1970s during the height of the liberal "me" generation; it might look rather monstrous in the light of 21st century America which has become a far more conservative and conforming place. It is important to keep firmly in mind that the humanists were absolutely not suggesting that everyone should pursue any course of action that pleased them (such as child molestation, or murder). Rather, they were concerned that there were many people out there who failed to become artists because their parents urged them to become accountants instead; that there were many homosexually oriented people out there who were afraid to come "out of the closet" for fear of being rejected by family and society. Their philosophy was aimed at helping people to develop the benign and healthy parts of themselves that would otherwise get squashed by society so as to help people to become more essentially happy; it was not to encourage the development of monsters or sociopaths. The humanistic philosophy does encourage a sort of selfishness, but it is not the monstrous sort of selfishness of the narcissist, but instead the healthy mature sort characteristic of the happy fulfilled person who knows how to set limits and to be responsible in addition to being able to follow their bliss spontaneously without worrying too much what other people think. The key insights to take home from humanistic theory are that: 1) achieving happiness is often a matter of developing the freedom for yourself to pursue your deepest interests, and that 2) there are many ways that your deepest interests can get sabotaged or buried. You will need to overcome any road blocks (which frequently take the form of either fear or duty) before you become free. Techniques that tend to be helpful in getting you back on track tend to play towards your emotions (helping you reconnect with your buried desires and feel their motivating force). Very Informative - AdamRS - Sep 14th 2009 This article helped me understand a lot about a paper I'm writing about the Humanistic Theory. Thanks a lot for the time and effort put into it. I couldn't have asked for much better of a source. I do have slight disagreences with you about the selfishness of this theory, but you definitely made some valid points. Thanks a lot! interesting - amanda (south wales uk) - Jan 26th 2009 i hadnt thought of humanistic theory as selfish. in fact i believed quite the reversehaving spent our lives living as social camileons under the conditions of worth we allow people to place on us realising our true organismic self can only benefit those around us.no more secrets this is me.xxx Selfish??? - Jim Vaughan, CEO Personal Management - Dec 7th 2008 I have a problem with the attitude "The humanistic philosophy does encourage a sort of selfishness." Isn't it true, before you can be what anyone else might want you to be, don't you have to first become, the best possible you? Life is like a series of circles, like ripples in a pond. You are the inner most circle, and from that center, you influence everything else around you. If your circle is poorly designed, you influence very little around you. If your circle is well defined, you influence everything else in the pond. If you want to have the maximum positive impact on the people and circumstances in your life, you have to "fill your own glass first" before you "share the contents" of your glass with the people you want to benefit from who and what you are. Selfish? I don't think so. Child of the 70's - Craig - Oct 26th 2007 Yes, I totally agree with the comment of becoming what our parents wanted and not what we dreamed to be. My life has been a non-stop revolving door of job after job. Why didn't I become the marine biologist I dreamed of in the 70's? Why don't I do that now? Heck I'm only divorced with two young children, 51 years old living in Utah. Sometimes a giant step has to be the first step. Self-actualization is a term that will now haunt me. Nice! - Jessica - Oct 24th 2007 Thought that it was very informational! Gave me great insight into the subject!
<urn:uuid:fd027769-f34f-49d2-a234-90a9420884b1>
CC-MAIN-2013-20
http://centersite.net/poc/view_doc.php?type=doc&id=9714&cn=353
s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368704007597/warc/CC-MAIN-20130516113327-00094-ip-10-60-113-184.ec2.internal.warc.gz
en
0.976864
1,465
2.65625
3
Historians often point to the fact that most famines are not caused by a lack of food but bad governance. SOYMB accuses the capitalist system, the moving force behind it all. A recent report from Oxfam posed a simple question: Is the answer to our future food needs to produce more food, or is it to try and fix our broken food system? SOYMB answers that it is capitalism in its entirety that requires replaced, and not patched up with band-aid palliatives. In 1996 the United Nations Food and Agriculture Organization estimated that the world was producing enough food to provide everyone with 2,700 calories a day, 500 more than is needed by the average human. Over the past 40 years the global population has grown by 80 percent, but food production has more than kept pace, leaving every man, woman and child, on average, with more food than they ever had before, according to the FAO. As populations rise and farmland becomes increasingly scarce, more rural poor are moving to cities to find food and jobs. In cities, where there are no shortages, the big problem confronting the poor is that food is too expensive. Mohammed Mohasin lives in a slum on the outskirts of Dhaka, the capital of Bangladesh. Finding it almost impossible to make ends meet in the countryside, Mohasin moved to the sprawling city of 7 million in search of a better life. Compared to many Bangladeshis, this father of two has done relatively well, as he has a stable job. But in spite of this, his ability to feed himself and his family is out of his control. Standing in the small gap between his tin-roofed home and an encroaching open sewer, he explains why he is skipping his lunch. "When food prices go up I first have to reduce our expenditure, try to search for cheaper foods and reduce our eating from three to two meals a day." Whereas the rural poor have opportunities to collect food from other sources such as open ground, forests and rivers, those that live in cities are dependent on global market fluctuations. Like many of the urban poor across Asia, Mohasin spends almost 90 percent of his income on food and rent, leaving him little flexibility if food prices soar as they did in 2008. The World Bank estimated that an extra 100 million people went hungry around the world in that year due to food price increases. Out of the world's estimated 7 billion people, 1 billion are clinically obese while 1 billion remain malnourished. Professor Paul Teng from the Center for Non-Traditional Security at Nanyang Technical University in Singapore has been studying losses in the food production, distribution and consumption systems and estimates that 50 percent is lost before it reaches our mouths. "In other words, if we could just recover the losses we would have more than enough food," he said. Professor Cai Jianming from the Chinese Academy of Sciences is a world leader in developing urban farmland, ensuring that Chinese cities have the means to meet all of their vegetable needs within their municipal boundaries. "In southern China we can use rooftop spaces, but in the north it is easier to create spaces around built-up areas where the distance food has to travel to markets is relatively short. Vertical gardens, using domestic balconies to grow edible food, are also gaining popularity in Beijing," Cai said. At the University of Philippines Los Banos, Professor of Crop Science Ted Mendoza demonstrated how combining drip feed irrigation, water harvesting, intercropping and organic manures can have impressive improvement results without the need to spray insecticides or genetically modify the seeds.
<urn:uuid:35db7166-cd61-4e41-8cb2-51cd3fa21b6e>
CC-MAIN-2022-27
https://socialismoryourmoneyback.blogspot.com/2011/08/needless-food-crisis.html
s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656104204514.62/warc/CC-MAIN-20220702192528-20220702222528-00090.warc.gz
en
0.972661
732
2.6875
3
None of us were around when the Earth was formed, but scientists are in agreement that the age of the earth is 4.54 billion years, give or take 1 percent. To determine the age of the earth, scientists use a process known as radiometric dating. It is based on the fact that uranium, a naturally occurring element, decays at an extremely slow rate — depending on the type (known as isotope) of uranium, it has a half-life (meaning half of it turns into lead) of 700 million to 100 billion years. By measuring ratios of different types of lead and uranium, scientists can determine how old a sample of mineral is. To arrive at the age of the Earth, scientists make various assumptions, one of them being that the Earth and the rest of our solar system were formed at the same time. Because of geologic changes, the age of most minerals found on the Earth is much less than the age of the Earth itself, so to get more accurate figures scientists have determined the ages of meteorites. Hundreds have been analyzed, and they consistently yield an age of around 4.5 billion years, so the assumption is that the Earth is about the same age. The “gold standard” of meteorites used in dating the Earth is the Canyon Diablo meteorite, which fell around 30,000 years ago in what is now Arizona. It provides an especially large sample of ancient mineral and has been extensively analyzed. Since geologic changes can form a new “birth date” for minerals, even the oldest rocks found on the Earth are newer than the Earth itself. But some of them come pretty close (in geological time, that is). According to the U.S. Geological Survey, some minerals found in northern Canada have been dated at 4.03 billion years, and some in western Greenland have been dated at 3.7 billion to 3.8 billion years. Also, some zircon grains found in Australia have lead/uranium ratios consistent with an age of 4.4 billion years. The oldest rocks from the moon have similar ages. These numbers are consistent with the estimated age of our galaxy, the Milky Way, of 11 billion to 13 billion years. Need research? Quezi's researchers can answer your questions at uclue.com
<urn:uuid:de420c43-87d0-4352-9c25-548e1c867d4e>
CC-MAIN-2016-26
http://quezi.com/1790
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396949.33/warc/CC-MAIN-20160624154956-00166-ip-10-164-35-72.ec2.internal.warc.gz
en
0.9629
469
3.765625
4
In 1999, geologists unearthed a beautifully preserved fossilized head of the extinct reptile ichthyosaur. It took months to carefully extract it from the strata layers. One interesting thing about this head is that it is still in three dimensions. Usually, the pressure of the sedimentary layers flattens fossils into a single, 2-D sheet. However, in this case, this had not happened. Why? The head was buried in a vertical, 90-degree nose-down position, preventing the flattening process (see image at right). What is more interesting about this fossil is that it spans three different strata layers that were allegedly laid down over a period of 1 million years! This is called a "polystrate" fossil, meaning that it was found spanning multiple strata layers ("poly" for many, and "strate" for strata . . . obviously!). Such a discovery presents a huge puzzle for evolutionists. According to uniformitarian geology, strata layers are laid down slowly, one after another, over millions of years. But no one would posit that this ichthyosaur hung nose-down for a million years while it was slowly buried in sediments! As may be expected, the long-agers have an explanation . . . albeit a somewhat unsatisfactory one. Dr. Achim Reisdorf, a German geologist, explains that right after this huge marine reptile died, it started to sink. Increasing water pressure caused the lungs and inner organs to collapse, moving the center of gravity right behind the head. This caused the ichthyosaur to tilt onto its nose, making it sink faster and faster toward the ocean floor in a "kamikaze" plunge. When it reached the bottom, the head and neck thrust into sedimentary layers that had remained perfectly soft over nearly a million years. But before bacteria could decompose the sunken head, all three sedimentary layers suddenly hardened, fossilizing the buried portion of the body. The rest quickly rotted and was swept away, preserving the fossil we find today. Alright. Sure, that makes sense to me! To start with, dead marine reptiles do not sink. They float. In fact, they do quite a bit of floating. A whale that died off the southern coast of Australian a few years ago refused to sink even after having enough TNT put in it by the police bomb squad to "blow a hole in a concrete wall" (see the AiG story here). Also, marine carcasses are quickly scavenged by sharks and other fish. The ichthyosaur wouldn't have had time to even start the trip down, much less stay intact! Even if this reptile had made the "kamikaze plunge" into the sediment, it seems like a mighty big coincidence that the layers had stayed soft for a million years without being disturbed, and then hardened "just in time". How convenient, don't you think? When scientists hold the preconcieved notion that the earth is billions of years old, look what kind of mental gymnastics they must undergo to keep their theory afloat (or, in this case, make it sink). Think how much easier it would be to allow the thought that maybe, just maybe, this reptile was buried at the same time as the sediments around it. See how much easier life is made when we accept the possibility that Genesis is true? Story taken from AnswersInGenesis.org.
<urn:uuid:36300458-db94-45fd-9ee0-7d6ceb6b0901>
CC-MAIN-2018-17
http://standonbible.blogspot.com/2005_08_01_archive.html
s3://commoncrawl/crawl-data/CC-MAIN-2018-17/segments/1524125947795.46/warc/CC-MAIN-20180425100306-20180425120306-00608.warc.gz
en
0.966996
711
3.484375
3
. Hinnels – The Theory and practice of human rights in Zoroastrianism.) Although it is a modern legal coinage not used in religious literatures of the past, the concept of human rights as a system of values and ideas is ingrained in Mazdaism. In Zoroastrianism the idea of human rights stems from the principle that man is created to be a coworker with God and as such ought to try to emulate the master of the craft. Being only a good creator, God has created the universe and man as essentially good. The soul of Creation’s complaints about rape, violence and passion; King Yima’s fall from power due to his vanity and nonobservance of the law; the prophet’s insistence on freedom of choice in acceptance of a faith; Zarathushtra’s advice to his daughter to respond to the call of wisdom and love in her choice of a bridegroom; the recognition of the equality of men and women in all respects; the condemnation of autocratic and unjust rule and the recommendation to the faithful not to submit to oppressive rulers-all these demonstrate the values of human rights in Zoroastrianism. THE MAZDAEN NOTION OF HUMAN RIGHTS IS THE NATURAL EXTENSION OF THE TWO DOCTRINES OF THE GOODNESS OF GOD AND THE FUNCTION OF MAN AS GOD’S CO-WORKER. From the book ” The Zoroastrian Tradition” By DR. Farhang Mehr
<urn:uuid:ae354b8d-37f6-44e2-8167-54bcc84076ea>
CC-MAIN-2017-09
https://arshtad.wordpress.com/english/notes-5/human-rights-zoroastrianism/
s3://commoncrawl/crawl-data/CC-MAIN-2017-09/segments/1487501171932.64/warc/CC-MAIN-20170219104611-00431-ip-10-171-10-108.ec2.internal.warc.gz
en
0.91397
312
3.21875
3
You are here: Home / Publication Information Title: A preliminary assessment of Montreal process indicators of forest fragmentation for the United States Author: Riitters, Kurt H.; Wickham, James D.; Coulston, John W. Source: Environmental Monitoring and Assessment 91: 257–276 Publication Series: Not categorized Description: Abstract. As part of the U.S. 2003 National Report on Sustainable Forests, four metrics of forest fragmentation – patch size, edge amount, inter-patch distance, and patch contrast – were measured within 137 744 non-overlapping 5625 ha analysis units on land-cover maps derived from satellite imagery for the 48 conterminous States. The perimeter of a typical forest patch is about 100 m from the perimeter of its nearest neighbor, except when there is not much forest, in which case that distance is 200 to 300 m. A typical analysis unit has from 10 to 40% as much forest edge as it could possibly have, given the amount of forest present. Most analysis units contain a large number of patches that are less than one hectare in size, and about 10% contain one or more 2000 to 5000 ha patches. Forest often defines the background landscape, and patch contrast is generally either very high or very low in eastern regions and intermediate in western regions. Many research needs were identified by this experimental analysis of available data and metrics. Keywords: fragmentation, land cover, Montreal Process, national assessment, spatial pattern - We recommend that you also print this page and attach it to the printout of the article, to retain the full citation information. - This article was written and prepared by U.S. Government employees on official time, and is therefore in the public domain. XML: View XML Riitters, Kurt H.; Wickham, James D.; Coulston, John W. 2004. A preliminary assessment of Montreal process indicators of forest fragmentation for the United States. Environmental Monitoring and Assessment 91: 257–276 Get the latest version of the Adobe Acrobat reader or Acrobat Reader for Windows with Search and Accessibility
<urn:uuid:fe337f6c-0f27-49f1-85e5-52ffd98aa97e>
CC-MAIN-2014-15
http://www.treesearch.fs.fed.us/pubs/6123
s3://commoncrawl/crawl-data/CC-MAIN-2014-15/segments/1397609537754.12/warc/CC-MAIN-20140416005217-00414-ip-10-147-4-33.ec2.internal.warc.gz
en
0.904014
427
2.59375
3
Recent breakthroughs in Artificial Intelligence (AI) have produced a new class of neural networks called Large Language Models (LLMs) that demonstrate a remarkable capability to generate fluent, plausible responses to prompts posed in natural language. While LLMs have already revolutionized certain industry applications, the debut of ChatGPT has generated new anxiety and curiosity about machine intelligence, especially in the way we teach, research, tell stories and report facts. The Princeton LLM Forum is bringing together leading scholars and researchers from a variety of disciplines and fields to discuss the implications that large language models (LLMs) have on our understanding of language, society, culture, and theory of mind. Join us for a discussion between Tal Linzen, Associate Professor of Linguistics and Data Science at New York University, and Tania Lombrozo, Arthur W. Marks '19 Professor of Psychology and Director or the Program in Cognitive Scienceat Princeton University. Tal Linzen is an Associate Professor of Linguistics and Data Science at New York University and a research scientist at Google. He studies the connections between human and artificial intelligence, with a focus on language: what can AI systems teach us about how humans learn and understand language, and how can we advance language technologies using what we know about humans?
<urn:uuid:fbf23f2c-6d7d-448e-b37b-d9fabf225800>
CC-MAIN-2024-10
https://cdh.princeton.edu/events/2024/04/llm-forum-tal-linzen-with-tania-lombrozo-topic-understanding/
s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947476374.40/warc/CC-MAIN-20240303111005-20240303141005-00160.warc.gz
en
0.907414
255
3.125
3
The pit can refer to the auxiliary percussion section of some high school or college-level marching bands. The Pit vs. Band/Colorguard The players in pit do not march. They do not learn drill at band camp. They do not play for six hours in the pouring rain. This is because: Grand marimbas are nearly impossible to march. Drill is for those who can pick up their instruments. Water can damage the chimes and xylophones. (The band/colorguard only seem to notice that the pit doesn't march and therefore envy the pit players.) Members of The Pit In higher levels of marching bands, the pit can be an impressive ensemble of talented percussionists who have spent crazy hours practicing and mastering every instrument of the pit from the triangle to the bass drum to the vibraphones. In many high school marching bands, the pit consists of a few percussionists as well as players of unmarchable instruments (bassoon, english horn, stringed instruments, etc.)
