text stringlengths 222 548k | id stringlengths 47 47 | dump stringclasses 95 values | url stringlengths 14 7.09k | file_path stringlengths 110 155 | language stringclasses 1 value | language_score float64 0.65 1 | token_count int64 53 113k | score float64 2.52 5.03 | int_score int64 3 5 |
|---|---|---|---|---|---|---|---|---|---|
The most commonly known flammable liquid is gasoline. It has a flash point of about -50° F (-65° C). The ignition temperature is about 495° E (232° C), a comparatively low figure.
Burning gasoline has a temperature above 1500° E (945° C). Therefore, it can heat objects in the fire area above its ignition temperature. To prevent reignition after extinguishment, the agent should be applied for sufficient time to allow hot objects in the fire area to cool below the ignition temperature of the gasoline.
The flammable range of gasoline is only 1.3% to 6%. Gasoline vapors are heavier than air. They tend to flow downhill and downwind from liquid gasoline, making it possible for explosive mixtures to collect – in low points such as pipe trenches or terrain depressions.
If the amount of oxygen in a given atmosphere is reduced from its normal 21 per cent to 14 per cent, by diluting with carbon dioxide, most petroleum products cannot burn. As a result, a gasoline fire can be “suffocated” by diluting the atmosphere with an inert gas.
It is dangerous to use water in a solid stream on a gasoline fire because it may spatter the fuel or raise its level in a container so it overflows. | <urn:uuid:6e7d9778-cf81-453e-a1d7-50d578094b20> | CC-MAIN-2022-49 | https://columbusfire.net/gasoline-fire-hazard/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446711278.74/warc/CC-MAIN-20221208050236-20221208080236-00295.warc.gz | en | 0.91049 | 267 | 4.09375 | 4 |
Background Oral health can be an important element of general well-being for older people. aged 70 and old surviving in one region of Mexico Town. Frailty was thought as the current presence of three or even more of the next five elements: weight reduction, exhaustion, slowness, weakness, and low exercise. Oral health factors included self-perception of teeth’s health weighed against others of the same age group; utilization of oral services over the last calendar year, number of tooth, oral condition (edentate, edentate partially, or totally dentate), efficiency and usage of detachable incomplete or comprehensive dentures, serious periodontitis, self-reported chewing xerostomia and complications. Covariates included had been Flavopiridol HCl gender, age, many years of education, cognitive functionality, smoking status, latest falls, hospitalization, amount of medications, and comorbidity. The association between teeth and frailty variables was determined performing a multivariate logistic regression analysis. Final models had been altered by socio-demographic and wellness factors Results From the 838 individuals examined, 699 had the provided information had a need to create the criteria for diagnosis of frailty. Those who experienced a higher probability of becoming frail included ladies (OR?=?1.9), those who reported myocardial infarction (OR?=?3.8), urinary incontinence (OR?=?2.7), those who rated their oral health worse than others (OR?=?3.2), and those who did not use dental care solutions (OR?=?2.1). For each additional 12 months of age and each additional drug consumed, the probability of becoming frail improved 10% and 30%, respectively. Conclusions Utilization of dental care solutions and self-perception of oral health were associated with a higher probability of becoming frail. and the answer was quoted as follows: 0?=?hardly ever or none of the time; 1?=?some Flavopiridol HCl or a little of the time; 2?=?a moderate amount of the time; or 3?=?most of the time. Participants answering 2 (a moderate amount of the time) or 3 Flavopiridol HCl (most of Flavopiridol HCl the time) to either of these two questions were considered as frail for this criterion. ? (0C32 teeth): Number of natural teeth present in the mouth. (edentulism/partial edentulism/completely dentate): Edentulism is definitely defined as the absence of all natural teeth; partial edentulism is definitely defined as having one to 24 natural teeth; dentate is thought as having 25 tooth completely. (Yes/No): Determined through the scientific examination. Individuals were asked showing their Compact disc or Cdh15 RPD towards the examiner; both those that were utilizing dentures during the evaluation and the ones who demonstrated but didn’t use them had been categorized as denture users. (Functional/Nonfunctional): Evaluation from the balance, retention, occlusion, expansion, and integrity from the oral prosthesis, as suggested by Ettinger . Dentures declining in one or even more of the aforementioned criteria had been considered non-functional. Prostheses had been also considered non-functional when the topics expressed they did not use their detachable prostheses frequently. (Yes/No): Periodontitis status was examined utilizing a improved version from the Periodontal Testing and Documenting Index (PSR) ; we assessed the scientific attachment lack of periodontal ligament by probing six sites per teeth (distobuccal, midbuccal, mesiobuccal, mesiolingual, midlingual, and distolingual) on all tooth within the mouth, saving the best PSR rating on each teeth. We categorized each participant based on the pursuing criteria: Serious periodontitis was thought as having one or more teeth using a PSR rating of 3 (3.5C5.5 mm of attachment loss) and furcation involvement or gingival recession of 3.5mm, or at least one teeth using a PSR rating of 4 (>5.5 mm of attachment loss); the lack of serious periodontitis was described by all tooth having PSR ratings of 0 thru 3 (0C5.5 mm of attachment loss) without furcation involvement or gingival recession. The next factors had been assessed through the interview: self-perception of teeth’s health compared with various other people of the same age group (Better/Identical/Worse), usage of oral services over the last calendar year (Yes/No), xerostomia (Yes/No), and self-reported gnawing complications (Yes/No). Covariates The next socio-demographic and wellness factors had been gathered by interview: age group, gender, education level (years), current and past cigarette smoking (Yes/No); cognitive impairment as examined with the Mini-Mental Condition Evaluation (MMSE) (18/19-30) ; bladder control problems (Yes/No); falls 3 x or even more in the. | <urn:uuid:a69838a0-c297-4a3c-ade3-ddf4eb137f9d> | CC-MAIN-2021-17 | http://www.cell-signaling-pathways.com/2017/09/25/background-oral-health-can-be-an-important-element-of-general-well-being/ | s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618039594808.94/warc/CC-MAIN-20210423131042-20210423161042-00480.warc.gz | en | 0.953201 | 1,079 | 2.53125 | 3 |
How Humans Are Affecting The Earth?. Data indicate that earth's surface temperature is rising. Human activities contribute to climate change and how do humans affect the environment? Green livinghow environmentearthpulse, maps, global trends, human impact national six ways activity is changing planet dirt. Humans affect earth system more than natural forces phys. If not we may even exhaust and emissions from transportation industry have fundamentally changed our atmosphere. Pounds per human impact on the environment wikipedia. The human impact on this earth youtube. It is becoming apparent that these climatic changes are negatively affecting physical and learn how the greenhouse effect keeps more of sun's heat energy within earth's atmosphere causing temperatures on earth to riseHuman activities contribute climate change do humans affect environment? Green livinghow environmentearthpulse, maps, global trends, human impact national six ways activity changing planet dirt. 21 jun 2017 humans affect the ecosystem in innumerable ways, including traps heat that would otherwise escape into space, increasing the earth's this page includes a brief, but thorough, overview of our human impact on the as well as affect land animals and humans reliant on these systems for survival land pollution, the degradation of the earth's surfaces and soil, is caused by evidence that human activities influence the global climate system continues to accumulate. Lovetoknow how_do_humans_affect_the_environment url? Q webcache. Human influence on global climate change classzone. How do humans affect the environment? Green living greenliving. Earth day five ways we affect the planet waste 4. And oceans, lakes, and rivers suffer from our pollution overfishing. Launchpad global warming how humans are affecting our planet. How do human activities contribute to climate change and how humans the real threat life on earth 10 ways impact environmentearth shattering affect environment. Parks, farmlands, and wilderness areas allow human use while preserving natural habitats 6 apr 2010 'from diverting a third of earth's available fresh water to planting this change has far reaching affects on oceanic ecosystems the 17 jun 2017 greenhouse gases aerosols affect climate by altering incoming solar infrared (thermal) radiation that are part energy balance 29 2013 if population levels continue rise, our grandchildren will see earth plunged into crisis, argues stephen emmott 2016 take look at 10 ways humans have left footprint forever changed environment planet change, extinction species, pollution life supporting air become growing concern for nations all over world. As the population grows, we are taking more and land to live using of world's natural 26 feb 2015 here 6 points on how do humans affect environment. How do humans impact the environment positively? Quora. Human activities contribute to climate change and how do. Googleusercontent searchburning of fossil fuels and toxic gases produced in factories causes pollution. H
Tags: How Humans Are Affecting The Earth? | <urn:uuid:76072792-1bf1-4ca1-9e48-707495542ec2> | CC-MAIN-2018-39 | http://3w9.discomfort.us/video/f7hBmS2XR0M | s3://commoncrawl/crawl-data/CC-MAIN-2018-39/segments/1537267155676.21/warc/CC-MAIN-20180918185612-20180918205612-00089.warc.gz | en | 0.845858 | 565 | 3.375 | 3 |
Revised September 20, 2007
Recent press reports detail an internal Bush Administration debate over whether to close the military detention facilities at Guantanamo Bay in Cuba. Whether to close the facility is not at the heart of the issue of how the U.S. treats detainees and prosecutes the war on terrorism. Regardless of where detainees are held, the U.S. government has a dual responsibility to uphold the rule of law and to protect the nation. Currently, the detention facilities at Guantanamo Bay are fully meeting those responsibilities. Any plan to move detainees would have to be justified on the basis that it would be more efficient and effective than the current system.
Doing the Right Thing. Wherever the U.S. military holds combatants, it must meet certain obligations:
- Detainees must be held in a safe, humane, and secure manner;
- Detainees must have their combatant status determined in a time and manner that are reasonable and appropriate, and their detention should be reviewed periodically to ascertain whether detention is still warranted;
- If detainees are suspected to have committed war crimes egregious enough to merit punishment, they should be put on trial at an appropriate time--which historically has been deemed to be only after hostilies have ceased--under a legal system that provides fundamental procedural protections;
- Safety and security should be guaranteed for the guards, support personnel, and legal staffs representing the government and the detainees, as well as the detainees themselves; and
- The government must be able to efficiently and effectively collect intelligence and protect national security.
These basic obligations are the same no matter where aliens who are unlawful combatants are held, and they are all being met at the military detention facilities in Guantanamo Bay, Cuba, in accordance with U.S. law. A legitimate tribunal process determines whether detainees are a threat to the United States. Annually, the tribunal reassesses whether detention should be continued. These reviews have led to the release of a number of detainees. Some have been returned to their home countries or given asylum in other countries, and others are awaiting release while the United States ensures that the countries receiving them will treat them in a humane manner. Still others will be tried as war criminals under a military commission process established and authorized by law. The operations at Guantanamo Bay meet the letter of the law and are performed by the U.S. military in an exemplary manner.
Changing Course. Any proposal to move detention operations must articulate how these detention operations can be performed more efficiently and effectively than they are now. Arguing that the U.S. should close the facilities merely to placate criticisms of its detention policies is insufficient. By and large, the criticisms are patently false and unjustified. In any case, because the government's responsibilities will not change, it is unlikely that detention operations will be conducted in a significantly different manner in a different location. Merely closing the facilities at Guantanamo Bay is not likely to placate any of America's critics.
The best policy is to continue to do the right thing: protect American citizens, respect the rule of law, and combat transnational terrorism. Moving the jails will not change anything.
James Jay Carafano, Ph.D., is Assistant Director of the Kathryn and Shelby Cullom Davis Institute for International Studies and Senior Research Fellow for National Security and Homeland Security in the Douglas and Sarah Allison Center for Foreign Policy Studies at The Heritage Foundation.
According to new (and novel) Supreme Court law-making, detainees have the right to a meaningful hearing by a neutral decisionmaker if the legitimacy of their detention is in question. | <urn:uuid:8ef5b613-9e69-4151-8348-955006479e88> | CC-MAIN-2017-43 | http://www.heritage.org/homeland-security/report/gitmo-debate-misses-the-point | s3://commoncrawl/crawl-data/CC-MAIN-2017-43/segments/1508187824899.75/warc/CC-MAIN-20171021224608-20171022004608-00395.warc.gz | en | 0.949887 | 726 | 2.546875 | 3 |
October 16, 2013
Bone Loss Associated With Increased Production Of ROS
Bone is constantly being broken down and remodeled. Osteoporosis results when bone resorption outpaces bone regeneration. Production of reactive oxygen species, a form of oxidative stress, has been predicted to promote bone loss, but a source of reactive oxygen is unknown.
In this issue of the Journal of Clinical Investigation, Katrin Schröder and colleagues at Goethe-University identify a relationship between NADPH oxidase 4 (NOX4), an enzyme that promotes reactive oxygen species formation, and bone resorption. In a mouse model of osteoporosis, genetic disruption or drug-induced loss of NOX4 protected the mice from bone loss. Additionally, the authors identify a small nuclear polymorphism in NOX4 in human patients that associated with increased bone turnover. Together, these data suggest treatments targeting NOX4 activity may benefit osteoporosis patients.---
On the Net: | <urn:uuid:9c462f23-2858-4f1f-bc41-c1b1641fdadc> | CC-MAIN-2016-40 | http://www.redorbit.com/news/health/1112976479/bone-loss-associated-with-increased-production-of-ros/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-40/segments/1474738661349.6/warc/CC-MAIN-20160924173741-00193-ip-10-143-35-109.ec2.internal.warc.gz | en | 0.897031 | 198 | 2.75 | 3 |
Hadoop Big Data Training Program
The core of Hadoop consists of a storage part (Hadoop Distributed File System (HDFS)) and a processing part (MapReduce). Hadoop splits files into large blocks and distributes them amongst the nodes in the cluster. To process the data, Hadoop MapReduce transfers packaged code for nodes to process in parallel, based on the data each node needs to process. This approach takes advantage of data locality—nodes manipulating the data that they have on hand—to allow the data to be processed faster and more efficiently than it would be in a more conventional supercomputer architecture that relies on a parallel file system where computation and data are connected via high-speed networking.
This course will get you up to speed on Big Data and Hadoop. Topics include how to install, configure and manage a single and multi-node Hadoop cluster, configure and manage HDFS, write MapReduce jobs and work with many of the projects around Hadoop such as Pig, Hive, HBase, Sqoop, and Zookeeper. Topics also include configuring Hadoop in the cloud and troubleshooting a multi-node Hadoop cluster. This Hadoop video training covers how to install, configure, and manage Hadoop clusters, as well as working with projects in Hadoop such as Pig and HBase.
Hadoop Course Curriculum
Who should take our Hadoop Big Data program?
- Programming Developers and System Administrators
- Experienced working professionals , Project managers
- Big DataHadoop Developers eager to learn other verticals like Testing, Analytics, Administration
- Mainframe Professionals, Architects & Testing Professionals
- Business Intelligence, Data warehousing and Analytics Professionals
- Graduates, undergraduates eager to learn the latest Big Data technology
What are the prerequisites for taking this Hadoop Certification Training?
There is no pre-requisite to take this Big data training and to master Hadoop. But basics of UNIX, SQL and java would be good.
Why you should go for Big Data Hadoop Online Training?
- Global Hadoop Market to Reach $84.6 Billion by 2021 – Allied Market Research
- Shortage of 1.4 -1.9 million Hadoop Data Analysts in US alone by 2018– Mckinsey
- Hadoop Administrator in the US can get a salary of $123,000 – indeed.com
Big Data is fastest growing and most promising technology for handling large volumes of data for doing data analytics. This Big Data Hadoop training will help you tobe up and running in the most demanding professional skills. Almost all the top MNC are trying to get into Big Data Hadoop hence there is a huge demand for Certified Big Data professionals.Our Big Data online training will help you to upgrade your career in big data domain.
- Hadoop Installation & Setup
- Understanding HDFS & Mapreduce
- Hive, Impala, & Pig
- Flume, Sqoop, & HBase
- Expert Lectures and Demonstrations
- Program Comppnents Pre-Loaded on Device of Your Choice | <urn:uuid:db02a1a0-4c02-480f-ac90-18dd7718ca6d> | CC-MAIN-2019-04 | https://teched360.com/certification/hadoop-big-data-training-program | s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547583807724.75/warc/CC-MAIN-20190121193154-20190121215154-00072.warc.gz | en | 0.90423 | 668 | 2.515625 | 3 |
Lecture 9: What Jesus Did
Course: Life is a Journey
Lecture: What Jesus Did
There is a character in the New Testament called John the Baptist, and he was quite a character. Part of his job was to prepare the way for Jesus’ coming. When he did see Jesus coming, he cried out, “Behold, the Lamb of God who takes away the sin of the world” (John 1:29); this is a tremendously important verse if we are going to understand what Jesus did on the cross. The technical term for what Jesus did on the cross is The Atonement, which is what actually affected, or happened, when the Lamb of God died on the cross and took away the sin of the world.
A. Jesus is the Lamb of God
When John calls Jesus a lamb, he’s not making reference to some cute farm animal, but he’s making reference to the fact that Jesus is the sacrificial lamb; Jesus was going to be a lamb who would be sacrificed. There is no better place to go to understand what that means than in the book of Leviticus in the Old Testament. Leviticus is all about explaining the holiness of God, the sinfulness of all human beings, and specifically how God goes about forgiving sin. Turn in your Bibles, please, to the book of Leviticus in chapter 1. The scenario is that someone has sinned, and in order to be forgiven of his sin, he’s going to make a sacrifice. The question is how do we make the sacrifice. Here is one of the many sets of instructions on how we do that: In Leviticus 1:10, it says, “If his gift,” the sinner’s, “for a burnt offering is from the flock, from the sheep or goats, he shall bring a male without blemish,” not defective, the best you have, “and he,” the sinner who is bringing the animal, not the priest, “shall kill it on the north side of the altar before the Lord, and Aaron’s sons the priests shall throw its blood against the sides of the altar. And he,” the sinner, “shall cut it into pieces, with its head and its fat, and the priest shall arrange them on the wood that is on the fire on the altar, but the entrails,” the guts, “and the legs he shall wash with water. And the priest shall offer all of it and burn it on the altar; it is a burnt offering, a food offering with a pleasing aroma to the Lord.” This is a rather graphic description of how people in the Old Testament went about being forgiven, yet the book of Leviticus is there for no other reason than to help us understand what it means for Jesus to be the Lamb of God—to be the Sacrificial Lamb.
B. Two Principles
There are at least two principles in this passage of Leviticus that come directly into John the Baptist’s pronouncement to help us understand. For the first principle, as we look at Leviticus, we understand that sin against the holy God is a very serious thing; it’s very clear, isn’t it? It is something that is punishable by death. We can just imagine going to the altar and slitting the animal’s throat and then hacking its body into pieces; we can understand how that would send a pretty strong message, couldn’t we? Sin is really, really bad and punishable by death. The second principle that comes out of Leviticus, which is just as important, is that God is a merciful God. As a merciful God, He will accept the death of a sinless substitute in place of the sinner, and He will forgive our sin. Sin is so horrible and vile that it requires death, but God, in His mercy, will accept the death of a sinless substitute in our place; these two principles help us understand what it means for Jesus to be the sacrificial Lamb of God. It means that we understand that our sin must be punished. As Paul tells the Roman church, “The wages of sin is death. As well, we also understand that God, in His mercy, will accept the death of Jesus in our place; that is why theologians sometimes will call it the “substitutionary atonement.” Atonement is what Jesus accomplished on the cross, and it was accomplished by His being our substitute; His being our sinless sacrifice, substituting for our own death. This is what the prophet Isaiah was talking about in Isaiah 53, some 700 years before the time of Christ. Isaiah knew that Jesus was coming and he knew that Jesus was going to die. He knew that Jesus was going to die as a substitute for our sin, and so he writes in Isaiah 53:5, “But He,” Jesus, “was wounded for our transgressions; He was crushed for our iniquities; upon Him was the chastisement that brought us peace, and with His stripes we are healed. All we like sheep have gone astray; we have turned—every one—to his own way; and the Lord,” God the Father, “has laid on Him,” Jesus, “the iniquity of us all.” Jesus is the Lamb of God; our sin requires death, but God, in His mercy, allows the substitution of a sinless sacrifice to pay the penalty for our sin, and that is why John the Baptist continues, “Behold the Lamb of God who takes away the sin of the world.” On the cross, God took our sin away from us and laid it on Jesus. Paul tells the Corinthians, “He who knew no sin was made to be sin so that you and I could be made the righteousness of God.” Our sin was taken away from us and laid on Jesus. He was made to be sin because He had lived a sinless life, and therefore, His sacrifice was perfect for our sin.
C. Two Ramifications
Now, I know that this is somewhat of a review because we talked about issues of conversion when we started this series. However, there are two ramifications that are tremendously important upon which to focus when we think about Jesus’ being the Lamb of God, who takes away the sin of the world.
1. “Lamb of God who takes away...”
The first of those ramifications is that only the Lamb of God can take away sin; only the Lamb of God can take away sin. Jesus, and Jesus alone, is the acceptable sacrifice to pay the penalty for our sin. Sin is not taken away by being a good Muslim. Sin is not taken away by being a good Hindu. Sin is not taken away by being a good Buddhist or a Baptist. Sin is not taken away by being a nice person or being a religious person. Sin is not taken away by doing certain things like attending church or confessing to a priest or being baptized. Sin can only be removed by the Lamb of God, because only the Lamb of God was the sinless, substitutionary sacrifice for my sin and your sin. Jesus says, “I am the Way and the Truth and the Life. No one comes to the Father but by Me.” Peter says in Acts 4, “There is salvation in no one else for there’s no other name under heaven given among men whereby we must be saved.” Jesus is the only Lamb of God and only the Lamb of God can take away sin. Now, this notion of absolute claim to uniqueness and being exclusive is absolutely central and non-negotiable in our sharing of the Gospel, and it runs totally contrary to American culture. This notion doesn’t run contrary to a lot of other cultures, but it runs contrary to our culture; and as new Christians, we are going to start running up against this pretty soon, if we haven’t already. What our friends and co-workers will tell us is that there really is no such thing as absolute truth. They’ll say, “There’s nothing really right or really wrong.”
“There’s nothing that’s really true or really false.”
“Everything is relative.”
“Your truth is just as valid as my truth, and that’s okay because, in fact, my truth may change between this morning and this afternoon. It’s okay because there’s no such thing as absolute truth.” So look at them and pray a prayer and say, “No, there is only one way for sin to be forgiven because there is only one Lamb of God. There is only one Lamb of God who took away the sin of the world.” We will be told that all roads lead to heaven. Our answer is “No, all roads except one lead to hell.” Our answer is not because we’re arrogant, but because there was only one Lamb of God, only one God-man who did something about sin, and only one acceptable sacrifice; there is only one way for sin to be taken away. Only the Lamb of God can take away sin.
2. “...the sin of the world”
The second ramification is wrapped up in the phrase, “...the sin of the world.” “Behold the Lamb of God who takes away the sin of the world.” The Lamb of God takes away all of the sin of the entire world. John tells us in his letter that Jesus is the propitiation—or as the NIV translates it, the atoning sacrifice—for our sin, and not for ours only but also for the sin of the entire world. Jesus’ death is sufficient, and that’s the important word. Jesus’ death is sufficient to cover all of the sin for all of the world, for all who ask for forgiveness will receive. The theological phrase for this concept is the “sufficiency of the cross,” and it is tremendously important. The doctrine of the sufficiency of the cross is that Jesus’ work on the cross is sufficient to take away the sin of all who believe. To put a different emphasis on it: Jesus did everything that needs to be done in order to remove our sin. Jesus does not need our help; He does not need the help of priests; He does not need the help of the church. Jesus’ work on the cross was sufficient, and He provided the sacrifice that is sufficient to cover the sin of all who will but ask for forgiveness.
a. It Is Finished!
This doctrine of the sufficiency of the cross is powerfully illustrated at least two different ways in Scripture. The first way in which it is illustrated is Jesus’ final words from the cross. As Jesus bore the penalty for our sin, actually as He bore our sin, as He was made to be sin, we believe the presence of God the Father left Him for the first time in all eternity. On the cross, He cried out, “My God, My God, why have You forsaken Me?” “When is this going to be over?” “When will I have paid the penalty for all this sin?” When He realized that He had paid the penalty, when He realized that it was over, He cried out, “It is finished!” Then He bowed His head and He died. You see, when Jesus said, “It is finished,” He meant exactly what He said: It is finished. If we were to ask Him, “Jesus, what’s finished?” He would have answered, “The work that My Father sent Me to do is finished.” If we were to ask Him, “What was the work you were sent to do”, He could respond as back in John 6:40, “For this is the will of my Father, that everyone who looks on the Son and believes in Him should have eternal life, and I will raise him up on the last day.” When Jesus cried out, “It is finished,” He was saying, “My work is sufficient so that everyone who believes on Me, I will grant them eternal life. Everyone who believes on Me will be raised up on that final Day of Judgment to spend eternity with our Father and our brothers and sisters in heaven. It is finished! I have done what only I can do and I have done everything that I need to do; such that if you believe in Me, your sin can be forgiven”; it’s a powerful statement.
b. Temple Veil Torn in Two
The other illustration of the sufficiency of the cross, and I think my favorite, is the fact that the temple veil (temple curtain) was torn in two when Jesus died. There is an area in the temple called the Holy of Holies; it’s the place where God’s presence used to dwell, and it was a very holy place. It was a place that only the High Priest could go in, and he could only go once a year, because he was going into the very presence of God. We know from secular sources that there was about a six-inch thick curtain that separated the Holy of Holies from the rest of the Temple. The curtain was incredibly important because it represented the presence of God on the other side of the curtain, and it represented our separation from God as we stood on this side of the curtain; we could not go directly into the presence of God the Father. When Jesus died, His death was sufficient to take away the sin of the world; it was sufficient to guarantee direct access into God the Father and to make it really clear that God ripped that curtain in two from top to bottom. We can now move directly into the presence of God because Jesus has done everything that was necessary to grant us full forgiveness of our sin, which enables us to come fully into the presence of God. You know, that curtain was torn from top to bottom; there was no partial tear—it was torn all the way. Why? Jesus’ death was sufficient to take away the sin of the entire world.
c. Sew the curtain back up
One of the sad commentaries on human life is that religion has been busy, ever since, trying to sew that curtain back up. So many times religion says, “Jesus’ death wasn’t sufficient; He didn’t quite do enough, and we have to help Him if, in fact, we are to be forgiven and come into the presence of God.” So religion likes to add on religious activity to salvation. “If we just do some things to earn God’s favor—perhaps go out enough and knock on doors and witness of Jehovah—then somehow we will have finished ripping the curtain and have forgiveness of sin.” I heard a man speak who had knocked on over 70,000 doors witnessing for Jehovah and then he became a Christian. He said the problem was on how many doors do I have to knock; maybe it was 71,000! So you see, he didn’t believe that Jesus’ death was sufficient and so he had to give God a helping hand by earning favor; by doing religious things; by witnessing for Jehovah—sewing up that curtain as fast as they could. Other parts of religion will tell you, “No. You can’t come into the presence of God.”
“That Temple curtain isn’t totally torn.”
“If you were going to confess your sin, you don’t confess them to God you confess them to a priest.”
“Certainly you can’t come into the presence of God.” Even worse still, some religion teaches that the cross wasn’t sufficient; that Jesus’ death was not sufficient, and therefore, we have to keep killing Jesus every day in Mass. My nephew who serves at Mass will say, “Time to go to the sacrifice.” He understands very clearly that they think they are killing Jesus every celebration of Mass. These are all ways in which, frankly, we thumb our noses at the work of Christ. We say, “No, You did not take away the sin of the world.” “No, Your work on the cross was not sufficient to guarantee me forgiveness and full access to God.” The Bible says that Jesus died as the Lamb of God; He and He alone takes away the sin of the world—there is forgiveness of sin in no one or nothing else; Jesus did all that needed to be done. His work on the cross is sufficient to take away the sin of the entire world; this truth is just as true for us now as it was when we first believed. When presenting the Gospel, it’s important that people understand that the only way to the Father is through the Son. When we’re coming up to the point of conversion, it’s important that we understand “Jesus paid it all, and all to Him I owe,” as the songwriter says. As life continues, we’re tempted to forget the uniqueness and the sufficiency of the cross; that truth is just as true for us, who are children of God. There is a temptation to think, “Well, yes I became a Christian through the work of Jesus on the cross, but there’s other ways to get there; other ways to have sin forgiven.” As we move along in our Christian walk, we can easily think that God needs a helping hand. However, the cross is sufficient, both in conversion and in our walk as Christians, and we must never leave the hope to which we originally grasped—that “Jesus paid it all, and all to Him I owe.” That’s the doctrine of that atonement—what Jesus did on the cross—but the atonement does no good unless we respond to it.
D. We Must Respond to the Atonement
We are not universalists; we do not believe that Jesus’ death paid the penalty for all people, so all people automatically go to heaven; that’s never been Christian doctrine. Christian doctrine has always required that we respond to the message of the cross, and that we respond to the atonement. John 6:40 says, “For this is the will of my Father, that everyone who looks on the Son and believes in Him may have eternal life.” When Peter was preaching his great sermon in Acts 2, and they came to him saying, “What must we do to be saved?” He didn’t say, “Well, nothing! You know, Jesus paid the price of everyone’s sin so everyone automatically goes to heaven”; Peter did not say that. He said, “You must respond to the good news of Jesus Christ on the cross; you must repent and be baptized. Paul tells the Ephesian church, “For by grace you have been saved through faith.” Grace is God’s gracious gift of the Lamb, and faith is our necessary response; our believing that Jesus was the Lamb of God; our believing that He and He alone sufficiently paid the penalty of our sin. Conversion is such a crucial step, isn’t it? Conversion is absolutely crucial because no one is born a Christian. No one who was baptized as an infant automatically goes to heaven. My mom was a relatively young Christian when I was born and the church wanted to baptize me; they were insistent. Mom had to threaten to sue them if one drop of water touched her baby’s head, because being baptized as an infant doesn’t do anything but confuse people. There is no family plan; no one goes to heaven because of his mom or dad or his brothers or sisters or his uncles or great-aunts. Every one of us must respond to the message of the atonement for the forgiveness of sin to be applied to you and to me.
There is a wonderful teaching tool in scripture as we perhaps struggle to understand the immensity of the atonement; it’s also a good tool that reminds us all about what the atonement is. That teaching tool is Communion. Some churches have other names for it: some call it the Lord’s Supper, and some call it Eucharist—just different words to describe the same thing. Communion is a ritual; it’s one of the two rituals that Jesus gave us—He gave us baptism and He gave us communion. Communion is a good ritual, and it’s one of those good rituals because it’s there to teach us, as well as to remind us, about the nature of the atonement.
1. Egypt, 1400 BC
Very briefly, when the Jewish nation was enslaved in Egypt around 1400 BC, God saved His chosen people through a series of plagues, which became known as the Exodus—the going out of Israel out of slavery and out of Egypt. The Jews rightly look back at the Exodus as the greatest salvation act in the history of reality. We read in the book of Exodus, Chapter 12, the instructions that God gave His children to get ready for the tenth plague, the most horrible plague. I’m going to skip around a bit, but these are the instructions starting in Exodus 12:3: “Take a lamb according to their fathers’ houses, a lamb for a household. And if the household is too small for a lamb, then he and his nearest neighbor shall take according to the number of persons;” they wanted to make sure that there were enough people there to eat the whole lamb, “according to what each can eat you shall make your count for the lamb.” It was a family affair; they got a group of people together. Now verse 6, “... the whole assembly of the congregation of Israel shall kill their lambs at twilight. Then they shall take some of the blood and put it on the two doorposts and the lintel of the houses,” the area over the top of the door, “in which they eat it. They shall eat the flesh that night, roasted on the fire; with unleavened bread and bitter herbs they shall eat it.” The unleavened bread was symbolic of the fact that God was going to save them quickly; there wasn’t even time for the bread to rise. The bitter herbs are there to remind them of their bitter years of slavery in Egypt. Verse 11 goes on to say, “In this manner you shall eat it: with your belt fastened, your sandals on your feet, and your staff in your hand. And you shall eat it in haste. It is the Lord’s Passover. For I will pass through the land of Egypt that night, and I will strike all the firstborn in the land of Egypt, both man and beast; and on all the gods of Egypt I will execute judgments: I am the Lord.” Verse 13, “The blood shall be a sign for you, on the houses where you are. And when I see the blood, I will pass over you, and no plague will befall you to destroy you, when I strike the land of Egypt.” As the instructions continue, God makes it clear that this was to be a yearly festival, a yearly celebration of the salvation of the Lord. Among other things, it was to continue to be a family time of instruction. Verse 25 says, “And when you come to the land that the Lord will give you,” the Promised Land, Canaan, “ as He has promised, you shall keep this service,” this yearly festival. “And when your children say to you, ‘What do you mean by this service?’ you shall say to them, ‘It is the sacrifice of the Lord’s Passover, for He passed over the houses of the people of Israel in Egypt, when He struck the Egyptians but spared our houses.’”
2. Jesus Reinterprets Passover
That’s the background to the story of Passover. On the night that Jesus was betrayed, it was that Passover meal that they were celebrating together. It’s interesting as Paul writes to the Corinthian church in 1 Corinthians 11 that as Jesus was celebrating the Passover, He was reinterpreting the Passover. Jesus was reinterpreting the Passover in a way that the Passover meal, now what we call Communion, would be this teaching tool to help us understand all about what the atonement is. Paul says in 1 Corinthians 11:23-26, “For I received from the Lord what I also delivered to you, that the Lord Jesus on the night when He was betrayed took bread, and when He had given thanks, He broke it, and said, ‘This is my body, which is for you; do this in remembrance of Me.’ In the same way also He took the cup, after supper, saying, ‘This cup is the new covenant in my blood. Do this, as often as you drink it, in remembrance of Me.’ For as often as you eat this bread and drink the cup, you proclaim the Lord’s death until He comes.” Jesus is reinterpreting the Passover meal and He’s saying that the cross is now the greatest act of God’s salvation. The Passover bread now points to Jesus’ death, Jesus’ body broken on the cross. When Jesus says “...this is my body and this is my blood,” we don’t believe that it literally becomes flesh and blood. We believe that the elements, as we call them, represent Christ’s body and Christ’s death. Sometimes we use unleavened bread in reflection on the historical antecedents of Communion. Sometimes we use crackers that break, and sometimes we use bread that tears—they are all ways to help us understand that this stands for Christ’s body, which was broken and torn on the cross for you and for me. The Passover Cup now points to Jesus’ death, His blood spilt on the cross; it is why we use a dark liquid and not a light liquid. The dark liquid helps us remember Christ’s blood—the blood of the Lamb of God, who died for you and me as a substitution to pay the penalty for your sin and mine. Jesus is the Lamb of God. He’s the only one who ever died for your sin and mine. His death is sufficient to cover all of your sin and mine; all of the sin of all who believe and will come to Him. The Gospel is good news indeed, is it not? | <urn:uuid:85f65ee3-f3a1-4b3b-a5ee-a7ae82672952> | CC-MAIN-2021-43 | https://www.biblicaltraining.org/transcriptions/lecture-9-what-jesus-did | s3://commoncrawl/crawl-data/CC-MAIN-2021-43/segments/1634323585522.78/warc/CC-MAIN-20211022212051-20211023002051-00238.warc.gz | en | 0.975052 | 5,652 | 3.015625 | 3 |
The Influence Of Sulphur Dioxide Emissions Environmental Sciences Essay
Biogeochemical cycling is the term which describes the transportation of chemical elements and compounds between compartments, whilst taking into consideration the influences of biology. ( Harrison. R.
M and Mora. S. J, 1996 ) . Anthropogenetic activities can impact on these rhythms, for case the consequence of sulfur dioxide emanations on the sulphur rhythm. A big proportion of these sulfurs dioxide emanations are sourced from the combustion of fossil fuels ( Hewitt and Jackson, 2009 ) , which has given rise to an addition in atmospheric deposition of sulfur, a term we may recognize as acerb rain. The undermentioned treatment analyses the beginning of these emanations, how they cause acerb deposition and the effects of it.
The sulphur rhythm is comparatively complex and involves several gaseous species ( Manahan, 2005 ) . On land it is found chiefly as sulfide and sulfate ores, whereas in the oceans, it is present as dissolved sulfate ( Cullis and Hirschler, 1980 ) . In the ambiance the key sulphur compounds include hydrogen sulfide, sulfur dioxide and sulfate aerosols and mists, where in footings of pollution the presence of sulfur dioxide is the most important portion of the sulphur rhythm ( Manahan, 2000 ) . The rhythm operates whereby sulfur is continuously transported between the different stages. Ivanov ( 1981 ) has attempted to place the major sulfur fluxes of both anthropogenetic and natural beginnings. Annually about 120b Tg S are extracted by adult male from the geosphere in fossil fuels and sulfur incorporating natural stuffs for the chemical industry. Of this sum 70 Tg S are emitted to the ambiance. Around half of the staying 50 Tg S straight enters rivers, and another portion is applied with fertilisers to agricultural land. Natural beginnings lending to the sulphur rhythm include 29 Tg yr-l from volcanic gases. River overflow is the major transportation of sulfur from continents to the ocean with an one-year burden of 224 Tg, where 109 Tg of this is accounted for by anthropogenetic pollution. The entire flux of assorted sulfurs signifiers from pelagic H2O to deposits and farther to the lithosphere sums to 130 Tg yr-l. Anthropogenic sulfur fluxes have now reached a degree that is comparable with natural fluxes and this is expected to increase in most parts of the universe ( Ivanov, 1981 ) . Sulphur dioxide emanations are now one of the largest fluxed in the sulphur rhythm.
Sulphur dioxide can arise from natural and semisynthetic beginnings. Natural beginnings include gases from vents, forest fires and from the oxidization of other sulphur compounds such as H sulfide ( Environment Agency, 2010 ) . On the other manus, anthropogenetic activities ensuing in sulfur dioxide emanations include the smelting of ores, warming of pyrites, sulfur excavation and burning of fossil fuels ( Moller, 1984 ) . We are chiefly interested in the emanations from the combustion of fossils fuels, since the oncoming of the industrial revolution has increased the sulfur load in the ambiance dramatically. Hewitt and Jackson ( 2009 ) stated that the anthropogenetic part to the entire sulphur emanation budget, chiefly in the signifier of sulfur dioxide, approaches 75 % , with around 90 % of this derivation from the northern hemisphere. The most abundant beginning of atmospheric sulfur is the combustion of coal and its byproduct ; nevertheless this is hard to quantify due to the assortment of coals such as difficult coal, lignite and coal for cookery ( Cullis and Hirschler, 1980 ) . The following most of import beginning of atmospheric sulfur is the combustion of crude oil merchandises, where the coevals of sulfur from this is still increasing ( Cullis and Hirschler, 1980 ) .
Even in the absence of air pollution, rain H2O is somewhat acidic ( pH 5.6 ) due to the presence of C dioxide, therefore why the phrase acid rain refers to rain with a pH of below 5 ( Clarke and Tomlin, 1999 ) . Acid rain is caused by sulfur and N oxides come ining the ambiance, where they are converted to sulphuric and azotic acids severally. When these combine with hydrochloric acid from lifting H chloride emanations, these acids so cause acidic precipitation ( Manahan, 2005 ) . Acid deposition is the general term for acid rain, acerb sleet and acid snow etc. There are two types of deposition, moisture and prohibitionist, where moisture involves the transition of sulfur dioxide to sulphuric acid in the presence of wet from the ambiance, and dry deposition occurs when sulfuric acid is converted into sulfate atoms which straight hit the Earth ‘s surface ( Hill, 1997 ) .The same applies to nitrogen oxide. Beginnings of nitrogen oxide include buoy uping and natural combustion of biomass whereas for semisynthetic beginnings the chief 1 is vehicle emanations ( Clarke et al, 2001 ) .
Sulphur dioxide is oxidised in the ambiance by a figure of mechanism. In low humidness conditions the most of import reaction is with the hydroxyl extremist ( Harrison and Mora, 1996 ) :
SOa‚‚ + OH > HOSOa‚‚
HOSOa‚‚ + Oa‚‚ > SOa‚? + HOa‚‚
SOa‚? + Ha‚‚O > Ha‚‚SOa‚„
Due to sulfuric acid ‘s low vapor force per unit area it can quickly attach to the condensed stage such as aerosol atoms. The majority of Ha‚‚SOa‚„ is lost via wet deposition mechanisms in cloud droplets and precipitation ( Hewitt and Jackson, 2009 ) . In wetting agent climes different reactions occur since cloud H2O droplets are of import in transition of sulfur dioxide to sulfuric acid. When sulfur dioxide is dissolved in H2O it is in equilibrium with sulphite and bisulphite ions. This can be seen in the undermentioned equations ( Harrison and Mora, 1996 ) :
SOa‚‚ ( g ) + Ha‚‚O a‡? SOa‚‚ ( aq )
SOa‚‚ ( aq ) + Ha‚‚O a‡? Ha‚?Oa?? + HSOa‚?a?»
HSOa‚?a?» + Ha‚‚O a‡? Ha‚?Oa?? + SOa‚??a?»
Sulphite may be oxidised by atmospheric O but this is a slow procedure unless it is catalysed by a passage metal ion such as Fe. The overall procedure can be seen below, which shows how sulfurous acid, which is a weak acid is converted to Ha‚‚SOa‚„ , a stronger acid ( Harrison and Mora, 1996 ) :
2SOa‚??a?» + Oa‚‚ > 2SOa‚„?a?»
Sulphur dioxide has a short mean abode clip as it has an atmospheric life-time of yearss, so it may come in the free troposphere but is improbable to come in the stratosphere ( Harrison, 1999 ) . This makes it a regional job since the gas does non transcend the planetary horizontal commixture clip, so it can do taint of the ambiance, hydrosphere, and dirt ( Ivanov, 1981 ) . ‘Sulphur emanations lead to acid deposition far from the beginning ‘ ( UNDP, 2000 ) and can hold inauspicious effects on aquatic ecosystems, trees, dirt and substructure.
Schindler ( 1988 ) stated that it is now clear that acid rain has caused widespread acidification of many aquatic ecosystems in the north eastern United States, Canada, Norway, Sweden, and the United Kingdom. Recent information has shown that juvenile fishes and other beings lower in the nutrient web have seen to be intolerant to higher pH values ( Schindler, 1988 ) . This can do trouble at higher trophic degrees as marauding fish may hunger, which can be the cause of decease even before the direct toxication of the H ion ( Schindler, 1988 ) . Persson ( 1981 ) besides found a lessening in reproduction caused by egg and fry mortality, which once more can impact further up the nutrient web.
Damage to woods by acerb rain became noticeable in Germany in the early 1980s, shortly following this other states besides reported similar incidences ( Harrison, 1999 ) . Numerous field and research lab surveies have taken topographic point in peculiar with the ruddy spruce in the Northern hemisphere, as it has suffered widespread freezing hurt, growing decrease and mortality ( DeHayes et al, 1999 ) . The freezing hurt instances in ruddy spruce woods has increased over the past 40 old ages, which coincides with the clip of increased emanations of sulfur and N oxides. However the mechanism for the ruddy spruce diminution is non clearly understood. One account is that exposure of trees to promote SOa‚„?a?» in acerb rain may change C metamorphosis of trees, which can worsen the effects of natural emphasis such as cold and drouth ( Schindler, 1988 ) . Another theory is that acerb deposition mobilizes aluminum in the dirt which reduces soils storage of Ca and its handiness for root consumption. Freezing hurt consequences in the loss of leaf which is critical for photosynthesis and hence growing ( DeHayes et al, 1999 ) .
Acid deposition can do corrosion on edifices constructed of limestone such as celebrated cathedrals. In damp conditions sulphur dioxide will change over Ca to carbonate to gypsum ( CaSOa‚„ ) which is more soluble than carbonate, therefore the reacted rock can be removed by disintegration ( Harrison, 1999 ) . Solid gypsum occupies a larger volume than carbonate which leads to flaking and checking of stuff from the surface.
To reason we can see that sulfur dioxide emanations from the burning of fossil fuels have greatly impacted on the sulfur rhythm, peculiarly in the last 100 old ages, to the extent where it is now the largest flux in the rhythm. One of the remotion mechanisms of sulfur dioxide emanations is acerb deposition, which has found to hold had black effects on aquatic ecosystems, trees and workss and substructure. Reducing these emanations would be good to the latter and may reconstruct the anthropogenetic flux to a degree below the natural flux in the rhythm. | <urn:uuid:fe5abda5-d08d-4f9b-9652-1dc1d017f933> | CC-MAIN-2019-22 | https://phdessay.com/the-influence-of-sulphur-dioxide-emissions-environmental-sciences-essay/ | s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232255092.55/warc/CC-MAIN-20190519181530-20190519203530-00362.warc.gz | en | 0.916867 | 2,239 | 3.1875 | 3 |
is a familiar example of this. His letters to Louis, as King of Holland, to Joseph, as King of Spain, to Jerome, as King of Westphalia, are marked by an amazing absolutism. "All feelings of State yield to State reasons," he sent word to Joseph. "I recognize as relatives only those who serve me. My fortune is not attached to the name of Bonaparte, but to that of Napoleon." As a rule, however, his letters to his family are as conspicuous for their common sense as for their despotism.
When he reached the point in his career where first as consul and then as Emperor he must direct the framing of a new code of laws for France, must organize schools, beautify the capitol, revive industries, his addresses to the councils and officials charged with the duties, show the same knowledge of the principles involved and the same attention to details which distinguish his military writings.
All of the extraordinary stories of Napoleon's capacity for work, of his teeming brain, his incessant invention, which one finds in the memoirs of his secretaries and associates, are fully justified by his ad- | <urn:uuid:121abd65-7092-473e-b3c7-ce20628b663d> | CC-MAIN-2017-51 | https://en.wikisource.org/wiki/Page:Napoleon's_Addresses.djvu/19 | s3://commoncrawl/crawl-data/CC-MAIN-2017-51/segments/1512948619804.88/warc/CC-MAIN-20171218180731-20171218202731-00642.warc.gz | en | 0.991575 | 237 | 2.78125 | 3 |
Eunuchs were powerful political players in ancient Chinese government. Originating as trusted slaves in the royal household they were ambitious to use their favoured position to gain political power. Advising the emperor from within the palace and blocking the access of officials to their ruler, the eunuchs were eventually able to acquire noble titles themselves, form a bureaucracy to rival the state’s and even select and remove emperors of their choosing. Their influence on government would result in the falling of dynasties and last right up to the 17th century CE.
From Slaves to Political Heavyweights
Eunuchs, or 'non-men' as they could be known, first appeared in the royal courts of ancient pre-imperial Chinese states where they were employed as servants in the inner chambers of the palace. They were more or less slaves and were usually acquired as children from border territories, especially those to the south. Castrated and brought to serve the royal household, they had no real means of altering their lives. Eunuchs were regarded as the most trustworthy of servants because they could neither seduce women of the household or father children which might form a dynasty to rival that of the sitting emperor’s.
A eunuch’s duties, therefore, included exclusively serving the women of the royal palace. Any other males were forbidden from staying overnight in the palace, and any person who entered unauthorised faced the death penalty. Eunuchs acted as fetchers and carriers, bodyguards, nurses, and essentially performed the roles of valets, butlers, maids, and cooks combined. Despite their privileged position, the general public’s view of eunuchs was extremely negative as they were regarded as the lowest class of all servants.
In contrast to the confidence put in them by rulers, their physical deformity, disdain from the ruling class and the general stigma attached to them made eunuchs more likely to seek to exploit their privileged position and gain political influence within the court. The eunuchs would not be content with the life of a simple slave for very long. Often aligning themselves with the powerful Buddhist monasteries, they advised, spied, and intrigued in equal measure in order to acquire the top positions in the state apparatus.
Eunuchs, with their special access to the Inner Court (Neiting), where no ordinary officials were permitted, could be especially prominent when the ruler was not yet an adult and they fully exploited the possibility of not only filtering out communications from ministers to the emperor and vice versa but also appointments so that very often ministers simply could not gain an audience with their ruler. Eunuchs ingratiated themselves with the emperor and were perhaps more compliant than high-minded and more principled scholar-officials which made the emperor more likely to follow their advice.
Another point in the eunuchs’ favour was that they had known their emperor perhaps for all his life and that they were the only males the ruler ever met until adulthood. In addition, the emperor knew that the eunuchs did not have a power base or loyalties outside the court, unlike the politicians.
In the Han Dynasty
Very often the eunuchs encouraged and made worse political factions, which damaged the unity of the government. Eunuchs are charged with playing a major part in the fall of the Han Dynasty (206 BCE - 220 CE). During the 2nd century CE, in particular, a succession of weak emperors were easily manipulated by the eunuchs at court. In 124 CE they even put their own child candidate on the imperial throne. They gained more imperial favour and further entrenched their position in 159 CE by helping Emperor Huan settle a family succession dispute. In gratitude, the emperor awarded a noble title to five leading eunuchs.
The eunuchs’ even greater power ultimately resulted in government officials and students banding together and staging protests in 166 and 168-169 CE. The eunuchs would not be put off so lightly though and they instigated a wave of purges which saw many of those involved in the protests imprisoned and 100 executed. The luckier officials, students, and intellectuals who had spoken out against eunuch power were merely excluded from ever holding public office. In 189 CE events took an even more brutal turn. The eunuchs murdered the 'Grand General' He Jin after it was discovered he had plotted to assemble an army to himself purge the eunuchs. The general’s followers exacted immediate revenge by killing all the eunuchs in the palace. With this power vacuum there then ensued a civil war for control of the empire, with the result that the Han fell and the Wei dynasty was established in 220 CE.
In the Tang Dynasty
In the troubled final years of the Tang Dynasty (618-907 CE) the eunuchs once again played a prominent role, this time in the downfall of emperors. Following rebellions in the provinces by renegade military commanders, the imperial court was eager to strengthen its position and so created a new palace army in the mid-8th century CE. The eunuchs were put in charge of this new force and soon began to create problems of their own for the emperor. Just as in previous eras, eunuchs manipulated the court, created divisions amongst the government officials, and by the 9th century CE, even began to enthrone and murder emperors. One emperor authorised an official purge of the eunuchs in 835 CE to try and claw back some power but before the plan could be executed the eunuchs wiped out over 1,000 of the conspirators and anyone else they remotely suspected of trying to usurp their power. As a shocking demonstration to any future conspirators, three chancellors along with their families were publicly executed in one of the marketplaces of the capital, Chang’an.
During the Song Dynasty (960-1279 CE) eunuchs were often made military commanders. One such figure was Tong Guan (1054-1126 CE) who was Emperor Huizong’s most important general. He won famous victories in the north-west border regions in his youth, quashed the Fang La rebellion in Zhejiang province and continued to loyally serve his emperor into his seventies. Guan was also honoured with an official biography where it is recorded he was a painter of some talent. The biography, which appears in the Song History, displays the typical disdain and prejudice that eunuchs suffered even if they were such talented individuals as Guan:
It was his nature to be cunning and fawning. From being an attendant in the side-apartments of the palace, because he was skilled at manipulating the weighty as well as the trivial intentions of people, he was able by means of first serving in order to later command. (in Di Cosmo, 208)
Another famous eunuch was Zheng He (1371-1433 CE) who made seven voyages to the Indian Ocean for Emperor Yongle of the Ming Dynasty (1368-1644 CE). One of He’s fleets was composed of 317 ships, including 62 'treasure ships' full of gifts for foreign rulers and over 30,000 men. On his various travels, He followed Arab trading routes and stopped off at such far-flung places as Vietnam, Indonesia, India, Sri Lanka, and East Africa. He then returned to China and wowed the court with his exotic captures such as giraffes, lions, and fabulous gems.
From the early 15th century CE the eunuchs set up their own mini-bureaucracy at court where they could ferret away paperwork and filter out the input of government ministers in state affairs. It even included a secret service branch which could investigate corruption or identify suspects who might plot against the status quo and imprison, beat, and torture them if necessary in the prison the eunuchs had created for that purpose. At the end of the century, this eunuch-led apparatus had grown spectacularly to 12,000 employees, making it the equal of the official state bureaucracy. By the latter stages of the Ming Dynasty (1368-1644 CE) there were some 70,000 eunuchs, and they had established almost complete domination of the imperial court. During that period four infamous dictators - Wang Zhen, Wang Zhi, Liu Jin, and Wei Zhongxian - were all eunuchs.
The power they held and the political intrigues they often stirred up resulted in the eunuchs becoming infamous, and they were especially unpopular with Confucianist scholars. Huang Zongxi, the Ming dynasty Neo-Confucianist thinker here sums up the general view of eunuchs in Chinese history: "Everyone has known for thousands of years that eunuchs are like poison and wild beasts" (in Dillon, 93). | <urn:uuid:6e727d0c-8518-47ab-8c41-fb61b0d68ee5> | CC-MAIN-2020-40 | https://www.ancient.eu/article/1109/eunuchs-in-ancient-china/?=&page=14 | s3://commoncrawl/crawl-data/CC-MAIN-2020-40/segments/1600401600771.78/warc/CC-MAIN-20200928104328-20200928134328-00669.warc.gz | en | 0.982581 | 1,817 | 4.28125 | 4 |
Glycemic Index Chart, Which Foods Convert Quickly
The glycemic index pertains to the metabolism of carbohydrates, and how quickly they are converted to blood sugar (glucose). A carbohydrate with a high glycemic index is one that is quickly absorbed and metabolized into blood sugar. A carbohydrate with a low glycemic index is one that is absorbed and converted more slowly into blood sugar.
The importance of the glycemic index is that when a carbohydrate is rapidly converted to blood sugar, the blood sugar rises quickly. This leads to a rapid rise in insulin, in an attempt by the body to lower the blood sugar level.
In some people, this can lead to a rapid fall in blood sugar, and at times even an abnormally low blood sugar. This low blood sugar leads to hunger in an attempt to raise the blood sugar level. The fallout from this is that, when a carbohydrate with a high glycemic index is eaten, less energy (calories) is expended to metabolize it, and more calories are taken in sooner, as compared to one with a low glycemic index. As such, it is advised that patients needing to maintain their weight or control their blood sugar should select carbohydrates with a lower glycemic index.
High glycemic Index = Food converts into Blood sugar Quickly
Low glycemic Index = Food converts into Blood sugar Slowly
|POTATO (NEW), BOILED||70|
|BREAD, WHOLE GRAIN||72|
How to Be Healthy and Happy in Life
We can write a book on the countless ways to keep healthy but I willRead More
Woman’s Fitness Program-What Should a Wise Woman Consider?
While a woman could certainly jump straight into a man’s fitness program and see someRead More | <urn:uuid:27a82781-0c80-4fd9-b276-36f38ababbe8> | CC-MAIN-2018-13 | http://www.lookscharm.com/glycemic-index-chart-which-foods-convert-quickly-for-your-health.html | s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257644701.7/warc/CC-MAIN-20180317055142-20180317075142-00465.warc.gz | en | 0.821431 | 367 | 2.96875 | 3 |
I want to know what is the use of
I read about it from the internet, and know that it is a toolkit and uses the Actor model system. After this I studied about the Actor model system in which there are different actors that can message each other and initiate action.
I also know that Akka helps provide concurrency and avoid the locking mechanism. But even after reading all this I am unable to summarize exactly what Akka is and why we use it? Also, how is it used?
Can anyone please elaborate it to me in simple words? Thanks. | <urn:uuid:3ae64533-6033-487d-bee0-e5bb28a3e35c> | CC-MAIN-2022-27 | https://stackoverflow.com/questions/24652053/what-is-akka-and-for-which-purpose-it-is-used/24655874 | s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656103036363.5/warc/CC-MAIN-20220626010644-20220626040644-00564.warc.gz | en | 0.968744 | 121 | 2.71875 | 3 |
Performing a complete physical exam on a real patient for the first time provokes anxiety in all medical students. It is like learning to swim. Despite all the courses and the reading, the student swimmer must get in the water and swim. Likewise, the young physician must construct the history and perform the physical examination on a living patient.
Physical diagnosis is the “sine qua non” for the practice of medicine. If a physician lacks this essential ability, he or she cannot be a physician at all, let alone a good one.
Faculty members who are practicing or have practiced medicine usually teach physical diagnosis during the second year of medical school. These physicians share their knowledge and expertise with medical students who hope to emulate their methods of diagnosis and management.
On the other hand, the enthusiasm, wonderment, and altruism of these students impresses and exhilarates the physicians who teach this course. Like passing a baton in a relay race to a spirited runner who will uphold the standards and excellence of the team, the teaching of physical diagnosis can be fulfilling and uplifting. It is a method not only of sharing in the students’ future, but also of participating in their development.
Download the free Physical Exam Sheet
I’ve compiled a “cheat sheet” of the basics for taking a medical history. For any medical students studying physical diagnosis, this list of prompts and questions will be an invaluable resource. | <urn:uuid:dbfa2581-85d9-46d9-b364-1969d03d4f15> | CC-MAIN-2017-43 | http://www.medical-exam-essentials.com/complete-physical-exam.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-43/segments/1508187822625.57/warc/CC-MAIN-20171017234801-20171018014801-00839.warc.gz | en | 0.953609 | 294 | 3.4375 | 3 |
Energy, everyone needs it. People need physical energy, and electrical energy. Humans aren’t the only organism, plants require energy to grow. This energy that plants receive, is called photosynthesis. Do you know where this energy comes from?
Surprisingly enough, the sun is the main light energy that plants take and transform into chemical energy. I came to write this blog because I know some people dislike the sun very much due to burns and irritation of heat. Some people don’t really pay much attention to how important the sun really is. The sun is the main key for photosynthesis and without it, really people wouldn’t have fruits and vegetables today. I remember learning in 6th grade what photosynthesis was. According to Wikipedia, photosynthesis is the process used by plants and other organisms to transform the light energy, mainly from the sun, into chemical energy that is later used. In my WTMC environmental science class, we had to go to our sit spots which is a location that you choose in one of the WCC woods. As I went out and chose my sit spot, it seemed at all the plants were freshly cut really short. Six weeks after that date, on 6/24/2015, I went out and there were these huge plants that grew to be at least 5ft and 8 inches (as seen in the picture). As I saw these plants, I was amazed because they weren’t really noticeable before. I then realized that these plants were doing photosynthesis to create their own food, causing them to grow bigger. This wasn’t the only plant that grew to be tall, other plants were brushing up against my knees, happening to be 1 foot tall. Before I wrote this blog, I knew what photosynthesis was and what it does to the environment, but I never really payed much attention to it myself. Writing this blog has showed me how much the human society really needs photosynthesis even though we can’t do photosynthesis ourselves. | <urn:uuid:73fc7301-11b8-4b79-84c5-a8666b194f6d> | CC-MAIN-2018-26 | https://longrosewigscience.wordpress.com/2015/06/25/a-different-energy-source/ | s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267864958.91/warc/CC-MAIN-20180623113131-20180623133131-00600.warc.gz | en | 0.986307 | 407 | 2.984375 | 3 |
With Harvey and Irma understandably making headlines, it can be easy to be forget the infrastructural crises we've already had to deal with this year. Take the overflow of the Oroville Dam spillway in northern California back in February. The California Department of Water Resources (DWR) has released a flyover of the spillway in its current form, in the midst of reconstruction.
The Oroville Dam had roots in a divided California betting on post-war jobs, was first built in 1963 through 1968. The tallest dam in the United States, it became a source of panic when chunks of concrete flew off the spillway in a cave-in. The underlying Feather River Basin area, consisting of around 188,000 people, was forced to evacuate on February 12.
Through a massive relief effort, the evacuation only lasted until the 14th. But the entire disaster will cost around $400 million in repairs. Right now, the DWR is cleaning out rocks, replacing anchors, framing side walls, and filling the damaged areas of the spillway with roller-compacted concrete. It's a long road ahead in repairs, but it's clear progress is being made.
Source: California DWR | <urn:uuid:d1da9dfe-7911-4d9e-85dc-849e4954a893> | CC-MAIN-2017-47 | http://www.popularmechanics.com/technology/infrastructure/a28104/oroville-dam-repair-flyover/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-47/segments/1510934808935.79/warc/CC-MAIN-20171124195442-20171124215442-00670.warc.gz | en | 0.964511 | 243 | 2.96875 | 3 |
A Fact Sheet for Athletes on concussions in Youth sports
A concussion is a brain injury that affects how your brain works.
- A concussion is caused by a bump, blow, or jolt to the head or body.
- A concussion can happen even if you haven't been knocked out.
- If you think you have a concussion, you should not return to play on the day of the injury and not until a health care professional says you are ok to return to play.
CONCUSSION SIGNS AND SYMPTOMS:
Concussion symptoms differ with each person and each injury, and they may not be noticeable for hours or days. Common symptoms include:
- Difficulty remembering or paying attention
- Balance problems or dizziness
- Feeling sluggish, hazy, foggy, or groggy
- Feeling irritable, more emotional, or "down"
- Nausea or vomiting
- Bothered by light or noise
- Double or blurry vision
- Slowed reaction time
- Sleep problems
- Loss of consciousness
During recovery, exercising or activities that involve a lot of concentration (such as studying, working on the computer, or playing video games) may cause concussion symptoms to reappear or get worse.
WHAT SHOULD I DO IF I THINK I HAVE A CONCUSSION?
- DON'T HIDE IT. REPORT IT. Ignoring your symptoms and trying to "tough it out" often makes symptoms worse. Tell your coach, parent, and athletic trainer if you think you or one of your teammates may have a concussion. Don't let anyone pressure you into continuing to practice or play with a concussion.
- GET CHECKED OUT. Only a health care professional can tell if you have a concussion and when it's OK to return to play. Sports have injury timeouts and player substitutions so that you can get checked out and the team can perform at its best. The sooner you get checked out, the sooner you may be able to safely return to play.
- TAKE CARE OF YOUR BRAIN. A concussion can affect your ability to do schoolwork and other activities. Most athletes with a concussion get better and return to sports, but it is important to rest and give your brain time to heal. A repeat concussion that occurs while your brain is still healing can cause long-term problems that may change your life forever.
HOW CAN I HELP PREVENT A CONCUSSION?
Every sport is different, but there are steps you can take to protect yourself.
- Follow your coach's rules for safety and the rules of the sport.
- Practice good sportsmanship at all times.
*Information obtained from the Department of Health & Human Services USA (CDC)* | <urn:uuid:3f878430-284f-433d-ba8d-7f10be287b44> | CC-MAIN-2021-25 | http://www.columbusyouthsoccer.com/player-s-portal/concussion-facts/ | s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623488504838.98/warc/CC-MAIN-20210621212241-20210622002241-00276.warc.gz | en | 0.937861 | 562 | 3.765625 | 4 |
What is Alzheimer’s disease?
Alzheimer’s disease is a long-standing disease that starts slowly and progress gradually over the time. It presents as gradual loss of memory and concentration. The earliest symptoms of Alzheimer’s disease are the loss of memory for recent events such as forgetting the location of keys, personal belongings, eyeglasses, or books. Other symptoms include repeating the same question several times in a short period of time. Sometimes, they take a longer time to remember words or ideas that they could remember easily in the past. Later on, in the disease course, they lose memory for the familiar places such as home address, and workplace. Many healthcare professionals such as medical doctors and psychiatrists refer these symptoms to the stress and anxiety which can be true, however, if these symptoms persist and last for a longer time this can be due to Alzheimer’s disease not to the stress or anxiety. The loss of memory or concentration is not the only problem in Alzheimer’s disease, but also these patients suffer mood disorders such as depression, lots of anxiety and sleep problems.
What causes Alzheimer’s disease?
In many patients, Alzheimer’s disease happens without a clear reason, however, there are many factors that initiate the process of Alzheimer’s disease or accelerate its incidence such as :
· Family history and genetics: Many families carry the genes for Alzheimer’s disease, a factor that makes the future generations more vulnerable to Alzheimer’s disease than others.
· Head trauma: Persons exposed to frequent head trauma and concussions such as rugby players, boxers, wrestlers, and cyclists are more liable to have Alzheimer's disease than the normal population due to the continuous damage to the brain caused by these head traumas.
· Lifestyle: people living a sedentary lifestyle without doing any exercise, those who have obesity, smokers, or exposed to the vapours and fumes, or have high blood pressure, and type 2 diabetes are more prone than others to develop Alzheimer's disease.
What is the situation in North America and Canada in 2018?
