text stringlengths 222 548k | id stringlengths 47 47 | dump stringclasses 95 values | url stringlengths 14 1.08k | file_path stringlengths 110 155 | language stringclasses 1 value | language_score float64 0.65 1 | token_count int64 53 113k | score float64 2.52 5.03 | int_score int64 3 5 |
|---|---|---|---|---|---|---|---|---|---|
Bloodborne Pathogen Training
Bloodborne pathogens are disease and infection-causing microorganisms carried by blood and other potentially infectious materials. Protecting employees from occupational exposures to disease-causing viruses and bacteria has become an extremely significant issue in many work places. Everyone with a possible exposure to bloodborne diseases on the job has to understand the hazards and the ways to avoid exposure. OSHA created the Bloodborne Pathogens Standard to inform employers and employees what actions to take to prevent exposure to bloodborne pathogens at work. Employers at any facility with workers who handle, or have the potential to come into contact with, blood, other body fluids which may contain bloodborne pathogens, or other contaminated items, must comply with this regulation.
Please follow this link to a complete copy of the Monmouth University Bloodborne Pathogens Exposure Control Plan. A self-paced training program for Monmouth University employees may be reached at http://bluehawk.monmouth.edu/~aaction/bloodborne/
For problems or questions regarding this web contact [email@example.com] | <urn:uuid:785c88ca-bad5-4ad4-8ad4-c7c27c9ef701> | CC-MAIN-2015-06 | http://bluehawk.monmouth.edu/~aaction/bp.htm | s3://commoncrawl/crawl-data/CC-MAIN-2015-06/segments/1422115899686.93/warc/CC-MAIN-20150124161139-00096-ip-10-180-212-252.ec2.internal.warc.gz | en | 0.90187 | 220 | 3.25 | 3 |
One of the mysteries of the English language finally explained.
A small Andean guitar, traditionally made from an armadillo shell.
- ‘All night, squads of dressed-up campesinos trotted through town, the men strumming charangos, the women shrilling praise-songs to whichever roadless hamlet they'd walked from.’
- ‘Instead, on lonely curves, we'd pass a young man in a tall, conical knitted hat and a bright embroidered jacket, walking along playing a tiny guitar, a charango, to himself.’
- ‘The haunting sound of the large pan pipes, the melodious sound of the charango and the moving atmosphere created by the violin bring this diverse repertoire beautifully together.’
- ‘They cooked and washed, men drank and played charangos, older kids whined about the rustic boredom, and Fabrizio, age five, made a first disastrous experiment with chicha.’
- ‘Originally, the soundbox of the charango was made from the shell of an armadillo, which gave it a unique sound and appearance.’
1920s: from South American Spanish.
Top tips for CV writingRead more
In this article we explore how to impress employers with a spot-on CV. | <urn:uuid:4e76f3ab-e0c2-4caa-b5fc-143071978b93> | CC-MAIN-2017-17 | https://en.oxforddictionaries.com/definition/charango | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917120187.95/warc/CC-MAIN-20170423031200-00052-ip-10-145-167-34.ec2.internal.warc.gz | en | 0.928886 | 280 | 2.75 | 3 |
10 item checklist about the intersection of domestic violence, substance abuse and mental health issues
by David Mandel, MA, LPC
Domestic violence frequently co-occurs with mental health and substance abuse issues. A batterer may be diagnosed correctly or inappropriately with mental health issues. A domestic violence survivor may also have a substance abuse problem. A child who has been exposed to batterer’s behaviors may have mental or behavioral health issues. Frequently our response to these issues are “siloed,” meaning we prioritize one over the other or even completely ignore one issue to focus on another. For instance substance abuse and mental health counselors may not screen for domestic violence or if domestic violence perpetration is identified as an issue it may seen as a symptom of the substance abuse. A survivor’s recovery plan may be developed without consideration of how the perpetrator might try to sabotage her recovery. Or a child’s behavioral health issues are not evaluated in the context of historic and current domestic violence.
The following is a 1o item checklist to help begin the conversation about the intersection of domestic violence, substance abuse and mental health issues. I share this list with the idea that raising our awareness by asking questions about the connection between different issues can be huge step forward in our ability to help families.
- What is the relationship between domestic violence, substance abuse, mental health issues?
- How have the batterer’s behavior created or exacerbated mental health/behavioral health and/or substance abuse issues for the adult survivor and/or child?
- What is the relationship between the batterer’s abusive behavior and any of his mental health and/or substance abuse issues?
- How is the batterer interfering with/supporting the treatment and recovery of family members?
- How are family members more vulnerable to the batterer because of their mental health and/or substance abuse issues?
- How is child welfare and others assessing for domestic violence when the presenting issue is adult or child behavioral/mental health/ substance abuse?
- What are important case or treatment plan steps when domestic violence is co-occurring with substance abuse and/or mental health issues?
- What are skill level/policy/practices of substance abuse and mental service providers regarding assessing for domestic violence, safety planning and the integration of co-occurring issues into their treatment plan?
- What information do mental health and substance treatment providers have access to regarding the domestic violence?
- What is the training and skill level of mental health or substance abuse evaluators/assessors regarding domestic violence in general and more specifically regarding the co-occurrence of domestic violence with substance abuse and/or mental health issues? | <urn:uuid:fbbfcc98-492c-43fd-b989-a9b87b269123> | CC-MAIN-2015-35 | http://endingviolence.com/2010/03/10-item-checklist-about-the-intersection-of-domestic-violence-substance-abuse-and-mental-health-issues/ | s3://commoncrawl/crawl-data/CC-MAIN-2015-35/segments/1440645293619.80/warc/CC-MAIN-20150827031453-00252-ip-10-171-96-226.ec2.internal.warc.gz | en | 0.941942 | 552 | 2.859375 | 3 |
August 28, 1867|
|Died||September 12, 1918
|Alma mater||Harvard University
University of Göttingen
|Doctoral advisor||Felix Klein|
|Doctoral students||William Brenke
David R. Curtiss
Griffith C. Evans
Lester R. Ford
Walter B. Ford
Charles N. Moore
Joseph L. Walsh
|Known for||Differential equations, series, and algebra|
Maxime Bôcher (August 28, 1867 – September 12, 1918) was an American mathematician who published about 100 papers on differential equations, series, and algebra. He also wrote elementary texts such as Trigonometry and Analytic Geometry. Bôcher's theorem, Bôcher's equation, and the Bôcher Memorial Prize are named after him.
Bôcher was born in Boston, Massachusetts. His parents were Caroline Little and Ferdinand Bôcher. Maxime's father was professor of modern languages at the Massachusetts Institute of Technology when Maxime was born, and became Professor of French at Harvard in 1872.
Bôcher received an excellent education from his parents and from a number of public and private schools in Massachusetts. He graduated from the Cambridge Latin School in 1883. He received his first degree from Harvard in 1888. At Harvard, he studied a wide range of topics, including mathematics, Latin, chemistry, philosophy, zoology, geography, geology, meteorology, Roman art, and music.
Bôcher was awarded many prestigious prizes, which allowed him to travel to Europe to research. Göttingen was then the leading mathematics university there, and he attended lectures by Klein, Schönflies, Schwarz, Schur and Voigt. He was awarded a doctorate in 1891 for his dissertation Über die Reihenentwicklungen der Potentialtheorie (Development of the Potential Function into Series), he was encouraged to study this topic by Klein. He received a Göttingen university prize for this work.
In Göttingen he met Marie Niemann, and they were married in July 1891. They had three children, Helen, Esther, and Frederick. He returned with his wife to Harvard where he was appointed as an instructor. In 1894 he was promoted to assistant professor, due to his impressive record. He became a full professor of mathematics in 1904. He was president of the American Mathematical Society from 1908 to 1910.
Although he was only 46 years old, there were already signs that his weak health was failing. He died at his Cambridge home after suffering a prolonged illness.
Bôcher's theorem states that the finite zeros of the derivative of a nonconstant rational function that are not multiple zeros of are the positions of equilibrium in the field of force due to particles of positive mass at the zeros of and particles of negative mass at the poles of , with masses numerically equal to the respective multiplicities, where each particle repels with a force equal to the mass times the inverse distance.
Bôcher's equation is a second-order ordinary differential equation of the form:
The Bôcher Memorial Prize
The Bôcher Memorial Prize is awarded by the American Mathematical Society every five years for notable research in analysis that has appeared in a recognized North American journal.
Winners have included James W. Alexander II (1928), Eric Temple Bell (1924), George D. Birkhoff (1923), Paul J. Cohen (1964), Solomon Lefschetz (1924), Marston Morse and Norbert Wiener (1933), and John von Neumann (1938).
He wrote Introduction to Higher Algebra (1907) and Introduction to the Study of Integral Equations (1909). He was one of the editors of the Annals of Mathematics, of the Transactions of the American Mathematical Society, and collaborator on the Encyclopädie der mathematischen Wissenschaften. His final book was Leçons sur les méthodes de Sturm dans la théorie des équations différentielles linéaires et leurs développements modernes (circa 1917).
- Birkhoff, George D. (1919). "The scientific work of Maxime Bôcher". Bull. Amer. Math. Soc. 25 (5): 197–215. MR 1560177.
- Osgood, William F. (1919). "The life and services of Maxime Bôcher". Bull. Amer. Math. Soc. 25 (8): 337–350. MR 1560199.
- One or more of the preceding sentences incorporates text from a publication now in the public domain: Rines, George Edwin, ed. (1920). "Bocher, Maxime". Encyclopedia Americana.
- O'Connor, John J.; Robertson, Edmund F., "Maxime Bôcher", MacTutor History of Mathematics archive, University of St Andrews.
- Maxime Bocher biographical memoirs of the national academy of sciences.
- Maxime Bôcher at the Mathematics Genealogy Project
- National Academy of Sciences Biographical Memoir | <urn:uuid:97f01e5c-41d4-42e9-a892-e58b7e9b959a> | CC-MAIN-2013-48 | http://en.wikipedia.org/wiki/B%c3%b4cher's_equation | s3://commoncrawl/crawl-data/CC-MAIN-2013-48/segments/1386164028001/warc/CC-MAIN-20131204133348-00098-ip-10-33-133-15.ec2.internal.warc.gz | en | 0.916221 | 1,081 | 2.6875 | 3 |
Hardiness Zone: 5a
Alice from Prairie du Chien, Wisc
Are your pears splitting and rotting right on the tree? Do the fruits or leaves have velvety olive-brown spots on them? If so, your tree could be suffering from a disease called pear scab. With scab, as the pears mature the spots turn into "corky" lesions and the fruit usually cracks (or is malformed) and drops off the tree prematurely. Scab is a fungus that over-winters in leaves and twigs that have fallen from the tree. In the spring, the spores are carried by the wind to the newly developing fruit causing an infection. Once this infection occurs, a new "summer" spore is formed, which can last throughout the season and keep the annual cycle going. To control scab, you'll need to clean up leaf debris each spring and fall, and get on a schedule for spraying an organic fungicide. Before doing anything, I would get an expert out for an onsite opinion to confirm your tree's problem.
About The Author: Ellen Brown is our Green Living and Gardening Expert. Click here to ask Ellen a question! Ellen Brown is an environmental writer and photographer and the owner of Sustainable Media, an environmental media company that specializes in helping businesses and organizations promote eco-friendly products and services. Contact her on the web at http://www.sustainable-media.com
Here are the recent answer to this question.
By Randa (Guest Post)04/26/2006
Not sure but my family had some like that that we called cooking pears
Add your voice to the conversation. Click here to answer this question. | <urn:uuid:140a2c5d-c46d-4d96-a9dd-3721c37a41dd> | CC-MAIN-2014-15 | http://www.thriftyfun.com/tf36003668.tip.html | s3://commoncrawl/crawl-data/CC-MAIN-2014-15/segments/1398223207985.17/warc/CC-MAIN-20140423032007-00245-ip-10-147-4-33.ec2.internal.warc.gz | en | 0.953682 | 349 | 2.796875 | 3 |
Oakfield offers an exciting and innovative Design Technology experience, which includes learning in resistant materials, textiles and food.
Our Specialist Design Technology Team: Ms Lesley Peat, (Head of Design and Technology/ DT,) Mrs Philippa Nightingale (DT Teacher.)
Students will learn a variety of hand and machine sewing skills while developing fun projects using a variety of dying methods.
At Oakfield we are committed to teaching pupils about the importance of healthy eating and also teaching them the skills that they need to produce food as part of a healthy diet.
no images were found
Pupils benefit a specially equipped classroom that encourages creativity and design within a wide range of specialist areas including wood, plastic and graphics.
At Oakfield pupils also learn how to make tasty recipes as well as crafting using a variety of textiles and techniques.
Pupils preparing their cooking ingredients
Annual Food and Textile Competitions:
Gingerbread : Christmas competition. Every year we run a competition for pupils
to design and make their own Gingerbread design. The entries are judged by 2 key stages
(KS2 & KS3) prizes are awarded for each year group.
Photos of previous entries –
- KS2 Food Technology Resistant Materials overview
- KS2 Cooking Ingredients
- KS3 Cooking Ingredients
- Kids think Design
- Junior Masterchef
Useful website links for further study of Design & Technology & insight to possible careers. | <urn:uuid:cbfcc0eb-0a24-45b1-b3d2-be5ebc13a3e9> | CC-MAIN-2019-26 | http://www.oakfieldacademy.co.uk/our-academy/curriculum/design-and-technology/ | s3://commoncrawl/crawl-data/CC-MAIN-2019-26/segments/1560627999040.56/warc/CC-MAIN-20190619184037-20190619210037-00412.warc.gz | en | 0.926124 | 297 | 2.625 | 3 |
Once ghost towns along the Puttlum – Mannar coastal line bordering Wilpattu National Park, these small towns and villages have now woken up form the 30 year slumber after the end of the LTTE terrorist occupation.
This stretch of sea was world famous for thousands of years for for producing finest pearls in the world but today a waste land with few fishing villages due to over exploitation.
Portuguese, Dutch and British all had considerable interest in the region and the best example is the massive bungalow of the British Governor, Sir Frederick North (1798-1805) built for the supervision of pearl fishery operations in the region.
Frederic North, who became Earl of Guilford later, arrived here in Sri Lanka (then Ceylon) in 1798 and visited Arippu a few times during the next few years as the pearl fishery was revived by the British. By this time, pearl fishery was revived in Kondachchi, a tiny village south of Silavathura. Kondachchi later became popular due to the establishment of government cashew plantations.
It could be probably during these visits that Frederic North had the idea of building a bungalow in these premises. The governor himself laid the foundation stone of the Doric building on March 18, 1802, and it took almost two years to complete the construction. There are official records such as letters and minutes to suggest that this was almost completed by early 1804. Governor North was probably able to stay in this bungalow for the first time during the fishery of 1804, as he was at Arippu from early February to early April.
Cordiner in his Description of Ceylon mentions that this building was planned by the Governor. He further provides a detailed account of this building with a drawing made by him. This drawing shows the Doric columns rising on the front and rear porticos, which are no more available. Cordiner provides the layout plan of the building, which could be traced even now. According to him, there were four small bed rooms on the ground floor and stairs on the center; two well proportioned were on the upper floor. Though the upper floor is no more, the ground floor plan is very similar to the existing plan of the ruin. The building had a terraced roof over the upper floor, from where someone could have seen the entire area around, providing an excellent place to watch the fishery activities on the sea. Even from the top of the existing ruin, we could observe the area around us. Cordiner states that this was ‘undoubtedly the most beautiful building in the island and almost the only one which is planned according to any order of architecture’.
Time showed the ravages of nature on this building. – Sea breeze, harsh conditions and negligence were the key reasons for this. By the early 1900s, the upper floor was gone and the rear portico to the seaside was a prey to sea erosion in 1980s. The remaining walls are being continuously corroded by the wind and washed by the rains. The damage continues as the northern section of the building (which seems intact in the photos) had also collapsed in 2004, when our friend Ajitha Madanayake visited the site and photographed the building. There is a serious uncertainty of the future of the ruins, which is a part of our heritage.
The Doric has been erroneously mentioned as the Dutch Fort by a few journalists and authors recently. Some of these have provided photographs of it. This mistaken identification seems to be due to few reasons. Though many knew about the existence of the Dutch Fort in Arippu, most of them were ignorant of the existence of a British mansion in the aarea. Also the lack of frequent visitors is the main cause of this ignorance. In some extreme cases the Doric was mentioned as a Portuguese mansion and the palace of a legendary queen!
The Tower at Arippu, (Arippu Tower, Doric Tower) lying few hundred meters way from the fort is a strange cerement tower with no apparent use. Top of this square tower tapers off in to a pyramid shape. Despite any visible signs, this tower is believed to be a sort of a light house which had a fire burning at the top guiding the pearl vessels to land.
- Forts and Fortifications of Sri Lanka
- Ancient Heritage Sites of Sri Lanka
- Other Places of Interest Within Close Proximity
Map of The Doric House and Doric Tower
The map above also shows other places of interest within a approximately 20 km radius of the current site. Click on any of the markers and the info box to take you to information of these sites.
Zoom out the map to see more surrounding locations using the mouse scroll wheel or map controls.
Driving Directions to Doric House and Doric Tower
Route from Colombo to Doric House and Doric Tower
Route from Anuradhapura Town to Doric House and Doric Tower
|Though : Puttlam – Eluwankulama|
Distance : 235 km
Travel time : 6+ hours
Driving directions : see on google map
|Though : Medawachchiya – Seelawathura|
Distance : 110 km
Travel time : 3 hours
Driving directions : see on google map | <urn:uuid:ee9f1208-7907-4f12-8a92-fa9c8d7f6f86> | CC-MAIN-2019-30 | https://amazinglanka.com/wp/arippu/ | s3://commoncrawl/crawl-data/CC-MAIN-2019-30/segments/1563195524568.14/warc/CC-MAIN-20190716135748-20190716161748-00358.warc.gz | en | 0.97512 | 1,100 | 2.875 | 3 |
Send the link below via email or IMCopy
Present to your audienceStart remote presentation
- Invited audience members will follow you as you navigate and present
- People invited to a presentation do not need a Prezi account
- This link expires 10 minutes after you close the presentation
- A maximum of 30 users can follow your presentation
- Learn more about this feature in our knowledge base article
Do you really want to delete this prezi?
Neither you, nor the coeditors you shared it with will be able to recover it again.
Make your likes visible on Facebook?
Connect your Facebook account to Prezi and let your likes appear on your timeline.
You can change this under Settings & Account at any time.
Transcript of My Passion
Bach was taught in childhood by both his father and brother and had a passion for music. He was a boy soprano but from 1703 he began playing instruments, including violin and organ, which he performed and taught through his life. Some of his best known work includes St. Matthew Passion and St. John Passion. (Johann Sebastian Bach 2012)
Mozart was taught at a very young age by his father and was composing music before he was five. By the age of 13 he had written a large variety of music pieces including concertos, sonatas and an opera in 1769. Some of his best know works include The Marriage of Figaro, Symphony No. 40 and The Magic Flute. (Wolfgang Amadeus Mozart 2012)
Born in Bonn, Germany he learned music from both his musician father and local musicians. He studied further in Vienna with well recognised composers of the era and established himself with a reputation as a piano virtuoso. Some of his best know works include Symphony No.5 and Symphony No.9. (Ludwig van Beethoven 2012) Musicians Song from the Classical Genre Sourced on the Classical Music Only channel via YouTube.com, a channel sharing classical music with over 85,000 subscribers. (Classical Music Only 2008)
Johann Sebastian Bach: 1685 – 1750 Wolfgang Amadeus Mozart: 1756 – 1791 Ludwig van Beethoven: 1770–1827 (Questia.com 2013) 'The Marriage of Figaro' Mozart (mi9, 2010) (svconline, 2009) (adwomen, 2011) | <urn:uuid:925b3b84-6201-41dd-933f-5bda59b07fba> | CC-MAIN-2017-34 | https://prezi.com/1m8ijfwtdqyz/my-passion/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886105187.53/warc/CC-MAIN-20170818213959-20170818233959-00008.warc.gz | en | 0.965579 | 497 | 2.6875 | 3 |
Posted: January 6th, 2017
.Which of the following is an advantage of corporations relative to partnerships and sole proprietorships?
Harder to transfer ownership.
Most common form of organization.
Reduced legal liability for investors.
64. The group of users of accounting information charged with achieving the goals of the business is its
110. Which of the following financial statements is concerned with the company at a point in time?
Retained Earnings statement.
Statement of cash flows.
112. An income statement
presents the revenues and expenses for a specific period of time.
summarizes the changes in retained earnings for a specific period of time.
reports the assets, liabilities, and stockholders’ equity at a specific date.
reports the changes in assets, liabilities, and stockholders’ equity over a period of time.
118. The most important information needed to determine if companies can pay their current obligations is the
net income for this year.
relationship between current assets and current liabilities.
projected net income for next year.
relationship between short-term and long-term liabilities.
124. A liquidity ratio measures the
short-term ability of a company to pay its maturing obligations and to meet unexpected needs for cash.
percentage of total financing provided by creditors.
income or operating success of a company over a period of time.
ability of a company to survive over a long period of time.
Place an order in 3 easy steps. Takes less than 5 mins. | <urn:uuid:ad81eaeb-0f29-4273-b4ac-6ad7ff366485> | CC-MAIN-2022-40 | https://www.thecollegepapers.com/liquidity-ratio-measures-short-term-ability-company-pay-maturing-obligations-meet-unexpected-needs-cash/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030335286.15/warc/CC-MAIN-20220928212030-20220929002030-00107.warc.gz | en | 0.922712 | 348 | 2.75 | 3 |
Git Log: How to Use It
The git log command displays a record of the commits in a Git repository. By default, the git log command displays a commit hash, the commit message, and other commit metadata. You can filter the output of git log using various options.
Version control systems have one core purpose—to record how your codebase evolves over time. This allows you to see how your projects have progressed. You can find out who has contributed to your project and identify what changes have been made to your code and when.
But how do you actually view the history your Git repository creates? That’s where the git log command can be helpful.
This tutorial will discuss, with examples, the basics of the git log command and how you can use it to inspect a Git repository.
The git log Command
The git log command shows a list of all the commits made to a repository. You can see the hash of each Git commit , the message associated with each commit, and more metadata. This command is useful for displaying the history of a repository.
Whereas the git status command is focused on the current working directory, git log allows you to see the history of your repository.
git log Command Example
Let’s walk through an example to illustrate how the git log command works. We have been working on a repository called “demo-repository”. Now we want to see a list of all the commits we have pushed to our repository. To do so, we can use this command:
The git log command returns a list of all commits made in a repository. Here’s an example of a single commit returned by this command:
commit 43433c674e3d6c86a889fad222dae179785893cf (HEAD -> master, origin/master, origin/HEAD) Author: James Gallagher <email@example.com> Date: Tue Apr 7 13:09:58 2020 +0100 Update index.html
Let’s discuss this output step-by-step. Each entry returned by the git log command contains:
- The Secure Hash Algorithm (SHA) hash for the commit, which is used to uniquely identify each commit in a repository. In our above example, this was “43433c674e3d6c86a889fad222dae179785893cf”.
- The author of the commit. In our above example, this was James Gallagher. The email of the author is also specified.
- The date the commit was pushed. In our above example, this was Tuesday, April 7th.
- The message associated with the commit. The commit message returned above was “Update index.html”.
All this data gives us useful information about the commits in our repository.