<urn:uuid:1ed37ac9-34f2-4a2c-a8c4-c047d08a6785>
CC-MAIN-2013-20
http://everything2.com/title/The+Pit
s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368699924051/warc/CC-MAIN-20130516102524-00080-ip-10-60-113-184.ec2.internal.warc.gz
en
0.951726
219
2.640625
3
ALFALFA: Perennial that roots deeply. Fixes the soil with nitrogen, accumulates iron, magnesium, phosphorous and potassium. Withstands droughts with it's long taproot and can improve just about any soil! Alfalfa has the ability to break up hard clay soil and can even send its' roots through rocks! Now that is a tenacious plant! Alfalfa is practically pest and disease free. It needs only natural rainfall to survive. AMARANTH: A tropical annual that needs hot conditions to flourish. Good with sweet corn, it's leaves provide shade giving the corm a rich, moist root run. Host to predatory ground beetles. Eat the young leaves in salads. ANISE: Licorice flavored herb, good host for predatory wasps which prey on aphids and it is also said to repel aphids. Deters pests from brassicas by camouflaging their odor. Improves the vigor of any plants growing near it. Used in ointments to protect against bug stings and bites. Good to plant with coriander. ASPARAGUS: Plant with Tomato, Parsley, Basil . Sprinkle parsley leaves onto the asparagus while it is growing. BASIL: Plant with tomatoes to improve growth and flavor. Pepper, Marigold .Basil can be helpful in repelling thrips. It is said to repel flies and mosquitoes. Incompatible with or near rue. BAY LEAF: A fresh leaf bay leaf in each storage container of beans or grains will deter weevils and moths. Sprinkle dried leaves with other deterrent herbs in garden as natural insecticide dust. A good combo: Bay leaves, cayenne pepper, tansy and BEANS: All bean enrich the soil with nitrogen fixed form the air. In general they are good company for carrots, celery, chards, corn, eggplant, peas, potatoes, brassicas, beets, radish, strawberry and cucumbers. Great for heavy nitrogen users like corn and grain plants. French Haricot beans, sweet corn and melons are a good combo. Summer savory deters bean beetles and improves growth and flavor. Incompatible BUSH BEANS: Irish Potato, Cucumber, Corn, Strawberry, Celery, Summer Savory - Not compatible with Onions POLE BEANS: Corn, Summer Savory, Radish - Not compatible with Onions, radish, sunflower, Beets, Kohlrabi, BEE BALM (Oswego, Monarda): Plant with tomatoes to improve growth and flavor. Great for attracting beneficials and bees of course. Pretty perennial that tends to get powdery mildew. BEET: Good for adding minerals to the soil. The leaves are composed of 25% magnesium making them a valuable addition to the compost pile if you don't care to eat them. Companions are lettuce, kohlrabi, onions and brassicas. Garlic improves growth and flavor. They are also beneficial to beans with the exception of runner beans. Runner or pole beans and beets stunt each other's growth. BORAGE: Companion plant for tomatoes, squash, strawberries and most plants. Deters tomato hornworms and cabbage worms. One of the best bee and wasp attracting plants. Adds trace minerals to the soil and a good addition the compost pile. The leaves contain vitamin C and are rich in calcium, potassium and mineral salts. Borage may benefit any plant it is growing next to via increasing resistance to pests and disease. It also makes a nice mulch for most plants. Borage and strawberries help each other and strawberry farmers always set a few plants in their beds to enhance the fruits flavor and yield. Plant near tomatoes to improve growth and disease resistance. After you have planned this annual once it will self seed. Borage flowers are edible. BRASSICA: Benefit from chamomile, peppermint, dill, sage, and rosemary. They need rich soil with plenty of lime to BUCKWHEAT: Accumulates calcium and can be grown as an excellent cover crop. Attracts hoverflies in droves. (Member of the brassica family.) CABBAGE: Celery, dill, onions and potatoes are good companion plants. Aromatic Herbs, Beets, Onion Family, Chamomile, Spinach, Chard - Incompatible with: dill, strawberries, tomatoes and pole beans. CARAWAY: Good for loosening compacted soil with it's deep roots so it's also compatible next to shallow rooted crops. Tricky to establish. The flowers attract a number of beneficial insects especially the tiny parasitic wasps. Incompatible with: dill and fennel. CARROTS: Their pals are leaf lettuce, radish, onions and tomatoes. English Pea, Rosemary, Sage, Incompatible with: dill CATNIP: Deters flea beetles, aphids, Japanese beetles, squash bugs, ants and weevils. We have found it repels mice quite well: mice were wreaking havoc in our outbuildings, we spread sprigs of mint throughout and the mice split! Use sprigs of mint anywhere in the house you want deter mice and ants. Smells good and CELERY: Companions: cabbage family, tomato., Onion, Bush Beans, Nasturtium CHAMOMILE, GERMAN: Annual. Improves flavor of cabbages, cucumbers and onions. Host to hoverflies and wasps. Accumulates calcium, potassium and sulfur, later returning them to the soil. Increases oil production from herbs. Leave some flowers unpicked and German chamomile will reseed itself. Roman chamomile is a low growing perennial that will tolerate almost any soil conditions. Both like full sun. Growing chamomile of any type is considered a tonic for anything you grow in the garden. CHARDS: Companions: Bean, cabbage family and onion. CHERVIL: Companion to radishes for improved growth and flavor. Keeps aphids off lettuce. Said to deter slugs. CHIVES: Improves growth and flavor of carrots and tomatoes. Keeps aphids help to keep aphids away from tomatoes, mums and sunflowers. Chives may drive away Japanese beetles and carrot rust fly. Planted among apple trees it helps prevent scab and among roses it prevents black spot. You will need patience as it takes about 3 years for plantings of chives to prevent the 2 diseases. A tea of chives may be used on cucumbers and gooseberries to prevent downy and tea on disease page. CHRYSANTHEMUMS: C. coccineum kills root nematodes. (the bad ones) It's flowers along with those of C. cineraruaefolium have been used as botanical pesticides for centuries. (i.e. pyrethrum) White flowering chrysanthemums repel Japanese CLOVER: Long used as a green manure and plant companion. Attracts many beneficials. Useful planted around apple trees to attract predators of the woolly aphid. COMFREY: Accumulates calcium, phosphorous and potassium. Likes wet spots to grow in. Traditional medicinal plant. Good trap crop for slugs. More on comfrey. CORIANDER: Repels aphids, spider mites and potato beetle. A tea from this can be used as a spray for spider mites. A partner for anise. CORN: Irish Potato, Beans, English Pea, Pumpkin, Cucumber, Squash Not compatible with tomato COSTMARY: This 2-3 foot tall perennial of the chrysanthemum family helps to repel moths. Cucumbers are great to plant with corn and beans. The three plants like the same conditions warmth, rich soil and plenty of moisture. Let the cucumbers grow up and over your corn plants. A great duet is to plant cukes with sunflowers. The sunflowers provide a strong support for the vines. Cukes also do well with peas, beets and carrots. Dill planted with cucumbers by attracting beneficial predators. Nasturtium improves growth and flavor. Incompatible with: sage, Irish Potato, Aromatic Herbs DAHLIAS: These beautiful, tuberous annuals that can have up to dinner plate size flowers repels Improves growth and health of cabbage. Do not plant near carrots or caraway. Best friend for lettuce. Attracts hoverflies and predatory wasps. Repels aphids and spider mites to some degree. Also may repel the dreaded squash bug! (scatter some good size dill leaves on plants that are suspect to squash bugs, like squash plants, yeah that's the ticket.) Dill goes well with onions, cabbage, sweet corn and cucumbers. Dill does attract the tomato horn worm so it would be useful to plant it somewhere away from your tomato plants to keep the destructive horn worm away from them. We like to plant it for the swallowtail butterfly caterpillars to feed on. Even their caterpillars ELDERBERRY: A spray (see insect treatments) made from the leaves can be used against aphids, carrot root fly, cuke beetles and peach tree borers. Put branches and leaves in mole runs to banish them. Yes, it works! FLAX: Plant with carrots, and potatoes. Flax contains tannin and linseed oils which may offend the Colorado potato bug. Flax is an annual from 1-4 feet tall with blue or white flowers that readily self sows. FOUR-O'CLOCKS: Draw Japanese beetles like a magnet which then dine on the foliage. The foliage is pure poison to them and they won't live to have dessert! It is important to mention that Four O'clock are also poisonous to humans. Please be careful where you plant them if you have children. They are a beautiful annual plant growing from 2-3 feet high with a bushy growth form. near roses to repel aphids. Accumulates sulfur: a naturally occurring fungicide which will help in the garden with disease prevention. Garlic is systemic in action as it is taken up the plants through their pores and when used as a soil drench is also taken up by the roots. Has value in offending codling moths, Japanese beetles, root maggots, snails, and carrot root fly. Researchers have observed that time-released garlic capsules planted at the bases of fruit trees actually kept deer away! Hey, worth a try! Concentrated garlic sprays have been observed to repel and kill whiteflies, aphids and fungus gnats among others with as little as a 6-8% concentration! It is safe for use on orchids too. -Repels cabbage worms and Japanese beetles, plant around grapes, roses, corn, and cabbage. GOPHER PURGE: Deters gophers, and moles. GRAPES: Hyssop is beneficial to grapes as are beans, peas, or blackberries. Keep radishes and cabbage away from grapes. Planting clover increases the soil fertility for grapes. Chives with grapes help repel aphids. Plant your vines under Elm or in containers in the potato patch to keep away Colorado potato bugs. There are some very effective insect sprays that can be made with the root. Use the bottomless pot method to keep horseradish contained. Also repels Blister beetles. We have observed that the root can yield anti-fungal properties when a tea is made from it. (See: HOREHOUND: (Marrubium Vulgare) like many varieties in the mint family, the many tiny flowers attract Braconid and Icheumonid wasps, and Tachnid and Syrid flies. The larval forms of these insects parasitize or otherwise consume many other insects pests. It grows where many others fail to thrive and can survive harsh winters. Blooms over a long season, attracting beneficial insects almost as long as you are likely to need them. For best results use horehound directly as a companion plant. Stimulates and aids fruiting in tomatoes and peppers. HYSSOP: Companion plant to cabbage and grapes, deters cabbage moths and flea beetles. Do not plant near radishes. Hyssop may be the number one preference among bees and some beekeepers rub the hive with it to encourage the bees to keep to their home. It is not as invasive as other members of the mint family making it safer KELP: When used in a powder mixture or tea as a spray, this versatile sea herb will not only repel insects but feed the vegetables. In particular we have observed that kelp foliar sprays keep aphids and Japanese beetles away when used as a spray every 8 days before and during infestation times. If you have access to seaweed, use it as a mulch to keep slugs away. LAMIUM: This will repel potato bugs- a big problem for many gardeners! LARKSPUR: An annual member of the Delphinium family, larkspur will attract Japanese beetles. They dine and die! Larkspur is poisonous to humans too! Repels fleas and moths. Prolific flowering lavender nourishes many nectar feeding and beneficial insects. Use dried sprigs of lavender to repel moths. Start plants in winter from cuttings, setting out in Use leeks near carrots, celery and onions which will improve their growth. Leeks also repel carrot flies. Sprinkle throughout the garden in an herbal powder mixture to deter many bugs. Lemon balm has citronella compounds that make this work: crush and rub the leaves on your skin to keep mosquitoes away! Use to ward off squash bugs! Carrot, Radish, Strawberry, Cucumber Improves flavor and health of most plants. Good habitat for ground beetles. A large plant, use one planted as a backdrop. Similar to celery in flavor. MARIGOLDS: (Calendula): Given a lot of credit as a pest deterrent. Keeps soil free of bad nematodes; supposed to discourage many insects. Plant freely throughout the garden. The marigolds you choose must be a scented variety for them to work. One down side is that marigolds do attract spider mites and slugs. Note that within one night after planting marigold plants, all the leaves were already eaten off, though the flowers were still on. Blamed it on geckos, but probably is slugs or snails. yuck. Slugs and snails love marigolds. French Marigold (T. patula) has roots that exude a substance which spreads in their immediate vicinity killing nematodes. For nematode control you want to plant dense areas of them. There have been some studies done that proved this nematode killing effect lasted for several years after the plants were These marigolds also help to deter whiteflies when planted around tomatoes and can be used in greenhouses for the same purpose. Whiteflies hate the smell of marigolds. Mexican marigold (T. minuta) is the most powerful of the insect repelling marigolds and may also overwhelm weed roots such as bind weed! It is said to repel the Mexican bean beetle and wild bunnies! Be careful it can have an herbicidal effect on some plants like beans and cabbage. MARJORAM: As a companion plant it improves the flavor of vegetables and herbs. Sweet marjoram is the most commonly MELONS: Companions: Corn, pumpkin, radish and squash. Other suggested helpers for melons are as follows: Marigold deters beetles, nasturtium deters bugs and beetles. Oregano provides general pest protection. MINT: Deters white cabbage moths, ants, rodents, flea beetles, fleas, aphids and improves the health of cabbage and tomatoes. Use cuttings as a mulch around members of the brassica family. It attracts hoverflies and predatory wasps. Earthworms are quite attracted to mint plantings. Be careful where you plant it as mint is an incredibly invasive perennial. Placing mint (fresh or dried) where mice are a problem is very effective in driving MOLE PLANTS: (castor bean plant) Deter moles and mice if planted here and there throughout the garden. Drop a seed of this in mole runs to drive them away. This is a poisonous plant. See Moles: Critter MORNING GLORIES: They attract hoverflies. Plus if you want a fast growing annual vine to cover something up morning glory is an excellent choice. NASTURTIUMS: Plant as a barrier around tomatoes, radishes, cabbage, cucumbers, and under fruit trees. Deters wooly aphids, whiteflies, squash bug, cucumber beetles and other pests of the cucurbit family. Great trap crop for aphids (in particular the black aphids) which it does attract, especially the yellow flowering varieties. Likes poor soil with low moisture and no fertilizer. It has been the practice of some fruit growers that planting nasturtiums every year in the root zone of fruit trees allow the trees to take up the pungent odor of the plants and repel bugs. It has no taste effect on the fruit. A nice variety to grow is Alaska which has attractive green and white variegated leaves. The leaves, flowers and seeds are all edible and wonderful in salads! Try our recipe for: Nasturtium Salad NETTLES, STINGING: The flowers attract bees. Sprays made from these are rich in silica and calcium. Invigorating for plants and improves their disease resistance. Leaving the mixture to rot, it then makes an excellent liquid feed. Comfrey improves the liquid feed even more. Hairs on the nettles' leaves contain formic acid which "stings" you. chamomile with onions improves their flavor. Other companions are savory, carrot, leek, beets, kohlrabi, strawberries, brassicas, dill, lettuce and tomatoes. Intercropping onions and leeks with your carrots confuses the carrot and onion flies! Beets, Carrot, Lettuce, Cabbage Family, Onions planted with strawberries help the berries fight disease. Incompatible with: Beans, English Peas and summer savory. OPAL BASIL: An annual herb that is pretty, tasty and said to repel hornworms! OREGANO: Can be used with most crops but especially good for cabbage. Plant near broccoli, cabbage and cauliflower to repel cabbage butterfly and near cucumbers to repel cucumber beetle. Also benefits grapes. PARSLEY: Plant among and sprinkle the leaves on tomatoes, and asparagus. Use as a tea to ward off asparagus beetles. Attracts hoverflies. Let some go to seed to attract the tiny parasitic wasps and hoverflies. Parsley increases the fragrance of roses when planted around their base. Rose problems? See: Rose Rx for Peas fix nitrogen in the soil. Plant next to corn and they will provide extra nitrogen. Corn is a heavy feeder so this is a great combination! Companions for peas are bush beans, Pole Beans, Carrots, Celery, Chicory, Corn, Cucumber, Eggplant, Parsley, Early Potato, Radish, Spinach, Strawberry, Sweet pepper and Turnips. Incompatible with: onions, Gladiolus, Irish Potato. PEPPERMINT: Repels white cabbage moths, aphids and flea beetles. It is the menthol content in mints that acts as an insect repellant. Bees and other good guys love it. BELL (Sweet Peppers): Plant peppers near tomatoes, parsley, basil, and carrots. Onions make an excellent companion plant for peppers. They do quite well with okra as it shelters them and protects the brittle stems from wind. Don't plant them near fennel or kohlrabi. They should also not be grown near apricot trees because a fungus that the pepper is prone to can cause a lot of harm to the apricot tree. Peppers can double as ornamentals, so tuck some into flowerbeds and borders. Harvesting tip: The traditional bell pepper, for example, is harvested green, even though most varieties will mature red, orange, or yellow. Peppers can be harvested at any stage of growth, but their flavor doesn't fully develop until maturity. PEPPERS, HOT: Chili peppers have root exudates that prevent root rot and other Fusarium diseases. Plant anywhere you have these problems. Teas made from hot peppers can be useful as insect sprays. Hot peppers like to be grouped with cucumbers, eggplant, escarole, tomato, okra, Swiss chard and squash. Herbs to plant near them include: basils, oregano, parsley and rosemary PENNYROYAL: Repels fleas. The leaves when crushed and rubbed onto your skin will repel chiggers, flies, gnats, mosquitoes and ticks. Warning: Pennyroyal is highly toxic to cats. It should not be planted where cats might ingest it and never rubbed onto their skin. PETUNIAS: They repel the asparagus beetle, leafhoppers, certain aphids, tomato worms, Mexican bean beetles and general garden pests. A good companion to tomatoes, but plant everywhere. The leaves can be used in a tea to make a potent bug Grow poached egg plant with tomatoes, they will attract hover flies and hover flies eat aphids. for potatoes are bush bean, members of the cabbage family, carrot, celery, corn, dead nettle, flax, horseradish, marigold, peas, petunia, onion and Tagetes marigold. Protect them from scab by putting comfrey leaves in with your potato sets at planting time. Horseradish, planted at the corners of the potato patch, provides general protection. Don't plant these around potatoes: cucumber, kohlrabi, parsnip, pumpkin, rutabaga, squash family, sunflower, turnip and fennel. Keep potatoes and tomatoes apart as they both can get early and late blight contaminating each other. Beans, Corn, Cabbage Family, Marigolds, Horseradish Incompatible with: Pumpkin, Squash, Tomato, Cucumber, Sunflower PUMPKINS: Pumpkin pals are corn, melon and squash. Marigold deters beetles. Nasturtium deters bugs, beetles. Oregano provides general pest protection. Incompatible with: Irish Potato PURSLANE: This edible weed makes good ground cover in the corn patch. Use the stems, leaves and seeds in stir-frys. Pickle the green seed pod for caper substitutes. If purslane is growing in your garden it means you have healthy, fertile soil! RADISH: Companions for radishes are: radish beet, bush beans, pole beans, carrots, chervil, cucumber, lettuce, melons, nasturtium, parsnip, peas, spinach and members of the squash family. Why plant radishes with your squash plants? Radishes may protect them from squash borers! Anything that will help keep them away is worth a try. Chervil and nasturtium improve growth and flavor. Planting them around corn and letting them go to seed will also help fight corn borers. Chinese Daikon and Snow Belle are favorites of flea beetles. Plant these at 6 to 12 inch intervals broccoli. In one trial, this measurably reduced damage to broccoli. Incompatible with: hyssop plants, cabbage, cauliflower, brussel sprouts and turnips. Planting an early row of radishes may lure flea beetles away from susceptible plants. ROSEMARY: Companion plant to cabbage, beans, carrots and sage. Deters cabbage moths, bean beetles, and carrot flies. Use cuttings to place by the crowns of carrots for carrot flies. Zones 6 and colder can overwinter rosemary as houseplants or take cuttings. RUE: Deters aphids, fish moths, flea beetle, onion maggot, slugs, snails, flies and Japanese beetles in roses and raspberries. Companions for rue are roses, fruits (in particular figs), raspberries and lavender. To make it even more effective with Japanese beetles: crush a few leaves to release the smell. Has helped repel cats for us. You should not plant rue near cucumbers, cabbage, basil or sage. A pretty perennial with bluish-gray leaves. May be grown indoors in a sunny window. Rue may cause skin irritation in some See cats and dogs: Rue spray. RYE: An excellent use of plant allelopathy is the use of mow-killed grain rye as a mulch. The allelochemicals that leach from the rye residue prevent weed germination but do not harm transplanted tomatoes, broccoli, or many other vegetables. SAGE: Use as a companion plant with broccoli, cauliflower, rosemary, cabbage, and carrots to deter cabbage moths, beetles, black flea beetles and carrot flies. Do not plant near cucumbers, onions or rue. Sage repels cabbage moths and black flea beetles. Allowing sage to flower will also attract many beneficial insects and the flowers are pretty. There are some very striking varieties of sage with variegated foliage that can be used for their ornamental as well as practical qualities. More on sage. SOUTHERNWOOD: Plant with cabbage, and here and there in the garden. Wonderful lemony scent when crushed or brushed in passing. Roots easily from cuttings. Does not like fertilizer! It is a perennial that can get quite bushy. We have started to cut it back every spring and it comes back in not time. A delightful plant that is virtually pest free. SOYBEANS: They add nitrogen to the soil making them a good companion to corn. They repel chinch bugs and Japanese beetles. Soybeans are so good for you! They are many ways to prepare SPINACH: Strawberry, Faba Bean SQUASH: Companions: Corn, cucumbers, icicle radishes, melon and pumpkin. Helpers: Borage deters worms, improves growth and flavor. Marigolds deters beetle. Nasturtium deters squash bugs and beetles. Oregano provides general pest protection. with: Irish Potato STRAWBERRY: Friends are beans, borage, lettuce, onions, spinach and thyme. Foes: Cabbage. Allies: Borage strengthens resistance to insects and disease. Thyme, as a border, deters worms. SUMMER SAVORY: Plant with beans and onions to improve growth and flavor. Discourages cabbage moths, Mexican bean beetles and black aphids. Honey bees love it. SUNFLOWERS: Planting sunflowers with corn is said by some to increase the yield. Aphids a problem? Definitely plant a few sunflowers here and there in the garden. Step back and watch the ants herd the aphids onto them! We have been doing this for years and it is remarkable. The sunflowers are so tough that the aphids cause very little damage and we have nice seed heads for our birds to enjoy! Talk about a symbiotic relationship! SWEET ALYSSUM: Direct seed or set out starts of sweet alyssum near plants that have been attacked by aphids in the past. Alyssum flowers attract hoverflies whose larva devour aphids. Another plus is their blooms draw bees to pollinate early blooming fruit trees. They will reseed freely and make a beautiful groundcover Plant with fruit trees, roses and raspberries keeping in mind that it can be invasive and is not the most attractive of plants. Tansy which is often recommended as an ant repellant may only work on sugar type ants. These are the ones that you see on peonies and marching into the kitchen. At least for us placing tansy clippings by the greenhouse door has kept them out. Deters flying insects, Japanese beetles, striped cucumber beetles, squash bugs, ants and mice! Tie up and hang a bunch of tansy leaves indoors as a fly repellent. Use clippings as a mulch as needed. Don't be afraid to cut the plant up as tansy will bounce back from any abuse heaped on it! It is also a helpful addition to the compost pile with its' high potassium content. TARRAGON: Plant throughout the garden, not many pests like this one. Recommended to enhance growth and flavor of THYME: Deters cabbage worms. Wooly thyme makes a wonderful groundcover. You may want to use the upright form of thyme in the garden rather than the groundcover types. Thyme is easy to grow from seeds or cuttings. Older woody plants should be divided in TOMATOES: Tomato allies are many: asparagus, basil, bean, carrots, celery, chive, cucumber, garlic, head lettuce, marigold, mint, nasturtium, onion, parsley, pepper, marigold, pot marigold and sow thistle. Basil repels flies and mosquitoes, improves growth and flavor. Bee balm, chives and mint improve health and flavor. Borage deters tomato worm, improves growth and flavor. Dill, until mature, improves growth and health, mature dill retards tomato growth. Enemies: corn and tomato are attacked by the same worm. Kohlrabi stunts tomato growth. potatoes, cabbage and cauliflower. Keep Irish Potato, Fennel, Cabbage Family apart from tomato as they both can get early and late blight contaminating each other. TURNIP: English Pea , Incompatible with Irish Potato WHITE GERANIUMS: These members of the pelargonum family draw Japanese beetles to feast on the foliage which in turn kills them. Keeps animals out of the garden when planted as a border. An excellent deterrent to most insects. A tea made from wormwood will repel cabbage moths, slugs, snails, black flea beetles and fleas effectively. The two best varieties for making insect spray are Silver King and Powis Castle. Adversely Powis castle attracts ladybugs which in turn breed directly on the plant. Silver Mound is great as a border plant and the most toxic wormwood. Note: As wormwood actually produces a botanical poison do not use it directly on food crops. See More on wormwood. for more details. For insect spray: YARROW: Yarrow has insect repelling qualities and is an excellent natural fertilizer. A handful of yarrow leaves added to the compost pile really speeds things up. Try it! It also attracts predatory wasps and ladybugs to name just two. It may increase the essential oil content of herbs when planted among them. Yarrow has so many wonderful properties to it and is an ingredient in our own Golden Harvest Fertilizer.
<urn:uuid:8009dc5a-8a62-4070-8665-ceae6349c4e3>
CC-MAIN-2015-48
http://www.earthmountainview.com/companion_planting.htm
s3://commoncrawl/crawl-data/CC-MAIN-2015-48/segments/1448398447769.81/warc/CC-MAIN-20151124205407-00350-ip-10-71-132-137.ec2.internal.warc.gz
en
0.900901
7,135
2.5625
3
The Ottawa Citizen ran a story entitled Another 40 Business Bloopers and the teacher in me saw immediate parallels to the classroom. Here are a few of my favourites from the article. 4. Not empowering subordinates to challenge and correct you. Teachers make mistakes. There is nothing to be ashamed of if you make a mistake in the classroom. I know I’ve had a few occasions where a student has caught me making a small error or blunder. Every time this happens, I praise the student, make the correction, and use it as a teaching point to show that not only do we all make mistakes, but that we can help each other out to improve our own work. 8. Not understanding that feedback – from teachers, peers, staff – is a gift. Students need to be taught to look at their marked work when they get it back, to look at the mistakes they have made, and to learn from them. This directly relates to point number 4 above. A bad mark on a paper or assignment is really an opportunity to improve on the next assignment. We should all strive to do our best and to use the feedback we get to make that happen. 10. Treating dissatisfied students as problems rather than opportunities. I believe that there is a way to engage and to reach every child. This is the principle behind differentiated learning. It’s a difficult thing to do as we need to address a multitude of concerns in the classroom. But it can be done. We just need to pay attention to each and every student we teach. 13. Not keeping a special notebook or digital document to record ideas for new products and tactics. Whenever I get inspired to try something new, I just try it. I like to improvise in the classroom and although I plan my lesson and day out very thoroughly, sometimes I will abandon that plan to try something new. Other times, I make a mental note, share something on Twitter or on Google+ that I know I want to try later. 17. Not telling students you have confidence in their decisions If you show that you believe that your students are capable of making their own choices, they will often surprise you by not only meeting, but exceeded your expectations. They also need to hear this message, so make sure you tell them that you believe in them. 25. Settling for average. Never accept an idea, initiative or assignment without asking “what could we do to make this unforgettable?” If a student hands me a piece of work in which I know they haven’t put in their best effort, I will ask them if they think it is their best work. Half of the time, the student will look at it, say, “No,” and head back to his or her seat to improve the work. The other half of the time, the student needs a gentle reminder, or some coaching on how they can improve the work. This also relates back to point 8. 34. Not carving out more time for yourself. it’s not just about balance – you’ll get your best ideas when you’re relaxing, running, or playing with the kids. Very true. There is often an avalanche of work on our desks and things calling for our attention. Some teachers work before school, after school, and bring work home. Don’t make your career a 24 hour / 365 day a year affair. I have a policy to Keep It At School that helps me keep that balance. That was a useful exercise. As teachers and students we can learn from everything around us, which I think is another great lesson we should pass on to our students. Thanks to Randy Wilson for the story and the link. If you enjoy art, go check out some of his talented pieces. For more Teaching Tips, check out the Teaching Tip Tuesday Archive or leave a comment below to add to the discussion.