According to the Alzheimer’s and Dementia Scientific journal, an article published in March 2018, https://www.sciencedirect.com/science/article/abs/pii/S1552526018300414 an estimated 5.7 Million Americans have dementia by 2018, and this number is expected to boom to 13.8 million by the mid 21st century which is caused mainly by an increase in the number of the ageing population. In Canada, 564,000 Canadians have Alzheimer’s disease by 2018, and in 15 years, this number will be projected to 937,000 (close to a million patient). Overall, 1.1 million Canadians are affected directly or indirectly by the disease, and every year, Canadian Taxpayers pay 10.4 BILLION CANADIAN DOLLARS to cover the costs of Alzheimer’s disease.
What is the solution to this problem?
Medical doctors and psychiatrists treat Alzheimer’s disease by a class of medications called choline esterase inhibitors which work by increasing the amount of the chemical neurotransmitter Acetyl Choline which can improve the cognitive functions of these patients. Examples of these medications are Donepezil (Aricept), and Rivastigmine ( Exelon). In a clinical study done in 2006, Donepezil was found to improve the symptoms of Alzheimer’s disease and reduce the burden of the disease on the caregiver https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3321665/ however, so far, there is no medical treatment that can cure this disease rather than delays the progression of the disease and reducing its aggressiveness.
Natural health products, and acupuncture role in Alzheimer’s disease
Over the years, a lot of research was done to study the effectiveness of different natural interventions such as vitamins, herbals and acupuncture. This is a summary of these interventions:
· Acupuncture: in a systematic review and meta-analysis research done in 2017, https://www.ncbi.nlm.nih.gov/pubmed/28922926 it was found that the use of the acupuncture and the Chinese medicine have the SAME efficacy and positive influence as the medications and medical interventions used for treating the Alzheimer’s disease. In another trial, in 2015 testing the acupuncture effects in 141 clinical trials revealed that, acupuncture in many cases, was more effective than drugs and medications in improving the symptoms related to the Alzheimer’s dementia, and in other cases, it helped the medication’s effects https://www.ncbi.nlm.nih.gov/pubmed/26039131 So, it can be concluded that using acupuncture in people with Alzheimer’s dementia can be effective in managing the symptoms of the disease, either alone or in combination with the medications.
· Vitamin B12 shots: In a recent research, vitamin B12 injections or oral forms, showed a positive value of vitamin B12 supplementation for patients with a cognitive dysfunction and Alzheimer’s dementia. This research: https://www.ncbi.nlm.nih.gov/pubmed/24379897 was conducted in Ontario, Canada, and it revealed that in one year (2010) almost 2.9 million serum blood tests were done to detect vitamin B12 levels for Ontarians this year, and this cost 40 Million dollars. At the end of this study, it was found that low levels of vitamin B 12 in the blood was associated with a neurocognitive dysfunction, or in other words, vitamin B12 whether given as injections or orally can slow the onset of brain damage that can be related to Alzheimer’s dementia
· Herbal Medicine: Many herbs can help patients with Alzheimer’s dementia in reducing the severity of the disease symptoms and alleviating the stress related to memory loss. They also improve cognitive function and mental clarity. Examples of herbs that help improve brain function and could possibly improve Alzheimer’s dementia are Bacopa Monnieri, and Gingko Biloba. Ginkgo Biloba has been studied for many years and proved efficacy in correcting the brain fogginess and memory disorders in Alzheimer’s dementia. An example of a high-quality research in this topic was systematic review and meta-analysis done by Tan et al (2015) https://www.ncbi.nlm.nih.gov/pubmed/25114079 who studied extensively the impact of Gingko Biloba in the cognitive dysfunction as well its adverse effects in patients with Alzheimer’s dementia. This big study proved that Gingko was able to stabilise or slow the deterioration of cognitive dysfunction and behaviour in patients with Alzheimer’s dementia after using it for 22- 26 weeks especially in patients with psychiatric symptoms such as low mood and anxiety.
Have questions? Need help?
Don’t hesitate to contact us:
Grimsby Clinic: https://www.ontarionaturopathicclinic.ca/site/about-naturpathic-dr-grimsby-niagara
Toronto Clinic: https://www.ontarionaturopathicclinic.ca/site/contact-naturpathic-dr-toronto-north-york | <urn:uuid:69fb143f-9d7c-447c-9f60-4031e02d74e9> | CC-MAIN-2020-05 | https://www.ontarionaturopathicclinic.ca/site/blog/2018/11/04/alzheimers-disease- | s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579250607314.32/warc/CC-MAIN-20200122161553-20200122190553-00167.warc.gz | en | 0.922979 | 1,508 | 3.265625 | 3 |
The Wheatstone bridge is an electrical circuit for the precise comparison of resistances. Sir Charles Wheatstone is most famous for this device but never claimed to have invented it - however, he did more than anyone else to invent uses for it,when he 'found' the description of the device in 1843. The first description of the bridge was by Samuel Hunter Christie (1784-1865) in 1833.
The Wheatstone bridge is an electrical bridge circuit used to measure resistance. It consists of a common source of electrical current (such as a battery) and a galvanometer that connects two parallel branches, conta ining four resistors, three of which are known. One parallel branch contains one known resistance and an unknown (R4 in the above example); the other parallel branch contains resistors of known resistances. In order to determine the resistance of the unknown resistor, the resistances of the other three are adjusted and balanced until the current passing through the galvanometer decreases to zero.
The Wheatstone bridge is well suited also for the measurement of small changes of a resistance and, therefore, is also suitable to measure the resistance change in a strain gauge. It is commonly known that the strain gauge transforms strain applied to it into a proportional change of resistance. It is widely used across industry even today. | <urn:uuid:5bd91d3b-772e-4843-b16f-ada5e626a503> | CC-MAIN-2022-21 | http://freezoneearth.org/allmeters/scrapbook/WheatstoneBridge.htm | s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652662522270.37/warc/CC-MAIN-20220518115411-20220518145411-00043.warc.gz | en | 0.963057 | 266 | 3.21875 | 3 |
About 95% of U.S. births currently take place in hospitals with physicians. However, some women are having their children assisted by a midwife (meaning "with wife/woman") at home, in birthing clinics, or at a hospital. Although this may seem new to some, midwifery was commonly practiced in earlier days. What has caused these changes in the use of midwives?
Until the 1800s, childbirth had been a female-centered event, taking place in the home under the supervision of a skilled female midwife. (This bias was so strong that, in 1552, a Hamburg physician named Wertt was burned at the stake for posing as a woman to attend a delivery.) Typically physicians took a dim view of childbirth. As late as the 1700s, physicians considered it beneath their dignity to care for a pregnant woman, and their notions of modesty kept them from assisting in labor.
Beside the midwife, many female relatives and friends attended the new mother to either contribute their knowledge or learn from the event. However, unlike today, childbirth was not seen as a joyous event. In contrast, it was seen to reveal the power of God and nature over women. The pain of childbirth was to remind women of God's curse on Eve for tempting Adam into eating the forbidden fruit. In addition, the fear was even greater, since women frequently died of childbirth.If the midwives could not get the baby through the birth canal, the baby was killed and then dismembered with sharp hooks. The device that stopped this practice also ushered in male midwives and later obstetricians. Invented in the early 1600s (but not becoming well-known until centuries later), this device was the forceps. Forceps look like two enlarged spoons with handles that could be used to draw out a baby in a difficult delivery.
As the forceps became well-known, male midwives used them. However, for some unknown reason, female midwives did not. Male midwives not only used forceps for difficult births, but they also used forceps to speed up natural labor. This gave them a distinct advantage over female midwives.
When the first U.S. medical schools were established, midwifery was the first medical specialty. In the 1800s, medicine was neither a rich or highly respected profession. To increase their status and income, physicians tried to become more scientific. In doing so, they rejected female midwives as being untrained and scientific. Although a medical school education did not necessarily give physicians much expertise, midwifery was attacked, and male midwives became known as obstetricians. By the mid-1800s, most middle-class women gave birth at home attended by a male obstetrician. Eventually the process was transferred from the home to the hospital.
In 1847, a physician administered chloroform to a woman in labor. His horrified colleagues feared that the anesthesia would stop the contractions. However, the labor was normal, even though the woman was unconscious. Now women had the possibility of giving birth without pain.
But when women began to ask for anesthetics to relieve pain, there was an outcry from the religious community — painless childbirth was a blasphemy against God! In Christian tradition, the birthing pains had been given religious significance as Eve's punishment for tempting Adam and leading him astray. However, in 1853 when Queen Victoria delivered her eighth child under chloroform, religious opposition discreetly disappeared.
With the use of pain killers for childbirth, a new attitude developed toward women and their relationship to pain. The Victorian culture encouraged women to be more sensitive to pain and to openly express their aches and illnesses. Thus pain was subjectively perceived as being worse than before, and women were seen as no longer being capable of enduring it.
To meet increasing demands for painless childbirth, birthing moved from the more natural, female-centered process in the home to one dominated by males, requiring medical skill, and centered in the hospital.
With the advent of women's liberation, women sought more control over all areas of their lives — including childbirth. To many, the hospital setting made childbirth an impersonal, expensive, and needlessly medicalized procedure. Only a minority of deliveries has problems which require a physician's help. In Great Britain, for example, midwives deliver 60-80% of the babies. At Yuma Regional Medical Center between October, 1998, and March, 1999, midwives participated in over one-third of all deliveries.
Currently, in many communities — but not Yuma — women can choose between a standard delivery in a hospital or natural childbirth at home with a midwife. However, the home birth with a midwife is a safe choice only if it is a low risk pregnancy — it has progressed normally and there are no anticipated complications.
In Yuma, there are now at least seven Certified Nurse Midwives, RNs who have advanced training as midwives. Although they do not do home births, they are associated with the various offices listed below. For those who cannot afford care and lack insurance, prenatal care and delivery can be provided on a sliding scale. For more information call:
* Adapted from Bryan Strong and Rebecca Reynolds' Understanding Our Sexuality, West, 1980, 112-113.
Go back to "A Line on Life" page. | <urn:uuid:c7a6a8ab-fe25-4e61-aef8-0415fcaecfc5> | CC-MAIN-2018-05 | http://virgil.azwestern.edu/~dag/lol/Midwife.htm | s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084890928.82/warc/CC-MAIN-20180121234728-20180122014728-00227.warc.gz | en | 0.982995 | 1,102 | 3.421875 | 3 |
They’re invisible from the ground. But from the air, these stone structures materialize, forming strange wheel-like patterns. What are these ancient “geoglyphs” that stretch across the Middle East?
What are Geoglyphs?
Geoglyphs are large ground-based drawings. They’re formed by either placing or removing stones, gravel, or earth. While nearly impossible to see from up close, the resulting lines form amazing images when viewed from aircraft.
The most famous geoglyphs in the world are found in southern Peru’s Nazca Desert. But the Middle East has its own version of the “Nazca Lines.” They first gained some prominence during the 1920s. As Royal Air Force pilots flew airmail routes over Jordan, they noticed strange designs far below them. According to RAF Flight Lt. Percy Maitland, the stone structures were known among the locals as the “Works of the Old Men.”
Recently, a team led by Professor David Kennedy from the University of Western Australia conducted a “long-term aerial reconnaissance project” of the Middle East. Using aerial photography and satellite-mapping technologies, they identified thousands of geoglyphs scattered across the region.
These geoglyphs take the form of “wheels” with diameters ranging from 82 to 230 feet. They’re often found on lava beds near other stone structures such as “kites (stone structures used for funnelling and killing animals); pendants (lines of stone cairns that run from burials); and walls, mysterious structures that meander across the landscape for up to several hundred feet and have no apparent practical use.”
The wheels remain unexcavated but researchers believe that they may have been created more than 2,000 years ago.
“In Jordan alone we’ve got stone-built structures that are far more numerous than (the) Nazca Lines, far more extensive in the area that they cover, and far older.” ~ Professor David Kennedy
Guerrilla Explorer’s Analysis
So, what was the purpose of these strange structures? In the past, archaeologists thought they were remnants of ancient houses or cemeteries. But Professor Kennedy disagrees, due to the widespread nature of the wheels as well as the lack of a consistent pattern.
One interesting suggestion is that the wheels represented places of worship or ritual. But until excavations are initiated, it’s impossible to be sure. | <urn:uuid:058fcfa8-b7bb-4f0b-9d6e-a73129e20ae6> | CC-MAIN-2023-23 | https://www.davidmeyercreations.com/tag/geoglyphs/ | s3://commoncrawl/crawl-data/CC-MAIN-2023-23/segments/1685224644907.31/warc/CC-MAIN-20230529173312-20230529203312-00661.warc.gz | en | 0.958198 | 523 | 3.859375 | 4 |
Scientists have “trained” some microorganisms to poop terpenes, including many of the most common terpenes normally found in cannabis. These microorganisms include bacteria, fungi, algae, and even cutworm larvae, but E. coli is the champion of biotransformation, with scientists engineering these common bacteria to produce several different monoterpenes and sesquiterpenes as “waste” products. However, although this may sound weird and surprising to some, this isn’t a new technology; researchers have been working on these projects for decades.
When some microorganisms are fed a specific substance as food, the process of digestion or biotransformation results in the organism pooping out a totally different substance. In many cases, the food taken in becomes terpenes on the way out. Researchers have taken advantage of this shit, and have even begun engineering certain microorganisms to poop some of the most useful and difficult-to-produce terpenes.
E. coli bacteria is the standard that scientists work with when they’re looking for a microorganism to figuratively crap gold. These bacteria have been engineered to eat carbon and poop sabinene, a Top 30 terpene in cannabis. Other researchers produced nootkatone – a valuable and difficult-to-produce aroma molecule – from the biotransformation of valencene by E. coli. Researchers in China engineered E. coli to consume glucose and then poop out geraniol, while other work has shown that E. coli can be metabolically engineered to produce farnesene, and myrcene, and, if fed acetic acid, the bacteria can produce beta-caryophyllene – a dietary cannabinoid. Fascinatingly, E. coli has also been engineered to inversely produce geraniol from geranyl acetate, and geranyl acetate from geraniol – both important terpenes in cannabis.
Other work training bacteria to poop valuable compounds includes producing farnesene photosynthetically from the cyanobacterium Anabaena sp., using only CO2, mineralized water, and light.
Fungi has also been the subject of this seemingly mad-scientist work, with Corynespora cassiicola, a species of sac fungus, being engineered to produce valuable linalool oxides after being fed pure linalool. Brewer’s yeast (S. cerevisiae) – already in use for centuries to produce beer – has been engineered to produce the monoterpene ester geranyl acetate via the biotransformation of various media, while other scientists have built cell factories where S. cerevisiae produces nerolidol – a Top 10 terpene in cannabis. Botrytis cinereal – a common and pervasive fungal pathogen of cannabis – has been engineered to poop geraniol as a gasoline alternative, and, in a twist of function, two Mucor fungi species have been engineered to consume the terpene valencene, and in turn produce nootkatone.
Moving beyond classic microorganisms, scientists have produced several new variations of fenchol – a Top 15 terpene in cannabis – by feeding the pure compound to cutworm larvae (Spodoptera litura).
While this work may seem novel and interesting, it’s likely that this could be the beginning of the end of sourcing terpenes from trees, herbs, and other plants, as many of these processes are inefficient and destructive to the environment. One day soon, the bulk of our need for important compounds may be filled with products that were engineered for us in factories staffed by bacteria or fungi. In other words, we’re not too far away from being full of shit.
Haibo Zhang, Qiang Liu, Yujin Cao, Xinjun Feng, Yanning Zheng, Huibin Zou, Hui Liu, Jianming Yang, Mo Xian. Microbial production of sabinene—a new terpene-based precursor of advanced biofuel Microbial Cell Factories volume 13, Article number: 20 (2014)
Zelena K, Krings U, Berger RG. Functional expression of a valencene dioxygenase from Pleurotus sapidus in E. coli. Bioresour Technol. 2012 Mar;108:231-9
Wei Liu, Xin Xu, Rubing Zhang, Tao Cheng, Yujin Cao, Xiaoxiao Li, Jiantao Guo, Huizhou Liu & Mo Xian Engineering Escherichia coli for high-yield geraniol production with biotransformation of geranyl acetate to geraniol under fed-batch culture Biotechnology for Biofuels volume 9, Article number: 58 (2016)
Wang, Chonglong, Sang-Hwal Yoon, Hui-Jeong Jang, Young-Ryun Chung, Jae-Yean Kim, Eui-Sung Choi, and Seon-Won Kim. “Metabolic engineering of Escherichia coli for α-farnesene production.” Metabolic Engineering 13.6 (2011): 648-655
Kim EM, Eom JH1 Um Y, Kim Y, Woo HM. Microbial Synthesis of Myrcene by Metabolically Engineered Escherichia coli. J Agric Food Chem. 2015 May 13;63(18):4606-12. doi: 10.1021/acs.jafc.5b01334
Biosynthesis of β-caryophyllene, a novel terpene-based high-density biofuel precursor, using engineered Escherichia coli JianmingYang, Zhengfeng Li, Lizhong Guo, Juan Du, Hyeun-Jong Bae Renewable Energy Volume 99, December 2016, Pages 216-223
Liu, W., Xu, X., Zhang, R. et al. Engineering Escherichia coli for high-yield geraniol production with biotransformation of geranyl acetate to geraniol under fed-batch culture. Biotechnol Biofuels 9, 58 (2016) doi:10.1186/s13068-016-0466-5
Charles Halfmann, Liping Gu, William Gibbons, Ruanbao Zhou. Genetically engineering cyanobacteria to convert CO2, water, and light into the long-chain hydrocarbon farnesene. Applied Microbiology and Biotechnology December 2014, Volume 98, Issue 23, pp 9869–9877
Bormann, Sebastian, Maria Etschmann, Marco-Antonio Mirata, and Jens Schrader. “Integrated bioprocess for the stereospecific production of linalool oxides from linalool with Corynespora cassiicola DSM 62475.” Journal of Industrial Microbiology Biotechnology 39.12 (2012): 1761-1769
Wu, T., Li, S., Zhang, B. et al. Engineering Saccharomyces cerevisiae for the production of the valuable monoterpene ester geranyl acetate. Microb Cell Fact 17, 85 (2018)
Construction of cell factories for high production of nerolidol in Saccharomyces cerevisiae (brewer’s yeast) Zhang LL, Ma XL, Wang D, Yu P, Huang LQ, Zhang XL, Dai ZB. Zhongguo Zhong Yao Za Zhi. 2017 Aug;42(15):2962-2968. doi: 10.19540/j.cnki.cjcmm.20170714.002
G. Bock, I. Benda, P. Schreier. Microbial transformation of geraniol and nerol by Botrytis cinerea Applied Microbiology and Biotechnology January 1988, Volume 27, Issue 4, pp 351–357
Furusawa M, Hashimoto T, Noma Y, Asakawa Y. Highly efficient production of nootkatone, the grapefruit aroma from valencene, by biotransformation. Chem Pharm Bull (Tokyo). 2005 Nov;53(11):1513-4
Miyazawa, Mitsuo, and Yohei Miyamoto. “Biotransformation of (+)-(1 R ,2 S )-fenchol by the larvae of common cutworm ( Spodoptera litura ).” Tetrahedron 60.13 (2004): 3091-3096 | <urn:uuid:482b6183-281d-4d43-bc61-409ac9ca4482> | CC-MAIN-2023-40 | http://www.thebigbookofterps.com/microorganisms-trained-to-poop-terpenes/ | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233506029.42/warc/CC-MAIN-20230921174008-20230921204008-00439.warc.gz | en | 0.849655 | 1,852 | 2.78125 | 3 |
Epilepsy in the dog is a common and frequently debilitating condition that often leads to a shortened lifespan, death, and major distress for owners of affected dogs.[1-4] The disease in dogs occurs at a frequency similar to epilepsy in people, with seizures occurring in 0.5–5% of all dogs and with idiopathic epilepsy being the most common underlying cause.[5, 6] Although antiepileptic drugs (AEDs) continue to form the cornerstone of epilepsy treatment in this species, up to 25% of epileptic dogs remain refractory to medication. This compares to a similar proportion in the human epileptic population, among whom approximately one third continue to suffer seizures despite medication. For a subset of human patients with hippocampal sclerosis, resection of the mesial temporal lobe will result in a reduction in seizure frequency of 80–90%, but for many patients this is inappropriate because of the location of the seizure focus, unacceptable adverse effects such as memory impairment, or multiple seizure types. As a result, other potential treatments are actively being investigated.[9, 10]
The success of vagal nerve stimulation as a form of neurostimulation capable of improving seizure control has led to research into deep brain stimulation (DBS) as a treatment for epilepsy in recent years.[9, 11-20] Targets proposed for stimulation have included the anterior nucleus of the thalamus (ANT), the centromedian nucleus of the thalamus (CMT), the subthalamic nucleus, and the hippocampus. Much of this work has been performed in rodent models and has provided valuable insight into the pathogenesis of seizures. However, rodent models suffer from disadvantages related to their size and dissimilar anatomy as compared with people. For this reason, large animal models such as the sheep and minipig are being developed that will allow better translation of DBS strategies into people. Recently, one such study has investigated the feasibility of implanting leads into the ANT and hippocampus of a sheep model as part of the evaluation of a novel device capable of both stimulating and recording from the brain.[22, 23]
Vagal nerve stimulation as a treatment for epilepsy in dogs has shown some promise, suggesting that electrical stimulation of the nervous system in this species also may be capable of improving seizure control. With the advent of the Brainsight system and other frameless stereotaxy devices, it has recently become possible to access deep regions of the brain in dogs and potentially to stereotactically implant DBS electrodes.[25, 26] Given the potential for epileptic dogs to provide a spontaneous model in which to test thalamic stimulation, therefore, the aim of this study was to investigate the feasibility and safety of placement of stimulating and recording electrodes in the ANT and hippocampus of normal dogs using the Brainsight system, as well as to test a novel device capable of providing DBS in conjunction with simultaneous EEG recording.
- Top of page
- Materials and Methods
This study showed that it is feasible to place DBS and recording electrodes in the thalamus and hippocampus of dogs with accuracy and with minimal morbidity. Using the Brainsight system, an overall mean accuracy of 4.6-mm placement error was achieved in the dogs with successful fixation. Given the size and spacing of the electrodes, this accuracy allowed the positioning of at least 1 electrode in the target in all dogs. In all cases, the dogs recovered without adverse neurologic effects and showed no outward sign of the effects of the implantation or stimulation. In addition, stimulation and recording from the electrodes showed that stimulation of the ANT can produce evoked responses identical to those obtained in other large animal models in which similar studies have been performed. The shape and latency of the EPs was consistent with activation of the circuit of Papez, suggesting that the dog is a suitable model for the testing of DBS strategies in the treatment of epilepsy.
To the authors' knowledge, this is the first report to describe the implantation of indwelling electrodes in the brain of dogs for the purposes of recording and stimulating simultaneously. Other studies in the field of veterinary medicine have examined the use of stereotaxy for needle placement, but predominantly in the setting of lesion biopsy.[28-31] In addition, studies have examined image-guided freehand or directed biopsy techniques, both to biopsy lesions and to implant indwelling catheters for delivering brachytherapy. Overall, the morbidity and mortality described in most studies in dogs is low, ranging from 12 to 29% and 6 to 9%, respectively.[28, 30, 32] This is higher than the 3–12% morbidity rate and 0–1% mortality rate reported in human patients.[33, 34] The limited numbers in our study do not allow for direct comparison, but the use of the Brainsight system to implant electrodes did not result in any neurologic deficits in any of the dogs involved. It is likely that the implantation of these electrodes is a safer procedure because there is no suction applied to the brain parenchyma and therefore the risk of intracranial hemorrhage is smaller than with needle biopsy. In addition, the dogs in this study had no structural pathology, as compared with dogs undergoing needle biopsy to diagnose lesions, in which the presence of additional blood vessels within the lesions would increase the likelihood of hemorrhage, the biggest cause of postbiopsy morbidity.
Given the small size of some of the targets involved, such as the ANT, obtaining accurate electrode placement is extremely important in a trial such as the one reported here. A mean placement error of 4.6 mm was acceptable, given that in all cases, this allowed for contact of at least 1 pair of contacts with the target, although further testing in more cases is necessary to definitively assess accuracy of placement. Several factors are likely to have contributed to the placement error. When using the Brainsight system, a registration to the animal's MRI scans is obtained by locating homologous markers on the animal and on the display using an optical position sensor. In people, frameless stereotaxy devices, such as the Brainlab and Stealth systems, use up to 9 registration points glued to the skin over the skull, as compared with the 5 registration points clustered around the front of the skull with the Brainsight system.[35, 36] The difficulties associated with gluing and maintaining registration points to the skin and the mobility of the skin in dogs precludes this possibility. As a result, the registration process involves some error, and the further away the subsequent trajectory is from the registration device located on the frontal bone, the more this error is exaggerated. Differences in skull shape and size among breeds are also likely to contribute to challenges in lead placement, because a smaller skull results in a greater distance between the frame and the target. In addition, the smaller brachycephalic skull shape offers less scope for an accurate lateral approach for lead placement. Finally, it is likely that movement of the electrodes occurred during or after stylette placement, which in some cases was >5 mm. Solutions to improve this currently are being examined, and in the future, different methods of maintaining the electrodes in place and of securing them to the calvarium will be utilized. In humans, special securing devices such as the Guardian burr hole cap are available that are placed in the burr hole and which then have a locking cap overlaid to secure the lead. It is likely that future improvements will involve a similar solution. Finally, the process of fusing the CT scans and MRI scans is imperfect and the hyperdense appearance of the electrode tips on CT scan makes the precise location of the electrode tip difficult to determine. Some studies have utilized the superior soft tissue imaging characteristics of MRI to image DBS electrodes during or after placement to establish the exact location of contact points.[37-39] However, the presence of ferromagnetic material in the electrodes raises the concern of thermal injuries when MRI is performed, as well as generating a signal void as a result of local distortion of the magnetic field. For these reasons, CT generally is regarded as a safer modality for postoperative imaging. The exaggerated appearance of the electrodes on CT has been characterized, with a 1.27-mm lead having been shown to generate an artifact of up to 3.4 mm. For this reason, fusing postoperative CT images with preoperative MRI is commonly used to combine the anatomical accuracy of MRI images with the safety of CT, and studies have shown the registration of the 2 involves a discrepancy of approximately 1.5 mm. Therefore, a substantial proportion of the placement error in this study is likely to have been arisen from the fusion of CT and MRI images. In the future, the use of improved electrodes may allow MRI scanning to replace CT scanning as the modality of choice for postoperative assessment. This would eliminate the error associated with fusion of the 2 images while simultaneously evaluating small amounts of hemorrhage or edema associated with the procedure.
The rationale for stimulation of the ANT as part of seizure therapy comes from the discovery that the ANT plays a crucial role in the propagation of limbic epilepsy as part of the Papez circuit (Fig 6). The Papez circuit was described in 1937 by James Papez as a circuit linking hippocampal output via the fornix and mammillary nucleus in the posterior hypothalamus to the ANT. The ANT projects to the cingulum bundle deep to the cingulate gyrus, which travels around the wall of the lateral ventricle to the parahippocampal cortex. This structure then completes the circuit by returning to the hippocampus. Atrophy or sclerosis of any structures within the circuit has been known to cause epilepsy, as occurs with mesial temporal sclerosis. Although mesial temporal sclerosis has yet to be described in dogs, the importance of the Papez circuit in the propagation of seizure activity suggests that it remains an important target for the treatment of epilepsy in dogs. Two other circuits are believed to be involved in the propagation of seizures: the corticothalamic circuit and the mammillary circuit. The corticothalamic circuit involves propagation of seizure activity from the motor cortex to the caudate, putamen, the globus pallidus and the thalamus, and unilateral, repeated stimulation of this circuit can result in continual partial seizures. The mammillary circuit also involves the ANT, from which seizure activity is propagated to the mammillary bodies to the brainstem.
Targeting of these circuits in the treatment of epilepsy is based on the theory that stimulation delivered to these pathways can prevent the generalization and propagation of seizures, although the exact mechanisms remain unclear. It is known that the unilateral stimulation of the anterior thalamus in amygdala-kindled seizures in rats decreases the incidence of generalized seizures. EEG and concurrent thalamic recording after surgery in human patients are consistent with a recruitment pattern that correlates with clinical improvement. Several studies of ANT stimulation have been performed, the largest of which is a multicenter, double-blind, randomized clinical trial entitled Stimulation of the Anterior Nucleus of the Thalamus for Epilepsy (SANTE). The treatment group of the 110 patients in the SANTE trial showed a median seizure frequency reduction of 29% at 3 months, 41% at 1 year, 56% at 2 years, and 68% by the end of 3 years as compared with baseline. Other, smaller, nonrandomized trials of ANT stimulation also have been performed with 4–6 patients per trial, with seizure frequency reduction of 14–75%.[9, 11, 16-19]
Perhaps the most exciting prospect raised by this trial is the possibility of closed loop recording and stimulation for the treatment of epilepsy. Long-term stimulation has been performed in human patients for a number of years, and long-term EEG recording recently has become available, but the device described here is one of the first that combines both capabilities simultaneously. This, in turn, raises the prospect of intelligent stimulation that can be instigated in response to seizure activity as detected in the EEG recording. Such devices would represent an important advance in brain stimulation for the treatment of epilepsy, and potentially could revolutionize the lives of human and canine patients with epilepsy. | <urn:uuid:5ac7df9a-62ff-472b-885c-9e7be62eab02> | CC-MAIN-2014-15 | http://onlinelibrary.wiley.com/doi/10.1111/jvim.12235/full | s3://commoncrawl/crawl-data/CC-MAIN-2014-15/segments/1397609530895.48/warc/CC-MAIN-20140416005210-00483-ip-10-147-4-33.ec2.internal.warc.gz | en | 0.943663 | 2,502 | 2.890625 | 3 |
- freely available
Biosensors 2013, 3(3), 327-340; doi:10.3390/bios3030327
Abstract: Lab-on-a-chip immuno assays utilizing superparamagnetic beads as labels suffer from the fact that the majority of beads pass the sensing area without contacting the sensor surface. Different solutions, employing magnetic forces, ultrasonic standing waves, or hydrodynamic effects have been found over the past decades. The first category uses magnetic forces, created by on-chip conducting lines to attract beads towards the sensor surface. Modifications of the magnetic landscape allow for additional transport and separation of different bead species. The hydrodynamic approach uses changes in the channel geometry to enhance the capture volume. In acoustofluidics, ultrasonic standing waves force µm-sized particles onto a surface through radiation forces. As these approaches have their disadvantages, a new sensor concept that circumvents these problems is suggested. This concept is based on the granular giant magnetoresistance (GMR) effect that can be found in gels containing magnetic nanoparticles. The proposed design could be realized in the shape of paper-based test strips printed with gel-based GMR sensors.
Immuno assays are an established method in medical analysis to determine the concentration of a macromolecular analyte (antigen) in solution [1,2,3]. Recent advances in lab-on-a-chip technologies have made it possible to carry out complete immuno assay procedures on the area of one chip of several cm2 [4,5,6]. These, so-called, Micro Total Analysis Systems (µTAS) often employ detectable labels that are connected to an antibody probe. In direct immunoassays, proteins in the sample are immobilized on the chip surface. Labeled antibodies that specifically bind the target antigen are then introduced into the system, binding to the antigens on the surface. In a washing step, unbound labels are removed so that only labels bound to antigen molecules can be measured by a suitable detection scheme. In sandwich immuno assays, only target antigens are immobilized on the surface, which are functionalized with a second antibody.
Common labels employed in immuno assays are enzymes (ELISA) [7,8,9,10], radioactive isotopes (RIA) [11,12,13], or fluorophores [14,15]. In recent years, however, superparamagnetic beads have attracted interest as alternative labels in immuno assays [16,17]. These beads consist of magnetic nanoparticles that are encapsulated in a polymer shell. When the size of the nanoparticles is below a certain threshold, the superparamagnetic limit, the thermal energy exceeds the magnetic crystalline anisotropy energy of the particles. Typical superparamagnetic limits are on the order of one to several dozen nanometers. Below this limit, the particles exhibit a random, fluctuating magnetization. An ensemble of the particles will therefore not show a net magnetization unless an external magnetic field strong enough to align the magnetic moment vectors is applied . The beads then develop a stray field. Due to this magnetic stray field, the beads can be detected via magneto resistive sensors [19,20,21,22]. These devices offer high-sensitivity detection at low production cost and can even be printed onto standard printing surfaces such as paper using GMR ink . As the output signal is electronic, they are easy to implement into handheld devices. MR sensors currently employed for µTAS detection include spin valves [24,25,26], Hall crosses , anisotropic magnetoresistive rings , tunnel magnetoresistance (TMR) [22,29], and GMR sensors [30,31,32,33,34,35].
Magnetic beads have several advantages compared to other labels. Unlike fluorescent labels, magnetic beads do not bleach, the MR detector can easily be structured onto the chip surface, there is no background signal from the sample, they are safer to handle than radioactive material and the detection is faster than in ELISA. However, the depositing of solved or dispersed particles such as beads onto a surface is usually diffusion limited. Beads, which generally have a low diffusion coefficient due to their comparably large size (primarily, diameters in the range of 100 nm to 10 µm are used for the detection with magneto-resistive sensors), usually settle onto a surface due to gravitational forces only. However, this requires a long time, depending on the size and density of the particles. Polystyrene beads like the Dynabeads M-280 (Invitrogen) with a diameter of 2.8 µm sink at a velocity of 1.7 µm/s when dispersed in water. Thus, sedimentation times in the absence of any flow are on the order of tens of seconds, or even minutes, depending on the system dimensions. Brownian motion, the parabolic flow profile of flows in micro-channels and lift forces exacerbate this problem. As the beads need to contact the sensor surface for binding events between antigens and antibodies to occur, they need to pass the sensor surface at close distance. This issue is aggravated by the fact that microfluidic pumps with a low flow velocity are difficult to design [37,38], making it more difficult for beads to contact the sensor surface before passing the sensing zone.
There exist a few µTAS that work under static conditions, where no microfluidic flow is applied during the time of the binding so that beads can settle on the surface due to gravitational forces. For such devices, repulsive double layer forces may become a problem. Sharp et al. demonstrated that a 4.5 µm polystyrene bead might be kept from sedimenting onto an untreated glass surface in 0.5 mM NaCl solution by repulsive forces that act at a distance of 100 nm between bead and surface. Nevertheless, working examples for sedimentation of beads onto a sensor surface have been published. The Naval Research Laboratory in Washington developed a powerful multi-analyte biosensor where beads settle on and bind to functionalized GMR sensors [30,31]. Unbound beads are not removed in a washing step but by a magnetic field gradient. Schotter et al. have shown that their GMR sensor offered a sensitivity superior to fluorescence detection at low analyte concentrations. Their experiment, however, required a time step of one hour for the beads to bind to the sensor surface. Koets et al. showed that actuation of the bead dispersion during the binding step can decrease the necessary time interval from 30 min to 1.5 min. Thus, an effective method to bring beads into contact with the sensor surface seems necessary to keep assay times down to feasible levels.
Over the decades, different solutions for this problem have been found. These can generally be allocated to one of three categories, one employing magnetic forces, one utilizing hydrodynamic effects and one applying acoustofluidics. In the following paragraphs, these three categories are defined and examples of actual applications are given. However, as these approaches have their disadvantages, a new sensor concept that might solve these problems in the future is presented in the final section.
2. Magnetic Approach
The trajectory of superparamagnetic beads flowing in microfluidic systems can be controlled with magnetic fields, e.g., produced by on-chip conducting lines [25,26,29,40,41,42,43]. Thus, one possible approach to ensure contact between the antibody-coated beads and the sensor surface is to employ magnetic field gradients that pull the beads towards the sensor. By adjusting the gradient, the force can be limited to altering the trajectory without fixing unbound beads in place above the sensor. After binding is completed, removal of the magnetic field allows for the detection of the stray fields of the beads on the magneto resistive sensor surface. Such trapping schemes were applied by Graham et al. and Lagae et al. for spin-valve sensors. Lee et al. developed a microelecromagnetic ring trap to capture beads in a small volume with a diameter of 60 µm (see Figure 1(a,b)). Li et al. designed a bead concentrator made from current-carrying microstructures that attracts beads and moves them towards a trapping chamber which also serves as the sensing element. This trapping chamber represents a constant volume. When analyte molecules are attached to the beads, their diameter is increased and fewer beads fill the chamber. The underlying TMR sensor then registers the number of beads present in the chamber. This immobilization and detection scheme works best for large biomolecules like DNA. For smaller molecules, additional spacers binding to the analyte are required.
However, magnetic fields can be utilized even further. Instead of just assuring contact between bead and sensor surface, they can assist in the transport of beads, rendering microfluidic pumps unnecessary. Lee et al. developed a microelectromagnetic matrix made from two layers of current-carrying wires at 90° angle (see Figure 1(c,d)). By changing the magnetic field patterns created by these structures, they were able to control the movement of a particle cloud of 20 µm diameter with high precision. Another method to achieve transport and even separation of different bead species is the construction of a so-called “magnetic on-off ratchet” . In this concept, a magnetic potential asymmetric in time and space combined with non-directional Brownian motion of magnetic beads leads to a net transport of beads in a specified direction (see Figure 2). When the asymmetric field is switched on, beads move to the potential minima until equilibrium between magnetic forces and Brownian motion is reached, resulting in a narrow concentration distribution (Con). However, if the fields are switched off, the beads begin to diffuse apart, resulting in a broader concentration distribution (Coff) after a few seconds of diffusion. When the fields are reactivated, the beads are once again transported to the minima. Due to the asymmetric shape of the potential, a net transport of beads is achieved.
As the diffusion times strongly depend on the hydrodynamic radius of the beads, a separation by size is possible if appropriate time intervals for the switching of the field are chosen. However, the sample size is restricted to objects on the micrometer scale, as magnetic forces are volume dependent and need to overcome the Brownian motion of the particles. On the one hand, objects in the range of a few nanometers show such a strong diffusion that is is not possible to generate strong enough magnetic field gradients within handheld devices. For beads with a diameter above 10 µm, on the other hand, diffusion becomes negligibly small, hindering efficient transport. This problem can be circumvented by modifying the device into a so-called “rocking ratchet” structure . Here, an additional time-dependant force is applied in flow-direction, e.g., in the form of a magnetic field gradient. With an appropriate choice of field strengths and time-dependencies, it is still possible to generate a magnetization dependent net flux of particles without an external bias even at the limit of zero diffusion.
However, utilizing current carrying microstructures to manipulate bead positioning also possesses some disadvantages. First of all, conducting lines have to be structured on-chip and need contacting. Depending on the complexity of the wire structure, this can significantly increase the production costs. To assure that beads contact the sensor surface, conducting lines need to be structured next to the sensors. If they were to be structured right on top of the sensor, an additional layer of insulating material would be required, thus increasing the distance between beads and sensor. This would result in a decreased signal intensity. Thus, the maximum field strength is limited. High field strengths would collect beads right on top of the conducting lines, away from the sensor. Thus, there is a trade-off between field strength (and thus capture range) and resolution. Either the field strength is high and beads in a large liquid volume are attracted but deposit on the conducting lines, or the filtered liquid volume is smaller and the deposition less accurate, leading to more beads being deposited on the actual sensor surface. Additionally, Joule heating caused by the wires might influence sensitive measurements or deteriorate temperature-sensitive analytes.
3. Hydrodynamic Approach
Instead of employing magnetic fields to draw beads to the sensor surface, hydrodynamic effects caused by variations in the channel geometry can be utilized to support the bead capture process. Weddemann et al. [46,47] calculated concentration profiles for bead flows through a rectangular channel, like the one shown in Figure 3. Over length l the channel’s height drops from h1 to h2 and broadens in width from a1 to a2, forming a ramp-like structure.
In a straight channel, beads only change their altitude through diffusion and buoyancy. In the ramp structure, the fluid gains an additional motion in the z-direction. The fluid profile drags beads at high altitudes faster towards the sensor surface than beads at low altitudes. This way, Weddemann et al. predicted an increase in the capture rate of beads by more than 100%. However, the overall fraction of captured beads still remains small compared to methods that apply the magnetic approach.
Furthermore, while this approach circumvents the problems of producing magnetic gradients by conducting lines, as mentioned above, it increases the complexity of the channel system, as a three-dimensional design is required. Additionally, the whole concept of collecting beads only works for slow velocities up to a few hundreds of µm/s, depending on the remaining parameters (see Figure 4(c)). It is possible to adjust the structure to higher velocities by elongating the sensor surface and by increasing the aspect ratio. However, elongating the ramp to counter higher velocities leads to a dilution of beads captured on the surface as the beads spread over a larger area. This decreases the signal strength and, thus, the sensor’s detection threshold. A higher aspect ratio complicates the manufacturing further, leading to increased production costs.
An alternative approach would be to apply methods of flow focusing utilizing sheath flow. Chiu et al. designed a very simple and effective channel system for 3D focusing. However, their design confines the flow to a small area near the center of the channel. For the purpose of bead immobilization on a surface, the focus has to be near the sensing surface. Thus, appropriate modifications of the design would be required, possibly increasing the device complexity.
Although a hydrodynamic approach to the problem seems a reasonable and feasible way to increase binding fractions, few µTAS exist that apply this method. Further research is needed to obtain simple, yet effective structures that have reduced complexity compared to on-chip conducting wires.
4. Acoustofluidic Approach
Ultrasonic standing waves constitute another way to move beads onto a sensing surface . An ultrasonic actuator, e.g., a piezo ceramic, can create ultrasonic standing waves inside a microfluidic channel system. Particles inside this standing wave experience radiation forces that depend on the distance between the particle and the nearest pressure node, thus driving them towards these nodes. As the force is proportional to the particle volume, this approach works best for particles in the µm range, e.g., cells or beads. Zourob et al. and Hawkes et al. used this method to capture Bacillus subtilis var niger cells on an activated surface. Hawkes et al. reported an efficiency 200 times better than in the absence of the standing wave (see Figure 5). Zourob reported that 96% of the cells were successfully pushed to the surface. Glynne-Jones et al. and Oberti et al. achieved similar results for beads of 6 µm and 9.6 µm/26 µm diameter, respectively. Using a multi-modal approach which allowed them to switch between an attractive and a repulsive force (facing towards or from the surface), Glynne-Jones et al. were even able to remove unfunctionalized beads that were not bound to the surface. Only beads functionalized with streptavidin were left attached to the biotionylated surface. For all of the four systems, operation times were on the order of a few minutes.
Until recently, acoustofluidic devices were mainly made from metals, silicon, or glass. Gonzalez et al. recently presented a chip for the sorting of polystyrene particles of different sizes that was made from SU-8 polymer, while Glynne-Jones et al. created a functional chip composed of adhesive transfer tape and cellulose acetate. Thus, a first step towards mass production utilizing polymeric materials has been undertaken.
The significant advantage of the acoustofluidic approach is fast and efficient collection of particles in the µm range. However, the method is not suitable for smaller particles. Additionally, the systems require miniaturized actuator and reflector layers. To keep production costs down, the actuators have to be built as part of the packaging, and not as part of the chip system. Care has to be taken when combining sensor arrays and ultrasonic standing waves, as the resulting distribution of particles on the surface is often not uniform, but patterned.
5. Nanogranular GMR
As mentioned above, beads can be detected via their stray field by magnetoresistive sensors, e.g., GMR sensors. In these sensors, two ferromagnetic (fm) layers are separated by a third, non-magnetic (nm) layer. The giant magnetoresistance effect (GMR effect) was found and originally studied in magnetic multilayer systems [56,57]. Its physical origin has been explained in terms of spin-dependent scattering of conduction electrons at the interface of the magnetic layers . The scattering probability of electrons passing through the structure strongly depends on the relative orientation of the magnetization of the fm layers (see Figure 6). For a parallel orientation of the magnetization vectors of the fm layers the resistance of the device is low, whereas it is high when the magnetizations are aligned antiparallel.
However, GMR sensors require well defined surfaces and well controlled lithography. They need to be integrated into a µTAS structure, including microfluidic pumps for low flow velocities. This increases production costs for the chips, often preventing a successful market introduction. However, newly developed printing methods employing GMR ink could change that . As an alternative to GMR ink, granular GMR sensors in the form of GMR gels could be utilized. They are based on the granular GMR effect that was reported in systems consisting of fm granules in metallic matrices [60,61]. Contrary to previous granular systems prepared by sputtering or metallurgical procedures, magnetic nanoparticles can also be integrated into conductive nonmagnetic gel matrices, e.g. salt-containing biogels. For Co nanoparticles, magneto-transport measurements at room temperature revealed GMR effects of more than 200% (see Figure 7), which is far above the values known from common systems [62,63,64]. Regarding technological relevance, this results in enhanced sensor sensitivity.
The possibility of printing gel allows for the realization of granular gel-GMR sensors without employing sputtering or lithography processes. The complexity of the production of such sensors could thus be reduced, leading to a more rapid and less expensive fabrication compared to conventional devices. Besides, biogels such as alginates are abundant in supply and available at low cost. The mechanical flexibility of the matrix might simplify the application in specific geometries or on flexible materials such as paper, thus enabling new lab-on-paper technologies. Finally, the large effect amplitudes will ensure high sensor sensitivity.
With the help of these gel-based GMR sensors, a new type of paper-based immunoassay µTAS systems could be developed. Instead of structuring sensors on the bottom of a microfluidic channel, spots of GMR gel could be deposited on a small paper strip, similar to a pH test strip. The gel has to contain functional groups that assemble on the surface of the gel and are able to bind antibodies (see Figure 8). Dipping the strip into a specific antibody solution would then activate the strip for a specific sandwich immunoassay. After mixing the test sample (blood, saliva, etc.) with a bead solution containing the marker beads and antibodies bound on the bead surface, the activated strip could be dipped into the mixture. Antigens in the solution would link antibodies on the bead surface and antibodies on the gel, thus resulting in beads that are bound to the gel surface. Subsequently to a washing step, the strip would be inserted into a standardized magnetic field. The developing stray field of the beads would alter the resistance of the GMR gel, thus allowing the direct measurement of the bead density on the gel surface. As the mixing takes place under macroscopic flow conditions (no laminar flow), the usual problem of contact between beads and surface could be circumvented. However, repulsive double-layer forces would have to be prevented by careful choice of the surface materials. Due to the simplified fabrication of these strips, the production costs of this µTAS system could possibly be low enough to allow for mass production.
The authors would like to thank the DFG for financial support in the framework of FOR 945 (project 3), the federal state NRW for financial support in the framework of “NRW Forschungskooperation U&FH—MoRitS” (project K01) and the BMBF for financial support in the project Bead.Plus (16SV5403). Bernhard Eickenberg gratefully acknowledges financial funding from the German National Academic Foundation. Frank Wittbracht wishes to thank the Alexander von Humboldt foundation for a Feodor Lynen fellowship.
Conflicts of Interest
The authors declare no conflict of interest.
- Chan, C.P.Y.; Cheung, Y.C.; Renneberg, R.; Seydack, M. New trends in immunoassays. Adv. Biochem. Eng. Biotechnol. 2008, 109, 123–154. [Google Scholar]
- Mattiasson, B.; Teeparuksapun, K.; Hedstrom, M. Immunochemical binding assays for detection and quantification of trace impurities in biotechnological production. Trends Biotechnol. 2010, 28, 20–27. [Google Scholar] [CrossRef]
- Kricka, L.J. Selected strategies for improving sensitivity and reliability of immunoassays. Clin. Chem. 1994, 40, 347–357. [Google Scholar]
- Hartwell, S.K.; Grudpan, K. Flow based immuno/bioassay and trends in micro-immuno/biosensors. Microchim. Acta 2012, 169, 201–220. [Google Scholar]
- Paek, S.H.; Cho, J.H.; Cho, I.H.; Kim, Y.K.; Oh, B.K. Immunosensors for point-of-care testing. Biochip J. 2007, 1, 1–16. [Google Scholar]
- Kim, Y.K. Signal transducing methods for immuno-sensing devices. Biochip J. 2007, 1, 145–150. [Google Scholar]
- Lequin, R.M. Enzyme immunoassay (EIA)/Enzyme-linked immunosorbent assay (ELISA). Clin. Chem. 2005, 51, 2415–2418. [Google Scholar] [CrossRef]
- Truszczynski, M.; Pejsak, Z. Importance of ELISA in epidemiology and control of animal infectious diseases. Medycyna Wet. 2005, 61, 10–13. [Google Scholar]
- Zangar, R.C.; Daly, D.S.; White, A.M. ELISA microarray technology as a high-throughput system for cancer biomarker validation. Expert Rev. Proteomics 2006, 3, 37–44. [Google Scholar] [CrossRef]
- Yoshihara, N. ELISA for diagnosis of infections by viruses. Jpn. J. Clin. Med. 1995, 53, 2277–2282. [Google Scholar]
- Gelpi, E. Radioimmunoassay and the development of RIA-HPLC procedures: An updated literature survey. Trends Anal. Chem. 1985, 4, R13–R14. [Google Scholar]
- Yalow, R.S. Practices and pitfalls in immunologic methodology. Adv. Prostaglandin Thromboxane Leukot. Res. 1986, 16, 327–338. [Google Scholar]
- Goldberg, M.E.; Djavadiohaniance, L. Methods for measurement of antibody antigen affinity based on ELISA and RIA. Curr. Opin. Immunol. 1993, 5, 278–281. [Google Scholar] [CrossRef]
- Zheng, M.Z.; Richard, J.L.; Binder, J. A review of rapid methods for the analysis of mycotoxins. Mycopathologia 2006, 161, 261–273. [Google Scholar] [CrossRef]
- McKie, A.; Vyse, A.; Maple, C. Novel methods for the detection of microbial antibodies in oral fluid. Lancet Infect. Dis. 2002, 2, 18–24. [Google Scholar] [CrossRef]
- Gijs, M.A.M. Magnetic bead handling on-chip: New opportunities for analytical applications. Microfluid. Nanofluidics 2004, 1, 22–40. [Google Scholar]
- Gijs, M.A.M.; Lacharme, F.; Lehmann, U. Microfluidic applications of magnetic particles for biological analysis and catalysis. Chem. Rev. 2010, 110, 1518–1563. [Google Scholar] [CrossRef]
- Liu, C.; Stakenborg, T.; Peeters, S.; Lagae, L. Cell manipulation with magnetic particles toward microfluidic cytometry. J. Appl. Phys. 2009, 105, 102014:1–102014:11. [Google Scholar]
- Weddemann, A.; Albon, C.; Auge, A.; Wittbracht, F.; Hedwig, P.; Akemeier, D.; Rott, K.; Meissner, D.; Jutzi, P.; Hütten, A. How to design magneto-based total analysis systems for biomedical applications. Biosens. Bioelectron. 2010, 26, 1152–1163. [Google Scholar] [CrossRef]
- Albon, C.; Weddemann, A.; Auge, A.; Rott, K.; Hütten, A. Tunneling magnetoresistance sensors for high resolutive particle detection. Appl. Phys. Lett. 2009, 95, 023101:1–023101:3. [Google Scholar]
- Graham, D.L.; Ferreira, H.A.; Freitas, P.P. Magnetoresistive-based biosensors and biochips. Trends Biotechnol. 2004, 22, 455–462. [Google Scholar] [CrossRef]
- Reiss, G.; Brückl, H.; Hütten, A.; Schotter, J.; Brzeska, M.; Panhorst, M.; Sudfeld, D. Magnetoresistive sensors and magnetic nanoparticles for biotechnology. J. Mater. Res. 2005, 20, 3294–3302. [Google Scholar] [CrossRef]
- Karnaushenko, D.; Makarov, D.; Chenglin, Y.; Streubel, R.; Schmidt, O.G. Printable giant magnetoresistive devices. Adv. Mater. 2012, 24, 4518–4522. [Google Scholar] [CrossRef]
- Li, G.X.; Joshi, V.; White, R.L.; Wang, S.X.; Kem, J.T.; Webb, C.; Davis, R.W.; Sun, S.H. Detection of single micron-sized magnetic bead and magnetic nanoparticles using spin valve sensors for biological applications. J. Appl. Phys. 2003, 93, 7557–7559. [Google Scholar]
- Graham, D.L.; Ferreira, H.; Bernardo, J.; Freitas, P.P.; Cabral, J.M.S. Single magnetic microsphere placement and detection on-chip using current line designs with integrated spin valve sensors: Biotechnological applications. J. Appl. Phys. 2002, 91, 7786–7788. [Google Scholar] [CrossRef]
- Lagae, L.; Wirix-Speetjens, R.; Das, J.; Graham, D.; Ferreira, H.; Freitas, P.P.P.; Borghs, G.; de Boeck, J. On-chip manipulation and magnetization assessment of magnetic bead ensembles by integrated spin-valve sensors. J. Appl. Phys. 2002, 91, 7445–7447. [Google Scholar] [CrossRef]
- Besse, P.A.; Boero, G.; Demierre, M.; Pott, V.; Popovic, R. Detection of a single magnetic microbead using a miniaturized Hall sensor. Appl. Phys. Lett. 2002, 80, 4199–4201. [Google Scholar] [CrossRef]
- Miller, M.M.; Prinz, G.A.; Cheng, S.F.; Bounnak, S. Detection of a micron-sized magnetic sphere using a ring-shaped anisotropic magnetoresistance-based sensor: A model for a magnetoresistance-based biosensor. Appl. Phys. Lett. 2002, 81, 2211–2213. [Google Scholar] [CrossRef]
- Li, F.; Gooneratne, C.; Kosel, J. Magnetic Biosensor System to Detect Biological Targets. In Proceedings of 2012 International Conference on Electromagnetics in Advanced Applications (ICEAA), Cape Town, South Africa, 2–7 September 2012; pp. 1238–1241.
- Baselt, D.R.; Lee, G.U.; Natesan, M.; Metzger, S.W.; Sheehan, P.E.; Colton, R.J. A biosensor based on magnetoresistive technology. Biosens. Bioelectron. 1998, 13, 731–739. [Google Scholar] [CrossRef]
- Edelstein, R.L.; Tamanaha, C.R.; Sheehan, P.E.; Miller, M.M.; Baselt, D.R.; Whitman, L.J.; Colton, R.J. The BARC biosensor applied to the detection of biological warfare agents. Biosens. Bioelectron. 2000, 14, 805–813. [Google Scholar] [CrossRef]
- Schotter, J.; Kamp, P.B.; Becker, A.; Pühler, A.; Reiss, G.; Brückl, H. Comparison of a prototype magnetoresistive biosensor to standard fluorescent DNA detection. Biosens. Bioelectron. 2004, 19, 1149–1156. [Google Scholar] [CrossRef]
- Koets, M.; van der Wijk, T.; van Eemeren, J.T.W.M.; van Amerongen, A.; Prins, M.W.J. Rapid DNA multi-analyte immunoassay on a magneto-resistance biosensor. Biosens. Bioelectron. 2009, 24, 1893–1898. [Google Scholar] [CrossRef]
- Mujika, M.; Arana, S.; Castano, E.; Tijero, M.; Vilares, R.; Ruano-López, J.M.; Cruz, A.; Sainz, L.; Berganza, J. Magnetoresistive immunosensor for the detection of Escherichia coli O157:H7 including a microfluidic network. Biosens. Bioelectron. 2009, 24, 1253–1258. [Google Scholar] [CrossRef]
- Manteca, A.; Mujika, M.; Arana, S. GMR sensors: Magnetoresistive behavior optimization for biological detection by means of superparamagnetic nanoparticles. Biosens. Bioelectron. 2011, 26, 3705–3709. [Google Scholar] [CrossRef]
- Di Carlo, D.; Irimia, D.; Tompkins, R.G.; Toner, M. Continuous inertial focusing, ordering, and separation of particles in microchannels. Proc. Natl. Acad. Sci. USA 2007, 104, 18892–18897. [Google Scholar] [CrossRef]
- Iverson, B.D.; Garimella, S.V. Recent advances in microscale pumping technologies: A review and evaluation. Microfluid. Nanofluidics 2008, 5, 145–174. [Google Scholar] [CrossRef]
- Luo, Y.; Qin, J.H.; Lin, B.C. Methods for pumping fluids on biomedical lab-on-a-chip. Front. Biosci. 2009, 14, 3913–3924. [Google Scholar]
- Sharp, J.M.; Clapp, A.R.; Dickinson, R.B. Measurement of long-range forces on a single yeast cell using a gradient optical trap and evanescent wave light scattering. Colloids Surf. B 2003, 27, 355–364. [Google Scholar] [CrossRef]
- Sinha, A.; Ganguly, R.; Puri, I.K. Magnetic separation from superparamagnetic particle suspensions. J. Magn. Magn. Mater. 2009, 321, 2251–2256. [Google Scholar] [CrossRef]
- Deng, T.; Whitesides, G.M.; Radhakrishnan, M.; Zabow, G.; Prentiss, M. Manipulation of magnetic microbeads in suspension using micromagnetic systems fabricated with soft lithography. Appl. Phys. Lett. 2001, 78, 1775–1777. [Google Scholar] [CrossRef]
- Weddemann, A.; Wittbracht, F.; Auge, A.; Hütten, A. A hydrodynamic switch: Microfluidic separation system for magnetic beads. Appl. Phys. Lett. 2009, 94, 173501:1–173501:3. [Google Scholar]
- Lee, C.S.; Lee, H.; Westervelt, R.M. Microelectromagnets for the control of magnetic nanoparticles. Appl. Phys. Lett. 2001, 79, 3308–3310. [Google Scholar] [CrossRef]
- Auge, A.; Weddemann, A.; Wittbracht, F.; Hütten, A. Magnetic ratchet for biotechnological applications. Appl. Phys. Lett. 2009, 94, 183507:1–183507:3. [Google Scholar]
- Helmich, L. Separation of Magnetically Functionalized Cells in a Microfluidic Rocking Ratchet. Master Thesis, Bielefeld University, Bielefeld, Germany, April 2013. [Google Scholar]
- Weddemann, A.; Wittbracht, F.; Auge, A.; Hütten, A. Positioning system for particles in microfluidic structures. Microfluid. Nanofluidics 2009, 7, 849–855. [Google Scholar] [CrossRef]
- Kappe, D.; Hütten, A. Positioning System for Particles in Microfluidic Structures. In Proceedings of Comsol Conference 2012, Milan, Italy, 10–12 October 2012.
- Chiu, Y.J.; Cho, S.H.; Mei, Z.; Lien, V.; Wu, T.F.; Lo, Y.H. Universally applicable three-dimensional hydrodynamic microfluidic flow focusing. Lab Chip 2013, 13, 1803–1809. [Google Scholar] [CrossRef]
- Wiklund, M.; Radel, S.; Hawkes, J.J. Acoustofluidics 21: Ultrasound-enhanced immunoassays and particle sensors. Lab Chip 2013, 13, 25–39. [Google Scholar] [CrossRef]
- Zourob, M.; Hawkes, J.J.; Coakley, W.T.; Treves Brown, B.J.; Fielden, P.R.; McDonnell, M.B.; Goddard, N.J. Optical leaky waveguide sensor for detection of bacteria with ultrasound attractor force. Anal. Chem. 2005, 77, 6163–6168. [Google Scholar] [CrossRef]
- Hawkes, J.J.; Long, M.J.; Coakley, W.T.; McDonnell, M.B. Ultrasonic deposition of cells on a surface. Biosens. Bioelectron. 2004, 19, 1021–1028. [Google Scholar] [CrossRef]
- Glynne-Jones, P.; Boltryk, R.J.; Hill, M.; Zhang, F.; Dong, L.; Wilkinson, J.S.; Melvin, T.; Harris, N.R.; Brown, T. Flexible acoustic particle manipulation device with integrated optical waveguide for enhanced microbead assays. Anal. Sci. 2009, 25, 285–291. [Google Scholar] [CrossRef]
- Oberti, S.; Neild, A.; Dual, J. Manipulation of micrometer sized particles within a micromachined fluidic device to form two-dimensional patterns using ultrasound. J. Acoust. Soc. Am. 2007, 121, 778–785. [Google Scholar] [CrossRef]
- González, I.; Fernández, L.J.; Gómez, T.E.; Berganzo, J.; Soto, J.L.; Carrato, A. A polymeric chip for micromanipulation and particle sorting by ultrasounds based on a multilayer configuration. Sens. Actuators B Chem. 2010, 144, 310–317. [Google Scholar] [CrossRef]
- Glynne-Jones, P.; Boltryk, R.J.; Hill, M.; Harris, N.R.; Baclet, P. Robust acoustic particle manipulator: A thin-reflector design for moving particles to a surface. J. Acoust. Soc. Am. 2009, 126, EL75–EL79. [Google Scholar] [CrossRef]
- Binasch, G.; Grünberg, P.; Saurenbach, F.; Zinn, W. Enhanced magnetoresistance in layered magnetic-structures with antiferromagnetic interlayer exchange. Phys. Rev. B 1989, 39, 4828–4830. [Google Scholar] [CrossRef]
- Baibich, M.N.; Broto, J.M.; Fert, A.; Vandau, F.N.; Petroff, F.; Eitenne, P.; Creuzet, G.; Friederich, A.; Chazelas, J. Giant magnetoresistance of (001)Fe/(001)Cr magnetic superlattices. Phys. Rev. Lett. 1988, 61, 2472–2475. [Google Scholar] [CrossRef]
- Mott, N.F. Electrons in transition metals. Adv. Phys. 1964, 13, 325–422. [Google Scholar] [CrossRef]
- Wedemann, A.; Ennen, I.; Regtmeier, A.; Albon, C.; Wolff, A.; Eckstädt, K.; Mill, N.; Peter, M.K.H.; Mattay, J.; Plattner, C.; et al. Review and outlook: From single nanoparticles to self-assembled monolayers and granular GMR sensors. Beilstein J. Nanotechnol. 2010, 1, 75–93. [Google Scholar]
- Berkowitz, A.E.; Mitchell, J.R.; Carey, M.J.; Young, A.P.; Zhang, S.; Spada, F.E.; Parker, F.T.; Hütten, A.; Thomas, G. Giant magnetoresistance in heterogeneous Cu-Co alloys. Phys. Rev. Lett. 1992, 68, 3745–3748. [Google Scholar] [CrossRef]
- Xiao, J.Q.; Jiang, J.S.; Chien, C.L. Giant magnetoresistance in nonmultilayer magnetic systems. Phys. Rev. Lett. 1992, 68, 3749–3752. [Google Scholar] [CrossRef]
- Meyer, J.; Rempel, T.; Schäfers, M.; Wittbracht, F.; Müller, C.; Patel, A.V.; Hütten, A. Giant magnetoresistance effects in gel-like matrices. Smart Mater. Struct. 2013, 22, 025032. [Google Scholar] [CrossRef]
- Allia, P.; Knobel, M.; Tiberto, P.; Vinai, F. Magnetic properties and giant magnetoresistance of melt-spun granular Cu100-x-Cox alloys. Phys. Rev. B 1995, 52, 15398–15411. [Google Scholar] [CrossRef]
- Chen, Y.J.; Ding, J.; Si, L.; Cheung, W.Y.; Wong, S.P.; Wilson, I.H.; Suzuki, T. Magnetic domain structures and magnetotransport properties in Co-Ag granular thin films. Appl. Phys. A Mater. Sci. Proc. 2001, 73, 103–106. [Google Scholar] [CrossRef]
© 2013 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/). | <urn:uuid:b77e56bb-2aa5-4312-b4fa-08f03a70e49c> | CC-MAIN-2017-26 | http://www.mdpi.com/2079-6374/3/3/327/htm | s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128320679.64/warc/CC-MAIN-20170626050425-20170626070425-00566.warc.gz | en | 0.82392 | 8,996 | 2.625 | 3 |
The U.S. needs energy — lots of it. Day in and day out, this country, with only 5% of the world’s population, consumes one quarter of the world’s total energy supply. About 40% of our energy comes from oil: some 20 million barrels, or 840 million gallons a day. Another 23% comes from coal, and a like percentage from natural gas. Providing all this energy to American consumers and businesses, even in an economic downturn, remains a Herculean task, and will only grow more so in the years ahead. Addressing the environmental consequences of consuming fossil fuels at such levels, all emitting climate-altering greenhouse gases, only makes this equation more intimidating.
As President Obama faces our energy problem, he will have to address three overarching challenges:
1. The United States relies excessively on oil to supply its energy needs at a time when the future availability of petroleum is increasingly in question.
2. Our most abundant domestic source of fuel, coal, is the greatest emitter of greenhouse gases when consumed in the current manner.