Filtering the Output of git log
By default, git log returns a list of all the commits made to a repository using this structure. As you can imagine, it can quickly become difficult to read your git log statements if there are many commits to read.
git log comes with a few flags you can use to filter your logs. These are:
Filter by Most Recent
If you want to return a specific number of commits, you can do so using the -n flag. Here’s an example of this flag in action:
git log -n 3
This command returns a list of the three most recent commits made to a repository.
"Career Karma entered my life when I needed it most and quickly helped me match with a bootcamp. Two months after graduating, I found my dream job that aligned with my values and goals in life!"
Venus, Software Engineer at Rockbot
Filter by Author or Committer
You can also filter the commits returned by git log by the person who wrote or committed the changes. Suppose we want to see a list of commits pushed by “John Smith.” We can do so using these commands:
git log --author="John Smith" git log --committer="John smith"
The author flag limits the results to commits whose changes were made by John Smith. The committer flag limits the results to the commits that were actually committed by that individual.
You will find that, in most cases, the author and committer are the same individual. In larger projects, the author of a commit may not necessarily be the one who pushes it to a repository. This is why these two flags exist.
Filter by Date
In addition, you can filter the results of git log by date. To do so, you can use the—before and—after flags. These flags both accept a wide range of date formats, but the two most commonly used are relative references and full dates.
Suppose we want to retrieve a list of commits from after 2019-3-2. We could do so using this command:
git log --after="2019-3-2"
We have specified a date to filter our commits. Similarly, if we want to retrieve a list of commits from before yesterday, we could do so using this command:
git log --before="yesterday"
We have specified a relative value (“yesterday”).
Now, suppose we want to retrieve a list of commits that were published after 2019-3-2 and before 2019-3-19. We could do so using this command:
git log --after="2019-3-2" --before="2019-3-19"
Filter by File
When you’re using the git log command, you may only want to see a list of commits that have affected a particular file. To do so, you can specify the file whose changes you want to see.
Suppose we want to see the changes made to the “main.py” file in our code. We could do so using the following command:
git log -- main.py
The — statement instructs the git log command that the arguments we have specified are file paths and not the names of branches.
In our command, we only specified one file which we wanted to use to filter the response of the git log command. But, if you want, you can specify multiple files.
Filter by Content
You can also search for commits that have removed or added a particular line of code.
Suppose we want to search for all commits that have added the term “# Introduction” to our code. We could do so using this command:
git log -S"# Introduction"
The -S flag is used to specify what commit change we want to look for in our list of commits. Notice that there is no space or equals sign between the -S flag. Also, the quotation marks that we used to specify the content of the commit for which we are looking.
Filter by Range
You can use the since and until parameters to pass a range of commits to git log. The syntax for these parameters is as follows:
git log <since>..<until>
Suppose we want to retrieve a list of commits made since the commit b72beb5 was pushed, and until the commit b53b22d was pushed. We could do so using this command:
git log b72beb5..b53b22d
This command returns a list of all commits between the b72beb5 and b53b22d commits.
Filter by Message
The –grep flag allows you to filter the commits returned by git log by the commit message associated with a particular commit.
For instance, suppose we want to return a list of all commits whose name starts with “feat:”. We could do so using this code:
git log --grep="feat:"
This command returns a list of all commits whose messages start with “feat:”.
Formatting the Output of git log
In the last section, we worked with a full output from the git log command. This output contained the SHA for our commit, the commit author, the date the commit was pushed, and the commit message.
While all this information is useful, there are often occasions where you only need to retrieve specific data about a commit. Luckily, the git log command comes with a few flags you can use to format the output of the command.
Return Brief Logs
By default, the git log statement returns a full log entry for each commit made to a repository. You can retrieve a list of commit IDs and their associated commit messages using the –oneline flag.
Here’s the syntax for the –oneline flag:
git log --oneline
When run in our repository from earlier, this command returns:
43433c6 (HEAD -> master, origin/master, origin/HEAD) Update index.html a7d8dc2 docs: Update README.md b53b22d feat: Update website 3b16026 feat: Launch new homepage b72beb5 first commit
We can see the commit IDs and the first line of the messages associated with a commit. This is easier to read than all of the metadata associated with a commit that the git log command would otherwise return.
Each entry appears on a single line. This git log one line technique is handy because it shows commits without displaying too much information.
Decorating the Output
The –decorate flag allows you to see all the references (i.e. branches and tags) that point to a particular commit. Here’s the syntax for this flag:
git log --decorate
This command returns:
43433c6 (HEAD -> master, origin/master, origin/HEAD) Update index.html a7d8dc2 docs: Update README.md b53b22d feat: Update website 3b16026 (tag: v1) feat: Launch new homepage b72beb5 first commit
The fourth commit in our list now has the name of its tag specified. This is because the –decorate flag reveals the references associated with each commit in our commit history.
Returning a Diff
The –stat flag allows you to display the number of lines of code added to and deleted from a repository in each commit. Here’s an example of the git log –stat command in action:
Author: James Gallagher <firstname.lastname@example.org> Date: Mon Apr 6 09:11:46 2020 +0100 feat: Update website index.html | 1 + index.js | 0 2 files changed, 1 insertion(+)
The plus signs (+) indicate insertions, and, if there were any, the minus signs (-) would indicate deletions. This data allows you to learn more about the overall changes made to a repository.
If you want to see the exact changes made to a repository, you can use the -p flag. This returns a more comprehensive diff showing the changes made in a commit.
Here is one entry returned from the git log -p command, when run on our example repository:
Author: James Gallagher <email@example.com> Date: Tue Apr 7 13:09:58 2020 +0100 Update index.html diff --git a/index.html b/index.html index f45673f..2d2701d 100644 --- a/index.html +++ b/index.html @@ -1,2 +1,3 @@ -This is a file. -Changes have been made. +<body> + <p>This is a website.</p> +</body>
This output shows us both a description of the commit, and a detailed breakdown of each change made in the commit. We can see when people have added or removed content from files in our repository.
While this data is useful, it can quickly become difficult to read this output if there are many commits to display. You may want to use one or more of the other flags we have discussed in this article. This will help ensure the information returned by this commit is both comprehensive and easy to read.
You can read more about Git diffs in our git diff command guide .
The git shortlog Command
The git shortlog command provides a summary of a git log. The output of the git shortlog command is grouped by author which means you can easily see who made what changes to a repository.
Let’s run the git shortlog command on our repository from earlier:
Our command returns:
James Gallagher (5): first commit feat: Launch new homepage feat: Update website docs: Update README.md Update index.html
James is the only person who has contributed to this repository, and he has made five commits. But, if there were other contributors, their contributions would be listed here, alongside the total number of commits they have pushed to the repository.
The git log command shows you what changes were made to a repository, by whom, and when. You can filter the output of git log to show only the information you need to know.
The git log command comes with two types of flags. Some flags help you format the output of the log. Other flags that can help you filter the commits returned by the command.
This tutorial discussed, with reference to examples, how to use git log and the most common flags used with the command. The git log command is an important tool in your arsenal when working with Git. Once you know how to use this command effectively, you’ll be a master at inspecting Git repositories!
To learn more about Git, read our How to Learn Git guide . | <urn:uuid:14433f0a-7fce-4657-8280-caa1d9237937> | CC-MAIN-2022-27 | https://careerkarma.com/blog/git-log/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656103619185.32/warc/CC-MAIN-20220628233925-20220629023925-00633.warc.gz | en | 0.88133 | 2,860 | 2.6875 | 3 |
By Caleb T. Maupin
Published Jan 31, 2008 8:23 PM
On Jan. 30, 1968, Vietnam was divided and in the midst of a war for liberation. The northern part of Vietnam was under the control of a socialist government of workers and peasants. The southern part of Vietnam remained under the control of a regime bought and sold to U.S. bankers and capitalists. Peasants in southern Vietnam remained landless and hungry, and slums and poverty filled Vietnam’s large urban centers. But all throughout South Vietnam, the spirit of resistance was flowing.
In North Vietnam, the soldiers wore armbands showing their solidarity with their southern country folk. The armbands read “Born in the North, Died in the South.”
The Buddhist holiday of Tet marks the Lunar New Year, and was traditionally celebrated in Vietnam in late January and early February. In years previous to 1968, the National Liberation Front of Vietnam had signed peace treaties with the United States to mark the holiday.
The NLF planned an attack on U.S. forces for the Tet holiday, so their people could celebrate the holiday before the vicious bombings that would come from the U.S. in retaliation. They knew the U.S. would respond with brutality.
Already the U.S. was viciously bombing Vietnam. By the war’s end, more bombs would fall on the Vietnamese people than had been dropped in all of the Second World War. When directly bombing North Vietnamese cities and villages failed to weaken the Vietnamese resistance, the U.S. began bombing dams, causing massive flooding and a famine in Vietnam’s agriculture-based countryside.
Some estimate that as many as 4 million Vietnamese people died as a result of the bombing campaigns, which Gen. Curtis Lemay proclaimed were done to “bomb them back into the stone age.” Later, in 1972, the U.S. would drop 800,000 tons of explosives on Southeast Asia in one year alone.
The Tet Offensive struck 36 of the 43 provincial capitals of Vietnam. In each city, the attacks were similar. The guerrilla soldiers of the NLF were able to sneak into villages under the cover of the Tet celebrations. In some cities they were even able to test explosive weapons under the cover of the holiday fireworks.
Once inside the cities, with supporters residing within them acting as guides, they would wage mortar attacks on key sites and do their best to get control.
The attack on Saigon
Saigon, now called Ho Chi Minh City, was the capital city of the puppet government of Vietnam. It was also a city in which many Vietnamese people lived in poverty and longed to resist. The city, which had not been rocked in nearly 20 years, was suddenly the site of a massive insurrection.
NLF guerillas infiltrated and assaulted the U.S. occupiers right within their own embassy, which had been built up with massive security following a bombing. The diplomats were forced to barricade themselves inside inner rooms as the fighting went on, in the equivalent of modern day Iraq’s “green zone.”
After the fighting had subsided, U.S. troops ordered the slaughter of all people within the embassy who were “not American.” This included many Vietnamese people who had been hired to work at the embassy and had had no part in the rebellion.
The National Radio Station, which the U.S. used to broadcast pro-imperialist propaganda throughout Vietnam, was also invaded. Guerrillas were able to liberate much of the station’s $1 million worth of equipment, and destroy what they couldn’t take with them.
During the Tet Offensive, a Saigon prison was busted into by the National Liberation Front. In South Vietnam 65,000 people were in prison, most of them political prisoners. These prisons were known for beatings and torture at the hand of the puppet forces of the South Vietnamese government. Five thousand prisoners were set free from the clutches of the U.S. backed regime and joined the insurrection.
A horrific scene unfolded in the streets of Saigon during the rebellion. A leader of the police forces of South Vietnam carried out an on-the-spot execution of an NLF supporter. Police officers walked the man over to Police Chief Ngoc Loan, who promptly put a gun to his head and pulled the trigger in front of the lenses of Western television reporters. Soon the picture of this killing was on the front pages of newspapers and headlined on the evening news in the Western world. This helped turn many against the war in Vietnam and strengthened the anti-war movement.
“Imperialism and all reactionaries are paper tigers,” Mao Zedong wrote, and he was proved correct by the Tet Offensive and the eventual outcome of the Vietnam War. All of the countless thousands of U.S. CIA agents and spies in Vietnam could not predict the Tet Offensive. The Vietnamese were able to score massive blows against the U.S. occupiers. U.S. forces clearly had underestimated the strength of the Vietnamese people, who desperately wanted to be free from the clutches of U.S. imperialism and capitalism.
Eventually, the U.S. was forced to withdraw from Vietnam, as resistance flowed throughout the U.S. military itself and the streets of the U.S. were filled with militant youth. Fifty-eight thousand U.S. troops were sent to their death in Vietnam by the rulers of the U.S. Many more came home to spend the rest of their lives disabled or homeless.
It’s been 40 years since the Tet Offensive and since Vietnam has liberated itself from U.S. imperialism and established a socialist government that has redistributed land to the peasants, raised the life expectancy by 14.7 years and cut infant mortality in half.
All of this would not have been possible without the heroism of countless millions of Vietnamese people who fought and died for the liberation of their country—especially those who surged forth, 40 years ago, in the Tet Offensive.
Articles copyright 1995-2007 Workers World. Verbatim copying and distribution of this entire article is permitted in any medium without royalty provided this notice is preserved.
Workers World, 55 W. 17 St., NY, NY 10011
Support independent news http://www.workers.org/orders/donate.php | <urn:uuid:92aabcc1-d380-462c-a745-b03455dd4027> | CC-MAIN-2017-22 | http://calebmaupin.blogspot.com/2008/01/40-years-later-remembering-tet.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463608684.93/warc/CC-MAIN-20170526203511-20170526223511-00026.warc.gz | en | 0.97763 | 1,310 | 2.859375 | 3 |
The Southern Masked-Weaver or African Masked-weaver (Ploceus velatus) is a resident breeding bird species common throughout southern Africa.
This weaver is very widespread and found in a wide range of habitats, including shrubland, savanna, grassland, open woodland, inland wetlands and semi-desert areas. It also occurs in suburban gardens and parks.
The Southern Masked-Weaver is 11-14.5 cm long with a short, strong, conical bill and pinkish brown legs. The adult male in breeding plumage has a black face, throat and beak, red eye, bright yellow head and underparts, and a plain yellowish-green back,
The female has a pinkish-brown bill, brown or red-brown eye and is dull greenish-yellow, streaked darker on the upper back. The throat is yellowish, fading to off-white on the belly. The non-breeding male resembles the female but retains the red eye. The juvenile of this species is like the female.
The call is a harsh swizzling, similar to other weavers. It also utters a sharp chuk alarm note.
The Southern Masked-Weaver nests in colonies, mainly from September to January. Males have several female partners, and build a succession of nests, typically 25 each season. The nests, like those of other weavers, are woven from reed, palm or grass. A female will line a selected nest with soft grass and feathers. The nest is built in a tree, often over water, but sometimes in suburbia. his weaver also nests in reeds.
The Southern Masked-Weaver is usually seen singly or in small groups. It may also form larger flocks, alone or with other seed eating species. It eats insects, seeds and nectar, and will come to feeding tables. | <urn:uuid:e8c7ec5b-8609-43ba-8292-ac7a2c21f732> | CC-MAIN-2017-17 | https://www.kiwifoto.com/galleries/birds/african_masked_weaver/index.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917120187.95/warc/CC-MAIN-20170423031200-00556-ip-10-145-167-34.ec2.internal.warc.gz | en | 0.955186 | 393 | 3.21875 | 3 |
eso0923 — Science Release
Milky Way's super-efficient particle accelerators caught in the act
25 June 2009
Thanks to a unique "ballistic study" that combines data from ESO's Very Large Telescope and NASA's Chandra X-ray Observatory, astronomers have now solved a long-standing mystery of the Milky Way’s particle accelerators. They show in a paper published today on Science Express that cosmic rays from our galaxy are very efficiently accelerated in the remnants of exploded stars.
During the Apollo flights astronauts reported seeing odd flashes of light, visible even with their eyes closed. We have since learnt that the cause was cosmic rays — extremely energetic particles from outside the Solar System arriving at the Earth, and constantly bombarding its atmosphere. Once they reach Earth, they still have sufficient energy to cause glitches in electronic components.
Galactic cosmic rays come from sources inside our home galaxy, the Milky Way, and consist mostly of protons moving at close to the speed of light, the “ultimate speed limit” in the Universe. These protons have been accelerated to energies exceeding by far the energies that even CERN’s Large Hadron Collider will be able to achieve.
“It has long been thought that the super-accelerators that produce these cosmic rays in the Milky Way are the expanding envelopes created by exploded stars, but our observations reveal the smoking gun that proves it”, says Eveline Helder from the Astronomical Institute Utrecht of Utrecht University in the Netherlands, the first author of the new study.
“You could even say that we have now confirmed the calibre of the gun used to accelerate cosmic rays to their tremendous energies”, adds collaborator Jacco Vink, also from the Astronomical Institute Utrecht.
For the first time Helder, Vink and colleagues have come up with a measurement that solves the long-standing astronomical quandary of whether or not stellar explosions produce enough accelerated particles to explain the number of cosmic rays that hit the Earth’s atmosphere. The team’s study indicates that they indeed do and it directly tells us how much energy is removed from the shocked gas in the stellar explosion and used to accelerate particles.
“When a star explodes in what we call a supernova a large part of the explosion energy is used for accelerating some particles up to extremely high energies”, says Helder. “The energy that is used for particle acceleration is at the expense of heating the gas, which is therefore much colder than theory predicts”.
The researchers looked at the remnant of a star that exploded in AD 185, as recorded by Chinese astronomers. The remnant, called RCW 86, is located about 8200 light-years away towards the constellation of Circinus (the Drawing Compass). It is probably the oldest record of the explosion of a star.
Using ESO’s Very Large Telescope, the team measured the temperature of the gas right behind the shock wave created by the stellar explosion. They measured the speed of the shock wave as well, using images taken with NASA’s X-ray Observatory Chandra three years apart. They found it to be moving at between 10 and 30 million km/h, between 1 and 3 percent the speed of light.
The temperature of the gas turned out to be 30 million degrees Celsius. This is quite hot compared to everyday standards, but much lower than expected, given the measured shock wave’s velocity. This should have heated the gas up to at least half a billion degrees.
“The missing energy is what drives the cosmic rays”, concludes Vink.
This research was presented in a paper to appear in Science: Measuring the cosmic ray acceleration efficiency of a supernova remnant, by E. A. Helder et al.
The team is composed of E.A. Helder, J. Vink and F. Verbunt (Astronomical Institute Utrecht, Utrecht University, The Netherlands), C.G. Bassa and J.A.M. Bleeker (SRON, Netherlands Institute for Space Research, The Netherlands), A. Bamba (ISAS/JAXA Department of High Energy Astrophysics, Kanagawa, Japan), S. Funk (Kavli Institute for Particle Astrophysics and Cosmology, Stanford, USA), P. Ghavamian (Space Telescope Science Institute, Baltimore, USA), K. J. van der Heyden (University of Cape Town, South Africa), and R. Yamazaki (Department of Physical Science, Hiroshima University, Japan). C.G. Bassa is also affiliated with the Radboud University Nijmegen, the Netherlands.
ESO, the European Southern Observatory, is the foremost intergovernmental astronomy organisation in Europe and the world’s most productive astronomical observatory. It is supported by 14 countries: Austria, Belgium, the Czech Republic, Denmark, France, Finland, Germany, Italy, the Netherlands, Portugal, Spain, Sweden, Switzerland and the United Kingdom. ESO carries out an ambitious programme focused on the design, construction and operation of powerful ground-based observing facilities enabling astronomers to make important scientific discoveries. ESO also plays a leading role in promoting and organising cooperation in astronomical research. ESO operates three unique world-class observing sites in Chile: La Silla, Paranal and Chajnantor. At Paranal, ESO operates the Very Large Telescope, the world’s most advanced visible-light astronomical observatory. ESO is the European partner of a revolutionary astronomical telescope ALMA, the largest astronomical project in existence. ESO is currently planning a 42-metre European Extremely Large optical/near-infrared Telescope, the E-ELT, which will become “the world’s biggest eye on the sky”.
- To request the Science paper: http://www.sciencemag.org/help/about/contact_info.dtl
Astronomical Institute Utrecht
Tel: +31 30 253 5221
Astronomical Institute Utrecht
Tel: +31 30 253 2513
Kavli Institute for Particle Astrophysics and Cosmology
Tel: +1 650 926 8979 | <urn:uuid:b346768a-6fed-49b8-aa85-85d2e64ca357> | CC-MAIN-2016-07 | http://ohainaut@eso.org/public/news/eso0923/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-07/segments/1454701152959.66/warc/CC-MAIN-20160205193912-00047-ip-10-236-182-209.ec2.internal.warc.gz | en | 0.884735 | 1,289 | 3.046875 | 3 |
In the depths of the Australian winter, small fires burn through the Little Sandy Desert. These fires are special, lit and controlled by the Martu, an aboriginal group in the Western part of the country.
The Martu burn the grass and brush over small areas of less than 10 acres to look for holes where sand monitor lizards burrow. These lizards are a much appreciated local delicacy and an important source of protein.
This hunting tradition has been practiced for more than a century, and studies show that these fires have ecological benefits. It turns out, hunting fires can actually help boost kangaroo populations by increasing ecosystem diversity and creating a landscape with plants at varying stages of growth.Kangaroos feed primarily on young shoots which sprout after a fire, but use shrubs to hide from predators like dingoes. By burning small patches, the Martu create a vegetation mosaic that provides both cover and food for the kangaroos.
“It’s critical to have fire, but also to not have too much fire,” Dr. Sam Fuhlendorf, professor of fire and ecology at Oklahoma State University, told TreeHugger. “The neat thing about Australia is that the indigenous people still remember a lot about how they used fire historically. If they burn something every year, they get this shifting mosaic”
The historical basis of the fire burning practice led Dr. Brian Codding at the University of Utah to study how kangaroos and aboriginal peoples may have co-evolved. His study showed that kangaroo populations tend to be larger in areas where the Martu practice their fire regimes. Thus, the Martu play an important role in conservation by maintaining a varied environment in which they live and hunt that benefits kangaroos and other wildlife.
“In some circumstances, humans may modify their environments in ways that benefit endemic species,” Codding told TreeHugger. “People are not actively managing these populations, but because species in this environment are adapted to human disturbance, endemic species do better as a result of human interaction. The Martu are well aware of this.”
Kangaroos are not the only species that benefit from fire. Studies have shown that herbivores like the North American bison are often drawn to burned areas for younger shoots. Researchers like Fuhlendorf, who has been studying fire ecology for over 15 years, suggest that we may want to consider re-introducing fire as a way of boosting land-cover diversity, though he adds that doing so would require further studies on which habitats should be burned and how frequently.
But using fire is considered a double edged sword among ecologists. In many instances, fire is beneficial for maintaining ecosystem diversity, and in most cases all land will burn eventually if left to nature. Periodic fires are important for maintaining many ecosystems, especially grasslands. However, there are concerns about the damage that burning practices can have on other species.
“Generally, large scale burning is increasingly seen as an ecological disaster because it opens up the ground cover and greatly exposes small and medium vertebrates to predation by dingoes, foxes and feral cats,” Dr. Terry Dawson, who studies environmental physiology and arid zone mammals and birds, told TreeHugger.
There are indications that other animals like sand monitor lizards, bushtail possums and hare-wallabies also benefit from Martu fires, so there are clear benefits to periodic burning.
“Like all things in ecology, there are tradeoffs – winners and losers,” said Dr. David Bowman, professor of environmental change biology at the University of Tasmania. “There’s an enormous debate in Australia about the frequency and scale of burning the savannah environment, and there are potential carbon implications, but the fact of the matter is that, again, it’s a tradeoff. They’re naturally going to burn, so planned burning can reduce the [negative] impact.” | <urn:uuid:b06afb5b-3256-4de6-a18d-15198631b992> | CC-MAIN-2018-43 | https://www.treehugger.com/natural-sciences/aboriginal-hunting-practice-helps-kangaroos.html | s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583512014.61/warc/CC-MAIN-20181018194005-20181018215505-00473.warc.gz | en | 0.949049 | 828 | 3.90625 | 4 |
“We could all be perpetrators,” says Irish writer and photographer Nic Dunlop (Facebook profile), who has made reporting trips to Myanmar (former Burma) since the early 1990s. “It’s not just the urge to destroy that motivates people to do this. It’s about conditioning, context, and the [innate] human ability to carry out evil acts.” (See My North Korean film classes in humanity and creativity)
But people can also change their actions and refuse to participate. That’s the message Burma Soldier (Dunlop’s recent documentary) aims to bring to audiences inside Myanmar, where the military junta prohibits access to any books, movies, or music that might undermine their authority.