<urn:uuid:f7d3d96e-7e4d-438f-810a-5246a9ff2113>
CC-MAIN-2017-26
http://chasemarch.com/2012/03
s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128320763.95/warc/CC-MAIN-20170626133830-20170626153830-00205.warc.gz
en
0.96565
808
2.5625
3
The rising of the sun, the journey it makes across the sky, and its setting in the west is a cosmic mystery. Because this cycle is repeated every day, traditional Māori considered it the basic principle of the world. The sun represents the birth and growth of mana (power) in the world. The birth, rise and death of the sun came to be the primary model for all existence – all of life should in some way give expression to this pattern. When an orator rises to speak on a marae, he will often announce himself by saying: Ki te whaiao, ki Te Ao Mārama The breath, the energy of life To the dawnlight, to the world of light The words refer to a world constantly emerging from darkness into light. The orator’s speech is considered to be a re-enactment of Tāne separating earth and sky, the means by which light came into the world. Tāne was the father of humankind. When he separated his parents, Papatūānuku (the earth mother) and Ranginui (the sky father), the sun was able to shine into the world that was created. If the orator’s words offer guidance and wisdom, he brings his audience out of the ‘night’ of conflict and into the ‘day’ of peace and resolution. This occurs when mana (a spiritual force) enters the person – just as the sun illuminates and brings forth the new day. Looking back on history, we try to imagine the world view of the people of that time. Inevitably we see the past, or a traditional philosophy of life, through the lens of our own knowledge and experience. A people’s world view is complex and dynamic. The world view of Māori changed immediately after they arrived in New Zealand. Encounter with European settlers brought further change. It is not possible to say that there is a single viewpoint in Māori culture today. The ideas set out here are only an attempt to understand the world view of Māori before Europeans arrived. In traditional Māori knowledge, as in many cultures, everything in the world is believed to be related. People, birds, fish, trees, weather patterns – they are all members of a cosmic family. This linking was explained in tātai (genealogies) and kōrero (stories), collectively termed whakapapa (meaning to make a foundation, to place in layers). Experts recited the whakapapa of people, birds, fish, trees and the weather to explain the relationships between all things and thus to place themselves within the world. This helped people to understand the world, and how to act within these relationships. The entire world was seen as a vast and complex whānau (family). In the Māori story of creation, the earth and sky came together and gave birth to some 70 children, who eventually thrust apart their parents and populated the world. Each of the children became the god of a particular domain of the natural world. Their children and grandchildren then became ancestors in that domain. For example, Tangaroa, god of the sea, had a son called Punga. Punga then had two children: Ikatere, who became the ancestor of the fish of the sea, and Tūtewehiwehi, who became the ancestor of the fish and amphibious lizards of inland waterways. Whakapapa (genealogies and stories) express our need for kinship with the world. They describe the relationships between humans and the rest of nature. In one tradition, some tribal groups and the fish of the sea claim descent from Tangaroa, the god of the sea. Whakapapa also explain the origins of animals, plants and features of the landscape. To tell a story about the origin of a bird, for example, is to invoke its true essence or character. Although many of the stories are myths, they also have a practical function. They can pass on knowledge about the natural world, such as where to find kererū (New Zealand pigeons) and how to harvest them. Although science is another way of understanding the natural world, the traditional principle of interconnectedness is still important and meaningful to Māori. For example, the genealogy of fish and sea animals makes clear the kinship of people and other creatures. It also points out values that guide people’s interaction with other species, teaching respect and correct conduct. As the sun rises each morning and sets each evening, the world follows a daily cycle of light (Te Ao) and darkness (Te Pō). Māori creation stories emphasise this movement from nothingness and darkness to the world of light – Te Ao Mārama. It is said that the world itself is created each morning with the rise of the sun. In traditional Māori belief there is something beyond the world of everyday experience: we do not live in a closed system where what we see is all there is. This other world or dimension is known as Te Kore, the ‘void’, in most tribal traditions. Cleve Barlow has suggested that Te Kore means chaos – a state which has always existed and which contains ‘unlimited potential for being’. 1 Māori Marsden, a Tai Tokerau elder and Anglican minister, had a similar belief. He said that Te Korekore (a variant of Te Kore) was ‘the realm between non-being and being: that is the realm of potential being.’ 2 Some believe that Te Kore is where the ultimate reality can be found. Others think that it is where Io, the Supreme Being, dwells. The idea of Te Kore is central to notions of mana (status), tapu (sacred and restricted customs) and mauri (life force). Until the arrival of Europeans in the late 1700s, Māori held a world view that originated in their Polynesian homeland. This grew and changed according to life in the new land. The Polynesian influence is still widely evident, although it is challenged by some. Some iwi (tribes) hold that their ancestors did not come from over the sea, but sprang from the New Zealand landscape. For example, the Ngāi Tūhoe people claim that their ancestor is Hinepūkohurangi, the mist that dwells in the valleys of the Urewera Ranges. Similarly, Ngāti Whātua tradition states that their ancestor, Tuputupu-whenua, came up from beneath the ground. Some Whanganui traditions speak of the inland mountains as their place of birth. The world is a vast family, and humans are children of the earth and sky, and cousins to all living things. Such unity means that nature is the ultimate teacher about life. Traditional knowledge is inspired by heritage, passed down the generations by word of mouth. There is no alternative – to ensure success in fishing, long journeys, or handling life’s challenges, you have to trust your ancestors, who include the entire natural world. Humans are born of the earth and achieve fulfilment when the earth speaks through the human community. True tangata whenua (people of the land) can speak authoritatively about the world they inhabit – the animals, plants, weather patterns and natural rhythms of life. Tangata whenua are descendants of other tangata whenua, and know the histories of their forebears and how life spoke through them. According to this world view, when people are asked about their identity, they do not mention themselves directly. They refer to their mountain, their river, and their esteemed ancestor. For example, a Ngāti Tūwharetoa person from the Taupō region would respond in this way: Ko Tongariro te maunga Ko Taupō te moana Ko Te Heuheu te tangata. Tongariro is the mountain Taupō is the waterway Te Heuheu is the person. Mana refers to an extraordinary power, essence or presence. This applies to the energies and presences of the natural world. There are degrees of mana and our experiences of it, and life seems to reach its fullness when mana comes into the world. The most important mana comes from Te Kore – the realm beyond the world we can see, and sometimes thought to be the ‘ultimate reality’. Certain restrictions, disciplines and commitments have to take place if mana is to be expressed in physical form, such as in a person or object. The concepts of sacredness, restriction and disciplines fall under the term tapu. For example, mountains that were important to particular tribal groups were often tapu, and the activities that took place on these mountains were restricted. Mauri is an energy which binds and animates all things in the physical world. Without mauri, mana cannot flow into a person or object. The idea that mana can flow into the world through tapu and mauri underpinned most of Māori daily life. For example, sacred stones possessing mauri were placed in fishing nets, where they were able to attract fish. The stones were placed in bird snares for the same purpose. When fish arrived in the nets or birds in the snares, Māori saw something more than just the creatures before them – they saw energy within these physical forms. The harvest of fish was the arrival of Tangaroa, god of the sea, which meant the arrival of mana. Mauri stones were also used to prepare people who would receive mana. In the traditional whare wānanga (school of learning), small pebbles (whatu) were used in a student’s initiation ceremony. It was believed that when the student swallowed the pebbles, the mauri in them was taken into the stomach, establishing the conditions whereby mana in the form of knowledge and learning could come into the person. This is the theory behind Māori meditation practices, known as nohopuku (to dwell inwardly, in the stomach). Taniwha are ferocious creatures or guardians, representing the life force (mauri) of a place in physical form. They were seen as a constant presence in waterways, ensuring that fish and other resources remain plentiful. Tohunga (priests and other experts) were able to harness mauri and cause it to enter a boulder, a tree or a fish. This had such a powerful effect that the object seemed to take on a life of its own. There are many stories of trees moving against river currents and having a supernatural aspect, leading to a belief that these objects were taniwha. Taniwha were closely linked to the local chief, who was also known as a taniwha. The fertility of a region was seen as directly linked to the mana of that land and its chief, who would control the taniwha in the river. This is important in the concept of tangata whenua (people of the land). Only tangata whenua could control the mauri, and therefore the fertility, of their region. Barlow, Cleve. Tikanga whakaaro: key concepts in Māori culture. Auckland: Oxford University Press, 1994. Marsden, Māori. ‘God, man and universe: a Maori view.’ In Te ao hurihuri: aspects of Maoritanga, edited by Michael King, 118–138. Auckland: Reed, 1992. Marsden, Māori. The woven universe: selected writings of Rev. Māori Marsden, edited by Te Ahukaramū Charles Royal. Ōtaki: Estate of Rev. Māori Marsden, 2003.
<urn:uuid:82c3298b-b176-4076-85eb-929e0ee3a3e7>
CC-MAIN-2020-10
https://teara.govt.nz/en/te-ao-marama-the-natural-world/print
s3://commoncrawl/crawl-data/CC-MAIN-2020-10/segments/1581875146033.50/warc/CC-MAIN-20200225045438-20200225075438-00265.warc.gz
en
0.966078
2,466
3.09375
3
There is growing pressure on water resources in many parts of the world due to both local and global factors. Water quality and quantity is of global environmental concern and this both represents risks and opportunities for the industry. Water is used throughout the project life-cycle of oil and gas activities and is core to business continuity. Through a combination of practical tools, good practices and a forum for sharing industry knowledge, IPIECA enables the oil and gas industry to proactively identify potential water risks and to manage water issues. Water management principles IPIECA has outlined some key guiding principles relevant for water management across the life-cycle of oil and gas operations. These principles are embedded in the good practices guidance documents that are developed. Water risk assessment and good practice Identifying and assessing water risks throughout the life cycle of oil and gas activities is an essential component of a company’s water strategy, particularly as projects can last decades. IPIECA has developed two tools to aid in this process. Global Water Tool (GWT) The IPIECA Global Water Tool for Oil and Gas is a customized version of the free and easy-to-use World Business Council for Sustainable Development (WBCSD) Global Water Tool. The tool helps oil and gas companies map their water use and assess risks for their overall global portfolio of sites considering each part of the oil and gas value chain. Local Water Tool (LWT) The GEMI LWT™ for Oil and Gas helps to evaluate the high risk locations and identify actions to manage the risks. An option is provided in the GEMI tools to enable the user to transfer specific site data from the WBCSD or IPIECA tool. The IPIECA Global Water Tool and the GEMI LWT can be used together to enable companies to map their water use and assess risks for their overall global portfolio by identifying and prioritising high risk sites and also help identify the external impacts, business risks, and opportunities related to water use and discharge at specific sites or operations. E-learning training course Once water risks have been identified they need to be managed. Throughout the life-cycle of oil and gas activities water is used and produced, IPIECA recognises the importance of managing water effectively and maintaining business continuity as well as license to operate. IPIECA has developed a set of good practice guidance documents to promote responsible and effective water management throughout the life-cycle of oil and gas activities and continues to build on the set of guiding principles. This includes guidance on water sourcing as well as water efficiency and use.
<urn:uuid:a998e1a3-9a20-40e2-98d2-0141a4e566b0>
CC-MAIN-2019-09
http://www.ipieca.org/our-work/environment/water-management/
s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247511174.69/warc/CC-MAIN-20190221213219-20190221235219-00077.warc.gz
en
0.948317
525
2.53125
3
New research suggests that exposure to traces of lead may be linked to as many deaths as smoking and it has been linked to 412,000 premature deaths in the US each year. Because of its relative abundance in the earth’s crust and its malleability, lead (Pb) was used in the production of pipes for water supply for centuries. It wasn’t until the 20th century that scientific research demonstrated that lead was harmful to the human body. Ingestion or inhalation of lead can cause damage to the brain, kidneys, and nervous system, especially in young children and pregnant women. XRF technology is playing a key role in protecting human health. Lead can enter drinking water if the components in water installations (e.g. lead pipes, leaded-brass fixtures, lead solder) corrode. Homes built prior to 1980 are likely have copper pipes connected by a lead solder. To prevent the leaching of lead into drinking water, many pipes in potable water supplies have been replaced by copper because it is resistant to corrosion, impermeable, long-lasting and sustainable. However, the use of leaded solder is still widespread, and some brass faucets and fittings still contain lead particularly in aging water infrastructure systems prior to when corrosion control measures were adopted. Due to the fabrication of lead-free fittings being more costly, components containing lead are still used for other water installations and in countries in which safety regulations are not yet in place. To ensure that public drinking water meets strict safety requirements, the Safe Water Drinking Act was introduced in the U.S. in 1974. The Environmental Protection Agency (EPA) in the U.S. then published a regulation known as Lead and Copper Rule (LCR) to control both lead and copper in drinking water in 1991. However, recent news headlines suggest that lead, copper and other metals are still an issue in drinking water. This is why the U.S EPA is looking to update lead water pipe standards to ensure communities have access to safe drinking water. In Hong Kong, a comprehensive safety overhaul of drinking water is taking place. Hong Kong seeking to adopt standards beyond guidelines set by the World Health Organisation after learning a bitter lesson from a lead contamination scandal in 2015 and fears of a second scare back in late 2017. According to Defra, from the 1970s onwards the use of lead has been prohibited across Europe. Although lead pipes have not been permitted for this purpose for four decades, in older properties it remains possible that part, or all, of the underground service pipe connecting the water main in the street to a kitchen tap may be made from lead. X-ray fluorescence (XRF) is a proven, non-destructive technique that enables the determination of the elemental composition of various materials, including metal alloys, in seconds. Hitachi High-Tech’s X-MET8000 series of handheld analysers can be used for the rapid testing of metal plumbing components in existing and new water installations. The X-MET8000 can also be used for materials incoming inspection, manufacturing quality control, and to ensure the correct components are being selected in the warehouse prior to an installation or repair. Our two-step guide for checking for lead: With a handheld XRF analyser testing couldn’t be simpler: simply position the analyser’s nose on the part to test, and press the trigger to measure. Results are displayed almost immediately. The results display can be customised to show pass/fail messages when a given element is above or below a user-defined level (e.g. show FAIL if Pb > 0.25%), enabling rapid decision making. Solder joints can be narrow. The use of the integrated collimator ensures that you test the solder only, not the surrounding material. The optional built-in camera helps you position the analyser correctly on the solder joint. The small-spot collimator option is available on Hitachi High-Tech’s X-MET8000 Expert and Optimum models. Handheld analysers provide rapid and reliable material identification and chemistry for positive material identification (PMI) inspection as well as for manufacturing quality assurance and on-site verification of existing water supply installations. Their ease of use, robustness and ergonomics make them the tool of choice for any metal testing applications. Want to find out more about how Hitachi High-Tech’s X-MET range could help you? Contact us today to talk to an expert or book a demo.Find out more
<urn:uuid:3be8fc91-0126-4a68-8d88-60ac681b2511>
CC-MAIN-2020-10
https://hha.hitachi-hightech.com/en/blogs-events/blogs/2018/03/13/are-you-checking-for-lead-in-drinking-water-pipes-and-fittings/
s3://commoncrawl/crawl-data/CC-MAIN-2020-10/segments/1581875147234.52/warc/CC-MAIN-20200228135132-20200228165132-00018.warc.gz
en
0.938145
930
3.359375
3
Names: Rhodes, Cecil John Born: 5 July 1853, England Died: 26 March 1902, Muizenberg, Cape Colony In summary: South African statesman, proponent of British imperialism, and businessman after whom Rhodesia (Zimbabwe) was named Cecil John Rhodes was born on 5 July 1853 in England. He was the fifth son of Francis William Rhodes and his second wife, Louisa Peacock. A priest of the Church of England, his father served as curate of Brentwood Essex for fifteen years, until 1849, when he became the vicar of Bishops Stortford, where he remained until 1876. Rhodes had nine brothers and two sisters and attended the grammar school at Bishops Stortford. He fell ill shortly after leaving school and, as his lungs were affected, it was decided that he should visit his brother who had recently immigrated to Natal. He arrived in Durban on 1 September 1870. He brought three thousands pounds his aunt had lent him and used it to invest in diamond diggings in Kimberley. After a brief stay with the Surveyor-General of Natal, Dr. P. C. Sutherland, in Pietermaritzburg, Rhodes joined his brother Herbert on his cotton farm in the Umkomaas valley in Natal. In October 1871 Rhodes left the colony for the diamond fields of Kimberley. He supervised the working of his brother’s claim and speculated on his behalf. Among his associates in the early days were John X Merriman and C D Rudd, who later became his partner in the De Beers Mining Company. In 1872 Rhodes suffered a slight heart attack. Partly to recuperate, but also to investigate the prospects of finding gold in the interior, the Rhodes brothers trekked north by ox wagon. Their trek took them along the missionary road in Bechuanaland as far north as Mafeking, then eastwards through the Transvaal as far as the Murchison range. The journey inspired a love of the country in Rhodes and marked the beginning of his interest in the road to the north and the northern interior itself. In 1873 Rhodes left his diamond fields in the care of his partner, Rudd, and sailed for England to complete his studies. He was admitted to Oriel College, but only stayed for one term in 1873 and only returned for his second term in 1876. He was greatly influenced by John Ruskin’s inaugural lecture at Oxford, which reinforced his own attachment to the cause of British imperialism. Among his Oxford associates were Rochefort Maguire, later a fellow of All Souls and a director of the British South Africa Company, and Charles Metcalfe. His university career engendered in Rhodes his admiration for the Oxford ‘system’ which was eventually to mature in his scholarship scheme: ‘Wherever you turn your eye – except in science – an Oxford man is at the top of the tree’. Whilst at Oxford, Rhodes continued to prosper in Kimberley. Before his departure for Oxford he and Rudd had moved from the Kimberley mine to invest in the more costly claims of what was known as old De Beers (Vooruitzicht) which owed its name to Johannes Nicolaas de Beer and his brother, Diederik Arnoldus de Beer, the original owners of the farm Vooruitzicht. In 1874 and 1875 the diamond fields were in the grip of depression, but Rhodes and Rudd were among those who stayed to consolidate their interests. They believed that diamonds would be numerous in the hard blue ground that had been exposed after the softer, yellow layer near the surface had been worked out. During this time the technical problem of clearing out the water that was flooding the mines became serious and he and Rudd obtained the contract for pumping the water out of the three main mines. In April 1880 Rhodes and Rudd launched the De Beers Mining Company after the amalgamation of a number of individual claims. With 200 000 pounds capital the Company, of which Rhodes was secretary, owned the largest interest in the mine. In 1880 Rhodes prepared to enter public life at the Cape. With the incorporation of Griqualand West into the Cape Colony in 1877 the area obtained six seats in the Cape House of Assembly. Rhodes chose the constituency of Barkley West, a rural constituency in which Boer voters predominated. Barkley West remained faithful to Rhodes even after the Jameson Raid and he continued as its member until his death. The chief preoccupation of the Cape Parliament when Rhodes became a member was the future of Basutoland, where the ministry of Sir Gordon Sprigg was trying to restore order after a rebellion in 1880. The ministry had precipitated the revolt by applying its policy of disarmament to the Basuto. In 1890 Rhodes became Prime Minister of the Cape Colony and implemented laws that would benefit mine and industry owners. He introduced the Glen Grey Act to push Black people from their lands and make way for industrial development. Rhodes’ policies were instrumental in the development of British imperial policies in South Africa. He did not, however, have direct political power over the Boer Republic of the Transvaal. He often disagreed with the Transvaal government’s policies and felt he could use his money and his power to overthrow the Boer government and install a British colonial government supporting mine-owners’ interests in its place. In 1895 Rhodes supported an attack on the Transvaal. It was a failure and Rhodes had to resign as Prime Minister of the Cape. Rhodes also used his wealth to pursue his dream of expanding Britain’s empire in Africa. His British South Africa Company, which had a police force, was used to colonise Mashonaland, present Zimbabwe. They had hoped to start a ‘new Rand’ from the ancient gold mines of the Mashona, but the gold had been worked out of the ground long before. The White settlers who accompanied the British South Africa Company to Mashonaland became farmers. When the Matabele and the Mashona rebelled against the coming of the White settlers to their land, the British South Africa Company police crushed them. The conquered lands were named Southern and Northern Rhodesia, to honour Rhodes. Today, these are the countries of Zimbabwe and Zambia. He died at Muizenberg on March 26 in 1902.