3. No other source of energy, including natural gas, nuclear power, biofuels, wind power, and solar power is currently capable of supplanting our oil and coal consumption, even if a decision is made to reduce their importance in our energy mix.
This, then, is the essence of Obama’s energy dilemma. Let’s take a closer look at each of its key components.
Excessive Reliance on Oil
No other major power relies on getting so much of its energy from oil. Making that 40% figure especially daunting is this: the world supply of oil is about to contract. The competition for remaining supplies will then intensify, while most of what remains is located in inherently unstable regions, threatening to lead the U.S. into unceasing oil wars.
Just how much of the world’s untapped oil supply remains to be exploited, and how quickly we will reach a peak of sustainable daily world oil output, are matters of some contention, but recently the scope of debate on this question has narrowed appreciably.
Most energy experts now believe that we have consumed approximately half of the planet’s original petroleum inheritance and are very close to a peak in production. No one knows whether it will arrive in 2010, 2012, 2015, or beyond, but it is certainly near. In addition, most energy professionals now believe that global oil output will peak at far lower levels than only recently imagined — perhaps 90-95 million barrels per day, not the 115-125 million barrels once projected by the U.S. Department of Energy. (Here I’m speaking only of conventional, liquid petroleum; there are some "unconventional" sources of oil — Canadian tar sands, Venezuelan extra-heavy crude, and the like — that may boost these numbers by a few millions of barrels per day, without altering the global energy equation significantly.)
What underlies these more pessimistic assumptions? To begin with, the depletion rate of existing fields is accelerating. Most of the giant fields on which the world now relies for the bulk of its oil supplies were discovered 30 to 60 years ago and are now reaching the end of their productive life cycles.
It used to be thought that the depletion rate of these fields was about 4% to 5% a year, but in a study to be released November 12, the International Energy Agency (IEA), an affiliate of the Organization for Economic Cooperation and Development (the club of wealthy industrialized nations), is expected to report that the decline rate is closer to 9%, an astonishingly high figure. At this rate of decline, the world’s major fields will be depleted of their remaining supplies of oil relatively quickly, leaving us dependent on a constellation of smaller, less productive fields, often located in difficult to reach or unstable areas, as well as whatever new deposits the oil industry is able to locate and develop.
And this is the second big problem: Despite huge increases in the funds devoted to exploration, the oil companies are not finding giant new fields comparable to the "elephants" discovered in previous decades. Only two such fields were discovered between 1970 and 1990, and only one since — the Kashagan field in Kazakhstan’s corner of the Caspian Sea. True, the companies have discovered some large fields in the deep waters of the Gulf of Mexico and off the coasts of Angola and Brazil, but these are neither on a par with the largest fields now in production, nor anywhere near as easy to bring on line. They will not be able to reverse the coming decline in global output.
Given these factors, it is clear that the global supply of oil is destined to begin contracting in the not-too-distant future, and that the global peak in production — when it does arrive — will be at a level much lower than previously assumed. The current global economic downturn and the sudden fall in energy prices may, for a while, mask this phenomenon, but they won’t change it in any significant way.
Our excessive reliance on oil in good times and bad is made all the more problematic by the fact that, just as supplies are dwindling, global demand is expected to rise mainly because of increased consumption in China, India, and other developing nations.
As recently as 1990, the developing nations of Asia accounted for only a relatively small 10% of global oil consumption. Their economic growth has been so rapid, however, and their need for oil so voracious that they now consume about 18% of the world’s supply. If current trends persist, that will rise to 27% in 2030, exceeding North American net consumption for the first time. This means — if energy habits and present energy use don’t change radically — that Americans will be competing with Chinese and Indian consumers for every barrel of spare oil available on world markets, driving up prices and jeopardizing the health of our petroleum-dependent economy.
To make matters worse, more and more of the world’s remaining oil production will be concentrated in the Middle East, Central Asia, and sub-Saharan Africa. That these areas are chronically unstable is hardly accidental: many bear the scars of colonialism or are delineated by borders drawn up by the colonial powers that bear no resemblance to often fractious ethnic realities on the ground. Many also suffer from the "resource curse": the concentration of power in the hands of venal elites that seek to monopolize the collection of oil revenues by denying rights to the rest of the population, thereby inviting revolts, coups, and energy sabotage of every sort.
As it has grown more reliant on oil deliveries from these areas, the United States has attempted to enhance its energy "security" by an increasing reliance on military force, even though such efforts have largely proved ineffectual. Despite all the money and effort devoted to enforcement of what was once known as the Carter Doctrine — which stated that the uninterrupted flow of Persian Gulf oil to the United States is a vital national interest to be protected by any means necessary, including military force — the Persian Gulf is no more stable or peaceful today than it was in 1980, when President Jimmy Carter issued his famous decree.
Our over-reliance on oil, then, is our greatest energy vulnerability. But what are the alternatives?
The Problem with Coal
The energy source which the United States possesses in greatest abundance is coal. This country has the world’s largest reserves, 247 billion metric tons, and is second only to China in using coal. In this country, coal is primarily employed to produce electricity, but it can also be converted into a diesel fuel — known as coal-to-liquids or CTL — to power cars and trucks. Although CTL, widely used by Germany during World War II to power its war machine, is still in its infancy in the U.S., it could conceivably be used to supplement future declining gas supplies.
When coal is burned in the conventional manner, however, it emits more climate-altering greenhouse gases than any other fossil fuel — twice as much as natural gas and one-and-a-half times that of oil to produce the same amount of energy. As a result, any increase in our reliance on coal will lead to ever greater emissions of carbon dioxide, only accelerating the already perilous rate of global warming.
In addition, an increased U.S. reliance on coal would only flash a green light to China, India, and other countries eager to do likewise. The bottom line? Any hope of reversing the buildup of greenhouse gases in the atmosphere in time to avert the most severe consequences of climate change would go out the window (possibly quite literally).
During the recent election campaign, Barack Obama and John McCain both spoke of speeding the development of "clean coal technology." In the present context, however, clean coal is a deceptive term, if not an outright misnomer. It generally refers to pollution-free coal, not to coal free of carbon emissions. Coal that would burn without damaging the climate is best referred to as climate-friendly coal, or "safe coal." At present, there are no power plants anywhere on the planet capable of burning coal in a climate-safe manner.
Right now, there is only one technology being seriously discussed that would burn coal safely: carbon capture and storage, or carbon sequestration. Under this process, powdered coal is combined with steam and turned into a gas; then the carbon is stripped away and eventually buried. This is a tricky and costly technique that has yet to be fully tested. But at the moment, it is the only foreseeable path to using coal in a climate-friendly way. President-elect Obama has spoken of his interest in this technology, but without a lot more support and investment — no small matter in economically tough times — it will never get the boost it deserves.
Consider the Alternatives
So what’s left to satisfy our future energy needs?
Natural gas is the next biggest source and it possesses a number of advantages. Of all the fossil fuels, it releases the least amount of carbon dioxide when burned. We possess substantial, if not overwhelming, reserves of natural gas in this country. But like oil, it is a finite substance. Eventually, it, too, will peak and begin a decline of its own. Energy experts are less certain about when exactly this is likely to occur, but most see it coming a decade or so after oil’s peak.
Our biggest problem with natural gas is that we are gradually running out of North American reserves and so must increasingly rely on supplies from elsewhere — in this case, in the form of liquefied natural gas, or LNG. Fully 45% of the world’s remaining reserves are, however, held by just three countries, Russia, Iran, and Qatar, while large amounts are also held by Algeria, Iraq, Kazakhstan, Saudi Arabia, Turkmenistan, and Venezuela. This means, of course, that we face the same geopolitical problems relying on natural gas as we do with oil.
Some say we should increase our reliance on nuclear power. Nuclear power’s attraction is that, once in operation, it does not emit carbon dioxide. It does, however, raise enormous safety issues and produces toxic radioactive wastes that must be stored for thousands, or even tens of thousands, of years in ultra-safe containers — a technological challenge that has yet to be overcome. Given these problems, the rising costs and legal problems of building new reactors have deterred all but a few utilities from considering their construction, putting distinct limits on nuclear power’s capacity to overcome America’s energy crisis.
By far the most attractive alternative to oil and coal is obviously renewable energy, especially wind and solar power — much praised but inadequately supported by politicians of both parties. These need no fuel source (save the sun and wind), are never used up, and emit no carbon dioxide. They seem the perfect solution to the planet’s energy and climate crises.
The full potential of wind and solar power, however, cannot be realized until at least two other hurdles are overcome: the development of efficient storage systems to collect energy when the sun and wind are strong and release it when they are not, and the construction of an expanded nationwide electrical grid to connect areas of reliable wind (especially the mountain states and high plains) and sunshine (the Southwest) with the areas of greatest need. These are bound to be costly endeavors, but until they are fully funded, wind and solar power will not be capable of replacing more than a tiny fraction of oil and coal in the nation’s overall energy mix. Unfortunately, against a backdrop of bad times in a new era of "cheap" oil that will not last, the likelihood of such funding at the levels needed has declined precipitously.
Much can be said about the potential of advanced biofuels (those not reliant on food crops like corn), geothermal energy, wave power, hydrogen power, and nuclear fusion, but these all remain in the same category as wind and solar (only more so): they show a lot of potential, but without substantially more research, development, and investment, they cannot help wean us from our reliance on oil and coal.
The Challenge to be Met
If this assessment is accurate, President Obama will face a tough, if not overwhelming, challenge in attempting to get the nation’s long-term energy crisis in hand. On coming into office in increasingly tough times, he will be besieged by a host of immediate crises and demands for funds. On energy, his natural inclination, given limited financial resources, will undoubtedly be to make a series of modest gestures toward "green energy independence." This coming crisis, the central one of our lifetimes and those of our children and grandchildren, cannot, unfortunately, be solved via small-scale course corrections.
Needed is a major White House-led initiative on the scale of the World War II Manhattan Project that produced the first atomic bomb or the Apollo Moon Project. The principal goals of such an epic undertaking would have to include:
1. Reducing oil’s contribution to America’s total energy supply by half over the next quarter century. This would require a comprehensive program of conservation, increased development of public transport, the accelerated development of electric-powered vehicles and advanced biofuels, and other technological innovations.
2. Gradually reducing U.S. reliance on coal, unless consumed in a climate-friendly manner, as well as providing government support for the development of carbon capture and storage technology.
3. Increasing the contribution of renewable energy sources to America’s total energy mix from their current 6% to at least 25%, if not significantly more, by 2030. This would require substantial public investment in new technologies and electrical power lines.
4. Demilitarizing America’s reliance on imported petroleum. This means repudiating the Carter Doctrine, dismantling the vast military apparatus created since 1980 to enforce that policy, and using the resulting savings — as much as $150 billion per year, says a new report from the National Priorities Project — to help finance the initiatives described above.
Only by embracing such goals can President Obama hope to overcome the long-term, potentially devastating energy crisis now facing this nation.
Michael T. Klare is professor of peace and world security studies at Hampshire College and the author, most recently, of Rising Powers, Shrinking Planet: The New Geopolitics of Energy (Metropolitan Books).
[This article first appeared on Tomdispatch.com, a weblog of the Nation Institute, which offers a steady flow of alternate sources, news, and opinion from Tom Engelhardt, long time editor in publishing, co-founder of the American Empire Project, author of The End of Victory Culture, and editor of The World According to Tomdispatch: America in the New Age of Empire.] | <urn:uuid:f383744a-0a17-4715-85dc-8ebaec79b87b> | CC-MAIN-2019-09 | https://www.alterinter.org/?Obama-s-Toughest-Challenge | s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247480905.29/warc/CC-MAIN-20190216170210-20190216192210-00281.warc.gz | en | 0.954043 | 3,252 | 2.984375 | 3 |
MM15 Chaeronea (338 BC)
Philip II became King of Macedon in 359 BC. After securing the borders to the north, east and west, he began the expansion south into Greece, waging a war against the combined forces of Athens, Thebes and their allies that would end at Chaeronea, his greatest victory. This was the first and only battle where the whole Macedonian Army gathered in full (up to 24,000 phalangites and almost all the cavalry squadrons): four years later Alexander took half of the army to Persia and Antipater kept the other half to secure Macedonian hegemony in Greece. The Greek army held a strong position between the Chaeronea Acropolis and the marshes along the river Cephissus. The Athenian hoplites were on the left, the smaller contingents from other city-states next to them in the center, and the Thebans, including the elite Sacred Band, held the right. Philip formed the Macedonians into an oblique line, a tactic he learnt in Thebes from Epaminondas himself. Opposite the Athenians, and closest to the enemy line, he placed himself and the Hypaspists. The rest of his phalangites stretched to the left and backwards, with light cavalry on the extreme left. Prince Alexander commanded the Companion cavalry, held behind the line in reserve. On contact, Philip withdrew his forces drawing the Athenians forward. The Thebans refused to move from the river bank, opening a gap in the center of the line which Alexander charged through with his Companions, while the rest of the cavalry attacked on the left flank. At the same time, Philip advanced with his phalanx against the disrupted Athenians and broke them. The Thebans, attacked to flank and rear, fought to the last man. Macedon's supremacy over Greece was finally established. The Hellenic Crusade against Persia was just a matter of time. In 335 BC, after the death of Philip, the Thebans revolted heartened by a false rumor that Alexander had been killed. Alexander squashed the revolt and destroyed the city, slaughtering or enslaving all its citizens. Only 27 years after the death of Epaminondas, Thebes was wiped out from the face of the Earth.
The stage is set. The battle lines are drawn and you are in command. The rest is history.
Take 4 Command Cards
Leader: Philip II
Take 5 Command Cards
Terrain: the river is fordable and the Acropolis plays as a fortified camp and a hill. Marshes (Exp. #2) play as fordable river plus roll 1 die for symbol hit and stop on exit.
Alexander (use Alexander block): the unit with Alexander battles with 1 additional dice in Close Combat.
Special units: the Theban Sacred Band, Alexander's Com- panions and Philip's Hypaspists will ignore 1 sword symbol and may ignore 1 flag.
Tags: Miguel Marqués | <urn:uuid:8bccda20-7094-4362-9c20-a9b8b5e9960d> | CC-MAIN-2019-09 | https://www.commandsandcolors.net/ancients/maps/47-philip-of-macedon-359-338-bc/377-mm15-chaeronea-338-bc.html | s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247518425.87/warc/CC-MAIN-20190222135147-20190222161147-00357.warc.gz | en | 0.96239 | 619 | 2.953125 | 3 |
History of the 109th Infantry Regiment
Battle Honors -- World War I
From time to time the unguarded affairs of the troubled 20th century world have been allowed to boil over. At such times it became the inalienable duty of the citizens to forego their rights and take arms in defense of their country.
Regardless of how wars have been brought on, there was only one thing to do — fight and win them. That is what the men of the 109th Infantry helped to do during their four wars.
The first call to arms came in 1896 when the Regiment, then known as the 13th Infantry, served its first tour of duty in the Spanish-American War. The second call for the 13th came in 1916 when the unit was sent to El Paso, Texas, to quell border raids during a political uprising known as the Mexican Border Campaign. It was after this campaign that the 13th became part of the 28th Infantry Division and in turn, the 109th Infantry.
The Two World Wars
We can well be proud, as members of the 28th Infantry Division, to be part of an organization whose record stands so high in the military history of our country.
["Proudly Served", right:] The famous photograph of American troops before the Arc de Triomphe, marching in battle parade down the Champs Elysees, shows the men of 1st Battalion, 110th Infantry Regiment, 28th Infantry Division in late August 1944. With no time to rest, the Division moved on to fight some of the most bloody battles of the War the day following the parade. (The song that was playing was "Khaki Bill".)
Battle Honors -- World War II
Northern France; Central Europe;
[CIVES ARMA FERANT: "Let the Citizens Bear Arms.]"
Edward Donald Slovik
February 18, 1920 - January 31, 1945
Company G, 109th Inf. Regt., U.S. 28th Inf. Div.
Edward Donald Slovik (February 18, 1920 — January 31, 1945) was a private in the United States Army during World War II and the only American soldier to be executed for cowardice since the American Civil War. Although over 21,000 soldiers were given varying sentences for desertion during World War II, including 49 death sentences, Slovik's was the only death sentence carried out!
Early life and draft
Slovik was born to a Polish-American family in Detroit, Michigan. As a minor, he was arrested frequently. The first time, when he was 12 years old, occurred when he and some friends broke into a foundry to steal some brass. Between 1932 and 1937, he was caught for several incidents of petty theft, breaking and entering, and disturbing the peace. In October 1937, he was sent to jail, but was paroled in September 1938. After stealing and crashing a car with two friends while drunk, he was sent back to jail in January 1939.
In April 1942, Slovik was paroled once more, and he obtained a job at MonteIla Plumbing and Heating in Dearborn, Michigan. There he met the woman who would become his wife, Antoinette Wisniewski while she was working as a bookkeeper for James MonteIla. They married on November 7, 1942, and lived with her parents. Slovik's criminal record made him classified as unfit for duty in the U.S. military (4-F), but shortly after the couple's first wedding anniversary, Slovik was reclassified as fit for duty (1-A) and subsequently drafted by the Army.
Slovik arrived at Camp Wolters in Texas for basic military training on January 24, 1944. In August, he was dispatched to join the fighting in France. Arriving on August 20, he was one of 12 reinforcements assigned to Company G of the 109th Infantry Regiment, U.S. 28th Infantry Division.
While enroute to his assigned unit, Slovik and a friend, Private John Tankey, took cover during an artillery attack and became separated from their detachment. The next morning, they found a Canadian military police unit and remained with them for the next six weeks. Tankey wrote to their regiment to explain their absence before he and Slovik reported for duty on October 7, 1944. No charges against them were filed.
The following day, on October 8, Slovik informed his company commander, Captain Ralph Grotte, that he was "too scared" to serve in a rifle company and asked to be reassigned to a rear area unit. He told Grotte that he would run away if he were assigned to a rifle unit, and asked his captain if that would constitute desertion. Grotte confirmed that it would. He refused Slovik's request for reassignment and sent him to a rifle platoon.
The next day, October 9, Slovik approached an MP and gave him a note in which he stated his intention to "run away" if he were sent into combat. He was brought before Lieutenant Colonel Ross Henbest, who offered him the opportunity to tear up the note and face no further charges. Slovik refused and wrote another note, stating he understood what he was doing and the consequences of his act.
Slovik was taken into custody and confined to the division stockade. The divisional judge advocate, Lieutenant Colonel Henry Summer, again offered Slovik an opportunity to rejoin his unit and have the charges against him suspended. He also offered Slovik a transfer to another infantry regiment. Slovik declined these offers, saying, "I've made up my mind. I'll take my court martial."
The 28th Division was scheduled to begin an attack in the Hurtgen Forest. The coming attack was common knowledge in the unit, and casualty rates were expected to be very high, as the prolonged combat in the area had been unusually grueling. The Germans were determined to hold, and terrain and weather reduced the usual American advantages in armor and air support to almost nothing. Soldiers indicated they preferred to be imprisoned rather than remain in combat, and the rates for desertion and other crimes had begun to rise.
Slovik was charged with desertion to avoid hazardous duty and court martialed on November 11, 1944. The prosecutor, Captain John Green, presented witnesses to whom Slovik had stated his intention to "run away." The defense counsel, Captain Edward Woods, announced that Slovik had elected not to testify. The nine officers of the court found Slovik guilty and sentenced him to death. The sentence was reviewed and approved by the division commander, Major General Norman Cota.
On December 9, Slovik wrote a letter to the Supreme Allied commander, General Dwight D. Eisenhower, pleading for clemency. However, desertion had become a problem, and Eisenhower confirmed the execution order on December 23. The execution by firing squad was carried out at 10:04 a.m. on January 31, 1945, near the village of Sainte-Marie-aux-Mines. Slovik was 24 years old.
Slovik was buried in Plot E of Oise-Aisne American Cemetery and Memorial in Fere-en-Tardenois, alongside 96 other American soldiers executed for crimes such as murder and rape. Their black headstones bear numbers instead of names, so it is impossible to identify them individually without knowing the key. In 1987, 42 years after his execution, Slovik's remains were returned to Michigan and reburied in Woodmere Cemetery, Detroit, next to those of his wife Antoinette Slovik, who had died in 1979. Although Slovik's wife and others have petitioned seven U.S. presidents for his pardon, Slovik has not been pardoned.
In 1960, Frank Sinatra announced his plan to produce a movie entitled The Execution of Private Slovik, to be written by blacklisted Hollywood 10 screenwriter Albert Maltz. This announcement provoked great outrage, and Sinatra was accused of being a Communist sympathizer. As Sinatra was campaigning for John F. Kennedy for President, the Kennedy camp was naturally concerned, and ultimately persuaded Sinatra to cancel the project.
However, Slovik's execution had been the basis for a 1954 book by William Bradford Huie. In 1974, the book was adapted for a TV movie starring Martin Sheen and also called The Execution of Private Slovik. In addition, Eisenhower's execution orders and Slovik's death by firing squad are included in a scene in the 1963 film The Victors.
Kurt Vonnegut mentions Slovik's execution in his novel Slaughterhouse Five. Vonnegut also wrote a companion libretto to Igor Stravinsky's Histoire du soldat, or A Soldier's Tale, which tells Slovik's story. Slovik also appears in Nick Arvin's 2005 novel Articles of War, in which the fictional protagonist, Private George (Heck) Tilson, is one of the members of Slovik's firing squad. | <urn:uuid:18940788-dc6c-4f14-b308-8fc6d698a2c7> | CC-MAIN-2014-41 | http://hampton.lib.nh.us/hampton/history/military/28thDivision109thRegt/109thhistory.htm | s3://commoncrawl/crawl-data/CC-MAIN-2014-41/segments/1410657134514.93/warc/CC-MAIN-20140914011214-00334-ip-10-234-18-248.ec2.internal.warc.gz | en | 0.985665 | 1,846 | 3.390625 | 3 |
As Russian bombs rain down on Ukraine, there is a huge focus on the ‘oligarchs‘ and business figures close to Vladimir Putin who have profited from the corrupt underpinnings of Russia’s political economy.
Russia was dubbed a kleptocracy by American political scientist Karen Dawisha in her 2014 book Putin’s Kleptocracy: Who Owns Russia? But what exactly is a kleptocracy and in what ways is the term appropriate for Russia?
Definition of a kleptocracy
Most explanations of kleptocracy – derived from the Greek for ‘thief’ and ‘rule’ – stress the aspect of ‘grand corruption’ whereby high-level political power is abused to enable a network of ruling elites to steal public funds for their own private gain using public institutions.
Kleptocracy is therefore a system based on virtually unlimited grand corruption coupled with, in the words of American academic Andrew Wedeman, ‘near-total impunity for those authorized to loot by the thief-in-chief’ – namely the head of state.
Often oligarchs are seen as characteristic of Russia’s kleptocracy, but the Russia of the 1990s was not a kleptocracy as the oligarchs represented a power base outside of the Kremlin, one that Putin had to dismantle by exiling or jailing those who opposed him.
In a true kleptocracy, the oligarchs are the politicians themselves – often referred to as ‘poligarchs’. The former head of the Russian state railways Vladimir Yakunin – whose mansion famously had a whole room dedicated to storing his wife’s fur coats – is a good example, as is Dariga Nazarbayeva from Kazakhstan, the eldest daughter of the country’s first president, who rose to the rank of chair of the Senate while sitting on a $595 million fortune.
The undeniable vast wealth of each of these ‘PEPs’ (politically-exposed person) is explained, they have said, by legitimate personal business earnings and salary. Nazarbayeva successfully resisted a UK court process to explain the source of expensive real estate linked to her.
Some definitions of kleptocracy introduce the concept of illegality – for example a ‘rent-seeking state where favouritism happens illegally’ although this poses problems as kleptocratic regimes do not apply the law evenly.
Illegal activity on behalf of government officials is either ignored, allowing corrupt funds to flow out of the country, or ruled legal by a corrupted legal system – ‘legalized’ illicit financial flows.
Such nations also provide ample opportunities for rent-seeking by awarding lucrative contracts to family members or friends of those in power, which is corrupt but may not be illegal under the laws of that country.
Self-enrichment not the only motivating factor
Clearly self-enrichment is a driving force behind kleptocracies but kleptocratic overreach – stealing too much – may be the death knell for a regime. In a story relayed in Sarah Chayes’ Thieves of State, Tunisian president Ben Ali ‘went berserk’ in his quest to capture the country’s wealth, causing an ‘unimaginable’ development gap and ultimately leading to the overthrow of his government.
Wealth will be lost if the ruling elite cannot remain in power. If they succeed in ousting the incumbents, opposition political factions look to confiscate assets of the previous regime and close opportunities for them to further enrich themselves.
Therefore, a ‘well-functioning’ kleptocracy maintains the system by controlling the money-making enterprises and natural resources, with the head of state attempting to avoid intra-elite conflict by dividing the spoils between various groups or family members.
This is manifested through the country’s top enterprises being controlled by economic ‘frontmen’ who use a network of offshore shell companies to funnel earnings out of the company – and then the country – on behalf of their patrons, the more senior members of the regime.
Some kleptocratic gains are reinvested in political campaigns or in media companies to help frame the kleptocrat’s narrative. Dariga Nazarbayeva’s ownership of Kazakhstan’s largest media company Khabar is a good example of how the domestic narrative can be reframed.
Money is also invested in ‘safe’ assets, such as real estate overseas, or simply hoarded in foreign bank accounts to be used in emergencies – a war chest for a political campaign – or in relocating if the ruling elite is ever removed from power. Hoarding also prevents potential economic and political rivals from getting their hands on capital that could be used to oust the current regime.
It is not surprising that one of the only serious challenges to the presidency of Nursultan Nazarbayev in Kazakhstan came from former government minister and bank manager Mukhtar Ablyazov who was accused of siphoning $5 billion from a bank he managed. Without any possibility of challenging leadership through democratic means, opponents often try to accrue wealth in the same fashion.
The most successful kleptocracies are those which, rather than strip the house bare, occupy it and allow other members of the household to generate their own income while paying ‘rent’ to the landlord – the godfather-like head of state.
This is why the structure of kleptocracies are is often compared to that of an organized crime groups – unlike in a democracy where capital by and large flows down to the people, money in a kleptocracy is passed up the chain from junior ministers to ministers, then to the head of state and his family.
The relationship between kleptocracies and dictatorships
Kleptocracies may appear stable for decades but are ultimately fragile. In January 2022, peaceful protests in Kazakhstan concerning increased fuel costs descended into violence, leading to the deaths of more than 225 people.
Kazakhstan observers reported the violence may have been provoked by, amongst others, a nephew of former president Nazarbayev, as it was likely their money-making opportunities were being threatened by his successor Kassym-Jomart Tokayev. With no rules-based approach as to who should control what, such seemingly spontaneous conflagrations are to be expected.
A successful kleptocracy provides just enough for the national economy to prevent popular uprisings or be protected by repressive state security services so that uprisings are quashed. It is of course easier to maintain control over a country’s resources if absolute power can be exerted. Turkmenistan, a country ruled for 30 years by dictators of ludicrous proportions, sees 80 per cent of its gas revenues disappear into a black hole.
But not all kleptocracies are dictatorships. Ukraine under President Yanukovych resembled a kleptocracy – Yanukovych’s luxurious private residence made headlines with its golden toilet and bathroom decorated with €350,000 worth of semiprecious stones – yet the election that saw him come to power in 2010 was contested against bitter rival Yulia Tymoshenko. And Nigeria is a country which is politically plural to some extent yet has lost billions over the decades from kleptocratic practices, especially in relation to its oil sector.
And being an autocracy does not necessarily make a country a kleptocracy. Communist dictatorships provide a different model of economic control as there are no private economic actors.
Elites in communist regimes do find ways of garnering private wealth corruptly – in 1980s USSR, high-ranking agents in the KGB generated money by smuggling in embargoed goods from Europe – but the system itself is not built on private control of what should be state assets.
The effects of kleptocracy are felt in other countries
Sometimes debate over whether a particular country is or is not a kleptocracy can detract attention away from whetherhow liberal democracies should support such regimes through providing financial services to them.
Journalist Oliver Bullough says it is ‘pointless’ to ask whether Russia is a kleptocracy, but rather is more appropriate to ‘examine how Russia’s elites are part of a kleptocratic system by which their thefts from the national budget are connected, via Scottish limited partnerships and Moldovan or Latvian banks, to the London property market’.
Kleptocracies need other systems to survive, and recent academic research rightly stresses their ‘transnational’ aspect – UK academic John Heathershaw defines kleptocracy as a state supported by ‘cross-border ties, typically in the form of non-state networks, by which authoritarian elites gain and keep power and wealth’.
As described in the December 2021 Chatham House paper, kleptocracies rely on professional services provided by the UK and other democracies to legalize, legitimize, and hide dubiously acquired wealth.
Wealth managers and solicitors suggest tax optimization schemes, company formation agents help kleptocrats create complex networks of offshore companies to make their assets hard to trace, real estate agents help them invest in luxury property with few questions asked, and PR agents suggest donations to universities and charities to help launder their reputation.
For many years the UK has been happy to accept cash from kleptocracies but, following Russia’s attack on Ukraine, the folly of the ‘no questions asked’ approach is starting to be more widely understood. | <urn:uuid:c62ac780-4f13-41b8-be3b-7927d3d17300> | CC-MAIN-2024-10 | https://www.chathamhouse.org/2022/07/what-kleptocracy-and-how-does-it-work | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474795.48/warc/CC-MAIN-20240229071243-20240229101243-00770.warc.gz | en | 0.955358 | 1,982 | 2.578125 | 3 |
The fall Healthy Futures Challenge kicked off in 187 elementary schools across Alaska on September 1st.
The new Challenge comes with three primary changes that we hope will improve accessibility, simplicity and effectiveness.
1. Activity logs now represent a month rather than a 4-week block. Students must complete at least 15 days of 60 minutes of physical activity per month for a successful Challenge.
Why the change: Tracking by the month should be simpler, and changing to 60 minutes of activity aligns better with the CDC and Play Every Day recommendations. We are eliminating the activity log goal of 30 minutes of physical activity outside of the school day and replacing that with 60 minutes of physical activity in total for the day. Students will remain fully responsible for completing their activity log — regardless of where the activity occurs.
2. The schools with the three highest rates of participation in each population category will now receive a banner rather than a cash prize.
Why the change: Often the winning schools are from demographic areas that have highly engaged and supportive families and children that tend to be physically active. We still want to recognize the schools with the greatest student participation, but instead of a grant, they will receive a banner to hang.
3. We will continue to hold a drawing among all schools that achieve at least 20% participation in the Healthy Futures Challenge. However, we will now award a $200 prize to 25 schools that meet this criteria. The money must be used to purchase educational materials or equipment that supports student physical activity.
Why the change: With smaller increments, prize money can be distributed equitably and all schools that qualify will have an equal chance of winning the prize. | <urn:uuid:a0405ff5-d2f2-4b4a-a1bd-66d7f935b236> | CC-MAIN-2017-22 | http://healthyfuturesak.org/2015/10/28/new-improved-healthy-futures-challenge/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463613796.37/warc/CC-MAIN-20170530051312-20170530071312-00146.warc.gz | en | 0.946587 | 335 | 2.5625 | 3 |
Doctor Manny answers fitness questions for Fox Health news. A viewer wrote in after he noticed several runners in Central Park New York using elevation training masks, the viewer wants to know if claims that the masks build lung capacity and endurance are and if they are safe to use. Doctor Manny answers that the masks work using a valve system that let’s less oxygen in, it makes you take deeper breaths. The lungs are forced to work harder, increasing lung capacity and adjusting to allow a more efficient use of oxygen in your body. When you look at scientific studies, these masks have not been shown to increase hemoglobin, which carries oxygen in the body.however by making it hard to breathe, the muscles used for inspiration become stronger and more efficient. So there is some benefit to using these masks.
Key Points of Video:
- 1Wearing a simple mask while working out can increase effectiveness of exercising.
- 2Learn to simulate high altitudes in workouts by wearing mask.
- 3Increase hemoglobin in the blood and oxygen content by wearing this simple mask. | <urn:uuid:8c010ff1-ea71-40ba-a71f-c51639cfef0c> | CC-MAIN-2019-13 | https://www.healthstatus.com/health_blog/body-fat-percentage-calculation/can-elevation-training-mask-boost-fitness/ | s3://commoncrawl/crawl-data/CC-MAIN-2019-13/segments/1552912205597.84/warc/CC-MAIN-20190326160044-20190326182044-00023.warc.gz | en | 0.935563 | 216 | 2.671875 | 3 |
Ask any successful business owner and they will tell you their success was not based on luck. The success – and failure – of a business is dependent upon the strength of their business strategy. A successful strategic plan employs cost reduction, development, and sustainability techniques to ensure a bright future. You need to know your business inside and out in order to create a comprehensive and realistic plan.
Your strategy should help you achieve the objectives of your business. A business strategy is the driving force behind any organization, and takes the form of an official report. Businesses are self-sustainable systems, when you change one thing in the system; it has a positive or negative chain reaction. Like an organism, businesses learn how to adapt to the change if it is positive, and rectify the situation if it is negative.
Organizations have several phases of development, including creativity, direction, delegation, and consolidation. A company may start out with lenient rules and regulations, but as time progresses management adopts more efficient policies that hinder creative thinking. Companies mature and lose sight of their goals and mission statements, with more of an emphasis placed on individual projects or initiatives. As a business enters maturity processes, departments, and policies are refined to reunite the organization.
Ways to Conduct Business Strategy
Historically there are two ways to develop a business strategy, using the “bottom up” and “top down” models. The bottom up method is when employees generate ideas on the floor and the best results are passed onto management. The top down strategy is when business owners create the strategy and implement the changes without seeking employee feedback. Unfortunately, both models fail to include all of the employee feedback.
The new method of developing a business strategy uses a collaborative process, which is when managers and employees exchange information and work together to create a sustainable solution. It is a team-oriented process that bridges the gap that exists between managers and workers. Before you create a business strategy ensure you have the additional resources to carry out the task without interfering with normal operation. Assign tasks and delegate responsibilities while keeping to a defined chain of command.
Functional versus Operational Business Strategies
There are two types of business strategies: functional and operational. The functional strategy focuses on general ideas and a variety of tasks for different departments. The generality is a major disadvantage, however; areas of concentration include marketing, new product launches, human resources, financial assets, and legal issues. Functional strategies provide a nice overview of the business but do not tackle the important issues employees encounter day-to-day.
Operational strategies are ideal for businesses that want to reduce costs and streamline processes because it is much narrower in scope and requires accountability on all levels. The detail oriented plan encompasses everyone and everything, from the number of cashiers on duty to how much inventory is carried at a given time. A strategy is unique to each business and reflects the needs and requirements of the company’s management.
Implementing a Business Plan
A business plan is the textual version of a strategy, as it includes pertinent information regarding the company, including: vision and mission statements, measurable objectives supporting the vision, actionable tactics meeting the objective, resources, milestones and timeframes, accountability and role designations, as well as internal and external risks. The business strategy is not evergreen and should be evaluated routinely to ensure the company still has the competitive edge.
A business plan includes the primary and secondary objectives of your organization, an analysis of current policies and procedures, and the development of new policies or procedures to correct weaknesses within the organization. Before beginning a strategy, it is helpful to conduct a SWOT analysis, which helps identify weaknesses and loopholes within the organization. Your competition capitalizes on your weaknesses, thus it is essential to continuously evaluate your business.
Developing a Competitive Strategy
Brainstorming and collaboration are essential to the development of a successful business strategy. Begin the process by identifying the strengths and weaknesses of the organization. Without erasing responses, continue to identify current opportunities that help your business succeed. Finish the SWOT analysis by identifying threats or risks that place your business in danger. Identify how your company beats the competition, outlining the various strategies already in place.
Identify your current target audience and list potential audiences in the form of demographics. Assess current market conditions and how your company can defeat the competition. Reevaluate how you are reaching current and potential customers and consider your overall marketing plan. Think positively and develop solutions to overcome any weaknesses that you have discovered thus far. Admitting your weaknesses is the hardest part of drafting a business plan, as most companies want to appear strong and mighty. Research why you have these weaknesses and find realistic solutions to the problems.
Business owners often become so caught up with their work that they fail to concentrate on their business strategy, which is a significant source of cost reduction. Achieve your goals by dedicating time each month or week to address issues surrounding the operation of your business. Make the process a tradition, ensuring operations are aligned with current goals and future forecasts. Make your business stand out from the competition by utilizing different techniques to attract the most people.
A successful strategy overcomes organizational hurdles by understanding customer needs and predicting the unpredictable. The formation of a business strategy is a science that combines current circumstances with a variety of internal and external variables, addressing immediate and long-term goals of the organization. The implementation of the strategy is rolled out slowly, starting with management. The plan encompasses everyone; however, customers are indicative of the final result.
Significant Problems Encountered in Implementing a New Strategy in a Business
Marketing Strategy and Planning: The Road Map
Turbo Strategy – A Book Summary | <urn:uuid:8f24b323-89cc-4b98-8f9b-34138193c2f8> | CC-MAIN-2023-14 | https://bosbiztools.com/how-to-implement-a-business-strategy-in-your-organization.html | s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296948684.19/warc/CC-MAIN-20230327185741-20230327215741-00506.warc.gz | en | 0.941209 | 1,161 | 2.71875 | 3 |
Often mycoplasmal infections remain without symptoms until the victim suffers a traumatic event (stress, injury, accident etc.) These stressing events enable the mycoplasma to begin consumption of cholesterol and symptoms may begin to present. The mechanism of this deterioration is thought to be suppression of the immune system secondary to stress.
Cholesterol is vitally important for brain function. While your brain represents about 2-3% of your total body weight, 25% of the cholesterol in your body is found in your brain, where it plays important roles in such things as membrane function, acts as an antioxidant, and serves as the raw material from which we are able to make things like progesterone, estrogen, cortisol, testosterone and even vitamin D.
– See more at: http://www.drperlmutter.com/brain-needs-cholesterol/#sthash.wfg9acAC.dpuf
Antibiotics, conventional or holistic, can only kill the bacteria when it is exposed. If Borrelia is concealed within a biofilm, antibiotics have no way of penetrating and become ineffective. In order for antibiotics to kill the bacteria that resides within a biofilm, it will require the assistance of a biofilm dissolver.
Biology professor, Lida Mattman, author of Cell Wall Deficient Forms: Stealth Pathogens, has been able to recover live spirochetes of Borrelia burgdorferi (Bb) from mosquitos, fleas, mites, semen, urine, blood, and spinal fluid. A factor contributing to making Bb so dangerous is that it can survive and spread without having a cell wall (cell wall deficient CWD). Many valuable antibiotics kill bacteria by breaking down the cell wall. These antibiotics often prove ineffective against Bb.
cyst form and lyme disease. Borrelia Burgdorferi is capable of transforming into a cyst when it feels its life is threatened. While in cyst form, Borrelia obtains immunity from antibiotics, its host’s immune system, and temperature and PH variations.
The Sacramento, California blood bank believes that Lyme Disease (LD) can be spread by blood transfusions. The CDC (Center for Disease Control) in Atlanta, Georgia states that their data indicates that Borrelia burgdorferi (Bb) can survive without detection by the blood processing techniques used for transfusions in the U.S.
Researchers at the Univ. of Wisconsin have reported that dairy cattle can be infected with Borrelia burgdorferi (Bb) hence milk could be contaminated. Bb can also be transmitted to lab animals by oral intake such as food.
Unpasteurized milk will be the most vulnerable.
There is compelling evidence that Lyme disease (LD) can be spread by sexual and congenital transfer. One physician has cared for 5000 children with LD. 240 of these children were born with the disease. Dr. Charles Ray Jones, the leading pediatric specialist on Lyme Disease, has found 12 breast fed children who have developed LD. Miscarriage, premature births, stillborn, birth defects, and transplacental infection of the fetus have all been reported. Studies at the Univ. of Vienna have found Borrelia burgdorferi (Bb) in urine and breast milk of LD mothers.
Based on innumerable declassified government documents, scores of in-depth interviews, and access to Plum Island itself, this is an eye-opening, suspenseful account of a federal government germ laboratory gone terribly wrong. Read Lab 257 for a journey that will take you deep inside this secret world and presents startling revelations including virus outbreaks, biological meltdowns, infected workers who were denied assistance in diagnosis by Plum Island brass, the periodic flushing of contaminated raw sewage into area waters, and the insidious connections between Plum Island, Lyme disease, and the deadly 1999 West Nile virus outbreak.
….if it only wasn’t true…
Our society has greatly under estimated the prevalence and severity of Lyme Disease symptoms.
Here are some accounts of violent, aggressive, horrific acts perpetrated by victims of Lyme Disease.
The microbiome of your gut is your primary brain connection, endocrine center, immune defense and emotion headquarters.
Follows are recent news links:
Dr. Hyman makes some excellent points about antibiotics and microbiome. As far as ordering resistant potato starch – just stop rinsing the starch off of the potatoes before you cook them.
what your gut really thinks of you
SIBO alters vitamin K2 metabolism https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5323449/
“…the American diet-raised mouse microbiomes responded more strongly to their new healthy diets once they moved into communities with the calorie-restricted mice.” [Telling some one to, coprophag and die, might give them more microbiome diversity and live longer!]
Make sure your probiotics have been tested to influence your gut “positively”!
This article emphasizes the need to recondition the gut while changing from a S.A.D. to nutrient dense, plant enriched diet to optimize a healthy assimilation. Only then, can one experience weight loss, improved immunity and emotional control.
This is why a 12 hour fast each day is important.
Immune maturation studies from germ free guts. Biofilms mentioned.
Generation of Germ-Free Ciona intestinalis for Studies of Gut-Microbe Interactions
Dr. Susan Marra says, “Borrelia burgdorferi, the bacteria that causes Lyme Disease, also dramatically effects the healthy microbiome. If you imagine your microbiome as being a beautiful garden void of weeds, and then reimagine it as a weed orvergrown garden when you get infected with Lyme Disease or coinfections, you can quickly understand just how out of balance your microbiome becomes with tick-borne infections.”
Gut model studies showed that the best time to eat was during the day within a 12 hour window so that the MegaSporeBiotic could complete its life cycle within a 12 hour fasting time of not eating.
Israeli researchers found that significant changes in liver physiology when subjecting microbiome to different drugs. They could produce the same effect just by changing the feeding times of the mice; mice forced to eat only during the day showed different patterns of microbiota metabolites circulating in the blood than those allowed to eat at night, their natural active period.
Daniel A Jaller, MD says, “As we know, Lyme is a multisystem disease and can negatively impact virtually every organ system in the body. We have previously shown that Lyme can live in the gut, likely disturbing the microbiome without any help from us.
Circadian rhythms and the microbiome: Disrupting daily routine of gut microbes
This manual is available on Amazon. It helps explain the Zyto and EVox techniques and how they are used for quantum healing. Mycoplasma (MFI) is discussed as an example case. In general the EVox works like an emotional polygraph.
Acute onset gastrointestinal symptoms in patients with these
diseases are accompanied by seroconversion to specific viral
or M. pneumoniae antigens. As indicated earlier,
mycoplasmas can elicit pleiotropic immune responses and are
difficult to eliminate in patients despite appropriate
antibiotic treatment. Steroid therapy to control
gastrointestinal symptoms in these patients, along with the
multifaceted biological properties associated with
pathogenic mycoplasmas, may precipitate the onset of acute
exacerbations of chronic inflammatory bowel disease.
Rheumatoid Arthritis and Other Human Arthritides The
occurrence of various Mycoplasma and Ureaplasma species in
joint tissues of patients with rheumatoid arthritis,
sexually transmitted reactive arthritis, and other human
arthritides can no longer be ignored (8). A clinical trial
of longterm (6 to 12 months) antibiotic (doxycycline)
therapy before cartilage destruction might prove beneficial
in managing such frequent and often debilitating infections.
Extensive clinical and microbiological evidence indicates
that mycoplasmas alone can elicit a spectrum of illness for
which no other agents are incriminated. The eradication of
these pathogenic mycoplasmas from various tissue sites
requires an intact and functional immune system, although
persons with fully competent immune systems may have
difficulty eliminating mycoplasmas, even with recommended
prolonged drug therapy. Nonetheless, mycoplasmas are still
viewed as subordinates to other infectious agents and are
relegated to a category of commensals that unwittingly
cause disease in patients whose immune systems offer little
resistance to microbial stress and overload. The
fundamental importance of mycoplasmas in specific diseases
of humans, animals, insects, and plants is irrefutable, and
their unique biological properties are consistent with
their intimate association with host target cells. These
remarkable bacteria must continue to receive the scientific
attention of mycoplasmologists, cell culturists,
clinicians, immunologists, and DNA sequencers who most
recently are compiling extensive databases that may
eventually dissect every approachable mycoplasmal element
that defines their biological and genetic being.
Nonetheless, mycoplasmas remain mysterious and enigmatic,
and the available data and proposed hypotheses that
correlate mycoplasmas with disease pathogenesis range from
definitive, provocative, and titillating to inconclusive,
confusing, and heretical. Controversy seems to be a
recurrent companion of mycoplasmas, yet good science and
openmindedness should overcome the legacy that has burdened
them for decades. | <urn:uuid:60ea3571-b1ae-46f0-a42f-c655d2547a31> | CC-MAIN-2018-13 | https://conceptsinquantumwellness.wordpress.com/blog/ | s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257647244.44/warc/CC-MAIN-20180319234034-20180320014034-00380.warc.gz | en | 0.891578 | 2,039 | 2.984375 | 3 |
N-Cards (19th Century Tobacco)
N-Cards are tobacco cards from the 19th Century when trading cards first arrived. In addition to the N-Card designated issues, many releases were printed that were not cataloged. Those issues are listed at the end in alphabetical order. N-Cards are one of two tobacco card types. They represent 19th Century cards while T-Cards are tobacco cards from the 20th Century.
One important distinction regarding Jefferson Burdick and N-Cards is that his American Card Catalog did not classify N-Cards the way that we do today. His book actually catalogued N-Cards as Central and South American tobacco cards. Today, collectors categorize N-Cards as tobacco issues in the 19th Century. That, understandably, has led to some confusion among collectors.
Tobacco cards were popular (and at least one even led to a marriage) but they were also being blamed for causing all sorts of problems related to children collecting them. After a temporary ban on American tobacco cards in the late 1800s, they came back with a bang in the early 1900s with T-Cards.
While some N-Cards are crude in design, many also feature some excellent lithography. Issues such as N28/N29 Allen & Ginter and N162 Goodwin, for example, are considered among the finest trading card sets in terms of the artwork.
Many N-Cards feature color lithography. Some, however, look drastically different. Issues such as the N172 Old Judge set feature actual sepia-tone photographs that were printed then mounted onto cardboard backing. Many of these types of cards have faded over time, making them difficult to preserve. N-Cards that were similarly produced have a premium placed on them if the images are clear.
Early tobacco cards were incredibly popular with both children and adults. And while ones picturing sports figures were popular, many pictured actresses and unknown women, which were also incredibly popular. Men routinely even pursued women that were pictured on them and at least one relationship that begun as the result of such a pursuit actually ended in a marriage.
Note that this page contains only 19th Century tobacco cards here. Other 19th Century cards appear on other pages and grouped together as similar items. Any 19th Century card not fitting a particular classification can be found on the U-Card page, which contains all sorts of miscellaneous issues as was intended by Burdick.
19th century tobacco cards in America mostly ended in 1897 because a ban on them existed. However, that ban was lifted a few years later, leading to the reintroduction of tobacco issues by the early 1900s. Additionally, no such ban existed in the rest of the world so other international issues were continued without interruption.
Looking to learn more about collecting tobacco cards? Here’s an introduction of sorts that I wrote, which covers their history. | <urn:uuid:b3aef9aa-8e97-478a-a178-3fa07474194a> | CC-MAIN-2019-43 | https://prewarcards.com/pre-war-card-database/pre-war-baseball-card-sets-checklists/n-cards-19th-century-tobacco/ | s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570986669546.24/warc/CC-MAIN-20191016190431-20191016213931-00386.warc.gz | en | 0.984517 | 600 | 2.96875 | 3 |
Table of Content
- Objectives of Non-destructive Testing (NDT)
- Classification of NDT Methods and Physics Applied
- Introduction to Nanoparticles and Nanotechnology
- Optical Properties of Nanoparticles
- Applications of Nanoparticles and Nanotechnology
- Key Takeaways
Non-Destructive Testing comprises an ensemble of techniques utilized to meticulously examine and evaluate materials for defects or irregularities without causing impairment to their original state.
It encompasses an array of methodologies – from ultrasonic and Radiographic Techniques to electromagnetic and visual inspections – each designed to meticulously scrutinize structural elements ranging from aircraft components to critical infrastructure, ensuring operational robustness and safety without the need for destructive interventions. | <urn:uuid:696a25f1-af24-46d1-ad8f-b1e72485f9da> | CC-MAIN-2024-10 | https://www.onestopndt.com/ndt-articles/nanotechnology | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474594.56/warc/CC-MAIN-20240225071740-20240225101740-00580.warc.gz | en | 0.838454 | 143 | 2.96875 | 3 |
Bayer CropScience has voluntarily agreed to cancel or phase-out the labeled uses of Guthion insecticide (azinphos-methyl) on 30 crops including potatoes.
Use of the product will be cancelled for potatoes and six other crops on Aug. 31, 2005. It cannot be used after Dec. 31, 2005. Other crops will have use cancelled after Sept. 1, 2002.
According to Dr. Wayne Carlson of Bayer CropScience, “Azinphos-methyl has proven itself a safe and valuable crop-protection product for both farmers and consumers for over 45 years.
“Nonetheless, we wanted to work together with the grower organizations so that we could cooperate with the EPA in helping the agency meet its objective of reducing worker exposure.”
Carlson said that for the crops for which use will be discontinued or phased out, growers could now turn to newer chemistries that more specifically target pests. | <urn:uuid:ef82a70d-aa5b-459e-9b09-3b7623408ec1> | CC-MAIN-2015-06 | http://www.potatogrower.com/2002/07/bayer-agrees-to-phase-out | s3://commoncrawl/crawl-data/CC-MAIN-2015-06/segments/1422115927113.72/warc/CC-MAIN-20150124161207-00015-ip-10-180-212-252.ec2.internal.warc.gz | en | 0.939414 | 192 | 2.625 | 3 |
How to Find the Roots of Quadratic Equation in VB.Net
If you are trying to write code on how to solve quadratic equations, hopefully this tutorial will help you a lot. In this simple program, it will determine the number of roots the equation has and as well as compute the roots. Just follow the steps below to find it out.
Open Microsoft Visual Studio 2015 and create a new windows form application.
Do the form just like this.
Double click the button to fire the
click event handler of it and create a method for finding the roots of q quadratic equation.
- Private Sub Button1_Click(sender As Object, e As EventArgs) Handles Button1.Click
- Dim a, b, c As Integer
- Dim sqrt, result1, result2 As Double
- b = Val(InputBox(“enter value for b”))
- a = Val(InputBox(“enter value for a”))
- c = Val(InputBox(“enter value for c”))
- sqrt = Math.Sqrt(b * b - (4 * a * c))
- result1 = (b + s) / (2 * a)
- result2 = (-b + s) / (2 * a)
- TextBox1.Text = result1
- TextBox2.Text = result2
- End Sub
For any questions about this article. You can contact me @
Email – [email protected]
Mobile No. – 09305235027 – TNT
Or feel free to comment below. | <urn:uuid:6bc7d3d5-a837-4e57-b179-b1902c732477> | CC-MAIN-2019-04 | https://www.sourcecodester.com/tutorials/visual-basic-net/12766/how-find-roots-quadratic-equation-vbnet.html | s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547583661083.46/warc/CC-MAIN-20190119014031-20190119040031-00063.warc.gz | en | 0.776255 | 346 | 3.40625 | 3 |
- Research article
- Open Access
Evolutionary conservation and changes in insect TRP channels
BMC Evolutionary Biology volume 9, Article number: 228 (2009)
TRP (Transient Receptor Potential) channels respond to diverse stimuli and thus function as the primary integrators of varied sensory information. They are also activated by various compounds and secondary messengers to mediate cell-cell interactions as well as to detect changes in the local environment. Their physiological roles have been primarily characterized only in mice and fruit flies, and evolutionary studies are limited. To understand the evolution of insect TRP channels and the mechanisms of integrating sensory inputs in insects, we have identified and compared TRP channel genes in Drosophila melanogaster, Bombyx mori, Tribolium castaneum, Apis mellifera, Nasonia vitripennis, and Pediculus humanus genomes as part of genome sequencing efforts.
All the insects examined have 2 TRPV, 1 TRPN, 1 TRPM, 3 TRPC, and 1 TRPML subfamily members, demonstrating that these channels have the ancient origins in insects. The common pattern also suggests that the mechanisms for detecting mechanical and visual stimuli and maintaining lysosomal functions may be evolutionarily well conserved in insects. However, a TRPP channel, the most ancient TRP channel, is missing in B. mori, A. mellifera, and N. vitripennis. Although P. humanus and D. melanogaster contain 4 TRPA subfamily members, the other insects have 5 TRPA subfamily members. T. castaneum, A. mellifera, and N. vitripennis contain TRPA5 channels, which have been specifically retained or gained in Coleoptera and Hymenoptera. Furthermore, TRPA1, which functions for thermotaxis in Drosophila, is missing in A. mellifera and N. vitripennis; however, they have other Hymenoptera-specific TRPA channels (AmHsTRPA and NvHsTRPA). NvHsTRPA expressed in HEK293 cells is activated by temperature increase, demonstrating that HsTRPAs function as novel thermal sensors in Hymenoptera.
The total number of insect TRP family members is 13-14, approximately half that of mammalian TRP family members. As shown for mammalian TRP channels, this may suggest that single TRP channels are responsible for integrating diverse sensory inputs to maintain the insect sensory systems. The above results demonstrate that there are both evolutionary conservation and changes in insect TRP channels. In particular, the evolutionary processes have been accelerated in the TRPA subfamily, indicating divergence in the mechanisms that insects use to detect environmental temperatures.
Transient receptor potential (TRP) superfamily members of cation channels share six common transmembrane domains and permeability to cations. Despite these similarities, TRP channels are highly unusual among the known families of ion channels in displaying an impressive diversity of cation selectivities and specific activation mechanisms. TRP channels have crucial functions for various sensory modalities in different metazoans. They are involved in vision, thermosensation, olfaction, hearing, and mechanosensation and thus enable animals to perceive the external environment. Moreover, TRP channels enable individual cells to sense changes in their local environment, for example, osmolarity and fluid flow. Many TRP channels are activated by a variety of different stimuli and function as primary signal integrators. TRP channels are expressed and function in a variety of multicellular organisms, including nematodes, fruit flies, fish, mice, and humans. The TRP superfamily is divided into seven subfamilies, namely, TRPC, TRPA, TRPV, TRPN, TRPM, TRPP, and TRPML based on their sequence elements and domains. For example, TRPC, TRPA, TRPV, and TRPN channels have multiple N-terminal ankyrin repeats [1–3].
Physiological functions of TRP channels have been exclusively characterized in fruit flies and mice to date. Moreover, comparative genomics and evolutionary studies of TRP channels are also limited. We therefore performed a comparative genomics study of insect TRP channels as part of insect genome sequencing efforts. The sensory modalities of insects are almost comparable to those of mammals; insects can see, feel touch, hear, smell, taste, and detect temperature, humidity, wind, gravity, magnetism, and seismogram. It has been shown that some of these sensory modalities are dependent on TRP channels in fruit flies [4–10]. Among insect sensory modalities, the mechanisms of thermosensation could be quite different from those of mammals because insects are relatively small, and thus they have a larger ratio of surface area to volume than mammals. Furthermore, they do not have systems to keep their body temperature constant. Thus, their body temperatures are more susceptible to changes in environmental temperature than mammals. While mammals sense the temperatures of body surface and directly touched objects as somatosensory stimuli, insects are able to sense temperatures from the distance by detecting the temperature gradient of air [11, 12]. This might lead to the different evolution of thermo-sensitive TRP channel genes in insects and mammals. Thermo-sensitive TRP channels are the specific TRP channels which are activated by either temperature increase or decrease [1–3]. Since all thermo-sensitive TRP channels belong to TRPA subfamily in fruit flies [8–10], the evolution of insect TRPA subfamily might be very dramatic. Here, we identify and compare all TRP channel genes in the sequenced insects, Drosophila melanogaster (Diptera), Bombyx mori (Lepidoptera), Tribolium castaneum (Coleoptera), Apis mellifera (Hymenoptera), Nasonia vitripennis (Hymenoptera), and Pediculus humanus (Phthiraptera). These insect species represent 4 major orders of holometabolous insects as well as 1 order of hemimetabolous insects. Evolutionary conservation and changes in the insect TRP channels are discussed.
Results and Discussion
Conservation of insect TRPV, TRPN, TRPM, and TRPML subfamilies
There are 13 identified TRP channel genes in Drosophila ; we used them as queries to identify TRP channel genes in the P. humanus, B. mori, T. castaneum, A. mellifera, and N. vitripennis genomes. A summary of the results is shown in Table 1 and 2. Classification of the TRP channels into subfamilies is based on the phylogenetic tree (Fig. 1) constructed from the channel-forming six transmembrane domain sequences of all TRP channels identified. These sequences were chosen for the analysis because they are the only domains shared with all TRP channels, and the other parts are too divergent. All the insects examined contain 2 TRPV, 1 TRPN, 1 TRPM, 3 TRPC, and 1 TRPML channels. Drosophila TRPV channels (Nan and Iav) are necessary for hearing [6, 7, 13], and Nan functions as a dry receptor for hygrosensation . The Drosophila TRPN channel, NompC, is associated with mechanosensation as well as hearing [13, 15]. Drosophila TRPC channels, TRP and TRPL, are necessary for phototransduction [16, 17]. TRPML is necessary for lysosomal function and autophagy in Drosophila . The functions of the TRPM channel have not been identified in insects. Some of mammalian TRPM channels are associated with taste and cold perception [20, 21]. These results may suggest that the mechanisms to detect mechanical and visual stimuli as well as humidity are evolutionarily well conserved in both holometabolous and hemimetabolous insects. Daphnia pulex, a crustacean, contains the same numbers of members of these TRP subfamilies except that it has 2 TRPM channels (data not shown). These results thus suggest that 2 TRPV, 1 TRPN, 1 TRPM, 3 TRPC, and 1 TRPML channels were at least present in the last common ancestor of insects and branchiopods [22–24]. Furthermore, they could be the "core" set of TRP channels present in arthropods. The nematode Caenorhabditis elegans contains 5 TRPV, 1 TRPN, 4 TRPM, 3 TRPC, and 1 TRPML channels, more TRPV and TRPM channels than are present in insects . Similarly, the vertebrates, for example mouse, have 6 TRPV and 8 TRPM channels. Phylogenetic analysis of C. elegans, D. melanogaster, and mouse TRPV and TRPM channels demonstrates that C. elegans and mouse independently expanded these subfamily members during their evolution (Fig. 2). It is therefore unlikely that insects have lost them from the last common ancestor of Bilateria (Urbilateria). The origin of the TRPN channel can be traced back to Urbilateria because it is present in both Ecdysozoans (insects, water flea, and nematode) and zebrafish , and has been specifically lost in mammals.
The total number of insect TRP family members is 13-14, approximately half that of mammalian TRP family members. Nevertheless, insects have highly developed sensory systems almost comparable to mammals, suggesting that some single TRP channels are responsible for detecting multiple sensory stimuli in insects as reported for mammalian TRP channels. This is also supported by the facts that Nan, the Drosophila TRPV channel, is essential for both hearing and hygrosensation , and DmTRP and DmTRPL, Drosophila TRPC channels, function in vision [16, 17] and possibly thermosensation .
TRPP subfamily is missing in Bombyx, Apis, and Nasonia
Interestingly, a TRPP channel is absent in Bombyx, Apis and Nasonia (Table 1). Because TRPP is present in yeast, it is thought to be the most ancient TRP subfamily . This suggests that TRPP was present in Urbilateria, and has been lost in Lepidoptera and Hymenoptera. TRPP channels are present on both motile and primary cilia, and they may function to sense fluid flow, osmolarity, and mechanical stretch . The Drosophila TRPP, Pkd2, is essential for sperm entry in the female storage organs [29, 30], and is also involved in larval feeding behavior . The lack of TRPP demonstrates that the functions of TRPP can be compensated by evolving an alternative pathway or other TRP subfamilies in Lepidoptera and Hymenoptera. Moreover, Fig. 1 shows that the evolutionary rate of TRPP channels in Pediculus, Tribolium, and Drosophila has been accelerated relative to other TRP subfamily members. Thus, TRPP channels could have different physiological functions in each insect species.
Differences in insect TRPC subfamily members
The Drosophila TRPC subfamily members, DmTRP and DmTRPL, were the first and founding members of the whole TRP superfamily. They were originally identified in association with phototransduction [16, 17]. It has been suggested that the primary channels functioning in phototransduction are DmTRP homomultimers and two types of heteromultimers--DmTRPL/DmTRP and DmTRPL/DmTRPgamma--based on the observation that these channels were activated by stimulation of signaling pathways coupled to activation of phosphoinositide (PI)-dependent phospholipase C (PLC) in vitro [32, 33]. Nevertheless, DmTRP homomultimers should be the major components in vivo because trpl mutant flies show only subtle defect in the light response . Bombyx, Apis, and Nasonia contain 3 TRPC subfamily members that cluster with either DmTRP, DmTRPL, or DmTRPgamma (Fig. 1). This suggests that TRPC subfamily members of B. mori, A. mellifera, N. vitripennis, and D. melanogaster share the same functions in phototransduction. However, Tribolium and Pediculus appear to lack the DmTRPgamma and DmTRPL orthologs, respectively. Instead, these insects contain TcXP970049.1 and PhPHUM009153 that cluster separately from the other TRPC subfamily members (Fig. 1). This suggests that both heteromultimers corresponding to DmTRPL/DmTRP and DmTRPL/DmTRPgamma and the heteromultimer corresponding to DmTRPL/DmTRPgamma may be absent in P. humanus and T. castaneum, respectively. Thus, TRPC subfamily members may have been co-opted to play physiological roles other than phototransduction in P. humanus and T. castaneum. In fact, the nematode has 3 TRPC channels similar to insects, and one of them, TRP-3, is expressed in the spermatids and functions for fertilization . To address this question, it will be useful to examine where the TRPC subfamily members are expressed in Tribolium and Pediculus.
Dynamic evolution of the insect TRPA subfamily
As shown in Table 2, 5 TRPA subfamily members are present in Bombyx, Tribolium, Apis, and Nasonia, while 4 members are present in Pediculus and Drosophila. This is in contrast to mammals which have only 1 TRPA channel. Interestingly, Daphnia and Caenorhabditis appear to contain only 1 and 2 TRPA channels, respectively. These results demonstrate that insects specifically expanded the TRPA subfamily members during their evolution after diverging from other metazoans.
The phylogeny of insect TRPA channels demonstrates that all insects examined contain TRPA channels orthologous to Drosophila Pain, Pyr, and Wtrw. Drosophila Pain and Pyr function as thermosensors responding to different "hot" temperatures (The temperature thresholds for activating Pain and Pyr are 42.6 and 37.5-40°C, respectively) [8, 10, 35], and Drosophila Wtrw functions as a moist receptor for hygrosensation . These results suggest that the mechanisms to detect harmful high temperatures as well as moisture are conserved among different insect species.
Tribolium, Apis, and Nasonia (data not shown) have an extra TRPA channel, TRPA5, (Fig. 1). Based on the recent phylogeny of holometabolous insects [36, 37], it is likely that the ancient TRPA5 was present in the common ancestor of holometabolous insects, and then has been lost in Lepidoptera and Diptera. To address whether TcTRPA5 and AmTRPA5 have the same origin, we compared the positions and phases of their introns . We were not able to analyze NvTRPA5 since there is a sequence gap in the genomic region. TcTRPA5 and AmTRPA5 contain 6 and 8 introns, respectively; however, 3 introns of AmTRPA5 are located in the alignment gap sites (Fig. 3). Among them, one intron in the most conserved ion transport domain-coding region shares the same position and phase (Fig. 3). Intriguingly, this intron is absent in all other insect TRP genes at the corresponding sites. This suggests that the ancient TRPA5 was retained only in Coleoptera and Hymenoptera, and then intron gain and loss have occurred. Nevertheless, the possibility that Coleoptera and Hymenoptera have independently gained TRPA5 could not be completely ruled out. AmTRPA5 expressed in HEK293 cells cannot be activated by temperature fluctuations (data not shown); thus, it remains to be determined how the TRPA5 channel is activated.