Brendan Brady, who reports on diplomacy, human rights, religion and culture in Asia, discusses the film for The Newsweek. In Burma Soldier, Dunlop and his fellow directors examine the question of what drives an otherwise ordinary person to join up with a brutal institution—and what gives him the courage to risk his life and change course.
Burma Soldier follows the life of Myo Myint, who signed up with the Army (known as the Tatmadaw and recognized as the most brutal and repressive army in Southeast Asia) to serve in Kachin and Karen states as a teenager. Born into a society where privilege belongs almost exclusively to the Army brass and their loyal allies, Myo Myint saw a military career as the only way to escape a future of grinding poverty. Plus, as a boy he had seen his neighbors in Rangoon (now Yangon) greet soldiers with seeming admiration. He was still too young, he says, to understand the difference between true respect and thinly veiled fear.
The Burmese haven’t always been so wary of their military. Nationalist fighters who ousted the British colonial administrators after World War II—and who went on to establish the modern Army—became cultural heroes. But before long, the Army had become embroiled in battles with various ethnic minority groups who thought that their right to self-governance naturally followed the end of British rule.
The conflict eroded the new civilian government’s control, giving a clique of hardline generals an opportunity to justify a coup. Repressive law and order became central to the junta’s rule, and generals used the ever-growing military apparatus to silence dissenting voices.
A pivotal shift in the Burmese majority’s view of the Army came in 1988, when a popular nonviolent uprising was quelled with gunfire.
The generals told the soldiers “the ethnic armies and the democracy protestors are enemies of the state [and] killing them is your duty,” Myo Myint told Newsweek by phone from Fort Wayne, Ind., where he sought asylum in 2008. “Some soldiers, in private, oppose the actions they are told to do. But they don’t dare say this.”
Myo Myint’s time in the Army ended abruptly, after mortar fire left him near dead and missing an arm and a leg. To battle depression during his convalescence, he immersed himself in banned texts on religion, history, and politics. His studies convinced him that he needed to speak out about the abuses of his former commanders. In 1988, as nationwide protests broke out against the dictatorship, Myo Myint delivered an impromptu speech that rallied other soldiers to join demonstrators in the streets. As punishment, authorities threw him in jail for 15 years. Upon his release, Myo Myint fled to a refugee camp in Thailand, where he met Dunlop and sparked the Burma Soldier project.
To thwart the ban on opposition media in Myanmar, the producers of Burma Soldier have made a Burmese-language version of the film and encouraged its copyright theft inside Burma. Within one week, since a Burmese language version of the film was made available on the Vimeo site on 24 March 2011, online viewings have jumped from a handful to a daily total of several thousands.
Dunlop describes the effort to reach a wide audience in Burma with the film as ‘reverse pirating’—a process of smuggling a film into Myanmar instead of out of the country. The most famous example of a film made with material smuggled out of the country was the award-winning documentary Burma VJ, the story of the 2007 monk-led ‘Saffron Revolution’, which was mostly the work of so-called amateur ‘video-journalists’ working inside Myanmar.
Nonagenarian U Tin Yu is not really a video-journalist but he is a no-less important figure in the Myanmar’s movie industry. Mr. Yu can be said to have been born along with it, in fact. The first feature film produced in Burma was Myitta Hnint Thura (Love and Liquor) and premiered on October 13, 1920. U Tin Yu was born three days later. He shares:
“My uncles directed and acted in Myitta Hnint Thura. Ours is a movie-making family,” he said, adding that the pioneering Myanmar Aswe Film Studio, founded in 1923, was owned by his grandfather U Ba Nyunt and grandmother Daw Nyein Shin.
“At one point my uncles planned to move to England, but later gave up the idea and started producing one movie after another. Then Myanmar Aswe Film Studio was established, which later became A1 Film Company [in 1933].”
U Tin Yu explained that his mother was Daw Mya Khin, the eldest daughter in the family that founded A1 Film Company [in Mayangone township, Yangon]. His uncles U Tin Maung U Nyi Pu and U Tin Nwe were actors and directors, and his auntie Daw Khin Khin worked as a cinematographer.
He has directed more than 60 movies, and in 1960 his film Myitta Shwe Yi (Gold Water of Love) won a Myanmar Academy Award for cinematography.
He recollects, “In historical movies, male actors had to wear long hair. I don’t like wigs, so my actors, Nyunt Maung and Aye Kyu, were not allowed to accept other movie roles while acting in mine, to let their hair grow long enough. Directors at the time used toy swords made of wood and painted silver, but I used iron swords. I also used race horses instead of cart horses. And while foreign films were shot at 24 frames per second, Burmese films were shot at 16 frames, making the movements jerky. I tried to shoot at 18 frames per second to smooth the movements.”
Over the years, U Tin Yu has taught classes sponsored by the Myanmar Motion Picture Organisation. He helped train technical staff for Myawady Television (a free TV channel in Myanmar) and has produced short films for the station.
Not all of Mr. Yu’s colleagues have freedom to become as prolific in their creative expressions. A documentary This Prison Where I Live tells the story of Zarganar, Myanmar’s top comedian, director and movie star, who was sent to languish in jail under a 59-year sentence. He was freed on 11 October 2011 in a mass amnesty of political prisoners.
Due to heightened competition from foreign films and other entertainment media as well as escalating costs of production, the number of feature-length Burmese films has gone from nearly 100 films per year in the 1970s to barely more than ten today. Another issue plaguing the Burmese cinema is a steep decline in the number of theaters in which to screen the films. According to a December 2011 survey, the number of theaters nationwide had declined to just 71 from their peak of 244. The survey also found that most were several-decade-old aging theaters, and that only six “mini-theaters” had been built in 2009–2011. Moreover, the vast majority of the theaters were located in Yangon and Mandalay alone.
One example of the less-lucky movie theaters is The Yuzana Cinema in Pyin Oo Lwin, Mandalay Division. It was built in 1956, or ’57 – one of numerous movie theaters to go up during the democratic interlude. It’s been closed since the turn of the 21st century.
Copyright in Myanmar Since 1914 by U Khin Maung Wi | <urn:uuid:8d06430e-b5bb-45d6-b91c-0fa64ccab24e> | CC-MAIN-2017-22 | https://steppesinsync.wordpress.com/2012/02/26/myanmar-its-soldiers-pirates-posters-and-theaters/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463608617.6/warc/CC-MAIN-20170525214603-20170525234603-00586.warc.gz | en | 0.973942 | 1,753 | 2.515625 | 3 |
Based on the analysis of grain-size constitution and distribution curves of the XYC core in the downstream of the Cao'e River—the central section of the Ningshao plain, we arrived at the following conclusions: (1) According to the grain-size constitution, the sediments of the XYC Core can be divided into four lithologies: silty sand, sandy silt, silt, and clayey silt. They distribute along the core alternately. The core is divided into 9 layers and they compose multiple grain-size combinations. The 9 layers are marked as layer 1 to layer 9 from the bottom to the top. Among them, layer 1 and layer 4 are silty sand, and the percentage of clay is 10%~15%, which is poorly sorted and the dynamics is complicated. Layer 3 and layer 5 are sandy silt, the percentage of silt is no more than 70%, and clay is more than 20%. The percentage of clay is low. Layer 2, layer 7, and layer 9 are silt, the percentage of silt is more than 70%, and clay and sand are less than 20%. Layer 6 and layer 8 are clayey silt, the percentage of silt is more than 70%, and clay is more than 20%. The percentage of sand is very low. (2) According to the C-M graph of the max and the mean values and the analysis of its variation, there were four types of deposits from the bottom to the top: fluvial, tidal flat, shallow marine, and lakes and marshes. For layer 1 and layer 2, the hydrology was high energy and unstable, which indicates a fluvial environment; for layer 3 to layer 7, the max hydrology weakened, but the mean hydrology was strong and the range was still wide, and the hydrology was similar to the SYTT tidal flat samples. It referred to a tidal flat environment; for layer 8 and layer 9, the hydrology was weak and stable, which indicates still water environment. Based on the grain-size and biology information, it can be concluded that the under part of layer 8 belonged to shallow marine environment, but the upper part and layer 9 belonged to lakes and marshes environment. (3) Vertical variation of grain-size indicates that clay increased from the bottom to the top with fluctuation, while sand declined. The average grain diameter is decreasing and the sorting coefficient is higher. The sediments change from the bottom to the top reveals that the XYC Core and its adjacent area experienced sea level rise, and then water level decreased during 9690~5131 cal.a BP. The results of the study are helpful for identifying the paleoenvironmental evolution characteristics of the Qiantang River Basin. | <urn:uuid:d1cc8cf2-8066-4e3d-8a55-47bb4e22e7ab> | CC-MAIN-2023-06 | http://www.progressingeography.com/EN/volumn/volumn_3584.shtml | s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764495001.99/warc/CC-MAIN-20230127164242-20230127194242-00522.warc.gz | en | 0.942687 | 561 | 3.0625 | 3 |
A biology teacher could...
|Encourage students to explore how the ecosystem of an aquarium is similar to the ocean's ecosystem.||Introduce students to microscopes and how they're used to see tiny plant and animal structures.|
|Explain to students what DNA is and how genetic mutations can lead to common diseases.||Plan a dissection lesson that will give students a firsthand understanding of anatomy and how their bodies work.|
Key Facts & Information
|Overview||Life is all around us, in beauty and abundance, and the people who introduce students to how life forms live and interact are biology teachers. Their work helps develop the next generation of doctors, nurses, life scientists, and engineers. Their enthusiasm and appreciation for all life helps students understand their own bodies, and how life forms are all connected to each other and to their environments.|
|Key Requirements||Enthusiasm; extroversion; a positive, patient personality; a love for working with children; and outstanding communication skills|
|Minimum Degree||Bachelor's degree|
|Subjects to Study in High School||Biology, chemistry, physics, algebra, geometry, pre-calculus; if available, additional biology related science classes like biotechnology, marine biology, environmental sciences, physiology|
|Projected Job Growth (2014-2024)||More Slowly than Average (3% to 6%) In Demand!|
Training, Other Qualifications
Biology teachers typically have a bachelor's degree in Biology, with an education minor or emphasis. Public school teachers also must earn a state-level teaching license.
Education and Training
High school biology teachers typically have a 4-year Bachelor of Science degree in Biology, with an education emphasis or minor. Courses in a biology program, with an education emphasis, might include math, chemistry, teaching methods and physics. Public high school biology teachers must be licensed by the state in which they teach. Private schools might not require licensure.
High school biology teachers must be able to keep their students on task and engaged. They need to employ various teaching methods to meet students' individual needs. Being bilingual might give a high school biology teacher an advantage in the job market.
Nature of the Work
High school biology teachers instruct secondary school students in the fundamentals of biology at both private and public schools. They develop engaging curricula, including lab experiments and other scientific investigations; present lessons; and evaluate student performance. High school biology teachers also set and enforce guidelines for classroom behavior and arrange parent-teacher conferences when needed. In addition to teaching, high school biology teachers can work as field biologists or curriculum specialists.
Many teachers work more than 40 hours a week, including school duties performed outside the classroom. Most teachers work the traditional 10-month school year, with a 2-month vacation during the summer. During the vacation break, those on the 10-month schedule might teach in summer sessions, take other jobs, travel, or pursue personal interests. Many enroll in college courses or workshops to continue their education. Teachers in districts with a year-round schedule typically work 8 weeks, are on vacation for 1 week, and have a 5-week midwinter break.
Seeing students develop new skills and gain an appreciation of knowledge and learning can be very rewarding. However, teaching can be frustrating when one is dealing with unmotivated or disrespectful students. Occasionally, teachers must cope with unruly behavior and violence in schools. Teachers might experience stress in dealing with large classes, heavy workloads, or old schools that are run down and lack modern amenities. Accountability standards also might increase stress levels, with teachers expected to produce students who are able to exhibit a satisfactory performance on standardized tests in core subjects. Many teachers, particularly in public schools, also are frustrated by the lack of control they have over what they are required to teach.
Teachers are sometimes isolated from their colleagues because they work alone in a classroom of students. However, some schools allow teachers to work in teams and with mentors, to enhance their professional development.
Teachers in private schools generally enjoy smaller class sizes and more control over establishing the curriculum, as well as setting standards for performance and discipline. Their students also tend to be more motivated, since private schools can be selective in their admissions processes.
Most states have tenure laws that prevent public school teachers from being fired without just cause and due process. Teachers may obtain tenure after they have satisfactorily completed a probationary period of teaching, normally 3 years. Tenure does not absolutely guarantee a job, but it does provide some security.
On the Job
- Establish and enforce rules for behavior and procedures for maintaining order among students.
- Instruct through lectures, discussions, and demonstrations in one or more subjects, such as English, mathematics, or social studies.
- Establish clear objectives for all lessons, units, and projects and communicate those objectives to students.
- Prepare, administer, and grade tests and assignments to evaluate students' progress.
- Prepare materials and classrooms for class activities.
- Adapt teaching methods and instructional materials to meet students' varying needs and interests.
- Maintain accurate and complete student records as required by laws, district policies, and administrative regulations.
- Assign and grade class work and homework.
- Observe and evaluate students' performance, behavior, social development, and physical health.
- Enforce all administration policies and rules governing students.
- Plan and conduct activities for a balanced program of instruction, demonstration, and work time that provides students with opportunities to observe, question, and investigate.
- Prepare students for later grades by encouraging them to explore learning opportunities and to persevere with challenging tasks.
- Guide and counsel students with adjustment or academic problems, or special academic interests.
- Instruct and monitor students in the use of equipment and materials to prevent injuries and damage.
- Prepare for assigned classes and show written evidence of preparation upon request of immediate supervisors.
- Use computers, audio-visual aids, and other equipment and materials to supplement presentations.
- Meet with parents and guardians to discuss their children's progress and to determine priorities for their children and their resource needs.
- Confer with parents or guardians, other teachers, counselors, and administrators to resolve students' behavioral and academic problems.
- Prepare objectives and outlines for courses of study, following curriculum guidelines or requirements of states and schools.
- Meet with other professionals to discuss individual students' needs and progress.
- Prepare and implement remedial programs for students requiring extra help.
- Attend professional meetings, educational conferences, and teacher training workshops to maintain and improve professional competence.
- Confer with other staff members to plan and schedule lessons promoting learning, following approved curricula.
- Collaborate with other teachers and administrators in the development, evaluation, and revision of secondary school programs.
- Prepare reports on students and activities as required by administration.
- Select, store, order, issue, and inventory classroom equipment, materials, and supplies.
- Plan and supervise class projects, field trips, visits by guest speakers, or other experiential activities, and guide students in learning from those activities.
- Administer standardized ability and achievement tests and interpret results to determine students' strengths and areas of need.
- Sponsor extracurricular activities such as clubs, student organizations, and academic contests.
- Attend staff meetings and serve on committees, as required.
- Perform administrative duties such as assisting in school libraries, hall and cafeteria monitoring, and bus loading and unloading.
- Provide disabled students with assistive devices, supportive technology, and assistance accessing facilities such as restrooms.
Companies That Hire Biology Teachers
Explore what you might do on the job with one of these projects...
Do you have a specific question about a career as a Biology Teacher that isn't answered on this page? Post your question on the Science Buddies Ask an Expert Forum.
- National Education Association: nea.org
- National Board for Professional Teaching Standards: https://www.nbpts.org
- National Center for Alternative Certification: https://teach-now.edu
- National Council for Accreditation of Teacher Education: www.ncate.org
- Council for Higher Education Accreditation: https://www.chea.org/
- Teacher.org - How to Become a Science Teacher: https://www.teacher.org/career/science-teacher/
- O*Net Online. (2016). National Center for O*Net Development. Retrieved July 1, 2017, from https://www.onetonline.org/
- Study.com. (2010). Biology Teacher: Job Duties and Requirements for Becoming a High School Biology Teacher. Retrieved May 11, 2010, from https://study.com/articles/Biology_Teacher_Job_Duties_and_Requirements_for_Becoming_a_High_School_Biology_Teacher.html
- National Institutes of Health. (2006, April 27). Meet a real Biology Teacher, Secondary, Egda M. Morales-Ramos. Retrieved May 22, 2019, from http://nihlifeworks.org/Interviews/Egda%2bM.html
- National Institutes of Health. (2004, April 7). Meet a real Biology Teacher, Secondary, Peggy Deichstetter. Retrieved May 22, 2019, from http://nihlifeworks.org/Interviews/Peggy%2BDeichstetter.html
- YouTube. (2008, May 27). Mr. Geaney: AP Biology Teacher. Retrieved May 11, 2010, from https://www.youtube.com/watch?v=509oWoEXLXQ
Explore Our Science Videos
Toy Sailboat with Keel
4 Easy Robot Science Projects for Kids
DIY Toy Sailboat | <urn:uuid:3bbd687e-de3f-41cc-a1f4-54a3fd004ab2> | CC-MAIN-2019-51 | https://www.sciencebuddies.org/science-engineering-careers/life-sciences/biology-teacher | s3://commoncrawl/crawl-data/CC-MAIN-2019-51/segments/1575541315293.87/warc/CC-MAIN-20191216013805-20191216041805-00372.warc.gz | en | 0.932872 | 2,016 | 3.234375 | 3 |
- Am I letting things go because I’m worried about making things worse for the person being targeted? Some things we do when we witness cyberbullying – even when we’re trying to help – can make things worse, so it’s always a good idea to step back and think about the situation before jumping in.
- Am I hoping that someone else will do something so I don’t have to? A lot of people are reluctant to take action, but did you know that almost three-quarters of kids who’ve witnessed cyberbullying did something about it? If that surprises you, it may be because a lot of the things we can do to help – like speaking privately to the person who’s being mean, or letting the person who’s being targeted know you care about them – don’t happen in public.
- Am I letting things go because I don’t think I can do anything to help? Actually, what you do is super important. What witnesses do about bullying is actually one of the most important factors in how much someone is hurt by it and can go a long way in building positive online spaces.
Before you react, ask yourself:
Lots of times kids will say they’re not bullying, they’re ‘just joking’ – in fact, it’s the number one reason for being mean online. Other times, people will play down how serious the situation really is.
Give your kids the guidance they need.
MediaSmarts is pleased to announce that we have partnered with Instagram and Connect Safely to launch a Parents’ Guide to Instagram to help prepare you to give your kids the guidance they need.
Understanding what kids are doing on social networks can be challenging – even if parents are on many of the same platforms.
The purpose of this workshop is to provide tweens and young teens with strategies and knowledge that will help them respect themselves, respect others and respect the space when using social media.
Background information for parents and teachers for Privacy Pirates: An Interactive Unit on Online Privacy which introduces children, ages 7-9, to the concept of online privacy and teaches them to distinguish between information that is appropriate to give out and information better kept private – and to recognize how this may change in different contexts.
Co-Co’s AdverSmarts: An Interactive Unit on Food Marketing on the Web is an educational game for young children. The purpose of the game is to teach five- to eight-year-olds how to recognize commercial websites that target kids through highly engaging and interactive Web environments. | <urn:uuid:3509b95e-4834-4597-806d-a34d5b35e3a0> | CC-MAIN-2019-47 | http://mediasmarts.ca/search?page=4&f%5B0%5D=type%3Acurricular_outcome_chart&f%5B1%5D=field_categories%3A488&f%5B2%5D=type%3Atip_sheet&f%5B3%5D=field_categories%3A473&f%5B4%5D=field_categories%3A504&f%5B5%5D=type%3Aguide&%3Bf%5B1%5D=type%3Alesson_plan&%3Bamp%3Bf%5B1%5D=field_categories%3A479&%3Bamp%3Bf%5B2%5D=field_categories%3A483&%3Bamp%3Bf%5B3%5D=field_categories%3A464&%3Bamp%3Bf%5B4%5D=field_categories%3A529 | s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496669967.80/warc/CC-MAIN-20191119015704-20191119043704-00489.warc.gz | en | 0.943317 | 538 | 2.921875 | 3 |
Wild cat organizations, universities and government agencies based or working in Russia to protect big cats and small wild cats in this country.
ALTA Amur Leopard Conservation
A coalition of 13 international and Russian NGOs have pooled resources by creating ALTA (the Amur Leopard and Tiger Alliance) for the conservation of Amur lepards and tigers in the wild.
"...With a wild population of less than 45 individuals, the Amur leopard is critically endangered. Most of the reasons for this status are human activities...ALTA (is) working hard to reduce these threats by funding patrols and telling people about the importance of the Amur leopard..." Land of the Leopard National Park (Russia)
By resolution of the government of the Russian Federation, the Land of the Leopard National Park was established in the southwest of Primorsky Province.
This single protected territory has the capacity to ensure the survival of at least 50 Far Eastern leopards and covers 60% of its remaining habitats. And most importantly, the park includes all breeding grounds, which leopards use from generation to generation. The national park will also become home to 10 Amur tigers that are key for Changbaishan population in China and a valuable Korean pine forest. Pallas' Cat Study and Conservation Program
Organized by the Siberian Environmental Center (Novosibirsk) to support and develop initiatives dedicated to the study and conservation of the Pallas' cat.
Our mission is to conserve the exceptionally rich fauna and flora of the Russian Far East, the only region where Amur tigers and leopards survive in the wild.
The Altai Project
Protectng the natural and cultural heritage of Altai in Southern Siberia
As of 2014, fewer than 100 snow leopards remain in Russia, mostly in the Altai-Sayan Ecoregion...Scientists from Altaisky Nature Reserve, Arkhar NGO, and regional protected areas have spent the last 3 years conducting extensive presence/absence and camera-trapping surveys to gain a more comprehensive and nuanced understanding of snow leopard distribution and ecology in Altai and other parts of the cat’s Russian habitat range. Wildlife Conservaton Society (WCS) - Russia
Wildlife conservation in Russia, including Amur leopards and Amur tigers..
The Russian Far East is home to some of the world’s rarest and unique species, including Amur tigers and leopards, Kamchatka brown bears, and Blakiston’s fish owls. The Wildlife Conservation Society focuses on these key species as a means to achieve biodiversity conservation and protect critical habitats throughout this region. We use science as a foundation for designing and implementing effective conservation plans. World Wildlife Fund
International conservation, protection and restoration of species and their habitats. WWF recently announced the establishment of a new national park in Russia to save the Amur leopard. | <urn:uuid:11b09a36-468f-4231-bf6c-c2f908deea70> | CC-MAIN-2015-35 | http://bigcatswildcats.com/russia/ | s3://commoncrawl/crawl-data/CC-MAIN-2015-35/segments/1440644065341.3/warc/CC-MAIN-20150827025425-00229-ip-10-171-96-226.ec2.internal.warc.gz | en | 0.906692 | 588 | 2.734375 | 3 |
Content for an app may already exist. This may be stored on a database, appear on a website, an RSS feed or you may have the unenviable job of starting completely from scratch.
So let’s take a look at a few examples…
The most obvious data source for information is of course a website. Maybe you are utilising the content from your own site and wish to feature this in an app? Common choices of websites that work well within an app environment are those that offer rich details into news, reviews, previews, blogs, editorials and databases that include trivia, encyclopaedic knowledge and so on.