<urn:uuid:78dd1d10-28a0-47aa-80b5-e31e23df8385>
CC-MAIN-2019-39
https://theholisticexpeditionofafrica.wordpress.com/2013/08/
s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514575751.84/warc/CC-MAIN-20190922221623-20190923003623-00087.warc.gz
en
0.986978
1,312
3.234375
3
Dookie CenotaphPrint Page Commemorates those who died or were killed in World Wars One and Two. The memorial cairn was originally unveiled on the 12th September 1937 by the Shepparton Shire President , Councillor E.P Hill and dedicated by the Reverend W Adams. The memorial tablet contained the names of 16 soldiers from the district who fell in the Great War. (The Argus,13th September 1937) Monument characteristices : Cairn of locally quarried stone with a low, concrete-capped wall on either side. It has a two-stepped concrete stone base and sits on a cement brick apron. It is dedicated to those who gave their lives in both World Wars. |Address:||Baldock & Mary Streets, Dookie, 3646| |GPS Coordinates:||Lat: -36.3276| Note: GPS Coordinates are approximate. |Actual Monument Dedication Date:||Sunday 12th September, 1937| THIS MEMORIAL IS ERECTED TO THE MEMORY OF THOSE WHO GAVE THEIR LIVES SERVING THE EMPIRE IN THE GREAT WARS 1914 - 1918 1939 - 1945 1914 - 1918 1939 - 1945 LEST WE FORGET
<urn:uuid:62f31769-e0f6-4780-9fee-ca77dfb0bda5>
CC-MAIN-2016-50
http://monumentaustralia.org.au/themes/conflict/multiple/display/31063-dookie-cenotaph/
s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698540928.63/warc/CC-MAIN-20161202170900-00100-ip-10-31-129-80.ec2.internal.warc.gz
en
0.87454
269
2.703125
3
Space weather researchers at The Johns Hopkins University Applied Physics Laboratory (APL), in Laurel, Md., are helping expand a global radar network used to study electrical disturbances in our atmosphere that can create auroral displays or disrupt communications, knock out electrical power grids, damage satellites or even affect astronauts. The Super Dual Auroral Radar Network, or SuperDARN, expansion project, scheduled for completion in 2012, will add an array of mid-latitude radars to capture data on drifting plasmas in our ionosphere that radars at high-latitude locations miss when strong solar storms stretch to lower latitudes. The SuperDARN network currently consists of 21 radar sites in eight countries and Antarctica, with 14 northern sites stretching from Finland, through Canada, to Japan that monitor the ionosphere above the North Pole, and seven southern sites arrayed around and in Antarctica that observe events above the South Pole. Four new radar pairs will be built — one pair per year — in Kansas, Oregon, the Aleutian Islands, and the Azores. "With expanded radar coverage stretching from Eastern Asia to Europe and from Kansas to the magnetic north pole, we will better understand the near-Earth space environment, which will help us better understand and predict the effects of solar storms on space- and ground-based systems," says Elsayed Talaat, APL's SuperDARN principal investigator and science lead. The SuperDARN project began at APL and the mid-latitude expansion is a collaborative effort between Virginia Tech, the University of Alaska Fairbanks, Dartmouth College and APL. "We're partnering with the other institutions on the design and construction of the new radars, and APL is providing and installing all related software," Talaat says. APL built and manages the Wallops Island radar in Virginia, the first mid-latitude radar constructed, and collaborates with Virginia Tech on three other existing radars located in Goose Bay and Kapuskasing in Canada, and in Blackstone, Va. APL is the central data collection and distribution site, and maintains the software for radar operation and data analyses, as well as the project's Web site where several products, including real-time radar displays and convection maps, and time-series and field-of-view measurements, are archived and made available to the atmospheric science communities. The software and Web site are maintained at APL by Robin Barnes, the SuperDARN software engineer since 1997. The radars at each SuperDARN site are virtually identical, with some minor differences in antenna design and for accommodating the physical conditions at the site. Each of the radars has two arrays of 50-foot antenna towers; the primary array consists of 16 towers, and the secondary, interferometer array, consists of four towers. The antennas function as a single radar with beams scanning a 53-degree sector. They operate 24/7, autonomously transmitting five gigabytes of data daily back to APL, through computer and electronic equipment housed in an accompanying building at each site. APL then routes the data to the other principal investigator institutions. SuperDARN data is being used in conjunction with data from NASA's TIMED (Thermosphere, Ionosphere, Mesosphere Energetics and Dynamics) spacecraft, built and operated by APL, to study heating in the thermosphere and for auroral studies. The SuperDARN project is funded by grants from the National Science Foundation. For more information, visit http://superdarn.jhuapl.edu/. Click on the thumbnail image for a larger version.
<urn:uuid:b7a0699d-8152-4152-9eca-9fefd213ee22>
CC-MAIN-2015-22
http://www.jhuapl.edu/newscenter/pressreleases/2009/090708.asp
s3://commoncrawl/crawl-data/CC-MAIN-2015-22/segments/1432207929176.79/warc/CC-MAIN-20150521113209-00247-ip-10-180-206-219.ec2.internal.warc.gz
en
0.912578
743
3.015625
3
AMAZING Animals That Use TOOLS!! From hunting for food to collecting water…stay tuned to number 1 to find out animals you had no idea used tools! Transcript Provided by YouTube: From hunting for food to collecting water…stay tuned to number 1 to find out animals you had no idea used tools! Number 10: Dolphins. In 2012, an Indian Minster said that Dolphins should be treated as non-human people, and scientists have long understood how intelligent these creatures really are, so, perhaps it’s not surprising that they’ve recently been observed using tools. Well, in Shark Bay, Australia, a scientist was lucky enough to observe how a group of bottlenose dolphins have learned to carry marine sponges in their beaks to stir ocean-bottom sand to uncover pray. This cool technique has made this group more successful at hunting food on the bottom of Not only that, but it also protects their noises. Although this is just one group of dolphins, they’re ability to do this is yet another testament to their intelligence, though it should be pointed out that it seems to be a relatively new invention. And what’s to say there’s not other groups of dolphins using other sea-based tools for In fact, as highlighted in a previous video, some scientists have stated that this group spend more time hunting with tools that any other non-human animal…but as we’ll see moment, there is another contender who others think are slightly ahead of dolphins in using Number 9: Chimpanzees. These intelligent creatures made headlines last year when footage emerged showing that the clever primates habitually make special water-dipping sticks – chewing the end of the stick to turn it into a soft, water-absorbing brush. These sticks were examined by primate researchers and they concluded they were made specifically Apparently, using similar brush-tipped sticks to dip into bees’ nests for honey was common in chimpanzee populations across Africa. This particular population of chimpanzees has what the researchers call a “drinking culture”, which they class as a custom shared throughout a group of making these special water-dipping sticks to help them through the dry season. But this isn’t the only group of Chimpanzees to be observed using tools. Decades earlier, in 1960 a chimp was observed using a twig to reach one the chimp’s favorite He did this by picking up a twig and stripping the leaves off it. Then he stuck the twig into one of the holes in the termite mound, left it there for a moment, and slowly pulled it out. So, he was effectively fishing for termites. It’s quite clear these intelligent animals have found ways to use tools to overcome difficult situations, yet, like other species on this list who are at serious risk of extinction due to human action, they’re tool use won’t save them from habitat loss or bulldozers! Number 8: Crows. Before we see what crows have to offer, we’d truly appreciate it if you took a moment to subscribe to our channel and like this video! Also, it’s important that you click that little notification bell, too, so you’ll always know when there’s new content from Zero2 Hero! Crows have long symbolized death because they are carrion birds, or’birds that feed on dead However, our view and understanding of the Crow might just change as the result of recent observations of a group of captive crows. Ivo Jacobs of Lund University in Sweden and his team were fortunate to observe some interesting behavior in the crows. They saw how one crow slipped a wooden stick into a metal nut and flew off with both objects. Later, they observed another crow insert a thick stick into a hole in a large in a large wooden ball to move the items of the room. As well as these examples, they also observed four other instances of the crows’ clever In fact, the ability to use objects to transport both items at once is something that had never been seen in non-human animals. Yet this ingenious feat is not that surprising, as we already knew crows could use tool, but this particular trick is often seen as a hallmark of complex cognitive abilities suggesting they might be a little bit more intelligent that we first though. At the end of the day, this is definitely interesting, but a lot more research needs to be completed to see whether the birds also use tools this way in the wild. Number 7: Wrasse. So, we’ve seen that Dolphins can use tool, and that’s not too surprising given how intelligent we know they are, but the next example highlights that they aren’t the only marine animal to In fact, this example is the first-time tool use has been observed in fish species. This orange dotted tuskfish likes to eat clams. But how does a fish defeat a clam? Well, it uses a neat trick to expose one buried in the sand. The fish grabs the clam in its mouth and, using all its power, smashes it against a The blows are so precise that, after a short time, the shell breaks apart. The fish then eats it all up, swallowing the soft flesh and spitting out shattered shell It just goes to show, fish might just be a bit more intelligent than we give them credit for…well this fish at least! Number 6: Orangutans. In the wild, orangutans use branches, sticks and leaves the way humans use utensils, screwdrivers and power drills. Sticks are the main all-purpose tool, wielded by these primates to pry tasty insects out of trees or for use with certain fruits. Others have been known to use leaves as a sort of glove..like when their picking prickly plants…or big leaves as umbrellas in heavy rain. Some have even suggested that some orangutans have been observed using sticks to measure the depth of water, but there is a lot of debate around whether this is the right interpretation for this act. Nevertheless, they are clearly intelligent, but for all their intelligence and their ability to use tools, these beautiful creatures can’t possibly defend themselves against humans, and with recent scientific warnings suggesting that they are at risk of imminent extinction by the end of the century, we can only hope that enough is achieved that they might survive in the future. Number 5: Elephants. It is no secret that Elephants are some of the most intelligent animals on the planet. And it’s not surprising when you considering the size of their brain, and the fact that they pass on information for one generation to the next. So it’s not that surprising that they’ve been observed using tools for a variety of reasons. You have some who’ve been observed dropping logs on electric-fences to short circuit them, or others, like the Asian Elephants, have been observed making fly-swatting branching…even modifying the branches so that they are the perfect length. Elephants have a lot of this going for them, but their intelligence has helped them overcome some difficult situations, Number 4: Gorillas. Tool use by gorillas is something scientists have been aware about for some time. Most observations generally relate to obtaining food, either by cracking nuts with rocks or using twigs to eat termites, like we’ve seen with other animals on this list. However, recently tool-savy wold gorillas were caught on camera. One gorilla was observed using a tool to test the depth of the water before wading in…which could suggest a similar action might have been the right interpretation for our earlier entry with the orangutans. In the same video, another gorilla was caught using a stick to help search for food, and even possibly as a bridge over a muddy puddle. Although this is not completely surprising, as tool use in primate is well document, it is great to catch wild gorillas doing this! Number 3: Octopus. We’ve already introduced two marine animals that have been known to use tools, and the next example is yet another one to add to the list. The octopus are notorious for their ability to hide behind rocks or slip through the smallest But groups of octopi, like the coconut octopus, have also been found to use tools. The coconut octopus, Amphioctopus marginatus, is the first identified species to gather materials for its shelter with apparent foresight. While we see this in birds, it is much less known in marine life…especially with octopi. This two-inch-long Indonesian cephalopod has been observed retrieving discarded coconut half-shells, swimming with them up to 50 feet away, and then carefully arranging the shells on the sea floor for later use. In one video, an octopus was caught quickly jumping in to its coconut shell. Using the discarded shells in this way allows the soft-bodied creature to hide from predatory cuttlefish, and divers who get a bit to close. The coconuts can even be used as a getaway vehicle…the octopuses can roll away from danger, safe inside the shell. Number 2: Macaques. The next entry on this list has been so successful at using their particular tool and method that they have come close to pushing their prey towards extinction…so it appears humans aren’t the only primate able to do this…though we obviously do it on a much bigger scale. Long-tailed macaque forage for shellfish on islands off Thailand, then crack them open with stone tools. They target the largest rock oysters, bludgeoning them with stone hammers, and pry open the shells with the flattened edges of their tools. It’s great to see more primates using tools for finding food, but by over-harvesting their prey that are even putting their own technology knowledge at risk. How will they pass on the skills to harvest the food when there’s no more food to harvest? Number 1: Sea Otters. We mentioned earlier in the video about an animal that makes Dolphin tool use look like child’s play, well it’s these cute creatures. Recent research has indicated that otters learned how to use tools long before other A genetic study of more than 100 wild sea otters living off the Californian coast suggests their ancestors living millions of years ago showed this behavior. So, what do they do? Well, sea otters are often seen floating on their backs, using rocks to break open shellfish In comparison to the Dolphin example we discussed earlier, this is not a recent phenomenon, and researchers even plan to study fossil remains to get a better understanding of exactly when they started doing this. If sea otters’ ancestors held rocks on their chests, then that may explain the depressions found in the chests of some modern otters. What’s even more interesting is that otter pups express rudimentary tool behavior in captivity without any demonstration or training, which could be further evidence for it starting a long, long time ago. Tell us what you think about these brilliant creatures in the comments below and…take This post was previously published on YouTube.
<urn:uuid:a8cfde3c-cbed-4088-aa15-a63e9c3d2986>
CC-MAIN-2019-51
https://goodmenproject.com/environment-2/top-10-amazing-animals-that-use-tools/
s3://commoncrawl/crawl-data/CC-MAIN-2019-51/segments/1575540506459.47/warc/CC-MAIN-20191208044407-20191208072407-00007.warc.gz
en
0.93979
2,487
3
3
Proteinase inhibitors give a means of executive plant level of resistance to bugs. Some developmental abnormalities from the pupae and growing moths had been noted. These results claim that the sugars beet gene may demonstrate helpful for effective control of a number of different lepidopteran bugs in genetically improved tobacco and various other plant life. The glucose beet serine proteinase inhibitor could be far better for insect control because glucose beet is normally cropped in limited geographical areas hence limiting the publicity from the pests to glucose beet proteinase inhibitors and build-up of nonsensitive midgut proteases. Launch Assimilation of eating proteins is crucial on track insect development and development, as a result, inhibition of digestive proteolytic enzymes is known as a desirable focus on for advancement of buy 1000787-75-6 effective ways of control bugs. Insect digestive proteases are grouped into many mechanistic classes predicated on the amino acidity residue or steel ion that’s involved with peptide connection catalysis. Main midgut proteases from the Lepidoptera and Diptera insect purchases been shown to become predominately from the serine (trypsin) type C. In the Homoptera and Coleoptera purchases, major proteases used for digestion had been been shown to be from the cysteine course , . These proteases are targeted by many normally occurring place proteinase inhibitors (PIs) that are likewise seen as a their specificity toward proteases C. PIs are believed attractive equipment for crop improvement because their significant defensive role in organic defense mechanisms continues to be well-documented C. Defensive capacities of place PIs depend on inhibition from the pests digestive proteases hence limiting the option of amino acids essential for regular insect development and advancement , . Transfer of PI genes to plant life is a broadly accepted way of anatomist enhanced degrees of insect tolerance in plant life. It’s been conclusively showed that over-expression of heterologous PI genes considerably decreased or inhibited larval development and nourishing on transgenic plant life C. The inhibition provides been shown to become quite effective as showed with bitter gourd PIs where a lot more than 80% of serine proteases had been inhibited by nourishing over the transgenic PI plant life . Appearance of grain cysteine PI genes, and and beet armyworm (gene could be area of the general level of resistance system that protects the place from insect strike. To investigate the function from the PI gene in insect buy 1000787-75-6 level of resistance, the gene was reconstructed for over-expression in transgenic plant life. We report over the expression from the glucose beet transgene in plant life and bioassay from the transgenic plant life for insect level of resistance to five Lepidoptera bugs. Materials and Strategies Place Transformation Vectors Having the Gene The entire length coding series from the gene was extracted from the cloned EST series (GenBank #”type”:”entrez-nucleotide”,”attrs”:”text message”:”DV501688″,”term_id”:”120448645″,”term_text message”:”DV501688″DV501688) using 5 and 3 Competition (BD Biosciences, San Jose, CA) and the next primers: 5 Competition, gene was after that amplified buy 1000787-75-6 from glucose beet series F1016 by RT-PCR using primers: Forwards 5ACCATGGCTTCCATTTTCCTGAAATC 3 and Change 5GGTCACCTAGACCATCGCTAAAACATCA 3 that acquired an NcoI and BstEII limitation enzyme sites, respectively, built-in for simple sub-cloning. The entire length coding series was cloned behind the CaMV35S promoter in the pCAMBIA1301 place change vector (pBvSTI, Fig. 1; CAMBIA, Canberra, Australia). pCAMBIA1301 holds the marker gene for collection of hygromycin (Hg) resistant changed plant cells. Open up in another window Amount 1 Schematic from the reconstructed gene in the pCAMBIA1301 change vector (pBvSTI).RB, best border; LB, still left boundary; p35S, cauliflower mosaic trojan (CaMV) 35S promoter; gene utilized being a probe for Southern blots. Place Transformation (series 16c) leaf disks had been excised and inoculated with stress EHA105 that holds the pBvSTI change vector , . Putative transformants had been chosen on Murashige and Skoog press containing B5 vitamin supplements and 20 mg Hg sulfate/l , . Regenerated shoots had been excised and positioned on the same press for rooting ahead of transfer to dirt. After acclimation, vegetation had been cultivated in the greenhouse and managed at 20 to 30C throughout the day and 18 to 25C during the night with a day time amount of 14 to 16 h. All vegetation had been fertilized regular monthly with Osmocote (Scotts Miracle-Gro, Marysville, OH). T2 progeny homozygous for Hg level of resistance had been selected from your T1 progeny of individually produced T0 transgenic vegetation. Southern Blot Evaluation Genomic DNA was purified using the CTAB (hexadecyltrimethylammonium bromide, Sigma, USA) removal technique . DNA focus and purity had been driven using an ND-8000 Spectrophotometer (NanoDrop Technology Inc., DE, PCK1 USA). Around 10 g of DNA was digested buy 1000787-75-6 with NdeI.
<urn:uuid:1f6974a9-74e4-4728-a1e8-b70f68d78359>
CC-MAIN-2021-43
http://cancer-ecosystem.com/2018/08/12/proteinase-inhibitors-give-a-means-of-executive-plant-level-of-resistance/
s3://commoncrawl/crawl-data/CC-MAIN-2021-43/segments/1634323588257.34/warc/CC-MAIN-20211028034828-20211028064828-00335.warc.gz
en
0.92828
1,201
2.734375
3
Connect with your students on the autism spectrum, and watch them grow! And it jump-starts our students' natural language development! In Natural Language Acquisition on the Autism Spectrum, we are introduced to 'invisible' echolalia, the kind we barely pay attention to in our typically-developing youngsters. It slips under the radar, and we think nothing of it. But in autism, it's really late. And obvious. And seemingly pervasive. And that's the subject of this ground-breaking book. Echolalia in our kids with autism is just like the 'typical' variety, just later, much later. The good news, though, is that it communicates, and it jump-starts language development! In-Depth Training Available > Read this book, and you will learn all you need to know to understand your students who use echolalia. You will learn to listen for meaning, to present language at the right level, and to support your students towards the next steps of NATURAL language development. Research determined decades ago that kids who use echolalia are communicating — and jump-starting their journey towards self-generated language. NLA builds on that foundation, and reports the progress of students over time. It tells the real stories of real kids, and empowers professionals and parents to track the heart and meaning of children's expression. It gives professionals and parents the freedom to 'be there' with children — to truly listen-and to converse in a form that is meaningful to each child. NLA does this by acknowledging echolalia as a stage of language development: the one a child is ready for as we shape and support it towards the stages of language development. No longer are we tempted to 'teach' language like a skill. Now we can grow language as true development, natural development: Natural Language Acquisition. As we learn to implement the principles of natural language acquisition, kids make progress-true, developmental progress. When we tune into the intent of a child's language, the regulatory needs of the child, and the child's life context, we can provide appropriate support for real language development. Open your mind to a new understanding: our kids with autism are communicating with us! They are doing their best, at their language-development level! And they will be able to develop more sophisticated forms of communication with you as their guide. Open this book, and share it with the others who support your students on this ride of life. Enjoy! This book is useful: It includes all the information a practicing SLP needs to assess and support language development in children who use echolalia, from the beginning stages to the advanced stages of language development. From assessment protocol and treatment planning to inspiring stories, catchy illustrations, and extensive language samples, this book has everything you need to guide your students through the stages of Natural Language Acquisition! "Thank you for your work in helping children with Autism. I was floored by how much insight it has given me into my own students!" – SLP, 1/25/2017 "I now own two copies of your book and have read it in its entirety, but have read certain sections repeatedly...sometimes with tears in my eyes, because it is so beautiful. I integrated your work into my grad course in ASD this past July, and shared your writings and ideas with my students." — L.S., PhD, CCC-SLP "This is the language course we missed in school." — Leslie W, MA, CCC-SLP "Marge's work will revolutionize your thinking about your child's language and help you understand the depth of meaning behind it!" — Megan S, MS, CCC-SLP "This book feels very personal, but it's bigger than that: it is profound and awe-inspiring." — Kristen P.L., MS, CCC-SLP "This book is marvelous!" — Kjersten S, MS, CCC-SLP SHIPPING YOUR ORDER: US Domestic - Orders are shipped through USPS or UPS. Rates for both services are based on current published rates. Please use our shipping estimator (available in the shopping cart)to determine your shipping costs, based on your preferences. International - Orders are shipped through USPS or UPS. Duties and taxes are NOT included in the shipping cost. Some countries impose additional duties and taxes when packages cross their borders. Please check your local laws, as any additional charges(duties/taxes), may be due upon delivery of your package. NSS is not responsible for any additional charges. Tracking information will be emailed to you upon order shipping. If an item is not in stock when your order is received, you will be notified via email with the estimated ship date for your order. Generally, backorders are shipped within 1-2 weeks. If you order with a Purchase Order, your invoice will not be sent until the order is completely filled. CANCELING AN ORDER: If you have not received your order, you may cancel it by calling 888-337-3866, faxing 888-696-9655, or e-mailing firstname.lastname@example.org. In the event that your order has already been shipped, you are responsible for returning the items in accordance with our RETURN policy (a copy is provided with your order). ALTERNATIVES TO USING YOUR CREDIT CARD THROUGH OUR WEBSITE: We offer the option of phoning, faxing or mailing in your information after you place your order for products. Simply use the Downloadable Order Form, which you can print and fax or mail to our office. Order must be returned within 30 days after receiving order. If you received a wrong/defective/damaged/duplicate order, please email email@example.com. Include your Order Number, Product Name, and problem with your order. Do not return the product until you have received an authorization from our Office. If product is returned in unused and in good condition, a full refund will be processed, minus shipping and handling charges. We accept checks (US dollars only), money orders, credit cards (Visa, MasterCard, American Express, Discover), EFT (electronic funds transfer) and purchase orders. CREDIT CARD SECURITY: When you submit your credit card and other sensitive information to NorthernSpeech.com, rest assured that the transaction is secure. In fact, shopping online at NSS is as safe as using your credit card at a restaurant or department store. Our servers use Secure Sockets Layer (SSL), one of the most robust encryption platforms available. SSL technology works with Netscape Navigator (versions 2.0 and above), Microsoft Internet Explorer (version 3.0 and above), AOL (AOL 3.0 and above), Firefox, Safari and Opera. This technology encrypts your private information from the moment you enter it until your transaction is processed, and your personal information will not be saved on a public server--thus safeguarding your personal information and guaranteeing privacy. If you still feel unsure about sending your information via internet, please feel free to call us (888-337-3866) and we can process your order over the phone.