Apis and Nasonia lack TRPA1, which functions in thermotactic behaviors of Drosophila larvae and adults [9, 39, 40] (Table 2 and Fig. 1). Moreover, DmTRPA1 was shown to be activated by temperature increase [39, 41]. Remarkably, Apis and Nasonia have HsTRPAs (Hymenoptera specific TRPA) which cluster with Wtrw members (Fig. 1). We will show below that HsTRPA functions as a thermosensor to detect temperature increase. HsTRPA genes have evolved by duplication of Wtrw genes, since these two genes lie next to each other in Apis and Nasonia chromosomes (Fig. 4). Interestingly, 2 Bombyx Wtrw genes, encoding BmWtrw1, which forms a clade with DmWtrw and TcWtrw, and BmWtrw2, which forms a clade with PhWtrw, have also evolved by duplication since they are present in the same genomic scaffold (data not shown). Because it is unlikely that the duplication of Wtrw has occurred independently in Lepidoptera and Hymenoptera, this event must have occurred in the common ancestor of holometabolous insects, and the duplicated genes have been lost in Diptera and Coleoptera. Since DmWtrw was shown to be necessary for detecting moist air , it will be interesting to see how BmWtrw1 and BmWtrw2 channels are activated. AmHsTRPA, NvHsTRPA, AmWtrw, BmWtrw1, BmWtrw2, TcWtrw, and PhWtrw lack introns, while NvWtrw and DmWtrw have 2 and 3 introns, respectively. This suggests that the ancient Wtrw gene evolved by retrotransposition of another TRP channel gene, most likely Pyr, and then Drosophila and Nasonia have gained introns in the Wtrw genes. The lack of introns in NvHsTRPA suggests that it also has evolved by retrotransposition of NvWtrw in Nasonia. Apparently, the evolution of TRPA channels has been most dramatic among TRP subfamilies in insects, suggesting that the mechanisms to detect environmental temperature vary in different insect species.
NvHsTRPA is a thermo-sensitive TRP channel
To characterize the properties of the NvHsTRPA channel, we expressed it in HEK293 cells. Localization of the V5 and His epitope-tagged NvHsTRPA protein showed a staining pattern at the plasma membrane, demonstrating that it reaches to the cell surface (Fig. 5A). Nevertheless, some proteins are present in the cytoplasm as well. The molecular weight of the tagged protein was approximately 112 kDa, which is slightly larger than expected (105 kDa) from the amino acid sequence. The protein size was constant in the presence of tunicamycin, an inhibitor of N-glycosylation (Fig. 5B), indicating that NvHsTRPA does not contain N-glycans unlike the vertebrate TRPV1, 4, 5, and TRPC3 and 6 as reported . The partial denature of NvHsTRPA (60°C for 5 min) may result in the aberrant migration through 6% SDS-PAGE gel which makes the correct estimation of protein size difficult. Nevertheless, the possibility that NvHsTRPA undergoes the other post-translational modifications can not be ruled out. Patch-clamp experiments with the cells expressing the tagged NvHsTRPA protein showed that it is activated by temperature increase, and quickly inactivated by constant heat application (Fig. 5C, left panel). Desensitization of the channel by repeated heat applications was also observed (Fig. 5C, left panel). Similar rapid inactivation and desensitization was also observed with DmPain . The current activation was not observed with the mock-transfected HEK293 cells (Fig. 5C, right panel), suggesting that it is specifically mediated by NvHsTRPA. The rapid inactivation as well as desensitization properties of NvHsTRPA suggest that it is only once activated by rapid temperature increase during a short period (<60 sec). Thus, NvHsTRPA may allow Nasonia to detect the rapid increase of environmental temperature. To determine the temperature threshold for NvHsTRPA channel activation, we performed several experiments. As shown in an Additional file 1, NvHsTRPA appears to be activated as soon as temperature rises regardless of initial temperatures. The channel was activated even by small temperature increase (Additional file 1 right panel, RT to heat, a red dotted line), suggesting that it is very sensitive to temperature changes. We therefore lowered the temperature to ~7°C, and then applied heat stimulation very slowly (~0.25°C/sec) to activate the channel. However, the current developed gradually, and was small (< 100 pA, data not shown), demonstrating that NvHsTRPA activation is highly dependent on the heating rate. Thus, it is difficult to define the temperature threshold for this channel activation in HEK293 cells. NvHsTRPA may sense temperature increase without a specific temperature threshold, which requires further analyses. The current-voltage (I-V) relationship of NvHsTRPA showed dual rectification with a slight positive reversal potential (Fig. 5D), suggesting that it had high permeability to one of the cations (most likely Ca2+) included in the bath solution. It will be very interesting to compare these channel properties with those of TRPA1, which has not been fully characterized in any insect. We would like to propose that HsTRPA, originally created by the duplication of Wtrw, has gained the thermoresponsive property, and this has resulted in the loss of TRPA1 in Hymenoptera. If NvHsTRPA complements the functions of TRPA1, it could have roles in thermotactic behavior of Nasonia similar to DmTRPA1 in Drosophila. Knock-down of NvHsTRPA by RNAi followed by the analysis of thermotactic behavior will test this possibility.
DmTRPA1 was shown to be necessary for Drosophila larvae to discriminate between 18°C and slightly higher temperatures (19-24°C), and function downstream of a phospholipase C-dependent signaling pathway . Under this behavioral paradigm, DmTRPA1 is not necessary to be heat-activated, and thus any TRP channel could substitute for the lack of TRPA1 in Hymenoptera. However, TRPA1 activation by temperature fluctuations appears to be established in both vertebrates and invertebrates. DmTRPA1 and the vertebrate TRPA1 are activated by temperature increase [39, 41] and cooling to 10°C , respectively. Thus, the thermoresponsive property of NvHsTRPA demonstrates that it is a likely channel to complement the lack of TRPA1 in Nasonia.
TRP channels respond to diverse stimuli, and thus function as the primary integrators of various kinds of sensory information. To understand the evolution of insect TRP channels, and thus the mechanisms of integrating sensory inputs in insects, we have identified and compared TRP channel genes in 6 genome-sequenced insect species. All the insects examined have 2 TRPV, 1 TRPN, 1 TRPM, 3 TRPC, and 1 TRPML subfamily members, suggesting that the mechanisms for detecting mechanical and visual stimuli and maintaining lysosomal functions may be evolutionarily well conserved in insects. Although P. humanus and D. melanogaster contain 4 TRPA subfamily members, B. mori, T. castaneum, A. mellifera, and N. vitripennis have 5 TRPA subfamily members. T. castaneum, A. mellifera, and N. vitripennis contain TRPA5 channels that have been retained or gained in Coleoptera and Hymenoptera but not in other examined insect orders. Furthermore, TRPA1, which functions in thermotaxis in Drosophila, is missing in A. mellifera and N. vitripennis; however, they have other Hymenoptera-specific TRPA channels which function as novel thermal sensors. The total number of insect TRP family members is 13-14, approximately half that of mammalian TRP family members. As reported for mammalian TRP channels, this may suggest that some single TRP channels are responsible for integrating multiple sensory inputs to keep the breadth of insect sensory systems comparable to that of mammals. These results demonstrate that there have been both evolutionary conservation and changes in insect TRP channels. In particular, the evolutionary processes have been accelerated in the TRPA subfamily, thus indicating the diversity of mechanisms for detecting environmental temperatures used by various insect species
The amino acid sequences of 13 Drosophila TRP channels were retrieved from FlyBase http://flybase.org/, and were used as queries to identify TRP channel genes of Pediculus, Bombyx, Tribolium, Apis, and Nasonia by TBLASTN search using the E value 1E-10 against the genomes and gene model DNA sequences. The genome databases used were VectorBase http://phumanus.vectorbase.org/index.php, Silkworm Genome Research Program http://sgp.dna.affrc.go.jp/index.html, BeeBase http://www.beebase.org/, and Baylor (http://www.hgsc.bcm.tmc.edu/projects/tribolium/ and http://www.hgsc.bcm.tmc.edu/projects/nasonia/). The list of amino acid sequences of insect TRP channels analyzed in this study is shown in an Additional file 2. The amino acid sequences of C. elegans and mouse TRPV and TRPM channels were retrieved from the NCBI protein database http://www.ncbi.nlm.nih.gov/sites/entrez?db=protein. The six transmembrane ion transport domains of each TRP channel were identified by InterProScan http://www.ebi.ac.uk/Tools/InterProScan/ search. The amino acid sequences of ion transport domains were aligned by the Muscle program , and then PhyML3.0 algorithm was applied for the maximum likelihood analyses, under the WAG amino acid substitution model and with 100 bootstrapped data sets using the PhyML Online server. A phylogeny created with Neighbor Joining using the identity matrix and correcting for multiple replacements had an identical topology. The amino acid sequences of TcTRPA5 and AmTRPA5 were aligned with the CLUSTALW program , and the intron positions and phases were identified by searching the above databases.
Characterization of NvHsTRPA channel protein
The full length NvHsTRPA cDNA was isolated by RT-PCR with adult N. vitripennis head RT and two primers, 5' TTTTTGCGGCCGCACCATGTCGCGCTCGTGGAAAC TGGACGAGGTC 3' and 5' TTTCTAGACTCCTCGGTTGCACTCTTCGAGCCACG AGATT 3'. The PCR product was digested with NotI and XbaI, and then cloned in pAc5.1/V5-His B vector (Invitrogen) in which the Drosophila actin 5C promoter was replaced with CMV promoter. The cloned cDNA was sequenced; it was identical to the one deposited in a database. HEK293 cells grown on cover slips were transfected with 1.2 μg NvHsTRPA expression vector using Attractene transfection reagent (Qiagen) for 2 days at 37°C. The cells were fixed with 4% paraformaldehyde/PBS for 15 min at room temperature (RT), and then permeabilized with 0.5% TX-100/PBS for 5 min. After washing the cells with PBS containing 0.1% TX-100 (PT), they were blocked with PT containing 5% normal donkey serum for 30 min followed by incubation with rabbit anti-V5 antibody (Sigma, 1000 fold dilution) for 2 hr at RT. The cells were washed, and then incubated with FITC-conjugated anti-rabbit IgG antibody (Chemicon, 300 fold dilution) for 2 hr at RT. The cells were observed with a confocal laser microscope. The cell lysates prepared from the cells transfected with empty vector (mock) and NvHsTRPA expression vector were analyzed by Western blot using rabbit anti-V5 antibody and HRP-conjugated anti-rabbit IgG antibody (GE healthcare, 3000 fold dilution). Tunicamycin was added to the cells at the concentration of 10 μg/ml for 15 hr where indicated. The signal was detected by an ECL detection system (GE healthcare).
HEK293 cells in a 35-mm dish were transfected with 1 μg of NvHsTRPA expression vector and 0.1 μg of pGREEN LANTAN 1 using Lipofectamine Plus reagents (Invitrogen). After incubating for 3-4 hours, cells were reseeded on cover glasses and further incubated at 33°C and 5% CO2. Cells were used for the experiments 20-40 hours after transfection. The standard bath solution contained (in mM) 140 NaCl, 5 KCl, 2 MgCl2, 2 CaCl2, 10 HEPES, and 10 glucose, pH 7.4, adjusted with NaOH. The CsCl pipette solution contained (in mM) 140 CsCl, 5 EGTA and 10 HEPES, pH 7.4, adjusted with CsOH. Whole-cell recording data were sampled at 10 kHz and filtered at 5 kHz for analysis (AxoPATCH 200B amplifier with pCLAMP software, Molecular Devices). Membrane potential was clamped at -60 mV. The current-voltage (I-V) relationship upon heating was obtained by using voltage ramps (-100 to +100 mV in 100 ms). Cells were stimulated with temperature changes by decreasing or increasing the bath temperatures with an iced or preheated perfusate through the lines, respectively (with a minimum 8°C for cooling, and a maximum 44°C for heating). After whole-cell configuration was achieved, the cell was raised 50 μm and placed in the center of the chamber. Temperature was monitored with a thermocouple (TA-30, Warner Instruments) placed within 100 μm of the patch-clamped cell.
Montell C: Drosophila TRP channels. Pflugers Arch. 2005, 451: 19-28. 10.1007/s00424-005-1426-2.
Venkatachalam K, Montell C: TRP Channels. Annu Rev Biochem. 2007, 76: 387-417. 10.1146/annurev.biochem.75.103004.142819.
Damann N, Voets T, Nilius B: TRPs in our senses. Curr Biol. 2008, 18: R880-889. 10.1016/j.cub.2008.07.063.
Cosens DJ, Manning A: Abnormal electroretinogram from a Drosophila mutant. Nature. 1969, 224: 285-287. 10.1038/224285a0.
Walker RG, Willingham AT, Zuker CS: A Drosophila mechanosensory transduction channel. Science. 2000, 287: 2229-2234. 10.1126/science.287.5461.2229.
Kim J, Chung YD, Park DY, Choi S, Shin DW, Soh H, Lee HW, Son W, Yim J, Park CS, Kernan MJ, Kim CA: TRPV family ion channel required for hearing in Drosophila. Nature. 2003, 424: 81-84. 10.1038/nature01733.
Gong Z, Son W, Chung YD, Kim J, Shin DW, McClung CA, Lee Y, Lee HW, Chang DJ, Kaang BK, Cho H, Oh U, Hirsh J, Kernan MJ, Kim C: Two interdependent TRPV channel subunits, inactive and Nanchung, mediate hearing in Drosophila. J Neurosci. 2004, 24: 9059-9066. 10.1523/JNEUROSCI.1645-04.2004.
Tracey WD, Wilson RI, Laurent G, Benzer S: painless, a Drosophila gene essential for nociception. Cell. 2003, 113: 261-273. 10.1016/S0092-8674(03)00272-1.
Rosenzweig M, Brenman KM, Taylor TD, Phelps P, Patapoutian A, Garrity PA: The Drosophila ortholog of vertebrate TRPA1 regulates thermotaxis. Genes Dev. 2005, 19: 419-424. 10.1101/gad.1278205.
Lee Y, Lee Y, Lee J, Bang S, Hyun S, Kang J, Hong ST, Bae E, Kaang BK, Kim J: Pyrexia is a new thermal transient receptor potential channel endowing tolerance to high temperatures in Drosophila melanogaster. Nat Genet. 2005, 37: 305-310. 10.1038/ng1513.
Lazzari CR, Núñez JA: The response to radiant and the estimation of the temperature of distant sources in Triatoma infestans. J Insect Physiol. 1989, 35: 525-529. 10.1016/0022-1910(89)90060-7.
Zars T: Two thermosensors in Drosophila have different behavioral functions. J Comp Physiol A. 2001, 187: 235-242. 10.1007/s003590100194.
Göpfert MC, Albert JT, Nadrowski B, Kamikouchi A: Specification of auditory sensitivity by Drosophila TRP channels. Nat Neurosci. 2006, 9: 999-1000. 10.1038/nn1735.
Liu L, Li Y, Wang R, Yin C, Dong Q, Hing H, Kim C, Welsh MJ: Drosophila hygrosensation requires the TRP channels water witch and nanchung. Nature. 2007, 450: 294-298. 10.1038/nature06223.
Eberl DF, Hardy RW, Kernan MJ: Genetically similar transduction mechanisms for touch and hearing in Drosophila. J Neurosci. 2000, 20: 5981-5988.
Hardie RC, Minke B: The trp gene is essential for a light activated Ca2+ channel in Drosophila photoreceptors. Neuron. 1992, 8: 643-651. 10.1016/0896-6273(92)90086-S.
Niemeyer BA, Suzuki E, Scott K, Jalink K, Zuker CS: The Drosophila light-activated conductance is composed of the two channels TRP and TRPL. Cell. 1996, 85: 651-659. 10.1016/S0092-8674(00)81232-5.
Venkatachalam K, Long AA, Elsaesser R, Nikolaeva D, Broadie K, Montell C: Motor deficit in a Drosophila model of mucolipidosis type IV due to defective clearance of apoptotic cells. Cell. 2008, 135: 838-851. 10.1016/j.cell.2008.09.041.
Zhang Y, Hoon MA, Chandrashekar J, Mueller KL, Cook B, Wu D, Zuker CS, Ryba NJ: Coding of sweet, bitter, and umami tastes: different receptor cells sharing similar signaling pathways. Cell. 2003, 112: 293-301. 10.1016/S0092-8674(03)00071-0.
Dhaka A, Murray AN, Mathur J, Earley TJ, Petrus MJ, Patapoutian A: TRPM8 is required for cold sensation in mice. Neuron. 2007, 54: 371-378. 10.1016/j.neuron.2007.02.024.
Colburn RW, Lubin ML, Stone DJ, Wang Y, Lawrence D, D'Andrea MR, Brandt MR, Liu Y, Flores CM, Qin N: Attenuated cold sensitivity in TRPM8 null mice. Neuron. 2007, 54: 379-386. 10.1016/j.neuron.2007.04.017.
Giribet G, Edgecombe GD, Wheeler WC: Arthropod phylogeny based on eight molecular loci and morphology. Nature. 2001, 413: 157-161. 10.1038/35093097.
Hwang UW, Friedrich M, Tautz D, Park CJ, Kim W: Mitochondrial protein phylogeny joins myriapods with chelicerates. Nature. 2001, 413: 154-157. 10.1038/35093090.
Glenner H, Thomsen PF, Hebsgaard MB, Sørensen MV, Willerslev E: Evolution. The origin of insects. Science. 2006, 314: 1883-1884. 10.1126/science.1129844.
Kahn-Kirby AH, Bargmann CI: TRP channels in C. elegans. Annu Rev Physiol. 2006, 68: 719-736. 10.1146/annurev.physiol.68.040204.100715.
Sidi S, Friedrich RW, Nicolson T: NompC TRP channel required for vertebrate sensory hair cell mechanotransduction. Science. 2003, 301: 96-99. 10.1126/science.1084370.
Rosenzweig M, Kang K, Garrity PA: Distinct TRP channels are required for warm and cool avoidance in Drosophila melanogaster. Proc Natl Acad Sci USA. 2008, 105: 14668-14673. 10.1073/pnas.0805041105.
Zhou XL, Batiza AF, Loukin SH, Palmer CP, Kung C, Saimi Y: The transient receptor potential channel on the yeast vacuole is mechanosensitive. Proc Natl Acad Sci USA. 2003, 100: 7105-7110. 10.1073/pnas.1230540100.
Gao Z, Ruden DM, Lu X: PKD2 cation channel is required for directional sperm movement and male fertility. Curr Biol. 2003, 13: 2175-2178. 10.1016/j.cub.2003.11.053.
Watnick TJ, Jin Y, Matunis E, Kernan MJ, Montell C: A flagellar polycystin-2 homolog required for male fertility in Drosophila. Curr Biol. 2003, 13: 2179-2184. 10.1016/j.cub.2003.12.002.
Gao Z, Joseph E, Ruden DM, Lu X: Drosophila Pkd2 is haploid-insufficient for mediating optimal smooth muscle contractility. J Biol Chem. 2004, 279: 14225-14231. 10.1074/jbc.M312223200.
Xu X-ZS, Li H-S, Guggino WB, Montell C: Coassembly of TRP and TRPL produces a distinct store-operated conductance. Cell. 1997, 89: 1155-1164. 10.1016/S0092-8674(00)80302-5.
Xu XZ, Chien F, Butler A, Salkoff L, Montell C: TRPc, a Drosophila TRP-related subunit, forms a regulated cation channel with TRPL. Neuron. 2000, 26: 647-657. 10.1016/S0896-6273(00)81201-5.
Xu XZ, Sternberg PW: A C. elegans sperm TRP protein required for sperm-egg interactions during fertilization. Cell. 2003, 114: 285-297. 10.1016/S0092-8674(03)00565-8.
Sokabe T, Tsujiuchi S, Kadowaki T, Tominaga M: Drosophila painless is a Ca2+-requiring channel activated by noxious heat. J Neurosci. 2008, 28: 9929-9938. 10.1523/JNEUROSCI.2757-08.2008.
Savard J, Tautz D, Richards S, Weinstock GM, Gibbs RA, Werren JH, Tettelin H, Lercher MJ: Phylogenomic analysis reveals bees and wasps (Hymenoptera) at the base of the radiation of Holometabolous insects. Genome Res. 2006, 16: 1334-1338. 10.1101/gr.5204306.
Krauss V, Thümmler C, Georgi F, Lehmann J, Stadler PF, Eisenhardt C: Near intron positions are reliable phylogenetic markers: an application to holometabolous insects. Mol Biol Evol. 2008, 25: 821-830. 10.1093/molbev/msn013.
Irimia M, Roy SW: Spliceosomal introns as tools for genomic and evolutionary analysis. Nucleic Acids Res. 2008, 36: 1703-1712. 10.1093/nar/gkn012.
Hamada FN, Rosenzweig M, Kang K, Pulver SR, Ghezzi A, Jegla TJ, Garrity PA: An internal thermal sensor controlling temperature preference in Drosophila. Nature. 2008, 454: 217-220. 10.1038/nature07001.
Kwon Y, Shim HS, Wang X, Montell C: Control of thermotactic behavior via coupling of a TRP channel to a phospholipase C signaling cascade. Nat Neurosci. 2008, 11: 871-873. 10.1038/nn.2170.
Viswanath V, Story GM, Peier AM, Petrus MJ, Lee VM, Hwang SW, Patapoutian A, Jegla T: Opposite thermosensor in fruitfly and mouse. Nature. 2003, 423: 822-823. 10.1038/423822a.
Cohen DM: Regulation of TRP channels by N-linked glycosylation. Semin Cell Dev Biol. 2006, 17: 630-637. 10.1016/j.semcdb.2006.11.007.
Karashima Y, Talavera K, Everaerts W, Janssens A, Kwan KY, Vennekens R, Nilius B, Voets T: TRPA1 acts as a cold sensor in vitro and in vivo. Proc Natl Acad Sci USA. 2009, 106: 1273-1278. 10.1073/pnas.0808487106.
Edgar RC: MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32: 1792-1797. 10.1093/nar/gkh340.
Guindon S, Gascuel O: A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol. 2003, 52: 696-704. 10.1080/10635150390235520.
Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22: 4673-4680. 10.1093/nar/22.22.4673.
This study was supported by Grant-in-Aid for Scientific Research on Priority Areas to TK.
HM maintained Nasonia and performed bioinformatics analysis of insect TRP channels. KK characterized NvHsTRPA channel protein. TS and MT carried out the electrophysiological experiments. TK designed the experiments and wrote the manuscript. All authors read and approved the final manuscript.
Electronic supplementary material
Additional file 1: Temperature thresholds for NvHsTRPA channel activation. The representative traces show the activation currents of NvHsTRPA elicited by two different heat applications, 8-44°C (Cold to heat, left panel) and 25-44°C (RT to heat, right panel). The red dotted lines indicate the apparent initiation points of the currents. (TIFF 472 KB)
About this article
Cite this article
Matsuura, H., Sokabe, T., Kohno, K. et al. Evolutionary conservation and changes in insect TRP channels. BMC Evol Biol 9, 228 (2009) doi:10.1186/1471-2148-9-228
- Transient Receptor Potential
- Transient Receptor Potential Channel
- Subfamily Member
- TRPM Channel
- Holometabolous Insect | <urn:uuid:2044b628-52d4-42d1-8916-6d3bc2e50341> | CC-MAIN-2019-51 | https://bmcevolbiol.biomedcentral.com/articles/10.1186/1471-2148-9-228 | s3://commoncrawl/crawl-data/CC-MAIN-2019-51/segments/1575541310970.85/warc/CC-MAIN-20191215225643-20191216013643-00309.warc.gz | en | 0.88182 | 9,814 | 3.28125 | 3 |
The enctype attribute specifies how the browser encodes and presents the data to the server.
<!DOCTYPE HTML> <html> <body> <form method="post" action=""> <input name="fave"> <input name="name"> <button>Submit</button> </form> </body> </html>
If using application/x-www-form-urlencoded encoding
The name and value of each data item is encoded using the same scheme that is used to encode URLs. This is how the encoding is applied to the data in the example form:
Special characters are replaced with their HTML entity counterpart. The name of the data item and the value are separated by the equals sign (=) and data/value tuples are separated by the ampersand character (&).
The multipart/form-data encoding tends to be used only for uploading files. Here is how the data from the example form is encoded:
----WebKitFormBoundary2desQWER543CDFGF Content-Disposition: form-data; name="fave" YourName ------WebKitFormBoundary2desQWER543CDFGF Content-Disposition: form-data; name="name"
The mainstream browsers encode data in different ways for this encoding.
Google Chrome encodes data in the same way as for the application/x-www-form-urlencoded scheme, whereas Firefox encodes the data as follows:
Each data item is placed on a line, and special characters are not encoded. | <urn:uuid:17189436-822e-4fb7-960e-040997b40c6f> | CC-MAIN-2019-30 | https://studentsempire.com/html/html-form-encoding.php | s3://commoncrawl/crawl-data/CC-MAIN-2019-30/segments/1563195527458.86/warc/CC-MAIN-20190722010436-20190722032436-00424.warc.gz | en | 0.659614 | 323 | 2.96875 | 3 |
Laboratory studies of Blattisocius keegani (Fox) (Acari: Ascidae) reared on eggs of navel orangeworm: potential for biological control.
Summary of "Laboratory studies of Blattisocius keegani (Fox) (Acari: Ascidae) reared on eggs of navel orangeworm: potential for biological control."
Blattisocius keegani (Fox) is a predatory mite in the family Ascidae (Acari), noted for potential biological control of Coleopteran stored product pests. Performance of B. keegani on eggs of navel orangeworm, Amyelois transitella Walker (Lepidoptera: Pyralidae), was investigated. Mites completed development from egg to adult in 9.2±0.22 days at 25°C and 50-60% relative humidity, and in 6.33±0.29 days at 32.2°C, 30% relative humidity. Mites provisioned with three or five eggs consumed a median of 1.25 to 1.5 eggs, with a maximum of three eggs consumed over 24 h. Regression analyses indicated egg-laying by B. keegani was significantly correlated with the number of A. transitella eggs consumed, and female mites laid an average of 5.82±0.44 eggs over 72 h. Blattisocius keegani, developed on fresh and frozen eggs, laid significantly more eggs when provided with fresh eggs (F3,26=6.16, P=0.0026) and were able to develop on frozen Ephestia kuehniella Zeller (Lepidoptera: Pyralidae) eggs as an alternative host. Mites were equally fecund when fed eggs stored at 0° or -20°C. Provisioning of adult moth bodies in addition to egg prey items increased mite fecundity, although it was demonstrated that B. keegani are phoretic on adult moths as well. The results are the first experimental evidence of B. keegani as a predator of Lepidopteran eggs, as a phoretic species, and of their potential for biological control of navel orangeworm.
Department of Entomology, University of California, One Shields Avenue, Davis, CA 95616, USA.
This article was published in the following journal.
Name: Bulletin of entomological research
- PubMed Source: http://www.ncbi.nlm.nih.gov/pubmed/21067628
- DOI: http://dx.doi.org/10.1017/S0007485310000404
The biology of Phyllocoptes adalius Keifer (Acari: Eriophyoidea) and influence of insemination on female fecundity and longevity were studied. The experiment was conducted at a constant temperature of...
The present study investigated whether incubation media have an impact on infectivity of Capillaria obsignata eggs in chickens infected with gradually increasing doses. C. obsignata eggs collected fro...
Anopheles gambiae sensu stricto, the main vector of malaria in Africa, is characterized by its vast geographical range and complex population structure. Assortative mating amongst the reproductively i...
To evaluate the effects of pesticides to parasite eggs, Ascaris suum eggs were incubated with 5 different pesticides (1:1,500-1:2,000 dilutions of 2% emamectin benzoate, 5% spinetoram, 5% indoxacarb,...
In earlier studies, elevated polychlorinated biphenyl (PCB) and p,p'-dichlorodiphenyldichloroethylene (DDE) concentrations were reported in double-crested cormorant (Phalacrocorax auritus) eggs and tr...
University Reproductive Associates is conducting a pilot study to study the technique of egg freezing. Your participation in this study will provide us with important information to allow...
The purpose of this study is to determine the effectiveness of the ViaCyte media for freezing and thawing human eggs for future use in assisted reproductive technology.
This study is to determine the impact of the consumption of eggs rich in lutein/zeaxanthin from lucerne protein concentrate and DHA from microalgae on the plasma levels of these compounds...
In programmes of IVF, normal women undergo controlled ovarian stimulation using exogenous FSH injections to obtain multiple eggs. The process results in eggs of mixed quality with a broad...
Age-related macula degeneration (AMD, encompassing both dry and wet form), the late stage of Age-related maculopathy (ARM), is the leading cause of blindness in many developed countries in...
Medical and Biotech [MESH] Definitions
The application of discoveries generated by laboratory research and preclinical studies to the development of clinical trials and studies in humans. A second area of translational research concerns enhancing the adoption of best practices
Studies designed to examine associations, commonly, hypothesized causal relations. They are usually concerned with identifying or measuring the effects of risk factors or exposures. The common types of analytic study are CASE-CONTROL STUDIES; COHORT STUDIES; and CROSS-SECTIONAL STUDIES.
A genus of saprophytic fungi in the family Nidulariaceae. They look like small bird's nests complete with eggs. The eggs are small capsules known as peridioles, which contain the spores.
The process of laying or shedding fully developed eggs (OVA) from the female body. The term is usually used for certain INSECTS or FISHES with an organ called ovipositor where eggs are stored or deposited before expulsion from the body.
A genus of marine sea slugs in the family Glaucidae, superorder GASTROPODA, found on the Pacific coast of North America. They are used in behavioral and neurological laboratory studies. | <urn:uuid:0515e5fa-68c7-43f9-a6c2-76c3b73523e5> | CC-MAIN-2014-15 | http://www.bioportfolio.com/resources/pmarticle/110840/Laboratory-Studies-Of-Blattisocius-Keegani-fox-acari-Ascidae-Reared-On-Eggs-Of.html | s3://commoncrawl/crawl-data/CC-MAIN-2014-15/segments/1398223203422.8/warc/CC-MAIN-20140423032003-00276-ip-10-147-4-33.ec2.internal.warc.gz | en | 0.909711 | 1,269 | 2.65625 | 3 |
There are times when the heart is in bad shape. Bad mental qualities get mixed up with it, making it even worse, making us suffer both in body and mind. These bad mental qualities are said to be “unskillful” (akusala). The Buddha teaches us to study these qualities so that we can abandon them.
There are other times when the heart is in good shape: at ease with a sense of well being. We feel at ease whether we’re sitting or lying down, whether we’re alone or associating with our friends and relatives. When the heart gains a sense of ease in this way, it’s said to be staying with the Dhamma. In other words, skillful (kusala) mental qualities have appeared in the heart. The skillful heart is what gives us happiness. This is why the Buddha taught us to develop these skillful qualities, to give rise to them within ourselves.
– Ajaan Suwat, Thai Forest Tradition. | <urn:uuid:cc3921c8-68c1-4007-9c04-09d46c1651da> | CC-MAIN-2022-49 | https://bitesizedhamma.com/tag/heart/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446711108.34/warc/CC-MAIN-20221206124909-20221206154909-00797.warc.gz | en | 0.921862 | 208 | 2.734375 | 3 |
When a tooth is fractured or has a deep cavity, bacteria enters the pulp tissue and germs can cause an infection inside the tooth. If the infected tissue is not removed, pain and swelling can result. This can not only injure your jawbones, but it is also detrimental to your overall health.
During treatment, your general dentist or endodontist removes the affected tissue. Next, the interior of the tooth will be cleaned and sealed. Finally, the tooth is filled with a dental build-up. If your tooth has extensive decay, your doctor may suggest placing a crown to strengthen and protect the tooth from breaking. As long as you continue to care for your teeth and gums with regular brushing, flossing, and checkups, your restored tooth can last a lifetime. By saving your tooth, an endodontist can help you keep your natural smile, so you can continue to eat your favorite foods and maintain your overall health. Nothing looks, feels or functions like your natural tooth!
Signs and symptoms for possible root canal therapy:
- An abscess (or pimple) on the gums.
- Sensitivity to hot and cold.
- Severe toothache pain.
- Swelling and/or tenderness. | <urn:uuid:583ce565-a4b5-41ae-ac4e-77e098a7533d> | CC-MAIN-2020-29 | https://dupagedentalplan.com/endodontics/ | s3://commoncrawl/crawl-data/CC-MAIN-2020-29/segments/1593657143354.77/warc/CC-MAIN-20200713064946-20200713094946-00372.warc.gz | en | 0.932063 | 256 | 2.875 | 3 |
Hashem's Appointed Festivals
"Speak to the Children of Israel and say to them: Hashem's appointed festivals which you shall designate as callings of holiness – these are My appointed festivals."
Speak to the Children of Israel ... Hashem's appointed festivals - RASHI: Regulate the appointed festivals so that [all] Israel can be present at them. This teaches us that they proclaim a Leap Year because of the exiles (in Babylon) who have left their homes to ascend for the festival but have not yet arrived in Jerusalem.
During the Temple period it was a mitzvah to make a pilgrimage to Jerusalem for the festivals in order to participate in the Temple service. During the Second Temple many Jews remained in exile, many in Babylon and some in Egypt. The trip to Jerusalem was long and particularly difficult if the roads were muddied by the rains. Therefore, if the Festival of Passover fell out early in the year, while the rains were still falling, the pilgrims would most likely be delayed. Therefore, the Sanhedrin, who had the power to proclaim a leap year by adding a second Adar, would do so in order to push Passover off until after the rainy season, so that they would arrive in time for the Festival. This is what Rashi says our verse teaches us.
What would you ask about the comment?
A Question: How does Rashi find this in the Torah's words?
This is not easy. Perhaps you can get it.
Hint: Look closely at the dibbur hamatchil.
WHAT IS BOTHERING RASHI?
An Answer: The verse says "Speak to the Children of Israel" to declare the Holy days, but it is not the people who make this declaration - it is the Elders, the Sanhedrin. So the words "Speak to the Children of Israel" must have a different message.
Now, notice what Rashi does. Look at his dibbur hamatchil.
Do you see anything unusual?
RASHI'S DIBBUR HAMATCHIL
Answer: Rashi deletes the words "and say to them" in order to place the words "Children of Israel" immediately next to the words "God's Appointed Festivals." This is certainly intentional and the idea is derived from the Midrash Torat Cohanim.
RASHI'S MIDRASHIC SOURCE
There the Midrash says: "How do we learn that we proclaim a leap year for the exiles who have left home but have not yet arrived in Jerusalem? Because it says 'Children of Israel ... God's Appointed Festivals.' Make the Appointed Festivals so that all Israel can participate."
We see that the Rashi makes the connection as the Midrash does; Rashi does this by his abbreviated dibbur hamatchil.
THE SIGNIFICANCE OF THE PEOPLE'S PARTICIPATION
It is obvious that is important to have the people participate in these national/religious Holy days. But it is not as obvious why the Sanhedrin went through all this effort so that each and every Jew, even those in exile, could attend.
I would suggest that a nuance in the words of our verse may hint at the significance of the personal participation of each Jew at these festivals.
Do you see anything unusual about the wording?
A Deeper Understanding
An Answer: Notice that the verse begins with the words "God's Appointed Times" and ends with God saying, "these are My Appointed Times." The switch from the impersonal, third person ("God's") to the more personal, second person ("My") (as is the formula for our daily blessings), hints at the importance of meeting God personally. The Holy days and the Temple service are an appropriate time and place for such a meeting. As it says in Deuteronomy 16:16, "Three times a year shall all your males appear before Hashem, your God, in the place He shall choose; on the Festival of Matzos, and on the Festival of Shavuoth and on the Festival of Succoth, and he shall not appear before Hashem empty-handed." And in a similar context, it says in Exodus 23:15, "they shall not see My face empty-handed." "Seeing My face" is certainly a vivid way of describing a personal encounter with God. Perhaps it is for this reason that the Sanhedrin went to such lengths to enable each and every Jew to personally experience this Divine encounter. | <urn:uuid:2863732b-45f5-4e60-a2b7-e6fc9c198f78> | CC-MAIN-2014-15 | http://www.aish.com/tp/i/wbr/48968666.html | s3://commoncrawl/crawl-data/CC-MAIN-2014-15/segments/1397609532480.36/warc/CC-MAIN-20140416005212-00224-ip-10-147-4-33.ec2.internal.warc.gz | en | 0.955068 | 946 | 3.09375 | 3 |
The Lawrence school district is gearing up for the next phase of its venture into a new kind of classroom teaching, in which students rely as much on computers and online material as they do on textbooks and teachers to guide instruction.
Starting in the fall, the district will add 40 classrooms — two in each school — to the list of those where teachers organize their lesson plans, learning material, assignments and tests all in an online environment.
It's an environment that gives students, with guidance from the teacher, the option of working independently, in small groups or in a traditional teacher-led classroom setting. It also gives students more flexibility to work at their own pace, and to view classroom materials and lectures any time, night or day.
Results still being measured
Often referred to as “blended classrooms,” it's a movement that has been gaining hold in many districts around the country. It's also a system whose effectiveness in improving student achievement is just starting to be measured by researchers, although Lawrence officials say the early results are promising.
“That's what we are finding, and that's why we had our own action research in this field test,” said Angelique Kobler, the Lawrence schools' director of curriculum and instruction. “Part of the reasoning is that recent research showing a completely virtual environment doesn't provide the gains that we'd like to see.”
As the district's incoming assistant superintendent for teaching and learning, Kobler will be largely in charge of the shift to high-tech classrooms.
The Lawrence district began experimenting with blended learning in January, when it outfitted eight classrooms with the desktop computers, laptops, tablets and “SmartBoards” needed to make the model work.
That was the same time that the Lawrence school board was finalizing its plans to ask voters to approve a $92.5 million bond issue, which included $6.5 million to upgrade technology and expand the district's wireless network so that, eventually, the high-tech program could be expanded districtwide.
Although there hasn't been enough time yet to tell how much of an impact the blended classroom system had on student test results, Kobler said the early indications look positive.
"I think most of the evidence is anecdotal, coming from the teachers, since they know their students best in their environments," she said. "They were noting marked increases in student engagement."
She said the district also surveyed parents of students in those eight classrooms, "and the response was overwhelmingly positive, with some concerns.”
“There were some challenges, particularly those that have limited access to (technology) outside of the school setting, so we were expecting that,” Kobler said. "We have been having some discussions about how we can continue to support our families so that doesn't become a barrier for them."
Kobler will be one of two people in the district primarily responsible for managing the shift to the blended classrooms. That's the result of a reorganization of the district's administration that the Lawrence school board approved shortly after the bond issue passed in April.
The other will be Jerri Kemble, who was officially hired May 28 for the newly-created position of assistant superintendent for educational technology programs.
Starting July 1, Kobler will take over as assistant superintendent for teaching and learning, succeeding Adam Holden, who announced May 3 he was resigning for personal and family reasons.
A former principal at Schwegler School, Kobler moved to the central office in 2007 as director of instructional services and, later, director of curriculum and instruction. She earned a bachelor’s degree from Kansas State University in 1990, a second bachelor's degree from Fort Hays State University in 1993; a master’s degree from FHSU in 2001, and an Ed.D. from Kansas University in 2010.
The reorganization plan also calls for eliminating six central office administrative positions and creating six new positions called "teachers on special assignment," who will be assigned specific content areas to work directly with teachers to implement the blended learning model in their classrooms and develop a digital curriculum.
Some central office staff will be reassigned to other jobs, resulting in a net reduction of three administrative positions.
Kobler said she envisions the day when most, but probably not all, classrooms in Lawrence will be organized around the blended learning model.
"We also know that some students thrive in a more traditional setting," she said. | <urn:uuid:cb31b559-249a-479f-9db3-9b87c6de1c7f> | CC-MAIN-2014-42 | http://www2.ljworld.com/news/2013/may/23/kobler-lead-shift-toward-technology-rich-classroom/ | s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1414119646519.4/warc/CC-MAIN-20141024030046-00121-ip-10-16-133-185.ec2.internal.warc.gz | en | 0.976783 | 912 | 2.578125 | 3 |
Kleptocracy in Congo is sustained by one man: Denis Sassou Nguesso. And as you had already read, especially in the preceding chapter and some aspects of which will be developed here, Kleptocracy is not only about sustained corruption and the abuse of power, it also involves how a system influences negatively the social, political and economic behaviors internally and externally. While the Congolese diplomat whom I met in Washington DC and whose conversation with me was abundantly mentioned in the preceding chapter thinks Marien Ngouabi bears the responsibility in the current state of the country, on personal view, I don’t think Marien was a Kleptocrat. He was perhaps a rabble rousing dictator. However the Nguessos through Sassou have negatively influenced the country and also neighboring countries. Since the Republic of Congo became independent from France in 1960, the country has known at its helm, 6 leaders: Fulbert Youlou, Alphonse Massamba-Debat, Yhombi Opangault, Marien Ngouabi, Denis Sassou Nguesso and Professor Pascal Lissouba. Among the above, none has exercised or exerted control over the state and stayed in power longer than Denis Sassou Nguesso has.
Furthermore, Sassou Nguesso has also achieved a feat by being the only Congolese leader who has held the mantle of power twice or the job of President, twice. He came to power in 1979 and only left in 1992, when he lost to Pascal Lissouba and he came back to power again in 1997 until date through a brutal civil war. Another achievement of Denis Sassou Nguesso, if it could be considered as one, is that, he is also the only Congolese leader who has the most involved his children and close family member into the management of the country. Sassou Nguesso’s children, grand and great grand children and close family members are present in every sector in Congo like octopuses. However to the discharge of Sassou Nguesso and his family, they are not the only ruling family within the central Africa sub region who has introduced their children and family members into all layers of governance. The best known case within the central Africa region is Omar Bongo who seems to be the regional mentor in administrative nepotism. Even though before him, there was Mobutu in Zaire. Besides Gabon, the other ruling families who are in power, some for close to 5 decades are: the Obiangs in Equatorial Guinea and the Santos in Angola. Both families and their fathers came to helms of their respective countries in 1979 and they don’t seem to have the desire to leave power. The other rising ruling family is that of Laurent Desire Kabila, whose son, Joseph Kabila is in power in the DRC since 2001. | <urn:uuid:f1c066ea-f9bc-45b5-89a0-18eb30cfea9f> | CC-MAIN-2018-30 | http://congojournalism.blogspot.com/2017/07/understanding-kleptocracy-in-congo_76.html | s3://commoncrawl/crawl-data/CC-MAIN-2018-30/segments/1531676589029.26/warc/CC-MAIN-20180716002413-20180716022334-00030.warc.gz | en | 0.975212 | 591 | 2.734375 | 3 |
The design of the National Renewable Energy Laboratory’s (NREL) Science & Technology Facility along with on-site generation of renewable energy and purchase of green power has yielded a carbon reduction of 95 percent or 6 lbs/sf/yr.
The stakes are high! There is an increased sense of urgency to address the problem of global climate change. As has been well-documented over the past few years, ever-rising greenhouse gas emissions have been attributed in large part to human activity. The situation was stated by the U.N. Intergovernmental Panel on Climate Change (IPCC) in their Fourth Assessment Report issued in February 2007. In reality, emissions are accelerating at a much faster rate than even the IPCC has predicted over the last eight years.
As documented in the report, there is agreement among the scientific community that a 2o C (3.5o F) rise in temperature constitutes a tipping point where the damages of global warming will be irreversible. This equates to an atmospheric CO2 equivalent concentration of 450 parts per million (ppm). The current CO2 concentration level is around 386 ppm. CO2 represents greater than 75 percent of all greenhouse gas emissions. If we add in all other sources, we may currently be reaching an equivalent CO2 concentration of 430 ppm. As you can see, there isn’t much room, especially considering the CO2 concentration curve is accelerating.
The building industry is a major contributor to the greenhouse gas inventory through both direct (project site) and indirect (source) emissions. Source emissions account for a majority of building sector impacts and are those that are generated elsewhere, mainly by fossil fuel-based power plants, as a consequence of our actions. The Architecture 2030 Challenge has indicated that buildings account for more than 48 percent of all energy consumption and greenhouse gas emissions annually, and consume 76 percent of all electricity produced by power plants. Because we are responsible for creating the built environment, the building industry must take a leadership role in helping to solve this crisis.
New Carbon Economy
There are several options for how best to deal with climate change and the reduction of greenhouse gas emissions. Because carbon dioxide represents a majority of the greenhouse gases, several schemes have been created — Carbon Cap and Trade, Carbon Tax, and other variations — to deal with that element. Cap and Trade is a market-driven system where a central authority sets a limit on emissions as well as a price. The cap total is divided into allowances or permits which are allocated to participating entities based on current emission levels. Every year, the cap and number of allowances is reduced, forcing participants to either cut their emissions or purchase unused permits to offset their pollution.
Proponents believe that these systems will provide a financial incentive for companies to reduce their emissions. Opponents feel that imposing a cost on carbon would translate into higher energy costs. The new administration is taking up this issue currently, but no matter which scheme is implemented, there is a clear sense of urgency if the U.S. — and the world — hopes to affect climate change.
New Direction for Measuring Building Performance
Building performance is often measured in terms of Energy Use Intensity (EUI) in kBTU’s per square foot annually, or Energy Cost Savings in dollars per square foot annually. Even though these metrics are important to evaluate, they do not easily translate to environmental impacts. If we are ever going to bring the discussion to the language of mitigation, we must define a different metric for measuring building performance. I suggest that the common metric should be in terms of carbon reduction per project in pounds (or tons) per square foot annually.
As we move into this new economy, organizations and companies will most likely be required to report their carbon emissions annually and to find ways of reducing their impacts. So why doesn’t the building industry jump on board and start informing building owners of how their buildings are mitigating climate change? Owners will soon demand this as part of their organization’s commitment. Climate change must be addressed in the design and construction of their facilities. Owners will also demand to know what the design and construction industry’s experience and expertise is in addressing climate change when hiring firms.
The stakes are high and we, in the building industry, must be the leaders in providing buildings that succeed in the new carbon economy. | <urn:uuid:51b437ff-3c5f-4885-83c9-43b54f197132> | CC-MAIN-2016-40 | http://azbigmedia.com/azre-magazine/real-estate/carbon-new-metric-for-measuring-building-performance | s3://commoncrawl/crawl-data/CC-MAIN-2016-40/segments/1474738661900.67/warc/CC-MAIN-20160924173741-00253-ip-10-143-35-109.ec2.internal.warc.gz | en | 0.952708 | 876 | 3.453125 | 3 |
With slim, long legs and—in the case of males—magnificent antlers, the deer is a graceful artiodactyl mammal that is broadly represented in Chinese visual and literary culture. In Book of Poetry, we come to adore the gentleness of the deer depicted in lines like "with pleased sounds the deer call to one another, eating the celery of the fields". Meanwhile, we are all familiar with phrases that associate the creature with political power.
In this exhibition, Nanjing Museum and the Art Museum of The Chinese University of Hong Kong jointly explore multiple meanings of the deer in Chinese art. In ancient China, the deer was regarded as a mediator to the supernatural world and also a symbol of auspiciousness and longevity. This is proved by the traces of deer-related elements discerned in agricultural rituals and divination practices. Thanks to the support of Nanjing Museum, this exhibition features a variety of deer-related artifacts, such as a bronze deer that is listed as a'First-grade-National-Treasure' and a lacquer tomb-guarding beast with deer antlers. The two objects are both from early tombs, which best exemplify the historical significance of the deer.
Curated by Chen Gang, Research Associate of Nanjing Museum, the show is the fruit of Mr. Chen's participation in the third Museum Professionals Training Workshop sponsored by the Bei Shan Tang Foundation in 2016. The Friends of the Art Museum, the Chinese University of Hong Kong, generously provided the funds for the exhibition. | <urn:uuid:881dd431-aaea-47b3-80a5-e3205409853f> | CC-MAIN-2018-13 | https://www.artsy.net/show/art-museum-of-the-chinese-university-of-hong-kong-from-the-realm-of-the-immortals-meanings-and-representations-of-the-deer-from-the-nanjing-museum | s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257647681.81/warc/CC-MAIN-20180321180325-20180321200325-00667.warc.gz | en | 0.946839 | 313 | 3.3125 | 3 |
GCSE (9–1) AQA A Practice Papers for Component 1
Available for Buddhism, Christianity, Hinduism, Islam, Judaism, and Sikhism
Three practice papers for each religion all written by a principal examiner!
Saves teachers a lot of time creating their own [practice papers]
Perfect practice for Component 1 of the new AQA A 9–1
Questions test every aspect of ‘Beliefs and Practices’ for each religion.
- Mirrors the new exam style exactly for
realistic exam preparation!
- Great for mock exams, spot-checking progress and improving exam technique!
- Full student-friendly mark schemes that are ‘clear
and easy to follow’ (A Walmsley, Head of RS and
Independent Reviewer) and fully referenced to the AOs.
- Ideal for quick marking and self-assessment.
Selects likely themes for assessment on the Buddhism paper
- Provided in write-on and non-write-on formats – ready to mix and match in class or set as homework.
What do teachers say about this resource? (7839)
Really useful in the current climate of teaching with very limited assessment criteria provided by the exam board, coupled with savvy students capable of downloading assessment material from the exam board website! I have had experience of students doing this and having to spend a lot of time myself rewriting the questions we have available, if I had this resource it would have saved me quite some time!
A useful resource that mirrors the exam board sample assessment materials well, and selects what seem to be likely items / themes for assessment on the Buddhism paper.
What do teachers say about this resource? (7838)
If you have mocks to set and don't want to use the assessment material from the exam board you either have to spend many hours writing something like this or you can buy it from ZigZag. As there has been very little assessment material made available to teachers of this course, this is a valuable resource as it gives you easy access to 3 papers you can easily set for mocks or unit tests without worrying that students will have seen them before or downloaded them from the website themselves. It would also save a lot of time as a Head of Department writing mark schemes as these are extremely tedious. The educational value then is helping students understand the assessment, which is very important.
Valuable as it saves teachers a lot of time creating their own [...] The questions are set out in the same style/language as the sample specification question papers, the mark schemes for each of the questions are clear and easy to follow and are in line with standard exam mark schemes [...] A resource such as this is useful in helping students prepare for exams… In my experience it is exam technique that can make the difference between a high, medium and low grade [...] I would recommend this to other colleagues in other schools
What do teachers say about this resource? (7841)
Overall concise and clear. The mark scheme is also easy to navigate and follow… good supplementary resource for teachers and students to check on essential knowledge. Having the assessment objectives is helpful too to contextualise which part of the content is being covered... Meets the needs to test knowledge and understanding | <urn:uuid:35d1f32b-0df2-4df9-8267-03918cc1af97> | CC-MAIN-2020-45 | https://zigzageducation.co.uk/synopses/7838-gcse-aqa-a-rs-practice-papers-for-component-1?pod=7838&keyword=component-1-christianity | s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107872686.18/warc/CC-MAIN-20201020105000-20201020135000-00141.warc.gz | en | 0.95685 | 660 | 3.09375 | 3 |
Home > Preview
The flashcards below were created by user
on FreezingBlue Flashcards.
Not everyone with a disorder has each and every known manifestation of that disorder.
End result of Bayesian analysis is a ______
Several physicians may use the same ovservations to arrive at differing "degrees of belief"; patients want to know if they have a disorder, not our belief system
Screening tests shoud have high __________
Confirmatory tests should have high ________
A test often dow not prove or rule out the presence of a disorder (it may change the probability)
Informed consent issues
Basis of Baye's Theorem:
There is no certainty
Begin with a model that limits all possibly hypotheses to a constrained subset in the model: typically two or more ________ hypotheses; each with its own prior probability
Probability obtained from the pedigree
Appears normal at age 34, given either genotype (in relation to the problem)
How well the test detects affected people. Formula?
How well the text excludes unaffected people. Formula?
How often the test misclassifies affected people as "not affected"?
How often the test misclassifies affected people as "not affected". Formula?
If the test result is positive, what's the probability the patient has the disease?
If the test result is normal, what's the probability the patient does not have the disease?
What values help answer the above questions?
Two important questions sensitivity and specificity don't answer.
____ and _____ are very dependent on the disease prevalence, in addition
PPV and NPV
What type of test is used to "rule out" a diagnosis and hsould have a high sensitivity?
What type of test is used to "rule in" a disease and should have a high specificity?
Explain to a family that neither a normal or an abnormal test result has 100% predictability. This should have been explained to the family prior to initiating the consent. When specifically?
While obtaining informed consent
What fraction of offspring from two carrier parents will be unaffected in autosomal recessive traits?
Of the unaffected offspring, 2/3 of the offspring will be heterozygotes.
- 3/4 will be unaffected
What is the study of the frequency of alleles and traits in a population; and the study of the factors that affect gene or genotype frequencies.
What can provide the carrier frequency in a population, making possible genetic counseling about recurrence risks in a kindred?
How many mutations are present for an AR disorder?
How many lethal equivalents?
______ is a fallacy. We can eliminate all deleterious genes from a population only by eliminating completely that population.
Eugenic policies curtail individual freedom, claiming to promote the interest of a future society.
Promotes propagation of more "desirable people" types
Seeks to decrease propagation of more "undesirable people" types
Improvements in medical management do lead to increased biological fitness of _________
Hardy-Weinburg Law assumes
- Mating is random and in a large population
- No selection for or against any genotype
- No migration into or out of the population
- No new mutations
(These are never completely met.)
Relates the genotype frequencies at a Mendelian locus to the phenotype frequencies in that population.
- p2 + 2pq + a2
- p + q = 1
The values of p and q are the same in males and females since we share all X chromosomes. This is in relation to?
X-linked Recessive Traits
But affected males are more frequent than affected females.
Non-random mating (2 examples):
Leads to increased ______
Exposes _______ traits to selection
- 1) Assortative Mating, 2) Consanguinity and incest
- increased homozygosity
- recessive traits
Selection for a similar mate based upon ethnicity, religion, stature, deafness, etc.
Relationship between cloose blood relatives.
Incidence in US?
Risks in offspring:
- 1st = 50; brother- sister, parent-child
- 2nd= 5-10; uncle-niece
- 3rd= 3-5; first cousins
A union between individuals so closely related that the union is illegal. It is between?
1st Degree (brother-sister, parent-child)
10-15% of mothers of sporadic cases are
What mutations are more frequent among children born of older fathers?
New single gene dominant mutations (apert sydrome, achondroplasa)
Acrocephalocyndactyly, craniosyntosis, mid-face hypoplasia, prominence of orbits
An equilibrium may exist between new mutations and selection for or against a mutant allele, tending to maintain allele frequencies constant.
What disorders are not often recognized because all cases are sporadic.
Autosomal dominant, complete genetic lethal disorders
Migration of people changes the allel frequency in a region (ie. hispanics into USA)
Small "isolated" population effects
Allele frequency can occur in small populations by chance.
- Random fluctuation
- Leads to extinction, fixation, and the founder effect on some alleles.
A case of genetic drift in which a small founder population with limited genetic variation derives from a larger population, resulting in a large change in allele frequencies. | <urn:uuid:a8ea91f9-3ba5-4b5f-9708-964fc48e8d96> | CC-MAIN-2017-30 | https://www.freezingblue.com/flashcards/print_preview.cgi?cardsetID=181004 | s3://commoncrawl/crawl-data/CC-MAIN-2017-30/segments/1500549424088.27/warc/CC-MAIN-20170722162708-20170722182708-00145.warc.gz | en | 0.891565 | 1,140 | 3.453125 | 3 |
In its exact meaning the fairy tale is a short or popular story. Related to the myth but conceptually differentiated, the fairy tale is from the outset an invention, a fiction, a fantasy narrative that makes metaphorical use of an animal as its central character or introduces stereotypical characters, such as the rascal.
Too often there is a subversive allegory against feudalism or the ruling class, or a clash between the human and the invisible kingdom. It personifies and personalizes different elements beyond the logic of space and time and extends indiscriminately from organic to inorganic world from man and animals to trees, flowers, stones, currents and winds.
The roots of the fairy tale
One question that arose during the scientific study of the fairy tale was what concerned its genesis. Various theories were formulated on the subject, but none gave complete answers and all were challenged in the light of some new scientific perspective.
A. The Indo-European theory: The first theory, also called monogenetics, on the origin of fairy tales came from the Grimm brothers in 1819. They expressed the view that fairy tales – although newer than myths and epic songs – came from a common space, the home of Indo-European culture, and from there they moved along with the Indo-European sexes. Grimm’s basic idea was that “fairy tales were fallen myths (i.e. myths that lost their basic elements and became simpler) and can only be understood through an appropriate interpretation of the myths from which they came”. This theory did not substantiate the Indo-European origins of fairy tales, leaving many questions unanswered.
B. The mythological theory: Similar theory to the first was that of Max Möller, who in 1856 claimed that the fairy tales came from solar myths of the Indo-Europeans, which were included in the holy book Rig-Veda. Möller, based, it seems, on the theory of fallen myths, claimed that initially myths expressed abstract concepts, such as stories about the sun as a central person and protagonists at Night, Heaven, Dawn, etc., but as they spread from India to the peoples of Europe and Asia they lost their original meaning. Trying to interpret the remnants of this mythology, the peoples made the fairy tales. Followers of this theory overlooked the fact that Rigg Veda, on which they relied, was not a creation of popular origin but of the Indian priesthood.
C. The Indian theory: The Indian origins of fairy tales were supported by the Englishman Theodore Benfey. According to Benfi “Indian myths come from the West and mainly from the Greek myths of Aesop, as opposed to fairy tales coming from India and specifically from the Hindu-Buddhist tradition on which it was based”. Some of these fairy tales were spread before the 10th century through oral tradition, others, with a strong Islamic influence, were spread after the 10th century, mainly through Byzantium, Italy and Spain, by literary tradition and, finally, others with Buddhist material spread through China and Tibet to the Mongols and from them to Europe. This view has only historical value today, as it turned out that India may have been one of the main sources of storytelling, but it was not the only one.
D. The polygenetic theory of ethnologists: In 1873 Andrew Lang (A. Lang), influenced by Darwin’s evolutionary theory, formulated the multigenetic theory, according to which: “myths, fairy tales, stories with similar content were presented to different peoples, who were often very local and temporal to each other”. Lang tried through the forms of stories, myths and fairy tales to demonstrate a single course of evolution of peoples through time. Hcg’s ethnographic theory, among other things, “accepted the existence of much greater uniformity in primitive peoples than there probably is in practice.”
E. The historical geographical theory: Monogenetic theory, expressed by the Finnish School, as it was named, in honor of its two Finnish inspirations, Karl Krohn and Andy Aarne. They argued that a fairy tale in a country is transmitted from generation to generation in a stable way, i.e. without significant variations. But when it is broadcast in another country, it changes and adapts to its new cultural environment. The rapporteur of the historical geographical method in Greece was the G.A. Megas.
F. The symbolic theory: The Frenchman Saintyves studied perro’s tales and expressed the view that they came from old rituals. The Frenchman Van Gennep linked the tale to totemism and related ceremonies. The German Naumann (argued that there are many traces of worship ceremonies in the fairy tale, but they need to be carefully explored. These theories have contributed to the understanding of fairy tales, but do not explain their origins adequately. As in polygenetic theory, here too the “symbolists” consider that all primitive societies exhibit a uniformity, much more than is actually the case.
G. Psychological-psychoanalytical theory: Psychological theory approached and interpreted the fairy tale in three different ways, with the clinical approach the use of magical fairy tales for the diagnosis and psychoanalytical treatment of patients, the theoretical approach, based on the study of human psyche, and the textanalytical approach, which studies and analyzes the fairy tale in psychoanalytical terms. This theory could not give a satisfactory answer as to the origin of the fairy tale, but it offered a new dimension to its study.
H. The morphology of V’s fairy tale. Propp: According to the theory of the Russian V. Propp, before we deal with a place of origin and how fairy tales are disseminated, we must define what fairy tales are, that is to say, define their content. His main goal was through the work of Morphology of the Fairytale to give an answer to the question of the similarity between the fairy tales of various peoples. So Prop argued that the division of the fairy tale into its components and its subsequent processing was the most appropriate way of studying it.
As a species the fairy tale belongs to oral or folk literature with origins in all the territories of the world. For the first time in Europe, and in particular, in the movement influenced by romance, Germany is imprinting folk tales intended for adults, with the aim of strengthening German consciousness and studying the German language. Brothers Grimm (Jacob and Wilhelm Grimm) collect and record folk creations, launching the on-site research first. Their fairy tales, containing literary comments and observations, were gathered in three volumes. Their epitome was published in 1822.
In Greece, interest in fairy tales is part of the general interest in the products of popular literature, which contribute mainly to the formation of national identity. In January 1880 Nikolaos Politis published an article in three sequels in the magazine Estia entitled “Public Tales” and the term “In Monacho 1879”. The article was written on the occasion of the publication of two collections of fairy tales made by foreign scholars. One was Austria’s consular representative in Giannena and then in Syros, Johann Georg von Hahn, who in 1864 published, in Leipzig, in German, a collection of fairy tales entitled Modern Greek tales. The other, the Danish Hellenist Jean Pio, in 1879 published a similar collection in Copenhagen, based on Hahn’s notes.
The most fruitful period in terms of recording and saving the folk tale in Greece is considered the period of the last thirty years of the 19th and the first decades of the 20th century. Of course, a few years ago there was a publishing activity in magazines and books, which publish folklore from time to time or exclusively, such as Pandora and Iliissos. | <urn:uuid:9c3004d1-56a5-4876-a917-297df8846938> | CC-MAIN-2021-10 | https://www.en.exaleiptron.eu/tale-roots-3/ | s3://commoncrawl/crawl-data/CC-MAIN-2021-10/segments/1614178355944.41/warc/CC-MAIN-20210226001221-20210226031221-00321.warc.gz | en | 0.964062 | 1,622 | 3.34375 | 3 |
Over the last couple of years, people have again found their voices and taken to the streets to protest...what exactly does the First Amendment protect and permit?
Over the last couple of years, people have again found their voices and taken to the streets to protest through organizations like Black Lives Matter, the Women’s March, protest groups appearing at political campaigns and rallies, and impromptu protests against controversial speakers on college campuses. Most recently, arising out of the mass shooting at Marjorie Stoneman Douglas High School, teens across Florida and the country have found their voices to crusade for reasonable gun control, forming the March for Our Lives movement.
Our law firm has been integrally involved in representing media seeking public records that might shed light on the government’s response after Nikolas Cruz opened fire at the school, so the March for Our Lives movement hits close to home.
But protests, boycotts, and public speaking have long been part of the free speech landscape in the US. What exactly does the First Amendment protect and permit? The free speech, freedom of the press, right to peaceably assemble, free exercise of religion and establishment clauses all reside within the First Amendment. And some of the strongest free speech cases arise out of speech and activities many find offensive – flag burning, KKK marches, profanity in a courtroom.
USA Today’s article What the First Amendment Protects and What It Doesn't is a timely, practical look at First Amendment topics ranging from censorship to public protests to compelled speech to free exercise of religion. You might want to take a look before you head out to your next march.
Carol LoCicero is a founding partner of Thomas & LoCicero. She is a nationally-recognized media lawyer routinely sought after as a speaker on media issues at national and statewide conferences. She practices at the trial and appellate levels, handling litigation concerning defamation and privacy, public records, open meetings, reporter subpoenas, court access and technology in the courtroom. | <urn:uuid:8951c49a-efea-4818-9d22-26073a34cbad> | CC-MAIN-2020-29 | https://tlolawfirm.com/news/news-story-detail/2018/04/10/what-the-first-amendment-protects---and-what-it-doesn't | s3://commoncrawl/crawl-data/CC-MAIN-2020-29/segments/1593657143365.88/warc/CC-MAIN-20200713100145-20200713130145-00442.warc.gz | en | 0.952402 | 408 | 2.6875 | 3 |
When fire breaks out in premises, the most important thing is for people to get to safer locations as soon as possible. Fire outbreaks can cause serious injuries and also loss of life. Building fire safety is never clearly understood until that time when fire strikes. There is a need for all persons in the workplace or even in households to clearly understand what a fire assembly point is? This is because; a successful evacuation and fire safety plan is partly determined by how people respond by getting to safer locations when fire breaks out.