API short for ‘Application Program Interface’ allows you to tap into data in an advanced way, although the amount of information available is dependent on the API itself. Many website giants feature an API, allowing other websites and more importantly in our case ‘apps’ to feature content and share services. This may also result in the ability to login to your app using Facebook login credentials for example.
Really Simple Syndication commonly known as RSS for short, is a collection of web based formats that allow websites to share information particularly news, however it can also expand to other areas as well.
With these feeds, content can be gathered and featured on other websites and indeed elsewhere.
User Created Content
Not all content is professionally written. In fact the World Wide Web is full of user opinions, reviews and discussion. This powers a whole universe of comparison, amateur experiences and a second layer of useful advice. Is your app suitable for such a gathering of data?
If not, is there any way you could incorporate it? Building a community around your app is a superb way of achieving positive notoriety while also providing continued app accesses as people track the conversations and user information.
If your app is going to rely on external sources of information, you should of course always ask for permission, even if only as a courtesy. The data may be freely available; however it may still be legally protected.
Even without any protection of any kind, content providers won’t be best pleased if you do not correctly acknowledge and respect the source, so insure that you follow any guidelines they provide and most importantly keep them on your side. If you can strike a rapport with them and reach the point where you can share a few friendly conversations, no doubt they will offer advice and additional access to the areas of content you require.
Unfortunately, having a permanent connection to the online world isn’t always achievable. Either the device doesn’t have a form of mobile internet connection or worse they are in a zone where the coverage is extremely limited.
If your app depends on information that is almost completely online, your app will suffer in these situations. This would be a good time to consider whether content can be stored locally to the device your app is running on. For example, an app that relies on presenting map related information that fails while out in the countryside is of no use to anyone.
Your challenge is competing with this vast library of already impressive offerings which, although a daunting prospect to the fledgling traveller, can be navigated successfully with the right ideas and implementation. Whether you want to create an income generator or simply desire recognition for your efforts, this book will aim to show you the path and inspire your imagination to overflow with possibilities.
Allow James Woodcock to guide you through the wilderness and raise your chances of realising your development dreams by detailing different routes with this light hearted tour of the Apps terrain. Featuring a myriad of exciting and surprising examples, you can glean important suggestions for your own creation.App Creation Series Index:
App Creation – Beginners Guide to App Design, Development and Marketing | <urn:uuid:34004290-b274-4fd1-9583-0e251b29ce20> | CC-MAIN-2017-13 | http://www.jameswoodcock.co.uk/2016/05/02/app-creation-59-app-design-content/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-13/segments/1490218189403.13/warc/CC-MAIN-20170322212949-00625-ip-10-233-31-227.ec2.internal.warc.gz | en | 0.92701 | 759 | 2.5625 | 3 |
Millions of miles from Earth, two astronauts hover weightlessly next to a giant space rock, selecting pebbles for scientific research. The spaceship where they'll sleep floats just overhead. Beyond it, barely visible in the sky, is a glittering speck. It's Earth.
It sounds like a science-fiction movie, but this surreal scene could, if President Barack Obama has his way, become a reality. However, unlike Hollywood depictions in such movies as "Armageddon," it's going to be a lot harder to pull off.
Almost 50 years after President John F. Kennedy proposed sending a man to the moon "before this decade is out," Obama has set an equally improbable goal. He has proposed a 2025 date for the National Aeronautics and Space Administration to land humans on an asteroid, a ball of rock hurtling around the sun.
The moon is 240,000 miles away. A trip to an asteroid would be 5 million miles -- at a minimum.
If the mission ever gets launched, it would mark a milestone just as significant as Neil Armstrong's "small step" on the moon, experts say. To go to an asteroid, humans would have to venture for the first time into "deep space," where the sun, not the Earth, is the main player.
An asteroid trip "would really be our first step as a species outside the Earth-moon system," said planetary scientist Andy Rivkin of the Applied Physics Laboratory. "This would be taking off the training wheels."
Asteroids have always been passed over as a destination for human explorers. Then-President George H.W. Bush wanted NASA to go to Mars, while his son, George W. Bush, chose the moon. During the last six years, NASA has spent $9 billion building a spaceship, rocket and other gear to help reach the second Bush's goal of returning humans to the lunar surface by 2020.
In February, Obama took steps toward killing Bush's moon program, which was beset by technical troubles and money woes. Two months later, in a speech at Cape Canaveral, Fla., Obama announced that the astronauts' next stop is an asteroid.
So far, the Obama administration has been quiet on the need for a major sum of money to accomplish his goal. And unlike Kennedy, who used Russian spacecraft missions known as Sputnik to promote the moon mission, Obama doesn't have a geopolitical imperative to justify the scheme. Congress is resisting Obama's change of direction, which could delay investment in the program.
If Obama wants to bolster his cause, there's a rationale he could cite: An asteroid could wipe out as many human lives as a nuclear bomb. The dominant scientific theory posits that dinosaurs went extinct because of a direct hit from an asteroid as wide as San Francisco. A space rock big enough to kill thousands slams into Earth every 30,000 years, according to a January report from the National Research Council.
That scenario provided the rationale for asteroid missions in various Hollywood movies, including "Armageddon." The 1998 film, which starred Bruce Willis, grossed more than $200 million at the box office in the United States, and more than $500 million worldwide. It went on to be a staple on cable television.
But if Americans think they have an understanding of the challenge of going to an asteroid, they're wrong. "I loved the movie," said Laurie Leshin, a top NASA official who is involved in the early planning stages of an asteroid mission, although "it was completely inaccurate."
Obama's plans for NASA have drawn many opponents, including Armstrong, but their criticism centers on the administration's reliance on private space companies to ferry astronauts to orbit. The goal of an asteroid hasn't been questioned as much.
That doesn't mean it would be easy. Although experts agree it could be done, here are four asteroid-sized reasons why life won't imitate art.
• ASTRONAUTS CAN'T HOP ON A SPACE SHUTTLE TO GET THERE. In "Armageddon," Willis' character and his crew blast off in two modified space shuttles to reach the killer asteroid. But NASA has long planned to retire the shuttles within the next year. And even if they weren't all headed to museums, they're useless as asteroid transporters.
The shuttles were built only to circle Earth, said Dan Adamo, a former mission control engineer who has studied human missions to asteroids. They don't carry the fuel to jump into deep space, and their heat shields aren't designed to withstand the extra-high temperatures of returning from a destination other than the Earth's orbit.
What's needed instead is a giant rocket on the scale of the monstrous Saturn V -- taller than Big Ben -- that propelled man to the moon in the 1960s and 1970s. Such a project is "a difficult challenge" that will cost in the multiple billions of dollars, said Ray Colladay, a member of NASA's advisory council.
NASA spent more than $52 billion in 2010 dollars to develop and build the Saturn V. Building a 21st-century version can be done but will require a sharp increase in the NASA budget later this decade, some space experts say.
"That's the issue everybody wants to duck right now, because it's uncomfortable to face that," Colladay said.
NASA would also need to build a new spaceship where the astronauts can live and store all the oxygen, food and water needed for a long voyage. One option is to launch a small space pod carrying the crew, then, once safely in space, unleash an inflatable habitat, Leshin said.
NASA has little practice with such a blow-up spacecraft.
• THE TRIP TAKES A LONG, LONG TIME. Willis and company arrive at their target asteroid in a few days, if not a few hours. Admittedly, it's streaking toward Earth at the time. NASA would prefer to go to one before it gets to that stage.
Studies by Adamo, former astronaut Thomas Jones and others show that a round trip to a target asteroid would typically take five to six months. That assumes NASA shoots for one of the 40 or so asteroids that come closest to the Earth's path in the 2020s and 2030s and relies on spacecraft similar to those NASA had designed for Bush's moon mission.
Another problem during the journey -- the crew would spend months "cooking" in space radiation, said NASA's Dave Korsmeyer, who has compiled a list of the most accessible asteroids. Shuttle passengers are somewhat screened from such radiation by Earth's magnetic field. Astronauts who leave Earth's orbit have no such protection.
Space radiation raises the risk of cancer and in extreme cases causes nausea and vomiting, said Walter Schimmerling, former program scientist of NASA's space radiation program. The astronauts might need to take drugs to prevent the ill effects of radiation.
Then there's the "prolonged isolation and confinement" that the crew will have to endure, said Jason Kring of Embry-Riddle Aeronautical University. "This crew will be more on their own than any other crew in history."
If there's an emergency halfway into the trip, the astronauts would not be able to get home in a few days, as the Apollo 13 crew did. Instead it would take weeks, if not months.
• HUMANS CAN'T WALK OR DRIVE ON AN ASTEROID. Once they land on the asteroid "the size of Texas," the heroes of "Armageddon" run over the spiky terrain, except when they're steering two tank-like vehicles. In reality, even the biggest asteroids have practically no gravity. So anything in contact with the surface could easily drift away.
"You don't land on an asteroid," said former Apollo astronaut Rusty Schweickart, a longtime advocate of asteroid studies. "You pull up to one and dock with it. And getting away from it, all you have to do is sneeze and you're gone." He envisions a spaceship hovering next to the asteroid and occasionally firing its thrusters to stay in place.
Astronauts wouldn't walk on an asteroid. They would drift next to it, moving themselves along with their gloved hands.
To keep from floating into space, crewmembers could anchor a network of safety ropes to the asteroid's surface, but "that has its own risks, because we don't understand how strong the surfaces of asteroids are and whether (they) would hold an astronaut in place," said Daniel Scheeres, a planetary scientist at the University of Colorado.
The minimal gravity also means that any dust the astronauts stir up will hang in a suspended cloud for a long time. Because there's no weather on an asteroid, there's no erosion to smooth the dust particles.
"It's all going to stay pretty razor-sharp. It's not the most friendly stuff in the universe," Korsmeyer said. Keeping humans safe as they explore an asteroid "is going to be really tricky."
• HUMANITY DOESN'T HANG IN THE BALANCE. In "Armageddon," NASA must send a crew to an asteroid or life on Earth will be wiped out. "Even the bacteria," said the NASA chief, played by Billy Bob Thornton.
In the real world, that irrefutable motivation is absent. By 2025, Obama's target date, there will have been four presidential elections. Any could result in the mission's cancellation, just as Obama canceled Bush's moon plan. "The politics of this is far more challenging than the engineering," Colladay said.
The Obama administration has promised to increase NASA's budget by $6 billion over the next five years, but priorities may change. The Bush administration, for example, in 2007 cut long-term funding for its own moon program by $1.2 billion.
As the deficit looms larger, "especially as the November elections come along I would just not be surprised if enthusiasm for some big human spaceflight mission ends," said Marcia Smith, founder of spacepolicyonline.com.
As it is, the extra $6 billion Obama has promised NASA is inadequate for all the tasks the agency is supposed to tackle, Jones said. "The declaration that we're going to deep space is not matched by budget reality," he said.
Leshin, the NASA official, responds that the agency is embarking on a research program that will lead to new, less costly technologies. The agency will build new spacecraft over a period of many years, so the costs don't pile up all at once, she said.
"If we're making progress toward goals that are exciting and important to the American people, then it should be a sustainable program," Leshin said.
She is optimistic that relatively soon, NASA astronauts will speed toward a rendezvous with an asteroid, and that it will be better than in the movies.
"The first time we send humans beyond the cradle of the Earth-moon system, it's going to be extraordinary," Leshin said. "We will have gone further with humans in space than ever before. It will be an incredible first."
Explore further: Collisions of coronal mass ejections can be super-elastic | <urn:uuid:43bfc4b6-f139-4bab-8c69-dc41eadfec5d> | CC-MAIN-2013-20 | http://phys.org/news196920110.html | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368704234586/warc/CC-MAIN-20130516113714-00027-ip-10-60-113-184.ec2.internal.warc.gz | en | 0.965848 | 2,301 | 3.3125 | 3 |
What does an A mean? What does a B or C mean? Having survived the NJ public school system, I know they mean different things to different people. But at least I can be sure that when I try to convince my Grandma that F means fantastic (on a spelling test of course, if you couldn’t guess from this blog) – she won’t buy it. My mother had the same grading system in the 60s.
Here in Sweden, since I moved here, they have had 4 different grading systems. That is 4 different assessment systems teachers had to understand, interpret and apply in little more than a decade.
There was the 1-5 system. Then the VG-G-UG (high pass-pass-fail). Then they added an MVG (very high pass). Then they switched to an A-F system.
Most of the changes were due to policy changes directly from the government, that while built on actual pedagogical research, lacked the one thing I personally think is most important in a grading system – stability and general understanding of what each grade means.
Yes, in the US the grade C is supposed to be average, but the whole grading system is so inflated that C really means ‘poor’ in most schools. And that is OK because it is generally understood to be so. Many report cards will also include an explanation of each grade.
Teachers in Sweden have just barely managed to establish what an MVG means and it disappears.
If you want to give Swedish kids a fair shot, and lessen their stress levels, quit pulling the carpet out from underneath them, politicians, and give them a leg to stand on. | <urn:uuid:9f7d9b20-2c17-40f5-a862-11ede8163622> | CC-MAIN-2017-34 | http://survivinglifeinsweden.blogspot.com/2013/03/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886105326.6/warc/CC-MAIN-20170819070335-20170819090335-00066.warc.gz | en | 0.977294 | 345 | 3.0625 | 3 |
Attributional Style And Depression: Does Experiential Avoidance Function As A Mediator?
Depression is a complex illness, with many factors thought to be involved in the development and maintenance of the disorder. One possible risk factor for depression is the attributional style which an individual has (Abramson, Seligman, & Teasdale, 1978); or in other words, the way a person explains why the events in his or her life occur. Although numerous studies have found that negative attributional style is linked to depression, other studies have shown there to be a weaker relationship. Therefore, there may be additional factors involved in mediating the relationship between attributional style and depression. This study hypothesized that experiential avoidance would function as one of these mediators.
Attributional Style and Depression
The concept of attributional style was first developed by Abramson et al.ÂÂ (1978) in their reformulation of the Learned Helplessness theory of depression1 (Seligman & Maier, 1967). Attributional style refers to the habitual way that individuals explain the events which occur in their lives, and their expectancies for future events. Abramson et al. stated three dimensions which can be used to indicate a person's attributional style. The first is a locus of control measure. This is where attributions may be made to internal causes, with the individual believing the cause of the event is within oneself; or to external causes, where the cause is outside of oneself. The second dimension is about how stable or unstable the individual believes the cause of the event is. Finally the cause may be described as global, where it also affects other areas of life; or specific, where the cause only affects the given situation. These three dimensions can be measured on scales and be combined to yield a perception of an individual's attributional style. Those who explain negative events in terms of internal, stable and global causes are said to have a pessimistic or negative attributional style, rendering them 'helpless', whilst those who explain negative events to external, unstable and specific causes have an optimistic attributional style (Seligman, 1990). Attribution theory postulates that those individuals who have negative attributional styles are more prone to depression.
Get your grade
or your money back
using our Essay Writing Service!
This model has received a lot of support over the years. Sweeney, Anderson and Bailey (1986) concluded in a meta-analysis of over 100 studies that attributional style is highly predictive of depression, therefore providing support for the theory. However, a study by Munton (1985) found that the link between attributional style and depression was fairly weak; he claimed that the association between the two factors is overstated, and that there are probably other explanations for the existence of this relationship. Therefore, this link is likely to be affected by other factors. Past research has highlighted the role of experiential avoidance in depression (Tull, Gratz, Salters, & Roemer, 2004), and so it is possible that this cognitive process mediates the relationship between attributional style and depression.
Experiential avoidance can be defined as an unwillingness to experience negatively evaluated private thoughts, sensations, and emotions. The individual makes deliberate attempts to escape from or to consciously suppress these internal events (Hayes, 1994). Long term suppression of these private events, whilst serving a self protective function in the short term, may cause problems over an extended period of time. Experiential avoidance becomes an issue when avoidance behaviours are applied strictly and inflexibly, to the extent that great effort goes into suppressing these unwanted thoughts (Kashdan, Barrios, Forsyth, & Steger, 2006). Hayes, Wilson, Gifford, Follette and Strosahl (1996) state that a process known as cognitive fusion is at the root of experiential avoidance. This fusion causes negatively evaluated thoughts to be defined as unbearable, and this leads to the splitting of the self away from the internal thoughts as a coping mechanism against negative feelings.
Studies have shown that experiential avoidance is involved in the development and maintenance of many psychological problems, including depression (Tull et al., 2004). Gross and John (2003) argued that this occurs because individuals who are constantly disconnected with their internal events are not able to fully immerse themselves in enjoyable experiences; this results in less frequent positive life events, and hence, more negative emotions. Furthermore, thought suppression has been found to have negative rebound effects, in a way that suppressed thoughts are likely to be encountered more frequently following attempts to eliminate them from awareness (Wegner, Schneider, Carter, & White, 1987). It may be via these mechanisms that experiential avoidance engagement could cause depressive symptoms to develop, or be exacerbated.
Always on Time
Marked to Standard
The link between experiential avoidance and depression can be strengthened by considering the impact of Acceptance and Commitment Therapy (ACT) (Hayes, Strosahl, & Wilson, 1999) upon patients with depression. ACT is a 'third wave' cognitive therapy, which acts upon the premise that psychological problems are caused by experiential avoidance and cognitive fusion. Unlike traditional Cognitive Behavioural Therapy (CBT), ACT does not try to change maladaptive thought patterns; instead, it teaches individuals to notice and accept private events by encouraging cognitive defusion of thoughts, and greater psychological flexibility in regards to their internal events. These methods are designed to help the individual to deal with painful thoughts more effectively. Evidence for this therapy has shown that it is highly effective in treating depression (e.g. Zettle & Hayes, 1986; Forman, Herbert, Moitra, Yeomans, & Geller, 2007).
Experiential Avoidance: A Mediator?
As previously stated, both attributional style and experiential avoidance have been linked to depression. This research project aims to study these associations in greater detail by considering the function that experiential avoidance might play in the relationship between attributional style and depression. It is theoretically sound to examine the role of experiential avoidance in this context for many reasons. Firstly, studies on the relationship between attributional style and depression have yielded inconsistent results (Coyne & Gotlib, 1983). This suggests that there may be one or more other variables involved in this relationship, which vary from study to study; one of which could be individual differences in experiential avoidance. For example, in individuals with negative attributional styles, high levels of experiential avoidance are likely to contribute to these individuals developing depression. On the other hand, some individuals with a negative attributional style may demonstrate low levels of experiential avoidance, and instead of suppressing feelings are able to recognize and accept private events. In this instance, high psychological flexibility (or low levels of experiential avoidance) may function as a protective factor against depression, despite the individuals having negative attributional styles. This example illustrates how individual differences in experiential avoidance levels could explain why some studies have shown strong links between attributional style and depression, whilst others have not.
Another reason to consider whether experiential avoidance is involved in the relationship between attributional style and depression is because it has been noted as a mediating factor in other relationships. A study by Merwin, Rosenthal and Coffey (2009) found that the relationship between sexual abuse and depression was mediated by experiential avoidance. Interestingly, studies have shown that individuals with a history of sexual abuse are likely to have negative attributional styles (e.g. Gold, 1986; Runyon & Kenny, 2002). Taken together, these two studies illustrate that it is appropriate to consider experiential avoidance as an important concept in determining the link between attributional style and depression.
On the basis of past research, this study hypothesized that experiential avoidance is a mediator of the relationship between attributional style and depression. As depression is a highly complex illness with numerous contributing factors, it was expected that experiential avoidance would only function as a partial mediator, rather than a full one. In order to determine whether these hypotheses were accurate, the three variables of attributional style, experiential avoidance and depression were measured by three questionnaires, and the results were statistically analyzed in line with Baron and Kenny's (1986) four-step approach for determining mediation.
In a within-subjects design, three continuous variables were measured by the use of three online questionnaires, with no manipulation of variables. The criterion variable was the individual's depression levels as measured by the Beck Depression Inventory-II2 (Beck, Steer, & Brown, 1996), and the predictor variable was the individual's attributional styles, which were measured by an adapted version of the Attributional Style Questionnaire (Peterson et al., 1982). Experiential avoidance was used as a mediator, and was measured by the Acceptance and Action Questionnaire-II (Bond et al., 2010). Results were analysed with simple and multiple regressions, and an online Sobel test was utilized to assess the possible meditational effects of experiential avoidance.
Seventy-four psychology undergraduate students (54 females, 20 males) from the University of Southampton, England, served as participants in this research in exchange for course credits. Participants were aged between 18 and 30 years old, with a mean age of 20.01 (SD = 1.79).
This Essay is
a Student's Work
This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.Examples of our work
Beck depression inventory-II. The Beck Depression Inventory (BDI-II) contains 21 self report questions which aim to determine an individual's depressive symptoms. Possible scores on this questionnaire range from 0 to 63, with a higher score indicating a higher level of depression. Used widely, the BDI-II has strong psychometric qualities, including a high level of internal consistency with college students (a = .93) and a high test-retest reliability (r = .93) (Beck et al., 1996).
Adapted attributional style questionnaire. The Attributional Style Questionnaire (ASQ) is a self report measure which determines how individuals explain the events which occur in their lives, and their expectancies for future events. The original version includes 12 hypothetical events; six of these being negative, and six being positive. Within these two categories, three questions are based on academic events and three on interpersonal events. Individuals respond to these theoretical experiences by stating the one main cause of the event if it was to happen to them. Then participants rate the cause of the event on internality, stability, and globality scales, and they also indicate how important the event would be if it happened to them3. The scales range from one to seven, with one indicating attributions being made to external, unstable causes, with a lack of globality; and a rating of seven indicating that attributions are made to internal, stable and global causes. Higher ratings on the importance question indicate that the individual perceives the event as very important.
The original ASQ was adapted to fit the requirements of the present study. This is because the ASQ was used alongside the Acceptance and Action Questionnaire, for which the focus is on how much individuals avoid or suppress negative thoughts or events, rather than positive ones. Therefore, the positive events were omitted from the ASQ, and only the negative events were used to assess attributional style. This adapted version is therefore being referred to in the present study as the Adapted Attributional Style Questionnaire (AASQ). The authors of the ASQ stated that as the two groups of events (good and bad) are independent, it does not affect the validity of the questionnaire to divide the sections and to only impose one group. The six bad events from the questionnaire were found to have an acceptable test-retest reliability (r = .64) (Peterson et al., 1982).
Acceptance and action questionnaire-II. The Acceptance and Action Questionnaire (AAQ-II) consists of 10 self-report questions which determine how much emotional avoidance and thought suppression a person engages in, as well as whether or not the person takes action when negatively evaluated thoughts are encountered. The individuals respond to each of the questions on a seven point scale, where one represents 'never true' and seven represents 'always true'. Therefore, the possible scores on the AAQ-II range from 0-70. Items 2, 3, 4, 5, 7, 8, and 9 were reverse scored so that, for all questions, a higher score represented higher psychological flexibility, and lower levels of experiential avoidance. The 10-item scale was selected because it has been found to have greater psychometric qualities than older versions of the AAQ; it has a good reliability of between .81 and .87 (Bond et al., 2010) and a high level of internal consistency (a = .89) (McCracken & Zhao-O'Brien, 2010).