<urn:uuid:f7c60d99-a42f-4e84-b0bb-520404ecff00>
CC-MAIN-2018-09
https://www.northernspeech.com/parents-seminars-and-materials-for-parents/natural-language-acquisition-on-the-autism-spectrum/
s3://commoncrawl/crawl-data/CC-MAIN-2018-09/segments/1518891814538.66/warc/CC-MAIN-20180223075134-20180223095134-00382.warc.gz
en
0.937138
1,511
2.8125
3
In the New Testament Bible, John 18:38, Pilate responds to Jesus’s statement that he should bear witness to the truth with this question, “What is truth?” Two thousand years later, we seem to still be grappling with this question. This past year, 2016, was a year in which “truth” became very nuanced. Oxford Dictionaries selected “post-truth” as the 2016 international word of the year. It defined post-truth as “relating to or denoting circumstances in which objective facts are less influential in shaping public opinion than appeals to emotion and personal belief.” We saw this play out in the United States presidential election. Fact-checkers described numerous times when candidate Trump stretched the truth, and yet this seemed to not matter to his followers. According to a Washington Post-ABC News post last November, Trump was seen as more honest than Clinton by an eight-point margin. This is the backdrop to next week’s EDU 6323 lesson on web-based search. Google Search is the most used search engine on the web, handling more than 3 billion searches every day. Last year’s statistics ranked it with nearly two-third’s market share globally. The main purpose of Google Search is to hunt for text in publicly accessible documents offered by web servers. It was originally developed by Larry Page and Sergey Brin in 1997. I remember using Alta Vista before that…but Google rapidly became the search leader. Google Search provides several features beyond searching for words. These include synonyms, weather forecasts, time zones, stock quotes, maps, earthquake data, movie showtimes, airports, home listings, and sports scores. There are special features for numbers, dates, and some specific forms, including ranges, prices, temperatures, money and measurement unit conversions, calculations, package tracking, patents, area codes, and language translation. In June 2011 Google introduced “Google Voice Search” to search for spoken, rather than typed, words – an alternate to Apple’s Siri. My lesson includes an exploration of advanced search on Google, as well as an exploration of web site ownership through WhoIs and the Wayback Machine. I am asking my students to pick a 2016 political action committee from this website … and then first search for this PAC using Google to provide the baseline information for analysis. They will then compare their Google returns to those generated by Bing, DuckDuckGo and the Chinese search engine Baidu, Do they get the same results? What is different? Which do they prefer? Then I will have them analyze the website for their SuperPac to see if they can find who registered and authored that website. Using the Wayback Machine, they will see if they can determine how long the has website been around. My hope is that this exploration will generate some discussion around “truth”. Dan Rockwell noted this past week that when he asked CEO’s at a dinner what kept them up at night, several shared ideas around truth (among others): - Biased media creating mis-perceptions. - Seeking input from others. - Being viewed as trustworthy. - Navigating transparency. - Getting it right when people ask for advice. The Chronicle of Higher Education this past week published a special report called “The Post-Truth Issue.” Two articles stood out to me. Safiya Noble, in “Google and the Misinformed Public,” noted that “…Google and Facebook have no transparent curation process by which the public can judge the credibility or legitimacy of the information they propagate.” She goes on to say: “Online search can oversimplify complex phenomena. The results, ranked by algorithms treated as trade secrets by Google, are divorced from context and lack guidance on their veracity or reliability. Search results feign impartiality and objectivity, even as they fail to provide essential information and knowledge we need: knowledge traditionally acquired through teachers, professors, books, history, and experience.” Lucy Ferriss, in “Post-Truth and Chaos,” had an interesting closing: “Truth, in other words, is a thing — a goal, a bedrock, a provable hypothesis, a conclusion from evidence, an insight to which, per Keats, the perception of beauty can bring us. Post-truth is a strategy. Its relationship to truth is strategic. Its goal is the exploitation of emotion. And while it cannot kill truth, it does in a way look past it, as a hubristic traveler might try to look past that North Star, and find beyond it utter darkness, nothingness, chaos.” Determining validity on the web should be a part of digital literacy. At lunch this past month with Enoch Hale, Director of VCU’s new Center for Excellence in Teaching and Learning, he made an interesting comment that his job really was more about “thinking” – thinking critically – than teaching or learning. As we approach this next week, I want my EDU6323 students to think critically about what they find on the web, and about truth.
<urn:uuid:ec3726cd-03a3-43e8-a6b5-d1b9817cf946>
CC-MAIN-2018-47
http://bwatwood.edublogs.org/2017/01/21/what-is-truth/
s3://commoncrawl/crawl-data/CC-MAIN-2018-47/segments/1542039746528.84/warc/CC-MAIN-20181120171153-20181120193153-00181.warc.gz
en
0.952687
1,068
2.890625
3
The fact that electric arc could operate was known for over a 100 years. The first ever underwater welding was carried out by British Admiralty – Dockyard for sealing leaking ship rivets below the water line. Underwater welding is an important tool for underwater fabrication works. In 1946, special waterproof electrodes were developed in Holland by ‘Van der Willingen’. In recent years the number of offshore structures including oil drilling rigs, pipelines, platforms are being installed significantly. Some of these structures will experience failures of its elements during normal usage and during unpredicted occurrences like storms, collisions. Any repair method will require the use of underwater welding. Underwater welding can be classified as 1) Wet Welding 2) Dry Welding In wet welding the welding is performed underwater, directly exposed to the wet environment. In dry welding, a dry chamber is created near the area to be welded and the welder does the job by staying inside the chamber. Wet Welding indicates that welding is performed underwater, directly exposed to the wet environment. A special electrode is used and welding is carried out manually just as one does in open air welding. The increased freedom of movement makes wet welding the most effective, efficient and economical method. Welding power supply is located on the surface with connection to the diver/welder via cables and hoses. In wet welding MMA (manual metal arc welding) is used. Power Supply used : DC Polarity : -ve polarity When DC is used with +ve polarity, electrolysis will take place and cause rapid deterioration of any metallic components in the electrode holder. For wet welding AC is not used on account of electrical safety and difficulty in maintaining an arc underwater. The power source should be a direct current machine rated at 300 or 400 amperes. Motor generator welding machines are most often used for underwater welding in the wet. The welding machine frame must be grounded to the ship. The welding circuit must include a positive type of switch, usually a knife switch operated on the surface and commanded by the welder-diver. The knife switch in the electrode circuit must be capable of breaking the full welding current and is used for safety reasons. The welding power should be connected to the electrode holder only during welding. Direct current with electrode negative (straight polarity) is used. Special welding electrode holders with extra insulation against the water are used. The underwater welding electrode holder utilizes a twist type head for gripping the electrode. It accommodates two sizes of electrodes. The electrode types used conform to AWS E6013 classification. The electrodes must be waterproofed. All connections must be thoroughly insulated so that the water cannot come in contact with the metal parts. If the insulation does leak, seawater will come in contact with the metal conductor and part of the current will leak away and will not be available at the arc. In addition, there will be rapid deterioration of the copper cable at the point of the leak. Hyperbaric Welding (dry welding) Hyperbaric welding is carried out in chamber sealed around the structure o be welded. The chamber is filled with a gas (commonly helium containing 0.5 bar of oxygen) at the prevailing pressure. The habitat is sealed onto the pipeline and filled with a breathable mixture of helium and oxygen, at or slightly above the ambient pressure at which the welding is to take place. This method produces high-quality weld joints that meet Xray and code requirements. The gas tungsten arc welding process is employed for this process. The area under the floor of the Habitat is open to water. Thus the welding is done in the dry but at the hydrostatic pressure of the sea water surrounding the Habitat. There is a risk to the welder/diver of electric shock. Precautions include achieving adequate electrical insulation of the welding equipment, shutting off the electricity supply immediately the arc is extinguished, and limiting the open-circuit voltage of MMA (SMA) welding sets. Secondly, hydrogen and oxygen are produced by the arc in wet welding. Precautions must be taken to avoid the build-up of pockets of gas, which are potentially explosive. The other main area of risk is to the life or health of the welder/diver from nitrogen introduced into the bloodsteam during exposure to air at increased pressure. Precautions include the provision of an emergency air or gas supply, stand-by divers, and decompression chambers to avoid nitrogen narcosis following rapid surfacing after saturation diving. For the structures being welded by wet underwater welding, inspection following welding may be more difficult than for welds deposited in air. Assuring the integrity of such underwater welds may be more difficult, and there is a risk that defects may remain undetected. Advantages of Dry Welding 1) Welder/Diver Safety – Welding is performed in a chamber, immune to ocean currents and marine animals. The warm, dry habitat is well illuminated and has its own environmental control system (ECS). 2) Good Quality Welds – This method has ability to produce welds of quality comparable to open air welds because water is no longer present to quench the weld and H2 level is much lower than wet welds. 3) Surface Monitoring – Joint preparation, pipe alignment, NDT inspection, etc. are monitored visually. 4) Non-Destructive Testing (NDT) – NDT is also facilitated by the dry habitat environment. Disadvantages of Dry Welding 1) The habitat welding requires large quantities of complex equipment and much support equipment on the surface. The chamber is extremely complex. 2) Cost of habitat welding is extremely high and increases with depth. Work depth has an effect on habitat welding. At greater depths, the arc constricts and corresponding higher voltages are required. The process is costly – a $ 80000 charge for a single weld job. One cannot use the same chamber for another job, if it is a different one. Advantages of Wet Welding Wet underwater MMA welding has now been widely used for many years in the repair of offshore platforms. The benefits of wet welding are: – 1) The versatility and low cost of wet welding makes this method highly desirable. 2) Other benefits include the speed. With which the operation is carried out. 3) It is less costly compared to dry welding. 4) The welder can reach portions of offshore structures that could not be welded using other methods. 5) No enclosures are needed and no time is lost building. Readily available standard welding machine and equipments are used. The equipment needed for mobilization of a wet welded job is minimal. Disadvantages of Wet Welding Although wet welding is widely used for underwater fabrication works, it suffers from the following drawbacks: – 1) There is rapid quenching of the weld metal by the surrounding water. Although quenching increases the tensile strength of the weld, it decreases the ductility and impact strength of the weldment and increases porosity and hardness. 2) Hydrogen Embrittlement – Large amount of hydrogen is present in the weld region, resulting from the dissociation of the water vapour in the arc region. The H2 dissolves in the Heat Affected Zone (HAZ) and the weld metal, which causes Embrittlement, cracks and microscopic fissures. Cracks can grow and may result in catastrophic failure of the structure. 3) Another disadvantage is poor visibility. The welder some times is not able to weld properly. Principle of operation of Wet Welding The process of underwater wet welding takes in the following manner: The work to be welded is connected to one side of an electric circuit, and a metal electrode to the other side. These two parts of the circuit are brought together, and then separated slightly. The electric current jumps the gap and causes a sustained spark (arc), which melts the bare metal, forming a weld pool. At the same time, the tip of electrode melts, and metal droplets are projected into the weld pool. During this operation, the flux covering the electrode melts to provide a shielding gas, which is used to stabilize the arc column and shield the transfer metal. The arc burns in a cavity formed inside the flux covering, which is designed to burn slower than the metal barrel of the electrode. Developments in Under Water Welding Wet welding has been used as an underwater welding technique for a long time and is still being used. With recent acceleration in the construction of offshore structures underwater welding has assumed increased importance. This has led to the development of alternative welding methods like friction welding, explosive welding, and stud welding. Sufficient literature is not available of these processes. Scope for further developments Wet MMA is still being used for underwater repairs, but the quality of wet welds is poor and are prone to hydrogen cracking. Dry Hyperbaric welds are better in quality than wet welds. Present trend is towards automation. THOR – 1 (TIG Hyperbaric Orbital Robot) is developed where diver performs pipefitting, installs the trac and orbital head on the pipe and the rest process is automated. Developments of diverless Hyperbaric welding system is an even greater challenge calling for annexe developments like pipe preparation and aligning, automatic electrode and wire reel changing functions, using a robot arm installed. This is in testing stage in deep waters. Explosive and friction welding are also to be tested in deep waters. Amit Mukund Joshi (Mechanical Engineer) Junior Research Fellow Mechanical Engineering Department Indian Institute of Technology I.I.T – Bombay 1) D. J Keats, Manual on Wet Welding. 2) Annon, Recent advances in dry underwater pipeline welding, Welding Engineer, 1974. 3) Lythall, Gibson, Dry Hyperbaric underwater welding, Welding Institute. 4) W.Lucas, International conference on computer technology in welding. 5) Stepath M. D, Underwater welding and cutting yields slowly to research, Welding Engineer, April 6) Silva, Hazlett, Underwater welding with iron – powder electrodes, Welding Journal, 1971.
<urn:uuid:7c8dba7b-6e49-4968-8b50-efbf3c9ae947>
CC-MAIN-2022-40
https://raremetalblog.com/metalwebnews/underwater-welding/underwater-welding.pdf
s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030337723.23/warc/CC-MAIN-20221006025949-20221006055949-00233.warc.gz
en
0.92907
2,148
3.75
4
Tragus Piercing – What is this type of piercing? What is a Tragus Piercing? A tragus piercing is a piercing that is pierced by the thicker cartilage part of the ear, at the entrance of the auditory canal – see our ear guide here for more on the areas of the ear. Just like a helix piercing, it became very fashionable in the 1990s and is still popular. Process of Piercing the Tragus First of all, you should be aware that the piercing is a so-called cartilage piercing, which is more difficult to pierce than a typical piercing in the earlobe. The healing of a tragus piercing could take much longer. Nevertheless, the Tragus Piercing is one of the more common type of piercings, so it is offered by almost every piercing studio and professional piercer. After the piercer has informed you about the risks and the process and you have signed that you’re happy to go ahead, the piercing can take place in what should be a very sterile environment. Before the canal is pierced, the area around the inlet and outlet is thoroughly cleaned and disinfected. Now the place is marked with a pen so you can check in its positioning. The tragus piercing spot is engraved with a specially developed piercing cannula. This is a tube, which is hollow from the inside, so that the piercer can push through, and which remains when pulling out of the cannula in the freshly pierced channel and which can now be carefully closed. Behind the tragus, a piece of cork should be held against to prevent injuries in the ear canal. Since the cartilage tissue in Tragus piercing is very well supplied with blood, it often starts to bleed, which is completely normal and not uncommon. Healing and Care of Tragus Piercings The healing process of a tragus piercing can be from two months to eight months. The first few days you should not wear tight caps, as this would exert too much pressure on the fresh and healing piercing. The sea or the swimming pool should be avoided due to the chlorine and salt content as well as bacteria present, which can lead to severe inflammation of the fresh piercing. For care, which is very important, it is not recommended to use alcohol-based disinfectants. For cleaning, you usually get a small vial from the piercer or give it to you in the pharmacy. Gently apply the remedy to a clean cotton swab and gently clean the area around the puncture and exit points. Thus, the encrustations can be gently soaked and then removed, without parts of the wound are torn open again. The disinfection and cleaning of the piercing must be done at least twice a day, and of course, until this is completely healed. In addition, it is important to gently rotate the piercing every day so that it does not grow together with the healing tissue. The after piercing must remain in the piercing channel until complete healing and may only then be replaced by a normal piercing. Shortening should be done by the piercer, if at all. The piercer is also the right person to contact if there are problems with piercing, if there are still questions or if the pain does not subside even after several days. Material and models For the tragus piercing 316L Surgical Steel or Titanium is mostly used. These materials are considered very robust and high quality, so that it is tolerated by the body usually without problems. As for jewellery, use a Ball Closure Ring (BCR) or a labret plug is recommended. The after piercing, however, often consists of plastic. It is important to pay attention to the thickness of the rod so that the tragus is not unnecessarily squeezed. Too thick a piercing would have the dilation of the channel result and too thin a rod causes the piercing channel would gradually reduce.