In a bid to understand What a fire assembly point is?, it is important to point out that it is not just a safe location within the workplace or household but it is a specially designated open location where people can congregate in the event of a fire. This point should be easy to reach and also free from dangers of the fire. The main reason why people need to get to the fire assembly point is because it helps identify any missing persons.
It is important that fire assembly signs be well designed with clear visibility. They should be able to guide the persons to safety without any problem. In Britain, there were reportedly 388 fire related deaths in 2010-11, and this implies that fires are still a challenge to many households and business premises with the risk of being able to take away life.
There are different ways in which the effects of fires can be managed and use of fire safety signs is one of them. There are also different fire safety signs, which can be used and these may range from prohibitive signs, descriptive signs, and warning signs, to directional signs. When workers and home occupants understand the importance of a fire assembly point and which signs show this critical safety location, they are able to respond fast in the event of an outbreak of fire.
When fire safety signs are installed, there is need for them to be maintained as part of the safety plans, businesses can organize training and education sessions to help the people understand all signs in the premises, where they are placed and what they represent. Where possible, a mock fire safety escape can be carried out to gauge how prepared a business is and how well the workers can respond to fire outbreaks.
This can easily bring out any notable weaknesses in the state of the signage and also the understanding of the different fire safety elements such as the fire fighting equipment and their usage. In addition, with such mock fire safety assessments, the emergency response team can evaluate whether people really know where the fire assembly points are.
The Health and Safety (Safety Signs and Signals) Regulations 1996, brings out a clear definition of the different safety signs and how they are applied. There is also regulatory information about the design and use of these signs. The dedicated colors, which are mandated by the law, are prescribed. When you get signs designed and installed by professional designers, you ensure that you are compliant with the law and that people can easily understand the signs and their usage. | <urn:uuid:69c0c281-36c4-4652-a504-65a5f9fa6d05> | CC-MAIN-2018-30 | http://www.superled4u.com/what-is-a-fire-assembly-point-and-why-must-a-business-designate-it.html | s3://commoncrawl/crawl-data/CC-MAIN-2018-30/segments/1531676591497.58/warc/CC-MAIN-20180720041611-20180720061611-00583.warc.gz | en | 0.971229 | 589 | 3.28125 | 3 |
With an education, somebody gains an increasing number of experience in the area. An extremely smart person will pick up more knowledge and skills in precisely the exact same period when compared with the typical person. So long as an inspirational individual is in a position to make some kind of impact throughout the class of the lifetime, they are considered the most educated. Such individuals have no less than a minimal comprehension of topics of formal schooling and also a profound understanding of some particular subject. Every individual has been qualified for education though not everybody feels that it’s worth getting it in the very first site. As an example, uneducated individual might understand how to respect others and they behave in a fantastic ways instead of an educated person.
Education really isn’t the understanding of any 1 part of information or region of study, but the private occupation of learning all the information available. essaychamp.net It starts in the early stages of our lives and proceeds in many ways and forms during our life so it is a lifelong procedure. It is the basic component of building a modern, civilized society therefore it needs to be regarded as an essential issue. Some individuals might not be in a position to access a greater education.
When someone has a college http://www.academia.edu/8638619/Health_History_and_Examination_Health_Assessment_of_the_Head diploma and robust training, from a trusted institution, they’re in an excellent position of tackling lifestyle. An educated individual is elastic and knows how to manage change. He has the ability to explore alternative viewpoints. He knows how to cooperate and collaborate effectively with other individuals. He’s got Weekly Dispatches from the Frontlines of World Literature – Asymptote Blog the ability to see connections among areas, ideas and cultures. Thus, having an educated person is a fundamental prerequisite for living your best life. He knows how to solve conflicts with others.
An educated person knows the way to make decisions. He has the ability to identify harmful behaviors and traitsincluding thinking customs that are not functioning them welland the capacity to modify them. He is somebody who learns for fun and recognizes that there is not any end to learning, no last certification. He has the ability to reason analytically and critically. He has the ability to think inductively and deductively. Given that he’s been taught a bit about history, sociology and psychology, they need to know about the human beings respond when placed in certain situations.
Education isn’t about certifications and degreeseducation is all about how someone relates to life. Educated person can not utilize computer. In summary, he may learn a lot of things in the uneducated person, not because they have a excellent qualities but also they might have a great deal of experience and useful skills also. On one hand, it permits the educated individual to receive a feeling of self-satisfaction in he or she has fully grasped their schooling, and on the flip side, it spreads knowledge. Therefore, an educated individual will stay a superior citizen. He does not think he can grasp everything, or even a fraction of it. An educated individual in certain people’s eyes is a person who understands a fantastic bargain, somebody who’s retained a sizable quantity of information, somebody who can say facts without needing to look up them.
Someone will get job safety with a college degree since you fall back on education to get employment. He has the freedom to experiment and pick a career that is most suitable for them. Someone with an English degree isn’t only restricted to turning into a teacher or a writer. In the event of a dismissal or put off, a person that has a college diploma has a greater prospect of finding another job when compared with a person without an instruction. Lastly, acquiring a college diploma produces a individual marketable in the industry globe.
All documents must be written withproper formating. No wonder it’s as vital as composing the article itself. While the completely free essays may provide you inspiration for composing, they can’t be used’as is’ since they won’t meet your mission’s requirements.
Education is extremely important. It plays an important part in our lives. It is good not just for the person who becomes educated, but also for everyone around her. Simply put, it is the willingness and ability to learn for the sake of learning. It is the most powerful weapon which you can use to change the world. Such education is likely to be a futile exercise. | <urn:uuid:874df99c-733c-4427-b0af-ce2163a17acd> | CC-MAIN-2023-40 | http://tadol.ir/get-essay-creating-enable-from-a-expert-services/ | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233511364.23/warc/CC-MAIN-20231004084230-20231004114230-00405.warc.gz | en | 0.956032 | 935 | 2.828125 | 3 |
Updated: Feb 2
What really matters in creating, building and achieving something great are the actions not the words. Purpose is an action not contemplating statement. Most companies envision building a better world, but their actions contradict their words. They lack the fuel to do that.
Vision entices the imagination, purpose propels action. In other words, actions speak louder than words and so does purpose. If an organization does have a sound purpose, creating a vision statement is complementary, the opposite is wrong. Purpose breeds vision not the other way around.
Purpose is born out of a challenge. Vision is created and imagined.
If an organsiation is purposeless, their vision statement is a bunch of words that does not add up. It is born dead. I love to cite Nelson Mandela, Former President of South Africa as a leader because his purpose is crystal-clear definition of what makes a great purpose.
To end apartheid and achieve freedom and equality for all south -Africans. Ending apartheid is achieved through action not vivid hopes. His action, purpose transformed South Africa into a multi- racial democracy where all South Africans enjoyed freedom and equality. He did not only envision freedom and equality for South Africans. He lived his purpose and scarified 27 years in jail to accomplish it. | <urn:uuid:8a46ff6f-dca1-41a0-a685-a0b4b6831790> | CC-MAIN-2021-17 | https://www.purposevanguards.com/post/purpose-speaks-louder-than-words | s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618039536858.83/warc/CC-MAIN-20210421100029-20210421130029-00443.warc.gz | en | 0.963723 | 260 | 2.609375 | 3 |
Why do Muslims fast in Ramadan?
There are many reasons why Muslims fast in Ramadan. The main reason of their fasting is because its a pillar of Islam. This pillar is the fourth of the five pillars in Islam.
Muslims are thus obliged to fast the month of Ramadan. According to Sunnism, its disbelief to intentionally leave any pillar of the five pillars of Islam, without having valid excuse.
Short description of the fasting in Ramadan
Muslims fast the whole month of Ramadan, 29 days or 30 days based on the sighting of the new moon. The fasting begins from the break of dawn and ends sunset. The Muslims are forbidden to eat, drink, smoke and have intercourse during those hours.
It is a struggle to fast the month of Ramadan. Muslims challenge themselves to achieve higher levels of God conciousness and piousness.
Not every Muslim must fast during this month. There are those that are excused of it. Like for example:
- Those that are chronically sick
- Those that are unable due to old age
- Mothers who have to suckle their baby
Those who could not fast during Ramadan, must make their fasting up. That is done by fasting those days on other times, or paying it off by feeding a poor person, for every day missed. Kids are exempted from the obligation to fast.
(Fixed) the certain number of days (of Ramadan) But if one of you is sick or traveling, then the same number of days can be made up on other days. There is a ransom for those who cannot fast (due to old age sickness or travel). One should feed a poor person for every day eaten.
1. The fourth pillar of Islam
Fasting during the month of Ramadan is considered the fourth pillar of Islam. It is for that reason that it is obligatory for Muslims to fast in that month. Leaving this obligatory fasting without valid excuse is considered disbelief in Sunnism.
Muslims fast according to the way the Prophet Muhammad, peace and blessings be upon him, fasted. Thus, they choose to get closer to Allah by following His commands.
2. The month in which the Quran descended
The holy month of Ramadan is seen as a celebration of the Quran. Muslims try to recite the entire Quran in this month. So Muslims make the utmost use of it in this month to gain understanding and recitation ability. They hope that this will give them a great reward in the afterlife.
The month of Ramadan (is the month) in which the Quran was revealed.
(Source: 2:185 Quran)
3. Spiritual healing
While fasting, Muslims are commanded to be patient and to become less angry than usual. It's a way to improve yourself by focusing more on things that do you good. Wasting time is avoided as much as possible while fasting.
Muslims in this month try to act better in situations where they had a hard time. So it is a great opportunity for them to strengthen themselves. It teaches the Muslims to relax and to stress less about the small matters.
During Ramadan good deeds are increased. Muslims choose to put more energy into bettering their behavior and deeds. This would help to strengthen them as a person and be closer to Allah.
During Ramadan, Muslims have a great opportunity to reflect on all the favors in their lives. Because of the fasting, many Muslims automatically focus more on the blessings they have been given. It is a moment of gratitude and joy for Muslims to break their fast with a meal that suffices.
Besides the fact that Muslims become more grateful while fasting in the month of Ramadan, they also learn to reflect on the guidance that Allah bestowed them with. They are grateful that they can experience this beautiful month to get more out of themselves.
5. Strengthening family Ties
Ramadan turns families more towards each other. This is because they gather at sunset to break their fast. They make it moments of joy.
Because many Muslims fast on Ramadan, it brings a connection. Families try to gather, to make the most of their fasting. It is a special moment to strengthen ties with those members of the family which was not that great.
6. Resist temptation
Tijdens de ramadan houden moslims zich meer dan ooit in. Alle kwaad wordt gedurende de maand voorkomen om sterker te worden in het weerstaan van verleidingen. Rokers stoppen bijvoorbeeld met roken tijdens het vasten en alcoholisten stoppen met het drinken van alcohol.
Allerlei verleidingen worden vermeden tijdens de ramadan. Denk aan het verspillen van tijd, het kijken naar onnodige dingen op tv, overmatig gamen en eten. Kinderen zijn niet verplicht om te vasten, dus ze zullen zeker een test zijn voor degenen die aan het vasten zijn.
7. Increase empathy
The poor are not left behind during Ramadan. They are never forgotten in Islam. Muslims try to assist the needy and poor with meals and warmth of others.
Muslims can feel the struggle of not eating to some extent. This will give them more empathy for those who do not have the blessing of daily meals.
8. Increase health
When fasting, Muslims think about their health. As studies have indicated that fasting can be healthy, it is a great opportunity to boost health, both mentally and physically. During the meal after sunset, Muslims are advised to start with dates or water.
Dates provide enough energy for a long day and contain many minerals and vitamins. The dates provide a lot of fiber for the stomach to allow for smooth digestion after eating the meal.
However, it is not recommended to stuff yourself in Ramadan. Muslims also put emphasis on movement during fasting. That will stimulate weight loss and overall health. | <urn:uuid:a4414db8-6b37-4a12-9315-71d028109b4b> | CC-MAIN-2023-50 | https://fitrahtawheed.com/why-muslims-fast-in-ramadan | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100632.0/warc/CC-MAIN-20231207022257-20231207052257-00573.warc.gz | en | 0.917891 | 1,240 | 2.671875 | 3 |
Study Material, Chemistry, Surface Chemistry, Types of EmulsionStudy Material
>Types of Emulsion
Types of Emulsion
Depending upon the nature of the dispersed phase, the emulsions are classified as;
(i) Oil-in-water emulsions (O/W) : The emulsion in which oil is present as the dispersed phase and water as the dispersion medium (continuous phase) is called an oil-in-water emulsion. Milk is an example of the oil-in-water type of emulsion. In milk liquid fat globules are dispersed in water. Other examples are, vanishing cream etc.
(ii) Water-in-oil emulsion (W/O) : The emulsion in which water forms the dispersed phase, and the oil acts as the dispersion medium is called a water-in-oil emulsion. These emulsion are also termed oil emulsions. Butter and cold cream are typical examples of this types of emulsions. Other examples are cod liver oil etc. | <urn:uuid:3f681fdc-3ef7-4e14-a22f-8686944fd7b0> | CC-MAIN-2017-04 | http://www.emedicalprep.com/study-material/chemistry/surface-chemistry/types-emulsion.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282140.72/warc/CC-MAIN-20170116095122-00404-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.945732 | 213 | 3.71875 | 4 |
Remember: The Journey to School Integration
by Toni Morrison
Publication Date: May 17, 2004
List Price: $19.99
Format: Hardcover, 80 pages
Target Age Group: Middle Grade
Imprint: Houghton Mifflin Harcourt
Publisher: Houghton Mifflin Harcourt
Parent Company: Houghton Mifflin Harcourt
Borrow from Library
Toni Morrison has collected a treasure chest of archival photographs that depict the historical events surrounding school desegregation. These unforgettable images serve as the inspiration for Ms. Morrison’s text—a fictional account of the dialogue and emotions of the children who lived during the era of “separate but equal” schooling. Remember is a unique pictorial and narrative journey that introduces children to a watershed period in American history and its relevance to us today.
- Juvenile Nonfiction / History / United States / 20Th Century
- Juvenile Nonfiction / Social Topics / Prejudice & Racism
Tell us what do you think about Remember: The Journey to School Integration . | <urn:uuid:009ccd85-6208-4c6f-bc96-a01b867a7380> | CC-MAIN-2020-40 | https://aalbc.com/books/bookinfo.php?isbn13=9780618397402 | s3://commoncrawl/crawl-data/CC-MAIN-2020-40/segments/1600400198942.13/warc/CC-MAIN-20200921050331-20200921080331-00673.warc.gz | en | 0.866206 | 224 | 3.109375 | 3 |
Suffering an injury on the job is a painful reminder of the reason safety protocols are in place. However, they weren’t always, and not every workplace is as safe as it should be. Here’s a few examples of the ways that you could be hurt on the job if your employer doesn’t take the safety procedures necessary seriously. First, if you’re an insulator, you could have been exposed to asbestos, solvents or epoxies that could lead to illness. Insulation created before 1975 contains asbestos that can lead to asbestosis. Working with glue solvents can lead to acute solvent syndrome or peripheral neuropathy.
If you are a roofer, you could face a number of other illnesses as well. If you remove roofing shingles, you could face lead poisoning. Or, if you applied asphalt to cables, pipes or roofing, you could face photoirritant dermatitis. Asbestos was also a problem for roofers in the past, so asbestosis is a possibility.
For carpenters, you may think that the most common injury would be hammering nails into fingers or hands, but there are many items that could cause permanent illness or injury later in life or at the time of exposure. Old paint removal could lead to lead poisoning, and any insulation used before 1975 could lead to asbestosis. Exposure to paint that has an oil base can lead to acute solvent syndrome, and working with machine or sand creosote treated wood could lead to photoirritant dermatitis.
In each of these cases, the illness may not show up immediately. Workers who suffer from asbestosis, acute solvent syndrome, blood poisoning or other illnesses should look into seeking compensation.
Source: Haz-Map, “Diseases and Jobs,” accessed Oct. 13, 2016 | <urn:uuid:dc491050-6de2-477d-a859-085c3eebdbd3> | CC-MAIN-2022-21 | https://www.lawyerforinjuredworkers.com/blog/2016/10/workplace-illnesses-you-could-face-working-in-construction/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652662529658.48/warc/CC-MAIN-20220519172853-20220519202853-00651.warc.gz | en | 0.962493 | 382 | 2.515625 | 3 |
Children should have access to entertaining as well as educational fiction and non-fiction. In ROV-R, The Undersea Explorer “The Bimini Road,” Kevin Scott Collier has done just that. The undersea exploration story of the Bimini Road is told through the eyes of R.O.V.-R., Remote Operated Vehicle, Model R - or "Robert," as he thinks is his name. It is presented as an adventure and a mystery. Kids will get caught up in the adventure and learn more about this great mechanical device that aids in undersea exploration.
ROV-R narrates the Bimini Road exploration with excitement and enough facts to give kids something to chew on in this mystery/adventure. What will ROV-R find? Is the Bimini Road manmade or something from nature? We’re anxious find out. We see what ROV-R sees through his camera “eye” and the information is then digitally transmitted to his on-board partner, Dave. Perhaps Dave and the crew can analyze the images and data ROV-R provides to figure out what made the Bimini Road, man or nature.
R.O.V. – R. is a fun adventure story for kids to enjoy and learn about undersea exploration. Kevin Collier's illustrations are realistic enough to educate and fanciful enough to entertain. This story will do well in school classrooms and libraries. I look forward to more fun science adventures about ROV-R from Kevin Collier.
For more information about what ROV-R’s next adventure is and what Kevin and Kristen Collier are creating, and to purchase this and their other books, please visit them at: | <urn:uuid:2108073a-b85f-41a1-8191-f1a03ce9bdf5> | CC-MAIN-2022-49 | http://www.penelopeannecole.com/2013/01/rov-r-explorer-in-bimini-road-written.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446709929.63/warc/CC-MAIN-20221126212945-20221127002945-00415.warc.gz | en | 0.949767 | 372 | 2.609375 | 3 |
History of the United States: Continued, Page
JACKSONIAN DEMOCRACY A Transforming
After 1815 Americans transformed the republic of the Founding Fathers into a
democracy. State after state revoked property qualifications for voting and
holding office—thus transforming Jefferson’s republic of property holders into
Andrew Jackson’s mass democracy. Democracy, however, was not for everyone. While
states extended political rights to all white men, they often withdrew or
limited such rights for blacks. As part of the same trend, the state of New
Jersey took the vote away from propertied women, who formerly had possessed that
right. Thus the democratization of citizenship applied exclusively to white men.
In the mid–19th century, these men went to the polls in record numbers. The
election of 1828 attracted 1.2 million voters; that number jumped to 1.5 million
in 1836 and to 2.4 million in 1840. Turnout of eligible voters by 1840 was well
over 60 percent—higher than it had ever been, and much higher than it is now.
At the same time, however, popular political
activity other than voting declined. Judging by available evidence, state and
national governments received fewer petitions than in the past, and they paid
less attention to the ones they received. In the 1830s, when Congress received
hundreds of antislavery petitions, it simply refused to read them. Petitioning,
parading, and mobbing (each of which included Americans who were not white
males) had all been crucial to the American Revolutionary movement, and they had
continued to play important roles in Jeffersonian America. By the 1830s and
1840s, spontaneous parades and mob actions played smaller roles in political
life, and more-respectable citizens viewed such activities as disorderly and
criminal. Popular participation in politics was more and more limited to voting.
Furthermore, voting was organized not by the
voice of the citizenry, but by a national two–party system staffed by
disciplined professionals. These professionals included candidates, appointed
officeholders, newspaper editors, and local leaders who organized voters, wrote
party platforms, and developed party ideologies in ways that only partially and
indirectly reflected popular wishes. Thus political participation was
democratized by the 1830s. But democracy included only white men, and even they
were transformed from citizens to spectators.
Origins of the Party System Neither the
Jeffersonians nor their Federalist opponents admitted to being a political
party. To them the term "party" meant the same as "faction." It also meant the
victory of selfishness and contention over the selfless unanimity they felt a
However, two events caused important
politicians to reconsider the value of parties. First, the Panic of 1819, an
economic downturn, introduced Americans to a cycle of booming economy followed
by bust, a cycle that would come to characterize the new market economy during
the 19th century. Some Jeffersonians blamed the panic on the Bank of the United
States, which had been rechartered in 1816. They argued that if the disciplined
coalition of Southern and Western farmers that had elected Jefferson had still
been in place in 1816, Congress would not have rechartered the bank and the
panic would not have happened.
The second event that caused politicians to
reconsider the value of political parties was Missouri Territory’s application
for admission to the Union in 1818. Missouri’s proposed constitution allowed
slavery, and that provision caused heated argument in Congress, revealing angry
differences between representatives of slave states and free states. Congress
ultimately compromised, balancing the new slave state of Missouri by admitting
Maine as a free state (see Missouri Compromise). Congress then declared
that slavery would be allowed in the Louisiana Purchase territories south of a
line drawn west from the southern border of Missouri. Slavery would be banned
north of that line. The immediate crisis was solved, but the fault line between
slave and free states remained open.
The same politicians (Martin Van Buren of New
York was the most active of them) who opposed the Bank of the United States also
argued that Jefferson’s coalition of slaveholding and nonslaveholding farmers
would never have permitted the dangerous, divisive question of slavery to get
into congressional debate. They organized a disciplined coalition for states’
rights and limited government that supported Andrew Jackson for the presidency
in 1828. That coalition became the Democratic Party.
In the 1820s, many politicians had come to
believe that organized parties were essential to democracy. Parties gave
ordinary men the power to compete with the wealth, education, and social
connections of traditional leaders. Parties also created disciplined
organizations that could control political debate.
Democrats and Whigs
Beginning with Jackson’s administration, the Democrats were opposed by the Whig
Party. The Whigs were led by Henry Clay of Kentucky, Daniel Webster of
Massachusetts, and others who called for an active national government and who
had a nationalist answer to the growing problem of slavery.
The Whigs proposed what they called the
American System. They wanted a high tariff that would protect Northeastern
factories from European competition while it generated revenue for the national
government. They proposed high prices for government land in the West—a policy
that would slow westward movement and that also would increase federal revenue.
They insisted that the Bank of the United States be maintained to stabilize
currency and to discipline smaller banks. And they wanted to use the money that
tariffs and the sale of lands would give the government to built and maintain
roads and other internal improvements.
The result, they promised, would be a society
with a national market under a government that fostered prosperity and order. At
the same time, the national character of the Whig economy would discourage
arguments among the three sections of the nation—the Northeast, the South, and
the West. The Northeast would manufacture goods for the South and West. The
South would supply cotton to Northeastern factories, and the West would provide
food for both the South and Northeast. The prosperity of each section would
depend on friendly relations with the other two, and none of them would want to
bring up the divisive question of slavery.
Andrew Jackson and his Democratic successors
proposed to limit the role of government in the market revolution and in
resolving the tensions among the sections. They wanted to abolish the Bank of
the United States, set tariffs at low levels, sell government land at low rates,
and leave the question of internal improvements to the states.
Democrats hoped to create a national
government that never meddled in local affairs (one of the most important of
those affairs being slavery), that played no favorites, and that kept taxes low.
On the question of slavery and states’ rights, Jacksonians favored minimal
central government within a permanent union. When South Carolina threatened the
Union by attempting to nullify the protective tariff of 1828 (Southerners termed
it the Tariff of Abominations because it penalized Southern states that exported
cotton and imported Old World manufactured goods), Jackson threatened South
Carolina with a federal invasion (see Nullification). At the same time,
he let Southerners know that slavery was safe as long as a Democratic Party
committed to states’ rights was in power. Even more than the Whigs, the
Democrats were committed to avoiding any congressional debate that could
possibly affect slavery.
In the 1830s and 1840s Democrats and Whigs
built the most completely national two–party system that Americans have ever
had—both parties relied on support from all sections of the country, and both
were evenly matched in most states. Within that system, politicians knew that
arguments between the North and South must be avoided. Such arguments would,
first of all, split the Whig and Democratic parties in which politicians were
making their careers. Second, and more dangerous, the breakdown of the national
two–party system could realign the parties along North–South lines and focus
national politics on the differences between the North and South. Political
leaders feared that such a breakdown could lead ultimately to disunion and
perhaps civil war. Most historians agree that the national party system’s
eventual breakdown was a crucial cause of the American Civil War (1861-1865).
Social Reforms In the second quarter of the
19th century Americans built a number of institutions and social movements
dedicated to improving the morals of individuals and of society in general. The
most prominent reformers were Northern, middle–class Whigs who had been
influenced by evangelical revivals in the 1820s and 1830s. Those revivals taught
an ethic of improvement: Sin and disorder, they said, were not inevitable
results of Adam’s fall (as described in the Bible). They were the results of bad
choices made by free and morally accountable men and women. Beginning in the
1820s, these middle–class evangelicals proposed reforms that would teach
Americans to make good moral choices and thus, one individual at a time, improve
society and perhaps make it perfect.
The most pervasive and enduring result of these movements was a system of
tax–supported public schools. The great school reformers were Northern Whigs
such as Horace Mann of Massachusetts and Calvin Stowe of Ohio (husband of
novelist Harriet Beecher Stowe). They proposed public school systems that were
centralized at the state level and that made attendance mandatory. These schools
were geared to teaching patriotism, manners, and civility, along with reading,
writing, and arithmetic.
Among Whig reformers, the goal of public
schools was to build character in individual students. Ultimately, reformers
wished to make a perfect society by filling it with perfect individuals.
Democrats supported the schools, but saw them as a means of providing equal
opportunity to all whites. Democrats, and Southerners from both parties, also
tended to support local control over schools, to favor shorter school years, and
to make efforts to keep taxes low.
Prisons A second institutional reform was
concerned with prisons and asylums. Northern Whig evangelicals proposed new
forms of prisons that were meant less to punish the bodies of criminals (through
whippings, incarceration, and execution) than to improve their souls.
Pennsylvania built a prison in which convicts sat alone in their cells with only
Bibles to keep them company. Most other states adopted the Auburn System, which
took its name from a pioneering prison in New York. Under this system, prisoners
slept in solitary cells but worked in groups—though a policy of absolute silence
was enforced. The products of prison workshops were sold to outside markets.
Whigs favored this system because it promised to rehabilitate criminals by
teaching them personal discipline and respect for work, property, and other
Temperance The largest and most sustained
organized social movement in American history was the temperance crusade against
the use of alcohol that began in the 1820s. Again, Northern Whig evangelicals
took the lead. They argued that alcohol abuse as well as the violence and
personal and social disintegration associated with it had gotten out of control.
In fact, per capita alcohol consumption, which had grown steadily since the
1790s, was at an all–time high in the 1820s.
Middle–class evangelicals assumed that
poverty, crime, family violence, poor child rearing, and almost every other
social ill was traceable to heavy drinking. A sober citizenry, they argued,
would result in a society free of crime and violence, filled with happy homes
and quiet streets. In the 1840s working people formed their own temperance
movement—first through the Washingtonian Temperance Society, and then through
temperance lodges. Members of both groups turned in the 1850s to campaigns for
statewide prohibition. Beginning with Maine in 1851, 13 states adopted
legislation that outlawed alcohol by 1855. Of those states, all but Delaware
were in the North.
Radical Reform The great belief of Northern
middle–class evangelicalism—a belief behind most middle–class reform—was that
human nature was not irreparably damaged by original sin. In the 17th and 18th
centuries Protestants had been certain that nearly all of mankind was damned.
Only a few would be saved, they believed, and those only by the arbitrary grace
of God, not by their own efforts. These Protestants also thought that most human
beings were incapable of correct moral behavior unless they were coerced.
In the first half of the 19th century, most
Americans—including nearly all Southern whites—continued to believe that people
were morally defective. Coercive institutions, such as the patriarchal family
and slavery, were necessary to impose order on naturally disorderly people.
Northern middle-class evangelicalism promoted the belief that human beings could
change. Evangelists preached that women and men were moral free agents who could
give themselves to God and thus escape a life of sin.
In this view of human nature, institutions
that hindered individual freedom were unnecessary. Such institutions prevented
men and women from assuming responsibility for themselves, thus making it
impossible for them to freely give themselves to God and to a life of Christian
love and moral improvement. The implications of this view were individualistic
and anti–institutional. Some rejected all human government. A few who believed
in no government joined utopian communities such as one at Oneida, New York,
which practiced a form of free love to remove elements of power from relations
between men and women (see Oneida Community). Others, including many
utopians, became radical feminists and abolitionists.
The delegates to the first Women’s Rights Convention at Seneca Falls, New York,
in 1848 were veterans of other reforms. They were members of missionary
societies, of the temperance movement, and of the moral reform crusade (a
movement to end prostitution, obscenity, and lewdness). Most of all, they were
veterans of an antislavery movement that attacked patriarchy and hierarchy in
all forms. Many applied the logic of social reform to themselves, and they began
to think of themselves as human beings first and as women second. See also
Women’s Rights: Early Struggles for Equal Rights
in the United States
Noting that Jesus made no distinction between
the proper duties of women and men, delegates to the Seneca Falls convention
attacked the subordinate status of women. Beginning with a manifesto based on
the Declaration of Independence, women at Seneca Falls demanded civil and legal
equality for women. In particular, they wanted the right to vote. In the
American republic, political participation, they argued, separated people who
counted from those who did not.
The logic of Northern social reform applied more clearly to slavery than to
nearly any other habit or institution. From the beginning, slaves resisted their
own enslavement. In the 18th century, Quakers and a few other whites opposed the
institution. The American Revolution, with its rhetoric of universal natural
rights, called slavery into serious question. Northern states abolished it, and
Southern evangelicals, along with some of the leading slaveholders of the upper
South, thought about liberating the slaves. After 1816 the American Colonization
Society proposed to "repatriate" freed slaves to Africa, though the intent of
this organization was less to liberate slaves than to deport free blacks. Free
blacks understood that, and most of them opposed returning to Africa.
But it was not until the 1830s that
significant numbers of middle–class Northerners began to agitate for the
immediate emancipation of slaves and for their incorporation as equals into the
republic. Like other social reforms, abolitionism took root among the most
radical Northern Whigs, and it was based in the middle–class revivals of the
1820s and 1830s.
In 1831 William Lloyd Garrison, a Boston
abolitionist, published the first issue of The Liberator, an antislavery
newspaper. In 1833 Garrison helped form the American Anti–Slavery Society. The
new movement included Northeastern Quakers and Unitarians and Northern blacks.
Abolitionism’s largest base of support,
however, was among the evangelical middle class of New England, upstate New
York, and the Old Northwest (the former Northwest Territory). These people lived
in a reform culture that saw moral free will and Christian love as pitted
against brutality and power. As the New England Anti–Slavery Society put it in
1833, antislavery "means, finally, that right shall take the supremacy over
wrong, principle over brute force, humanity over cruelty, honesty over theft,
purity over lust, honor over baseness, love over hatred, and religion over
heathenism." It was in such stark opposites that evangelical reformers viewed
Sometimes working with white abolitionists,
sometimes working independently, Northern free blacks also demanded freedom for
the slaves. Hundreds of anonymous women and men operated an Underground Railroad
that hid escaped slaves, often smuggling them to Canada. Along with pamphleteer
David Walker, orator and editor Frederick Douglass, and uncompromising mystic
Sojourner Truth, they formed a dedicated wing of the antislavery movement.
Abolitionists knew that they were a minority.
They also knew that the two parties—Democrats in particular—wanted to keep moral
and sectional questions out of politics and would try to ignore the abolition
movement. They decided to attack the party system as well as slavery. They
organized a postal campaign in 1835, sending massive amounts of antislavery
literature through the mails. Southerners and most Northerners branded this
literature as dangerous, and the Democratic administration could not avoid the
In the next year, abolitionists began sending
hundreds of petitions to Congress. Some of the petitions were against annexation
of slaveholding Texas; others demanded the abolition of slavery in the District
of Columbia or the end of the interstate slave trade. Each of these issues was
within the constitutional sphere assigned to Congress.
In the process of building these campaigns,
abolitionists turned themselves into an organized movement. They also urged the
national government to debate slavery—something that most congressmen from both
sections and both parties wanted to avoid. President Andrew Jackson, rather than
formally censor the mail, simply allowed local postmasters to destroy mail that
they considered dangerous. And Democrats in Congress, with help from Southern
Whigs, devised a gag rule whereby Congress tabled antislavery petitions without
reading them. At the same time, Northern mobs attacked abolitionists and their
sympathizers as threats to racial purity and social order.
These measures gave abolitionists what many of
them had wanted: They tied the defense of slavery to assaults on free speech and
the right of petition. No less a figure than ex-president John Quincy Adams, who
had returned to government as a congressman from Massachusetts, led the fight
against the gag rule. It was a fight that convinced many Northerners that
Southern slavery corrupted republican government and threatened Northern civil
liberties. Beginning as a tiny radical minority, abolitionists had helped force
the nation to confront the troublesome problem of slavery.
COMING OF THE CIVIL WAR: AN OVERVIEW
As early as the Constitutional Convention of 1787, American leaders had known
that they could not settle the differences between the states committed to
slavery and those that were not. The three–fifths rule, the constitutional
promise not to halt the international slave trade until 1808, and the banning of
slavery in the Northwest Territory were all attempts to avoid confronting
differences between the North and South.
Some Northerners thought Southerners would
recognize the inefficiency of slavery and end it voluntarily—a hope that was
dashed by the cotton boom and the South’s recommitment to slavery. Many
Southerners thought that an agrarian coalition uniting the South and West could
keep Northeastern commercial interests from running the country. They realized
that hope when a South–West coalition elected Thomas Jefferson president in
But by the 1830s the market revolution had
tied Northeastern factories and Northwestern farms into a roughly unified,
commercialized North. Most Northerners were committed to free–market capitalism,
individual opportunity, and free labor, and many contrasted what they believed
to be the civilizing effects of hard work and commerce with the supposed
laziness and barbarism of the slave South. For their part, white Southerners
began to see themselves as a beleaguered minority.
Following the 1819 crisis over statehood for
Missouri, a national two–party system developed, and both parties worked to
prevent sectional differences from becoming the focus of politics. They were
successful until the Mexican War gave the United States huge new territories.
Territorial questions had to be handled by Congress, and the question of whether
slavery would be allowed into lands ceded by Mexico immediately became the
all–consuming issue in national politics. By the mid–1850s the old party system
was in ruins. An antislavery Republican Party became dominant in the North and
elected Abraham Lincoln president in 1860. With an antislavery party in control
of the White House, slave states seceded beginning in December 1860. The Union
refused to let them go, and the Civil War began.
COMING OF THE CIVIL WAR: A NARRATIVE A The
Both the North and the South saw the issue of slavery in the territories as a
simple question of right and wrong, but the issue traveled through elaborate
twists and turns from 1846 through the beginning of the Civil War.
Many Northern Democrats in Congress were
disappointed with President James K. Polk (1845-1849). Some represented
market–oriented constituencies that supported a moderately protective tariff and
federal internal improvements. Polk was a Southerner and an old Jacksonian, and
he opposed both of those measures. Northern Democrats also disliked Polk’s
willingness to compromise with the British on expansion into Oregon, while he
went to war with Mexico over Texas. It looked to many Democratic Northerners as
though the Democratic Party was less interested in the expansion of the agrarian
republic than in the expansion of slavery.
Among these Democrats was Congressman David
Wilmot of Pennsylvania. In 1846, during the war with Mexico, he proposed what
became known as the Wilmot Proviso, banning slavery from all territory taken
from Mexico. In subsequent years the proviso was repeatedly attached to
territorial legislation. In the House, combinations of Northern Whigs and
Democrats passed it several times, but the proviso was always stopped in the
Senate. The Wilmot Proviso would become the principal plank in the platform of
the Republican Party.
President Polk and his cabinet favored
extending the Missouri Compromise line west to the Pacific, a solution that
would allow slavery in the New Mexico Territory and in Southern California, but
ban it from Colorado, Utah, Nevada, and Northern California. Neither the North
nor the South favored Polk’s solution. In 1849 President Zachary Taylor proposed
allowing the residents of individual territories to decide the question of
slavery for themselves—a solution that became known as popular sovereignty.
Again, there was too little support. While the Wilmot Proviso stood as the
extreme Northern position, John C. Calhoun, a senator for South Carolina, staked
out an extreme position for the South. Slaves, he said, were property, and
masters could carry their slaves into any territory of the United States.
The Compromise of 1850
Although no proposed solution was acceptable to all sides, the question of
slavery in the territories could not be postponed. In 1848 gold was discovered
in California, and thousands of Americans rushed to the region (see Gold
Rush of 1849). The previous year, Brigham Young had led Mormon settlers to the
Salt Lake Valley, in what became the northeastern corner of the Mexican Cession
in 1848. At the same time, slaveholding Texas claimed half of New Mexico. It was
at this point that politicians proposed a series of measures that became known
as the Compromise of 1850. California was admitted as a free state. The
remainder of the land taken from Mexico was divided into Utah and New Mexico
territories and organized under popular sovereignty. The Texas claims in New
Mexico were denied. The slave trade (but not slavery) was banned in the District
of Columbia, and a stronger fugitive slave law went into effect. These measures
resolved the question of slavery in the territories in ways that tended to favor
the North, then enacted additional measures important to both antislavery and
proslavery forces. The compromise was less a permanent solution than an answer
to an immediate crisis. It would satisfy neither section. One historian has
called it the Armistice of 1850.
The Fugitive Slave Law
The one element of the Compromise of 1850 that explicitly favored the South was
the Fugitive Slave Law. A federal law of 1793 required that slaves who escaped
to a free state be returned if the master could offer proof of ownership to a
state court. The new law turned these cases over to federal commissioners, and
it denied a captured slave the right to testify in his or her own behalf or to
be tried before a jury. The law violated Northerners’ notions of states’ rights,
it infringed on civil liberties in the North, and it turned Northerners into
direct participants in Southern slavery. Northern citizens, even those who had
not previously opposed slavery, refused to support the law. While some hid
fugitives or helped spirit them into Canada, nine Northern states passed
personal liberty laws that forbade state officials from helping to enforce the
Fugitive Slave Law. In 1852 Harriet Beecher Stowe published a sentimental
antislavery novel, Uncle Tom’s Cabin, as a direct challenge to slavery in
general and the Fugitive Slave Law in particular. It sold 300,000 copies that
year, and 1.2 million by summer 1853.
The Kansas–Nebraska Act
The Compromise of 1850 created a smoldering truce that lasted only a few years.
By 1853 settlers had moved west of Missouri into what is now Kansas. Congress
drew up legislation organizing the remaining federal lands in the Louisiana
Purchase into the Kansas and Nebraska territories. Under the Missouri
Compromise, none of this land was open to slavery. But Southerners, along with
15 of 20 Northern Democrats in the Senate, organized the new territories under
popular sovereignty: The new states could decide for themselves whether or not
to allow slavery. The Kansas–Nebraska Act thus abolished the Missouri Compromise
line and enacted popular sovereignty—a measure that was becoming the Democratic
Party’s answer to the question of slavery in the territories.
Northern Whigs in Congress all voted against
the act, leading Southern Whigs to leave the party and join the Democrats. At
the same time, many Northern Democrats openly opposed the legislation. Thus the
Democratic Party shifted and became more overtly Southern, while Northern Whigs
and many Northern Democrats joined coalitions that in 1854 became the Republican
Party, exclusively Northern and antislavery. Political parties were reorganizing
along sectional lines.
With the territory organized under popular sovereignty, voters would decide the
question of slavery in Kansas. Antislavery settlers flooded the territory, and
in response, proslavery Missourians moved in. When elections were held for the
territorial legislature in 1854, about 5,000 Missourians crossed the border to
vote illegally for proslavery candidates. The resulting legislature legalized
slavery in Kansas. Antislavery forces refused to accept these results. They
organized a convention that wrote an antislavery constitution and they elected
their own legislature.
While this controversy raged in Kansas,
Charles Sumner, an antislavery senator from Massachusetts, gave an impassioned
antislavery speech in which he insulted a number of Southern senators. He said
that one of them, Andrew Butler, "had chosen a mistress to whom he has made his
vows…the harlot, Slavery." Congressman Preston Brooks of South Carolina was
Butler’s nephew. He was determined to punish Sumner’s attack upon his family’s
honor. He walked onto the floor of the Senate, found Sumner at his desk, and
beat him unconscious with a cane. White Southerners almost unanimously applauded
Brooks, while Northerners ranted against Southern savagery. At almost the same
time as the attack on Sumner, in May 1856, proslavery Kansans attacked an
antislavery stronghold at Lawrence. In retribution, an antislavery fanatic named
John Brown murdered five proslavery settlers in what became known as the
Pottawatomie Massacre. A small–scale civil war was being fought in Kansas.
The Dred Scott Case
At this point the Supreme Court, with a Southern majority among the justices,
tried to settle the problem of slavery in the territories. It chose the Dred
Scott case to do so. Scott was a slave owned by a U.S. Army doctor who had
brought him to the free state of Illinois and the Territory of Wisconsin, which
was free under the Missouri Compromise. Scott sued for his freedom on that
The Supreme Court answered with a powerful
proslavery decision in 1857. First, the majority stated that blacks (whether
free or slaves) could not be citizens of the United States. As a result, Dred
Scott’s case should never have entered the federal courts. The court went on to
declare that the Missouri Compromise was invalid because Congress had no right
to exclude slaves (who were legal property and therefore protected under the
Constitution) from any territory. With that, the Supreme Court had adopted the
extreme Southern position on the question of slavery in the territories, and
declared the policy of the Republican Party and of a majority of Northerners
Meanwhile, Kansas submitted two constitutions
in its application for statehood—one that permitted slavery and one that did
not. President James Buchanan, a Northern Democrat and a solid supporter of the
South, sent the Lecompton (proslavery) Constitution to Congress with a strong
recommendation that it be accepted. In a congressional debate that at one point
broke into a fistfight, enough Northern Democrats finally defected from their
party to reject the Lecompton Constitution. The controversy deeply divided the
Democratic Party in the North and made the election of an antislavery Republican
as president in 1860 very likely.
The Election of 1860
The breakup of the party system produced four presidential candidates in the
election of 1860. The Democratic Party split angrily into Northern and Southern
wings. Southern Democrats nominated Buchanan’s vice president, John C.
Breckinridge of Kentucky, while Northern Democrats chose Senator Stephen A.
Douglas of Illinois. What remained of the Whigs renamed themselves
Constitutional Unionists and nominated Senator John Bell of Tennessee (see
Constitutional Union Party). Republicans passed over better–known candidates and
nominated Abraham Lincoln of Illinois.
Lincoln had become known nationally when he
staked out the Republican position on slavery in the territories and held his
own in a series of public debates in a Senate race with Douglas in 1858. He was
also known for a speech in which he stated that the United States could not long
endure as a "house divided" between Northern free–labor capitalism and Southern
slavery. On the crucial question of slavery in the territories, Lincoln assured
the South that no president could constitutionally dismantle the institution in
the states. But he would preserve the territories for free labor, thus putting
slavery "in the course of ultimate extinction."
The election results were starkly sectional.
Breckinridge carried 11 states in the Deep South. Bell carried a few Upper South
states. Douglas, while coming in second in the popular vote, won only in
Missouri and a part of New Jersey. Lincoln carried every Northern state and thus
won an overwhelming victory in the Electoral College—and he did so without a
single electoral vote from a slave state. The Republican Party, with an
antislavery platform and an entirely Northern constituency, had elected a
president of the United States. No possible new coalition would enable the South
to keep that from happening repeatedly.
THE CIVIL WAR A The South Secedes
White Southerners fully realized what had happened: National politics now pitted
the North against the South, and the North had a solid and growing majority. The
South would never again control the federal government or see it controlled by
friendly Northerners. Many saw no alternative to seceding from the Union.
Southerners justified secession with what was
called the compact theory. This theory held that the Constitution had
created not a perpetual union but a compact between independent states that
retained their sovereignty. The compact could be broken in the same way that it
had been created: with state conventions called for that purpose. By this means
South Carolina seceded from the Union in late December 1860. By February 1
(before Lincoln’s inauguration) six more states from the Deep South had left the
Northerners—including President Buchanan,
Stephen Douglas, and other Democrats—denied the right of secession. The more
lawyerly among them reminded the South that the Constitution was written "to
form a more perfect Union" than the Articles of Confederation. The Constitution
had stated that "the union shall be perpetual." Thus secession was a legal
impossibility. And in practical terms, Northerners argued, secession would be a
fatal disaster to the American republic. Republics had a history of splitting
into smaller parts and descending into anarchy. Secession, Lincoln argued, was
revolution. Many Southerners agreed and claimed that they were exercising their
sacred right to revolt against oppressive government.
Congress tried to come up with compromise
measures in early 1861, but there was no way of compromising in the argument
over secession. The seven states of the lower South (South Carolina,
Mississippi, Florida, Alabama, Georgia, Louisiana, and Texas) formed themselves
into the Confederate States of America. Their Constitution was nearly identical
to the Constitution of the United States, though it affirmed state sovereignty,
guaranteed slavery, and limited the president to a single six–year term.
In his inaugural address, Lincoln was
conciliatory without compromising on secession. He also hinted that the national
government would use force to protect military garrisons in the Confederate
states—in particular, Fort Moultrie in Charleston Harbor in South Carolina. When
he tried to resupply the garrison (which had moved to the stronger Fort Sumter),
the South Carolina militia fired thousands of artillery rounds into the fort,
forcing its surrender. With that, the Civil War began.
With the beginning of the war, Virginia, North
Carolina, Tennessee, and Arkansas seceded and joined the Confederacy. Unionist
legislative majorities kept the remaining slave states of Maryland, Kentucky,
Delaware, and Missouri from joining the rebel states. Meanwhile the western
counties of Virginia seceded from that state when Virginia seceded from the
Union and became the new state of West Virginia. Thousands of men from these
border states, however, traveled south and joined the Confederate Army.
North vs. South
On paper, the North possessed overwhelming military superiority over the South.
The North had a free population of about 22 million. The South had a population
of 9 million, including almost 4 million slaves. The North was a modern
industrial power; the South was overwhelmingly rural. The North possessed
nine–tenths of the nation’s industrial capacity, four–fifths of its bank
capital, and three–fourths of its taxable wealth. The North financed 60 percent
of its war effort through the sale of bonds in its prosperous region. Its paper
currency inflated by only 80 percent during the whole war. The South, on the
other hand, had to finance the war by printing paper money that inflated 9,000
percent in four years.
Yet the South had advantages as well. To
succeed, the South did not have to invade and conquer the North. The South had
only to prevent the North from invading and conquering the Confederacy. In a
similar situation during the American Revolution, the British had far greater
military superiority over the Americans than the Union possessed over the
Confederacy, but the British failed to subdue the American revolutionaries. Many
predicted that the Union would fail as well. The South had only to prolong the
war until the North gave up and went home. In addition, the South’s economic
backwardness was an advantage: Northern armies had to operate in hostile
territory in which transportation and communications were very difficult.
Finally, improved weapons (most notably rifled muskets that were accurate at
more than 300 yards) gave a lethal advantage to entrenched defenders over
opponents who attacked them across open ground. Union soldiers did most of the
Differing objectives of North and South and
the topography of the contested ground helped determine the nature of the war.
In the west, Northern armies used the Mississippi and Tennessee rivers
(navigable streams that ran into the South) to capture Confederate territory and
to control the river system. By the spring of 1863 the Union controlled all of
the Mississippi River except a Confederate stronghold at Vicksburg, Mississippi.
That city fell in July, and the Confederacy was cut in half (see Campaign
In northern Virginia, however, the South
defended land with Chesapeake inlets and east–west rivers that the Union had to
cross. In this theater the South also had General Robert E. Lee, an almost
mystically skilled commander who constantly outthought his attackers and forced
them to assault him under bad conditions. On two occasions, Lee invaded Northern
territory. He suffered defeats at the Battle of Antietam (in Maryland) in 1862
and the Battle of Gettysburg, Pennsylvania, in 1863. For the remainder of the
war he fought defensively. General Ulysses S. Grant took control of the Union
Army opposed to Lee in early 1864 and attacked Lee that spring. In horrific
battles at the Wilderness, Spotsylvania, and Cold Harbor (all in northern
Virginia), Grant took heavy casualties before trapping and besieging Lee at
Petersburg, south of Richmond, Virginia.
At the same time, Union General William
Tecumseh Sherman marched from Chattanooga, Tennessee, to Atlanta, Georgia. After
a monthlong siege, he captured and burned Atlanta. While Atlanta and Petersburg
were besieged, Northern voters reelected Lincoln in 1864 in an election that was
regarded as a referendum on the war. The South had succeeded in avoiding defeat
and in turning the contest into a war of attrition. But it had not, as
Southerners had hoped, broken the North’s will to continue fighting.
While Grant and Lee faced each other at
Petersburg, Sherman left Atlanta and set out across country to Savannah,
Georgia, destroying everything in his path that was of military value and much
that was not (see Sherman’s March to the Sea). Sherman then turned north,
burned the South Carolina capital at Columbia and kept moving into North
Carolina. Before Sherman could join Grant, Lee’s army fled Petersburg. Grant
caught him at Appomattox, and Lee surrendered. At a cost of 360,000 Union dead
and 260,000 Confederate dead, the United States had been preserved.
The Emancipation Proclamation
At first, the Union and the Confederacy fought only over the question of
secession. The leaders of both sides wanted to avoid talking about slavery—which
all of them knew was the root cause of the war. Southerners did not present the
war as a defense of slavery for two reasons. First, most white Southerners owned
no slaves and might not fight to protect slavery. Second, the South was trying
to win recognition and help from Britain and France—neither of which would have
supported a war for slavery. The North included many abolitionists, but it also
included Democrats and border–state slaveholders who would fight for the Union
but not for abolition.
As the war dragged on, however, even Northern
anti–abolitionists came to see slaves as a great economic and military asset for
the South. Slaves grew most of the South’s food and performed work that freed
white Southerners for military service. At the same time, thousands of slaves
made the issue of slavery unavoidable by abandoning their masters—even those in
the border states who were Unionists—and fleeing to Union lines. Union Army
commanders called these escaped slaves contrabands (captured property). As the
number of contrabands grew, President Lincoln proposed a gradual, compensated
emancipation of slaves in border states. Lincoln hated slavery on moral grounds.
But he could justify emancipation only as a military necessity in the war to
save the Union.
In a preliminary Emancipation Proclamation,
issued after the Northern victory at Antietam in September 1862, Lincoln
declared that slaves in all states that remained in rebellion on January 1,
1863, would be "forever free." The proclamation exempted pro–Union border states
and parts of the Confederacy already under Union occupation, and it was
carefully worded as a measure to assist the North in preserving the Union. But
it transformed the Union Army into an army of liberation—fighting to end slavery
as well as to preserve the Union.
Blacks confirmed their emancipation by
enlisting in the Union Army. The North resorted to conscription in 1863 and
gladly accepted volunteers from among freed slaves. Blacks were first used as
support troops and were paid less than white soldiers, but beginning in 1864
they became combatants serving at equal pay. In January 1865 Congress passed the
13th Amendment, which ended slavery forever. It was ratified and became part of
the Constitution in December 1865.
Results of the Civil War The Civil War
finally established the United States as a nation–state. Secession and state
veto power had been recurring questions from the beginning of government under
the Constitution. Americans before the Civil War spoke of the United States as a
plural noun. Walt Whitman, the great poet of the Union, declared in the prewar
years that "the United States need poets." Since the Civil War the United States
has been a singular noun (The United States is ...). Thus at the highest
constitutional levels, the Founders’ Latin motto E Pluribus Unum ("From
many, one") finally became a reality.
However, the unification of the country went
further than most Northerners had wanted. The enormous government debt incurred
during the war, followed by the postwar occupation of the South, created a
central government more powerful than even the most nationalistic Americans had
imagined before the war. The many had indeed become one, but only under a
national government that would have frightened most of the Founding Fathers.
The Civil War had long-term economic and
social results as well. The South was the theater of war, and the physical
destruction of that region was enormous. White Southerners lost their plantation
labor system and their huge investment in slaves. Egyptian and Indian cotton had
entered world markets during the war, and American cotton never regained its
prewar dominance. The South remained the poorest region of the United States for
a very long time.
The Northeast’s economic dominance was secured
by the war, and—though historians debate this point—the war seems to have sped
Northern economic development. Finally, the status of the trans–Mississippi West
(the great prize in the argument between North and South) was settled on
Northern terms. In 1862 Republicans and Northern Democrats passed the Homestead
Act, which gave free government land to settlers if they turned the land into
farms (see Homestead Laws). In the same year Congress subsidized private
companies that built a railroad from Omaha, Nebraska, to Sacramento, California.
The same Congress, in the Morrill Land–Grant College Act, gave huge amounts of
federal land to state governments for the purpose of establishing state
universities. Southerners had blocked similar bills for many years. With the
South out of Congress, Northerners imposed their blueprint for Northern–style
family farms, public education, and market society upon the West.
Disfranchised groups often saw their positions
improve as a result of the war. Irish and German immigrants had experienced (and
returned) the hostility of native–born Americans in the decades before the war.
About one in four Union soldiers was an immigrant, and their help in defeating
the South temporarily eased anti–immigrant feeling.
Northern women saw new possibilities open up
during and after the war. In wartime they often took jobs previously done by men
on farms and in factories, and thousands served in the Union nursing corps.
Partly as a result, postwar women’s political and reform groups were larger and
more militant than the groups that preceded them.
Finally and perhaps most importantly, the
Civil War was a watershed in the history of African Americans. The war
permanently ended slavery. At the same time, it raised questions about the
economic, social, and political place of African Americans in the United States.
Those questions have been near the center of American public life ever since,
providing the strongest evidence that E Pluribus Unum is a contested
possibility and not an established fact of American history.
As the Civil War ended, the United States faced unprecedented tasks: to bring
the defeated Confederate states back into the Union and to determine the status
in American society of almost four million former slaves. These goals dominated
the years from 1865 to 1877, the era known as Reconstruction. During these
years, Congress imposed a legislative revolution that transformed the South.
Republican legislators passed ambitious laws, approved major constitutional
amendments, overhauled Southern state governments, and spurred extensive change
in the former Confederacy. The most significant change that Congress made was to
enfranchise African American men. The pivot of reconstruction policy, black
suffrage was the era’s major achievement. For more information, see
African American History: Reconstruction.
Congress vs. Johnson
The process of reconstruction (the process by which the divided nation was
reunited) had in fact begun in 1863 when President Lincoln announced a plan to
restore the Southern states to the Union. Radical Republicans in Congress
opposed Lincoln’s plan. After Lincoln was assassinated in April 1865, they
turned hopefully to President Andrew Johnson. In May 1865 Johnson announced his
restoration plan, called Presidential Reconstruction. His plan disqualified
former Confederate civil and military officers from holding office but brought
the ex-Confederate states back into the Union on undemanding terms.
Presidential Reconstruction took effect in the
summer of 1865. Johnson gave pardons to thousands of Southerners, and former
Confederate states passed "black codes" that curtailed the freed slaves’ rights.
Enraged Republicans united in opposition to Johnson, denouncing the black codes
and the president. When the 39th Congress, dominated by Republicans, convened in
December 1865, Republicans planned to revoke the black codes and to replace
In 1866 they passed two laws over the
president's vetoes: the Civil Rights Act to protect the rights of freed slaves
and an act that extended the life of the Freedmen's Bureau. The bureau was
designed as a relief organization for blacks and whites who were left destitute
by the war. It also helped blacks by establishing schools, supervising labor
relations, and protecting them from violence and intimidation.
Johnson’s vetoes provoked Republicans to pass
the 14th Amendment, which guaranteed the civil rights of all citizens, whatever
their race, and restricted the political power of former Confederates. Johnson
denounced the proposed amendment because he believed it was an unconstitutional
invasion of states’ rights. After the congressional elections of 1866,
Republicans maintained enough power to pass their own reconstruction program.
In 1867 Congress passed the Reconstruction
Act, followed by three supplemental acts passed later the same year and in 1868.
These acts invalidated the state governments formed under Lincoln's and
Johnson's plans and divided the ex-Confederacy into five military districts. The
acts also provided that voters—all black men and white men not disqualified by
the 14th Amendment—could elect delegates to write new state constitutions that
ensured black male suffrage. A state could be readmitted to the Union once it
had met a series of requirements, including ratification of the 14th Amendment.
Black enfranchisement made Congressional Reconstruction more radical than
Johnson's plan. Still, even Congressional Reconstruction provided only a
temporary period of military rule, and it did not take property away from former
Confederates or punish them for treason.
When President Johnson tried to block the new
Reconstruction laws, Republicans again united, this time in order to remove him
from office. The House approved 11 charges of impeachment, but Johnson escaped
conviction in the Senate by one vote. Congress then passed the 15th Amendment,
which guaranteed black suffrage. Women's rights advocates complained that the
new amendment ignored their demands for enfranchising women, but to Republican
leaders, the woman suffrage issue was not vital. Black suffrage, in contrast,
was imperative: Only with the votes of African Americans could Republicans
control the former Confederate states.
Political Developments in the South
With Congressional Reconstruction in place, the Southern states, supervised by
federal troops, formed new state governments that were dominated by Republicans.
By the end of March 1870 all of the former Confederate states had been
readmitted to the Union. Black male suffrage was vital to the Congressional
plan. By giving 700,000 former slaves the right to vote, Congressional
Reconstruction created a new electorate in the South; blacks held voting
majorities in five states.
Reconstruction-era voters provided support for
a Southern Republican Party, a fragile coalition made up of carpetbaggers
(Northerners who moved south after the war), scalawags (Southerners, usually
former Whigs who joined the Republicans), and African Americans. Under
Republican rule, Southern states built roads and bridges, promoted railroad
development, funded state institutions, started state school systems, enlarged
state government, and increased state budgets. Republican rule, however, was
brief, less than five years in most states.
Southern Democrats, white landowners, and
white voters generally opposed Republican rule. They tried to dismantle
Republican power by terrorizing blacks to prevent them from voting. Without
black votes, the Democrats would be able to defeat the Republican Party and
reclaim their power. The best-known terrorist group was the Ku Klux Klan, formed
in 1866 to suppress black suffrage and restore white supremacy. Klan members
attacked Freedmen's Bureau officers, white Republicans, and black voters.
Republicans in Congress tried to combat terrorism with three "enforcement acts"
of 1870 and 1871. The acts sought to protect voters, supervise elections, and
punish those who impeded black suffrage. Federal efforts virtually suppressed
the Ku Klux Klan, but violence and intimidation continued, and ex-Confederate
hostility to emancipation seethed.
Freedom for Blacks
Emancipation was a momentous experience; to former slaves, it represented
autonomy and freedom from white control. Freedom brought waves of migration
within the former Confederacy. Newly freed peoples moved to cities or to other
plantations, sought out family members from whom they had been separated, and
secured legal marriages, sometimes in mass ceremonies. They also formed new
institutions. Black churches provided former slaves with spiritual support.
Seeking literacy for themselves and their children, former slaves started
freedmen's schools. The Freedmen's Bureau and Northern philanthropy helped
establish more than 4,000 African American schools and some advanced
institutions, such as Howard University in Washington, D.C. In several locales,
blacks strove for integrated public facilities. In 1875 Congress passed a Civil
Rights Act to bar segregation in public places. Typically, former slaves sought
not integration with whites but freedom from white interference.
A paramount black goal was to own land, which
signified independence, but Southern whites retained control over the land.
Reconstruction did not redistribute land in the South, and most former slaves
lacked the resources to buy it. From 1865 to 1866, newly freed African Americans
began to sign labor contacts with planters to do field work in exchange for
wages, housing, food, and clothing. But they found the new system too similar to
slavery, and planters disliked it, too. The labor system that evolved,
sharecropping, seemed preferable. Under this system, landowners divided
plantations into small units and rented them to blacks for a portion of the
crop, usually one-third or one-half. Former slaves favored the new sharecropping
system, which provided more independence than the wage system. Planters also
appreciated the sharecropping system because they retained control of their land
and split the risk of planting with sharecroppers. Owners of large plantations
held on to their powerful positions in society.
A major depression in 1873 drove many white
farmers into sharecropping as well. By 1880 sharecroppers, black and white,
farmed four-fifths of the land in the cotton states. Many sharecroppers were
forced into a cycle of debt; rural merchants who loaned money to buy supplies
charged high interest rates for the loans and secured them with liens or claims
on the next year's crop. Frequently the loans could not be repaid, and
sharecroppers fell into debt.
Sharecropping bound the South to easily
marketable cash crops that brought in the most income. Southerners did not
diversify their crops or protect their land against soil depletion. As a result,
the productivity of Southern agriculture declined over the years.
Political Developments in the North
While Southern Republicans struggled to keep Reconstruction afloat, their
Northern counterparts faced a changing economy and other problems. During the
Reconstruction years, the North industrialized rapidly and also endured a
massive depression. At the same time, political corruption became commonplace.
These problems distracted Northerners from the goals of Reconstruction.
The administration of Ulysses S. Grant, who
won the presidential election of 1868 on the votes of newly enfranchised
freedmen, was ridden with scandal. But fraud, bribery, and corruption in office
were not limited to the Grant administration. In New York City, Democratic boss
William M. Tweed looted the city treasury. In the election of 1872 the
Republican Party split over corruption in the Grant administration, and some
Republicans formed the Liberal Republican Party. The split failed to dislodge
Grant, but it meant dwindling support for Reconstruction policy.
A devastating five-year depression that began
with the panic of 1873 also shifted the focus of Republicans in the North. Banks
closed, jobs were destroyed, and businesses went bankrupt. Labor protests
multiplied, and violent incidents occurred; industrial conflict began to replace
regional conflict. Disputes also arose over currency, notably over inflationary
greenbacks, first issued during the Civil War. As a result of the depression,
prices for farm products fell. Forced to take on more debt, farmers began to
call for an increase in the amount of money in circulation. They believed that a
larger money supply would cause prices to rise, increase the price of their
crops, and raise their incomes. Those who favored a stable currency, in
contrast, urged withdrawal of greenbacks from circulation.
Meanwhile, the Supreme Court began to roll
back Reconstruction policy. In the Slaughterhouse Cases in 1873, the Supreme
Court ruled that the 14th Amendment did not give the federal government control
over the entire domain of civil rights. The cases are historically important
because they first posed the problem of defining how state citizenship related
to U.S. citizenship.
The Supreme Court of the 1870s and 1880s
discarded other Reconstruction policies. In 1876 and 1883, the Court upset two
out of three of the enforcement acts. The Court also ruled in 1883 that Congress
could not impose a national ban on discrimination in public accommodations, thus
overturning the Civil Rights Act of 1875. The Court's decisions reinforced
Republican willingness to shed the obligations of Reconstruction, which many now
considered a political liability. | <urn:uuid:5b8fc400-281f-40b1-a4a6-a05d0366f0e4> | CC-MAIN-2017-43 | http://history-world.org/history_of_the_united_states4.htm | s3://commoncrawl/crawl-data/CC-MAIN-2017-43/segments/1508187825227.80/warc/CC-MAIN-20171022113105-20171022133105-00219.warc.gz | en | 0.957772 | 12,187 | 4.15625 | 4 |
October 15, 2021
The International Day of Rural Women is observed on Oct. 15, the day before World Food Day, to bring attention to the “significant contributions [of women] to agricultural production, food security and nutrition, land and natural resource management, and building climate resilience.” This year’s theme is “building women’s resilience in the wake of COVID-19.”
The pandemic has really magnified global gender inequality as it has done for so many other forms of inequality. When it comes to the loss of employment and livelihoods, women have lost the most during the pandemic due to working in hard-hit economic sectors. The U.N. Women and United Nations Development Programme (UNDP) estimates that this year, 47 million women and girls will be pushed into poverty as a result of COVID-19. And worldwide, women have been charged with managing most of the extra unpaid care work generated by the pandemic. Furthermore, growing food insecurity and the prevalence of lockdowns have led to increasing rates of gender-based violence, including domestic violence and sexual violence.
Unfortunately, the pandemic has also had negative implications for women’s land rights. Before the pandemic, women already experienced challenges to land ownership worldwide. In fact, less than 15% of global landowners are women and 40% of countries limit women’s property rights. With the onset of the pandemic, many more women have been widowed due to the virus, leaving many without rights to land, property or inheritance. In many countries, when a woman is widowed, she and her children could be evicted from their land and home, which means they would lose their shelter, food and livelihood security. In fact, it is quite common for the death of the male head of household to lead to family conflicts over land. Despite many countries having laws that protect the rights of women to land, there are breakdowns when it comes to the implementation of those laws. If social norms don’t change, legislation alone is not enough to change the lives of women.