Participants read an online consent form which contained information on the procedure of the experiment. As there was no deception involved in this research, participants were able to give fully informed consent after reading this form. If participants were happy to take part then they indicated this by ticking a box at the bottom of the webpage. Demographic details on age and gender were then taken. Participants were presented with three questionnaires simultaneously; these were the BDI-II, AASQ, and the AAQ-II. Upon completion, student identification numbers were reported so that participants could be rewarded with course credits. Finally, an online debriefing form was shown to participants, which detailed the aims and hypotheses of the experiment, and also provided contact details of the researcher if they had any questions. Participants were then free to close the online study page.
Before analyzing the data, statistical tests were conducted to assess whether the data fitted the parametric assumptions. One sample Kolmogorow-Smirov tests were conducted on the BDI-II, AASQ, and the AAQ-II scores to compare the data to a normal distribution. All three variables were normally distributed. Therefore, no items needed to be excluded from the data set. Furthermore, both age and gender had insignificant correlations with attributional style, experiential avoidance, and depression, indicating that the data did not need to be analyzed separately for males and females, or for participants of different ages. Furthermore as the AASQ was altered slightly, a reliability analysis was conducted for this measure; the results showed an adequate level of internal consistency for the questionnaire (a = .72).
In multiple regression analysis, multicollinearity is sometimes an issue. If the two predictor variables are highly correlated, then it is difficult to identify the individual contribution of one variable separately to the other variable, for their effects on the criterion variable. Therefore this needed to be tested between the two predictor values; AASQ and AAQ-II. Statistical tests showed that multicollinearity did not exist between the two variables.
Significant correlations were found between all combinations of the predictor variable (AASQ), mediator variable (AAQ-II) and the criterion variable (BDI-II). Therefore it was reasonable to assume that experiential avoidance may have had a meditational effect on the relationship between attributional style and depression.
Firstly, simple regression analyses were conducted to determine whether experiential avoidance and attributional style were predictive of depression levels. The results from these regression models are presented in Tables 2 and 3 (respectively), which show that both variables were significant predictors of depression. Therefore, as attributional style becomes more negative, or experiential avoidance levels increase, depressive symptoms worsen. In step 1 of a multiple regression model (see Table 3) AASQ explained a total of 31% of the variance in depression levels. This value increased to 54% in step 2, meaning that adding AAQ-II into the model accounted for an extra 23% of the variance in depression levels.
Analysis for Mediational Effects
The present study aimed to address the question of whether experiential avoidance acts as a mediator of the relationship between attributional style and depression. Baron and Kenny (1986) suggest a four step approach to determine mediation. Firstly, the predictor variable needs to be predictive of the criterion variable. As illustrated by Table 3, regression analysis showed that this condition was met, with attributional style being a significant predictor of depression (p <.001). This indicated that there was an effect to be mediated. The second of Baron and Kenny's steps is establishing that the predictor variable predicts the mediator. Regression analysis also showed this to be true (Table 2), with attributional style being a unique predictor of experiential avoidance (p <.001). The third step is confirming that the mediator affects the criterion variable when including both the predictor variable and the mediator in the analysis. A multiple regression model, presented in Table 3, showed this to be true, with experiential avoidance being predictive of depression independent of attributional style (p <.001). Finally, Baron and Kenny state that if complete mediation is present, the relationship between the predictor variable and the criterion variable should decrease to zero when controlling for the mediator. A partial mediation is present if the relationship between the predictor and criterion variables decreases when taking into account the mediator, but remains significant. This final step required the testing of the indirect effect; or in other words, examining the relationship between attributional style and depression whilst taking experiential avoidance into account.
The Sobel test (Sobel, 1982) was used to test the indirect effect. There are many online versions of this test, but the one used in the present study was Medgraph (Jose, 2003), which is designed to graphically illustrate meditational effects. The relevant regression coefficients and standard errors were entered into this program which determined whether experiential avoidance acted as a mediator. The Medgraph program reported a significant Sobel test value for the indirect route (z = 3.56, p <.001). The coefficient for the direct route (attributional style predicting depression) decreased from ß = .56 to ß = .31 when the indirect route was tested. The results indicate that a partial mediation is present.
This study aimed to examine the role of experiential avoidance in the relationship between attributional style and depression. It was hypothesized that experiential avoidance would function as a mediator in this context. For example, in those individuals with negative attributional styles, their likelihood of developing depression would depend on how much experiential avoidance they engaged in. It was therefore expected that when taking experiential avoidance into account, the relationship between attributional style and depression would become insignificant, or it would decrease in magnitude but remain significant. The results indicated that the latter option was true; experiential avoidance functioned as a partial mediator in the relationship; when controlling for experiential avoidance, the relationship between attributional style and depression fell by 45%. This indicates that the hypothesis of the study was accurate. These results have many implications in terms of theoretical insight, treatments for depression, and future research ideas.
This study provides further evidence that experiential avoidance plays an important role in depression, and has shown yet another area in which the construct acts as a mediator. The results of this study suggest that high psychological flexibility may function as a protective factor against the development of depression, despite an individual having other cognitive disturbances which are predictive of depression; such as a negative attributional style, in this case. This finding ties in with other studies which have looked at experiential avoidance as a mediator. For example, having low levels of experiential avoidance has also been noted as a protective factor against other clinical problems such as anxiety (Berman, Wheaton, McGrath, & Abramowitz, 2010).
As experiential avoidance acts as a partial mediator between attributional style and depression, this may impact on the success of depression treatments. An individual who engages in experiential avoidance is likely to be at a disadvantage when it comes to therapy, as he or she might find it difficult to connect with the therapist in a reciprocal relationship (Horvath & Bedi, 2002), or to engage in the behavioural strategies which are used to invalidate maladaptive thought patterns (J. S. Beck, 1995). The results from the present study help to illustrate this problem. For example, Cognitive Behavioural Therapy (CBT) is effective in treating depression (Hollon, 1990), and studies have shown that CBT can significantly improve an individual's attributional style (Seligman et al., 1988). However, because experiential avoidance may act as a barrier to recovery, as implied by past research (Berking, Neacsiu, Comtois, & Linehan, 2009), this might limit the success of the treatment because traditional CBT does not target experiential avoidance. The findings from this study therefore highlight the value of therapists paying special attention to a patient's experiential avoidance engagement when diagnosing and treating depression; and they also underscore the importance of 'third wave' cognitive therapies such as ACT.
Additionally, the results from this study help us to gain insight into the complicated mechanisms of depression. As experiential avoidance was found to be a partial mediator in the relationship between attributional style and depression, this indicates that other factors may be functioning in this relationship as well. Experiential avoidance is only one mediator which has been found to be involved. Past research has focused on many other factors in relation to depression, such as psychological rumination (Nolen-Hoeksema, 1991) and social problem solving ability (Henry, 2005), and so by combining the findings from the present study with previous research, it seems highly likely that depression levels are mediated by multiple factors, in a multifaceted relationship. Although it would be difficult to take into consideration all of the possible risk factors for depression in just one experiment, the results from this study add to the growing repertoire of information regarding the nature of depression.
Despite significant results, there are many drawbacks of the design used in the study at hand. To begin with, the questionnaires adopted for this research have associated weaknesses. Beck et al. (1986) warn against the use of the BDI-II for diagnostic purposes as many of the symptoms observed through the questionnaire are also symptoms of other disorders; the co-morbidity between depression and other disorders means that, in some instances, it may not have been depression which was being measured, but other disorders instead. Furthermore, the attributional style questionnaire was shortened to fit with the requirements of the study at hand by only using the six negative events; therefore, it could have benefitted from having a larger range of negative events on which to measure people's attributions. All three of the questionnaires were also self-report, which leaves the measurements vulnerable to weaknesses such as interpretation errors, or social desirability.
In addition to these weaknesses, cause and effect relationships cannot be determined through the quantitative research used in this study. Although a significant effect of experiential avoidance was found, this by no means implies that experiential avoidance has a causal effect in the relationship between attributional style and depression. As the present study researched a topic which has not been investigated thus far in the literature, the results here require clarification in order to gain more scientific value.
Due to the weaknesses of the current study, there are some improvements which could be made in future research. It would be useful to expand on the findings shown in this experiment by replicating the study with a larger sample size, and by utilizing a different measure of attributional style; such as the Expanded Attributional Style Questionnaire (EASQ) (Peterson & Villanova, 1988) which consists of 18 negative events. By doing this it would help to verify these preliminary findings into the topic of attributional style, experiential avoidance, and depression. Furthermore, to understand the findings of this study better, and to perhaps develop cause and effect relationships, qualitative research could be conducted with depressed individuals to help develop a more in depth understanding of how this partial meditational relationship might function.
Finally, as experiential avoidance functions as a partial mediator, rather than a full mediator, it suggests that other mechanisms are at work in the relationship between attributional style and depression. Perhaps future research could determine which other factors mediate the link; for example, whether social problems solving ability or rumination, as previously mentioned, are also involved. Conducting research into areas such as these may help to reveal other factors which mediate the relationship in question. This kind of research would have positive implications for the further development of effective treatments for depression.
The results from this experiment confirmed the hypothesis of the study; that experiential avoidance acts as a partial mediator in the relationship between attributional style and depression. Experiential avoidance appears to be an important contributing factor to depression levels within the context of attributional style, which therapists should be attentive to when treating depression. | <urn:uuid:db861c70-a6a6-489e-8153-41d320eaa3ae> | CC-MAIN-2016-40 | https://www.ukessays.com/essays/psychology/attributional-style-and-depression.php | s3://commoncrawl/crawl-data/CC-MAIN-2016-40/segments/1474738662856.94/warc/CC-MAIN-20160924173742-00011-ip-10-143-35-109.ec2.internal.warc.gz | en | 0.948898 | 5,161 | 2.90625 | 3 |
Email me when this product is available.
Add To Cart
Students will learn the basics of higher-level math concepts, focusing on sets & logic, with School of Tomorrow's Basic Mathematics I curriculum. PACE Self-Pac 5 covers recognizing a conditional statement, as well as its hypothesis and conclusion; determine the truth value of a conditional statement when given the truth value of the components, construct truth tables, translate the if-then statement into different forms, and draw a Venn diagram representing conditional statements and implications.
Fill-in-the-blank, multiple-choice, and write-in comprehension exercises help with review and retention. Paperback booklet. This resource is listed as "college" or post-secondary curriculum; parents may wish to consider for grades 8 & up.
Please note that the not-included book "Man's Mathematical Models" by Bill Williams and Gwen Crotts is a required resource for this course.
Accelerated Christian Education (ACE) curriculum has Scripture as its foundation, fully integrating biblical principles, wisdom, and character-building concepts into education. Students move at their own speed through the self-instructional "PACE" workbooks. Following the mastery approach, PACEs are formatted for students to complete the exercises found throughout the workbook, take a practice "self test," and conclude with a "final test" (torn out from the center) to measure understanding.
We offer thousands of quality curricula, workbooks, and references to meet your homeschooling needs. To assist you in your choices, we have included the following symbol next to those materials that specifically reflect a Christian worldview.
If you have any questions about specific products, our knowledgeable Homeschool Specialists will be glad to help you. Just call us at 1-800-CHRISTIAN. | <urn:uuid:4f519fc8-e26d-4978-89f9-f7eec8f325d5> | CC-MAIN-2018-22 | https://www.christianbook.com/college-math-self-pac-5/pd/6012444 | s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794867309.73/warc/CC-MAIN-20180526033945-20180526053945-00582.warc.gz | en | 0.939266 | 372 | 3.09375 | 3 |
No matter our color, ZIP code, or language, we want all our children to have a public education that imparts honesty about who we are, the integrity in how we treat each other, and the freedom to pursue our dreams.
Hispanic Heritage Month is not only a time for those of Hispanic and Latino descent to celebrate their cultural roots but also an occasion for people from all backgrounds to learn, appreciate, and celebrate the rich tapestry of Hispanic and Latino cultures.
Despite efforts by some politicians today to whitewash history, to restrict our freedoms to teach and to learn, throughout our history, Hispanic and Latino communities have left an indelible mark on the fields of art, music, literature, science, politics, education, and countless other domains. Their enduring legacy is not only a source of pride for those who share this heritage but also a source of inspiration for all of us who recognize the power of diversity in shaping our shared humanity.
Through this list of curated resources, books, lessons, videos and activities, we invite you to explore, learn, and celebrate the vibrant heritage and contributions of Hispanic and Latino communities to our world.
Celebrating Hispanic Art, Dance, and Holidays
Diving into Hispanic History and Culture
Latino Americans Share Their Experiences
Sí, se puede!": Chávez, Huerta, and the UFW
Hispanic Heritage Teacher Resources
Bring Hispanic Heritage Month to Life: A Collection of Resources
Interactive timelines, scavenger hunts, and other learning fun all about Hispanic Americans. Grades K-8
Colorín Colorado - Hispanic Heritage Month
Information, puzzles, biographies for English language learners. In English and Spanish. Grades K-12
Learn to play Cuban Dominoes with this printable pdf and instructions. Grades 3-8
Learn about and make your own lotería cards Grades 4-10
Fact Monster - Hispanic Heritage Month Activities
Crosswords, population statistics, and more. Grades 6-8
Famous Hispanic Americans (K-5)
Coloring pages and hero cards for sports, science, politics, and the arts.
Learn to play Cuban Dominoes with this printable pdf and instructions (3-5)
Day of the Dead - El Dia de los Muertos K-12 curriculum resources.
Smithsonian National Museum of the American Latino: Molina Family Latino Gallery
Includes exhibitions, virtual museum, Virtual Museum Bilingual Teacher Training Took Kit, and more.
National Hispanic Heritage Month Selected resources for teachers.
Articles Tagged as Latino American History from Smithsonian magazine.
Library of Congress - Hispanic Heritage Month
Images, exhibits, audio, and video.
Mexican American Migrations and Communities
Teacher Resources and ideas on how to use these these resources
Friends of the National Museum of the American Latino
The Friends of the National Museum of the American Latino strives to create a museum in our nation’s capital to educate, inspire and encourage respect and understanding of the richness and diversity of the American Latino experience within the U.S. and its territories. News and how to Take Action.
Pew Research Center: Who is Hispanic?
Analysis on statistics and identity.
AUDIO & VIDEO
Hispanic History - Timeline, Resources, Stories, Videos
Spanish Movies for Kids: G- and PG-rated Titles
Each year we’re seeing more Spanish movies for kids hit the theaters and streaming services. This is a list of family-friendly Spanish movies for kids (these are great movies for Spanish class as well!)
Chicano! History of the Mexican-American Civil Rights Movement
This documentary series chronicles the struggle for equality and social justice of the Mexican American community in the United States from 1965 to 1975.
Booklists and Recommended Titles
The Latinx Kidlit Book Database
Bilingual Picture Books in English and Spanish
Explore Latin American music and dance Grades 6-12
History: The Origins of 7 Key Latin Music Genres Grades 6-12
List of Genres:
- Latin Jazz Music – About
Latin jazz, also called Afro-Cuban jazz, IS a style of music that blends rhythms and percussion instruments of Cuba and the Spanish Caribbean with jazz and its fusion of European and African musical elements.
- Salsa Music
- Merengue Music
- Ranchera Music
- Tango Music
- Bolero Music
- Flamenco Music
- Reggaeton Music
- Latin Pop Music
- Bossa Nova Music
- Samba Music
- Norteño Music
- Corrido Music
- Danzón Music
- Cuban Rumba Music – Also, Cuban Music
- Cumbia Music
- Bachata Music
- Son Cubano Music
- Tejano Music
- Mariachi Music – Also, about Mariachi Music
- Banda Music
- Regional Mexican
- Latin Trap Music – Also, about Latin Trap Music | <urn:uuid:562bce38-6342-4069-848f-1a30c52fce8d> | CC-MAIN-2023-50 | https://www.nea.org/professional-excellence/student-engagement/tools-tips/hispanic-heritage-month?fbclid=IwAR1s5kMxk31OZxWMuX1Q42Dmb2WTumzt2wkBDDKnNy5iSnDcp2fmMThB800 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100227.61/warc/CC-MAIN-20231130130218-20231130160218-00655.warc.gz | en | 0.844458 | 1,029 | 4 | 4 |
It is a progressive brain disease slowly and gradually increases with time. The first symptom of this is patient faces difficulty with movement. Doctors discriminate these diseases into five different stages according to their symptoms. Even some people die due to this disease, although the chances are very low. This disease occurs when brain cells or neurons which used to control the movement get damaged or die. Generally, these neurons are an essential source of producing element that is known as dopamine. When these brain cells get impaired or die, the brain cannot produce enough dopamine, which leads to the problem in movement or the first symptoms of Parkinson’s disease.
Symptoms of parkinson's disease
The early sign by which anyone can recognize this disease at its early stage only are as follows:
Small, cramped handwriting
Decreased ability to smell (anosmia)
The main motor problems which are seen in this disease are as follow:
Stiffness in arms, legs, and trunk
Problems with balance
Secondary signs include the following:
Blank facial expression
The tendency to get stuck when walking
Decreased blinking and swallowing
Tendency to fall
Reduced arm swinging while walking
Other signs which are seen in this disease are as follow:
Problems with attention
Problem with visual-spatial relationships
Treatments of parkinson's disease
There is a mixed treatment for this disease, which depends on the patient’s lifestyle, proper medication, and different therapies. Proper rest, exercise, and a properly balanced diet is essential in this disease. There are some therapies like speech, occupational, and physical therapies that help improve communication and self-care are the most important in disease.
Crystal Healing Therapy
There are various crystals that are constantly used to get some relief in the symptoms of this disease. Many crystal healers recommend these crystals. There are various crystals, which were mostly recommended to the people who are suffered from this disease. Some of them are as follow:
Amethyst: It is a multipurpose healing gemstone used to cure many diseases and issues related to health. It helps in calming the anxiety as well as stimulates the mind. It is the best stone for the issues related to the mind. It brings emotional balance, soothes depression, tension, and improves mental condition and memory.
Cinnabar: It is a powerful healing crystal used to heal many problems. It is a great meditating gemstone that helps the person understands a better flow of energy from the world's source. It supports mental celerity. It stimulates the immune system and also purifies the blood. It brings strength and flexibility within the body.
Opal: It can be found in different colors out there, and each color is known for unique healing properties and totally different from each other. Basically, for Parkinson’s disease, pink opal is very beneficial. It helps in curing problems related to heart, lungs, spleen, and eyes as well. It is also helpful for hypoglycemia and diabetes.
Sugilite: Many people use this stone for treating Parkinson’s disease along with the amethyst. This crystal builds communication between the body and the mind. This will help in the treatment of symptoms of Parkinson’s disease. It is a spiritual gemstone and opens all the chakras in the body. It encourages positivity and alleviates sorrow, grief, and fear.
All these stones are the best crystals for treating Parkinson’s disease. | <urn:uuid:48f390d2-1465-41de-a92c-deb93396830a> | CC-MAIN-2023-40 | https://www.gemexi.com/blog/gemstone-healing/crystals-for-healing-parkinson-diseases | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233511284.37/warc/CC-MAIN-20231003224357-20231004014357-00635.warc.gz | en | 0.95241 | 751 | 2.515625 | 3 |
The critical thinking tools introduced here were developed by Dr. Sandra Kaplan, USC under the auspices of OERI, Javits Curriculum Project T.W.O., 1996. Ideas presented here are also adapted from Flip Book, Too Dr. Sandra Kaplan and Bette Gould
The Depth and Complexity Icons are visual prompts designed to help students go beyond surface level understanding of a concept and enhance their ability to think critically. These critical thinking tools help students dig deeper into a concept (depth) and understand that concept with greater complexity.
In fact, to truly understand something, one must be able to speak the language specific to that topic. One cannot have a critical understanding of that same topic without knowing the details, rules and patterns associated with it or understanding how it may have changed and the varied perspectives through which it is viewed.
As you examine each icon, pay close attention to the design, as it will help to reveal its meaning. Keep in mind that our goal is not to teach the icons themselves, but rather to utilize them as visual “thinking” tools to help students gain a critical understanding of a topic or concept.
Depth Tool- Language of the Discipline
The meaning of this icon is pretty self-explanatory. The lips represent specialized language related to a topic or concept. This language includes key words, phrases, signs/symbols, figures of speech, abbreviations, and the like.
For example, to truly understand a concept in mathematics, one must speak the “language of math”. A student being asked to add and subtract would need to understand not only terms such as “sum” and “difference”, but also be able to understand mathematical sentences which often include symbols: 27 + (16 – 5) =
In the study of the American Revolution, students would need to know the meaning of “Redcoat” and realize that it isn’t something one can purchase in a store!
Depth Tool- Details
As you consider the design of this icon, think about the details of the flower and how each part (flower petals, etc.) make up the whole flower. Details contain the information that enhance understanding. They act as supporting information to a big idea or concept (main idea). Details include: parts, factors, attributes, traits, and variables.
If we go back to our earlier math example: 27 + (16 – 5) = the details are the numbers themselves (the parts that make up the equation). Being able to discern important details of a story is key to one’s ability to critically analyze that text. While we can concede that one of the pigs in the story, The Three Pigs is wearing a red shirt, we can agree that the color of the shirt is extraneous and doesn’t lead to a deeper understanding of the story.
Depth Tool- Patterns
There’s no surprise that this icon represents patterns (note the circle, line, circle, and zig-zag pattern). If one were asked, it would be a fairly simple task to continue the pattern. Patterns are recurring elements or factors in ideas, objects, stories, and events. They are predictable, repetitive and ordered.
We see patterns in math: number lines, geometry; literature: “Little pigs, little pigs! Let me come in…” ; social studies: patterns in movement and settlement, behavior. The list goes on… Being able to move beyond simple identification of patterns to defining the cause and effect of a pattern or identifying relationships among patterns is rigorous and requires the ability to think critically.
Depth Tool- Rules
Rules are the organizational elements that create structure. This concept is an easy one for students, as they are surrounded by rules (at home, school, in sports, etc). Rules provide structure and represent organization and hierarchy. The meaning is reflected in the design of the icon, which itself has a clear structure.
This icon is often seen in science when looking at classifications. Students may encounter it when examining the structure of a text (compare and contrast, main idea and details, and the like). They may also be asked to apply mathematical rules (formulas) to solve a problem or utilize spelling and grammar rules in writing.
Depth Tool- Big Idea
The Big Idea indicates a generalization, principle or theory about the curriculum being studied. It often represents the focus of study or a learning task.
For example, the big idea of a science lesson might be the water cycle. The Big Idea design works well to help students organize the main idea of a story or paragraph (in the roof), which is then supported with evidence (pillars supporting the roof). Students use this with universal themes and generalizations.
Depth Tool- Ethical Issues
This element of Depth and Complexity represents moral principles (possible rights or wrongs). An easy way to remember the meaning: “Black and white/ right and wrong”. It represents conflicting points of view on events, ideas or issues and involves bias, values, or judgments.
Students will most likely encounter this dimension when analyzing literature or studying social studies. For example, students might be asked to consider ethical issues surrounding Spanish colonization and the establishment of missions along the California coast or to examine ethical issues surrounding a character’s behavior in a story.
Depth Tool – Trends
This is the icon I about which get the most questions. Trends represent the general direction of change. CHANGE is the key word here.
Trends can be explained by external factors or influences that contribute to the change. This icon is represented well by the line graph. Each spike and dip in the graph was caused by something (external factor or influence). Think cause and effect here. One example I like to use is the trend in schools to move away from hardback text books to e-books. What caused the change to go from one to another? Context is huge here! In this case, one reason the trend was caused was the availability of technology
This is different from simple change over time, because for a trend to occur, one thing has to replace, or compete with, another. It’s important to not only examine the “why”, but also the “so now what?” questions. What are the consequences, both intentional and unintentional?