<urn:uuid:38a0329e-a679-43ab-8ae0-732ee65a343a>
CC-MAIN-2020-05
https://www.greatpiercingshop.com/ear-piercings/tragus-piercing/
s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579250592261.1/warc/CC-MAIN-20200118052321-20200118080321-00402.warc.gz
en
0.964471
792
2.53125
3
Malcolm X (1925-1965) is best remembered as the charismatic spokesperson for the Nation of Islam whose fiery speeches helped the Black Muslims’ ranks swell from 6,000 to 75,000 between 1956 and 1961. However, he fell out of favor with the sect’s founder, the Honorable Elijah Muhammad, soon after making his pilgrimage to Mecca. While there, Malcolm prayed alongside Muslims of every hue who treated him like a brother. Consequently, upon returning to the States, he announced that he could no longer ascribe to one of his sect’s basic tenets, namely, that white people were a genetically-engineered race of devils created in a lab 6,600 years ago by a rogue scientist called Yakub. Since that claptrap was a core belief upon which the Nation of Islam was founded, Malcolm found himself marked for death for his blasphemous change of heart. And less than a year later, he was assassinated by three members of the Fruit of Islam, the paramilitary wing of the Nation of Islam. Malcolm X: The Lost Tapes revisits the late icon’s abbreviated career. The film features found footage illustrating the late civil rights leader’s concern for the welfare of all African-Americans. For instance, in one snippet, he says: “We’re not brutalized because we’re Muslims, Baptists or Catholics, but because we’re black people living in the United States.” Then, attempting to inspire his followers to appreciate their appearance, he asks: “Who taught you to hate the way you look from the top of your head to the bottom of your feet?” You might be surprised to know that Malcolm attended but did not speak at the historic March on Washington in 1963. Here, he explains why he disagreed with Dr. Martin Luther King’s non-violent philosophy. “There is nothing in the Koran that teaches us to suffer peacefully. If someone puts his hands on you, send him to the cemetery!” He also attempts to convert black military veterans to his cause by declaring that if they were willing to die overseas fighting to save Europeans from Hitler, they ought to be just as eager to shed blood to liberate their own people. Suggesting that it was silly to wait for segregationist Congressmen to end Jim Crow, Malcolm summarizes with a clarion call for “freedom, justice and equality by any means necessary.” An intriguing contribution to the enduring legacy of a common street pimp-turned-revolutionary Muslim firebrand. Excellent (4 stars) Running time: 51 minutes Production Studio: 1895 Films Distributor: Smithsonian Channel Malcolm X: The Lost Tapes is set to premiere on the Smithsonian Channel on Monday February 26th at 8 pm ET/PT, 7 pm CT. To see a trailer for Malcolm X: The Lost Tapes, visit: https://www.youtube.com/watch?v=bHOcO-K8UZY
<urn:uuid:7b2f1cbb-4167-4f2e-9055-87c0235af229>
CC-MAIN-2019-22
https://www.insightnews.com/aesthetics/malcolm-x-the-lost-tapes/article_1d61c9ec-7144-5821-bf3d-3907dc601b56.html
s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232256100.64/warc/CC-MAIN-20190520182057-20190520204057-00389.warc.gz
en
0.961497
626
2.5625
3
The First Intentional Recordings The first sound recordings were not done intentionally, and is the topic of another **link to post on pottery recordings**. However the first intentional recordings were done in the mid 19th century. Contrary to popular assumption, these recordings, done with a device called the phonautogram, pre-date Edison's phonograph by twenty years. Édouard-Léon Scott de Martinville is the inventor, and his vision revolved completely around the recordings. Today we take for granted that if you record something, you will be able to listen back to it. But with these initial recordings were designed to provide a visualization for various sounds in order to track loudness and/or pitch. They were used for scientific study of sound, not for listening back to the original sounds. In fact, there was no way to play them back. The subtle etchings on a black sooted background remained a silent historical object until 2008 when modern technology was used to decode and play back these early recordings. The initial attempts at this decoding revealed that Scott's equipment was (not surprisingly) was not perfectly calibrated, and the voice and guitar that were captured played back at the wrong speed and pitch. "squawky". The sounds were slowed down to what reasonably resembles human voice. Here's one of the recordings and the attempt at decoding it! Scott set out to record and visualize speech and sound; he never wanted to play it back, while Edison's goal, by contrast, was specifically to recreate sound. Scott felt that it was an inappropriate use of the technology to "reproduce" the sounds. He wanted to transcribe speech as a typewriter or note-taker might. Phonograph means "writing speech". see **post on sound recovery*** on how to get theses sounds off the sooted paper and into your ears. Thumbnail Photo by: Charles Kremenak, Flickr
<urn:uuid:72baa3db-ea58-4cc1-af84-55fd36cfef8c>
CC-MAIN-2018-34
http://www.soundisallaround.com/publish-blog-post/2014/5/29/recovering-old-sound
s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221214538.44/warc/CC-MAIN-20180819012213-20180819032213-00427.warc.gz
en
0.978046
397
2.921875
3
North American red squirrels (Tamiasciurus hudsonicus) born earlier than those in nearby litters are more likely to survive because they get a head start on finding a vacant territory to store food for wintertime, suggests a recent study from Yukon. “Being born earlier than litters within 130 meters of you is beneficial,” said David Fisher, a postdoctoral fellow at the University of Guelph and lead author of the paper in Evolution. North American red squirrels (Tamiasciurus hudsonicus) are born into litters of four pups on average, he said. When it’s time for young squirrels to leave the nest, they must find an unoccupied territory with a midden where they can bury their food to tide them over the winter. Typically, only 25 percent of juvenile squirrels last through the colder months, with survival largely dependent on obtaining this vacant space. Previous studies have indicated that squirrels born earlier in the year have a higher chance of survival, but Fisher was curious about which squirrels they had to be born before to experience this advantage – just those in neighboring litters or all those born that season in the broader habitat? To answer this question, Fisher set out to the boreal forests of southwestern Yukon. There, the Kluane Red Squirrel Project has been tagging and tracking thousands of squirrels since 1987 to learn more about their ecology and evolution. Researchers locate female squirrels in early spring to estimate when they’ll give birth and then return to tag their litters. Thanks to this extensive effort, Fisher and his colleagues could find out the birthdate, birthplace and whereabouts of every individual in the population throughout its life and examine how a squirrel’s birthdate affected how long it survived. Fisher’s team discovered that squirrels born before those in nearby litters had a greater likelihood of claiming an empty local territory on which to safeguard resources and make it through the winter. “How good it is to be born early is more pronounced when the population density is higher,” he said. These findings underscore the role of social competition with neighbors in the squirrels’ survival, Fisher said, and point to the importance of multilevel natural selection – a theory that has been debated in evolutionary biology for some time, partly because it has few examples in the wild. “Multilevel selection is when some attribute of a group or level of organization above the individual, influences an individual’s survival or reproductive success,” he said. The squirrels are a solitary species, he said, but a trait – birthdate – expressed at the level of the litter impacted how long individual pups survived in this study. “From a conservation and management perspective,” Fisher said, “this means that when studying animals that may not live in obvious groups, we need to still consider traits within things like social neighborhoods because these traits can alter how an animal responds to selection pressure.” Maintaining this awareness can help biologists monitor the effects of environmental change on a population across multiple levels beyond just the individual, he said. Fisher and his fellow researchers are now delving into factors that determine the success of juvenile squirrels in establishing territories and investigating the genetic influences on the animals’ social interactions. |Julia John is a science writer at The Wildlife Society. Contact her at firstname.lastname@example.org with any questions or comments about her article.|
<urn:uuid:631b3bbf-e09d-4fec-9dcb-7e645ee692f7>
CC-MAIN-2022-49
https://wildlife.org/study-shows-multilevel-natural-selection-in-red-squirrels/
s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446711394.73/warc/CC-MAIN-20221209080025-20221209110025-00160.warc.gz
en
0.954586
720
4.0625
4
by Associate Clinician Felicia Pasquale I frequently have new clients tell me they just got their blood test results back from their doctor and their vitamin D levels are low, even though they have been taking a vitamin D supplement for months, or even years. There is a good explanation for this! In order for your body to absorb vitamin D, you must be able to digest fats, have proper kidney and liver function, and have adequate calcium and vitamin K. Vitamin D is a fat soluble vitamin. Therefore, you must have optimal digestion in order to absorb vitamin D. That means your body must produce enough enzymes and hydrochloric acid in order to digest carbohydrates, proteins, and fats. Enzymes and HCL are only the start of the digestive process. The digestive system works in a synchronized fashion; each metabolic action is a precursor for the next. Everyone needs to be on their game. Optimal liver function is also essential to digestion. The liver makes bile. Bile breaks down fats. The liver sends bile to the gallbladder for storage. The gallbladder concentrates the bile and secretes it into the small intestines when needed. Bile breaks down large fat molecules into smaller ones, allowing the small intestines to absorb the nutrient. Vitamin D is dissolved in fat molecules. Not only does the liver produce bile that aids vitamin D absorption, but the liver also converts the inactive form of vitamin D to the active form, 25-Hydroxyvitamin D. The kidneys then convert 25-Hydroxyvitamin D to the most potent form of vitamin D, 1.25 dihydroxyvitamin D. This form of vitamin D encourages calcium absorption in the intestines as well. Vitamin D is essential for bone health, optimal mood, and immune function. Vitamin D enables the building of calcium in the bone. A process called bone remodeling allows the body to have access to calcium when needed. During this process, osteoclasts break down the old bone, allowing it to re-absorb into the tissues of the body, while osteoblasts allow the bone to rebuild, taking calcium from the tissues. Without proper vitamin D, bone remodeling is not optimal, causing weak bones. In addition to vitamin D, vitamin K2 actives osteocalcin, which is produced by the osteoblast (bone building) activity. Osteocalcin is needed to bind calcium into the matrix of the bone. This is another reason why I have my clients bring in their vitamin D supplement that they are taking, to make sure it has all the co-factors needed to absorb the vitamin D in the supplement. Not all supplements are created equal. In addition to lacking ideal digestion, kidney or liver function, clients can actually be taking a vitamin D supplement that their body cannot absorb. This can cause problems. If the body can’t absorb the supplement, it will cause undue stress on the body in its efforts to eliminate it. If it cannot be eliminated, it will store the excess in an organ. That’s why it is very important to have a supplement tested on each individual to see if it is appropriate. It is not always necessary to take a vitamin D supplement to absorb what is necessary. You can acquire vitamin D through exposure to the sun. The ultraviolet rays in the sun activate a cholesterol-like substance in the skin, which, through a few metabolic processes, converts to vitamin D3. We know the liver and kidneys secrete an enzyme that converts vitamin D3 to an active version that our body can assimilate. Ideal exposure to the sun would be 15 to 20 minutes per day, 3 to 4 times per week, mostly on the face. Every person has bio-individual needs. A good rule of thumb is to stay out in the sun half the time it would take for the skin to burn. No sunscreen or sunblock should be worn, as this will prevent the vitamin D absorption. For individuals who are prone to burning, stay in the sun 5 minutes, then 10 minutes, then 15 minutes, continuing to work their way up until they can manage the sun without getting burnt. Between 10 a.m. and 2 p.m. is the best time to be exposed to the sun. Ultraviolet rays are the greatest between these times. Summer is the most ideal time to get maximum exposure to ultraviolet rays, although getting sun on your face during spring, fall, and winter can definitely help. The sun will not only help vitamin D absorption, but also will improve mood. Increased sunlight exposure activates a brain hormone called serotonin. Serotonin produces feelings of well-being. Vitamin D strengthens the immune system by providing nourishment to tissues and cells in the body, allowing optimal cellular function. Cells are like little cities. The DNA of a cell is the mayor of the city. It gives the cell instructions on how it is to function. Other functions of the cell include the garbage man, the lysosome. They remove waste from the cell. The cellular membrane is the wall of the city with guards. They let good guys (nutrients) in and prevent bad guys (toxins and pathogens) from coming in. Without a properly running city or cell, there is chaos and dysfunction, which ultimately leads to disease. Increasing vitamin D to proper levels involves more than just taking a random vitamin D supplement. Digestion must be corrected. Stressors must be removed from the liver and kidneys so they can detoxify. Proper nutrition must be taken to allow the liver and the kidneys to function optimally. Lastly, every effort needs to be made to get some type of sun exposure, as well as eating a whole food diet rich in vital nutrients.
<urn:uuid:0ca2f011-1caf-4c3c-9ddc-474613086a27>
CC-MAIN-2019-09
http://welloflifecenter.com/2016/04/the-scoop-on-vitamin-d/
s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247491141.23/warc/CC-MAIN-20190219183054-20190219205054-00215.warc.gz
en
0.932842
1,173
2.84375
3
Heartburn drugs, hip fracture risk linked A study suggests extended use of proton pump inhibitors may decrease calcium absorption and promote osteoporosis. By DR. DAVID LIPSCHITZ Published February 13, 2007 Last year a noted study warned about a possible side effect of Prilosec, which belongs to a class of drugs called proton pump inhibitors. Its competitors include Nexium, Prevacid and Aciphex. These drugs are powerful suppressors of acid production in the stomach and are highly effective in treating indigestion and abdominal pain stomach ulcers cause. They also effectively treat gastro-esophageal reflux, caused by reflux of stomach acid and food into the esophagus. Symptoms can include heartburn, indigestion, chronic cough and hoarseness caused by stomach content irritating the larynx and windpipe. The reflux can also cause heart attack-like chest pain, as the stomach acid causes the esophagus to go into spasm. Proton pump inhibitors also can heal stomach ulcers and inflammation of the esophagus. Unfortunately, the recent study published in the Journal of the American Medical Association showed that individuals over the age of 50 who took proton pump inhibitors for at least one year had a 44 percent increased risk of experiencing a hip fracture. For people who took these drugs for four years or longer, the risk of fractures was more than twice as high as for those who did not take the drug. This study examined the medical records of more than 135,000 Britons over age 50; 13,556 of them had suffered a hip fracture. The study's authors suggest that proton pump inhibitors may interfere with calcium absorption, leading to osteoporosis and hip fracture. The average age of the subjects in the study was 77, an age at which virtually everyone has some osteoporosis. If you are taking a proton pump inhibitor, do not panic. Every drug has side effects; some are much worse than others. But you must ask yourself: Is the benefit of the medication great enough to warrant the risk of the side effect? Next, what can you do to reduce that risk? There is no question that proton pump inhibitors are highly effective in treating esophageal reflux. Most patients require only a few months of therapy. Others, however, who suffer a relapse may need longer-term treatment. If you have occasional heartburn or indigestion, over-the-counter antacids such as Pepcid AC and Tums are effective. But if you are taking proton pump inhibitors, make sure that your calcium intake is adequate, either from dairy foods or a 500-mg calcium supplement containing vitamin D. Remember always to take calcium supplements with meals. Remember, too, that impact and weight-bearing exercises will also decrease fracture risk. Gerontologist David Lipschitz holds a medical degree and a Ph.D. and is the author of "Breaking the Rules of Aging." Write to him at firstname.lastname@example.org His Web site is www.drdavidhealth.com. [Last modified February 13, 2007, 06:30:59] [an error occurred while processing this directive]
<urn:uuid:83b0f1fd-3d58-49b7-965f-552cda083dbe>
CC-MAIN-2017-04
http://www.sptimes.com/2007/02/13/Floridian/Heartburn_drugs__hip_.shtml
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280504.74/warc/CC-MAIN-20170116095120-00413-ip-10-171-10-70.ec2.internal.warc.gz
en
0.952527
675
2.53125
3
Author: Dana Miller “Pirate” evokes images of legendary figures from the days of the great tall-masted sailing galleons, like Captain Henry Morgan, the famous 17th century “pirate of the Caribbean.” But piracy is still with us today, and modern pirates do not only steal from passing ships. They take from the common treasury of the ocean: the shared fisheries that states, fishers, and scientists spend many diplomatic hours working to apportion fairly and sustainably. I and my colleagues revealed that modern-day pirates in the form of illegal fishers are able to purchase insurance coverage for their blacklisted vessels. Our research appears this month in the September 2016 issue of Frontiers in Ecology and the Environment. Captain Morgan reportedly used one of the earliest systems of workers compensation insurance. If a pirate lost a limb during a raid, they were financially compensated for the loss. Now, nearly 400 years later, pirates can obtain insurance services from the same institutions that insure legal vessels. We identified the insurers of 67 vessels known for their involvement in illegal, unreported, or unregulated (IUU) fishing activity. Some of these vessels are well known and have been written about in high profile news articles. Without insurance, fishing companies may face enormous financial losses should an accident occur. Not only is insurance accessible to illegal fishers, it is also valued by these criminals enough to be purchased even for smaller vessels, when it isn’t legally required. If insurers change their policies to make it harder for illegal fishers to purchase insurance, we believe fewer of these fishers will find it profitable to participate in illegal fishing. At a minimum, insurers should consult officially verified illegal vessel lists to make certain listed vessels are not granted insurance. By transforming their current role from facilitating illegal fishing to deterring it, insurers can enable the use of marine insurance as an economic tool in the global fight against illegal fishing.
<urn:uuid:973f657d-ff15-4504-b57e-e4ceed2851c1>
CC-MAIN-2020-45
http://www.iuuwatch.eu/2016/09/stop-insuring-fishery-pirates/
s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107879537.28/warc/CC-MAIN-20201022111909-20201022141909-00178.warc.gz
en
0.955081
395
3.015625
3
• reify • ree-ê-fai • Hear it! Part of Speech: Verb, transitive Meaning: 1. To project or perceive an abstraction as an object or thing, as to reify the elements (wind, thunder, rain) as gods. 2. (Marxist Philosophy) To depersonalize, to perceive people as things or objects, as to reify workers as numbers on a spreadsheet. Notes: The process of reifying is called reification, and a reificatory (the adjective) process it is, too. Someone who reifies would be a reifier, whomever that word could refer to. Notice how the Y is replaced by I before suffixes beginning with E. In Play: When anything abstract becomes a real object in any sense of the word, it has become reified: "Farley always thought that Gwendolyn was pulchritude reified." Now that Marxism is pretty much dead, everyone is free to use today's word in its second sense: "In all his memos and everything he says, Palmquist reifies his office staff as robots under his complete control." Word History: The root of today's Good Word is Latin res "thing, affair", also the root of real and the re- in republic. The latter word comes from the Latin phrase res publica "affair(s) of the public". (Russian retains the S in its respublika "republic".) The ablative plural case of res is rebus "by means of things", now used in English to refer to a puzzle in which words are represented by pictures. This root does not show up in many other Indo-European languages. Sanskrit rah "possession" is probably related, but there is no evidence of it in Germanic languages like English. (When it comes to Good Words, Lew Jury's suggestions, like this one, are always the real thing.) Come visit our website at <http://www.alphadictionary.com> for more Good Words and other language resources!
<urn:uuid:cb210433-551f-4bc3-af9b-ffbb8d99dd53>
CC-MAIN-2016-26
http://www.alphadictionary.com/goodword/date/2013/02/02
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783403826.29/warc/CC-MAIN-20160624155003-00121-ip-10-164-35-72.ec2.internal.warc.gz
en
0.964046
426
2.640625
3
The Wiener Holocaust Library is pleased to announce the launch of a new educational workshop series aimed at teachers, educators and students of the Holocaust. Run by the Library’s experienced education team and guided by the British curriculum, the workshops will focus on a variety of topics to help participants deepen their understanding of the Holocaust through engagement with the Library’s unique and historic archive. The workshops will help participants to critically consider the topic and explore the variety of ways in which it can be approached in an educational setting. The first of these workshops, aimed at secondary school teachers and educators, will take place on Tuesday 16 March 2021 and consider the use of photographs in teaching about the Holocaust. The workshop will use a range of contemporary images taken before, during and after the Holocaust to explore how these historical sources can be used effectively in the classroom. We will also examine the ethics of using photographs of victims; the motivations of the photographers; the context within which photographs were produced, and issues around editing and format of images. We will help participants to reflect upon the ways in which photographs can be used to deepen school students’ understanding of the Holocaust without compromising the humanity of the victims. We are looking to continue this series so if you are interested in attending a rerun of this workshop or future workshops on other topics, please send an email to Roxzann Baker, [email protected], The Holocaust Explained Project Coordinator, registering your interest. Virtual Teacher Workshop: Using Photographs in Teaching about the Holocaust. Wednesday 16 June, 6-7.30pm.
<urn:uuid:2efb7dc3-de26-4349-8029-9632bf2e278f>
CC-MAIN-2022-40
https://wienerholocaustlibrary.org/2021/03/01/virtual-workshops-for-teachers-educators-and-students/
s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030337360.41/warc/CC-MAIN-20221002212623-20221003002623-00207.warc.gz
en
0.928837
321
3.421875
3
By Thomas A. Kruzel, N D Most everyone will experience an allergic reaction at some time in their life as hypersensitivity reactions are the body’s way of defending against foreign invaders while enhancing the immune system development. It is also the body’s way of letting us know that we need to identify and eliminate what ever it is that is causing the reaction. Allergic reactions become problematic when they are excessive such as with an anaphylactic reaction, or prolonged as can occur during allergy season. There are 4 general classifications of allergic reactions. A type I reaction involves IgE that binds to basophiles and mast cells resulting in histamine release, type II which are cytotoxic reactions due to antigen/antibody interactions, type III which are immune complex reactions, and type IV which are cell mediated reactions, delayed or tuberculin like hypersensitivity reactions due to sensitized T lymphocytes. While these classifications are used to describe the various hypersensitivity reactions seen by physicians, in actuality there may be more than one occurring at the same time and the interactions between them are not well understood. One of the most commonly encountered allergic reactions are the type I variety, a hypersensitivity reaction due to the release of histamine. Usually experienced as allergic rhinitis or hayfever, it is commonly seen during times of increased pollination by trees and flowering plants such as in the spring or grasses during the summer months and weed borne pollens in the fall. During the winter months they are associated with house dust, animal dander and reactions to heating fuels. The term “allergic toxemia” was used to describe the anxiety, fatigue, muscle and joint aches, drowsiness, poor concentration, and depression often seen with allergies. Symptoms tend to wax and wane depending upon the amount of exposure, ability of the immune system to neutralize the offending agent, stress, diet and nutritional status, state of the person’s emunctories (organs of elimination), and the used of over-the-counter medications to control symptoms. From the naturopathic perspective, environmental allergies are almost always preceded by food allergies and clinically, when they are addressed; the seasonal allergies disappear or become less severe and are less frequently encountered. It is felt that the development of food allergies taxes the person’s immune system to such an extent that it is unable to mount a significant defense to the environmental pollens encountered seasonally. Therefore, the person experiences “allergic toxemia” or allergic tension fatigue syndrome as it is also known. Eventually, the other types of allergic reactions may ensue resulting in autoimmune disease or more severe hypersensitivity reactions. Food allergies have been associated with a number of conditions such as anxiety, aphthous stomatitis, asthma, atopic dermatitis, attention deficit disorder, autoimmune diseases, chronic fatigue syndrome, depression, irritable bowel syndrome, migraine headache, interstitial cystitis, multiple sclerosis, otitis media, rheumatoid arthritis, sinusitis, and urethritis. While specific treatments and medications have been used for each of these conditions, a concomitant use of an elimination and reintroduction diet for elimination of food allergies have made these treatments more successful, and in many cases have allowed the person to no longer need medication. Children who are breast fed for the first year of life have fewer problems with allergies than those who do not. Additionally, those children who were fed cows milk were much more prone to developing allergies than the breast fed infants. In my experience those children who received raw milk fared better than those who consumed pasteurized milk. Children who are from families that have a past history of allergies are more likely to develop them as well as if they are exposed to second hand cigarette smoke. When we are exposed to potential allergens the body will begin to react letting us know that there is an offending agent present. Food allergy symptoms include, upset stomach, heartburn, acid reflux, belching, gas and bloating, chronic constipation or chronically loose stools, alternating constipation and diarrhea, nausea, low energy, runny nose, swollen tonsils and adenoids, Eustachian tube swelling and sinus congestion. Occasional skin eruptions and rashes may also be seen. If any of these are encountered it is a warning that something needs to be changed in the diet. As a child’s immune system is developing it is not unusual that they exhibit a few allergic signs such as a runny nose, mucus discharges, occasional low grade fevers, periodic diarrhea and coughs and sneezing. These are usually seen for brief periods of time and then go away as the immune system has completed its work and move on to the next “bad guy”. It is when the process becomes prolonged and they are unable to move past it that intervention is needed. This usually involves additional nutrients such as Vitamin C and B complex, identification and elimination of the offending agent. Homeopathic medicines have proven to be very useful in the treatment of allergic symptoms in a number of studies. Animal Hair or Dander – from cats, dogs, horses, birds, pigs, or any other exotic creature living in close proximity. Pollens – from trees blooming in the spring, grass in the summer and fall, ragweed or other indigenous plants in the summer and fall. Chemicals Irritants – such as bug sprays, deodorants, cleansers, weed killers. Cottonseed – commonly found in furniture and mattresses. Foods – there can be a large number of foods that can contribute to the formation of allergic symptoms. Some of the more common ones encountered are wheat, dairy, corn, citrus, peanuts, chocolate, eggs, tomatoes, spices, onions, garlic, berries (especially strawberries). Suggestions for Elimination - Air purifiers such as Oreck, or Alpine system. - Thoroughly clean the bedroom to eliminate any dust as a good portion of time is spent there, as work or other environments are more difficult to control. A frequent cleaning schedule may be needed until the room is adequately cleared. - Keep the doors and windows closed during the day so that airflow is minimized. An air filter in the room will help keep the air clean. - Be sure the bedding is hypoallergenic. If not, encase them in dust proof coverings such as plastic. Mattress pads are discouraged unless they are encased. Sheets and blankets should be laundered weekly. - Eliminate known allergens such as animals, perfumes, or sprays. This may mean having fluffy or fido live out of doors or banned from certain rooms in the house. - Perform an elimination and reintroduction diet for several weeks in order to discover what food or foods the child is allergic to. The Feingold Diet is excellent for this purpose or you can contact your naturopathic physician for one.
<urn:uuid:d279c66c-0783-4459-b1a2-1fff7f2a0ccf>
CC-MAIN-2018-05
http://www.rockwoodnaturalmedicine.com/naturopathic-medicine-articles/allergies/
s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084886860.29/warc/CC-MAIN-20180117082758-20180117102758-00698.warc.gz
en
0.952643
1,434
3.328125
3
Essay structure the introduction jennifer bennett sanderson high school raleigh, nc wake county public school system essay structure basics three parts: introduction. Essay help - essay structure - how to structure an essay - a guide to how to structure your essays. How is an essay structured in order for your essay to be convincing and make sense, it needs to be presented inside a well structured piece of writing. An essay is a piece of continuous • it ‘sets the scene’ by providing just a little background information about written basic essay structure assignments. Essay writing guidelines for the school of biological sciences an introduction is used to define the of the essay and to give such background scope. How to write a perfect college essay tips on how to address the essay prompts on the common application 2013 for admission to american universities background. A guide to writing the literary analysis essay provides essential background about the literary work, and prepares the reader for your major thesis. The introduction to an essay has three and describe the structure and organisation of the essay statement that establishes the subject matter and background. Cause, effect, and cause and effect organization and structure cause essay introduction 1 opening sentence 2 background information (3-4 sentences about effects. Although there is no set model of organization for argumentative essays next you need to provide background information what are the details to your problem. This resource covers how to write a rhetorical analysis essay of primarily visual texts with welcome to the purdue owl purdue give some pertinent background. Persuasive essay structure • background information – give context to your argument/subject familiarize the reader with the content. 1 how to write a continuity and change over time (ccot) essay background: the rubric like the dbq and comparative essays, the ccot is scored according to a rubric. Structure of the introduction although essays vary in length and the general statements will introduce the topic of the essay and give background information. Outline for a five-paragraph essay background information: enough information necessary for your reader to understand your topic thesis statement. Essay structure essay structure few paragraphs at the end of the essay [a hook like this would be appropriate for a narrative essay] background information. My background essays: over 180,000 my background essays as it is said in the dictionary of social sciences a social structure is the most basic. Created 7/07 structure of a general expository essay the following maps a commonly used structure for many academic essays use this outline to guide you. Essay structure: providing background information when you are writing an essay, providing background information is very important for a number of reasons. Your structure needs to be flexible enough to meet the requirements of your purpose and audience welcome to the purdue owl purdue owl and convincing essay. 1 outline structure for literary analysis essay i catchy title ii paragraph 1: introduction (use hatmat) a hook b author c title d main characters. Essay structure in writing, following the correct essay structure is an important step in constructing a well- argumentative essay should include: background. Essay about my family background though hypervisors have security issues, ieee, computational intelligence essay draft structure and situ. 1/09 clrc writing center structure of a personal narrative essay “narrative” is a term more commonly known as “story” narratives written for college or personal. How to write a good history essay relatively unimportant background issues can be summarised with a the paragraph structure recommended above is just a. Essay structure background since 1989 our certified professional essay writers have assisted tens of thousands of clients to land great jobs and advance their. Acceptedcom helps college and graduate school applicants present themselves at their best our seasoned, professional consultants and editors will mentor you through. Structure and organization are integral components of an effective persuasive essay no matter how intelligent the ideas, a paper lacking a strong introduction, well. Essay structure essay maps ask you to predict where your reader will expect background information overview of the academic essay essay structure. For the background essay and other writing in this class, your audience is not the general public instead think of your audience as fellow researchers, for. 5 paragraph essay structure template in fact, it becomes difficult for them to even paragraph a deep essay calmly background of a topic may also help.