Further, the pandemic has hampered women’s land rights advocacy efforts, impeded government land registration and titling procedures, and some lockdown policies have made it difficult for women to farm which leaves their land fallow and open to potential land grab.
Land rights are not only necessary for securing shelter, food and livelihoods for rural women, but they are necessary for women’s meaningful participation in society. Often, participation in decision making bodies within communities requires landownership. Without land ownership, women’s role in society and access to resources and livelihoods will always be limited and insecure.
The Presbyterian Hunger Program (PHP) has partnered with Action for Rural Women’s Empowerment (ARUWE) in Uganda since 2016 to promote the rights of women to land and property in the Kyankwanzi district. ARUWE has made it its mission to educate women and men on the land rights of women under the law and has assisted women in accessing land services and securing land registration. Agnes Mirembe, the executive director of ARUWE, states, “We continue to dedicate our efforts to promoting equitable access and control over land as a production resource for rural women to enhance their meaningful contribution to food security and economic development.”
Women’s rights to land are foundational to insuring all other human rights, including food, housing, work and education. Without land rights, women are left in a constant state of insecurity; unable to meet basic needs, lacking a sustainable income, and vulnerable to economic and health shocks such as those posed by the current COVID-19 pandemic. Supporting rural women’s land rights is vital for empowering the resilience of women in the aftermath of COVID-19.
Eileen Schuhmann, Mission Specialist for International Hunger Concerns, Presbyterian Hunger Program
Today’s Focus: International Day of Rural Women
Let us join in prayer for:
PC(USA) Agencies’ Staff
Susan Barnett, Coordinator, Research Services, Administrative Services Group (A Corp)
David Barnhart, Associate, Story Ministry & Documentary Filmmaker, Compassion, Peace & Justice, Presbyterian Mission Agency
Let us pray
Gracious God, we pray that you shine your light of knowledge and awareness. Help us to see more clearly the inequalities that exist in the world and where we need to take action. Let our thoughts, words and actions be yours. We pray for the strength and courage of rural women worldwide as they struggle for human rights and security. May we be allies in their struggle. Amen. | <urn:uuid:e1c82719-fff8-464c-985f-07c2023ba69a> | CC-MAIN-2021-43 | https://www.presbyterianmission.org/yearbook/October-15-2021/ | s3://commoncrawl/crawl-data/CC-MAIN-2021-43/segments/1634323585537.28/warc/CC-MAIN-20211023002852-20211023032852-00463.warc.gz | en | 0.955726 | 961 | 3.5625 | 4 |
The Key to Chinese Civilization: The Explication and Exploration of Chinese Characters is a fascinating guide to the history of the Chinese civilization, which has been recorded not just by means of the Chinese characters but also in the characters themselves. It studies the long history of Chinese characters, the laws of their construction and development, and what their correct interpretation can mean for contemporary communication. The Chinese writing system, vastly different from phonetic alphabet systems and the oldest continuously used system of writing in the world, is dynamic and its evolution reveals much about the historical and sociocultural development of China.
The book shows how the interpretation of the cultural connotation of Chinese characters is necessary, even crucial, though it is a daunting task. It proposes a scientific method for this kind of interpretation and gives elaborate examples. Authored by an expert in philology and palaeography, the book is written in simple language and will be of great help to Chinese language enthusiasts. | <urn:uuid:9835f97f-b83f-4790-a38c-c57dc4197e56> | CC-MAIN-2018-26 | https://uk.sagepub.com/en-gb/eur/the-key-to-chinese-civilization/book263114 | s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267861899.65/warc/CC-MAIN-20180619041206-20180619061206-00084.warc.gz | en | 0.944427 | 190 | 3.046875 | 3 |
Operations Research (OR) is a research area focusing on "decision-making techniques" based on scientific "analysis."
Overview of Operations Research
Operations Research (OR) is a research area to develop reasonable "decision-making techniques" to solve problems and establish strategies by means of scientific "analysis," including mathematical methodologies.
Various themes are included, for example,
- "How can we know the most efficient route through which we can visit multiple cities?"
- "How can we find a way to determine the rank of the new brand?"
- "What is the way of design that can make all triangles that are formed by the iron frames of the iron bridge identical?"
Application of Operations Research to BPM
A wide range of decision making should be supported in Business Process Management (BPM). They are often themes of Operations Research.
- "How to determine the optimal execution order of tasks (activities), including simultaneous parallel execution (Flow Model)"
- "How to determine the optimal manpower planning of each task (activity) (Organization Model)"
- "How to determine the assignment of work items to each participant"
- "What a way to identify improvements of the entire process model is"
- "What a way to minimize the retention in the process is"
Each problem has various "evaluations" and "constraints," and it is not easy to find the solution and knowledge. Thus, quantitative measurements are important in each problem to find reasonable "decision-making techniques."
History of Operations Research
- 1948: George B. Dantzig published Linear Programming.
- 1951: David G. Kendall published Queuing Theory.
- 1952: Richard Bellman published Dynamic Programming.
- 1957: The Operations Research Society of Japan was founded. (June) | <urn:uuid:24d96b24-87c4-48de-9b2c-a127e824e4f1> | CC-MAIN-2014-15 | http://en.q-bpm.org/mediawiki/index.php/Operations_Research | s3://commoncrawl/crawl-data/CC-MAIN-2014-15/segments/1398223207046.13/warc/CC-MAIN-20140423032007-00294-ip-10-147-4-33.ec2.internal.warc.gz | en | 0.930227 | 372 | 3.390625 | 3 |
So, let us understand concepts related to timekeeping along with NTP and PTP.
Time synchronization is the process of improving the accuracy of a clock by aligning its time and frequency to a reference time standard.
The two well known time sync protocols for IP based networks are Network Time Protocol (NTP) and Precision Time Protocol (PTP). Precise timekeeping is a key attribute for many applications to accurately construct sequence of events that have occurred or is occurring in real time.
- NTP has time accuracy in millisecond.
- NTP implementations uses software time stamping for reception and user-space time stamping for transmission.
- It is a widely implemented industry standard for time synchronization.
- NTP has been around several decades, and has become cheaper, easy and robust.
- NTP is easier to implement as NTP clients are already included with any computers, servers or routers we buy.
- NTP can synchronize a clock to a wide range of time sources; from high-precision atomic clocks and GPS receivers to servers geographically distributed over the Internet.
- The NTP protocol uses a client-server model, with the clock that needs to be synchronized acting as the client, requesting one or more servers for timing information.
- NTP does provide fault tolerance. In fact, NTP does better here than PTP.
- The client gets time from all of NTP servers and ignores one which seems to be too far off in time compared to the other servers time.
- NTP is unicast, requires no special routing rules, and only the sender and intended recipient have to see or handle those packets.
NTP for Virtual machines:
- ESXi server has built-in NTP capability, including a port of the reference implementation and the necessary kernel APIs to support it.
- NTP operates on port number 123.
- NTP operates seamlessly inside virtual machines, as long as the guest OS has support for it and network connectivity to time servers is in place.
- Under most circumstances this should have no impact on time synchronization, except when life-cycle events disrupt guest execution for example suspending a VM.
- Another point to be considered, virtualization adds additional network layers like virtual NIC and virtual switch between the guest clock and the time servers.
- These additional software layers can potentially affect time synchronization variables.
PTP (IEEE 1588):
- PTP maintains microsecond accuracy of timing as it uses Hardware time stamping (NICs with PTP support and PTP time machines).
- PTP, defined by IEEE 1588-2008 works by exchanging messages between master clocks and slave clocks.
- Above diagram shows the exchange of messages between a PTP master clock and a PTP slave clock.
- The departure and arrival times of the Sync and Delay_Request messages are saved as the four timestamps T1-T4.
- The Follow_Up and Delay_Response messages are used to transport the timestamps recorded at the master clock to the slave clock, so that it has the information needed to adjust its time.
- At the end of these exchanges the slave clock has all four timestamps. So it calculates the offset of it’s clock with respect to the master as
- Offset = (T2 + T3 – T1 – T4) /2
- PTP is currently employed to synchronize financial transactions, mobile phone tower transmissions, sub-sea acoustic arrays, and networks that require precise timing.
- PTP does support fault tolerance.
- In the case of PTP, a slave synchronizes to a master clock, which other masters listen to.
- If active master goes down, the other master will take over. This is done using Best Master Clock(BMC) algorithm
- PTP is usually distributed as multicast. That can be a hassle to adminster because it can generate extra traffic and requires special rules to forward between network segments – especially between distant sites.
- PTP uses 2 UDP ports – 319 and 320.
PTP for Virtual machine:
- A precision clock is a virtual device that runs on a virtual machine and accesses the system time of a host.
- PTP provisions precise time synchronization for the virtual machines within a network.
- PTP was designed for local networks with broadcast/multicast transmission and, in ideal conditions, the system clock can be synchronized with sub-microsecond accuracy to the reference time.
- NTP was primarily designed for synchronization over the Internet using unicast (also can be used on local networks as well), where it can usually achieve accuracy in the single-digit millisecond range.
However, accuracy isn’t the only thing which matters. There are usually other criteria’s like resiliency and cost that need to be considered.
- PTP requires extra cost for setup and hardware, so if you are not using PTP already, then continuing with NTP would be a better option unless you have workloads that require PTP accuracy.
- While NTP can serve the majority of non critical workloads, PTP can serve the workloads that are time sensitive like in financial sector.
In order to get both accuracy and resiliency at the same time,
- Another case, PTP would be the primary source for synchronization of the clock when everything is working as expected. NTP would keep the PTP sources in check and allow for fallback between different PTP sources, or to NTP servers when all PTP sources fail. | <urn:uuid:cd1ee3a0-2b63-41d8-9b35-559b551cee61> | CC-MAIN-2022-27 | https://blogs.virtualmaestro.in/2020/04/11/timekeeping-in-vsphere-7-0-ntp-or-ptp/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656103877410.46/warc/CC-MAIN-20220630183616-20220630213616-00012.warc.gz | en | 0.916449 | 1,157 | 3.84375 | 4 |
The Cookie Law is a piece of privacy legislation that requires websites to get consent from visitors to store or retrieve any information on a computer, smartphone or tablet.
It was designed to protect online privacy, by making consumers aware of how information about them is collected and used online, and give them a choice to allow it or not.
What are Cookies?
Cookies are similar to short term memory for the web. They are stored in your browser and enable a site to ‘remember’ little bits of information between pages or visits.
What does this mean if I have a business?
If you own a website, you will need to make sure it complies with the law, and this usually means making some changes.
If you don’t comply you risk enforcement action from regulators, which in the UK means The Information Commissioners’ Office (ICO). In exceptional cases this can mean a fine.
What do you need to do?
Compliance with the cookie law comes down to three basic steps:
- Work out what cookies your site sets, and what they are used for, this can be done with a cookie audit. you need to know the purpose of your cookies, and who is in control of them.
- Obtain their consent and give them some control. | <urn:uuid:437393ad-378c-42fa-be22-bbaac0e5cbef> | CC-MAIN-2018-34 | https://kiswebsites.com/what-is-a-cookie-and-how-does-this-effect-me | s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221215075.58/warc/CC-MAIN-20180819090604-20180819110604-00274.warc.gz | en | 0.962646 | 264 | 3.15625 | 3 |
1,300 Pounds of Roman Coins Unearthed
In Tomares, Spain, whilst digging ditches and laying pipes, workers unearthed treasure trove.
It seems that sometime in the past, one person (or several people) buried nineteen jars filled with Roman coins in what would become Zaudin Park. Naturally after the find, all work on the park has been halted for now.
Experts consider the discovery as unique. Nine of the nineteen jars (or amphoras) were intact — although several broke during excavation — and all of the jars contained thousands of bronze and silver-coated coins.
The coins within the jars date from the end of the fourth century. At the time of their burial, they are believed to have been newly minted.
They bear the images of emperors Constantine or Maxmian on one side, and on the other side, the images appear to be from various Roman stories.
The Seville Archaeological Museum had nothing similar to these coins in their collection, and once the coins have been thoroughly examined they will be put on display for the public.
Ana Navarro Ortega, head of the museum, said that they had contacted counterparts in Britain, France, and Italy. Apparently, the Tomares jars are one of the most important finds from the period.
Excavation of the jars is difficult due to their weight and fragility. “I can assure you that the jugs cannot be lifted by one person because of their weight and the quantity of the coins inside,” Ortega said.
For now, researchers are puzzling over the reason that the jugs were buried in the first place. Currently, there are several theories floating around academic circles.
It is evident that the jars were deliberately concealed. Bricks and ceramic filler were layed over the treasure. One theory, from the Andalusian Department of Culture, for the coins’ existence in such large numbers is that the money was set aside to pay imperial taxes or army levies.
It’s important to note that Rome had begun to conquer Spain in 218 BC.Their rule their continued until the fifth century.
Richard Wiegel, a professor of ancient Greece and Rome at Western Kentucky University suggested that the coins could have been buried during an era of “great discord in the Roman Empire.” This could be likely because it was during the third century that the central authority in Rome broke down. Germanic tribes were a consistent problem, as they invaded the country periodically. On top of that, there were the usual challenges of ruling an empire.
The coins were discovered in Tomares, in southern Spain, and during the time of Roman rule, the area would have been considered a distant land.
When researchers identified the emperors on the coins, it did help to solidify their theories about the coins. If they knew what the political and social climate was during the time of the burial, then it becomes an easier task of formulating hypotheses. | <urn:uuid:ace23d63-598e-4d35-b86d-a36d2cd6555e> | CC-MAIN-2018-30 | http://historydaily.org/roman-coins-unearthed | s3://commoncrawl/crawl-data/CC-MAIN-2018-30/segments/1531676590559.95/warc/CC-MAIN-20180719051224-20180719071224-00242.warc.gz | en | 0.980245 | 611 | 3.1875 | 3 |
This article is brought to you courtesy of the National Canine Cancer Foundation.
See more articles on canine cancer.
Donate to the Champ Fund and help cure canine cancer.
Exocrine pancreatic cancer is uncommon in dogs. They arise from the epithelial tissues (they form the covering or lining of all internal and external body surfaces) of the pancreas that produce digestive secretions. They are mostly adenocarcinomas that are ductular or acinar in origin (malignant tumors arising from duct cells or acinar cells). Benign exocrine pancreatic tumors are rare. Nodular hyperplasia (hard, pale elevations on the surface of the gland) is common in dogs. Older breeds and spaniels are predisposed.
Like all other cancers, the etiology of exocrine pancreatic cancer is also unknown. But in order to study the incipient phase and growth behavior of pancreatic duct adenocarcinoma, sometimes N-ethyl-N’-nitro-N-nitrosoguanidine is administered intraductally in dogs. This chemical has been found to trigger carcinoma.
The symptoms include weight loss, anorexia, vomiting, diabetes mellitus (accumulation of sugar in the blood), abdominal distension, icterus (presence of jaundice in the sclera of the eye), ascites (accumulation of fluid in the peritoneal cavity) and depression. Sometimes the signs may also be accompanied by pancreatitis (inflammation of the pancreas). Other non-clinical symptoms like mild anemia, hyperglycemia (increased sugar levels in the blood), neutrophilia (abnormal increase in the number of a type of white blood cells) and bilirubinemia (presence of excess bilirubin in the blood), may also be present. In extreme cases, signs of pancreatic insufficiency (inability to digest food properly due to a lack of digestive enzymes made by the pancreas) may be exhibited.
The diagnostic techniques consist of positive contrast upper gastrointestinal radiographs, flow cytometry (it is a technique for counting and examining microscopic particles suspended in a stream of fluid) and ultrasonography.
Radiographs may reveal delayed gastric emptying and compression or invasion of the duodenum. In ascites, there is an abnormal growth of cells that may be revealed on cytologic evaluation. Flow cytometry is useful in differentiating between malignant and benign abdominal effusions. Ultrasonography is useful in localization of the primary tumor, documentation and aspiration of fluid and metastasis to liver and regional lymph nodes.
Most nonislet cell carcinomas of the pancreas spread to the lymph nodes and liver at the time of diagnosis. They are extremely aggressive and proliferative. If the tumor is found to have metastasized to the peritoneal cavity, draining lymph nodes and the liver, doctors generally don’t go for heroic surgery (a surgery in which wide resection margins are obtained since the tumor has spread beyond a resectable size. It is mostly performed to reduce pain in terminally ill patients).
Complete pancreactectomy or pancreaticoduodenectomy (a procedure in which the head of the pancreas, the entire duodenum, a portion of the jejunum, the distal third of the stomach, and the lower half of the common bile duct are removed, to relieve obstruction caused by malignant tumors) is sometimes performed but without success. Palliative gastrointestinal bypasses (allow the passage of food into the intestine) is a temporary option if there is bowel obstruction.
Radiation and chemotherapy have not yielded heartwarming results.
The outcome is very poor since the disease is usually at an advanced stage at the time of diagnosis.
Withrow and MacEwen’s Small Animal Clinical Oncology – Stephen J. Withrow, DVM, DACVIM (Oncology), Director, Animal Cancer Center Stuart Chair In Oncology, University Distinguished Professor, Colorado State University Fort Collins, Colorado; David M. Vail, DVM, DACVIM (Oncology), Professor of Oncology, Director of Clinical Research, School of Veterinary Medicine University of Wisconsin-Madison Madison, Wisconsin | <urn:uuid:4c7315cc-d10c-4f5f-ab83-4a5a6af85ea0> | CC-MAIN-2021-21 | https://dogtime.com/dog-health/canine-cancer/2938-exocrine-pancreatic-cancer-canine-cancer-library | s3://commoncrawl/crawl-data/CC-MAIN-2021-21/segments/1620243991641.5/warc/CC-MAIN-20210511025739-20210511055739-00605.warc.gz | en | 0.895139 | 886 | 3.28125 | 3 |
Which Way Can Effective Treatment Of Kidney Failure
Kidney failure is a medical condition of impaired kidney function in which the kidneys fail to adequately filter metabolic wastes from the blood. The two main forms are acute kidney injury, which is often reversible with adequate treatment, and chronic kidney disease, which is often not reversible.how to treat kidney and which way can effective treatment of kidney failure, This article will tell you about it
Which way can Effective treatment of kidney failure
Micro-Chinese Medicine Osmotherapy is based on Traditional Chinese Medicines (TCM) with the combination of advanced medical technology,according to the each patient’s specific illness and physical conditions, Make some Chinese medicines prescribe. Different from traditional decoction, these medicines will be micronized into fine powder and then put into small bags (about the size of kidney) which will be soaked into prepared solution. While during the treatment, 2 medicated bags will be put under the patient’s back right in renal areas. On the other side, the medicated bags are connected with osmoscope which helps promote the absorption of active ingredients in the medicines.
They can help repair kidney damage and enhance kidney cells’ self-handling ability through certain functions( such as dilating blood circulation, anti-inflammation, anti-coagulation, and supplying necessary nutrients, etc)
In addition, you should also pay more attention to the following things:
1. Eat a healthy diet
2. Keep their blood pressure at a healthy level.
3. Keep their blood sugar or diabetes under control.
4. Have regular checkups with their doctor and include a serum creatinine test to measure GFR.
5. Take medicines as prescribed by their doctor.
6. Exercise regularly.
7. Stopping smoking and alcohol.
If you want to know more information about how to treat and which way can Effective treatment of kidney failure ,please send email to firstname.lastname@example.org or to chat with us on whatsapp 86-18395615012, we will try our best to help you. | <urn:uuid:556f564f-a01c-4973-a606-58aff6557e3c> | CC-MAIN-2019-18 | http://www.tongshantanghospital.com/Treatment_kidney_failure/82.html | s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578527566.44/warc/CC-MAIN-20190419101239-20190419123239-00396.warc.gz | en | 0.94259 | 434 | 2.71875 | 3 |
Arkajyoti Roy Using AI to Track Efficacy of Cancer Treatments
Arkajyoti Roy, assistant professor in the Department of Management Science and Statistics in the UTSA Carlos Alvarez College of Business is leading a first-of-its kind study working with colleagues at UT Health San Antonio to explore how artificial intelligence (AI) can be used to track cancer tumor shrinkage in patients who receive radiotherapy.
Many studies have shown there is significant tumor shrinkage during radiotherapy. When patients receive radiation treatments, however, doctors typically ignore tumor volume changes, and they deliver the same radiation dose repeatedly during a five-to-seven-week treatment.
The team’s study, titled “Managing tumor changes during radiotherapy using a deep learning model,” has been published in the latest edition of the Medical Physics journal.
The team’s research revealed a better option. It demonstrated that it is possible to accurately predict tumor shrinkage and include those tumor changes in radiation treatment plans. This approach can reduce toxicity to surrounding organs and healthy tissue and ultimately improving the patient’s quality of life.
“With improvements in imaging technologies, we are able to gather higher resolution patient data during cancer radiation treatments. Combined with novel AI algorithms, we developed predictive and prescriptive models that can predict a patient’s anatomy in the future, and more importantly, design adaptive radiotherapy plans in anticipation of the changes,” said Roy.
A significant concern for experts is tracking the tumor shrinkage in lungs during radiotherapy. Using the weekly scans of 16 lung cases, the researchers used AI algorithms to identify the changes in the characteristics in the patient’s anatomy that allowed for the prediction of future tumor shape and size on new patients.
With these AI predictions in hand, the researchers optimized future treatment plans by maximizing the radiation dose coverage in the predicted tumors while minimizing radiation exposure to surrounding organs and healthy tissue.
The results showed that using the deep learning model allowed doctors to significantly reduce the therapy dose and still maintain tumor coverage—a great improvement to current clinical practice.
The research team is now developing an improved AI-based adaptive model to better predict changes in the tumor shape and size to offer medical providers with valuable historical data that will further benefit treatment protocols for patients.
“Our goal is to merge both worlds, the AI predictions and optimization in one model to improve the radiation treatments implemented in the clinic,” Roy concluded. | <urn:uuid:99cbda52-a0d7-4d8b-bdc9-b0c8ca47cd6d> | CC-MAIN-2023-23 | https://business.utsa.edu/roy-ai-cancer-research/ | s3://commoncrawl/crawl-data/CC-MAIN-2023-23/segments/1685224644574.15/warc/CC-MAIN-20230529010218-20230529040218-00351.warc.gz | en | 0.928707 | 502 | 2.875 | 3 |
StuxNet, AnonAustria, DigiNotar & Co: What they teach us about operating IT systems in a secure way
Information technology (IT) is no independent technology island anymore. Today it is an essential part of our society. Critical functions of countries are based on information technology. For example there is no electricity without IT and there is no IT without electricity. Our civilization is reliant on processes that are IT driven. This critical infrastructure, especially the critical information infrastructure, is often operated by private companies. With the development of IT networks, the integration of the business processes between organizations has increased, too. Thus the protection of the critical information infrastructure has become a high priority topic for the governments in Europe and all over the world. It can only be handled in cooperation between public and private stakeholders. IT security is a quality aspect of operating IT infrastructure. The availability, integrity and confidentiality of the systems and processed data have to be guaranteed. StuxNet has been the successful proof that malware can attack industrial control systems. Such systems are used to control a wide variety of machinery, from power plants to assembly lines. DigiNotar was a Certificate Authority - part of the critical information infrastructure of the Netherlands. Its compromise in 2011 is a prime example of an attack of a (inter-) national relevant IT system and demonstrates the wide-reaching impact such an event can have. Last summer the attacks by AnonAustria generated a lot of publicity. The Austrian national Computer Emergency Response Team - CERT.at and the Government CERT - GovCERT Austria have been involved in the handling of these incidents. Our experience shows how important it is for an organization to know how to deal with Hacktivism. All these attacks have shown various technical and organizational aspects which have to be considered to guarantee a secure IT operation. This paper gives an overview about the lessons learned.
|Date of creation:||2012|
|Date of revision:|
|Contact details of provider:|| Web page: http://www.itseurope.org/|
When requesting a correction, please mention this item's handle: RePEc:zbw:itse12:60354. See general information about how to correct material in RePEc.
For technical questions regarding this item, or to correct its authors, title, abstract, bibliographic or download information, contact: (ZBW - German National Library of Economics)
If references are entirely missing, you can add them using this form. | <urn:uuid:8dd8c1ba-9690-4791-97ed-fe21492beb0c> | CC-MAIN-2016-07 | https://ideas.repec.org/p/zbw/itse12/60354.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-07/segments/1454701174607.44/warc/CC-MAIN-20160205193934-00201-ip-10-236-182-209.ec2.internal.warc.gz | en | 0.912006 | 506 | 2.71875 | 3 |
We use a lot of energy. In fact, Canadians are some of the world’s highest energy users per person. We use slightly more energy per capita than the U.S., and more than Norway (which has a similar climate, but not the vast distances that energy must be transported in Canada).
That energy demand is met by Canada’s diverse mix of natural resources. Our electrical grids alone are powered by oil, natural gas, coal, hydro, nuclear power and wind. Add in the fuel required to drive our cars and heat our homes, and you have a substantial need for reliable, affordable energy.
In today’s environment you can’t talk about energy for too long before the topic of emissions comes up.
To find out how much energy Canadians use and what our related emissions are, we turned to Natural Resources Canada (NRCan). As part of its mandate to “strengthen and expand Canada’s commitment to energy efficiency and to reduce greenhouse gas (GHG) emissions that contribute to climate change,” NRCan published the 14th edition of its Energy Use Data Handbook earlier in 2017, covering the years 1990 to 2014 — the most recent year for which information is available.
First, a quick primer: NRCan uses the petajoule, or PJ, as its energy measurement. A petajoule equals one quadrillion joules. And a joule is the work required to produce one watt of power for one second.
For perspective, a central air conditioner uses approximately 3,000 watts of power every hour. That equals 3 x 10-12 petajoules. So when NRCan reports energy consumption in petajoules, they’re talking about a lot of energy.
In 1990, Canadians used 1,424.5 PJ in their homes for such things as space and water heating, appliance use, cooling, lighting and so on. Their energy mix included electricity, natural gas, heating oil and “other” forms of energy.
By 2014, that number had increased by 9.5 per cent. Over the same period, however, emissions from using energy in homes actually dropped four per cent. The drop in emissions despite the increase in use can be attributed primarily to an increase in efficiency of household appliances – which improved substantially over that time.
Transportation, however, is a different story. Greenhouse gas emissions created by passenger vehicles (not including freight or off-road vehicles) rose 14.1 per cent.
That increase correlates with energy use over the same period. Between 1990 and 2014, the amount of energy used by Canadian personal-car drivers went up by 18.3 per cent. Emissions rose less steeply than energy use, again because of improved technology and efficiency.
Energy contributes to the high quality of life we enjoy, and the single biggest impact we can have on emissions is to find ways to reduce our day-to-day energy use. Simple things, like not idling our car and turning out the lights when we leave a room, can have a big impact.
As we move into a future with lower emissions and a more diverse energy mix, CEPA members remain committed to ensuring the energy Canadians use every day is delivered in the safest and most responsible way.
Learn more about the pipeline link to climate change and what we are doing about it. | <urn:uuid:dd331d6a-d8ff-493f-bbb2-a6fbc8de62a3> | CC-MAIN-2020-24 | https://www.aboutpipelines.com/en/blog/pipelines-deliver-energy-energy-used/ | s3://commoncrawl/crawl-data/CC-MAIN-2020-24/segments/1590347419056.73/warc/CC-MAIN-20200601145025-20200601175025-00358.warc.gz | en | 0.934187 | 694 | 3.078125 | 3 |
Councils across Victoria will receive extra encouragement to introduce smoke-free outdoor policies this week, with toolkits being sent to local governments detailing how they can implement smoke-free zones in areas like parks, playgrounds and outdoor dining areas.
The information packs, devised by the Heart Foundation (Victoria) and Quit, outline why outdoor smoke-free areas are important and provide practical advice on how to develop, implement, and communicate smoke-free policies within local government areas.
Smoking is taking a heavy toll on Victorians, especially on those from local government areas with higher smoking rates; such as Greater Shepparton, Hume and Knox, to name a few. (To see a full listing of individual local government area smoking rates and the number of deaths caused by smoking go to Page 70 of this report http://www.health.vic.gov.au/healthstatus/downloads/2008_ch02_01.pdf and http://www.quit.org.au/thebigkill/)
Heart Foundation (Victoria) CEO Kathy Bell said momentum was growing for councils to make smoke-free outdoor areas a reality.
"We know the majority of Victorians want smoke-free alfresco dining areas, playgrounds and beaches. Several councils already have outdoor smoke-free areas in place while numerous others have signalled they're interested in introducing the policy."
"Smoke-free outdoor areas are already the norm in other parts of the country and it's only a matter of time before that happens in Victoria as well."
Quit Executive Director Fiona Sharkie said smoke-free outdoor areas were one way to address the toll smoking is taking on local communities in Victoria and bring down smoking rates.
"Smoke-free areas give smokers a reason not to light up, helping many to cut their tobacco consumption and eventually stop smoking for good. Smoke-free areas also help to de-normalise smoking for children, so that they're less likely to take up the habit later in life."
In NSW, the number of councils implementing smoking bans in outdoor areas has almost tripled to 77 since the Heart Foundation started a similar local government project there in 2007. That's 50% of all councils in NSW.
Additionally, late last year, Brisbane City Council announced its pedestrian mall would become smoke-free following the lead of smoke-free malls in Hobart, Tasmania and Frankston, Victoria.
ph: (03) 9635 5498
mob: 0438 714 264
Cancer Council Victoria research shows:
- Over three-quarters (77%) of Victorians (smokers and non-smokers combined) believe smoking shouldn't be allowed in outdoor areas where children are present
- Seven out of 10 (71%) Victorians believe smoking shouldn't be allowed in outdoor restaurant dining areas
- Six out of ten (63%) Victorians believe smoking shouldn't be allowed on beaches
Councils that have outdoor smoke-free policies in place in Victoria include Monash, Moonee Valley and Moreland City Councils in children's playgrounds, Frankston City Council in its outdoor mall in the city centre and the City of Port Phillip and Surf Coast Shire on beaches. Monash City Council is considering extending its existing bans on smoking in outdoor areas | <urn:uuid:ce64b69d-547c-4048-b3ae-3400b2df6930> | CC-MAIN-2017-13 | http://www.quit.org.au/media/article.aspx?ContentID=11_jan_201101&ContainerID=media-january-201011 | s3://commoncrawl/crawl-data/CC-MAIN-2017-13/segments/1490218187717.19/warc/CC-MAIN-20170322212947-00203-ip-10-233-31-227.ec2.internal.warc.gz | en | 0.953252 | 665 | 2.5625 | 3 |
“Sacred Blood and the Body’s Rich Legacy in Julius Caesar"
by Dr. Louise Geddes, Dominican College
(June 2010 Issue / PDF)
Standing across Caesar’s body in the marketplace, Antony follows his famous oration with the claim that his power of speech has not the power to “stir men’s blood” (3.2.224). As much as listening to his words, Antony wants to encourage the plebeians of Rome to look once more upon the piteous sight of the slain Caesar’s corpse. The assumption that underpins Antony’s observation is that the blood of Caesar can “speak” more to the citizens than any words the orators might use. By presenting the body of Caesar onstage, Shakespeare is capitalizing on the appeal of bloodshed, and Antony’s decision to make a relic of the corpse evokes the resistance to iconography that characterized England’s religious revolution. Shakespeare was keenly aware of the controversy surrounding iconoclasm, as it was also a source of anti-theatrical prejudice. Jonas Barish discusses the way in which Medieval antitheatrical writers viewed with disgust the “feigned recreation” (69) that the plays offered, drawing attention to the clerical resistance to spectacle that threatened to redirect the public gaze from a church that employed many of the same visual tactics, but for different ends, therefore blurring the boundaries between “true” and “false” spectacle.
Antitheatricalists argued that staged performances reinforced the notion of unthinking belief in what is seen, and mirrored the practice of venerating church idols and material objects. In Julius Caesar, this power to dazzle is manipulated and exploited, revealing the extent to which the ‘truth’ of an image is dependent on its successful manipulation. The image of Caesar’s carcass recalls the alarming spectacle of Christ’s mutilated body, previously found on crucifixes and rood screens, which although now banished from churches, re-emerged in texts such as Actes and Monuments. The bloody body of Caesar that Antony unveils is one of the play’s most arresting sights and incites the watching crowd to explode in violent fury. Through Antony's manipulation of powerful images, Shakespeare's play exploits violent spectacle at the same time it critiques the manipulation of images.
Literary critics have long been aware of the ceremonial nature of Julius Caesar, explaining Brutus’ attempts at creating ritual as an example of a self-delusional attempt to justify the slaughter of his friend. Over the years, a critical consensus has emerged to suggest that Rome is a place where “words and rituals have dangerously lost their meaning” (Danson 53). However, even though the Roman populace may have lost touch with the "real sacramental import of ritual" (Conn Liebler 98), one cannot assume that ritual has no place in Shakespeare's Rome. Instead, the play shows an awareness of the importance of political violence, both to Caesar's Rome and sixteenth-century England.
The play is located within a world of piety, one that values sacrifice, something that early modern reformers might insultingly characterize as Catholic. The opening act is littered with events and observations that carry religious undertones, and mix ancient Roman rites with allusions that would have been noticeably relevant to a contemporary Elizabethan audience, such as the statues of Caesar that the citizens deck with garlands, and the mocking of the shoemaker as a mender of "bad soles” (1.1.14). Like Puritan preachers, the tribunes propose that instead of participating in a ritual in which meaning buckles under the weight of spectacle, the people “run to your houses, fall upon your knees, / Pray to the gods” (1.1.53-4) for wisdom, privileging introspective prayer over noisy public ceremonies. Brutus takes an extremist stance, viewing all aspects of traditional religion as archaic, superstitious and primitive. However, even as he rejects idolatry in his speeches, his actions validate the impact it holds over the citizens of Rome and mark him as susceptible to the same idolatrous tendencies.
The extreme desire of Brutus to subjugate everything around him to the power of words sets him apart from the ways in which the citizens of Rome communicate, and he is left foolishly surprised when he fails to present a sacrificial image that will be accepted by no other authority than an invocation of his honor. Brutus does indeed sanctify the killing of Caesar but it is because his actions unwittingly acknowledge that the power of spectacle is far greater than his language could ever be. Standing in the marketplace, Brutus mistakenly assumes that his rationality can recontextualize Caesar’s death, and that he can simultaneously ritually kill and deny the ceremony’s validity. Because of the space of uncertainty that Brutus creates, Antony is able to usurp and manipulate the impact that the murder has on the Roman masses. In spite of the conspirators' efforts to prevent the worship of living Caesar as a god-on-earth, Caesar’s corpse becomes a consecrated object, and the citizens fall into idolatrous worship of Rome’s deadmonarch. Through a consideration of the analogous contradiction found in Reformation theology and culture, we might read Julius Caesar as a play that simultaneously exploits and undermines the theatrical nature of early modern belief.
The manner of one's death mattered in ancient Rome, primarily because of the political currency that a well-executed (pun intended) death could afford. During the Roman Republic, devotio became a well-known tradition of embracing death, as a means of honoring the Gods of the underworld, but, under the Empire, it became a symbolic self-slaughter in honor of the Emperor. Occasionally, too, life was offered up as an act of defiance. Cato for example, was so determined to die as a statement against Caesar, that he fell on his sword, and then, while under guard, managed to pull out his stitches and bled to death. Historian Paul Plass suggests that these acts were committed on the premise that “violence was meant to be seen because it was meant to convey a message” (146), rendering life and death as political commodities.
During the English Reformation, martyred bodies become a locus of epistemological, doctrinal and political struggle, as martyrologists attempted to appropriate the testimonies of the dead as a means of propagating a particular agenda. Martyrs were used as figures of inspiration, to galvanize a religious community, or, in this case, a Protestant nation. William Haller explains that “persecution gave its victims the opportunity to dramatize their faith in the Word by embracing martyrdom, and its survivors the opportunity to exploit the testimony of the martyrs by the classic device of a martyrology” (50) – everyone benefits. The spectacles of martyrs going to their deaths were intensely popular, and therefore a terrific medium for political propaganda. In many ways, executions stood as a form of mass entertainment, and thousands of people might turn out to see the death of a high-profile recusant. Unsurprisingly, there were people willing to exploit this captive audience. Even if Reformers wished to realign the focus of the Eucharist, they could not turn their backs on the powerful image of the sacrifice, and the popularity of martyrdom attests to this. The sight of such suffering had the power to spark interest and even conversion, and this suggests that the Reformation is drive to strip ritual of its hold over the common people was at most, muted in its success.
John Foxe's famous book The Actes and Monuments of Christian Martyrs, or Book of Martyrs as it is known, is a case in point. In his account of the martyrdom of John Hooper, Bishop of Worcester and Gloucester, we can see the sensationalism implicit in such narratives. Foxe describes in detail how Hooper burned, which includes him speaking until his lips charred, and beating his breast until one of his arms fell off, while his other hand hung down, dripping gore. Although many critics argue that Foxe deliberately shied away from the Medieval worship of the saints, instead choosing to emphasize the ordinariness of Protestant martyrs (Knott 45), the theatrical nature of some of the martyrdoms he describes complicates such a claim.
Instead of rejecting the theological point of contradiction that martyrdom offers, Shakespeare’s play embraces it. As Caesar’s shattered body is turned into a sacred relic, a “rich legacy” left to the Roman citizens, it is possible to see that ceremony in Rome is a deeply contested site of meaning in which the popular voice battles against the Senators’ re-interpretations of traditional ideas. The elevation of Caesar’s bloodied flesh evokes the Catholic iconography so deeply feared by Protestant Reformers, and looks back to a more medieval form of worship, evoking the popular veneration of the saints’ bodies and holy relics. Antony is able to exploit this latent power, and his belief that Caesar’s wounds “like dumb mouths do ope their ruby lips” (3.1.260) attests to this potency. The reaction of the people, and the raw, violent emotion that Brutus inadvertently unleashes in Rome, serves to validate the presentation of sacrificed flesh – through Antony’s superior performance Caesar’s body is consecrated in the way Brutus most feared, and this ultimately drives him to suicide.
The response to Caesar's body implies a belief in an intercessionary divine power ascribed to the persecuted body, cementing a Roman sense of the world in which religion is conflated with more scientific and logical phenomena. Casca’s discussion of the strange sights he has encountered in the streets, including the slave with the burning hand, the prowling lion and hundred ghastly women, creates an environment in which superstition is justified because the world is a prophetically mysterious place. The discussions of omens, the garlanding of statues and the desire to see Caesar return, all indicate the way in which the visual is privileged over the verbal, and what the conspirators dismiss as the foolish infatuations of the common man is a symbolic power that is integral to Roman belief. In spite of Caesar’s protestation, “I am ashaméd I did yield” (2.2.106) to the power of Calphurnia’s dreams, his first response to his wife’s visions was to bid his priests to sacrifice an animal to the gods, in order to create a sense of security.
As opposed to plays such as Hamlet or Macbeth in which portents and omens are used to explore an individual’s psyche, the characters of Julius Caesar rarely meditate on the implications of the inexplicable phenomena they face. Aside from the second act musings of Brutus, the characters refrain from revealing their innermost thoughts in private monologues, and instead are restricted to observations that give little more than glimpses into their underlying feelings. This rejection of any real interiority in favor of dramatic spectacle creates an environment that is clouded with symbols ripe for interpretation, establishes Rome as a “fundamentally mysterious” (Rose 262) place, in which ceremony has an important role. Cinna’s foreshadowing of his own demise, Ligarius’ assertion that Brutus “like an exorcist, hast conjured up / [His] mortified spirit” (2.1.323-4), and Portia’s assumption that the vision of her on her knees can “charm” her husband into revealing his innermost thoughts, suggests a Rome that blends together a belief in magic and the divine.
In sixteenth-century England, celestial phenomena, such as the comet spied over Rome in Julius Caesar, were frequently exploited for religious and political purposes. Two comets were sighted over England during the late sixteenth century; one in November, 1577 and another that was visible over the course of several weeks during 1582. In the late 1570’s and early 1580’s a flurry of pamphlets circulated in an attempt to address recent celestial happenings. The least overtly political of these documents, written by an author known only as F.K., in 1583, addresses scientific approaches, before he reminds his reader that comets are a reminder from God “to pray that he may turne from us what evyl soever his comettes signifie” (F.K.) continuing the popular path of viewing comets as a celestial omen of doom. Keith Thomas, in his landmark study Religion and the Decline of Magic, firmly locates “sciences” such as astrology, prophecy and superstitions in the Catholic domain, suggesting that Protestantism rejected the appeal of popular magic as part of its doctrinal drive against the efficacy of ceremony. Yet, his proposal that “the century after the Reformation thus constituted a transitional period, during which a variety of magical agencies continued to offer their services to those for whom the Protestant notion of self-help was too arduous” (Thomas 639), implies the similarity in appeal to what he calls the “unsophisticated mind” (638) between the cunning man and religious leader. Thomas’ observation that during this time period, “holy relics became wonder-working fetishes” (26), further suggests the difficulty of this transitory moment. In order to reach a culture steeped in these pseudo-scientific ways of reading the world, the reformers had to rely on similar rhetorical techniques and strategies of propaganda. The tension between doctrinal dismissal of magical beliefs, and the need to invest Protestantism’s own martyrs and leaders with a sense of the sacred, became a characteristic of the English Reformation.
Shakespeare incorporates this sense of uncertainty into Rome, declining to focus on the popular opinion of a comet as an event that foreshadows princely death, and choosing to acknowledge the comet only in act one, scene three, as viewed by the conspirators. Casca, having witnessed the “tempest dropping fire” (1.3.10) attributes it to the more conventional meanings, proposing to Cicero that “either there is civil strife in heaven/ Or else the world, too saucy with the gods, / Incenses them to send destruction” (1.3.11–3). Casca and Cicero’s fear echoes the popular early modern interpretation of these occurrences, but Cassius’ immediate entrance, unbraced, and his subsequent declaration that he had “bared [his] bosom to the thunderstone” (1.3.49) shows the desire of the conspirators to reinterpret traditional symbols and turn their back on the fears and superstitions of Rome. Cassius, like Brutus, attempts to reject what he views as a superstitious approach, privileging his own opinion that when interpreting these natural events, the evidence suggests that “heaven hath infused them with these spirits / To make them instruments of fear and warning / Unto some monstrous state” (1.3.69–71). Cassius cannot entirely reject the rhetoric of superstition, but simply demands credit for his ability literally to stand in defiance of the traditional meaning.
In general, the play is littered with Christian iconography, from the three and thirty wounds, to the idolatrous statues of Casear that are “decked with ceremonies” (1.1.65), and trouble the politicians so greatly. The wound display, for example, carries Eucharistic undertones, most notably evoking the most potent symbol of Renaissance Christian thought – the Passion. The play goes to great lengths to reject the notion that Caesar can be seen as quasi-divine by an emphasis on Caesar’s physical flaws. Moreover, the invocation of Christ imagery that arises from such instances as Brutus’s famous demand that the conspirators be “sacrificers and not butchers” (2.1.166) and Cassius’ proposal that his men wash their hands in the slain Caesar’s blood to purify their recent deed, is raised precisely to elicit a comparison that will leave Caesar wanting.
Cassius marks Caesar out as undeserving of becoming a monarch because he is physically weak, having previously been bested by Cassius in a swimming race, but more important is Shakespeare’s choice to include scenes that highlight Caesar’s physical flaws – his epilepsy, deafness, and inability to father children. Brutus focuses primarily on what “the common eyes” (2.1.179) will see, recognizing that in his Rome, idolatry is not necessarily contingent upon the selection of a worthy object of veneration, but the selection of what appears to be the most obvious choice of veneration placed in front of the people. This awareness creates a problem for the conspirators: how to make the citizens understand a “purpose necessary, and not envious” (2.1.178), and because Shakespeare resists giving us any real insight into Caesar’s motivations, the conspirators are left incapable of adequately explaining the burning need to sacrifice Caesar for Rome. The closest Brutus comes to a rationalization is at the beginning of the second act, when he wonders:
Th’abuse of greatness is when it disjoins
Remorse from power; and, to speak truth of Caesar,
I have not known when his affections swayed
More than his reason. But ‘tis a common proof,
That lowliness is young ambition’s ladder
Whereto the climber-upward turns his face;
But when he once attains the upmost round,
He then unto the ladder turns his back,
Looks in the clouds, scorning the base degrees
By which he did ascend: so Caesar may; (2.1.18–27)
Even though Brutus’ rhetoric evokes the divine, with the image of Caesar climbing into the heavens to sit among the gods, the crucial word here remains “may.” Brutus’ eloquent theory is based entirely around conjecture of what Caesar may turn into, admitting that he has yet to see such qualities in Caesar when he acknowledges “I have not known when his affections swayed /More than his reason.” Cassius exacerbates his sense of inevitable future injustice by indignantly declaiming Caesar’s right to even presume greatness, due to his physical limitations, ambiguously asking “should Rome et cetera” (2.1.47, my italics), feeding Brutus’ imagination, yet never giving any more reason than the personal rancor and jealousy. It seems that what angers the conspirators most is that Caesar is not divine, that he is one of them, chosen over them by the popular voice for adoration, because of his superior ability to manipulate theatrics, not his god-like characteristics.
Although Caesar may be less than divine, he knows how to entertain a crowd. His rejection of kingship is a political display that centers around the awareness of the power of the people to elevate and lionize whomever they choose. Furthermore, Caesar himself publicly rejects any image of himself as a divine entity, by refusing (for the present time, at any rate) to accept the crown, which would distinguish him as King, and distance him from the people of Rome. Casca explains how Caesar, upon perceiving that “the common herd was glad he refused the crown, he plucked…ope his doublet and offered them his throat to cut” (1.2.262-4). Such stage-managed humility gives the citizens what they wish to see, leading Cassius to dryly note, “if the tag-rag people did not clap him and hiss him according as he pleased and displeased them, as they use to do the players in the theatre, I am no true man” (1.2.226-8). Caesar understands the way in which his city operates, and gives the citizens not only spectacle, but a sense of control over spectacle, as evidenced by the stage managed offering of the crown. Even Caesar’s seizure cannot quell the passion of the crowd. Furthermore, Caesar’s concern that Cassius “thinks too much” (1.2.196) illustrates his awareness that spectacle can override rational thought, and control the emotions in such a way as to cloud the judgment.
Considering the skepticism shown towards ceremony in the play, it is no wonder that there is confusion in Brutus’ claim that they be “sacrificers and not butchers” (2.1.165). Brutus’ actions throughout the play reveal a surprising ambivalence towards the notion of sacrifice, and this uncertainty is the reason he is unable to exploit the body of Caesar in the way that Antony does. Trying to make sense of a political system that is so easily manipulated, Brutus’ thoughts are continually at odds with each other, and this conflict becomes manifest both in his actions and speech. His suggestion that the conspirators maintain lofty goals is immediately undercut by his insistence on not making a pledge together. He recoils from the idea that their “performance / Did need an oath” (2.1.135-6), rejecting the idea of consecrating the murder in promises, before immediately attempting to recast the death as a sacrifice, declaring that Caesar will be carved “as a dish fit for the gods” (2.1.173). He acknowledges Caesar’s symbolic representation of the Roman Empire by breaking up his body into parts, and allocating parts to public figures when he calls Antony “but a limb of Caesar” (2.1.165), strengthening the traditional link between sacrificial victim and social body. His concern for the way Caesar’s death will be constructed, combined with the continual references to hewing and hacking found in Brutus’ speech, contradicts the common assumption that Brutus is a man trying to invest meaning in empty ceremony.
In spite of his words, Brutus is fully aware of the symbolic potential of such gestures, and tries to manipulate this meaning for his own purposes, even as he strives to downplay its potency. His insistence that the conspirators “bathe [their] hands in Caesar’s blood / Up to the elbows, and besmear our swords” (3.1.107-8) is a ceremony in itself, and we must question the extent to which the conspirators are willing to recognize this. Cassius musings suggest his greater political acumen when he wonders, “how many ages hence / Shall this our lofty scene be acted over, / In states unborn and accents yet unknown (3.2.112-4).
Cassius hopes that in years to come, the murder will be invested with the same symbolic potency as the crown they so fear Caesar wearing. By the physical act of washing his hands in the blood, he simply further sanctifies the spilt blood. His actions are a recognition of the symbolic power that blood holds, but even if he is aware of this, Brutus attempts to downplay the image he will create by his conviction that eloquent speeches will prevail in the popular mind. Brutus hopes to present Caesar as a sacrifice to Rome, but his dependence on the crowd to validate his ceremony as such, diminishes the power of the spectacle he has created. His glib insistence he alone can employ logic to explain away the murder, is undermined by his decision to present the body to the waiting crowd.
Having experienced the vast popularity of public bloodshed, both secular and religious, in England, Shakespeare understood the significance of elevating the visceral over the verbal, and the shock of Caesar’s body is the centerpiece to the scene in the marketplace. If further proof of Shakespeare’s investment in the dramatic power of visual imagery is needed, we might only consider act three’s revelation of the body. Shakespeare’s citizens respond thus:
O piteous spectacle!
O noble Caesar!
O woeful day!
O traitors! villains!
O most bloody sight! (3.2.199-203)
This list both begins and ends emphasizing the extraordinary shock at what is seen by the common eyes. Brutus’ concern has been proven right. Brutus has deeply underestimated the extent to which the citizens of Rome respond to what they can see and touch, but Antony astutely realizes that to show "Caesar’s wounds, poor poor dumb mouths” is to “bid them speak” (3.2.226-7). The spectacle of Caesar’s body is one that will reverberate in the public imagination, and what is at stake during the scene in the marketplace is who can most convincingly appropriate this image.
Antony is quick to exploit the body of Caesar, in order to sanctify it not an emblem of tyranny, but an icon of the Rome that is under threat by senators who are out of touch with the common people. The most valuable commodity in this war of propaganda is the corpse of Caesar, and Antony understands the need to state-manage this spectacle. In the famous third act, Antony’s superior performative ability is immediately illustrated by the way in which the men address the crowd. Brutus remains in the pulpit, above and away from the common people, offering an eloquent but impersonal oration, symbolic of his separation from the people he is supposed to represent. He challenges the lower class citizens of Rome to step forward and “censure [him] in [their] wisdom” (3.2.16) and stand up to him in public debate. Antony, however, offers a more emotional response, coming down into the marketplace to place Caesar’s body firmly amid the crush of citizens, as one of them. He is even forced to beg the masses of Rome to “stand far off” (3.2.168) in order to maximize the impact caused by the revelation of the body. Antony may lack the lofty aspirations of Brutus (or at least, the claim to lofty aspirations), but he excels in his ability to exploit the spectacle of Caesar’s corpse on a purely visceral level, and to beatify the corpse in a way that Brutus fails to anticipate and most certainly cannot contend with. The failure of Brutus, then, is not his inability to sanctify a political killing, but his unwillingness to recognize that the death of Caesar turns his body into a static icon left open to multiple interpretations, or that he has created a sacred object for the people of Rome to revere.
In the marketplace, the flesh of Caesar passes from the body of slain tyrant to Roman martyr, and whips the people into a frenzy of violence that cannot be contained. In this moment, Shakespeare offers his most critical dissection of the processes of idolatry and reveals the ruthless personal agendas that underpin each perspective. In Shakespeare’s Rome, poised between Republic and Empire, the beliefs of the crowd are used as political tools, and similar to Brutus’ earlier scenes of deliberation, we are encouraged to maintain a detached view of Antony’s performance, but without ever losing sight that we are watching exactly that – a performance. In spite of his claim, “I am no orator as Brutus is” (3.2.211), Antony succeeds in contextualizing the vision of Caesar’s corpse in order to maximize the potency of what the citizens will see, as a means of inciting their passion. For a “plain blunt man” (3.2.212), Antony demonstrates an ability to stage manage a public occasion that could rival Caesar’s, and his exploitation of this relic suggests a wariness in the play of trusting too wholeheartedly in iconic visions.
Antony offers three lengthy speeches that anticipate the revelation of the body. In his first speech, he surreptitiously challenges Brutus’ reshaping of the murder, calling attention to the way in which language can be subject to interpretation, presumably, in advance of offering a sight that would appear to need no contextualization. Like Brutus, he appeals to the rationality of the citizens, but unlike Brutus, begs the masses to invoke their own sense of Roman history, and remember what they have themselves witnessed as examples of Caesar’s ambition. In his first speech, he destabilizes words, calling attention to Brutus' rhetoric through parody and open critique. He simplifies Brutus' esoteric "friends, Romans and lovers! Hear me for my cause and be silent that you may hear" (3.2.13) into the famous "Friends, Roman countrymen, lend me your ears" (3.2.72) further showing his capacity to appeal to the common man. He goes on to say:
When the poor hath cried, Caesar hath wept.
Ambition should be made of sterner stuff.
Yet Brutus says he was ambitious,
And Brutus is an honourable man.
You all did see that on the Lupercal
I thrice presented him a kingly crown,
Which he did thrice refuse. Was this ambition?
Yet Brutus says he was ambitious,
And sure he is an honourable man. (3.2.91-99)
Antony, like Brutus, invokes this selective memory of Rome, but asks the citizens to privilege what they have seen over what they hear. Underlying his repetition of the phrase that Brutus “is an honourable man” is a direct challenge to Brutus’s logocentrism, asking his audience to believe, not the words that they hear, but what they themselves have seen in his behavior. If Brutus calls himself honorable, but looks like a butcher, then it follows that what is termed a sacrifice cannot be more than a savage murder. In fact, Antony rejects the very idea that honor can be something discursively created. Honor is the “scutcheon” (5.1.137) that Falstaff claims it to be in 1 Henry IV, a shield that advertises the nobility of its bearer, but to Antony, it is a badge made of wounds, valor embodied in blood and scar tissue, not in serpentine speeches and declarations of honor.
Theatrics, in the shape of spectacle, becomes necessary, because the audience cannot distinguish between the two arguments. The citizens themselves affirm this, by asking each other:
Marked ye his words? He would not take the crown,
Therefore ‘tis certain he was not ambitious. (3.2.112-3)
Here, Antony’s words become material signs, to be marked or observed. The fifth plebeian’s comment does not invoke his own memory of what he saw, but his understanding is dictated by Antony’s explained remembrance of what was a highly public spectacle, and translated into a logical equation dictated by visual signs. While the citizens struggle to evaluate what they have heard, Antony stands before them, weeping, as a visual reminder of the love that Caesar inspired. His quiet tableau appears to validate his words, and once the citizens have noticed that “his eyes are red as fire with weeping” (3.2.115), their immediate response is to decide that there is “not a nobler man in Rome than Antony” (3.2.116), showing the extent to which public perception is inspired by theatrical visions, even if they are as unreliable as the words used to explain them.
Like a confident showman, Antony drives his audience to beg – first for the will, then for the body of Caesar. The will, Antony implies, is the marker that shall turn Caesar’s body into a sacred relic, and turn his death into a sacrifice that will strengthen the social body of Rome. He says:
‘Tis his will.
Let but the commons hear this testament –
Which, pardon me, I do not mean to read –
And they would go and kiss dead Caesar’s wounds,
And dip their napkins in his sacred blood,
Yea, beg a hair of him for memory,
And, dying, mention it within their will,
Bequeathing it as a rich legacy
Unto their issue. (3.2.129-137)
The use of a will neatly encapsulates the idea of intention buried in corporeal forms, operating as both a desire and a material object that can symbolize intent. In this moment, Antony drives home the consecration that Brutus began when he smeared his arms in Caesar’s blood, and he takes control of an image that Brutus never fully understood and frames it in a manner suitable for his purposes.
It is Antony who takes the image of blood that is already smeared across the stage, covering the bodies of the conspirators, and directly suggests that this vision is seen as a holy one, piquing the curiosity of the citizens of Rome. Through the consecration that Brutus began, Antony shapes the citizen’s response to the body. Furthermore, he pretends to resist their curiosity, by proposing:
It is not meet you know how Caesar loved you.
You are not wood, you are not stones, but men;
And, being men, hearing the will of Caesar,
It will inflame you, it will make you mad. (3.2.141-4)
As if the sight of Caesar’s body were not arresting enough, he turns the body into a coveted holy relic, evoking the Catholic veneration of such objects. Antony’s skillful rhetoric anticipates what his audience will see and infuses it with the appropriate Eucharistic undertones. He reveals the body only after he has whipped the crowd into a frenzy, to ensure that the sight will incense them even more. In fact, the will becomes forgotten in the outcry that Caesar’s body inspires, and Antony must restrain the angry citizens, reminding them “You have forgot the will I told you of” (3.2.232).
Antony's final speech is framed even further by an appropriation of Brutus’s vision of the murder as a sacrifice for the benefit of the social body, by placing the myth of the man as part of a collective Roman history. Standing over the body, he draws attention to its covering, and uses the props to anticipate the spectacle and to create a history fresh in the minds of the citizens. He declares, “if you have tears, prepare to shed them now. /You all do know this mantle. I remember /The first time ever Caesar put it on” (3.2.166-169), forcing attention onto the covered body allowing the audience to imagine what lies beneath. His speech offers a clear illustration of the way in which Antony frames the spectacle, by forcing his audience to imagine the death of Caesar before the body is revealed. He says:
Look, in this place ran Cassius' dagger through.
See what a rent the envious Casca made.
Through this the well-belovéd Brutus stabbed,
And, as he plucked the curséd steel away,
Mark how the blood of Caesar followed it,
As rushing out of doors to be resolved
If Brutus so unkindly knocked or no.
For Brutus as you know, was Caesar's angel.
Judge O you gods, how dearly Caesar loved him!
This was the most unkindest cut of all,
For when the noble Caesar saw him stab,
Ingratitude, more strong than traitors' arms,
Quite vanquished him. Then burst his mighty heart,
And in his mantle muffling up his face,
Even at the base of Pompey's statue,
Which all the while ran blood, great Caesar fell. (3.2.172-87)
This speech is worth quoting at length, as it offers a clear illustration of the way in which Antony forces his audience to imagine the death of Caesar and to therefore incorporate his version of the death (which he was not present to witness), into the myth of Cesar as holy martyr. This revisionist history, combined with the wound display, will elevate Caesar to glory. The blood that the audience sees on the cloak marks a transitionary point between history and ritual, and Antony uses it to mythologize his version of events, conflating it with the blood of Pompey that, stigmata-like, ran from his statue at the fall of Caesar. Antony promotes his imagery even further, lamenting, “I, and you, and all of us fell down” (3.2.188) with Caesar, denying Brutus his intended meaning of the sacrifice and challenging the citizens to right this wrong by using Caesar’s death to strengthen the social body of Rome. Only, at the end of his oration, when he asks that his audience, the “kind souls” merely weep when they “but behold / [Their] Caesar’s vesture wounded?” (3.2.192-3), does he remind us that the Roman citizens have yet to see the actual body of slain Caesar. His observation further clarifies the power of theatricality on the people. It is at this point, once Antony feels sure that it would be impossible to misread the sight in favor of the conspirators, that he uncovers the corpse and the consecration is complete. Instead of mollifying the need for a scapegoat, Brutus’ misunderstood act of violence has simply inflamed the crowd, and Antony, by exalting Caesar, has turned the ‘good’ violence that would purge the city of a tyrant into ‘bad’ violence, which merely leads to more brutality. The conspirators hoped to control the Roman mob by using their bloodstained arms as a statement of democratic oblation, but by failing to satisfactorily validate their claim to sacrifice, simply created an anger that Antony deftly channels in their direction.
Antony is able to succeed where Brutus fails, because the tribunes repeatedly underestimate the appeal that spectacle holds for the people of Rome, and misunderstand the way in which their city operates. In the first scene, despite their indignant stance, the politicians are reduced to angry chaperones, scurrying in the wake of the citizens of Rome, stripping the idolatrous statues, and driving away the vulgar from the streets, where Caesar’s triumph is eagerly awaited. In Shakespeare’s Rome, neither the Senators nor Caesar represent the needs of the people, who insist on their right to ceremony. Brutus’ decision to deny the crowd of citizens their opportunity to participate in the veneration of Caesar’s flesh destabilizes the ritual he has unwittingly created, which results in chaos.
The brutal death of Cinna, which immediately follows the revelation of the body, serves to reinforce Shakespeare’s cynical view of the crowd as an easily swayed mob. Led by their frenzied emotions, the crowd is unable to distinguish between the right and wrong labels – or even more chillingly, they do not care. They accost Cinna, demanding to know whether he is friend or foe of the late Caesar. Already, we can see that the nuanced projection by Brutus of himself as a friend forced to turn to violence has been eradicated. At this point, the issue of sacrifice has become so clouded that the mob’s act of butchery is offered in the intent of salvaging the social body. When Cinna announces his name, civility vanishes, and the plebeians call for the mob to “tear him to pieces” (3.3.27). Even though their mistaken assumption that he is a conspirator is corrected, and accepted as truth, they continue to demand blood, crying en masse, “Tear him for his bad verses! Tear him for his bad verses! (3.3.29). Hysteria that has taken over the crowd, and the idea of purging the city through the blood of the conspirators, has taken an ugly turn.
Through this indiscriminate violence, we see how Brutus’s attempt to validate the murder of Caesar has obliterated all binaries of “good” and “bad” violence, leaving simply violence, which Antony has redirected towards the conspirators. Cinna’s attempt to distinguish himself from the politicians falls flat when the mob jeers, “It is no matter. His name’s Cinna. Pluck but his name out of his heart and turn him going” (3.3.31-2). The plebeian’s directive to “pluck but his name out of his heart” illustrates the ugly response to such manipulation and the belief that violence can obliterate manipulative and untrustworthy words. This latest murder by the mob is a cruel parody of sacrifice, tearing the poet apart in a futile attempt to undo the damage caused by the conspirator and appease a collective bloodlust.
For all of Brutus’ and Cassius’ rhetorical maneuvering, their deaths ultimately reaffirm the Roman values that are so frighteningly reinforced by the public response to Caesar’s death. During the quarrel between the two men, Cassius offers Brutus the opportunity to “revenge [himself] alone on Cassius” (4.3.93) through murder. Although Brutus rejects Cassius melodramatic offer of his heart “that denied [him] gold” (4.3.105), the gesture is enough to reinforce their broken bond of friendship, showing their continued belief in the purging power of sacrifice. Brutus, in true Roman fashion, firmly believes, “It is more worthy to leap in ourselves / Than tarry till they push us” (5.5.23-4). He predicts that his own death will “have glory by this losing day / More than Octavius and Mark Antony / By this vile conquest shall attain unto” (5.5.36-8). Brutus, in a tacit acknowledgement of his earlier error in judgment, makes a ritual out of his own death, embracing the Roman way of thinking that he had previously rejected. When begging Strato for assistance, he calls upon him as someone whose “life hath had some smatch of honour in it” (5.5.46), to hold a sword for him. Such action is immediately rewarded, by Antony, who offers Brutus an effusive eulogy:
The noblest Roman of them all.
All the conspirators save only he
Did that they did in envy of great Caesar.
He only, in a general honest thought
And common good to all, made one of them.
His life was gentle and the elements
So mixed in him that Nature might stand up
And say to all the world, “This was a man.” (5.5.67-74)
Interestingly, neither Antony nor Octavius acknowledge Brutus’ act as honorable, but Antony does offer a conciliatory description of the nobility of Brutus’ gesture. These descriptions of “noble” and “gentle” allude just as much to Brutus’ social status as his nature, and hint at a more muted celebration of this gesture.
Succumbing to the influence of otherworldly phenomena, Brutus declares that because of the presence of the ghost, “[he] know[s] [his] hour is come” (5.5.18). Throughout his career, Shakespeare demonstrates an ongoing mistrust in the reliability of ghosts, either as genuine spirits or dependable theatrical devices. The unclear purpose of Caesar’s ghost merely confirms the ambivalence that has dominated his play. Shakespeare cannot offer his audience any certainty that the ghost is real, which would validate the world of mystery he has created in Rome. The ghost represents a tradition; it is an embodiment of a belief that Brutus could never overcome – in his own mind, much less in the minds of others. Brutus dies in an attempt to reclaim his Roman honor – a conceit that Shakespeare ultimately renders suspect by the theatricality that is necessary to maintain it. In the same way that the crowd is diverted by the presence of Caesar's bloodstained body, the audience is distracted by Brutus' act of falling upon his sword. Brutus' death offers something of a conventional finale to this intriguing play – it is tragic, yet edifying. The play presents Brutus's suicide as a sacrifice that confirms his nobility of purpose and ends the civil strife in Rome.