Depth Tool- Unanswered Questions
These are questions about anything is is unsolved, unclear, or unproven. These can be ideas that have yet to be explored, are unresolved, or that have missing components (incomplete). Unanswered questions are good!
These are questions we need to pursue. Having said this, many students will be content with simply asking a question and leaving it at that. As educators, we need to push students to pursue the answers to these questions. These are typically questions that are not answered quickly and sometimes they aren’t answerable (yet), but they do have the potential to generate some good thinking and discussion.
Complexity Tool- Multiple Perspectives
This icon basically represents different points of view on ideas, events, people, and issues.
It often represents an “expert” viewpoint, and is dependent on time and place. This icon falls under the “complexity” section of the Depth and Complexity framework. This icon is easy for students to remember because glasses have lenses through which one must look to see something clearly. Multiple perspectives combines nicely with the other icons. For example, one could look at the different perspectives on rules or on details. One really couldn’t get a good understanding of a conflict without first looking through the different perspectives involved.
Complexity Tool- Change Over Time
This icon prompts students to explore a concept, event, or person as it relates to time (past/present/future).
Change is inevitable. This powerful tool facilitates a more complex exploration and can easily be applied across disciplines and combined with all the other Depth and Complexity Tools. Consider having students examine how and why rules change over time. How do changing perspectives impact changes in rules? For a different approach, consider having students explore why things haven’t changed.
Complexity Tool- Across Disciplines
This icon also falls under the complexity section of the framework.
The Across Disciplines icon prompts exploration of connections within, between and across subject areas. Although not used as often as some of the other tools, this icon supports understanding of how something relates to multiple disciplines. For example, students can examine natural resources across science, economics, history, etc. Questions students might explore – How does the California Gold Rush relate to science, economics, and history? Through what disciplines might we better understand the presidential election? | <urn:uuid:039f65d6-50f9-41d6-ac90-f57de9043c80> | CC-MAIN-2019-39 | http://envisiongifted.com/services/understanding-depth-complexity/ | s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514572289.5/warc/CC-MAIN-20190915195146-20190915221146-00296.warc.gz | en | 0.944666 | 1,791 | 4.28125 | 4 |
Sit in classrooms, eat in lunchrooms, romp on playgrounds and wander the hallways in randomly selected public schools in America: It’s right here, in the nation’s increasingly segregated and astonishingly unequal schools, where one finds the most convincing case for keeping affirmative action intact.
The most recent statistics–compiled, analyzed and released by the Civil Rights Project, at Harvard–reveal that America’s schools are now in their twelfth year of a continuing process of racial resegregation. The integration of black students, the new study shows, had improved steadily from the 1960s through the late 1980s. But, as of the 2000-01 school year, the levels have backed off to lows not seen in three decades.
It’s true that the Supreme Court decisions and the enforcement of the 1964 Civil Rights Act that followed the Brown v. Board of Education ruling forced the South to desegregate. The region went, between 1964 and 1970, from almost complete segregation to becoming the most integrated region. After 1974, however, school integration efforts outside the South were stymied by the Supreme Court’s 5-4 decision in Milliken v. Bradley, which prohibited heavily minority urban systems from including nearby suburbs in desegregation plans. School districts in the North usually run coterminous with municipal borders. Thus, Northern school districts usually reflect housing segregation rates, which are highest there. In the 1990s, a new set of decisions by a more conservative Supreme Court required that many large (and successful) desegregation plans be dismantled across the country.
Nearly 40 percent of black students in 2000 attended schools that were 90 to 100 percent black–up steadily from a low of 32 percent in 1988. In 2000, about one-sixth of blacks attended schools where 1 percent or less of their fellow students were white. In 90 percent of these schools, the majority of children were poor. The average black student, meanwhile, attended a school where just 31 percent of students were white.
Latino students are America’s most segregated minority group and have become steadily more segregated in recent decades. The average Latino student now goes to a school that is less than 30 percent white, a majority of the children are poor and an increasing concentration of students do not speak English.
Segregation is not a word commonly associated with white students, though it should be. Whites are the most racially isolated group in America’s public schools. Statistics from the 2000-01 school year show that the average white student goes to a school where 80 percent of students are white. Only whites who live in the South and West have experienced increased racial integration over the years. | <urn:uuid:b3f8c951-ab73-41f8-b998-e86953098f9c> | CC-MAIN-2016-30 | https://www.thenation.com/article/back-segregation/?quicktabs_most_block=0 | s3://commoncrawl/crawl-data/CC-MAIN-2016-30/segments/1469257829320.91/warc/CC-MAIN-20160723071029-00193-ip-10-185-27-174.ec2.internal.warc.gz | en | 0.969425 | 548 | 3.421875 | 3 |
There’s no doubt that if every farm could get rid of disease they would be a lot more profitable. But being realistic, disease, no matter how underlying, is here to stay.
But the solution to living with disease is much more than relying on specialist diets and medicines, it’s about tinkering at the edges and maximising feed intake by other means, says Primary Diets managing director Paul Toplis.
“Every pig is compromised by having an active immune system and all farms will have some form of disease challenge, no matter how minimal. The problem is when you get a disease-challenged pig, their appetite goes down, so then if you can do anything to make it easier for pigs to get more food in to them then that is helpful.”
Disease can induce an enormous amount of inertia among pig producers, but Mr Toplis reassures farmers that they can make things better even when their position is compromised by disease.
“The greatest payback will come not from diet adjustments, but from efforts to increase feed intake. Making several small improvements is worthwhile, because it will increase feed intake and growth rate, as well as improving the feed conversation ratio that ultimately reduces feed costs a pig.”
He suggests that by having a check list of 10 key simple areas, farmers can help maximise feed intake on their unit.
Producers should check:
• Feed and water availability
• Feed specification, energy and feeder setting
• Pellet quality/grist/dust
• Bulk density
• Wet feed, volume, frequency, fermentation etc
• Stocking density and wastage
• Are the figures robust
• Do pigs “stall” at any stage
• How does it tie in with growth and grading
“For example, a lot of farms are built on the basis of producing 22 pigs a sow a year, but they are now producing 24-25 pigs which means more pigs a pen. This in turn puts pressure on access to food and water. So every effort to try and increase feed intake will be paid with a reward,” he says.
And research has shown that the biggest loss of performance in disease-challenged pigs comes from reduced feed intake, says Mr Toplis.
“Trials have shown that 70% loss of performance in disease-challenged pigs comes from reduced feed intake and 30% loss of performance comes from the animals having a more active immune system, which means nutrients are diverted away from growth to antibody production. This just reinforces the argument about maximising intakes.
“It’s important to remember that a healthy pig’s aim in life is to maximise lean meat growth, but when infected, their priority is to maintain survival and make sure their immune system is working.”
Rattlerow Farms, Suffolk
Pig farmer Robin Brice has been using a natural feed additive for the past three years on some of his units and says using it has not only improved the health of his pigs, but has improved growth rate and feed conversion.
“We believe it is important to invest not only in providing a good and healthy environment for pigs but to also feed good-quality feed,” says Mr Brice.
But the natural additive that he feeds at a rate of 2kg for every tonne in weaner diets and at 1kg a tonne in finisher diets has not only helped improve growth rates it has also improved the environment for the pigs and, in turn, pig health.
“The additive we use binds ammonia and so reduces the amount of ammonia in the accommodation. So directly the product not only improves gut health, it also has improved the environment – so much so that when you walk through the accommodation you don’t leave smelling of ammonia,” he says.
Mr Brice also says tailoring the feed with this additive has improved FCR and growth rates by 6-8%. “The improvement in production means it is definitely cost-effective to use,” he adds. | <urn:uuid:9767d07c-83a7-46c0-a53c-9ae589d55620> | CC-MAIN-2018-26 | https://www.fwi.co.uk/livestock/feeding-pigs-is-much-more-than-nutrition | s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267864822.44/warc/CC-MAIN-20180622220911-20180623000911-00513.warc.gz | en | 0.962997 | 836 | 2.6875 | 3 |
Happy (American) Labor Day from Biblio!
Even though approximately 40% of Americans will be working on Labor Day, we hope you all get to enjoy some of the last bit of summer before that nip of fall hits the air.
The plight of the working man and woman has long been a focus in literature, and we have collected some amazing works of fiction that showcase the struggles and triumphs of various labor movements. Many of the books featured below are classic works of American and European literature, and there are many rare and antique books that could be included. Even though these books were written decades ago, they continue to hold special significance in the ongoing discussion of labor rights and organizing political power in our societies. The passion these authors so clearly hold for their fellow person is truly inspiring, and if you are interested at all in worker’s rights, you would be captivated by any of the books listed below:
Wired has a great article on labor issues explored in fantasy and science fiction, and has particularly powerful words to say about labor issues that can be found even in works like Harry Potter, writing, “Using a powerful-yet-oppressed magical people like the house elves to explore those issues, in addition to having a character like Hermione who is staunch in her activist beliefs even while derided by her all-magical classmates, allows kids (and adults!) to draw a clear and powerful parallel between the fantasy they love and the realities they are forced to confront in their everyday lives.”
We at Biblio hope you and your family have a fun and safe Labor Day today! | <urn:uuid:24fb67ac-97d2-40d2-aebf-b55fd4c33497> | CC-MAIN-2018-17 | https://www.biblio.com/blog/2013/09/labor-literature/ | s3://commoncrawl/crawl-data/CC-MAIN-2018-17/segments/1524125946165.56/warc/CC-MAIN-20180423184427-20180423204427-00379.warc.gz | en | 0.972475 | 329 | 2.546875 | 3 |
GAZA CITY – At precisely 12 noon on a Thursday afternoon, among the rolling sandy hills in southern Gaza, a controlled explosion destroys another round of white phosphorous shells left in Gaza following the 2008-2009 Israeli war on Gaza.
Explosives experts from the Mines Advisory Group (MAG) and the United Nations Mine Action Team (UNMAT) are working together to eliminate the remainders of a deadly Israeli attack. The Israeli bombings from land, sea and air left behind large amounts of unexploded ordnance (UXO) in civilian areas.
In a precise, technical routine which takes into account all possible dangers to the MAG and UNMAT workers as well as Palestinian residents living in Gaza, the explosives experts are, detonation by detonation ridding Gaza of the remaining white phosphorous shells.
In order to deprive them of oxygen, shells are first sealed in plaster casts, then moved into large sand-filled containers, until their day of detonation.
Controlled detonations occur twice weekly, coordinated with the Hamas government and the Israeli army, whose war planes fly over the detonation site during the afternoon.
On the day of the seventh round of UXOs to be detonated, there are eight shells to destroy. Two are completely full and six are broken open but unexploded.
Inside each shell are 122 sponges soaked with the lethal chemical, designed to scatter far upon explosion.
"Some white phosphorous shells can be only liquid," explains Mark Buswell, MAG’s technical director. "But the kind used in Gaza were sponges, more difficult to get rid of."
The use of sponge-filled white phosphorous shells by Israel’s in its attack on Gaza 18 months back also meant that the probability of injuring civilians was greater.
The controlled detonations stop these shells harming civilians in the future and allow the lethal chemical weapon to burn off in containment pits in the ground, far enough away from the nearest houses to cause harm.
Twenty minutes after the first detonation, when the majority of the thick, white smoke has burned off and dissipated, MAG technicians prowl for stray sponges, move them to the pit, and re-ignite them together.
A solitary clump burns in five to ten minutes, although if covered by sand it can lie dormant for days, re-igniting with the poke of a child’s stick or kick of a shoe.
Jim Hill, a Canadian medic working with MAG in Gaza, explains their work. "We are here in case there are injuries from white phosphorous burns, smoke inhalation or unexpected detonations resulting in injuries."
Hill and other medics accompany the team as it slowly safeguards sites where the rubble clearance has finally begun, well over a year after the destruction.
With over 4,000 houses completely destroyed and 16,000 houses partially or badly damaged, the risk of UXOs is huge.
Buswell says their work is only just beginning.
Israel’s 23-day-war on Gaza December-January 2008-2009 killed more than 1,500 Palestinians, and left more than 5,320 wounded. Among the casualties were those hit or affected by white phosphorous bombings.
"When white phosphorus lands on skin it burns deeply through muscle and into the bone, continuing to burn until deprived of oxygen," says Amnesty International.
Dr. Nafez Abu Shaban, head of the Burns Unit in Al-Shifa Hospital of Gaza City, told the Palestinian Center for Human Rights (PCHR) that he was seeing patients "who sustained severe burns due to which the muscles and body cells are completely destroyed."
Among Israeli soldiers’ targets were homes, schools where thousands of Palestinians were taking refuge, UN buildings storing humanitarian aid, and hospitals. Over half of Gaza’s 27 hospitals and 44 medical centers were destroyed or damaged.
The Al-Quds hospital in Gaza City and the Al-Wafa Rehabilitation Center east of Sheyjayee — housing over 50 patients, the majority invalid and dependent on life-support machinery — suffered multiple bombings, including direct white phosphorous hits.
Israeli officials first denied using white phosphorous but later admitted and justified its use as a smokescreen for soldiers.
The International Committee of the Red Cross (ICRC) says its use among a concentration of civilians is "simply prohibited", and notes that white phosphorous can spread up to several hundred square meters, with the "potential to cause particularly horrific and painful injuries or slow painful death."
Over a year after the Israeli war on Gaza, the risk of UXO poses as real a threat as the fresh bombings.
These UXOs may detonate even decades later, MAG notes. In rural areas farmers ploughing or workers scavenging stones and steel can inadvertently set the bombs off. The anti-tank mines used by Israeli soldiers to demolish houses, and several of which remain, pose a risk to workers removing rubble or to families returning to their homes to sift for belongings.
As of August 2009, the UN reported 12 people killed from UXO explosions, six of who were children. Twenty-three were reported injured, including four children.
In March 2010, UNMAT and MAG began to destroy the 343 UXOs collected so far, including white phosphorous shells.
Mark Buswell compared the threat of an explosion in Gaza to "an explosion which could damage a city center area the size of the City of London (2.6 square kilometers)."
(Inter Press Service) | <urn:uuid:16dd293a-2e66-4122-928c-83e8827f0562> | CC-MAIN-2022-27 | https://original.antiwar.com/bartlett/2010/07/07/these-explosions-are-saviors/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656104512702.80/warc/CC-MAIN-20220705022909-20220705052909-00190.warc.gz | en | 0.949135 | 1,127 | 2.546875 | 3 |
- 1 Saskatchewan, Canada
Saskatchewan is a landlocked prairie province covering an area of over 588,000km2. The provincial highway system consists of over 26,000km of road. Add the municipal roads for a total of 190,000km, and Saskatchewan boasts the most kilometers of road of any province in Canada.
Cities in Saskatchewan (incomplete):
- Prince Albert
- Moose Jaw
- Swift Current
- North Battleford
State of the map
- Thanks to osm editor "gecho111" most of populated Saskatchewan now has rural grid roads!
- The University of Saskatchewan in Saskatoon needs updating!
Tagging guidelines for Saskatchewan
The following documents were referred to while developing these guidelines.
- http://www.highways.gov.sk.ca/docs/maps/rural_road_class_02.pdf [ dead link ]
- http://www.highways.gov.sk.ca/docs/reports_manuals/reports/rrc_criteria.pdf [ dead link ]
- http://www.highways.gov.sk.ca/docs/maps/nhs.pdf [ dead link ]
Highways and roads
This guideline has been updated to reflect current (2013) tagging standards and to follow predominant Canadian tagging guidelines.
The Rural Road Classification map now classifies many roads simply as Saskatchewan Highways. Roads that may have been class 1/2 (red) now are primarily marked as SK Hwy.
NHS Core Routes
- The routes, as defined by the National Highway System , for Saskatchewan are:
- Highway 1 (Trans-Canada) from Manitoba to Alberta (Where not already motorway)
- Highway 2 from Moose Jaw to Hwy 11
- also from Prince Albert to La Ronge
- Highway 6,39 from Estevan/US Border to Regina
- Highway 7 from Saskatoon to Alberta
- Highway 10 from Hwy 1 to Yorkton
- Highway 11 from Regina through Saskatoon to Prince Albert
- Highway 16 (Trans-Canada) from Manitoba to Alberta
- All other provincial highways (numbers 2-39 and 41, not including those already classified as trunk. Generally, these are class 1 roads drawn in red on the rural road class PDF linked above.).
- Provincial highways (numbers 40 and 42-99. Green or blue on rural road class PDF above.)
- Main routes through cities that are dual-carriageway with speed limits typically 60km/h or above even if they are not a highway route through the city.
- Provincial highways (numbers >= 100. Orange or pink on rural road class PDF.)
- Township roads, range roads, concession roads, and regional roads.
- Dominant roads in suburban areas generally with speed limits of 50 to 60km/h. (ex. for the residential road that is wider than others and leads to the traffic signal to leave the neighbourhood.)
- Normal roads in non-residential areas.
- Rural roads that are not part of the numbered highway system and grid roads. In Saskatchewan, grid roads are north/south or east/west roads spaced at 1 mile (1.6km) intervals. See: w:Dominion Land Survey. Make sure to tag gravel grid roads as surface=unpaved.
- Mark residential roads as residential. Consider promotion to tertiary were applicable.
- Use for roads that provide access to businesses and for alleys.
- Highways should get a surface tag indicating paved or unpaved. If there is no surface tag, the assumption is paved.
- Highways with one lane in each direction should be tagged as lanes=2, highways with two lanes in each direction should be tagged as lanes=4, etc. A divided highway with two lanes on each carriageway should have two separate ways, each tagged with lanes=2. If there is no lanes tag, the assumption is 2. This follows precisely the tagging procedure described at Key:lanes.
- All highways should have ref tags added indicating the highway/road number. Those that are named (e.g. the Trans-Canada highway, the Yellowhead, Louis Riel Trail) should also have name tags.
The Garmin MapSource (Windows) Installer file is available here http://www.mediafire.com/file/wd14gl2zgzj/OSM Routable Sask 30 April 2010.exe created from the OSM download of the outline of the province from http://downloads.cloudmade.com/north_america/canada/saskatchewan#downloads_breadcrumbs | <urn:uuid:d7be75cc-727e-40c8-97c6-f0ba617657b8> | CC-MAIN-2017-17 | http://wiki.openstreetmap.org/wiki/Canada:Saskatchewan | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917125881.93/warc/CC-MAIN-20170423031205-00017-ip-10-145-167-34.ec2.internal.warc.gz | en | 0.895023 | 966 | 2.828125 | 3 |
Requested resource is not accessible
I show you how to create a basic floor plan, including windows and doors.
What are the learning outcomes for this course?
- Learn how to choose and edit a Style to create a technical floor plan
- Become familiar with the various drawing tools to create a basic floor plan, including the following: Tape Measure tool, Line tool, Rectangle tool, the Offset tool and the Arc Tool
- Use the various drawing tools to create doors and windows
- Learn how to create Groups and Components
The Floor Plan You’ll Be Creating In This Course
SketchUp Floor Plan with Windows and a Door
Who is the Target Audience?
- This course is aimed at Interior Designers, Interior Design students, Interior Decorators, Interior Architects, Interior Stylists and Home Staging professionals, with no previous (or very limited) knowledge of SketchUp.
- Register with the SketchUp Hub, for free access to one of the video tutorials for this course: ‘Choosing and Editing a Style’! Go to the ‘Curriculum’ tab and scroll down to where the ‘Free’ label is, and click on the title of the video tutorial to view. Easy, peasy!
- When you register with the Hub, you’ll also receive a free eBook on our expert tips when producing accurate, professional and creative floor plans.
- This course will provide you with the necessary SketchUp skills to create an accurate (technical) floor plan based on real life dimensions, including the construction of windows and doors, as per recognised technical drawing symbols. You will learn how to create a floor plan accurately and efficiently, and in a professional manner, to support your design processes when considering layout and traffic flow. This basic floor plan will be the foundation from which you will add further detail in course #3, where you will add a furniture layout and lighting plan. Ultimately, this floor plan will be used to assist your design workflow and to facilitate discussion with clients when communicating design proposals.
- Includes downloadable files.
- Once you purchase this course, you’ll be entitled to unlimited access and dedicated one-to-one support for the duration of your course (and in many cases long after you have completed it!) Use this support to get additional help when navigating the online learning platform, or to request assistance when learning SketchUp. Don’t forget to check out the discussion forums, where you will find additional sources of support!
This course is part of our SketchUp Bundle: buy the Bundle course and save 37%! Read more here!
This course has been given CPD accreditation by the British Institute of Interior Design. Learn more here.
PLEASE READ OUR FAQs BEFORE PURCHASING THIS COURSE
Posting a Review
- Once you’ve completed the course, we would really appreciate if you could take two minutes to post a review! Check out the video in our Forum, for more information on how to do this. | <urn:uuid:efb9305e-fbfb-46db-bb2d-d1f4cb7368d6> | CC-MAIN-2022-27 | https://sketchuphub.com/course/floor-plan-sketchup-tutorial/?error=not-accessible | s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656104683683.99/warc/CC-MAIN-20220707033101-20220707063101-00588.warc.gz | en | 0.896899 | 643 | 2.90625 | 3 |
I originally wrote this for a statistical literacy course. It is not original, in the sense that it draws from other such ‘do’ and ‘don’t’ lists from various places as well as my own experience. I’m sure it could be improved, so comments suggestions and debate are very welcome.
The seven mortal statistical sins
Numbers are often an essential way to present clear and concise evidence for an argument. However they can be used well or badly. The following rules set out some common errors.
1 No measurement is perfect but some measures are more perfect than others (measurement error).
Numbers are only as good as the people who produce them. Any number depends upon the clear definition of what is measured and how it is measured. Very often it is difficult or impossible to precisely measure what is actually wanted (i.e. to obtain a valid measurement) in a way that will give consistent results whenever it is repeated (reliable measurements).
Numbers are more robust if they are based on definitions and means of measurement that are widely agreed, and whose strengths and weaknesses are well understood. Where there is controversy, the definition or measurement method used should be made clear. The source of numbers should always be provided.
Comparisons over time or across different groups can only be made if the measurement method stays the same. Extra care has to be taken when information from different sources is used to make such comparisons. Definitions used by different organisations rarely coincide exactly. Even within the same survey instrument question wording may change over time or new response categories may be added. Results can be influenced by the context within which a question is asked (including what questions have come before it). Comparisons across countries or language groups pose special problems.
Often it is sensible to report a range within which the true value of a measurement is thought to lie, but without both upper and lower limits, such ranges become meaningless. ‘Up to 99% of people’ includes the number zero; ‘as few as 1%’ does not rule out 99%.
Orders of magnitude matter. It is easy to misplace a decimal point or confuse a million with a billion, and thus get a number wildly wrong. Numbers should be presented with some readily recognisable comparison that make their magnitude comprehensible, and also makes the detection of such errors more likely.
2 Percentages or proportions have a base (denominator) which must be stated.
Percentages express numbers as a fraction of 100. If what that 100 comprises is not stated, then the meaning of the percentage will be unclear or misleading. Growth rates will depend upon the base year from which growth is measured. It is easy to confuse different groups of people on which percentages are based. E.g. does ‘working women’ refer to all women who do work, paid or unpaid; those currently in the labour force; those in employment; employees; employees working full time hours, and so on. Note too the ambiguity in english phrases like ‘the percentage of working women (who …)’: Does the % refer to the fact that they are women? or that fact that they work? or the fact that they do both?