<urn:uuid:aac36b00-ec11-4087-bbf3-755c386ca74e>
CC-MAIN-2018-09
http://bwtermpaperetog.refleksija.me/essay-structure-background.html
s3://commoncrawl/crawl-data/CC-MAIN-2018-09/segments/1518891812959.48/warc/CC-MAIN-20180220125836-20180220145836-00383.warc.gz
en
0.891869
870
3.15625
3
Public relations (PR), refers to the way individuals and organizations communicate to the outside world through the media. In a nutshell, it deals with management of information between the between an individual, an organization and the general public. Public relations are maintained by specialists who address the media either directly or indirectly to maintain a positive image and initiate a good relationship with the audience. Examples of forums for public relations include newsletters, press releases, public appearances, conferences, and conventions. In the business it the work of a PR specialist to create and maintain a good image with customers, by communicating on behalf of the business and presenting their products and services to the general public. A positive image in the eyes of the public helps create a strong relationship with the customers that increases the sales. Utilization of the internet as a source of a good P.R is an upcoming trend by specialists who are widely using social media networks and blogs to create a good public image for their organizations. Although those students who need online public realtions assignment help service, contact us. The advantage with this is that it incorporates the use of graphics giving the public relations experts the opportunity to spread better light on their organizations. A public relations specialist is someone with vast knowledge in journalism with good writing and verbal communication skills. Public relations revolve around the below disciplines: Public relations assignment help service are given by lecturers to test on the understanding of the student outside the classroom and also the ability to conduct research on the relevant material. However, there is no need for the student to overwork himself with work overload. Sample Assignment offers online public relations assignment help service to help students tackle their public relations assignments. We have a team of expert online writers who provide public relations assignment help with a wide spectrum of experience in the field of public relations owing to years of work in the same. This team is dedicated to working round the clock to solve your assignments in the required time. We also offer assignment editing services to ensure that the work presented is free from any error that may have been made during typing of the assignment. Our no-plagiarism policy ensures that your assignment has been properly researched and is written in the original language. This is to maintain originality and integrity, in addition, we also ensure that all assignments are presented within the required time to. Our payment procedures are easy and affordable. We offer all type of assignment help to students who need it. I was ill and though I tried, I could not finish my report on time. I panicked and called sampleassignment.com. They asked for some more details and within a day and a half the assignment was ready.Uzi - Australia Sometimes it is late in the night when I realise that I need assignment help, but they are online 24 x 7. So I’m glad I can get things get sorted out at all hours, a big relief.Edna - South Africa That time I forgot that my assignment was due. When I remembered, I had only 18 hrs. I am so thankful to sampleassignment.com and their experts - they solved the whole assignment and I had the solution in my inbox in 12 hours !Mike - UK We will be happy to help. Copyright © 2019 All rights reserved.
<urn:uuid:666923a6-0ffd-4202-9000-cb2ff0a051f5>
CC-MAIN-2019-47
https://www.sampleassignment.com/public-relations-assignment-help.html
s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496668954.85/warc/CC-MAIN-20191117115233-20191117143233-00468.warc.gz
en
0.964944
658
2.515625
3
Parenting During the COVID-19 Pandemic: What You Need to Know BY HANNAH ROPP No school, no play dates and no after-school activities. Children across the world have had their lives turned upside down because of the coronavirus (COVID-19) outbreak and it’s left parents grappling for a way to explain what’s going on and to help their children cope with all of the changes in their life. How do I know if my child has COVID-19? At this point, information that we have suggests that pediatric patients may develop milder symptoms than adults. Be on the lookout for fever, cough or shortness of breath. If you are concerned about any of these symptoms, reach out to your child’s pediatrician. We are working on ways to safely evaluate children in person and over the phone while minimizing potential exposures. Symptoms take anywhere between 2-14 days to develop after initial exposure. Should my child stick to a schedule while they are off from school? Maintaining a schedule for your children while they are out of school is important. Stay in touch with your school and discuss any roadblocks your children may have in completing assigned work. I would recommend trying to follow your typical bedtime and wake-up routines on schooldays. Allow some daily flexibility; though try to plan a schedule to allow time for learning, play/free time, healthy meals and physical activity. Use technology for schoolwork and for communicating with family and friends. Should my kids be doing any type of play date? At this time, avoiding play dates or group interaction is the safest way to reduce the spread of COVID-19. However, social communication is important to children of all ages. Try to incorporate telephone or video calls with your children’s friends into your daily routine. Sending hand-written letters or artwork to family members and friends is another great way to interact and provides for another fun, yet safe, at-home activity. Can my kids still play outside? It is important to maintain your physical health and wellness during this pandemic. Playing outside or going for a walk with appropriate social distancing is a great way to get some exercise and fresh air. Be sure to avoid playground equipment if you go to an area with a park What can I do to help my child cope with the anxiety and change in their schedule? This can be a stressful time for parents and children alike. Here are some tips for helping to reduce anxiety and fear: Stay up to date on the facts about COVID-19 by visiting the Centers for Disease Control and Prevention (CDC) website. Help and encourage your children to avoid media exposure, which can cause panic and fear. Have open discussions with your children about COVID-19 and encourage them to share their thoughts and feelings. Every child will demonstrate different understanding and exhibit different emotions. Signs you should look out for include, a change in sleeping or eating habits, avoiding activities that were previously enjoyable, unexplained aches or pains, difficulty with attention or concentration, regression of behavior (toileting accidents, for example), excessive worry or sadness. These signs should be reported and reviewed with your child’s pediatrician. Continue to focus on your children’s emotional and physical wellbeing – eat healthy meals, get some physical activity and enjoy relaxing activities like guided breathing or yoga. Stay informed about coronavirus (COVID-19) in our community by visiting LVHN.org/COVID19.
<urn:uuid:93a5aeca-892c-491c-aaee-328c3622c24a>
CC-MAIN-2021-04
https://news.lvhn.org/parenting-during-the-covid-19-pandemic-what-you-need-to-know/
s3://commoncrawl/crawl-data/CC-MAIN-2021-04/segments/1610703547333.68/warc/CC-MAIN-20210124044618-20210124074618-00206.warc.gz
en
0.953355
730
2.796875
3
The way we write and speak has changed a lot over the past 400 years since Shakespeare wrote his plays, so don’t be put off if you find Shakespeare’s words difficult. The language in The Merchant of Venice is often focused on money. The words ‘wealth’, ‘money’, ‘gold’ and ‘fortune’ feature repeatedly throughout. Similarly, words connected with love are also at the fore, with ‘heart’, ‘desire’ and ‘love’ being prominent. Shakespeare used the following aspects of language in The Merchant of Venice:
<urn:uuid:d0772ea4-0cf9-4020-bb18-924291f4382f>
CC-MAIN-2019-39
https://www.bbc.co.uk/bitesize/guides/z84mn39/revision/1
s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514572517.50/warc/CC-MAIN-20190916100041-20190916122041-00314.warc.gz
en
0.955874
131
3.84375
4
No matter how small the changes you make are, you are positively impacting the environment. The next few paragraphs will give you incorporate green energy sources that might work for you.Clean your furnace filters regularly and replace them at least one time a year. It is also a good idea to install filters on warm-air registers. This not only helps keep debris (and kids’ toys) from entering heating ducts, which reduces efficiency.Solar water heaters use the sun’s energy to heat to warm water rather than using natural gas or electricity for heat.You may get tax deductions for using energy efficient upgrades.If possible, use cold water in your clothes washer. Almost ninety percent of the energy used by a washing machine comes from heating the water for a warm or hot cycle. Good detergents wash clothes even in cold water. Don’t forget to only wash clothes when you have a full load s you are as efficient with your energy as possible!Use windows for when you are not home. This cools your house at a cooler temperature and lower the amount of energy used. Try adding window coverings that block heat, roller shades, and dark curtains.If you use heating fuel, ask a professional if you can convert your system to bio-diesel fuel system. Depending on your system, you may be able to switch to biodiesel without having to make any modifications to your system. Biodiesel is a better fuel because it has a cleaner burn and is more efficient.Turn you appliances off when you’re not in use. When you leave a room, like the lights, a television or your home theater. A power strip should be used for electronics and can be easily turned off when not needed, so consider placing one in a conspicuous place where many electronics are located.A good way to conserve energy is to not use your dishwasher unless it is completely full. The machine should not be used when only a few dishes need to be washed. You might be surprised by how much you can actually fit in the dishwasher. Place the dishes in your dishwasher so you can fit in as many dishes as possible.Solar power can heat water for a lesser cost. Consider a hot-water system that runs off of solar energy. You can select from direct circulation system or an indirect varieties. Indirect is the best if you have cold winters and worry about pipes which often freeze in the winter.When you consider solar heat for your home calculate potential hours of sunshine for energy generation during the winter months. This will guarantee that you will have energy no matter what the weather brings, and it will result in a surplus during the summer. If you’re using a net-usage plan, in the summer you’ll get cash back from your utility provider.Take time to properly maintain your refrigerator. Since refrigerators tend to eat up a great amount of power, it’s key to maintain it in working order. Make certain to clean out any dust that surrounds heating coils periodically. Make sure the door seals are clean and tight.If you are one of the many people who desire to live a greener life when it comes to saving our planet’s energy, there is much you can do. You can do things like clean your furnace or change the settings to 60 degrees when you aren’t at home. Reduce your water heat temperature to one hundred twenty degrees to save money as well. Each step you take, no matter how small, will count!Avoid turning the heat up in your home unless it’s absolutely necessary. If you’re chilly, simply put on a sweatshirt, like a sweatshirt and sweatpants. When you keep the heat is running it uses more energy than you need to–and that is expensive!Make sure you remind yourself to be on top of being energy efficient and check into your energy bills on a monthly and annual basis to see what the difference is. Be more conscious of energy usage so you can reduce it. For instance, if your stated goal is to reduce your consumption of electricity and water, you are more apt to remember to turn off the lights and shut off the faucet when not using them.A solar oven can be an energy efficient way of baking. You can make one out of a box, boxes, and pieces of aluminum foil. These ovens can be quickly assembled, while using no outside energy besides solar. Instead of using standard lights for your next holiday season, make sure to use LED lights to decorate your tree and home. A study conducted by the United States The U.S. Department of Energy says we could save over 2 billion kilowatt hours of power if everyone made this change. This is enough energy to power 20,000 houses in one year. You can save money on your electric bill.If you are a parent, there’s no reason not to carpool to them. You can also schedule grocery shopping and other errands with your neighbors.Replacing your boiler unit is an excellent way to save energy. A lot of the older boilers weren’t made to conserve energy, yet newer ones were made to keep this in mind. They can reduce your energy bill and they don’t produce as much carbon dioxide. Swap your old appliances for newer ones that have an Energy Star rating. The Energy Star rated appliance is guaranteed to use appreciably less energy than the older non-rated appliance. The amount of energy saved varies by appliances; you can save a lot of energy on your washing machine, refrigerator and dishwasher use if you switch to Energy Star appliances.Replace your old major appliances with new Energy Star rating. Energy Star ratings mean that your new appliances are technologically built to use less energy than those made previously. For refrigerators and freezers, the rating guarantees 20 percent less energy used, for dishwashers 40% less energy used, and at least 50 percent when it comes to washing machines.A microwave is a more energy efficient appliance than a stove, so consider using it more often. The stove uses a good bit of energy. So, by microwaving instead, you save a lot of energy.Green technology appliances can cost a bit more up front, but your utility bills will be reduced. It also pays off for the environment.An often-repeated, yet useful tip for anyone who wants to start saving energy today, is to flip off the light when they leave the room. Get yourself into the habif of always turning lights off and you can save a lot of energy. An additional benefit is the money you save on your monthly power bill.Replace your windows with weather-sealed efficient ones. These windows reduce energy costs, such as reduced spending on energy bills, a quieter home, and less condensation on the interior of your windows.Consider bamboo items when making a wood purchase. Bamboo is technically grass and is a “green product”, but it is often much stronger than other available woods. It replenishes itself rapidly, unlike most woods, and can be used for flooring, furniture and nearly any other wood product. This saves on recycling energy and the production of manufacturing products.Use motion detection sensors for lighting in the most popular rooms of your rooms. These lights only go off when someone is the room, which saves both energy and money. Remember to also have these lights outside above your garage and on your porch, as well!Use automatic motion detection sensors for lighting in your rooms. This turns the lights off in rooms that have nobody in them, which saves a lot of energy (and money). Use these sensors on outdoor garage lighting, as well.Going green can be very simple. As you have just read, you can make your life greener by using a variety of different methods. Use the tips in this article as soon as possible. Although the effort isn’t considerable, going green does have some tremendously great effects.You can reduce the amount of time your refrigerator or freezers runs by locating it in a cool place. If you put your appliances in direct sunlight or on top of a heating vent, the internal temperature can be raised, requiring more electricity to keep your food cool.
<urn:uuid:3da75de7-fa82-4df4-9308-f70eb6778de0>
CC-MAIN-2021-10
https://whatcausesglobalwarming.net/green-energy-information-everybody-needs-to-know/
s3://commoncrawl/crawl-data/CC-MAIN-2021-10/segments/1614178359497.20/warc/CC-MAIN-20210227204637-20210227234637-00170.warc.gz
en
0.941246
1,666
2.90625
3
A post-pandemic, greener, recovery As governments look to reboot their economies amid the pandemic, many are seizing the chance to integrate climate change into these efforts, offering potentially attractive opportunities for investors. - Europe’s Green Deal aims to cut greenhouse gas emissions by 50-55% by 2030, versus 1990 levels, while promoting economic growth - Europe has reduced emissions by roughly a quarter since 1990 - Many view the pandemic as an opportunity to help their transition to a low-carbon economy - The switch to a low-carbon world will create investment opportunities. Having suffered the initial health and economic shock of the coronavirus outbreak, governments are turning to encouraging recovery. Within this, some want to stimulate new growth and deliver on nationally determined climate commitments. Europe’s Green Deal The European Commission (EC) published its European Green Deal in December, laying out the blueprint for the bloc to achieve carbon neutrality by 2050. Its overarching ambition is for Europe to become the first climate-neutral, industrialised continent in less than thirty years. It aims to do so by reviewing each existing European law on its climate merits. The deal calls on the EU bloc to restore biodiversity, cut pollution levels and boost the efficient use of resources by moving to a clean, circular economy. Overall, it has targeted to cut greenhouse gas emissions by 50-55% by 2030 compared with 1990 levels. Europe has reduced emissions by roughly a quarter since 1990, according to the European Environment Agency. Despite this achievement, the results are not enough to put the EU on track to its net zero target by mid-century. The Green Deal was set out to bridge this gap, encouraging more fundamental review of economic activity and disruptive innovation to accelerate decarbonisation. Transitioning to a low-carbon world While the pause of most economic activity seen in many countries during the pandemic gave a glimpse of a less-polluted world, the need for employment and economic activity meant emissions would always rebound. However, rather than simply focus on general economic stimulus, many European governments and the EC seek to use the crisis as an opportunity to enable their transition to a low-carbon economy. For example, in the clean-energy sector, the German government has approved its 2030 National Energy and Climate Plan (NECP) and adopted a new National Hydrogen Strategy – both critical in shaping the EU green recovery. The NECP targets 65% renewable electricity and 30% renewable energy by 2030, while the Hydrogen Strategy aims to make Germany the “global number one” for renewable hydrogen applications and production. To this end the Hydrogen Strategy provides €7bn to ramp up domestic production and related value chains. More widely, the French president, Emmanuel Macron, and German chancellor, Angela Merkel, proposed an EU budget increase of €500bn to fund the Green Deal. This includes proposals to establish a recovery roadmap for each industrial sector and to increase the EU’s 2030 reductions target for greenhouse gas emissions. Thereafter, the EC launched a €750bn Next Generation EU fund on 27 May, aimed at helping Europe’s recovery from the COVID-19 crisis. Delving into the Green Deal and associate stimulus packages highlights potential climate risks from policy changes or attractive investment sectors that enable decarbonisation goals. Among the major initiatives in promoting clean-energy technologies, the EC plans to: - Renovate buildings and infrastructure to increase energy efficiency and build out a more circular economy - Roll-out more renewable energy projects, especially wind, solar and clean hydrogen energy - Promote cleaner transport and logistics, including the installation of one million charging points for electric vehicles and a boost for rail travel and clean mobility - Strengthening the Just Transition Fund to support re-skilling of displaced workers and helping businesses create new economic opportunities. Understandably, with the pandemic’s economic and societal effects, the Green Deal activity may not meet the same timeline as initially planned. However, the continued efforts show political willingness not to forgo the climate agenda in the midst of economic recession. Despite some of the headwinds to Europe’s Green Deal and arguments it could do more, the approach of the EC and European countries appears to show the benefits of placing its green agenda at the heart of a region’s stimulus. Not only does it provide support for recovery in response to the pandemic; it also shifts economic output to lower carbon intensity in response to the climate breakdown. Clearly a win-win for these countries. And for investors who can position their portfolios effectively, it is an opportunity for the same. Investments can fall as well as rise in value. Your capital or the income generated from your investment may be at risk. - Has been prepared by Barclays Private Bank and is provided for information purposes only - Is not research nor a product of the Barclays Research department. Any views expressed in this communication may differ from those of the Barclays Research department - All opinions and estimates are given as of the date of this communication and are subject to change. Barclays Private Bank is not obliged to inform recipients of this communication of any change to such opinions or estimates - Is general in nature and does not take into account any specific investment objectives, financial situation or particular needs of any particular person - Does not constitute an offer, an invitation or a recommendation to enter into any product or service and does not constitute investment advice, solicitation to buy or sell securities and/or a personal recommendation. Any entry into any product or service requires Barclays’ subsequent formal agreement which will be subject to internal approvals and execution of binding documents - Is confidential and is for the benefit of the recipient. No part of it may be reproduced, distributed or transmitted without the prior written permission of Barclays Private Bank - Has not been reviewed or approved by any regulatory authority. Any past or simulated past performance including back-testing, modelling or scenario analysis, or future projections contained in this communication is no indication as to future performance. No representation is made as to the accuracy of the assumptions made in this communication, or completeness of, any modelling, scenario analysis or back-testing. The value of any investment may also fluctuate as a result of market changes. Barclays is a full service bank. In the normal course of offering products and services, Barclays may act in several capacities and simultaneously, giving rise to potential conflicts of interest which may impact the performance of the products. Where information in this communication has been obtained from third party sources, we believe those sources to be reliable but we do not guarantee the information’s accuracy and you should note that it may be incomplete or condensed. Neither Barclays nor any of its directors, officers, employees, representatives or agents, accepts any liability whatsoever for any direct, indirect or consequential losses (in contract, tort or otherwise) arising from the use of this communication or its contents or reliance on the information contained herein, except to the extent this would be prohibited by law or regulation. Law or regulation in certain countries may restrict the manner of distribution of this communication and the availability of the products and services, and persons who come into possession of this publication are required to inform themselves of and observe such restrictions. You have sole responsibility for the management of your tax and legal affairs including making any applicable filings and payments and complying with any applicable laws and regulations. We have not and will not provide you with tax or legal advice and recommend that you obtain independent tax and legal advice tailored to your individual circumstances. THIS COMMUNICATION IS PROVIDED FOR INFORMATION PURPOSES ONLY AND IS SUBJECT TO CHANGE. IT IS INDICATIVE ONLY AND IS NOT BINDING.