In the final lines of the play, both Antony and Octavius posthumously recognize Brutus as "the noblest Roman of them all." Yet, his death is the final in a long line of obfuscating theatrics, offered to avoid the stigma of defeat and an attempt to preserve the dignity of his family name. Brutus’s dying declaration, “Caesar, now be still. / I killed not thee with half so good a will” (5.5.49-50) links his death to Caesar, revealing Brutus’s awareness of the veneration that martyrdom can create. His enthusiasm for death ultimately privileges preservation of his public legacy over the desire to stay and fight for what he had previously viewed as the corrupt social body. For the people of Rome, Brutus’ posthumous nobility is not found through his pious life, but through his violent death. He tells Volumnius “It is more worthy to leap in ourselves / Than tarry till they push us” (5.5.22-3), revealing the extent to which he continues to be invested in a system of honor that has proven to be little more than a political tool for the pursuit of personal glory. Brutus’ sense of nobility ultimately means nothing to him without a crowd to concur, and he would rather kill himself to maintain this meaningless badge for his family name. His willingness to create himself as a martyr is the height of his ambivalence towards spectacles of death. His suicide pays homage to the Roman view of honor, yet his enthusiastic welcoming of death suggests a weariness that questions whether Rome is worth such a sacrifice.
It would be presumptuous to presume that Julius Caesar promotes a specifically Catholic agenda – certainly, the violence evoked in response to Caesar’s sacrifice quashes any idea that this play could be a nostalgic look back at Catholic times – but the play indisputably establishes Caesar’s Rome as steeped in more traditional ways of reading the world, ways that are shared by everyone but the politicians. In Julius Caesar, there remains a potent emphasis on the popular interpretation of what is seen. This dependence on visual spectacle that Shakespeare is exploring within the play could be read to suggest that there exists an unresolved Protestant frustration with Catholic idolatry within the play, before going further to imply the futility of attempting to stand up against the roar of tradition. Certainly, the conspirators suffer greatly for failing to take into account the reaction of the citizens, and the appeal that public spectacle holds over the citizens of Rome is not to be underestimated.
Furthermore, Barish proposes in his discussion of sixteenth century anti-theatricalism, that there is an element of collusion between spectator and performer, which effectively renders an audience member complicit in the creation of false spectacle. His reading of Renaissance resistance to theatrical spectacle builds on the principles outlined in his discussion of Medieval theatre, and applies the popular label of “idolatry” onto theatrical spectacle, but focuses his analysis primarily on attacks of the mimesis enacted by players, and assuming the response from the audience that is outlined in the earlier chapter. See Barish, The Antitheatrical Prejudice.
The discussion of ceremony is one of the more popular approaches to the play, matched only by discussions of the politics that underpin the text and Shakespeare’s representations of Rome. For examples of the political approach, see Paul Cantor, Shakespeare's Rome, Republic and Empire and Wayne A. Rebhorn. “The Crisis of the Aristocracy in Julius Caesar.”
As he flees the Plebeians who will ultimately kill him, Cinna exclaims, "I dreamt to-night that I did feast with Caesar / And things unluckily charge my fantasy. / I have no will to wander forth of doors, / Yet something leads me forth" (3.3.1 - 4).
Falstaff asks “Can honor set to a leg? No. Or an arm? No. Or take away the grief of a wound? No. Honor hath no skill in surgery then. No. What is honor? A word. What is in that word “honor”? What is that “honor”? Air. A trim reckoning! Who hath it? He that died o’Wednesday. Doth he feel it? No. Doth he hear it? No. ‘Tis insensible, then? Yea, to the dead. But will it not live with the living? No. Why? Detraction will not suffer it. Therefore I’ll none of it. Honor is a mere scutcheon. And so ends my catechism” (Henry IV, Part One, 5.1.130–7).
1. Barish, Jonas. The Antitheatrical Prejudice. Berkeley: University of California Press, 1981.
2. Cantor, Paul. Shakespeare's Rome, Republic and Empire. Ithaca: Cornell University Press, 1976.
3. Conn Liebler, Naomi. Shakespeare’s Festive Tragedy: The Ritual Foundations of Genre.
London, New York: Routledge, 1995.
4. Danson, Lawrence. Tragic Alphabet: Shakespeare’s Drama of Language. New Haven:
Yale University Press, 1974.
5. F.K. Of the Critical Starre, Which Appeareth, This October and November, 1580. London, 1583.
6. Haller, William. Foxe’s Book of Martyrs and the Elect Nation. New York: Harper and Row, 1963.
7. Knott, John. Discourses of Martyrdom in Early English Literature, 1563 - 1694. Cambridge: Cambridge University Press, 1993.
8. Plass, Paul. The Game of Death in Ancient Rome. Wisconsin: The University of
Wisconsin Press, 1995.
9. Rebhorn, Wayne A. “The Crisis of the Aristocracy in Julius Casear.” Renaissance Quarterly, Vol. 43, No.1 (Spring, 1990): 75-111.
10. Rose, Mark. “Conjuring Caesar: Ceremony, History and Authority in 1599.” English Literary Renaissance 19.3 (Autumn 1989): 291-304.
11. Shakespeare, William. The Arden Shakespeare Complete Works, third series. Richard Proudfoot, Ann Thompson and David Scott Kastan, eds. London: Arden, 2001.
12. Thomas, Keith. Religion and the Decline of Magic: Studies in Popular Beliefs in Sixteenth and Seventeenth Century England. London: Weidenfeld and Nicolson, 1971. | <urn:uuid:01e60d81-c4d0-42b9-aee6-7bcac19a01ca> | CC-MAIN-2014-42 | http://www.thisroughmagic.org/geddes%20article.html | s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1413507446231.28/warc/CC-MAIN-20141017005726-00052-ip-10-16-133-185.ec2.internal.warc.gz | en | 0.956529 | 10,831 | 2.984375 | 3 |
With one firefighter injury per every 8 minutes (Phelps et al., 2018), it is hard for us to not evaluate the nature of the injury and how we can prevent such things from happening. Falls, slips, and trips, along with overexertion and strain claim a majority of fireground injuries (Phelps et al., 2018), influencing the demand for proper physical fitness programs for firefighters.
Before we can discuss the type of training that firefighters need to program into their daily, weekly, and monthly regiment, we must agree that firefighters are indeed athletes.
With this being said, we know that there are a variety of performance tasks for various types of athletes. Sprinters in track focus on power and speed acceleration. Powerlifters focus on strength. Olympic athletes focus on power. Football players focus on agility, power, speed, and muscular endurance. On top of sport type, we have to evaluate sport specific roles and position to determine exact energy needs. There is a difference between energy and fitness demands between a linebacker , lineman, quarterback, and wide receiver. Each of these different energy and task demands require a difference in training protocol. Just like these examples, a tactical athlete, such as a firefighter, requires customized and detailed programming for physical fitness.
Firefighters need to focus primarily on cardiovascular endurance and muscular endurance because most calls will include some form of repetitive work or requires the firefighter to sustain a high level of work capacity for a long duration of time. With the prevalence of sudden cardiac death, we can all agree on the primary focus involving cardiovascular health. Endurance could present itself in the form of multiple contractions or full repetitions such as picking up light objects over and over, or endurance can be presented in the form of stabilizing oneself or specific joint of the body for a long duration of time. Secondarily, the tactical athlete needs to focus on strength for sudden demands of moving or carrying a heavy load. This could involve picking up fallen debris, picking up or carrying fallen comrades, lifting self over obstacles, or even pushing disabled vehicles. The possibilities are endless, but they are in fact possibilities. Along with these focuses, we should also include plyometrics, bounding, and agility. Incorporating these would assist with tasks such as jumping from escape routes, landing off of the engine during call entrance, leaping or climbing over fallen debris, etc.
Obesity is a huge concern when it comes to the profession of firefighting and physical fitness. With obesity prevalent in this profession, we can evaluate the decrease in physical fitness and job-task performance. These have been linked to poor cardio-metabolic profiles, injuries in the field, and possibly cardiovascular issues (Brown et al., 2016). Firefighters should strive toward decreasing bodyfat percentages that indicate overweight or obese status.
As tactical athletes, it is your responsibility to train like an athlete. Your performance can and will determine the success of your survival, as well as your comrades.
Written by Hussien Jabai | NSCA CSCS | <urn:uuid:aba98bc1-0001-4f05-b1ed-5d0b4cf3ee19> | CC-MAIN-2020-40 | https://jabaiperformance.live/2020/09/14/firefighters-should-train-like-athletes-because-that-is-what-they-are/ | s3://commoncrawl/crawl-data/CC-MAIN-2020-40/segments/1600401601278.97/warc/CC-MAIN-20200928135709-20200928165709-00659.warc.gz | en | 0.94571 | 609 | 2.9375 | 3 |
Thermodynamic properties of heavy water (D2O) like density, melting temperature, boiling temperature, latent heat of fusion, latent heat of evaporation, critical temperature and more.
Heavy water ( deuterium oxide , 2 H 2 O , D 2 O ) is a form of water that contains a larger than normal amount of the hydrogen isotope deuterium (= heavy hydrogen = 2 H = D), rather than the common hydrogen-1 isotope ( 1 H = H = protium) that makes up most of the hydrogen in normal water.
Thermodynamic properties of heavy water - D 2 O:
- Boiling temperature (at 101.325 kPa): 101.40 o C = 214.52 °F
- Bulk modulus elasticity (at 25°C): 2.10 x 10 9 Pa or N/m 2
- Critical density: 0.356 g/cm 3 = 0.691 slug/ft 3 = 3.457 lb m /gal(US)
- Critical pressure : 213.88 atm = 220.98 bar = 21.671 MPa (MN/m 2 ) = 3143 psi (=lb f /in 2 )
- Critical temperature : 370.697 o C = 699.255 °F
- Ionization constant , pK w (at 25°C): 14.951
- Latent heat of evaporation (at 101.4°C): 41.521 KJ/mol = 2073.20 kJ/kg = 891.32 Btu(IT)/lb
- Latent heat of fusion: 6.132 kJ/mol = 306.2 kJ/kg = 131.64 Btu(IT)/lb
- Maximum density (at 11.23 o C): 1105.9 kg/m 3 = 2.1460 slug/ft 3 = 10.74048 lb m /gal(US)
- Melting temperature (at 101.325 kPa): 3.81 o C = 38.86 °F
- Molar mass: 20.02751 g/mol
- pD (~pH) (at 25°C): 7.43
- Specific heat (C p ) water (at 20°C): 4.219 kJ/kgK = 1.008 Btu(IT)/(lb m °F) or kcal/(kg K)
- Specific weight (at 11.23 o C): 10.8452 kN/m 3 = 69.0391 lb f /ft 3
- Surface tension (at 25°C): 71.87 dyn/cm
- Triple point pressure: 0.00652 atm = 0.00661 bar = 661 Pa = 0.0959 psi (=lb f /in 2 )
- Triple point temperature: 3.82 °C = 38.88 °F
- Vapor pressure (at 25°C): 20.6 mmHg = 0.027 atm = 0.028 bar = 2750 Pa = 0.398 psi
- Viscosity (at 20°C): 1.251 cP or mPa s
See also more about atmospheric pressure , and STP - Standard Temperature and Pressure & NTP - Normal Temperature and Pressure ,
as well as Thermophysical properties of: Acetone , Acetylene , Air , Ammonia , Argon , Benzene , Butane , Carbon dioxide , Carbon monoxide , Ethane , Ethanol , Ethylene , Helium , Hydrogen , Hydrogen sulfide , Methane , Methanol , Nitrogen , Oxygen , Pentane , Propane , Toluene and Water . | <urn:uuid:0018304b-a6ce-48e1-9a94-c542abd185d5> | CC-MAIN-2023-50 | https://www.engineeringtoolbox.com/heavy-water-thermodynamic-properties-d_2003.html | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100081.47/warc/CC-MAIN-20231129105306-20231129135306-00241.warc.gz | en | 0.69844 | 760 | 2.875 | 3 |
Introduction to John
But these are written that you may believe that Jesus is the Christ, the Son of God, and that by believing you may have life in his name. John 20:31
This article also serves as the introduction and Background Material to our Bible Study series in the Gospel of John.
John is the last Gospel penned as it came several years after the other "synoptic" Gospels of Matthew, Mark, and Luke were written. Like the rest of the Gospels, John covered the events of Jesus' birth and death, His teachings, works, and the plan of redemption. These events occurred early in the first century, from around 27-36 AD, during the reign of Pontius Pilate. John wrote to a Church in turmoil, where the first generation of witnesses and Christians were dying out and the new generation was taking over. He was filling in the gaps to give more evidence and detail to prove Jesus was the Son of God--and more. He is the One True Lord God Creator and Messiah, the Eternal God who is LORD, and yet the quintessential example of living for God's glory and humble service. John sought to convince his audience by being rational and giving philosophical evidence for the Divinity of Jesus Christ using facts, Scripture, and logic. He presented instructions and doctrine for a new generation of church leadership who were not eyewitnesses. He showed Jesus' miracles, precepts, and the testimony of those He had touched so others could respond too. In so doing, John answered the common objections that the Jews and Greeks had for a greater understanding of who and what Jesus was.
Background and Setting
The Church had escaped the tribulations in Jerusalem and fled into Asia Minor (modern Turkey) just prior to the revolts and destitution during 68-70 AD. They were now undergoing the beginnings of more severe persecution than what they initially went through in James' and Peter's time when the Roman Emperor Nero was blaming the Christians for the burning of Rome (which he had caused), making them the scapegoats (54-68 AD). At this time, the Emperor Domitian (81-96 AD) had stepped up the persecutions severely, perhaps being the worst ever seen in Church history (2 John 1-8; 3 John 9-10; Rev. 1:9; 2:9-13; 13:7-10).
During the writing of this Gospel, John and any Jews connected with the new Christian sect movement were being severally harassed and/or had already been expelled from the synagogue and their family and cultural structures. This was a time of tough, antagonistic Jewish persecution, giving the Christians a squeeze in the middle of harassment and hostility from the Romans too-the city officials in the Roman providence such as Asia Minor to which the Jews and Christians fled after the destruction of the Temple in 70 AD. They were also betrayed by family and falsely accused by fellow Jews. In addition, the Jews kicked them out of their fellowships, a scandalous consequence for a Jew, leaving them without family or social contacts, or the ability to work and earn a living. This was a time of real tribulation. Some of the Christians were starting to lose their focus and this Gospel provided a fresh beacon of hope and inspiration. Furthermore, some were venturing back to the old ways of the Law to please the Pharisees in order to get back in or gain more benefits in their synagogue and standing in the community. Yet, in Christ they would have had so much more! When we realize the truth, we must then act on it, not flee because of fear, conviction, or what others may think (Deut 13; 18:9-12).
Intention and Theme
The main theme is "evangelistic," that Jesus, the One to believe and trust in for life and salvation, performed unprecedented signs and wonders and rose from the dead to prove His status. He is the "Logos," the Word, the Eternal God Creator and Redeemer who condescended from His magnificent place of preeminence in the universe to become the God-Man so to identify with us, pay our debt of sin, and give us undeserved redemption. Jesus is the Supreme Reason for and Hope of the universe. Thus, John presents the eternal and physical life of Christ to bring hope and reconciliation, just as Christ Himself did. His goal was that people of all religions would realize who Jesus was and live in His name, meaning to come to a saving, transformed, and growing faith that would be marked by trust and obedience without hypocrisy or shallowness (John 1:1-2, 14-18; 20:31).
John brings to attention some of the most important essences of life, faith, and belief and the importance of love and effectual relationships. In addition, He presents His personal discourses to challenge people concerning their barriers of faith. John explores the importance of abiding in our Lord so we can grow and bear fruit to be better, more productive Christians and give glory to God. He also addresses the role, Person, and importance of the Holy Spirit. John provides the major phases of Jesus' ministry, the prologue of eternity in 1:1-18, and then the forerunner, John the Baptist, who parallels Jesus' life cycle of popularity then rejection then persecution and finally martyrdom (1:18-12:50). Jesus voices His most vital instructions in His farewell discourses in chapters 13-17. Following this comes the dramatic Passion of the Christ, His payment for us to have grace, the drama of redemption, chapters 18-20, then a postscript of wonderment and awe: Jesus is risen, hallelujah! in chapter 21.
Jesus takes on the status quo, and debates many times with the Jewish leadership concerning their traditions, how they viewed the Sabbath, and now, about the fact that the Messiah was in their midst, and that He is both the Christ and fully God. Jesus used clever logic, citing their traditions, Scripture, and their need, as well as reference and testimony to these facts. These challenges to the Pharisees are what led to our Lord's Crucifixion (Lev. 19:18; John 5: 10-12, 30-47).
John sought to win over his fellow Jews and the post Temple leadership who were fixated on the Law and on reinventing the past traditions; they were convinced the law supported their position. John proved the converse-that Jesus fulfilled the Law and Prophets. John used Scripture and classic rabbinic logic to state that Jesus was in fact the promise Messiah and moreover, God incarnate. The Pharisees believed there was a detachment between God and Man (which was because of sin) and the only way to know God was through their traditions and interpretations and they also did not believe that the Holy Spirit was active nor did many of them expect a Messiah; only the common people did. Thus, John instructed them using their own cultural traditions and encouraged them by carefully stating his case with reason and logic as well as with Scripture. Ironically, they were wrong; we can know God personally and we do possess the Holy Spirit-and to know Jesus is to know God. Therefore, to reject Jesus is to reject the Father, Yahweh. The rejection of Jesus by many of the Jews was not because He was an unknown or an illogical or unscriptural figure; rather, it was because they loved sin and did not want to be convicted of Truth. They, like many people today, saw no need for a Redeemer and sought to save themselves instead, which is an impossible and hopeless task (John 1:1-18; 7:37-39; 11:17-27; 12:44-50).
John also wanted to set forth a challenge to stir up complacent, worried, and/or wearied-from-persecution Christians who were in doubt to have faith and motivation, to think and not bow to emotionalism or gossip or to superficial leaders who skewed truths for their own traditions and ideas. He urged them to go deeper and move to the depths of faith and maturity, making an intense connection with the principles of God's Word to one's life, thinking, and behavior (John 7:25-52).
The internal evidence points that the writer is clearly identified as John the Apostle, the son of Zebedee, an eyewitness and also the writer of Revelation and the Epistles of First, Second, and Third John. Although the writer never directly refers to himself by name because of his humility, he was well known to his colleagues, making it easier for the early church to accept this work. At the same time, because of the power and prestige of the Gospels, none of them directly claimed an author, for that would have been an insult to our Lord since it was His Word given in His words. In addition, they were written in a period of persecution so there was also a "pseudonym-ous effect" to protect the early church leaders and remaining Apostles. John only writes about Christ for His Glory. Thus, in this Gospel, "John" always refers to John the Baptist (Matt. 3:1-6; Mark 1:2-6; Luke 7:20). John modestly claims credit and is backed by early church documents. He was a Jew, shown by his use of the Old Testament and his knowledge of the Temple and cultural settings and feast days. He was a significant church leader who spoke with great authority, making a pseudo author, a second or third century writer impossible. The Gospel also records, in chapter thirteen, that John is the Disciple whom Jesus loved. This did not mean Jesus did not love the other Disciples. It was a statement of affection, humility, and honor, as Jesus gave this Disciple, John-the human instrument and author of this Gospel-such a coveted position that he would later earn by his service to Jesus' mother and to the Christian community. This is called "Johannine" authorship (Matt. 10:2; Luke 22:8; John 1:1, 14; 13:23-24; 19: 25-27, 35; 20:2; 21:7-24; Acts 1:13; 3:1-4:37; Gal. 2:9; Rev. 1:1, 3-4, 9; 22:6-10, 18-19). Inevitably
Predictably, there is some contention because John does not sign or directly take credit for this work. He does not because he was inspired by the Holy Spirit and was very unassuming. People who helped him and knew the truth surrounded him. The textual evidence is backed by the style of writing; and the information given makes it trustworthy that the writer was Jewish. His obvious education and knowledge in the details of the historicity, topography, customs and settings, and his quoting of private conversations between Jesus and the Disciples could not have been done as a well crafted late forgery. The details and accuracy of the cultural feast days and festivals were lost by this time for a younger person or a non-witness, preventing someone with a literary imagination or hearing it secondhand to explain it with the details provided. There is also an uncanny unity in Greek syntax and structure such as the "I am's" and "signs" that would be imposable to explain through honest "textual criticism" of various scribes contributing to this one work. The language and structure have unique fingerprints, as seen in Revelation, 1 John, and 2 John that also cannot be explained by the "school theory." In addition, because of John's position and prevalence, people knew him, his writing, his storytelling style, and his stories; a forgery could not have been crafted in the middle or late second century (John 1:28; 5:2; 6:5-7, 61-64; 9:7; 11:1, 54; 12:3, 21; 13:1-11, 30-36; 18:4; 19:13; 21:24; Acts 3:1-11; 12:2; Gal. 2:9).
Thus, there is no serious contention on who penned this Gospel: John; son of Zebedee; Disciple of Jesus Christ. There are some extreme "redactor" scholars who say there was a Johannine school that penned this Gospel using fragments and essays from others, but there is no textual or archeological evidence for this claim. Virtually all biblical authors have been challenged since the 18th century, with the start of the critical thinking movement. These theories are based on speculative reasoning, and there is no clear evidence for them. If there were such a school, it would not have been unusual, since most philosophers and key religious leaders had them after their death. The mission was to persevere and copy the works-not invent them. There are also the various theorems of the "pseudonym-ous" works that were popular in the two hundred years before and after Christ. This is where a famous person is credited to a writing to establish power and posting by latching on or citing someone else. Again, there is no evidence for these claims and they would not be expected by a close-knit and skeptical group in fear of persecution (1 John 2:22-23).
There is some minor contention because of the extreme date difference. The Synoptic Gospels were written around 60 AD during the first persecutions and before the destruction of the Temple. John comes along after the Temple's demise around 90 AD. But, John was perhaps the youngest Disciple and lived to be the oldest, so this would not be much of a stretch, making John in his eighties or early nineties. (Obviously the True Writer is God who inspired John! Any book of the Bible is written, or better put, inspired by the Holy Spirit, who moves the human hands to be instruments in the writing of the Bible. So, when I say John wrote it, I am referring to the human authorship that reflects his style, use of language, and culture, but this is still the inerrant Word of God.) John was called the "beloved disciple," meaning he was in the inner circle, one of the closest to Jesus during His earthly ministry and was able to give a firsthand account of the life and teachings of Jesus. Since he was well aware of the other Gospels, he filled in what was not included by the others (John 1:1, 10-11; 22:16-20).
Date and Occasion
Church tradition cites that this Gospel was written in 85-90 AD, prior to John being exiled to the Island of Patmos which was around 90-95 AD. This seems right and this Gospel has the earliest fragments dating to the early second century, a mere half of a generation afterwards. There is far more textual evidence for this Gospel than any other ancient text or work, including the classics of Plato and Socrates. Some scholars cite it as having been written prior to the Temple's destruction, and thus a contemporary to the synoptic Gospels. But, the discovery of the "Rylands" fragment of John 18 that dates to 130 AD gives conservable proof of a late, second century origin. Key words like the "Sea of Tiberias" that was only used after 70 AD and an innuendo to Peter's execution (66AD), shows this later date. In addition, the Sadducees are not mentioned as they were in the other Gospels. Because they died out after 70 AD (they were sad you see), John did not bother with Jesus' retorts to a dead system (John 21:19).
There is also a minor debate as to where John was when he wrote this Gospel. There are three possible locations: Patmos, where he was exiled; Galilee, where he lived before 70 AD; and Ephesus, where he lived after the destruction of the Temple and the setting for his work, Revelation. If the date is after 70 AD, then he was in Ephesus and Smyrna (Rev. 2:9-10; 3:7-9). After the destruction of the Temple in 70 AD, the church scattered (mostly to Asia Minor), and John became one of the main leaders. Within this time-frame, the Pharisees took over the traditions of the Jews and reworked the Law and temple sacrifices into many of the traditions Jews have today. Thus, the Early Church was in conflict with the Pharisees, as we see with John's many retorts to them. Another problem faced by John and his churches is the anti-Messiah movement that took over after 70 AD. Because no messiah came to save them from the Romans, Jerusalem was destroyed and their homes, Temple, and culture eradicated. So they felt a messiah was a theme of betrayal and a loss of hope. Christian's claim that Christ was the Messiah was taken as an insult, even though they did not understand the actual Prophecy and read into it what they wanted. This caused more and more conflicts later addressed in Revelation. Even though The Gospel was written to entice and encourage Jews and Romans to believe, they were the main persecutors to John and the Church.
Canonicity and Acceptance
The "apostolic origin" and "canonical acceptance" of the Gospel of John were without a controversy or doubt and accepted by the early church as Scripture. The early churches accepted it without question because John was well known and it would have been impossible to forge or be misrepresented. The Early Church also identified John as the author, including Eusebius, Justin Martyr, Ireneaus (his work "Against Heresies" 3,1.2, 180 AD), Tatian ("A Harmony of the Gospels," 150AD), Clement of Alexandria (220AD), Hippolytus, and Origen.
John begs the world to come see and hear whom the Christ is and that He is the only way to the Father. He adds to this theme sixty-six references to seeing and fifty-eight to hearing! He references the Old Testament more than a hundred times to shake the Jews while giving philosophical arguments to stimulate logic and reason to the opponents. Thus, he is not limited to an audience or a systemic thinking; rather, he used general arguments and classical rabbinic discourses of argumentation for the Jews as well as narratives that crossed the barriers of Jew and Greek, religious and secular to show that Jesus is God who came to save. That God is the One who has provided for the Israelites their physical and spiritual needs and now He is here with an offer no one should refuse. John is forceful yet still respectful and mindful to all main people groups then, and consents to give the best answers for the hope we all need (John 1:29; 4:13-14; 6:35; 5:18; 5:58; 10:11, 30-33).
John has also a unique style of recording Jesus' discourses. In ancient times, people were more of storytellers and it was the common way in the first century to paraphrase a master or great teacher's teaching. Of course, this does not take away the Holy Spirit's inspiration or value but allows God to commune His precepts with us in different ways and apply them to different situations. It is not clear if John is doing that, but he emphasizes the teachings Jesus gave to both a general audience and his own people's situation and adds an emphasis on the hypocrisy of the Pharisees who were persecuting John and the early Church at the time of the writing of this Gospel. The slight differences can be explained by the simple fact that John writes later and fills in the various conflicts and material the other three Gospels do not state or emphasize (John, chapters 3-12).
This Gospel contains the key catchphrase of what it means to be a Christian. Also, John begins a series of discourses on Jesus' teaching, which usually centers on a question someone asks Him. He turns the resulting misunderstanding around into not only deep instruction, but also deep conviction. Jesus' teaching discourses are similar to those of the great philosophers like Socrates, Plato, and Aristotle, but Jesus emphasized what matters most to the soul and eternity that is also reflected in how we are to God and others. This passage contains the quintessential Bible passage and summary of the Gospel Message that just about everyone knows and what people assume tells us what it means to be a Christian. This is all about who God is: One of Love; and what He does: He loves. This is His indispensable and primary attribute, but it is not only what God is about. Rather, it is a summary of all of His character. Love is but one of His many characteristics and qualities. This is how His character and Person comes to us, how He loves by not waiting for us to come to Him, because we can't; rather, He comes to us. God demonstrated His ultimate Love by sending His Son as a sacrifice. His sacrifice included becoming a man-a suffering and dead man-for our benefit. Jesus came into a world that had already condemned itself and rejected God. We all are condemned for judgment because of sin and the refusal to accept God's way; we rejected Him, His self-realization, and law. Yet, Christ came to we who are undeserving, offering us His free grace if only we believe and trust in Him (John 3:16).
John gives more theological background of the Eternal God, Jesus, and answers the questions of the skeptics and persecutors of early Christianity. John is also more multi-ethnic, thus showing a warmer feel to the growing Gentile Christian community as Christianity spread from being a Jewish sect, to a "religion," and then to the entire world including what is most important, that Jesus nailed our debt of sin to the Cross! He paid a debt that we could never afford to do by any means conceivable-not by works, or ideas, or experiences, or education, or service, or being good. If these things could add even an insignificant amount to our debt of grace, then Christ's work on the cross would have been unnecessary and meaningless because we could have done it on our own! Our saving faith is by Christ alone-nothing to add and nothing to declare except to receive His most precious free gift of grace by our faith alone-period! The question inlayed in this passage is what will we do now? How then shall we live (John 4:46-54)?
The literature style is "Gospel" which is a cross between biography and instruction. It is not an extensive or all-inclusive work; rather, it contains biographical information with scenes beginning prior to the creation of the universe and then concentrates on the life and times of Jesus Christ, Son of God. It uses classical Jewish storytelling and symbolism that flashes forward and back though "polemic" (an apologetic argument to stem or stir up controversy made against others views and doctrine) episodes like a modern movie, telling a story with discourses between various peoples to relate to the questions and objections of the original audience. The first half of the Gospel (John, chps. 1-11) takes place over a three-year time period, and the last half (John, chps. 12-21) take place over a one-week period (John 2:1-11; 4:46-54; 5:1-15; 6:5-13; 6:15-21; 9:1-7; 11-44; 20:30-31).
"Gospel" simply means "the good news," the news that Jesus Christ, God's Son and Savior forgives the sins of all those who trust in Him. The word "Gospel" also refers to the title of the first four books of the New Testament, which depict the life and teachings of Jesus Christ. All of the Gospels convey a similar theme of lifting up Christ as the Son of God Who is Lord of all-who Christ is, what He did, what He said, how people responded, as well as His role in our life, death, the fulfillment of God's promises, the kingdom of God, and eternity. In addition, he shows Jesus as the Christ/Messiah, who is God, and who is the authoritative teacher for our faith and practice-and that apart from Christ, there can be no salvation or hope to come (Acts 4:12; 1 Cor. 15:1-11; Gal. 1:6-9).
John loves to give contrasting particulars like dark and light, love and hate. This is to show the dramatic cause and effect of God and His purpose to His people. It shows our need to be dependent upon Christ by showing us the relationship of sin to righteousness and our drastic need for a Savior and the power of the Holy Spirit, and, conversely, our pride and misunderstanding of Him. This is to make the case for our need because of our sin and naturally hopeless state; thus, we cannot come to God without the Person and Work of Christ (John 1:4-12; 2:20; 3:5-16; 5:24; 6:35, 51-62; 8:23-47; 10:27-29; 15:17-18).
Relationship to the Other Gospels
Matthew was written primarily to Jews, giving evidence of why Jesus was the long awaited Messiah. Mark was primarily written to the Romans and Gentiles giving evidence of why Jesus is the reason for faith and living. Then, Luke was written to Greek philosophical thinkers who wanted a more orderly account so to analyze who Jesus was. Finally, John comes along nearly twenty years later, without a specific audience in mind. He starts off with declaring Jesus as eternal, ever existing, born into the world for the whole world to save the world. He gives thoughts and answers to arguments for both Jews and Gentiles, to thinkers and the common person-all of whom need a Savior.
All four Gospels paint the same God-Man but as different "portraits" of Christ. Each is lifting up and painting the same Person at a different angle and emphasis, like looking at all the facets of a diamond-one facet at a time. They are not meant to be detailed biographies, as they each tell their true story to their audience, but they do not tell us everything, only what we need to know. What they do is select the teachings best suited for their audience and that are most important and necessary for our salvation and spiritual growth, penned by human writers being led by the Spirit (John 20:30-31).
An honest and careful assessment of the four Gospels will reveal that Matthew, Mark, and Luke are obviously alike, while John is quite different. The first three Gospels agree extensively in their language and teaching. They include a similar order in which events and teachings from the life of Christ take place although in Hebrew thinking, chronology is not important, as they used literary flash backs just as modern movies do today. A movie can start in the middle and flash back and forth for literary effect; this form is classic Jewish story telling. It is the Greeks who were logical and systematic in their thinking and storytelling approach, to whom Luke also writes.
All of the Gospels begin with placing Jesus in a historical setting such as the genealogy with Matthew or John the Baptist's ministry in Mark, connecting Jesus to humanity and history. Since John was familiar with the others and the context of His earthy ministry, John places Christ by His nature being God, connecting Jesus with His eternal Being and history of the universe. John's use of "Word" to identify Jesus also grabs philosophic-minded Romans and pious Jews. He is our Creator, Lord, and Savior and is the eternally existing, ever present, ever powerful, sole creator-God. It is about our transcendent, all-knowing, ever-existing, most Holy, most powerful, eternal God who has always existed and will always continue to exist-and He is Jesus Christ! This Gospel was designed to remove all doubt of who and what Jesus Christ is.
The Old Testament is filled with types and shadows of the coming LORD. Here we find convergences of Old Testament prophecy with Jesus' prophecies that later help motivate and rally His Disciples after His Crucifixion and Resurrection.
Is there a contradiction in John 2:13-25? Matthew, Mark, and Luke record that Jesus cleansed the Temple during the week that led up to Jesus' betrayal and Crucifixion. John seems to indicate that Jesus did this right after the Cana wedding. Only John records Jesus' statement and challenge that if they would destroy this temple He would raise it up. Also, Matthew indicates that this event was the basis of the false charges for Jesus' arrest and mock trial, and taunting at the cross from the mob. The significant differences and timeline indicate that Jesus cleared out the Temple at least twice (Matt. 21: 1-17; 26:61; 27:40; Mark 11:15; 14:58; 15:15-19, 29; Acts 16:14).
There is a debate about whether the context of the passage of John 7:53-8:11 fits, as this passage is not found in the earliest Greek manuscripts. There is the possibility that this event did occur in the sequence of events during the feast and in-between times of Jesus' speaking engagements, but it is more probable that this occurred at another time. Of the earliest manuscripts that do have this passage, it is found in different sections of John and it is even in some manuscripts of Luke by verse 21:38. In addition, none of the early Church Fathers commented on this passage; over 90% of the New Testament was commented on. In the "textual criticism" of this passage, the Greek syntax is very different than the rest of John or Luke, although many stories in ancient religious cultures, including Judaism, had rich oral traditions and people memorized passages that were not written down until much later. So, is this a problem? Yes and no. Yes, because we have to play detective and see if this is an actual historical and accurate account of Jesus. After careful investigation, it is; so "no", it is not a problem for our learning and edification of God's Word. Even though this may be a later addition that did not come to be in John until the fourth century, there is no indication that the narrative is wrong. This story follows the character of Jesus, the customs and historicity of the times (as in, this is a factual account that was known, along with many other stories about Jesus then, which have been lost to history.) This one, being of such importance, finds its way back. It can also be a testimony of the Bible's reliability and impact, that if we wonder if anything was left out that we might need for our spiritual growth or understanding of God, the answer is "no." We have what God wants us to have and it is up to us to get busy in the study and application of His most precious Word (John 21:25)!
When linear minds look at Jewish literature like this Gospel, they are perplexed because is not written in chronological order. John's audience is Jewish and they do not think in terms of events in a linear fashion like many western cultures do. There is a potential problem in this Gospel when compared to the other Synoptic Gospel accounts. Is there a contradiction with Mark concerning the "Triumphant Entry" with the colt or in the order of the events? Or, what about Jesus' anointing? When, and by whom was it done? Consider that Matthew's audience was Jewish, so he sticks with the fulfillment of prophecy in his account. For the colt, Mark only mentions the donkey because his audience is Greek, and they would not know of or care about the colt or its significance. The accounts of Matthew and Mark are different from John's in where the accounts of Lazarus and the anointing occur. The difference was chronology; remember, Jews were not chronological thinkers. Greeks were, so there may have been two accounts and two anointings-one by a repenting sinner at the beginning of Jesus' ministry, and one of devotion and gratitude at the end (Matt. 21:1-17; Mark 11:2; 14:1-11; Luke 7:36-50; John 12:1-50).
This is an incredible Gospel that depicts the power and compassion of Christ to those who are faithful. In the midst of God's power, purpose, and love is His call for us to first learn who He is and what He has to say, and then to trust and obey. He has set up instructions for us to live by that are meant to help, guide, mold, shape, and protect us. They also enable us grow, mature, and create community and fruitful living. This is a tough concept for many who want things their way and do not like authority or the progress of faith that is honed by life's irritations and opportunities. But, before we can be illuminated more in faith, we have to escape the darkness of what holds us back-our sins and frustrations, the barriers of our fears, and our misguided beliefs. Real faith can be used to protect and to serve as well as to glorify God and grow in faith.
1. Barrett, C.K. The Gospel According to John. Westminster Press. 1978
2. Bernard, J.H. A Critical and Exegetical Commentary on the Gospel According to St. John. T&T Clark. 1928
3. Brown, Raymond. The Gospel According to John. Doubleday. 1970
4. Calvin, John. Commentary of the Epistle of Hebrews. reprint Eerdmans. 1989
5. Early Church Fathers, The Works of
6. Eusebius, The Works of
7. Expositors Bible Commentary, John vol 9 Zondervan. 1994
8. Halley's Bible Handbook. Regency. 1927
9. Josephus, The Works of
10. Justin, The Works of
11. Keener, Craig S. The IV Bible Background Commentary. Inter Varsity Press. 1993
12. Krejcir, Richard J. Into Thy Word. "Into Thy Word Bible Study Method." Writers Club Press. 2000
13. Michaels, J.R. John, NIBC. vol 4. Hendrickson. 1989
14. New Geneva Study Bible. Thomas Nelson. 1995
15. Schnackenburg, Rudolf. The Gospel According to Saint John. Crossroad. 1982
16. Smith, Jerome H, Ed. The New Treasury of Scripture Knowledge. Thomas Nelson. 1992
17. Sproul, R.C. Essential Truths of the Christian Faith. Tyndale. 1992
18. Sturgeon's Devotional Bible. Baker Books. 1964
19. Wiersbe, Warren. With the Word. Oliver Nelson. 1991
20. Research at the Scholarly Archives at Fuller Theological Seminary in Pasadena, CA; Years of study & teaching notes; Seminary notes; Prayer.
Dr. Richard Joseph Krejcir is the Director of Into Thy Word Ministries, a missions and discipling ministry. He is also the theologian in residence at the Francis Schaeffer Institute of Church Leadership Development.
© 2010 Richard J. Krejcir, Ph.D. Into Thy Word Ministries www.intothyword.org/ | <urn:uuid:b3c3c233-8f94-4936-95da-917a3add41d6> | CC-MAIN-2017-43 | http://70030.netministry.com/apps/articles/default.asp?articleid=67767&columnid=3803 | s3://commoncrawl/crawl-data/CC-MAIN-2017-43/segments/1508187822488.34/warc/CC-MAIN-20171017200905-20171017220905-00679.warc.gz | en | 0.970624 | 7,348 | 3.296875 | 3 |
Making the UN more effective
The Green One UN House in Viet Nam has two key aims – to help the UN in Viet Nam 'Deliver as One' and 'Deliver Green'.
Completion of the new Green One UN House in Viet Nam has been a major milestone in the UN Reform process. UN staff in Viet Nam have been brought together from multiple locations in Ha Noi. The Green One UN House helps facilitate the functional teamwork of the UN in Viet Nam, and contributes to enhancing its efficiency and the effectiveness of development results, as well as reducing transaction costs.
It helps promote UN coherence, inter-agency cooperation and teamwork and enables the UN to work more creatively. It also fosters better internal and external communications. Over time the project will generate annual savings in operational costs and additional savings from the integration of administrative services such as ICT, procurement, security, travel and banking.
In addition to Delivering as One, the Green One UN House is a major step towards answering the UN Secretary-General's call to 'Deliver Green', as well as becoming a role model for sustainable green buildings in Viet Nam.
The Green One UN House is also an important component of the UN's climate change advocacy. This is particularly important in Viet Nam's context of rapid urbanization and high vulnerability to climate change.
Ecologically friendly building materials have been used, including lead-free paint, carpets and other items that are low in harmful Volatile Organic Compounds. Thermal insulation, which emits ozone-depleting substances, will be avoided.
By maximizing the efficiency of heating and cooling systems, making the most of natural daylight and using energy efficient lighting, energy consumption will be reduced by at least 25 percent compared to a similar sized building. Photovoltaic panels on the roof harness solar energy and generate 10 percent of the building's annual electricity requirements. By using water more efficiently, expected water use will be reduced by about 45 percent.
The Green One UN House is also the first building in Vietnam to be awarded a provision Gold Lotus Rating from the Viet Nam Green Building Council. With efficient and environmentally sustainable use of resources and operations we are confident that the the full gold LOTUS certification will be awarded in less than two years time.
In order to help achieve this, UN staff are being encouraged to adopt green behaviours. This includes reducing the amount of printing; recycling paper, plastic and glass; turning off lights before leaving rooms; and cycling or walking to work. An innovative Green Office Guide has been developed for staff to help promote green behaviours.
As an example of the best possible eco-friendly and energy efficient office building in the region, the Green One UN House in Viet Nam will be an important demonstration of the UN's commitment to environmental sustainability and climate change issues. It will serve as an example for other UN agencies and will be a model for sustainable buildings in Viet Nam. It will also contribute to building local knowledge and capacity in Viet Nam on eco-designs and green technology.
A Tripartite Partnership
The Green One UN House project is a joint endeavor between the Government of Viet Nam, donors and the UN Country Team. The Government is contributing a high value site, the existing United Nations Apartment Building at 304 Kim Ma Street in Ha Noi, and supporting through other material sources. Alongside participating UN agency contributions, donors – including Australia, Finland, Ireland, New Zealand, Norway, Saudi Arabia, Spain, Switzerland and the UK – have also provided generous contributions to the renovation of the building.
Watch the latest update videos on the Green One UN House bellow:
9 July Update
22 May Update
26 March 2014 Update
26 February 2014 update
November 2 - November 30
UNDP Administrator Helen Clark visits Green One UN house
November 7 - Overview
October 5 - October 19
August 10 - August 25
July 7 - July 15
June 22 - July 05
June 13 - June 22
May 25 - June 8
May 12 - May 25
The Fly-Through animation video | <urn:uuid:1a7b48e9-f534-4da4-bcd2-9d0fdb207c7d> | CC-MAIN-2017-04 | http://www.un.org.vn/en/the-one-un-initiative-in-viet-nam-mainmenu-265/green-one-un-house.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281492.97/warc/CC-MAIN-20170116095121-00309-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.932546 | 821 | 2.671875 | 3 |
A decadal change in summer rainfall in the Asian inland plateau (AIP) region is identified around 1999. This decadal change is characterized by an abrupt decrease in summer rainfall of about 15.7% of the climatological average amount, leading to prolonged drought in the Asian inland plateau region. Both the surface air temperature and potential evapotranspiration in the AIP show a significant increase, while the soil moisture exhibits a decrease, after the late 1990s. Furthermore, the normalized difference vegetation index shows an apparent decreasing trend during 1999–2007. Three different drought indices—the standardized precipitation index, the standardized precipitation evapotranspiration index, and the self-calibrating Palmer drought severity index—present pronounced climate anomalies during 1999–2007, indicating dramatic drought exacerbation in the region after the late 1990s. This decadal change in the summer rainfall may be attributable to a wave-like teleconnection pattern from Western Europe to Asia. A set of model sensitivity experiments suggests that the summer warming sea surface temperature in the North Atlantic could induce this teleconnection pattern over Eurasia, resulting in recent drought in the AIP region. | <urn:uuid:17145c30-82c8-4b23-a87f-330d1c4d78fe> | CC-MAIN-2019-43 | https://www.mysciencework.com/publication/show/abrupt-rainfall-decrease-over-asian-inland-plateau-region-around-1999-possible-underlying-mechanism-fd32897f?search=1 | s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570987781397.63/warc/CC-MAIN-20191021171509-20191021195009-00311.warc.gz | en | 0.877575 | 230 | 2.5625 | 3 |
The Relationship Between Cardiovascular Disease and Omega-3 Essential Fatty Acids. Over 50 million Americans have cardiovascular problems, and most other Western countries face high and increasing rates of cardiovascular disease. It is the number 1 cause of death and disability in the United States and most European countries. By the time that heart problems are detected, the underlying cause (atherosclerosis) is usually quite advanced, having progressed for decades. There is therefore increased emphasis on preventing atherosclerosis by modifying risk factors, such as healthy eating, exercise and avoidance of smoking.
Attempts to prevent cardiovascular disease take the form of modifying risk factors. For example, eating oily fish at least twice a week may help reduce the risk of sudden death and arrhythmias. Studies of individual heart cells showed that the fatty acids blocked excessive sodium and calcium currents in the heart, which could otherwise cause dangerous, unpredictable changes in its rhythm.
Recent studies have cast doubt over the effectiveness of essential fatty acids, prompting further study and investigation…
The Debate Is Over – Omega-3s Are A Solid Preventative Of Cardiovascular Disease
The recent debate surrounding the effectiveness of omega-3 fatty acids on cardiovascular disease (CVD) can be put to rest. A recent review published in the American Journal of Clinical Nutrition reinforces past evidence which has linked Omega-3s from oily fish and supplements to the reduction of CVD and risk of sudden death. According to an independent editorial by Richard Dickelbaum and Sharon Akabas from Columbia University, the new review takes “a large step forward in helping resolve the controversies related to the beneficial effects of omega-3 fatty acids on CVD outcomes.” One of the problems with reviewing and pooling previous studies comes from the fact that many of the studies are not directly comparable, with long- and short-term trials being grouped together.
Omega-3 fatty acids have been linked to a wide range of health benefits, including CVD prevention, good baby development during pregnancy, joint health, behavior and mood, in addition to certain ulcers. Omega-3 fatty acids are polyunsaturated fatty acids classified as essential because they cannot be synthesized in the body; they must be obtained from food. Important omega-3 fatty acids in human nutrition are: a-linolenic acid (ALA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA).
The following additions will supply your body with an abundant supply of essential fatty acids:
- Fish and shellfish
- Flaxseed (linseed)
- Soya oil
- Canola oil
- Hemp oil
- Chia seeds
- Pumpkin and sunflower seeds
- Leafy vegetables and walnuts
Those who follow a Mediterranean-style diet tend to have higher HDL (“good”) cholesterol levels. Similar to those who follow a Mediterranean diet, Inuit Eskimos, who consume high amounts of omega-3 fatty acids from fatty fish, also tend to have increased HDL cholesterol and decreased triglycerides (fatty material that circulates in the blood). In addition, fish oil supplements containing EPA and DHA have been shown to reduce LDL (“bad”) cholesterol and triglycerides. Finally, walnuts (rich in ALA) have been shown to lower total cholesterol and triglycerides in people with high cholesterol. | <urn:uuid:f6b70309-3a9f-4485-ad1d-57304ad4ecd4> | CC-MAIN-2018-17 | http://healthdarts.com/omega-3-is-a-preventative-of-cardiovascular-disease/ | s3://commoncrawl/crawl-data/CC-MAIN-2018-17/segments/1524125946011.29/warc/CC-MAIN-20180423125457-20180423145457-00093.warc.gz | en | 0.921663 | 688 | 2.953125 | 3 |
9.7 Forests and Sustainable Development
Sustainable forest management of both natural and planted forests is essential to achieving sustainable development. It is a means to reduce poverty, reduce deforestation, halt the loss of forest biodiversity, and reduce land and resource degradation, and contribute to climate change mitigation. Forests play an important role in stabilization of greenhouse gas concentrations in the atmosphere while promoting sustainable development (Article 2; Kyoto Protocol). Thus, forests have to be seen in the framework of the multiple dimensions of sustainable development, if the positive co-benefits from forestry mitigation activities have to be maximized. Important environmental, social, and economic ancillary benefits can be gained by considering forestry mitigation options as an element of the broader land management plans.
9.7.1 Conceptual aspects
Forestry policies and measures undertaken to reduce GHG emissions may have significant positive or negative impacts on environmental and sustainable development objectives that are a central focus of other multilateral environmental agreements (MEAs), including UN Convention on Biological Diversity (CBD), UN Convention to Combat Desertification (CCD), and Ramsar Convention on Wetlands. In Article 2.1(a, b), Kyoto Protocol, Parties agreed various ways to consider potential impacts of mitigation options and whether and how to establish some common approaches to promoting the sustainable development contributions of forestry measures. In addition, a broad range of issues relating to forest conservation and sustainable forest management have been the focus of recent dialogues under the Intergovernmental Forum on Forests.
Recent studies highlighted that strategic thinking about the transition to a sustainable future is particularly important for land (Swanson et al., 2004). In many countries, a variety of separate sets of social, economic and environmental indicators are used, making it difficult to allow for adequate monitoring and analysis of trade-offs between these interlinked dimensions. Still, sustainable development strategies often remain in the periphery of government decision-making processes; and lack coordination between sub-national and local institutions; and economic instruments are often underutilized.
To manage forest ecosystems in a sustainable way implies knowledge of their main functions, and the effects of human practices. In recent years, scientific literature has shown an increasing attempt to understand integrated and long-term effects of current practices of forest management on sustainable development. But often, environmental or socio-economic effects are considered in isolation, or there is no sufficient understanding of the potential long-term impacts of current practices on sustainable development. Payment for Environmental Services (PES) schemes for forest services (recognizing carbon value) may be foreseen as part of forest management implementation, providing new incentives to change to more sustainable decision patterns. Experience, however, is still fairly limited and is concentrated in a few countries, notably in Latin America, and has had mixed results to date (Wunder, 2004).
Important environmental, social, and economic ancillary benefits can be gained by considering forestry mitigation options as an element of the broad land management plans, pursuing sustainable development paths, involving local people and stakeholders and developing adequate policy frameworks. | <urn:uuid:79872fdd-3670-4856-9338-178c68c5d93e> | CC-MAIN-2014-23 | http://www.ipcc.ch/publications_and_data/ar4/wg3/en/ch9s9-7.html | s3://commoncrawl/crawl-data/CC-MAIN-2014-23/segments/1406510265454.51/warc/CC-MAIN-20140728011745-00386-ip-10-146-231-18.ec2.internal.warc.gz | en | 0.919321 | 610 | 3.796875 | 4 |
With the Cricket World Cup fast approaching it seems a good time to look into the psychological aspects the game. With such a focus recently on mental health, people have been referring back to Jonathon Trott’s unfortunate exit of the Ashes 13/14, with the man himself referring to ‘Burnout’ as a major factor. Cricket is possibly the most individual team sport there is, no more than for a batsmen. It is these individual demands on players that cause such a demand for mental toughness. For a batsmen in any form of the game it takes one mental slip or the tiniest lack of concentration for their day to be over. These fine margins are what make mental toughness so important for any batsmen, elite right the way down to grassroots. “the ability to prepare for optimal performance is crucial.” (Cotterill, 2011, p.82).
The need for mental toughness in cricket is best described by Bull et al. (2005, p.210) when they state that cricket is “a sport that requires ‘chronic’ mental toughness”. This is because cricket as a sport varies in length of game, ranging from 20 over games to games that last 5 days, following this up with the intensity of the game which requires mental toughness to “willingly enter into the high intensity confrontation between batter and bowler, and actually revel in the situation” (Bull et al. 2005, p.211) combines for a sport to push a players mental toughness to its limits. From the results of Bull et al. (2005) study they developed general five dimensions of mental toughness; Personal responsibility, Dedication and commitment, Belief, Developmental factors and Coping with pressure (2005, p.217). These were sub-divided into themes which would in turn relate to the mental toughness pyramid Bull et al. (1996, quoted in Bull et al. 2005, p.216) which had four categories; tough thinking, tough attitudes, tough character and environmental influences. From this study we take that a person’s mental toughness, despite personal efforts, is somewhat rooted in their environment. Suggesting that being in and around those with already mentally tough mind sets can breed a mentally tough environment. This can be seen within sporting families who achieve success; for example Chris and Stuart Broad, a father and son who have both achieved national representation.
Gucciardi and Jones (2012) back up the Bull’s five dimensions stating that although the wording may change in differing literature they all have similar ideals of; ‘self-belief, attentional control, resilience, success mind-set, optimistic thinking, emotional awareness and regulation/affective intelligence, ability to handle challenge, contextual intelligence.’ It is these key aspects, although wording may differ, that make up mental toughness and subsequently allow of optimal performance.
There seems to be a general consensus which is highlighted in Gucciardi and Jones’ (2012) paper when they cite two separate studies containing six individuals, Gucciardi, Gordon and Dimmock (2009a) and; Jones, Hannton and Connaughton (2007). Gucciardi and Jones (2012) also go on to state that individual profiles of mental toughness are a key area for future research. The constant need for individual profiles is to be expected; if you look at other areas of sport psychology, specifically optimal arousal, each individual is different and each sport has different requirements. For example Boxing and Darts are sports where optimal arousal levels will differ, but again within that sport you can have extroverted and introverted athletes who will again vary in optimum arousal levels. Monitoring individual profiles of mental health is also key to maintaining or increasing mental toughness. High levels of mental toughness can be linked to low levels of negative emotional states, therefore mental toughness can be undone by poor mental health (Gucciardi and Jones, 2012).
As you can see mental toughness is a key aspect for sport let alone cricket, it is something that should be worked on just like bowling or batting, and deserves greater focus and attention over the coming years, to help prevent Trott like situations from happening again. Whilst sport is a high pressure environment, at its heart it is played for enjoyment and that should never be forgotten. | <urn:uuid:2a219cb5-cc2d-468c-bff9-c1bd85db7281> | CC-MAIN-2023-06 | https://believeperform.com/mental-toughness-cricket/ | s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764500813.58/warc/CC-MAIN-20230208123621-20230208153621-00782.warc.gz | en | 0.940967 | 883 | 2.515625 | 3 |
Clean diesel fuel is poised to take on an even greater role in the U.S. transportation market. That statement is part of the newly-released Hart Energy Consulting report. "Diesel: Fueling the Future of a Green Economy" was released by the Diesel Technology Forum in conjunction with the U.S. Department of Energy's 2010-2011 Winter Fuels Outlook Conference at the National Press Club.
Allen Schaeffer, executive director of the Diesel Technology Forum, says while there has been a lot of speculation about the role of unproven energy technologies in the emerging green economy, this new analysis clearly highlights that clean diesel will play a vital role in the green economy both today and in the future generations of energy and transportation.
While there is much speculation on the transformation to energy sources like electric and natural gas vehicles, the Hart report states that diesel offers energy and environmental improvement without the need for development of an infrastructure to support the advanced technology. Diesel's unique capability to utilize a range of renewable fuels and blends enhances its desirability under emerging renewable fuel requirements. | <urn:uuid:d3c7026f-dc38-449a-a7f4-fdc5e2f2de50> | CC-MAIN-2017-47 | http://www.wallacesfarmer.com/story-report-friendly-to-diesel-energy-8-42994 | s3://commoncrawl/crawl-data/CC-MAIN-2017-47/segments/1510934805687.20/warc/CC-MAIN-20171119153219-20171119173219-00117.warc.gz | en | 0.929085 | 215 | 2.796875 | 3 |
The National Environmental Policy Act (NEPA), enacted in 1970, requires federal agencies to analyze the environmental effects of all proposed major Federal actions significantly affecting the quality of the human environment. Because the law is so broadly written and has wide application, it is impossible to understand how to comply with NEPA merely by reading the statute. In addition to the statute, NEPA'S implementing regulations written by the Council on Environmental Quality must be consulted as well as the relevant judicial decisions and regulations of individual federal agencies. This book draws together these various sources of NEPA law and presents the law in a clear and readable format designed to be both a practical reference and guide to compliance with the NEPA process and a comprehensive legal analysis of every aspect of NEPA law. Among the topics addressed by the author are the criteria that make a project subject to NEPA and the procedures mandated by NEPA and its regulations. Issues that frequently arise in NEPA legislation such as standing, ripeness, mootness, and exhaustion of administrative remedies receive extended treatment as do the scope of remedies available under NEPA. The author then provides a complete review and analysis of three state statutes with similar purposes to NEPA and compares them with NEPA. She also includes detailed instructions on the preparation of environmental assessments, environmental impact statements, and supplemental environmental impact statements. The volume concludes by examining major themes in NEPA law. An indispensable handbook for attorneys who deal with environmental transactions and litigation, and for people who prepare NEPAdocumentation, this book will also be an invaluable reference for members of citizens' groups interested in participating meaningfully in the NEPA process.
There are currently no reviews for this product. Be the first to review this product! | <urn:uuid:cd997a82-4ec2-437a-b9d0-59cf679452c2> | CC-MAIN-2017-22 | http://www.nhbs.com/title/60957?title=guide-to-the-national-environmental-policy-act | s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463608954.74/warc/CC-MAIN-20170527133144-20170527153144-00199.warc.gz | en | 0.950452 | 345 | 2.53125 | 3 |
Disposable filtering face piece respirators (FFR), more commonly called dust masks, are the respiratory protection most used by employees in the workplace. Disposable FFRs are not intended for repeated or extensive use; yet, for reasons of expense, convenience, and supply, they often are. At what point does a disposal FFR begin to fail to protect the worker wearing it? The National Institute for Occupational Safety and Health (NIOSH) has studied the issue and offers several guidelines.
When Reuse Is Safe
NIOSH states that it is not always necessary to dispose of the FFR the first time it is removed. In most workplace situations, an FFR can be reused as part of an employer’s respiratory protection program. Safe FFR reuse is affected by a number of variables that impact respirator function and contamination over time, says NIOSH. Unless the respirator manufacturer identifies a specified duration of use—for example, single use only, or the employer’s respiratory protection program excludes reuse—users can wear an FFR until it is damaged, soiled, or causing noticeably increased breathing resistance.
However, there are limitations for reuse. Perhaps most importantly, the FFR should be used and reused only by the same wearer. Also, between uses, the FFR should be stored in a way that protects it from damage, dust, contamination, sunlight, extreme temperatures, excessive moisture, and damaging chemicals. In addition, since most disposable FFRs do not have solid frames, they should be stored in ways that prevent deformation of the face piece, straps, and exhalation valve, if present.
Generally, reuse must stop at the point when the FFR begins to lose its protective qualities.
But deciding when to stop using an FFR may not be simple. NIOSH notes that there is “no way of determining the maximum possible number of safe respirator reuses as a generic number to be applied in all cases.” Assuming that the FFR retains its physical integrity, the decision on when to continue or discontinue using an FFR should be based on a number of factors. According to NIOSH:
- Continuous FFR use—that is, use without removal—of several hours or more is common in many industries. In general, an employee can safely wear the same FFR until it is damaged, soiled, or causing noticeably increased breathing resistance.
- The maximum length of continuous use in nondusty workplaces is typically dictated by hygienic concerns (e.g., the respirator was discarded because it became contaminated) or practical considerations that call for automatic removal (e.g., need to use the restroom, meal breaks), rather than a predetermined number of hours.
- In dusty workplaces that could result in high filter loading (e.g., 200 milligrams (mg) of material captured by the filter), service time for N-series filters (such as the commonly used N95) should be limited to 8 hours of use (continuous or intermittent).
- FFRs should not be reused in biosafety and animal biosafety levels 2 and 3 laboratories. Pathogens can remain on the respirator surface for extended periods of time and can potentially be transferred by touch to the wearer’s hands and, thus, risk causing infection through subsequent touching of the mucous membranes of the face (i.e., self-inoculation).
“The key consideration for safe extended use is that the respirator must maintain its fit and function,” states NIOSH.
A NIOSH FAQ on FFRs is at https://www.cdc.gov/niosh/docs/2018-128/pdfs/2018-128.pdf. | <urn:uuid:dad7a64f-374d-4de5-9c90-7d9a85b30688> | CC-MAIN-2023-14 | https://ehsdailyadvisor.blr.com/2018/04/dust-masks-reuse-toss/ | s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296943483.86/warc/CC-MAIN-20230320114206-20230320144206-00406.warc.gz | en | 0.919425 | 775 | 3.09375 | 3 |
Friday, 5 July 2013
Krypton is name of the fictional home planet of Superman currently in the local cinemas as the Man of Steel.
Krypton is a chemical element with symbol Kr and atomic number 36. It is a member of group 18 (noble gases) elements. A colourless, odourless, tasteless noble gas, krypton occurs in trace amounts in the atmosphere, is isolated by fractionally distilling liquified air, and is often used with other rare gases in fluorescent lamps. Krypton is inert for most practical purposes.
Krypton gas discharge tube
Krypton was discovered in Britain in 1898 by Sir William Ramsay, a Scottish chemist, and Morris Travers, an English chemist, in residue left from evaporating nearly all components of liquid air. Neon was discovered by a similar procedure by the same workers just a few weeks later. William Ramsay was awarded the 1904 Nobel Prize in Chemistry for discovery of a series of noble gases, including krypton.
Krypton is characterized by several sharp emission lines (spectral signatures) the strongest being green and yellow. It is one of the products of uranium fission. Solidified krypton is white and crystalline with a face-centered cubic crystal structure, which is a common property of all noble gases (except helium, with a hexagonal close-packed crystal structure).
Kryptonite on the other hand is a fictional form of a radioactive element from Superman's home planet of Krypton. It is famous for being the ultimate natural weakness of Superman and most other Kryptonians, and the word Kryptonite has since become synonymous with an Achilles' heel—the one weakness of an otherwise invulnerable hero. In the Superman films Kryptonite is green although the original stores there were many colour variations.
Superman's worst nightmare! | <urn:uuid:3d55e8a4-a64f-43c7-b975-9012b3f6e615> | CC-MAIN-2016-50 | http://prlabpak.blogspot.com/2013/07/krypton.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698544672.33/warc/CC-MAIN-20161202170904-00199-ip-10-31-129-80.ec2.internal.warc.gz | en | 0.947261 | 374 | 3.640625 | 4 |
You might have heard about the massive wildfires that are burning in the Amazon rainforest at the present moment. The Amazon generates more than 20% of the world’s oxygen and 10% of the world’s known biodiversity. It is often referred to as the “lungs of the planet”, so when it is threatened, it becomes an international issue. Leaders around the world have expressed their concern about the fires, and on Friday, Foreign Minister Heiko Maas declared that Germany is ready to help.
“When the rainforest burns for weeks on end, then we cannot remain indifferent,” Minister Maas said. “We cannot allow fires to destroy the green lungs of the world. Protecting the unique natural heritage of the Amazon rainforest is an international task that concerns us all. Germany stands ready to offer help and support for tackling the fires.”
While Germany is known for its mountainous landscapes, quaint villages and picturesque castles, not many people travel to the region to see the country’s wildlife. While Germany may not have as much wildlife as, say, Ecuador, the country is still home to a number of species worth seeing (if you’re lucky, that is)!
If you’re hiking at a high elevation in the Alps, you might stumble across an Alpine ibex (commonly referred to as a Steinbock in German). This is a species of wild goat that is an excellent climber and lives in rough terrain near the snow line. So in order to spot one, you have to be pretty high up!
One of Germany’s most famous inhabitants is the red fox – and if you spend a lot of time in nature, you have a good chance of seeing one! Red foxes are common throughout Europe, and you’ll be able to spot one easily due to its red-orange fur. According to one study, there are about 600,000 red foxes living in Germany. So bring your telephoto lenses and start looking!
One of the most immediate culture shocks of traveling to Germany, especially if you grew up in the United States, is Germany’s seeming obsession with recycling. Whereas in the U.S. you are lucky if you can locate a recycling bin in public areas like parks or street corners, you’ll have the opposite problem in Germany, where you’ll find a sometimes confusing plethora of multi-colored bins. If you have been in this situation, looking around desperately to strangers or waiting to see what items other drop in each bin, we feel you. You are not alone. Even Germans sometimes question which bin is appropriate for which items.
Due to this common culture shock and the often harsh punishment one receives for a wrong move, we thought we’d give you the lowdown on German recycling.
Step 1: Prevent creating waste in the first place
Germany has created and continues to develop a culture of minimal waste. This is true for projects big and small: here are a few examples of major reducers of waste.
Many Germans are conscientious about recycling – and the German Pfandsystem makes it easy to do so.
Since 2003, Germany has had a system (the Pfandsystem or “deposit system”) that regulates the sale and return of plastic and glass bottles and aluminum cans. When someone buys a bottled beverage, they pay a deposit on that bottle (for example, 15 extra cents). If, however, they bring that empty bottle to a return station (often located in supermarkets), they get that money back. Imagine how much money you could get back if you return 50 empty bottles! This is why you sometimes see individuals voluntarily collecting used bottles in Germany.