When the base is itself a percentage, as often happens when change is discussed, this presents two further problems.
The first is the confusion of absolute and relative change. If the growth rate rises from 2% to 3%, that is a 50% increase not 1%, but better expressed as a ‘one percentage point increase’ in the rate of growth. In this context the absolute change probably gives a better sense of what is happening than the relative change.
The second is the multiplication of the margin of error contained in calculating relative change on the basis of small numbers that themselves have a margin of error. E.g. a survey may show that over a period of time the number of people in a particular category has increased from 5% to 15%. This could, correctly, be described as a 300% increase. However it is from such a small base that the impression created is misleading. The obverse, that the number of people not in this category has declined from 95% to 85%, suggests a much more modest change, and one that will be less influenced by error in the original data because the absolute size of the base is larger: a few percentage points either way makes much less difference to 95% than 5%.
Incidence and prevalence are often confused. Incidence is a time based measure: those ‘at risk’ within a given time period experiencing an event: 10% of people caught a cold in 2009; 2% of motorists had an accident in 2009. Prevalence refers to a state of affairs at a point in time: on 1st December 2009 3% of people currently had a cold; on 1st December 2009, 24% of motorists had ever been involved in an accident.
3 The average may not be the same as ‘typical’, and will not be universal.
Averages summarise a lot of information in a single number. This makes them very useful, but their limitations should also be borne in mind. Averages may describe the most typical condition, but they may also describe a highly atypical mid-point between two or more very different conditions. Wherever there is variety, many cases may not be close to the ‘average’ and a few cases may be very far from it. This need not make such cases either ‘abnormal’ or unusual.
Distributions around an average may not be symmetrical. If there are a small number of cases with very high or very low values, this can drag the average up or down. When this is the case the ‘median’, the value of the case with the middle value when all cases are ranked, gives a better guide. Earnings are typically skewed in this way, so that substantially fewer than 50% of earners earn above ‘average’ earnings, but the level of ‘median’ earnings will divide earners into two equally sized groups.
4 Highly unusual events may be fairly common
The probability that an event will occur depends not only upon what the chances are of it occurring in a given situation, but also upon the number of such situations (the base). The chances of winning the lottery are very low, but since millions buy tickets each week, there are regular winners. The occurrence of an unusual or unexpected event is not, in itself, evidence that some special factor must have caused it, especially if there are many situations in which it might occur (‘the Texan sharpshooter’ fallacy). Many events and states of affairs follow an approximately ‘normal’ distribution in which fewer cases are found, the further one travels from the value typical of the ‘average’ case. Unfortunately there have been several miscarriages of justice in which people have been convicted because it has been wrongly supposed that the chances of a particular event (e.g. a death) occurring by chance have been so small as to point towards the culpability of the defendant. The problem is that any unique ‘event’, whether common or not, has the same unimaginably small chance of occurring. Thus the probability of having each individual lottery number is the same. It is also the probability of having the winning number. What is different is the probability of having a number that is not the winning one!
Repeated measures of the same phenomenon regress towards the mean, showing spurious improvement or deterioration. Because no measurement is perfect, it contains some element of random error. To the extent that results towards the extreme ends of a scale (e.g. the ‘best’ and ‘worst’ performers) contain more of such error, repeating the measurement of performance is likely to lead to results less far from the mean, even if there has been no change in the underlying value of the characteristic that is being measured. This should always be taken into account when analysing the performance of e.g. ‘failing’ schools or hospitals, accident blackspots, and so on.
5 Correlation is not causation
Natural sciences and medicine frequently use randomised control trials to get evidence about cause and effect. If, on average, two groups in the experiment are the same to start with (randomised), and only one group is subjected to the experimental condition, any difference between this experimental group and the control group must, on average, be caused by the experimental condition. Evidence of cause and effect in human affairs is much harder to produce because only observation is usually possible, not experiments. We can observe correlations between conditions (sex and earnings; age and religious belief; unemployment and crime; social class and voting preference etc.) but this is not evidence, in itself, of causation. It is stronger (but by no means conclusive) evidence of causation if it can be shown that, aside from the characteristics under discussion, the different groups in what is thought to be the causal category (e.g. men and women; young and old; employed and unemployed, are otherwise similar in terms of any relevant characteristic). This is what social scientists or economists mean when they refer to ‘control’. In the absence of such control, correlations may simply be ‘spurious’: the product of another, prior, causal factor. For example there is a high cross-country correlation between the number of mobile phones in a country and the rate of infant mortality: more phones are associated with fewer infant deaths. It would be foolish, however to think that mobile phones saved infant lives: both are the results of a prior factor: the level of economic development.
Observational or experimental studies rarely, if ever, claim to discover ‘the’ cause of a condition or state of affairs. Usually such claims concern the possible size of one or more contributory causes among many.
6 Surveys are a product of their samples.
Sampling makes it possible to get information about a population that is usually too large and expensive to measure directly. But it can do so only if the sample has been systematically selected: usually by random selection. ‘Convenience’ samples, especially those in which members of the sample select themselves in some way, describe little more than the sample itself. Many ‘surveys’ used to promote products or publications take this form and have no more than propaganda value.
A ‘selection effect’ also operates when a group of people or things apparently defined by one characteristic is also defined in whole or in part by another one, either by dint of the method of their selection, or because of a strong correlation between the two characteristics. Selection effects can be extremely powerful. A recent, prominent example is given by Ben Goldacre, who has drawn attention to the way in which studies of the effect of pharmaceutical drugs are much less likely to be published if the results of the study is that the drug has no effect. Journal editors prefer to report what they think of as substantive results rather than non-results. The effect of this is to bias public knowledge of any drug towards the conclusion that the drug is effective. Studies with positive results are selected for publication, and then the assumption tends to me made that these published studies comprise all studies that have been undertaken.
The likely accuracy of estimates of the characteristics of populations obtained from random samples depend upon the relevant number in the sample, rather than the population. Thus estimates about small sub-sections of the population (e.g. teenagers; single mothers; widowers; the self-employed; a minority ethnic group) may be liable to large errors. Surveys may also suffer from response bias if a substantial proportion of people choose not to respond to the survey, and there is reason to think that their characteristics may differ from those who choose to respond.
7 Significance is not substance
When working with random samples, economists and other social scientists often test any finding they obtain by calculating the probability that it is a result of chance sampling variation rather than a pattern that actually exists in the population. Conventionally a level of 5% probability is chosen, sometimes referred to as ‘statistical significance’. In this context significance means neither ‘important’ nor ‘substantial’: it just describes how unlikely it is that such a finding could have occurred randomly. It also means that up to around one in twenty ‘results’ are due to chance sampling variation, but, of course, we cannot know which ones. This is why replication is an important part of both natural and social scientific research.
© John MacInnes University of Edinburgh 2013. | <urn:uuid:5d911bcb-02f3-4bd5-a0d0-66c06f1aafff> | CC-MAIN-2017-09 | https://qmteaching.wordpress.com/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-09/segments/1487501170651.78/warc/CC-MAIN-20170219104610-00568-ip-10-171-10-108.ec2.internal.warc.gz | en | 0.96412 | 2,602 | 3.625 | 4 |
Graphic from Metro Creative
Answers to Go
SAN MARCOS PUBLIC LIBRARY
625 E. HOPKINS ST.
Q. How did Martin Luther King Jr.’s birthday become a holiday?
It took 32 years A. for MLK day to be approved and recognized by the Federal government as well as the states.
On April 8, 1968, just four days after Martin Luther King, Jr. was assassinated in Memphis, U.S. Rep. John Conyers introduced the first motion to make King’s birthday a federal holiday. Still, it would take 15 years of persistence by civil rights and labor activists for the holiday to be approved by the federal government and an additional 17 years for it to be recognized in all 50 states. (NMAAHC) However, John Conyers was not deterred. He continued to introduce legislation every year with the support of the Congressional Black Caucus and labor leaders. The bill would likely have died in committee, and stayed buried, had it not been for thousands of working-class Americans — most of them Black, but also white, Asian and Latino — who risked their jobs over the next fifteen years to demand the right to honor a man they viewed as a working-class hero. Throughout the 1970s, unions repeatedly voiced — and walked — to demonstrate their desire for the holiday. Union officials demanded a paid holiday in contract negotiations, and individual members were asked to donate a “significant portion” of their holiday pay to the campaign. United Autoworkers also contributed funds and made the holiday a standard contract demand. (Jones) Heated debate in Congress held up making it a federal holiday. Representative Katie Hall of Indiana reintroduced a new MLK Day bill in 1983, but it faced opposition led by North Carolina senators Jesse Helms and John Porter East, with Helms insinuating King’s opposition to the Vietnam War made him unpatriotic and unworthy of his own holiday. In 1983, Helms presented the Senate with a lengthy document that included accusations that Kind had Communist ties, which infuriated New York Senator Pat Moynihan, who threw the document on the floor and stomped on it with his feet. Eventually, the bill managed to pass the House of Representatives in August of 1983 and the Senate that October. (Jackson) President Ronald Reagan signed the bill into law on Nov. 2, 1983 making it a federal holiday. However, it took several more years for every state to get on board.
Alabama and Mississippi technically celebrated the civil rights leader’s holiday, but they have combined it with a celebration of Confederate Gen. Robert E. Lee. While South Carolina does have a Martin Luther King holiday, its observance is optional. State workers can choose between that day and three separate confederate holidays to take off.
In Texas, it wasn’t until 1991 that the state passed, and the governor signed legislation that officially observed MLK Day as a state holiday. Today, it is the only federal holiday designated as a National Day of Service to encourage all Americans to volunteer and improve their communities.
On Saturday, Jan. 15, from 10:30 a.m. to 12:30 p.m., join the Dunbar Heritage Association at the Library (625 E. Hopkins Street) for a family-friendly event with stories and fun crafts to learn and celebrate Dr. Martin Luther King, Jr. We’ll have lots to do for children of all ages, with special break-out groups for children ages 3-5, 6-9 and 10-teen. The library will also have, beginning Monday Jan. 10, a “take and make” craft to celebrate MLK Day. Pick up one early in the week since supplies are limited.
• Jackson, J. (2021, January 18). The history of how Martin Luther King Jr. day became a holiday. Newsweek. Retrieved Dec. 21, 2021, from newsweek.com/ mlk-day-history-1562032
• Jones, W. P. (2015, June 29). Working-class hero. The Nation. Retrieved December 21, 2021, from thenation.com/article/archive/working-class-hero/
• NMAAHC, National Museum of African American History & Culture. The 15 Year Battle for Martin Luther King, Jr. Day | National Museum of African American History and Culture. (2021, January 13). Retrieved December 21, 2021, from nmaahc.si.edu/ explore/stories/15-year-battle-martin-luther-king-jrday
Suzanne Sanders is the new columnist for the library. She is the Community Services Manager for the San Marcos Public Library and came from the Austin Public Library in 2015 after having served there as a librarian for over 20 years. She gratefully accepts your questions for this column. | <urn:uuid:0763fb19-3736-407e-bffc-baa5d773a98b> | CC-MAIN-2022-27 | https://www.sanmarcosrecord.com/features/answers-go-63 | s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656104293758.72/warc/CC-MAIN-20220704015700-20220704045700-00001.warc.gz | en | 0.964751 | 1,011 | 3.84375 | 4 |
Crowns & Bridges
A crown is a tooth-shaped cover placed over a tooth that is badly damaged or decayed. Many people call it a cap. Crowns may be placed for several reasons. Usually, the tooth has been broken or severely damaged by decay. As a result, a filling can’t replace enough of the tooth or make the tooth strong enough. A crown may hold together parts of a cracked tooth. It also can be used to hold a bridge in place. Crowns can be used to improve appearance as well. They may be placed to cover misshapen or badly discolored teeth. Crowns can be made ahead of time (prefabricated) or made to order in a laboratory. Prefabricated crowns are made of plastic or stainless steel. They can be used on a temporary basis until a permanent crown is made.
Dental bridges literally bridge the gap created by one or more missing teeth. A typical bridge consists of 2 crowns, 1 on each side of the gap created by the missing tooth and a false tooth that fill in the gap and is attached to the crowns. These 2 crowned anchoring teeth are called abutment teeth. These supporting teeth can be natural teeth or dental implants. The false tooth/teeth in between the anchoring teeth are called pontics. Bridges can be made from gold, alloys, porcelain or a combination of these materials. There are three main types of bridges: fixed, cantilever, and bonded. | <urn:uuid:dab8d038-9c30-4dd7-b8f2-356fda2aa3c8> | CC-MAIN-2021-25 | https://glauserfamilydentistry.com/general/crowns-bridges/ | s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623487611320.18/warc/CC-MAIN-20210614013350-20210614043350-00290.warc.gz | en | 0.954868 | 310 | 3.453125 | 3 |
The future of automated industries may be playing out in a New York toy fair. As adults worry about whether people will need a basic income to supplement lost earnings from robots taking over jobs, kids are putting together new machines and learning how to make them do their bidding. A new generation will grow up knowing how to make robots their masters.
The 114th North American International Toy Fair, a convention running from February 18th through to the 21st at New York City’s Javits Center, is a center point for new trends in toy technology. This year, 24 exhibitors mention robots in their description. It might sound like child’s play, but the products on display show that manufacturers are considering how the robo-revolution will change the demands of future industries.
It’s no secret that an economy shifting towards automation will require different sets of skills. The Obama administration produced a report in December looking at robot automation. The report concluded that the best way forward was to invest in artificial intelligence, rethinking the social safety net and, yes, educating Americans so they can take on the jobs needed in the future.
At the Toy Fair, several products are teaching kids how to build their own robots using simplified parts. One example of this is Tinkerbots, which uses simple rearrangeable building blocks, paired with a smartphone app, to create imaginative new designs:
Another product is Tami, a block building system created by Robotron. The blocks are interesting in that they come in both non-robotic and robotic forms. Kids can make simple designs using the basic Tami blocks, before moving onto simple and advanced Robotami kits, some of which use touch and infrared sensors to teach the basics of hardware creation and software programming.
Other toys focus more on the software side than on hardware. WowWee is the creator of Coji, a robot that teaches kids how to code using a smartphone app. The bot responds to input via the app, and it’s up to kids to work out how various emojis will string together to create commands. Similarly, Wonder Workshop are the makers of the Dash and Dot pair of robots, which interact with smartphone games that teach basic programming logic in an easy-to-understand interface.
The automation of kids’ toys can’t come soon enough. Tesla CEO Elon Musk claims that automation is going to transform the workforce, and a universal basic income will be necessary within 20 years of the first autonomous car hitting the road, which could be as soon as this year. Familiarizing kids with the shifting robot landscape will be crucial to helping the next generation understand this new world of technology. | <urn:uuid:1dc225d0-3576-46ee-afcb-0dc38b889b3d> | CC-MAIN-2020-24 | https://www.inverse.com/article/28078-new-york-toy-fair-kids-robots-adults-automation | s3://commoncrawl/crawl-data/CC-MAIN-2020-24/segments/1590347415315.43/warc/CC-MAIN-20200601071242-20200601101242-00120.warc.gz | en | 0.931093 | 543 | 2.90625 | 3 |
My longest stop in Mexico was a visit to the Pronatura Noroeste (BirdLife partner in Mexico) project on Thick-billed Parrots Rhynchopsitta pachyrhyncha around Madera, Chihuahua. The team, including Francelia Torres, are working on nesting ecology, ranging behaviour and other aspects of the ecology of this Endangered species, work which started in the 1990s by people like Tiberio Monterrubio-Rico, Ernesto Enkerlin Hoeflich, and the current director of Pronatura, Miguel Cruz.
|Thick-billed Parrot pair by nest hole in dead Trembling Aspen (Photo: Stu)|
The current research is working on several aspects of the species’ ecology, all aimed at stabilising, or hopefully boosting, the numbers of the ‘Cotorra Serrana Occidental’ (as the species is known locally) in the pine forests. These efforts, as with many parrot species, focus on maintaining and, hopefully, increasing reproductive output.
|Pine forests of Tutuaca - here the Cotorros nest in huge conifers (Photo: Stu)|
Researchers are counting parrots as they arrive at habitual drinking sites. During our visit Eduardo Cortés, a Pronatura biologist, took some high resolution photos of birds arriving at the drinking site, a small waterfall, and could quite easily recognise the white bills of juveniles against the dark ones of adults. This age identification may have useful applications in this population, as it may have with other parrots (see ‘Eyeing up the population structure of Grey Parrots’).
|A pair looking forward to doing its bit for the survival of the species (Photo: Stu)|
They are also looking at feeding ecology. For a species which eats mainly conifer cone seeds, there would seem to be a lot of food in these forests! But a closer look may reveal some more picky selection of trees to feed in, and, possibly, times of the year when food is relatively
|Decades of logging has seriously reduced nest hole availability (Photo: Stu)|
|Above - Nest box positioned in small Pine; |
Below - Manuel climbing to check nest box contents (Photos: Stu)
Designing a strategy for provision of adequate nest holes, be them in large remnant trees or in nest boxes right across the landscape and at minimal cost and management need, may be a priority for research. Forty artificial nests have been in place at Madera since 2008. So far, they have fledged just 45 young parrots (less than 0.2 per nest per year). Although any extra baby parrots are more than welcome, increasing the yield on investment in nest boxes (perhaps around $400 per nest box provision) through better positioning would be good.
|The parrot on the right has its wing around the one on the left, which is nice (Photo: Stu)|
While logging may have driven down the population over the last century, uncontrolled fires are a very current threat. One such blaze last destroyed tens of nests. In response, Pronatura will place a further 100 nest boxes in Tutuaca and a third site, Papagochi in time for the 2015 breeding season.
At the time of our visit, the Cotorras were winding up for the breeding season. Judging by the behaviour of the pairs, they were looking forward to contributing towards efforts to save the species. Good luck to them and the Pronatura team.
Monterrubio-Rico, T.C., Cruz-Nieto, J., Enkerlin-Hoeflich, E., Venegas-Holguin, D., Tellez-Garcia, L. & Marin-Togo, C. (2006). Gregarious nesting behavior of Thick-Billed Parrots, (Rhynchopsitta pachyrhyncha) in aspen stands. Wilson Journal of Ornithology 118: 237-243. | <urn:uuid:2fcabbe3-12a0-4424-8d3c-bd15d8308779> | CC-MAIN-2018-22 | http://stuartmarsden.blogspot.com/2014_07_01_archive.html | s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794867995.55/warc/CC-MAIN-20180527024953-20180527044953-00473.warc.gz | en | 0.922542 | 842 | 2.71875 | 3 |
Breed Group: Toy
Weight: Up to 6 lbs
Height: 6-9 inches
Coat: The Chihuahua coat comes in two varieties: The Smooth and Long coat. The Smooth coat has a glossy,
soft, and close coat which is full textured over the entire body, but quite scanty on the head and ears. The
Long coat has a soft, longer coat that can be slightly curly or flat. This variety does have an under-coat. Either
coat type comes in a variety of colors such as fawn, brown, black, and white. The coat may be solid in color,
marked with splashes of color, or tri-color. They are an average shedder.
Overview: The Chihuahua is the smallest of all breeds and has the distinction of being the oldest breed in
America. They were named after the Chihuahua region in Mexico. It is believed that this breed descended
from ancient breed that was larger in size and highly prized by Aztec royalty. The Chihuahua of today has a
very fine bone structure, but are actually quite muscular.
Character: The Chihuahua is a very individualistic breed. They each have their own unique personality, so
only a few generalizations can be made. They are commonly referred to as a "Chi". They are energetic,
graceful, and display a human-like expression. Their life span is the longest of any size dog.
Temperament: The Chihuahua is deeply devoted and fiercely loyal. They typically become extremely attached
to one or two people. They are bold, fearless, and highly protective of their masters. They thrive on inordinate
amounts of attention. The Chihuahua is by nature gentle, loving, and sweet-tempered. They are wary of
strangers and make excellent watchdogs. This breed is not well suited for children or other pets. However,
they are sociable with their own kind. Chihuahuas are excellent companions in the right circumstances.
Care: The Chihuahua requires minimal grooming. The Smooth coat variety requires only occasional
brushing. The Long coat variety should be brushed several times a week with a soft bristle brush. Both
varieties only need bathing once a month using a mild shampoo. Special care must be given to not get water
into their ears as they are prone to ear infections. Dental hygiene is a must to prevent tooth loss. The health
issues that affect this breed include slipped stifles, open font or soft spot, eye problems, and heart disease.
The Chihuahua does not tolerate cold climates and must be protected when taken outside.
Training: The Chihuahua can be difficult to train, but with patience, love, and consistency do well. They
respond best to positive reinforcement. Chihuahuas can be housetrained by either the crate method or the
paper training method. Early, extensive, and intensive socialization is an absolute must for this breed.
Activity: The Chihuahua is an excellent apartment or condominium dweller. The majority of their exercise
needs can be met indoors with toys or play sessions. However, they greatly enjoy going with their owners and
benefit from daily walks. Using a harness is recommended instead of a leash is best given their delicate neck
and bone structure. | <urn:uuid:ee5b4206-bb38-4c62-96ca-e68dc6a3a062> | CC-MAIN-2019-43 | https://www.bellaslittleangels.com/Breed_Information.html | s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570986717235.56/warc/CC-MAIN-20191020160500-20191020184000-00464.warc.gz | en | 0.952251 | 702 | 2.53125 | 3 |
Coal-fired power plants across Germany were scheduled to be shut down by the end of the year. But with Russia cutting gas deliveries, Germany is turning to coal.
Climate activists have never liked Trump-appointed World Bank President David Malpass. But this week, his comments on climate change fueled calls for President Biden to make a change.
A wide range of Latino communities in the United States are affected by climate-driven storms, floods, droughts and heat waves, and are leading the charge to address global warming.
Can we end poverty, provide food for all and otherwise make Earth a better place by 2030? By all accounts, the answer is no. So then what's the point of the Sustainable Development Goals?
Extremely heavy rain fell in the hardest-hit provinces. About 75% more water is falling during the heaviest rainstorms in the region, according to a new scientific analysis.
Democrats plan to spend $20 billion to help rural communities address the climate crisis. There's little sign the infusion of money will reshape politics in areas that traditionally vote Republican.
The charity Oxfam has issued a new report on hunger and climate change. In countries most severely affected, the number of people experiencing acute hunger has doubled in just 6 years.
Patagonia founder Yvon Chouinard says he will give his company over to a trust, with future profits being donated to causes fighting climate change.
Unprecedented heat waves are on the rise as the climate gets hotter. But experts say the country's heat warning system may be leading the public to underestimate the dangers.
By 2050, about $2 billion of Chatham County's tax-assessed property will likely be affected by sea-level rise.
U.N. Secretary-General Antonio Guterres appealed to the world to help Pakistan after arriving in the country Friday to see climate-induced devastation from months of deadly record floods.
The Earth has already warmed more than 1 degree Celsius. New research suggests that above 1.5 degrees, massive ice melt, ocean current disruptions and coral die-offs are likely.
Unusually hot summer days have become more common across the U.S. and overnight lows aren't as low as they used to be. In fact, all of Georgia's cities saw higher minimum temperatures this past July when compared to the 20th century average.