<urn:uuid:52d6e522-2aea-4ff1-bca0-95794cbc96bb>
CC-MAIN-2022-49
https://international.barclays.com/news-and-insights/2020/july/post-pandemic-greener-recovery/
s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446711126.30/warc/CC-MAIN-20221207021130-20221207051130-00465.warc.gz
en
0.933382
1,592
2.703125
3
Afraid to fearless soldiers heart by gary paulson charley goddard, the main character in the book soldiers heart by gary paulson, changed drastically. A summary of “the charge of the light brigade” in alfred perfect for acing essays into the “valley of death” the 600 soldiers were assaulted by the. An analysis of hemingway's style in soldier may 20, 2018, from life and death and. Writing a rhetorical analysis essay: tone, figurative in a carefully constructed essay identify the author intended effect on the “death of a soldier. Coping with death war english he simply shows the reader a soldier's death if you are the original writer of this essay and no longer wish to have. 'the soldier' by rupert brooke written during the early days of world war i, rupert brooke's 'the soldier', also known as 'nineteen-fourteen: the soldier,' is an expression of patriotism and loss felt by many as a result of the great war. The death of a soldier dirt wallace stevens analogy between death and season of autumn stanza 1 analysis 4,486 total deaths of us soldiers in. Free war poem papers, essays, and research papers. How to write a literary analysis essay the purpose of a literary analysis essay is to carefully examine and sometimes evaluate a work of literature or an aspect of a work of literature. Get free homework help on tim o'brien's the things they carried: book summary, chapter summary and analysis, quotes, essays with lavender's death. It is heavily influenced by the themes of honor and death lord byron spends most of the poem discussing the achievements of a valiant soldier and analysis essay. Rhetorical strategies in the excerpt, death of a soldier in the book sign up to view the complete essay show me the full essay show me the full essay. It described the death, in mosul, iraq, of a young soldier consider that there are 19 year old soldiers from the midwest who have in the last analysis. The things they carried summary and analysis of the a part native-american soldier in the company becomes obsessed by the death of literature essays. 2 the introduction the introduction to your literary analysis essay should try to capture your reader‟s interest to bring immediate focus to your subject, you may want to use a quotation, a. James longenbach here indeed is an early manifestation of stevens the reductionist as a poem about death, these lines [from the death of a soldier] call for no pity they call for no metaphor and little meaning. Read this essay on the death of a soldier in this analysis paper the argument that the united states has an obligation to send our military to help the child. Some tips on titling your critical analysis essay in the discipline of english life and death reality the significance of structure and imagery in “anatomy”. Essays: rhetorical analysis of death of a soldier by louisa may alcott the excerpt death of a soldier, taken from hospital sketches by louisa may alcott fe. Life contracts and death is expected, / as in a season of autumn / the soldier falls / he does not become a three-days’ personage, / imposing his separation, / calling for pomp. The excerpt death of a soldier, taken from hospital sketches by louisa may alcott features various rhetorical strategies to create an appeal to emotion. A short analysis of rupert brooke’s ‘the soldier shortly before brooke’s death then, is ‘the soldier’, with a little analysis of its meaning and. Technical analysis of the soldier literary devices and the technique of rupert brooke.Download
<urn:uuid:c00fb661-3ac0-4039-a343-992e58d9e4cc>
CC-MAIN-2018-34
http://izpaperokmk.getfiredband.us/analysis-essay-death-of-a-soldier.html
s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221215077.71/warc/CC-MAIN-20180819110157-20180819130157-00425.warc.gz
en
0.937397
768
2.625
3
Magnetite is a natural iron oxide magnet, Our black iron powder products have 98% or more Fe3O4 Magnetite 99% Fe3O4 (Black Iron Oxide) It occurs in crystals of the cubic system, in masses, and as a loose sand It is one of the important ores of iron (magnetic iron ore) and is a common constituent of igneous and metamorphic rocks Volume 4 Issue 1 1000133 J Powder Metall Min ISS: 2168806 JPMM, an open access ournal Beneficiation of Micaceous Iron Oxide from Veldurthi Area, Kurnool, AP, India. The Use of Iron Oxide Nanoparticles for Pancreatic Cancer Therapy. Review Article. Volume 1 Issue 1 2014. Maryam Malekigorji, Anthony DM Curtis . and Clare Hoskins* Institute of Science and Technology in Medicine, Keele . University, UK *Corresponding author: Clare Hoskins, Institute of Science and Technology in Medicine, Keele University, Iron Oxide Pigments 2013 USGS Mineral Resources Program. In 2013, natural crude iron oxide pigment (IoP) production in the United is separated from the spent pickle liquor when it is treated to ferrites fertilizers and magnetic ink and toner. continued production of micaceous iron oxide (mIo) from. Micaceous iron oxide production by appliion of magnetic . as for the other iron ore types, gravity concentration, magnetic separation, and flotation processes are promising methods for the beneficiation of micaceous iron oxide. micaceous iron oxide processing plants sale theccg. crushing plant for micaceous iron oxide,. mills for crush The new technology for the preparation of superfine ferric oxide from pyrite cinder is studied.The FeSO_4 is first prepared by H_2SO_4 leaching method,the leaching rate of Fe is 97%.Then the rod particlesuperfine ferric oxide with (120 nm) length and 30 nm a micaceous iron oxide, is sought for its anticorrosive iron oxides include dense medium separation and cement manufacture. Magnetite is used in dense medium separation due to its high specific gravity and magnetic properties which allow the magnetite to be recovered and reused. Magnetite (see separate chapter) magnetic iron oxide ==>, magnetic iron oxide epoxy ester antirust paint ==> .. Magnetic iron oxide and their hybrid nanoparticles have been used for magnetic separation in chemical and biological fields. Micaceous Iron Oxide Recycling Hammer Crusher. Wet drum magnetic separationmanufacturer quality magnetic separator machine magnetic separation china cs magnet pipe line magnet manufacturer and supplier in india china lifting magnet manufacturer magnetic hopper magnet manufacturer belt magnetic china ndfeb magnets permanent magnets magnetic experts in magnetics magnet separators grid Iron oxides are chemical compounds composed of iron and oxygen. There are sixteen known iron oxides and oxyhydroxides, the best known of which is rust, a form of iron(III) oxide. Iron oxides and oxyhydroxides are widespread in nature and play an important role in many geological and biological processes. They are used as iron ores, pigments Beneficiation of Micaceous Iron Oxide from Veldurthi Area, Kurnool, AP, India Research (PDF Available) · October 2015 with 130 Reads How we measure ''reads'' Hematite is the oldest known of the iron oxides and is widespread in rocks and soils It is also known as ferric oxide, iron sesquioxide, red ochre, specularite, specular iron ore, kidney ore, or martite Read More Magnetic separation Magnetic separation is a process in which magnetically susceptible material is extracted from a mixture Due to the mineral components and the chemical compositions of KTPC, it may be feasible to recover iron from KTPC by magnetic concentration or by preparing monodispersed micaceous iron oxide pigment [25e27], and the magnetic separation tailings can be magnetic separation of micaceous iron oxide. separation equipment for micaceous iron oxide. separation equipment for micaceous iron oxide As a leading global manufacturer of crushing, grinding and mining equipments, we offer advanced, reasonable solutions for any sizereduction requirements including quarry, aggregate, and different kinds of minerals [Chat Online] Magnetite is a natural iron oxide magnet, Our black iron powder products have 98% or more Fe3O4.Magnetite 99% Fe3O4 (Black Iron Oxide). It occurs in crystals of the cubic system, in masses, and as a loose sand. It is one of the important ores of iron (magnetic iron ore) and is a common constituent of igneous and metamorphic rocks.Black iron powder is also used as a colorant for a wide Iron reacts with oxygen in the air to form various oxide and hydroxide compounds the most common are iron(II,III) oxide (Fe 3 O 4), and iron(III) oxide (Fe 2 O 3). Iron(II) oxide also exists, though it is unstable at room temperature. Get Price Extraction Of Iron From Its Oxides YouTube Micaceous iron oxide is a micalike structure αFe2O3. As antirot material, micaceous iron oxide, holding the performance of good thermal and chemical stability, high covering capacity and strong ultraviolet absorption, is widely used in based pearlescent pigments. This paper introduces the preliminary test method of how to prepare pearlescent pigments from covering titanium dioxide over LAMOX is the only manufacturer of Processed Micaceous Iron Oxide in India. We have been manufacturing MIO since 1999, at our factory in Taloja, which is loed on the outskirts of Mumbai City. Ground Micaceous Iron Oxide from the best mines in the country is processed to remove impurities and then by drying, magnetic separation and sieving is refined to produce a grey material with a metallic The overall output of the multistage magnetic separation test is consistent with the findings of Jordens et al., 2016b, Jordens et al., 2016c, where iron oxide particles were concentrated into low magnetic intensity concentrate, whilst REE minerals reported with both higherintensity magnetic concentrate and nonmagnetic Iron oxide is an important inorganic nonmetallic material, which is widely used in pigments [1,2], alyzer [3,4], biomedical engineering and other fields . Micaceous iron oxide (MIO), a type of hematite (Fe 2 O 3), has attracted much attention due to its good durability, excellent chemical stability and low cost [,, ]. A naturally occurring lamellar form of ferrous oxide for use in manufacturing paint coatings. When viewed under an optical microscope by transmitted light, magnifiion X 200, the thin flake micaceous iron oxide particles appear as sharply defined red translucent platelets. Introduction. In the recent past the problem of removing the deleterious iron particles from a process stream had a few alternatives. Magnetic separation was Read More. Magnetic Separators. Magnetic Separation Equipment Bunting Magnetics. With everything from basic cartridges, grates, and plate magnets to magnet housings, self Hematite, also spelled as haematite, is a common iron oxide with a formula called Fe 2 O 3 and has been widespread in rocks and soils. Hematite forms in the shape of crystals through the rhombohedral lattice system, and it has the same crystal structure as ilmenite and corundum.Hematite and ilmenite form a complete solid solution at temperatures above 950 °C (1,740 °F). Micaceous Iron Oxide (MIO) for Paints. Micaceous Iron Oxide (MIO) is iron oxide in a form that resembles mica, a highly structured, layered mineral. Minerals with this highly layered structure are termed lamellar. Copyright © 2019.GXmachine All rights reserved.Sitemap
<urn:uuid:68b7d846-cf6e-4e7d-95a0-a0eaae41e43f>
CC-MAIN-2021-17
https://www.webwetenschap.nl/Dec/12_magnetic-separation-of-micaceous-iron-oxide.html
s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618039398307.76/warc/CC-MAIN-20210420122023-20210420152023-00498.warc.gz
en
0.901448
1,658
2.6875
3
Existing procedures to generate these, however, lead to results occurring more by chance in view of the number of photon pairs in one pulse. The consequences are errors in the quantum algorithms that greatly restrict their usefulness for deterministic quantum technologies that depend on the predictive accuracy. Optical stimulation of a semi-conductor quantum point with a short laser pulse (green), that emits single interlocked quantum pairs (red resp. blue). Image: University of Stuttgart In an experiment based on a semi-conductor quantum point, physicists from the University of Stuttgart have now shown how it is possible to generate single indistinguishable photon pairs based on parametric down conversion at the push of a button, so to speak. The work was published in the renowned specialist journal Nature Photonics*. Semi-conductor quantum points are ideally suited to generate interlocked photon pairs due to their properties. In this way the quantum point can be stimulated through a short optical or electrical pulse, and subsequently a so-called photon pair based on parametric down conversion can be released if the conditions are suitable and be used for applications. In the case of such photon pairs, the polarisation of each single photon is initially completely undefined. Only the targeted measurement on one of the two photons also enables a direct statement on the polarisation of the second photon, but this occurs immediately. In so doing it is irrelevant to what extent the single photons are separated from each other spatially. This property is exploited in a targeted way in the quantum technologies, for example for bug-proof communication. In work up to now to generate interlocked photon pairs, the quantum points were optically stimulated electrically or in a non-resonant way. This method of stimulating, however, entails some disadvantages. In this respect, exactly two electron pair of holes are not stimulated for each stimulation pulse and subsequently two photons (an interlocked photon pair) emitted. It is rather the case that only one single proton or more than two photons are released. The fact that these stimulation conditions also generate many charge carriers in the environment of the quantum point is even more problematic. The interaction between these charge carriers and the charge carriers in the quantum point leads to so-called decoherence processes, that ultimately limit the indistinguishability of the photons. Physicists at the Institute of Semiconductor Optics and Functional Interfaces under the management of Prof. Dr. Peter Michler have now succeeded of stimulating the quantum point with exactly two electron pair of holes with a so-called resonant two-photon stimulation process. Consequently, only one interlocked photon pair is emitted through this. Moreover, it was able to be shown that the photons generated in this resonant way are undistinguishable to a great extent, making them well suited for the aforementioned applications. The more exact photon pair generation rate of 86 percent achieved in this way was able to be determined in cooperation with the theoretic physicist Dr. Martin Glässl from the University of Bayreuth. This joint work is now the starting point for a range of further experiments in which the photon source is to be used for experiments on the quantum teleportation of photons, for example. * Original publication: M. Müller, S. Bounouar, K. D. Jöns, M. Glässl, and P. Michler, Nature Photonics, DOI 10.1038/nphoton.2013.377Further information: Email: p.michler (at) ihfg.uni-stuttgart.de Andrea Mayer-Grenu | idw Astronomers find unexpected, dust-obscured star formation in distant galaxy 24.03.2017 | University of Massachusetts at Amherst Gravitational wave kicks monster black hole out of galactic core 24.03.2017 | NASA/Goddard Space Flight Center Astronomers from Bonn and Tautenburg in Thuringia (Germany) used the 100-m radio telescope at Effelsberg to observe several galaxy clusters. At the edges of these large accumulations of dark matter, stellar systems (galaxies), hot gas, and charged particles, they found magnetic fields that are exceptionally ordered over distances of many million light years. This makes them the most extended magnetic fields in the universe known so far. The results will be published on March 22 in the journal „Astronomy & Astrophysics“. Galaxy clusters are the largest gravitationally bound structures in the universe. With a typical extent of about 10 million light years, i.e. 100 times the... Researchers at the Goethe University Frankfurt, together with partners from the University of Tübingen in Germany and Queen Mary University as well as Francis Crick Institute from London (UK) have developed a novel technology to decipher the secret ubiquitin code. Ubiquitin is a small protein that can be linked to other cellular proteins, thereby controlling and modulating their functions. The attachment occurs in many... In the eternal search for next generation high-efficiency solar cells and LEDs, scientists at Los Alamos National Laboratory and their partners are creating... Silicon nanosheets are thin, two-dimensional layers with exceptional optoelectronic properties very similar to those of graphene. Albeit, the nanosheets are less stable. Now researchers at the Technical University of Munich (TUM) have, for the first time ever, produced a composite material combining silicon nanosheets and a polymer that is both UV-resistant and easy to process. This brings the scientists a significant step closer to industrial applications like flexible displays and photosensors. Silicon nanosheets are thin, two-dimensional layers with exceptional optoelectronic properties very similar to those of graphene. Albeit, the nanosheets are... Enzymes behave differently in a test tube compared with the molecular scrum of a living cell. Chemists from the University of Basel have now been able to simulate these confined natural conditions in artificial vesicles for the first time. As reported in the academic journal Small, the results are offering better insight into the development of nanoreactors and artificial organelles. Enzymes behave differently in a test tube compared with the molecular scrum of a living cell. Chemists from the University of Basel have now been able to... 20.03.2017 | Event News 14.03.2017 | Event News 07.03.2017 | Event News 27.03.2017 | Earth Sciences 27.03.2017 | Life Sciences 27.03.2017 | Life Sciences
<urn:uuid:8d7f092c-9984-4ebe-aaf9-ff690ba20d30>
CC-MAIN-2017-13
http://www.innovations-report.com/html/reports/physics-astronomy/nicely-pairs-indistinguishable-photons-push-a-button-226418.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-13/segments/1490218189490.1/warc/CC-MAIN-20170322212949-00548-ip-10-233-31-227.ec2.internal.warc.gz
en
0.897807
1,367
3.484375
3
Steps to Independence: How to Get Your Adult Children Living on Their Own Close to 14 million adult children are still living at home. There are simple steps both parents and their kids need to take to make their lives more productive, fulfilling and healthy. - Set boundaries without feeling guilt. Parents need to put down boundaries and stick to them. Children often assume the victim role and say, "I can't do it. I have to live here." Parents buy into this thinking, and then feel guilty because they want to help their kids. When they feed that guilt, they ignore the fact that they are crippling their children's advancement in life. - Let your adult children plan their own lives. Parents should not try to make a life plan for their adult children; this is something they need to devise on their own so they will follow it. Parents can guide and support their kids, but treating them like babies may cause them to regress. They need to be moving ahead and maturing, not regressing into childhood roles. Adult kids should be living as independent young people and making their own way. They need to decide for themselves what they want out of life, and devise a plan to obtain it. - Think about the true meaning of help. There is an old saying: "Those for whom you do the most, wind up resenting you the worst." Are you really helping your kids if you're not showing them how the real world works? Parents need to redefine what it means to help someone. Look at your motivation for helping your children. If you are doing it to feel better about yourself, then you probably don't have your child's best interest in mind. You don't help people by taking away their self-sufficiency, pride of accomplishment and achievement. Children need to take an initiative and find ways to achieve their goals on their own. If something is important enough for your children, they will find a way to make it happen. - Prepare your children for the world. "When we talk about loving our children, loving them means preparing them," Dr. Phil tells his guests. In the world, your children will have to pull their own weight and make their own way. If you allow them not to require more from themselves, then they won't, and they won't progress. It is important for your children to learn self-sufficiency, develop high self-esteem and be motivated from early on in life. If you are constantly helping them and taking care of their needs, you are not preparing them for the real world, and in fact, you are actually crippling them. "It's not fair to enable them for a long, long time and then all of a sudden just put them on the street. You own the problem as well," Dr. Phil says. "There's got to be a plan. There's got to be a transition." For Adult Children: - Take responsibility for yourself. Oftentimes it is easier to sit back and let others provide for you, while you get accustomed to a comfort zone. By taking the path of least resistance, you reward yourself with comfort and relief from anxiety that comes from reaching for something else. You may feel safe when you don't attempt to change, but you are sabotaging yourself. You are selling out your happiness and putting up with something you don't want. Require more of yourself. - Have a plan to get on your own. Find a job, something that gives you the pride and independence to be able to say, "I am taking care of myself." Start living where you can get up in the morning and look in the mirror and say, "I'm a grown person; I'm living on my own and I'm proud of that." Dr. Phil asks his guests, "Won't you feel much better when you are totally self-sufficient and running your own life?" Start at an entry-level position if you have to, and then build from there. Saving yourself for a management position is not the place to start. You need to get whatever job you can, and then build for another job. Set some goals and make a timeline to get there.
<urn:uuid:ef9f33e6-1fad-47c4-bb70-57d86605fc36>
CC-MAIN-2015-14
http://www.drphil.com/articles/article/138/
s3://commoncrawl/crawl-data/CC-MAIN-2015-14/segments/1427131298228.32/warc/CC-MAIN-20150323172138-00265-ip-10-168-14-71.ec2.internal.warc.gz
en
0.977033
855
2.90625
3
Pax (păks) [key], in Roman religion, goddess of peace. Vespasian erected a temple to her at Rome. Her attributes were similar to those of the Greek Irene, the olive branch and the horn of plenty. The Columbia Electronic Encyclopedia, 6th ed. Copyright © 2012, Columbia University Press. All rights reserved. More on Pax from Fact Monster: - What does it mean? majuscule - majuscule -- Listen to the pronunciation: WAV format or AU format Which of the following phrases is ... - Beja - Beja Beja , town (1991 pop. 20,005), S Portugal, capital of Beja dist. and Baixo Alentejo. It is an ... - Shiloh Jolie-Pitt - Biography of Shiloh Jolie-Pitt, The Namibia-born daughter of Brad Pitt and Angelina Jolie - Maso Finiguerra - Finiguerra, Maso or Tommaso Finiguerra, Maso or Tommaso , 1426–64, Florentine goldsmith and ... - Vivienne Jolie-Pitt - Biography of Vivienne Jolie-Pitt, The twin daughter of Angelina Jolie and Brad Pitt See more Encyclopedia articles on: Ancient Religion
<urn:uuid:b50ac189-8078-4dcb-a557-fa3bc2bf3def>
CC-MAIN-2014-42
http://www.factmonster.com/encyclopedia/society/pax.html
s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1413507442420.22/warc/CC-MAIN-20141017005722-00301-ip-10-16-133-185.ec2.internal.warc.gz
en
0.725209
275
2.546875
3
- Revolutionary idea: Use video lectures to flip the classroom. Make video lectures homework (allow for self-paced learning), and reserve classroom time work on projects and assignments. It humanizes the role of the teacher, which now serves more as a mentor or guide. They just bumped up their one-on-one availability time from 10% to 100%! - The emergence of peer-to-peer tutoring. Everyone’s mentoring/tutoring participation is tracks so you can gauge how good they will be. The vision is a global, one-world classroom. - The current system penalizes you for experimentation and mistakes but does not require mastery. The Khan system encourages experimentation until you can master the subject. - Help teachers diagnose student needs by providing them with a lot of usable data. - Adding gaming elements to learning–merit badges, leader-boards by areas, motivational incentives, energy points. - Provides continuity throughout a learner’s education. - The site is ready to be applied in every classroom in America, tomorrow.
<urn:uuid:4c3d09c4-1054-410d-b123-0713df0bd4fe>
CC-MAIN-2017-39
https://bryantanner.wordpress.com/2011/03/10/salman-khan-let%E2%80%99s-use-video-to-reinvent-education/
s3://commoncrawl/crawl-data/CC-MAIN-2017-39/segments/1505818688158.27/warc/CC-MAIN-20170922022225-20170922042225-00252.warc.gz
en
0.918481
220
2.78125
3
PASADENA, Calif., March 1 (UPI) -- A newly shared image from NASA showcases the orbital mecca that is Saturn. In addition to the thick bands of gas and dust that constantly orbit the gas giant, forming its rings, Saturn boasts 62 known moons -- 53 of which have been formally named. Two of those moons, Tethys and Janus, appear alongside Saturn's rings in a new image, captured by the Cassini spacecraft's wide-angle camera late last year and published by NASA on Monday. Tethys and Janus offer an example of the variety of lunar conditions found among Saturn's satellites. The planet's moons come in all shapes and sizes. Tethys, appearing in the foreground, has a diameter of 660 miles and is large enough to feature a rounded shape and geologic activity -- activity that's allowed for a range of surface textures, including plains, chasms and arcs. The more distant Janus is much smaller and oblong in shape, with no known geologic activity. Its surface is textured only by craters. As Cassini scientists can attest, Saturn's moons regularly gather for group photos alongside the planet's rings. Earlier this year, NASA shared a picture of Tethys, Enceladus and Mimas posing above and below the ring plane.
<urn:uuid:29efe694-3ed4-42dd-b05d-950fae5292ff>
CC-MAIN-2017-22
http://www.upi.com/Science_News/2016/03/01/Tethys-Janus-pose-with-Saturns-rings-in-new-NASA-photo/8711456842472/
s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463612283.85/warc/CC-MAIN-20170529111205-20170529131205-00049.warc.gz
en
0.946969
273
3.09375
3