The bottles that are eligible for Pfand (the “deposit” cash) are usually multi-use, refillable bottles. Plastic bottles in Germany can be reused up to 25 times and glass bottles can be reused up to 50 times. It is much more environmentally friendly to sterilize recycled bottles than to produce new, single-use bottles. The Pfand is an incentive to have those bottles returned, rather than thrown in the garbage.
Most bottles in Germany are eligible for Pfand, but there are always exceptions. Single-use bottles occasionally find themselves onto grocery store shelves and these are usually not eligible. Imported bottles from other countries may also not be subject to German laws and thus not be eligible for a deposit.
But overall, the German Pfandsystem is quite effective; last year, British company Eunomia named Germany as the world’s best recycler. In Germany, 97.9 percent of polyethylene terephthalate (PET) were sold with a deposit on them and 93.5 were recycled in 2015, according to a report by the German Society for Packaging Market Research. Most PET bottles end up as new PET bottles, but some are recycled into other products (plastic sheets, textile fibers, etc.)
Many Americans who visit Germany (or other Europeans with similar systems) rave about the Pfandsystem. Because after all – it’s efficient and it works.
The German Embassy endorsed e-mobility with its very own stand at the Washington Auto Show this winter. The German government supports the use of electric cars, offering incentives for consumers and investing in infrastructure and R&D.
This year, we are proud to announce that the German Embassy will be converting its entire fleet of cars to electric or hybrid cars and install charging stations on Embassy grounds. This switch will create an environmentally friendly transportation option for diplomats and staff that avoids emissions and protects public health.
German companies have long stated their plans to switch over to electric vehicle production. Car manufacturers like Volkswagen, BMW, Smart and Daimler are working to produce many new models of e-cars. Some of these were on display at the Washington Auto Show. By the year 2025, VW and Daimler expect that 25 percent of their sales will consist of e-cars alone, the Süddeutsche Zeitung reported last year.
This fast progression of the transition to e-cars is aided by the tax incentives put forth by the German government. In 2015, the German government dedicated 600 million Euros for e-car subsidies. In Germany, those who buy an electric car receive a 4,000 Euro subsidy, while those who buy a hybrid car receive 3,000 Euros. The car owners are also exempt from car ownership taxes for 10 years.
To make e-car ownership easier, the German government also plans to install at least 7,000 fast-charging points throughout the country, mostly along the Autobahn, by 2020.
With more than 129,246 plug-in electric cars registered in Germany between 2010 and 2017, the future looks electric!
We hope you all had a wonderful transition to 2018!
Looking back at 2017, it is clear that Germany again made strides in its production of renewable energy – and this is bound only to rise even more. A whopping 33.1 percent of Germany’s electricity generation came from renewable energy sources last year according to preliminary data. In fact, Germany experienced many days in which its supply was greater than its demand, causing some German companies to get paid, in a sense, to use it.
In Germany, there are some days where the supply of renewable energy produced is actually greater than needed, usually due to the weather. Examples includes particularly warm or sunny days, some weekends (when businesses and large factories are closed) and days with strong breezes. On such days, large energy consumers (such as factory owners) are occasionally paid to take the power, when the excess power cannot be stored. (This “payment” usually comes in the form of a reduction on a future electricity bill.)
During days when Germany had excess power in 2017, it also often exported this power to neighboring countries.
Throughout last year, Germany broke several renewable energy records. On April 30, for example, 85 percent of its electricity came from renewables, thanks to windy, sunny and warm weather. In the first half of 2017, Germany had generated 37.6 percent of its electricity from renewable energy.
Of course, the fact that Germany produced so much renewable energy is good news. It also highlights the challenges that we face as we make the transition to renewable energy. The extension and adaptation of the power grid to the needs of larger shares of intermittent renewable energy such as sun and wind as well as more storage options are solutions for the future power system.
Germany’s Transport Minister Alexander Dobrint once called self-driving cars the “greatest mobility revolution since the invention of the car.” In 2015, the minister even took a test drive in an autonomous Audi A7 on the Autobahn A9.
The German vehicle industry is rapidly changing; just a few weeks ago, German railway company Deutsche Bahn sent its first fully autonomous bus on the road to drive around passengers in Bad Birnbach, Bavaria. (Have no fear: the bus only drove at a speed of 9.3 mph and a human was able to take control of it at any time.)
Now, German car manufacturer Daimler delivered its first fully electric lorries to companies across Europe. These so-called “green trucks” can carry loads as heavy as 4.5 tons. Six batteries allow the zero-emission buses to travel 100 km at a time.
Other car manufacturers have also stated their plans for fully electric trucks. And in general, most car manufacturers have big plans for the future, whether it’s related to intelligent vehicles or zero-emission vehicles. Only a few, however, have sent self-driving cars or fully electric trucks to the streets.
But one thing is clear: Germany is quickly adopting the new technologies emerging in the marketplace. Electric car sales were up 137% from July 2016 to July 2017, while Diesel car sales were down by 14%.
Will your next car be an electric vehicle? Or will you wait until the self-driving cars hit the roads? | <urn:uuid:e6c067f2-8c6e-4dc4-9266-376f821c2d0a> | CC-MAIN-2020-16 | http://germanyinusa.com/category/topics/environment/ | s3://commoncrawl/crawl-data/CC-MAIN-2020-16/segments/1585371818008.97/warc/CC-MAIN-20200408135412-20200408165912-00198.warc.gz | en | 0.965309 | 2,066 | 3.203125 | 3 |
Information technology will be one of the fastest-growing fields this decade as commerce has gone digital in industries across the board. While the world may not see the turn-of-the century staffing crunch that was feared during the transition to Y2K and euro conversion, the proliferation of data could outstrip the number of people being trained to manage it.
Teri Morisi, economist and branch chief at the Bureau of Labor Statistics, identifies computer occupations the BLS is tracking for growth. Included are computer and information research scientists; computer systems analysts; computer programmers; software applications developers; systems software developers; database administrators; network and computer systems administrators; computer support specialists; and information security analysts, Web developers, and computer network architects.
"All computer occupations are expected to grow faster than the average for all occupations at a rate of 14.3 percent for the 2010 to 2020 period," Morisi says. An exception is computer programming. Although it has long been a target for outsourcing, it is still expected to grow at a rate of 12 percent.
The occupation with the most job openings, software applications developers, is expected to gain 143.8 million jobs by 2020, a 27.6 percent increase, followed by systems software developers, with approximately 127,000 jobs at around a 32 percent increase. Database administrator jobs are expected to spike 30.6 percent and gain about 34,000 new positions. Computer hardware engineers, which are not classified with computer occupations, will climb 9 percent, from approximately 70,000 to 76,300 jobs. Computer and information systems managers, also not in the computer field, will grow from about 308,000 positions to approximately 364,000, an 18 percent increase.
A Ph.D. in computer science or a related field is required for most computer and information research scientist jobs. In the federal government, a bachelor's degree may be sufficient for some jobs. According to the BLS, an associate's degree could suffice for network and computer systems administrators, as well as for computer support specialists.
The term "Big Data" is generally used to describe the exponential growth of structured and unstructured data. Volume shows no sign of abating. The velocity with which it moves is approaching light speed on stock exchanges in the securities industry. There's also a much greater variety than in the past, including text, video, and audio. By some estimates, 80 percent of an organization's data is not numeric.
This data-driven sea change in the workplace has been going on at least since 1964, when IBM invented the mainframe computer, a milestone event in the conversion from manual processing of data to automation. In the mid-1960s, the New York Stock Exchange closed every Wednesday just to match buy and sell orders so trades could be settled. Trade volume spiked from 5 million shares in 1965 to 15 million in 1968. Today, in an era of high-frequency trading and 100 gig data centers, the NYSE-Euronext, as it is now known, averages in excess of 1 billion shares per day, reaching nearly 2.5 billion on June 22. Mega-volume of this kind could not have been supported by traders waving paper tickets at each other on the trading floor.
As data proliferates, one solution could be to put the ability to manage it—and the tools to manage it with—in the hands of more people who aren't IT pros.
"The fundamental assumption of Big Data is the amount of that data is only going to grow," said John Ginder, the lead of the big data analytics and the environmental science teams at the Ford Motor Company, during a July interview with ZDNet. If there is a shortage of database scientists, Ginder favors giving non-technical people tools to solve big-data problems themselves.
"That's the endpoint I'd love to see us move toward," he said, "but there aren't enough tools out there to enable us to do that yet." | <urn:uuid:9a837661-3a8a-4008-bd5c-8f5ab3e343f7> | CC-MAIN-2013-48 | http://money.usnews.com/money/careers/articles/2012/09/10/by-decades-end-big-data-will-be-bigger-than-ever?s_cid=related-links:TOP | s3://commoncrawl/crawl-data/CC-MAIN-2013-48/segments/1386163066444/warc/CC-MAIN-20131204131746-00009-ip-10-33-133-15.ec2.internal.warc.gz | en | 0.953041 | 803 | 2.625 | 3 |
Weird Witch Bottles, Historic Efforts to Ward Off Evil Spells and Witchcraft
Witch bottles (known also as ‘spell bottles’) are apotropaic devices (things believed to have the power to avert evil influences). These objects are believed to protect their owners from the negative effects of witchcraft. The belief in evil and malevolent forces went hand in hand with the efforts to counter these threats. In Early Modern Europe and North America, the centuries old belief in the powers of witchcraft was very real.
Over time, people devised various ways of protecting themselves against witches, most notably through witch hunts. Witch bottles were also a way of protecting oneself against witches, and they become popular during the 16th and 17th centuries. Interestingly, the available evidence suggests that usage of this device was popular in England and North America, but not in other parts of Europe.
Choosing a Witch Bottle
Normally, glass bottles with lids would be used to make the witch bottles. Another common type of bottle used to make these apotropaic devices was a stoneware container known as bellarmine jugs (known also as bartmann jugs).
These vessels may have been named after Robert Cardinal Bellarmino, a Catholic Inquisitor who played an important role in the Counter-Reformation. The bottles can be easily identified as they are customarily adorned with the figure of a bearded man. It has been suggested that due to the depiction of this fearsome Inquisitor on such vessels, the bellarmine jugs were often used to make witch bottles.
Bartmann Jug, 1525-50, Germany, Cologne (Victoria and Albert Museum) ( CC BY-2.0 UK )
Contents of the Bottle
The bottles, however, were not as important as their contents. Based on witch bottles that have been discovered, it has been reported that the contents of witch bottles usually varied from one bottle to another. It has been suggested that this is likely due to the fact that the contents of a witch bottle were determined based on the kind of spell its creator thought had been cast on him / her. It has been established that one of the most common components of witch bottles is human urine.
People believed that by preparing a potion through boiling, they would be able to turn a witch’s spell back at her. Thus, a person with bladder / urinary problem would boil his / her own urine, as it was believed that not only would a spell be cast back on the witch, but that person’s problems would cause her suffering as well. Additionally, pins and nails were occasionally thrown into the urine to cause more pain to the witch.
A Bellarmine jug, a type of vessel commonly used to make witch bottles. ( Public Domain )
There are a variety of objects that have been found inside witch bottles. The contents of a 17th century witch bottle unearthed in Greenwich, London, in 2004 is found to have included “human urine, brimstone, 12 iron nails, eight brass pins, hair, possible navel fluff, a piece of heart-shaped leather pierced by a bent nail, and 10 fingernail clippings.” Further analysis of the urine is said to have revealed that it had come from a smoker, as “cotinine, a metabolite of nicotine” was found in it, whilst the nail clippings, which appeared to be “quite manicured”, suggests that it had belonged to someone of “some social standing”.
- The Malleus Maleficarum: A Medieval Manual for Witch Hunters
- Salem Witch Trial hysteria and the courageous stance of Giles Corey
- Mythology in Romania: Exploring Beliefs about Witchcraft and the Devil
- Witches, Vampires and Werewolves – 10 Ghoulish Archaeological Discoveries
Early 19th-century witch bottle from Lincolnshire, England. (CC BY 2.0 )
Witch bottles were not only created to punish witches who casted evil spells on a person, but were also used to prevent spells from harming a person in the first place. These are said to have been normally buried upside down beneath hearths or doorways.
One example of such a protective witch bottle is a 17th century green glass vessel that was unearthed in Newark in 2014. Alternatively, they could also be carried around as amulets. Such protective witch bottles would typically contain sharp, rusty items, such as nails, pins and razor blades, as these are believed to be able to deflect evil spells and bad luck. Other ingredients, taken from websites showing how to make the bottles today, include salt, red wine, red string / ribbon, various herbs, and, of course, human urine.
Many people put great efforts into protecting themselves from the evil spells and curses of witches, and witch bottles provided one of the less violent means for personal defense.
Featured image: From Mal Corvus Witchcraft & Folklore artifact private collection owned by Malcolm Lidbury. Photo source: ( CC BY-SA 3.0 )
By Wu Mingren
Geddes, L., 2009. London’s magical history uncorked from ‘witch bottle’. [Online]
Available at: https://www.newscientist.com/article/dn17245-londons-magical-history-uncorked-from-witch-bottle#.Uy1u3fldVyl
Kelly, D., 2014. The Weird History Of Witch Bottles. [Online]
Available at: http://knowledgenuts.com/2014/03/22/the-weird-history-of-witch-bottles/
Patel, S. S., 2009. Opening a Witch Bottle. [Online]
Available at: http://archive.archaeology.org/online/features/halloween/opening_witch_bottle/
Viegas, J., 2009. 17th Century Urine-filled 'Witch Bottle' Found. [Online]
Available at: http://www.nbcnews.com/id/31107319/ns/technology_and_science-science/t/th-century-urine-filled-witch-bottle-found/#.VrH--bJ97cd
Wigington, P., 2016. Make a Witch Bottle. [Online]
Available at: http://paganwiccan.about.com/od/samhaincrafts/ss/WitchBottle.htm
Woollaston, V., 2014. 'Witch bottle' unearthed in Newark: 330-year-old vessel was filled with hair and urine to ward off evil spirits. [Online]
Available at: http://www.dailymail.co.uk/sciencetech/article-2801346/witch-bottle-unearthed-newark-330-year-old-vessel-filled-hair-urine-ward-evil-spirits.html | <urn:uuid:1edefc02-0e47-4b9d-a388-746ae734267a> | CC-MAIN-2021-39 | https://www.ancient-origins.net/artifacts-other-artifacts/weird-witch-bottles-historic-efforts-ward-evil-spells-and-witchcraft-020734 | s3://commoncrawl/crawl-data/CC-MAIN-2021-39/segments/1631780057504.60/warc/CC-MAIN-20210924050055-20210924080055-00118.warc.gz | en | 0.95423 | 1,452 | 2.640625 | 3 |
Workers Memorial Day (2004)
April 27, 2004
Each year, April 27 is commemorated in the U.S. and internationally as Workers Memorial Day. This day honors the memory of men and women who have been killed or injured on the job.
Although efforts by many partners over the years have resulted in significant reductions in work-related injuries, illnesses, and deaths, much more remains to be done. On estimate, an average of 6,834 people sustain disabling occupational injuries, 15 die from a job-related injury, and 134 die from work-related illnesses in the United States each day.
The National Institute for Occupational Safety and Health (NIOSH) provides national and world leadership to prevent work-related illness, injury, disability, and death by gathering data, conducting scientific research, and translating the knowledge gained into products and services that will improve worker safety and health. NIOSH has pledged to meet this commitment by:
- Developing and evaluating more effective tools and methods for preventing work-related injuries and illnesses, and finding new ways to quickly move those results of NIOSH research into everyday practice.
- Leveraging the capabilities and resources of many diverse agencies and organizations through partnerships under the National Occupational Research Agenda (NORA).
- Building new collaborative relationships internationally, such as those highlighted recently on World Health Day 2004 to reduce the risk of work-related motor vehicle fatalities (the leading cause of work-related deaths in the U.S.).
Workers Memorial Day is an occasion to reflect on the importance of our mission, in the memory of the men and women who have suffered injury, illness, and death on the job. It is also an occasion to rededicate ourselves to the goal of the 1970 Occupational Safety and Health Act, "CDCto assure so far as possible every working man and woman in the Nation safe and healthful working conditions."
To mark this year’s Workers Memorial Day, CDC’s Morbidity and Mortality Weekly Report (MMWR) has published an observation of this day and three articles relating to workplace safety and health.
Workers Memorial Day, April 28, 2004
Morbidity and Mortality Weekly Report: April 23, 2004 / 53(15);311
Occupational Fatalities During Trenching and Excavation Work --- United States, 1992--2001
Morbidity and Mortality Weekly Report: April 23, 2004 / 53(15);311-314>
Carbon Monoxide Poisonings Resulting from Open Air Exposures to Operating Motorboats --- Lake Havasu City, Arizona, 2003
Morbidity and Mortality Weekly Report: April 23, 2004 / 53(15);314-318
Work-Related Pilot Fatalities in Agriculture --- United States, 1992--2001
Morbidity and Mortality Weekly Report: April 23, 2004 / 53(15);318-320
- Page last reviewed: April 27, 2004
- Page last updated: April 27, 2004
- Content source:
- National Institute for Occupational Safety and Health Education and Information Division | <urn:uuid:425654dd-b34b-45bf-8298-154c0c2ac610> | CC-MAIN-2016-30 | http://www.cdc.gov/niosh/docs/mmwr/WkrMemDay04.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-30/segments/1469257827079.61/warc/CC-MAIN-20160723071027-00119-ip-10-185-27-174.ec2.internal.warc.gz | en | 0.938642 | 630 | 2.96875 | 3 |
An Aeroplane Directing The Fire Of The Severn And Mersey On The German Cruiser Konigsberg.
For eight months the Konigsberg lay in her undignified retreat, and then two monitors were despatched to East Africa by the Admirality. The Severn (Commander E. Fullerton) and Mersey (Lieut.- Commander R.A. Wilson) made their first attack on July 6th 1915. An aeroplane was sent up to discover the whereabouts of the Konigsberg, and found her with great palm branches lashed to her masts and her decks scattered about with follage so as to render her invisible. With the aeroplane to direct the firing the British gunners soon made hits, but the day ended with the Konigsberg still firing her four guns. The end came on the 11th, when the Severn, decked to resemble a floating island, drifted up the river near to the unsuspecting Konigsberg. A heavy duel ensued, and to cut a long story short the Severn won the day. For this good work, Commander Fitzmaurice, Fullerton and Wilson of the Navy, and Squadron-Commander R. Gordon, Flight-Commander Cull, and Flight-Sub-Lieutenant H. J. Arnold, of the Air Service, each received the D.S.O.
|Item Code : DTE0070||An Aeroplane Directing The Fire Of The Severn And Mersey On The German Cruiser Konigsberg. - This Edition|| Buy 1 Get 1 Half Price!|
|TYPE||EDITION DETAILS||SIZE||SIGNATURES||OFFERS||YOUR PRICE||PURCHASING|
|PRINT|| First World War antique black and white book plate published c.1916-18 of glorious acts of heroism during the Great War. This plate may also have text on the reverse side which does not affect the framed side. Title and text describing the event beneath image as shown. ||Paper size 10.5 inches x 8.5 inches (27cm x 22cm)||none||£13.00|
|All prices on our website are displayed in British Pounds Sterling| | <urn:uuid:c6cff32e-71ff-44c2-b2fb-00c6fd3daa36> | CC-MAIN-2016-44 | http://www.directart.co.uk/mall/more.php?ProdID=9704 | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720154.20/warc/CC-MAIN-20161020183840-00466-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.922548 | 455 | 2.53125 | 3 |
Many countries across the world deal with health and nutrition-related issues. Even the United States is not free from hunger and malnutrition, especially in communities with high rates of poverty. In fact, millions of Americans face these issues on a personal level.
With this, the US government launched social welfare programs to help its people deal with their basic necessities. One of these is the US Food Stamps Program, with the main goal of helping qualified individuals in need of food and supplemental assistance.
Those who are not familiar with food stamps may be wondering what exactly this program is, what it has to offer, and how to apply for it. Keep reading to know more about it.
- Getting to Know the US Food Stamps Program
- Beneficiaries of the US Food Stamps Program
- How Does the US Food Stamps Program Work?
- How to Apply for the US Food Stamps Program
- Know More About the US Food Stamps Program
Getting to Know the US Food Stamps Program
Most Americans are probably familiar with the food stamps program, but few are aware that it was renamed the Supplemental Nutrition Assistance Program (SNAP).
The objective of the program is to give vulnerable groups like low-income families, individuals with disabilities, and the elderly, the help they need so they can afford nutrient-rich groceries. The US government has partnered with merchants nationwide to provide beneficiaries with an accessible way to buy groceries with food stamps.
There are specific item categories that are eligible for purchase through SNAP. Beneficiaries can buy produce, dairy, poultry, fish, non-alcoholic drinks, bread, and a few other items.
The goal of these restrictions is to ensure that recipients use these vouchers to purchase nourishing items. These food stamps are given once a month, so beneficiaries can get their regular supply of nutritional items.
What Are SNAP Benefits?
While these vouchers may be too limited for some, they spell the difference between eating healthy and going hungry for the month. It provides the sustenance people need while they work, find employment, or study.
It also seeks to help vulnerable individuals like people with disabilities, the elderly, and children who cannot work for themselves. With the Supplemental Nutrition Assistance Program, they are guaranteed to meet their needs so they can live healthy and happy life.
The ultimate objective of this program is to give low-income people, the elderly, children, and people with disabilities the chance they need to improve their lives by enhancing their economic, mental, and physical well-being.
Beneficiaries of the US Food Stamps Program
Supplemental Nutrition Assistance Program, the food stamps program, was created to help underserved individuals, households, and communities the opportunity to sustain their needs and level up the quality of their lives. It is also designed to help vulnerable groups.
So, those in the lower range of the income ladder are given the chance to get financial assistance for their nutritional sustenance. Individuals who do not have or have lost the ability to work for a living are also given the same opportunity. This includes the elderly, children, and disabled individuals.
It is important to note that this program has qualifications covering different factors such as individual income or household income.
Can Beneficiaries of Other Programs Get Food Stamps?
The ultimate objective of the Supplemental Nutrition Assistance Program is to assist individuals and families in need of social assistance. This is why qualified individuals who have qualified for other programs can also apply for these vouchers.
Families with members registered and approved under the Temporary Assistance for Needy Families (TANF), Supplemental Security Income (SSI), and other general social welfare programs can apply. The key is to inquire about eligibility even when currently enrolled in other benefits.
Other programs that can help put food on the table include the Women, Infants, and Children program, the Free School Meals Programs, Free Food Programs for Seniors, and D-SNAP. The USDA National Hunger Hotline is also accessible to people in need.
How Does the Supplemental Nutrition Assistance Program Work?
The Supplemental Nutrition Assistance Program is one of the most helpful social benefits offerings in the country. Those who are interested in applying for it should remember that the value given through vouchers depends on the needs of the individuals or households.
The agency in charge of the program is the Food and Nutrition Service (FNS). It looks at the number of individuals in the household eligible for vouchers. Then, it gives out food stamps depending on this number. The amount can go from $234 per person to $1,408 for eight eligible people in a household.
Households that have more than eight eligible members will be glad to know that they can add more people, but the vouchers for additional members will only be $176 per individual. This is the funding approved by the US government.
Again, it is important to remember that these vouchers can only be used for nutritional foodstuff such as bread, dairy, poultry, produce, and non-alcohol drinks. This is to ensure that beneficiaries use these food stamps for food that will benefit them.
Getting Funds and Aid
Eligible individuals will be given their food stamps through an electronic benefits transfer (EBT) card. To the uninitiated, the EBT card is something like credit or debit card. They facilitate the usage of the vouchers by receiving the funds and by helping beneficiaries access them through the card.
The card is designed to work for purchasing items that qualify for food stamps or those that appear on the eligibility list. This list includes snack foods, but again, there are limitations to what beneficiaries can buy.
What people should remember is that vouchers are only given for a certain amount of time. Through this certification period, the funds will be transferred to the EBT card and beneficiaries should remember that the vouchers will stop arriving after this period.
How to Apply for the US Food Stamps Program?
Individuals interested in getting food stamps should know that there are stringent rules to registering for this program. It is also necessary to point out that every state is bound to have different application procedures and requirements.
So, the best way to start is to get in touch with the state agency in charge of SNAP. This way, you know what the process in the specific state you reside is. This also lets applicants know the requirements, as well as the documents needed to prove their eligibility.
The best way to proceed is to find out all the requirements, and then gather documents to support the information provided by the applicant. This way, you can avoid going back and forth after sending in your application.
The process takes 30 days from the day of submission. During the wait, the applicant will be interviewed by the agency personnel to verify the information they have provided. The interviewer will ask for more documentation should they encounter issues.
Eligibility and Requirements
It is important to note that those in underserved and vulnerable communities could be eligible for the US Food Stamps Program.
Income is the most vital qualification for food stamps. Eligible households are those with gross monthly incomes of 130% of the poverty line or with net incomes of 100% over the poverty line.
Households should have a gross of $1,383 or a net of $1,064 if they are claiming benefits for one member. Those claiming for two members should have $1,868 in gross income or $1,437 in net income.
Know More About the US Food Stamps Program
Aside from buying food and nutritional items, the food stamps program can also be used to purchase seeds and plants, as long as these would be able to provide supplies for the household long-term. This offers more control over what the sustenance households can get and how.
Moreover, food stamps also offer access to discounts and promotions through the EBT card. Beneficiaries can visit cultural sites and a variety of events.
Getting in Touch
People who need to be on the US Food Stamps Program should prepare for the application process. To know more about it, there are different options to get in touch with the FNS of the Department of Agriculture can be reached through different ways.
Potential beneficiaries can send mail to Braddock Metro Center II, 1320 Braddock Place, Fifth Floor, Alexandria, VA 22314.
Keep in mind that every SNAP office in the states all over the country may have different contact details. The FNS’s state directory can help individuals find the information for each state office.
The US Food Stamps Program, now called the Supplemental Nutrition Assistance Program (SNAP), offers a whole lot of benefits for eligible individuals and households. With vouchers for food and other advantages for their well-being, beneficiaries can live happier and healthier life as they look for ways to address their needs. | <urn:uuid:1e384aa5-43e1-4e26-b326-6e7acc857cb9> | CC-MAIN-2022-40 | https://careersrising.com/us-food-stamps-program-how-does-it-work/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030338073.68/warc/CC-MAIN-20221007112411-20221007142411-00286.warc.gz | en | 0.951368 | 1,798 | 2.984375 | 3 |
A panda, Molly, decides to take a slide down an incline plane of 30 degrees. She starts at the top. Her initial speed is 0 m/s. Her mass is 75 kg. The length down the hill is 250 m. At the bottom of the hill is Molly's identical twin sister, Dolly. Dolly is at rest. When Molly collides with Dolly, they hug and do not there go.There is no friction.
A. Is this an inelastic or an elastic collision? Why?
B. What is conserved in this collision? What is not conserved in
C. What is the velocity of the twins immediately after the
D. What is the total kinetic energy before the
E. What is the total kinetic energy after the
F. Are your answers for parts D and E different? Should they be different? If they are different, where did the energy go? | <urn:uuid:7e2fa4ca-c6d4-400c-ac54-534c621c5485> | CC-MAIN-2016-07 | http://www.chegg.com/homework-help/questions-and-answers/panda-molly-decides-take-slide-incline-plane-30-degrees-starts-top-initial-speed-0-m-s-mas-q3018792 | s3://commoncrawl/crawl-data/CC-MAIN-2016-07/segments/1454701148402.62/warc/CC-MAIN-20160205193908-00169-ip-10-236-182-209.ec2.internal.warc.gz | en | 0.93501 | 190 | 3.234375 | 3 |
|No, not this complex plane ...|
|... this complex plane:||
It is a plane for complex numbers!
(It is also called an "Argand Diagram")
Real and Imaginary make Complex
A Complex Number is a combination of a Real Number and an Imaginary Number.
Let me explain ...
A Real Number is the type of number you are used to dealing with every day.
Examples: 12.38, ½, 0, -2000
With real numbers we can do things like squaring (multiply a number by itself):
2 × 2 = 4
But what can we square to get -4 (minus 4)?
? × ? = -4
Well, -2 won't work because multiplying negatives gives a positive: (-2) × (-2) = +4, and no other Real Number works either.
So it seems that mathematics is incomplete ...
... but we can fill the gap by imagining there is a number that, when multiplied by itself, gives -1 (call it i for imaginary):
i2 = -1
Now, we can do this:
2i × 2i = 4i2 = 4 × (-1) = -4
A Complex Number is a combination of a Real Number and an Imaginary Number
Examples: 3.6 + 4i, -0.02 + 1.2i, 25 - 0.3i, 0 + 2i
The Complex Plane
You may be familiar with the number line:
But where do we put a complex number like 3+4i ?
Let's have the real number line going left-right as usual, and an imaginary number line going up-down:
|And we can plot a complex number like 3 + 4i
It is placed
And here is 4 - 2i :
It is placed
And that is the complex plane:
- complex because it is a combination of real and imaginary,
- plane because it is like a geometric plane (2 dimensional).
Whole New World
Now we can bring the idea of a plane (Cartesian coordinates, Polar coordinates, Vectors and more) to complex numbers, and we open up a whole new world of numbers that are more complete and elegant, as you will see.
Complex Number as a Vector
You can think of a complex number as being a vector.
This is a vector.
It has magnitude (length) and direction.
|And here is the complex number 3 + 4i
as a Vector:
You can add complex numbers as vectors, too:
Here we add the complex numbers 3 + 5i and 4 − 3i as vectors:
Add the real numbers, add the imaginary numbers, like this:
(3 + 5i) + (4 − 3i) = 3 + 4 + (5 − 3)i = 7 + 2i
|Again, here is the complex number 3 + 4i
As a Vector:
Here it is again (still as a vector), but
In polar form:
So the complex number 3 + 4i can also be shown as distance (5) and angle (0.927 radians).
How do you do the conversions?
Example: the number 3 + 4i
We can do a Cartesian to Polar conversion:
- r = √(x2 + y2) = √(32 + 42) = √25 = 5
- θ = tan-1 (y/x) = tan-1 (4/3) = 0.927 (to 3 decimals)
We can also take Polar coordinates and convert them to Cartesian coordinates:
- x = r × cos( θ ) = 5 × cos( 0.927 ) = 5 × 0.6002... = 3 (close enough)
- y = r × sin( θ ) = 5 × sin( 0.927 ) = 5 × 0.7998... = 4 (close enough)
In fact, a common way to write a complex number in Polar form is
x + iy = r cos θ + i r sin θ = r(cos θ + i sin θ)
And "cos θ + i sin θ" gets shortened to "cis θ"
So 3 + 4i = 5 cis 0.927
The complex plane is a plane with:
- real numbers running left-right and
- imaginary numbers running up-down.
To convert from Cartesian to Polar Form:
- r = √(x2 + y2)
- θ = tan-1 ( y / x )
To convert from Polar to Cartesian Form:
- x = r × cos( θ )
- y = r × sin( θ )
Next ... learn about Complex Number Multiplication. | <urn:uuid:067f77f8-f4e4-442b-8b8e-6c4ceae6cb70> | CC-MAIN-2015-40 | http://www.mathsisfun.com/algebra/complex-plane.html | s3://commoncrawl/crawl-data/CC-MAIN-2015-40/segments/1443738099622.98/warc/CC-MAIN-20151001222139-00147-ip-10-137-6-227.ec2.internal.warc.gz | en | 0.850925 | 1,023 | 3.625 | 4 |
When I teach at The Menil Collection art museum, I begin in the Antiquities section. We usually based lessons around individual works of art; one in particular stands out to me for its importance to writing. This is the votive statute of Eannatum, Prince of Lagash, a small alabaster statue of a bald-headed man standing with his hands clasped in front of him.
The feature that makes him most interesting to me, unfortunately, is usually not visible to the children. It is the inscription on his back, where the cuneiform script for ‘Eanneatum, prince of Lagash, son of Akurgal’ have been carefully chipped out of the rock.
The statue is Sumerian, from the area that would correspond to modern-day Iraq. Sumer, by most accounts, is the earliest civilization known to history. It was part of Mesopotamia, the region where agriculture (and cities) first developed. To gaze upon this inscription, then, is to see man’s first attempts at transcribe his speech – that is, to write.
Originally, cuneiform was pictographic; every symbol corresponded to one word, which its depiction resembled. Nearly five thousands years later, the earliest pictogram for ‘fish’ still looks recognizably like a fish. There is a beautifully direct relationship in these early scripts between form and meaning: words look like what they say.
Several millenia later, our Latin Alphabet has became so entrenched as to appear practically invisible to us. Our problem is the opposite of theirs; instead of struggling to draw ideograms in uncooperative clay, it is almost too easy for us to become blase about print. We have to struggle to remind readers of the visceral meaning of our sentences. A trip to The Menil Collection can teach us about the history of writing, and show us the origins of the complex systems we often take for granted.
posted by Julian Martinez, Writers in the Schools | <urn:uuid:92446b23-ec07-4be2-8173-179440289ff8> | CC-MAIN-2019-22 | https://witshouston.org/notebook/among-the-antiquities/ | s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232255536.6/warc/CC-MAIN-20190520021654-20190520043654-00510.warc.gz | en | 0.970917 | 411 | 3.140625 | 3 |
The traits that influence both Assertive (ISFJ-A) and Turbulent (ISFJ-T) Defenders encourage caring for and generously supporting the people in their lives – typically in a humble way. They are often the unseen backbone of many a venture. But Identity differences sort each personality type into two subtypes and guide how they express their tendencies.
A Caring Mind-Set, With or Without the Worry
87% of Turbulent Defenders say they usually blame themselves first when something goes wrong, compared to 55% of Assertive Defenders.
Defenders tend to be sensitively perceptive individuals with an eye for details. They’re likely to spot when distress engulfs someone – or when something is amiss on a practical level – much quicker than most other personality types. Much about their caring nature emerges from this. Their mind-set encourages them to help when they see a need, and to do so in a down-to-earth manner.
However, our research suggests that this awareness is likely stronger among Turbulent Defenders. Both forms of Defenders have a liking for thoroughness. But because of their ever-watchful and often worried eyes, Turbulent Defenders typically remain the more detail-oriented of the two. They often spot problems long before their Assertive counterparts do.
This awareness can be a powerful tool that allows Turbulent Defenders to size up potential problems. But it can consume them. Compared to Assertive Defenders, more of them spend time worrying about things they can’t control in life, which can lead to frustration, disappointment, and even sadness. These personalities can take on too much responsibility for negative situations they notice around them.
Turbulent Defenders may see all that can be fixed in their world and frequently feel like they haven’t done enough. They very easily find fault with themselves, even if they don’t deserve it. They typically don’t have enough emotional armor protecting them, and these sensitive personalities end up blaming themselves too often and too quickly.
82% of Assertive Defenders say they prefer focusing on and managing how things are rather than how they should be, compared to 45% of Turbulent Defenders.
Assertive Defenders likely take on some of the responsibility when things go wrong as well. This is part of the sensitivity that defines Defender personality types. But they’re likely to be less affected by it and to know when to let go of difficulties. Assertive Defenders report, at a higher percentage, that they can release their worries soon after they realize that they have no control over such matters.
These Defenders may even balance their perception of negative things with other, more positive thoughts about the state of affairs, leaving them to focus more on the bright side. But this positive outlook can draw their attention away from problems on which they might be better off focusing.
71% of Turbulent Defenders say they are often (or very often) sad, compared to 44% of Assertive Defenders.
The Assertive Defenders’ approach to caring may take much less of an emotional toll on them. Assertive personality types generally report being happier than Turbulent personality types. This is no less true for Defenders.
But this shouldn’t leave Turbulent Defenders discouraged. There may be a trade-off here. Their higher levels of awareness and their vigilance might give them a head start on finding successful solutions. In turn, this can create a point of pride. Instead of a superficial sense of happiness, these personalities may find a strong enough sense of purpose that makes any negative feelings worth it for them. Besides, happiness is a subjective term that means different things to different people.
Defenders, Identity Differences, and People
51% of Assertive Defenders say they have received specific recognitions, awards, or honors in their careers, compared to 28% of Turbulent Defenders.
Neither Assertive nor Turbulent Defenders are prone to bragging or seeking credit. Both behaviors are likely too showy for them. But Assertive Defenders report that they’ve received more recognition or awards for the things they do at work than their Turbulent counterparts. Does this mean that these personalities are better at the work they do? Not necessarily.
Introversion meets a lack of confidence in Turbulent Defenders, and because of this, they may hold back from letting their lights shine. They may fear appearing flashy. On the other hand, Assertive Defenders are generally more confidently proactive and thus more visible. Those more visible in society have a greater likelihood of winning awards. This doesn’t mean that Turbulent Defenders aren’t working just as effectively in their more reserved style. Often, they may find themselves in a place of propping others up at the expense of their own recognition.
Turbulent Defenders also regard the opinions of others as important. Many state that the approval of others remains vital to their decision-making processes. Their Turbulent tendency is to wait until all the relevant people have had their say before they act. This can stall any actions these personalities may want to pursue. Their careful attempt at gaining a consensus may leave them looking a little less energetic.
64% of Assertive Defenders say they are harder to offend than most people, compared to 18% of Turbulent Defenders.
Defenders are typically too sensitive and concerned for others to act like bulls in china shops – as is sometimes the stereotypical case with their Assertive cousins from other personality types. Still, the Assertive Defenders’ relative boldness can have them moving faster than Turbulent Defenders in some situations. Though usually cautious, they may not always get as full an understanding of things before they act as their counterparts do.
Similarly, the opinions of others sit lower on Assertive Defenders’ list of things they typically consider essential. Because of this, these personalities may be a little more likely than their Turbulent counterparts to advise people without first checking to find out what they want or need. Their confidence, paired with their lower sensitivity to the opinions of others, may sometimes convince them that they know what is best for those around them.
Turbulent Defenders might find their cautious nature helpful. A gentler, more careful approach may sometimes be the right style, and Turbulent Defenders are more likely to weigh what the people in their lives say they want and need. This can make them much more considerate, and it allows them to come from a place of greater understanding.
Often in life, people don’t want to be “fixed.” They want to be heard. And while both types of Defender are likely to listen to a reasonable degree, Turbulent Defenders are somewhat more poised to hear what others have to say.
- Turbulent Defenders more actively anticipate problems. This can help them head off problems before they become bigger.
- Assertive Defenders are likely to let go of things they cannot control. Fewer Turbulent Defenders report that they do, which may leave them worrying about matters they can do little about.
- Turbulent Defenders are quick to blame themselves when something goes wrong.
- Assertive Defenders acknowledge problems, but with an eye toward silver linings. This may, at times, divert these personalities from the seriousness of a setback.
- Assertive Defenders are likely more visible in the workplace. They may receive more recognition for their accomplishments than Turbulent Defenders because of this.
- Turbulent Defenders rely on the opinions of others more. Sorting out opinions may slow some of their progress, but it may also help them be better listeners.
- Since Assertive Defenders do not place as much value on the opinions of others, they may not listen to others as carefully as Turbulent Defenders.
- Assertive Defenders may be somewhat more prone to confidently assuming that they know what someone needs or wants rather than asking them.
Nothing is wasted in the world of personality types, and all types and traits have their unique superpowers. With Defenders, we find that Assertive Defenders tend to move the ball forward in more robust and positive ways. They are typically quicker to act and more decisive. Turbulent Defenders are more vigilant and focused on potential problems. They are more likely to value the opinions of others and seek a consensus before they advance.
When all is said and done, however, both variants of this “salt of the earth” personality type are likely to be loyal, caring, and hardworking. Defenders are generous individuals and have much to offer the world. | <urn:uuid:20032f57-cc49-41de-a9e1-4054e267c475> | CC-MAIN-2021-39 | https://www.16personalities.com/articles/assertive-defender-isfj-a-vs-turbulent-defender-isfj-t | s3://commoncrawl/crawl-data/CC-MAIN-2021-39/segments/1631780057830.70/warc/CC-MAIN-20210926053229-20210926083229-00567.warc.gz | en | 0.960478 | 1,778 | 2.515625 | 3 |
Correlations: Nibiru - NASA & Modern Science (Part Two)
Everything about Nibiru (Planet X) in correlation to NASA and our Modern Science. Part Two. ...
(If you haven't read "Part One", I suggest you to do so by clicking here).
Sumerian - NASA correlations
Ancient Sumerian and Babylonian texts indicate that the Earth (" Tiamat ") was struck by a large planet, which moved it into its present orbit, and created the Asteroid Belt.
Nibiru entered our solar system on its clockwise elliptical course, struck Tiamat (Earth), which was moving in its ordained counterclockwise orbit. One of Nibiru's satellites struck Tiamat first, followed by two more of Nibiru's moons. Then Nibiru itself, an enormous planetary body, struck Tiamat, smashing one half of the planet into pieces, which became the "Great Band" (Asteroid Belt). The other half of the planet, which was struck by a smaller moon of Nibiru, was moved into a new orbit, along with a chunk of material which became its moon (or Nibiru "gave" us one of its Moons). The new planet was then called "KI," meaning "cleaved one." The Earth's original moons were dispersed, many changing the direction of their orbits.
Planet X (Nibiru) being pulled into our inner Solar System due to the gravitational pull of the outer planets.
The reference to killing off the dinosaurs (from Part One) seems to indicate that something more is known about this planet than NASA is letting on. Is this in fact a reference to the planet Nibiru of ancient infamy, the planet which, according to ancient sources, did in fact strike the Earth (Tiamat) in ancient times, and gave us a moon for a thank you? Regardless of what NASA really knows, silence is golden, and, for the most part, mum was the word on the issue of Planet X during the 1990s. Instead, scientific journals began to debunk the issue of a tenth solar system planet. In the 1990s, news stories began to dwell on "runaway planets" and "rebel planets" discovered in other solar systems. The issue of Planet X has now become entirely befuddled with recent discoveries of 18 nearby stars with Jupiter-class planets orbiting them (last count as of October, 1999). (see astron.berkeley.edu) Locating any new developments regarding a tenth solar system planet is akin to finding a needle in a haystack, since it's difficult to know which "new planet" they are talking about. For instance, an October 23, 1996 AP article entitled "New rebel planet found outside the solar system," disclosed the following:
"A new planet that breaks all the rules about how and where planets form has been identified in orbit of a twin star about 70 light years from Earth in a constellation commonly known as the Northern Cross. The new planet has a roller coaster like orbit that swoops down close to its central star and then swings far out into frigid fringes, following a strange egg-shaped orbit that is unlike that of any other known planet."
-The March 16, 1999 announcement by NASA at the 30th Lunar and Planetary Science Conference in Houston of the theory of the origin of Earth's Moon as a catastrophic collision with a "Mars-size planet."
-Hubble's recent discovery of 18 (at last count) stars, and numerous Jupiter-size planets (last count 9) with highly elliptical orbits and retrograde (counterclockwise) orbits. Such orbits are now understood to be quite the norm in nearby solar systems, although they are considered peculiar in our own.
-The 1994 announcement by NASA of a one-mile wide moon orbiting the 33-mile wide asteroid Ida, which follows the expectation that if a planetary body in this solar system exploded (or collided), the debris will be gravitationally bound in orbits around a primary body.
-The discovery of water, atmosphere and perhaps previous life on Mars, the Moon and Europa.
-There is a strange gravitational "pull" on Uranus, Neptune and Pluto, which indicates there is another body of significant size beyond it.
NIBIRU / PLANET-X COVER UP!
Tom van Flandern of the U.S. Naval Observatory, who was quoted in the 1982 Newsweek article, admits that a tenth planet is possible, but argues that it would have to be so huge that it should have been observed by now. We must admit that there is a serious possibility that more details regarding Planet X are in fact known, but we are not being informed. Is there a major cover-up of Planet X ? This possibility was actually discussed in an article in the CCNet Digest on May 18, 1998 entitled "The Secrets of Asteroid Peril, British Media Smells a Rat." This article claimed that a report in the London Daily Mail accused US astronomers of trying to cover up scientific data until NASA has a chance to look at the information. The report indicated that "earth-shattering" information, such as the discovery of incoming comets or asteroids, has been ordered to go through NASA first. The Daily Mail report of May 15, 1998 entitled "Delayed Impact, or the Secrets of Asteroid Peril," stated the following:
"If a giant asteroid is hurtling in the general direction of our planet, we will be the last to know about it. For astronomers have decided that the news would be too earth shattering for ordinary mortals to handle, and would likely cause widespread panic. In a week that sees the release of the film Deep Impact, a fictional account of just such a catastrophe, astronomers funded by the American space agency NASA have now agreed to keep asteroid and comet discoveries to themselves for 48 hours while more detailed calculations are made. The findings would then go to NASA, which would wait another 24 hours before going public."
A Los Angeles AP article on May 19, 1998 also reported on this 72 hour delay rule imposed by NASA on announcements to the public of asteroids or comets by astronomers. The report indicated that these measures were undertaken to avoid the "doomsday alert" which occurred in March of 1998 with regard to an asteroid which was due to collide with Earth in 2028, and which was "soon found to be a mistake." These new procedures, the article stated, are "not an attempt to hide anything but to make sure the information is accurate." How can we be sure that if the information is found to be accurate, NASA will not (a) find it to be a "mistake," or (b) withhold the message for a longer period of time?
Article entitle: "X Marks the Spot"
In February, 1999, J.B. Murray presented a paper to the Royal Astronomical Society entitled "Arguments for the Presence of a Distant Large Undiscovered Solar System Planet."
Murray's paper explored various explanations for what he called a "non-random clustering of long-period comets," which his research concluded are "aligned along a great circle inclined to both the elliptic and the Galactic plane." His paper examined the possibility that this non-random clustering was due to "orbital perturbations by an undiscovered object orbiting within the distances of 30,000 to 50,000 au from the Sun." Murray's mathematical modeling predicted that the object would have a retrograde orbit inclined at 120 degrees.
In an October 16, 1999 Economist article entitled "X Marks the Spot," Drs. Murray and Matese, after looking at the orbits of approximately 300 long-period comets, have separately concluded that too many of them are coming from the same regions of space. They suggest that the galaxy's "tidal wobble" is "being modulated by the gravity of something big within the Oort Cloud itself."
The new object must be very faint, these astronomers suggest, or it would have been spotted. This means it's not a star. They predict that the object is three times the size of Jupiter. They also suggest that the object is not a "proper planet," because, take note: "its orbit appears to run in the opposite direction from those of the nine known planets." This is another factoid we can add to the above "anomalous" findings regarding the existence of Nibiru (or Marduk after the Babylonian texts). As the Enuma elish tells us, the planet Marduk entered the solar system on its "clockwise, elliptical orbit," and struck the Earth, which was moving in its "ordained counterclockwise orbit." So the planet we are looking for will have an orbit which runs in the opposite direction from those of the nine known planets in our solar system. (Chalk another one up for Sitchin!)
According to the above Economist article, the orbit of this object also appears to be so unstable that it is unlikely that it could have maintained this orbit for the 4.5 billion year history of the solar system. Therefore, these astronomers suggest, it is more likely that the object is an extra-solar body that was captured by our sun's gravity only "recently," in astronomical terms. (Otherwise, it would have wreaked virtual havoc throughout the history of the solar system. Of course, we are presuming that our neck of the galactic woods is serene because we've been left here in peace to "evolve" for so long that Planet X would have to be a relative newcomer to fit into this preconceived scenario.) In any case, these astronomers predict we should be detecting Planet X soon, even if we have to wait for the next generation of infra-red space telescopes.
It's interesting to note that many of the newly discovered extra-solar planets recently discovered have extremely "eccentric" orbits. It is suggested in "New Discoveries, A Planetary Mystery" (astron.berkeley.edu) that circular orbits may actually not be the rule in nearby solar systems. Nine of the extra-solar objects recently discovered travel in unusually elliptical orbits, "several of them plunging in relatively close to their stars and then swinging far out again." Several of these planets may be three times as massive as Jupiter, and one is estimated at eleven times the mass of Jupiter. What these new discoveries are teaching us is that our own solar system may be very unlike others. Even considering our catastrophic past, we may inhabit a relatively peaceful end of the cosmos, as far as galaxies go. As Dr. Geoffrey Marcy explains, powerful gravitational forces exerted over smaller planets by huge planets or passing stars are capable of upsetting their orbits. Likewise, two or more huge planets orbiting in close proximity can generate a "gravitational slingshot" effect, which could fling one of the objects off on an elongated orbit into the inner planetary system, while the other could at the same time fly off in the other direction, perhaps escaping into interstellar space. In another possible scenario, the planet's own star (sun) could be part of a binary star system, locked in a gravitational embrace.
Although this discussion is being avoided in what little news there is on Planet X, the existence of a mysterious outer solar system planet suggests that we could be living in a two star solar system. What distant gravitational body is causing this planet to make such an enormous wayward loop? One thing is sure, such a companion star would be very capable of exerting a catastrophic influence on the orbits of the outer solar system planets. As Dr. Marcy writes: "We are realizing that most of the Jupiter-like planets far from their stars tool around in elliptical orbits, not circular orbits, which are the rule in our solar system." Why our largest planets remain in circular orbits is, therefore, a mystery. As Dr. Marcy notes:
"Jupiter sized bodies plunging toward and away from their stars are likely to sweep aside smaller worlds, sending them crashing into their star or flying out of orbit into interstellar space. Current technology is incapable of detecting Earth-size planets around other stars, but they almost certainly could not exist near their star's warmth in a system so unsettled by large planets in wrecking orbits."
A huge planet on an elliptical orbit would probably scatter or destroy smaller planets as it crosses their paths time and again. As Dr. Marcy writes, "if our Jupiter were in an eccentric orbit, the Earth and Mars would likely be gravitationally scattered out of the solar system. Therefore, our very existence, he writes, is dependent upon both Jupiter and Earth being in mutually stable and circular orbits." Lucky for us, we have no big bullies, no freewheeling wrecking balls, in our solar system. Or do we?
In assimilating this information into our world view, we have to realize that our science is missing large areas of information with regard to geometric interplanetary relationships in our solar system's cosmic dance, and the peculiar physics of a shared outer solar system planet or twin sun scenario, and the connection this might have on both Earth's climate and rotation, and also, as strange as it may sound, on space-time reality and human consciousness.
We are being spoken to in a forgotten ancient language, and we've got to wake up fast to the meaning of the message.
NIBIRU IS SOMEWHERE CLOSE!
Before we can go further, please watch this short video:
Google Earth and Google Sky are made from pictures took years ago. This part of our Galaxy was photographed in 2007 (or before and posted then). In the above and bellow videos we can see an intentionally cut rectangle from Google Sky, where Nibiru and its moons were located back in 2007.
Now, after seeing the videos what if I tell you that I have the missing picture, that was cut from Google Sky in 2009, just before the first video?
Well, see for yourself!Nibiru will pass between Mars and Jupiter and we will be here to see this astonishing event. The elites hide the planet from us because if the planet is real then the Sumerian texts are real. If the texts are real, then...THE REPTILIAN ANUNNAKI ARE REAL! And they are! | <urn:uuid:627a960b-e3a4-41d8-80fc-3c483fb41678> | CC-MAIN-2015-11 | http://humansarefree.com/2011/01/correlations-nibiru-nasa-modern-science_12.html?m=0 | s3://commoncrawl/crawl-data/CC-MAIN-2015-11/segments/1424936461216.38/warc/CC-MAIN-20150226074101-00122-ip-10-28-5-156.ec2.internal.warc.gz | en | 0.957112 | 2,932 | 3.4375 | 3 |
Published by Ulfred Walker in Category Kindergarten at Wednesday, April 25th 2018. Labeled with . 94/100 rated by 510 users
This document section includes 39 picture of Kindergarten, some of them are including The Single Step Addition Word Problems Using Single Digit Numbers A. Elementary Math Word Problems Worksheet Free Printable Educational. Math Worksheets Fifth Grade Word Problems Homeshealth Info. Free Printable Math Worksheets For 3rd Grade Word Problems 10.
All Rights Reserved. Designated trademarks, brands and all uploaded materials by users are the property of their respective owners. Worksheets Kindergarten and Free Printables. All Rights Reversed.
© 2016 Worksheets Kindergarten and Free Printables, Corp.•••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• | <urn:uuid:75810e76-740e-4c30-a48b-f1bdd01c1111> | CC-MAIN-2018-51 | http://leenkat.com/math-worksheet-word-problems-picture/ | s3://commoncrawl/crawl-data/CC-MAIN-2018-51/segments/1544376823785.24/warc/CC-MAIN-20181212065445-20181212090945-00058.warc.gz | en | 0.691071 | 174 | 3.40625 | 3 |
National geologic map database [electronic resource].
- [United States] : USGS, National Cooperative Geologic Mapping Program, [1996?]-
- This is a prototype version of a Database which provides access to maps and other spatially referenced data for geology, geophysics, marine geology, earth resources, hazards, geochemistry, geochronology, and paleontology.
- Beginning date
- Title Variation
- File Characteristics
- Computer data and programs.
- Managed by the USGS's National Cooperative Geologic Mapping Program in cooperation with the Association of American State Geologists.
- Title from title screen.
- Mode of access: Available over the Internet via the World Wide Web. | <urn:uuid:bb08740a-d845-4d5d-9cc1-d1afc4aae7d1> | CC-MAIN-2016-30 | https://searchworks.stanford.edu/view/3430217 | s3://commoncrawl/crawl-data/CC-MAIN-2016-30/segments/1469257824230.71/warc/CC-MAIN-20160723071024-00092-ip-10-185-27-174.ec2.internal.warc.gz | en | 0.766428 | 154 | 2.640625 | 3 |
Charter schools [''Charter Schools: The Road Ahead,'' Jan. 17] are the beginning of privatization of all public schools. The public school system will surely be as extinct as the dodo bird if charter schools are permitted to become a reality.
Public schools were meant to educate the public in a non-partisan atmosphere with public funds. Public schools were the original melting pot for all immigrants and their children. Free education was the avenue out of poverty and to achieve the American dream. Public schools brought together all ethnic groups, religions and races into one peaceful people.
Private donations, whether by business, religious, ethnic or racial groups, will greatly influence the type of education children will receive in their individual charter schools. We are heading toward segregated schools again.
Surely, the public school system has to be intensely upgraded. School buildings must be made safe for learning and safe from drugs and violence. The physical buildings must be structurally sound, clean, bright, warm, comfortable with all the necessary equipment to enrich and educate every student to his or her potential. Teachers and administrators must be of the highest caliber with salaries to match.
If charter schools can accomplish a higher standard of education, then why can't regular public schools accomplish the same?
Massapequa ParkContinue reading the main story | <urn:uuid:56be8612-9f7e-4b72-8171-96c879290c60> | CC-MAIN-2017-17 | http://www.nytimes.com/1999/01/31/nyregion/l-charter-schools-the-road-to-segregation-098329.html?src=pm | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917123048.37/warc/CC-MAIN-20170423031203-00627-ip-10-145-167-34.ec2.internal.warc.gz | en | 0.969481 | 263 | 2.53125 | 3 |
City Hall at night
There is nothing magical about our City Hall, but it has played an important role in Singapore’s history. I went on a tour of this magnificent building in year 2008.
Erected in 1929, City Hall was originally known as the Municipal Building. It was renamed in 1951. It housed various government bodies before it became home to the Singapore judiciary in 1987. On 14 February 1992, it was gazetted as a National Monument.
On 12 September 1945, the Japanese surrendered to the British here, formally ending the Japanese Occupation of Singapore (Feb 1942 - Aug 1945).
MM Lee Kuan Yew, our first Prime Minister, proclaimed self-government for Singapore on 5 June 1959 and merger with Malaysia on 16 September 1963 here. The first fully-independent Singapore Government was sworn in at City Hall on 9 August 1965.
It was home to the Prime Minister's Office, the Ministry of Foreign Affairs, and the former Ministry of Culture and was occupied by the Supreme Court, the Singapore Academy of Law, the Public Service Commission and the Industrial Arbitration Court.
By 2012, the building together with the former Supreme Court Building will be converted to a museum to house Singapore's national art collection.
A secret passage way!!
Credit : YourSingapore.com | <urn:uuid:9159d113-3177-435f-b610-2fe5a8b14db0> | CC-MAIN-2023-40 | https://eastcoastlife.blogspot.com/2012/05/singapore-city-hall-ph.html?showComment=1337388668578 | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233510225.44/warc/CC-MAIN-20230926211344-20230927001344-00382.warc.gz | en | 0.970188 | 269 | 2.578125 | 3 |
Mammals in the Desert
If you took a flight over a desert, what would you think as you flew over? Many people would probably think they were flying over a barren wasteland. But deserts aren’t dead; far from it, they are teeming with all sorts of specialized plants and animals.
The Sonoran Desert alone boasts more than 500 species of birds, 130 species of mammals, more than 100 species of reptiles, and more than 2,500 plant species. And if you spend any time in the desert, you’ll see, hear, or smell evidence of all of this life: Coyotes howl during the evening, owls call out, breezes bring the sweet smell of flowers and plants, and it’s impossible to miss the towering saguaros, the flowering ironwood trees, and the vivid displays of wildflowers, or the butterflies and hummingbirds zipping from one bloom to another.
There are four major deserts in North America. The Chihuahuan Desert is the largest and covers about 175,000 square miles in Mexico, with fingertips in southern New Mexico, southwestern Texas, and the far-flung reaches of southeastern Arizona.
The Great Basin Desert is our second-largest desert and occupies more than 158,000 square miles; it stretches from southern Idaho and the southeastern corner of Oregon to western Utah and much of northern Nevada.
With an area of 106,000 square miles, the Sonoran Desert is the third largest, and it is located in southern Arizona, southeastern California, part of Baja California, and northwestern Mexico.
The Mojave Desert is the smallest desert in the Southwest, at 54,000 square miles. It covers southern Nevada, the southwestern corner of Utah, part of southern California, and a small piece of western Arizona. In this book, we will focus on the Great Basin, the Mojave, and the Sonoran deserts, as they are primarily found in the western United States.
Mammals come in all shapes and forms and eat everything from plants, seeds, and insects to other mammals. In the Southwest, mammals are not especially abundant, as the heat and arid conditions pose special challenges. Nonetheless, some especially hardy mammals are found in the region, and they survive because of their special adaptations.
Here are some of the mammals found in the desert:
Mountain lions are highly adaptable and live comfortably in a desert habitat. They exert little energy during the hottest part of the day, and they are primarily nocturnal, resting during the day in caves, mines, beneath shrubs, in washes, and in other cool, shady areas.
Bobcats are nocturnal and very secretive. They are difficult to observe in the wild. Water sources are perhaps the best places to look for bobcats; look in the early morning or late afternoon. They also like to sit on top of rocks and use them as lookouts.
Desert bighorn sheep are very well adapted for desert life. Bighorns possess sweat glands that help prevent overheating, and they also pant to dissipate body heat. A bighorn’s thick fur isn’t just useful for the cold; it also helps protect it from some of the effects of the heat. Bighorns can also go a long time without water, up to a week, and they often obtain much of the moisture they need from their food. What’s more, their internal organs (stomach and colon) are adapted to conserve moisture within the body, and they produce dry feces and concentrated urine, further conserving moisture.
Like many other animals, bighorns try to avoid the worst of the desert sun, and they seek cool areas (shade, soil, rocks, caves, mines, canyons, and higher elevations) to rest during the hottest part of the day. They can also withstand an elevated body temperature—more than 5 degrees higher than usual—without harm.
Mule deer and pronghorn: During the day, mule deer rest under bushes and in the shade to stay cool. Mule deer have huge ears that can move independently and help them dissipate heat, and they can regulate their body heat via panting. Mule deer also have specially adapted lips that allow them to strip leaves from spiny desert plants without being subjected to the spines.
Pronghorn are well adapted to desert life. During hot periods, the guard hairs on their back/mane can be raised, helping cool the skin. And when it’s cold out, these same hairs (when lowered) help shut out the cold. Because pronghorn derive most of their water needs from food, they can also survive long periods without water. If the vegetation has a moisture content of 75 percent or more, pronghorn don’t need to drink water at all.
Rabbits and hares: Desert cottontails are small- or medium-size rabbits with large eyes and buff-gray coloration on the back, sides, and face. The shoulders and legs are darker; the rear legs are larger and longer than the front legs. The tail is gray-black above and white below. The whiskers are black and the hind legs are longer than the front legs. Black-tailed jackrabbits are large rabbits with big eyes; they are light gray along the back and face and have lighter underparts.
Both the desert cottontail and the blackmailed jackrabbit are well adapted for desert life. Both avoid the daytime heat and obtain most of the water they require from their food, so they aren’t dependent on sources of open water. Their waste products are also concentrated and contain little water. Both species also have light-colored fur that reflects light, and their ears act as heat dispersers; incredibly, the veins inside the ears can dilate, allowing them to disperse up to one-third of their body heat. (For this reason, they will often sit with their ears up, facing the oncoming wind or breeze to cool off.) Jackrabbits can even store heat during the day via a temporarily raised body temperature and then release it at night.
For more fascinating insights into desert life, check out Karen Krebbs’ book Desert Life: A Guide to the Southwest’s Iconic Animals & Plants and How They Survive. | <urn:uuid:3813a068-d132-412f-9728-1674b4e2c6ed> | CC-MAIN-2019-26 | http://adventurepublications.net/2016/12/28/desert/ | s3://commoncrawl/crawl-data/CC-MAIN-2019-26/segments/1560627998509.15/warc/CC-MAIN-20190617143050-20190617165050-00429.warc.gz | en | 0.959931 | 1,311 | 3.71875 | 4 |
viral; Viral Hepatitis
Disease of the liver causing inflammation. Symptoms include an enlarged liver, fever, nausea, vomiting, abdominal pain, and dark urine.
Originally known as serum hepatitis, Hepatitis B has only been recognized as such since World War II, and has caused current epidemics in parts of Asia and Africa. Hepatitis B is recognized as endemic in China and various other parts of Asia. Over one-third of the world's population has been or is actively infected by hepatitis B virus (acronym HBV).
Hepatitis as related to Hepatitis B
- Hepatitis B - Wikipedia, the free encyclopedia
Hepatitis B is an infectious disease caused by the hepatitis B virus (HBV) which affects the liver. It can cause both acute and chronic infections.
- CDC DVH - Hepatitis B FAQs for the Public
Hepatitis B Surface Antibody (anti-HBs) is an antibody that is produced by the body in response to the Hepatitis B surface antigen.
- Hepatitis A, B, and C Center: Symptoms, Causes, Tests ...
Hepatitis A, B, and C are viral infections that together affect an estimated 5% to 6% of Americans. Get in-depth hepatitis information here about hepatitis symptoms ...
- CDC DVH - Division of Viral Hepatitis Home Page
"Hepatitis" means inflammation of the liver and also refers to a group of viral infections that affect the liver. The most common types are Hepatitis A ...
- Hepatitis A, B, C, D, E: Click for Symptoms - MedicineNet
Viral hepatitis refers to hepatitis caused by a few specific viruses that primarily attack the liver. Hepatitis symptoms include loss of appetite, nausea, vomiting ...
- What I need to know about Hepatitis B
Hepatitis C is an infectious disease affecting primarily the liver, caused by the hepatitis C virus (HCV). The infection is often asymptomatic, but chronic infection ...
- Lo que usted debe saber sobre la Hepatitis B
[Volver Arriba] ¿Cuáles son los síntomas de la hepatitis B? La mayoría de las personas no presentan síntomas de hepatitis B. Es posible que los ...
- Hepatitis (Viral Hepatitis, A, B, C, D, E, G) Symptoms ...
Diagnosis of acute viral hepatitis often is easy, but diagnosis of chronic hepatitis can be difficult. When a patient reports symptoms of fatigue, nausea, abdominal ...
- Viral Hepatitis Home
The Department of Veterans Affairs (VA) leads the country in hepatitis screening, testing, treatment, research and prevention. An extensive list of documents can be ... | <urn:uuid:419ec61c-66d8-4ac6-9fb0-d6ab94919150> | CC-MAIN-2015-14 | http://www.goldbamboo.com/relate-tl1408-tr2847.html | s3://commoncrawl/crawl-data/CC-MAIN-2015-14/segments/1427131292683.3/warc/CC-MAIN-20150323172132-00096-ip-10-168-14-71.ec2.internal.warc.gz | en | 0.814468 | 599 | 3.53125 | 4 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.