Historic flooding and record droughts are stressing water systems across the country, and experts warn that with climate change intensifying the crisis in Jackson, Miss., may be just the beginning.
Heat waves, drought, massive storms. The bad news just keeps coming and there's no denying these issues are anxiety-provoking. If you feel that way, you're not alone. | <urn:uuid:526c4329-5623-40b8-bea9-3aacf72b90ca> | CC-MAIN-2022-40 | https://www.gpb.org/news/articles/climate-change | s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030335059.31/warc/CC-MAIN-20220927225413-20220928015413-00725.warc.gz | en | 0.950317 | 557 | 2.625 | 3 |
Some vegetables prefer cooler temperatures, making them perfect for springtime gardens. Start seeds in late winter and be prepared to set plants out as soon as the soil is warm enough, and you’ll enjoy the first fruits of your labor before summer even arrives!
There are two basic kinds of peas: garden peas, which require shelling, and snow or sugar peas, which yield edible pods. No matter which you prefer, eat ’em with gusto, as these little gems are an excellent source of iron, protein, vitamin C and soluble fiber. Pass the peas, please!
Planting Advice: When soil is workable (near the end of March in cold climates), sow seeds 1 to 2 inches deep and 4 inches apart; 18 inches between rows.
Harvest Tips: Peas generally mature in 54 to 72 days, depending on the variety. Younger peas taste sweeter than more mature peas. Harvest garden peas when the seeds are visible, but before they get too big and the weather gets too hot. Harvest edible-pod peas before the seeds fully develop. Use two hands: one on the vine, the other to pick the peas. Regular picking encourages continued
TOP PICKs: Snowflake, Daybreak (early), Wando (summer)
Tasty Heirlooms: Amish Snap, Blue Podded, Golden Sweet, Green Arrow, Sutton’s Harbinger
Versatile lettuce is easy to grow, yields a bumper crop in small spaces and is largely pest- and disease-resistant. Plus, the yellow, bronze, pink and cherry-red varieties make great ornamentals—and add color to salads. What’s not to like?
Planting Advice: Around two weeks before the last frost, plant seeds in full sun or partial shade, 1/4 to 1/2 inch deep and 2 inches apart in fertile, well-draining soil. Thin seedlings to 12 inches apart. For a fall or early-winter harvest, sow seeds every two weeks, starting at least eight weeks before the first frost.
Harvest Tips: Ready to pick in 40 to 85 days. Use quickly; lettuce doesn’t keep long.
Top Picks: Buttercrunch, Green Ice, Little Caesar (Romaine).
Tasty Heirlooms: Amish Deer Tongue, Grandpa Admire’s, Gold Rush, Red Leprechaun, Susan’s Red Bibb, Yugoslavian Red
There’s no polite way to say this: With its bulbous above-ground stem and spokelike arms, kohlrabi looks a bit, well, odd—like a garden alien. But follow Mom’s advice and don’t judge this ugly duckling of the cabbage family by its outward appearance. Instead, focus on its pleasantly mild, sweet flavor, which lends itself to stir-fry, soups and stews, and its nutritional content, which includes vitamin C and potassium.
Planting Advice: About a month before the last expected frost, sow seeds in full sun and well-draining soil, 1/2 inch deep and 3 inches apart. Thin seedlings to 6 inches apart. Kohlrabies can withstand a bit of frost. For fall harvest, plant seeds about eight to 10 weeks before last typical frost date.
Harvest Tips: Most kohlrabi varieties mature in six to seven weeks, and taste best when bulbs are smaller—2 to 4 inches in diameter. Bigger bulbs tend to get woody and develop
an off flavor.
Top Picks: For white stems, Express Forcer, Kolpack and Triumph. For purple, Blaro and Rapid.
Tasty Heirlooms: Delicatesse Blue, Delicatesse White, Early Purple Vienna, Early White Vienna
Greens (Chard, Kale, Spinach)
Beta vulgaris subsp. cicla
Great taste and nutritional value. Prolific production. Low maintenance and high resistance to disease. Grows in shade and poor soil. Doubles as an ornamental, thanks to colorful leaves. Yup, chard definitely is the Swiss army knife of veggies. (It’s also known as Swiss chard, but it’s not native to Switzerland.) Chard tastes amazing when sauteed in olive oil with garlic.
Planting Advice: About a week or two before the last-frost date, plant seeds (which actually are more like dried fruits that hold several seeds each) 1/2 to 3/4 inch deep, about eight to 10 seeds per foot. Thin seedlings so they’re 4 to 6 inches apart. A second planting is possible in late summer. Keep in mind that red-stemmed varieties are more likely to bolt.
Harvest Tips: When the outer leaves are 6 to 8 inches tall, cut them off about 11/2 inches above the ground; younger leaves pack more flavor. Don’t nick the terminal bud in the center.
Top Picks: Bright Lights (multicolored stems), Burgundy, Perpetual (white).
Tasty Heirlooms: Fordhook Giant, Lucullus, Oriole, Rainbow, Ruby Red
Kale is an undersung veggie-garden hero. This cabbage relative not only provides calcium, iron, potassium, cancer-fighting antioxidants and vitamins A, B and C, it also offers a sweet, earthy flavor. And cooler temps prompt kale to turn stored starch into sugars, which makes it taste even sweeter. It’s even OK to harvest it after it snows!
Planting Advice: When soil is workable, sow seeds 1/4 to 1/2 inch deep in full sun or partial shade, 4 inches apart. Or start seeds indoors six to eight weeks before last-frost date; set transplants two weeks before last-expected frost. When seedlings are 2 inches tall, thin to 8 or 12 inches apart. In fall, plant more seeds eight weeks before first-frost date.
Harvest Tips: To boost yield, harvest outer leaves when 8 to 10 inches tall. Or pick the whole head when plant is 10 to 12 inches tall.
Top Picks: Redbor, Winterbor, Blue Curled Vates.
Tasty Heirlooms: Dwarf Blue Curled, Lacinato, Red Russian
Science has confirmed what Popeye knew all along: Spinach is good for you. Along with megadoses of vitamins A and K, plus folate, manganese, magnesium and iron, spinach includes flavonoids that can help fight certain cancers.
Planting Advice: Spinach thrives in cooler weather, so plant seeds in early spring as soon as soil is workable. Sow about a dozen seeds per foot about 1/2 inch deep, with about 1 foot between rows. Thin to 2 to 4 inches apart when seedlings are 1 inch tall. For an extended harvest, plant successive batches
for several more weeks. For late summer or fall plantings, chill seeds in a refrigerator for one or two weeks before sowing.
Harvest Tips: Matures in 39 to 48 days, depending on variety. Cut off leaves at ground level when they reach desired size; younger leaves taste better. When seed stalks form, harvest
the rest of the crop.
Top Picks: Vienna, Giant Nobel (plain leaf), Indian Summer.
Tasty Heirlooms: America, Bloomsdale, New Zealand, Red Malabar, Strawberry
Afraid to grow these finicky bad boys? Don’t be. It’s easier than you think, and a smart budget move, since asparagus is expensive.
Planting Advice: Soak year-old crowns briefly in lukewarm water, then plant in well-draining soil when ground is workable. Dig a 6-inch-deep, 12- to 18-inch-wide trench. Create a small mound along the middle. Plant crowns atop the mound, with roots draped over the sides, about 12 to 18 inches apart, with rows 3 to 4 feet apart. Then bury the crowns 2 inches deep.
Harvest Tips: Asparagus plants take at least a year to get established, so don’t expect a first-season harvest; only lightly harvest in spring of second year. Cut spears at ground when they’re pencil-thick, or about 8 inches tall. Store ’em like cut flowers—upright in a container filled with an inch of water.
Top Picks: Jersey Giant, Jersey Prince, Jersey Knight, Viking KBC.
Tasty Heirlooms: Conovers Colossal, Mary Washington, Precoce d’Argenteuil
Broccoli & Cauliflower
Brassica oleracea italica
Italian immigrants brought broccoli to America in the early 1800s, and gardens haven’t been the same since. And that’s a good thing. Broccoli contains vitamin C and beta-carotene, and is a good source of protein and fiber. Mangia!
Planting Advice: Start seeds indoors five to seven weeks before last frost. Three weeks before last frost, transplant seedlings 18 inches apart, planted a little deeper than they were indoors. Or sow seeds directly, just before the last frost, 1/4 to 1/2 inch deep and 18 inches apart. Space rows 36 inches apart.
Harvest Tips: Ready to harvest in 55 to 60 days, when the central head is 4 to 6 inches in diameter. Don’t wait too long, or florets will flower. Broccoli keeps in the fridge for a couple of weeks in airtight plastic bags. To freeze, cut the head into bite-sized chunks; leave a little stem on each piece. Cut stems into 1-inch lengths. Blanch for 3 minutes in boiling water, then dunk in ice-cold water for 3 minutes. Drain; store in airtight freezer bags for up to six months.
Top Picks: Green Comet, Green Goliath, Cruiser (drought-tolerant).
Tasty Heirlooms: Romanesco (bright-green whorled head), Calabrese, DeCicco
Brassica oleracea var. botrytis
What kind of flower did Lassie wear to the doggie ball? A cauliflower! Jokes aside, this veggie packs some serious health benefits—it helps fight heart disease and several kinds of cancer.
Planting Advice: Transplants work best. Plant seeds indoors 1/4 inch deep, five or six weeks before the last-frost date. About two weeks before the last frost, plant hardened-off seedlings in direct sun, 18 to 24 inches apart. For fall crop, start seeds 75 days before the first-frost date. To help the heads (curds) turn white and boost flavor, many varieties need blanching; loosely tie leaves around the heads when they’re egg-sized. Or buy self-blanching varieties.
Harvest Tips: Pick when curds are 6 inches aross, white and firm (about seven to 12 days after blanching), with some outer leaves and 1 to 2 inches of stem attached.
Top Picks: Violet Queen (purple), Snow Crown (early), Andes (self-blanching).
Tasty Heirlooms: Early Snowball (self-blanching), Purple Cape
Brussels sprouts are tasty. Honest! As a kid, Mom probably force-fed you store-bought, overcooked and mushy sprouts. But when homegrown and properly prepared, these veggies are a nutty-tasting, full-flavored delight—and packed with vitamins and minerals.
Planting Advice: Sow seeds indoors four to six weeks before transplanting seedlings, about 90 to 100 days before the first expected fall frost. Plant in full sun and well-draining soil, 2 to 3 feet apart, in rows 2 feet apart. Or sow seeds in the garden—about five seeds per foot, 1/4 inch deep—120 days before the first expected frost. When the seedlings are 4 or 5 inches tall, thin them to 2 feet apart. The plants will grow about 3 feet tall and produce 20 to 40 sprouts along each stem.
Harvest Tips: Pick in about 90 days, when the sprouts are firm and 1 inch in diameter, and before leaves turn yellow. Sprouts keep in the fridge for about 10 days in a refrigerated airtight bag, and up to a year if frozen.
Top Picks: Bubbles, Oliver, Royal Marvel, Rubine (red sprouts), Valiant.
Tasty Heirlooms: Falstaff (purple-red leaves), Long Island Improved
- Bette Manley
Brassica oleracea var. capitata
From coleslaw to sauerkraut, cabbage has clout. A member of the same family that brings you broccoli and brussels sprouts, cabbage is packed with vitamins K and C, iron and folate—and it’s inexpensive to boot. So cash in on the crunch!
Planting Advice: When soil is workable, plant seedlings in full sun, 12 to 24 inches apart and in rows spaced 24 to 32 inches apart. Or sow seeds about four weeks prior to the last average frost date, about 1/2 inch deep; later, thin seedlings to one every 12 inches. Extend your harvest by planting varieties with staggered maturation times.
Harvest Tips: Pick the heads after they’re firm and fully formed, and before they crack open. If you leave outer leaves intact, smaller heads may form for a later harvest.
Top Picks: Cheers (green), Savoy King (crinkly leaves, heat-tolerant), Red Meteor, Ruby Ball (red).
Tasty Heirlooms: Copenhagen Market, Early Jersey Wakefield, Mammoth Red Rock, Winningstadt
A vegetable that functions as an easy-to-grow fruit—what a concept! Whether canned, frozen, or baked
in pies, cobblers and breads, rhubarb’s pleasantly sharp, tart flavor blends with apples, cherries, and most berries.
Planting Advice: Grow from crown divisions or nursery plants. When soil is workable, or in late fall, plant crowns in full sun and well-draining soil, with the crown bud top 2 inches below the soil; plant 3 to 4 feet apart.
Harvest Tips: It will take rhubarb a year to become established, so don’t harvest
until the following spring—and only lightly for a week or two, at that. Enjoy a complete harvest for eight to 10 weeks in the third growing season. Snap off each stem at the ground or twist the stem gently, as with celery. The leaves are poisonous; trim them off immediately. Refrigerate fresh whole stalks for up to 3 weeks in sealed plastic bags.
Top Picks: Canada Red, Cherry Red, Crimson Red, Ruby, Valentine.
Tasty Heirlooms: German Wine, Victoria
Good things do come in small packages—like radishes, tiny nutritional powerhouses full of potassium, vitamin C and fiber. The longer they grow, the spicier they get, so harvest them early for a milder flavor.
Planting Advice: When soil is workable, plant seeds 1/4 to 1/2 inch deep; thin seedlings to 1 inch apart (2 to 4 inches for winter radishes). In summer, sow a winter crop, which will take longer to mature but will last longer in storage.
Harvest Tips: Spring varieties mature in 22 to 28 days; winter ones in 52 to 70 days. Harvest when roots are less than 1 inch across; larger for winter varieties. Spring radishes don’t keep long; winter varieties last for several months if kept cool and moist. Harvest before the ground freezes.
Top Picks: For spring, Champion, Easter Egg (various colors), Snow Belle (white). For winter harvest, China Rose, Chinese, Round Black Spanish and Tama Hybrid (white).
Tasty Heirlooms: Cincinnati Market, French Breakfast, Helios, Philadelphia White Box, Plum Purple, Rat-Tailed
- More From Birds & Blooms
- Top 10 Garden Tools and How to Choose Them
- Top 10 Colorful Flowers Hummingbirds Love
- 10 New Veggies of 2018 You Should Try
- Top 10 Best New Plants for 2018
- Top 10 Vegetables That Grow Well in Shade
- 10 Fast-Growing Vegetables You Can Harvest Quickly
- 8 Early-Blooming Flowers for Spring
- 10 Flowering Houseplants to Grow
- Top 10 Pretty Plants for Winter | <urn:uuid:b2098da3-f7b0-49d0-a6f3-5429441618ec> | CC-MAIN-2019-04 | http://www.birdsandblooms.com/gardening/top-10-lists-for-gardeners/top-10-spring-vegetables/?6 | s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547584519757.94/warc/CC-MAIN-20190124080411-20190124102411-00003.warc.gz | en | 0.872236 | 3,501 | 2.625 | 3 |
Cuttlefish are wizards of camouflage. Adept at blending in with their surroundings, cuttlefish are known to have a diverse range of body patterns and can switch between them almost instantaneously. New research from MBL Marine Resources scientists, to appear in the May 2006 issue of the journal Vision Research, confirms that while these masters of disguise change their appearance based on visual cues, they do so while being completely colorblind.
While previous research has reported cuttlefish colorblindness, MBL Research Associate Lydia Mäthger and her colleagues in Roger Hanlon’s laboratory approached the problem in more depth and with a new behavioral assay. The researchers tested cuttlefish (Sepia officinalis) color perception through observing the animal’s behavioral response to a series of checkerboard patterned substrates of various colors and brightnesses.
They found that the animals did not respond to the checkerboard pattern when placed on substrates whose color intensities were matched to the Sepia visual system, suggesting that these checkerboards appeared to their eyes as uniform backgrounds. However, their results showed that cuttlefish were able to detect contrast differences of at least 15%, which Mäthger and her colleagues suspect might be a critical factor in uncovering what determines camouflage patterning in cuttlefish.
Despite these results, the vexing question of how cuttlefish master the task of camouflage in low-contrast, color-rich environments such as those found at shallow depths of water, remains to be answered. Mäthger and her colleagues are currently looking at cuttlefish contrast sensitivity in more detail. “Our result that cuttlefish are able to detect contrast differences of at least 15%, is only an upper limit,” says Mäthger. “It’s certainly not the contrast threshold, which we would like to know. It seems that cuttlefish camouflage themselves by matching intensities of objects in the environment and we’re collecting data to test see whether this is really the case.”
In addition to looking at contrast between different objects, Mäthger and her colleagues are testing a variety of other optical clues, in particular, cuttlefish perception of object edges, brightness, and sizes of objects.
Cuttlefish are cephalopods, relatives of octopuses and squid, and are found in all marine habitats worldwide; they are particularly abundant around coral reefs and temperate rock reefs in which the visual habitat is richly varied. Cephalopods can change their appearance with a speed and diversity unparalleled in the animal kingdom. Some squids, octopuses, and cuttlefish can show 30-50 different appearances. Their sophisticated neural control of the skin make cuttlefish an excellent model for studying camouflage.
Cite This Page: | <urn:uuid:25197b65-5c6d-4029-b179-cda4abbf2523> | CC-MAIN-2014-41 | http://www.sciencedaily.com/releases/2006/04/060419072340.htm | s3://commoncrawl/crawl-data/CC-MAIN-2014-41/segments/1410657140379.3/warc/CC-MAIN-20140914011220-00255-ip-10-234-18-248.ec2.internal.warc.gz | en | 0.956484 | 578 | 3.640625 | 4 |
- An example of realistic is a person who knows his own limitations and isn't going to expect to be an amazing opera singer when he can't even carry a tune.
- An example of realistic is a book that really rings true and that could be about true life.
- of, having to do with, or in the style of, realism or realists
- tending to face facts; practical rather than visionary
- Tending to or expressing an awareness of things as they really are: She gave us a realistic appraisal of our chances.
- Of or relating to the representation of objects, actions, or social conditions as they actually are: a realistic novel about coal mining. See Synonyms at vivid.
(comparative more realistic, superlative most realistic) | <urn:uuid:eb689997-b6e4-422d-852f-766119b177e0> | CC-MAIN-2016-30 | http://www.yourdictionary.com/realistic | s3://commoncrawl/crawl-data/CC-MAIN-2016-30/segments/1469257821671.5/warc/CC-MAIN-20160723071021-00107-ip-10-185-27-174.ec2.internal.warc.gz | en | 0.934889 | 159 | 3.09375 | 3 |
Early Cape Breton — From Founding to Famine
by Robert Morgan • photos • 176 pages
THROUGH LIVELY CONVERSATIONS, TALKS, and essays, this popular educator keeps history alive and accurate!
From the founding of the independent Colony of Cape Breton and the coming of the Loyalists, to annexation to Nova Scotia and the (continuing) idea of separation, this is brisk and informative.
Dr. Robert Morgan tells the story of Cape Breton's early administrators, the devastation of Cape Breton’s six-year famine that tore apart and restructured the island's life, the work and character of its four great surveyors, and much much more.
A pleasure to read. | <urn:uuid:e4f562a3-c8dd-4a2d-a447-1087b958719d> | CC-MAIN-2021-04 | https://capebretonbooks.com/products/early-cape-breton-from-founding-to-famine | s3://commoncrawl/crawl-data/CC-MAIN-2021-04/segments/1610704835583.91/warc/CC-MAIN-20210128005448-20210128035448-00319.warc.gz | en | 0.891647 | 149 | 2.84375 | 3 |
|Lesson Plan ID:
Identifying the Elements of Plot in a Short Story
Students become motivated readers as they read, comprehend, and interpret a short story. Students present plot diagrams in slideshows and additional information about the author in a brochure.
|TC2(6-8) ||2. Publish digital products that communicate curriculum concepts. |
|TC2(6-8) ||5. Use basic features of word processing, spreadsheets, databases, and presentation software. |
|TC2(6-8) ||6. Select specific digital tools for completing curriculum-related tasks. |
|ELA2013(6) ||2. Determine a theme or central idea of a text and how it is conveyed through particular details; provide a summary of the text distinct from personal opinions or judgments. [RL.6.2] |
|ELA2013(7) ||2. Determine a theme or central idea of a text and analyze its development over the course of the text; provide an objective summary of the text. [RL.7.2] |
|ELA2013(8) ||2. Determine a theme or central idea of a text and analyze its development over the course of the text, including its relationship to the characters, setting, and plot; provide an objective summary of the text. [RL.8.2] |
|Primary Learning Objective(s):
Students will analyze the elements of plot. Using an assigned short story, students will create a sequential diagram illustrating the elements of plot: exposition, rising action, climax, falling action, and resolution.
|Additional Learning Objective(s):
Students will design a short story slideshow presentation. Students will research the author of their assigned story and present this information in a brochure.
|Approximate Duration of the Lesson:
|| Greater than 120 Minutes|
|Materials and Equipment:
Copies of a variety of short stories (as multicultural as possible), copies of the attachments provided, media center access
|Technology Resources Needed:
Computers with Internet access, printer, presentation software (such as PowerPoint), desktop publishing software, TV scan converter or other digital projection device
Students will need a basic working knowledge of word processing and slideshow software.
1.)The teacher will lead a discussion on the importance of the short story as a literary genre.
2.)The teacher will present the five basic elements of a plot diagram using a slideshow presentation such as PowerPoint (see attached). Students will copy the notes as they are written on each slide of the PowerPoint presentation.
3.)The teacher will present the possible short stories for the assignment (attached). The teacher will write the title and author name of each short story on a small sheet of paper. The teacher will then put the 25 short story titles in a hat. Students will draw a sheet of paper from the hat. Each student will have a different short story for his/her project.
4.)The teacher will then hand out a sign-up sheet (attached). Students will print their names, write the title of their short stories, and then sign the form. After all students have signed the form, the teacher will keep the sheet for his/her records.
5.)Students read their assigned short stories.
6.)Students create their own plot diagram using an activity sheet (Rough Draft Activity Sheet attachment). Students should write legibly, using complete sentences.
7.)Using the rough draft of their plot diagrams, the students will create a PowerPoint presentation (see Creating the Student PowerPoint attachment).
8.)Upon completion of their slide shows, the students will design a brochure based on their short story (see Creating a Short Story Brochure and Student Brochure attachments). This part of the assignment requires students to find additional information about their author and his/her works.
(Alabama Virtual Library
)Excellent age appropriate databases for research
9.)Each student then presents his/her short story to the class using the PowerPoint presentation and the brochure. Although students may be given the opportunity to volunteer to present first, drawing names from a hat works well. The teacher will use the rubric (attached) to grade each presentation.
|Attachments:**Some files will display in a new window. Others will prompt you to download.
||Elements of a Plot Diagram].ppt|
Creating Short Story Brochure.doc
Rough Draft Activity Sheet.doc
Creating the Student PowerPoint Presentation.ppt
Short Story Sign Sheet.doc
Short Story List.doc
The students will be evaluated on the following: following directions, accuracy/completeness of work, grammar/spelling. A rubric is attached.
Students may use graphic organizers to categorize the various elements of a plot diagram.
Each area below is a direct link to general teaching strategies/classroom
for students with identified learning and/or behavior problems such as: reading
or math performance below grade level; test or classroom assignments/quizzes at
a failing level; failure to complete assignments independently; difficulty with
short-term memory, abstract concepts, staying on task, or following directions;
poor peer interaction or temper tantrums, and other learning or behavior problems.
|Presentation of Material
||Using Groups and Peers
|Assisting the Reluctant Starter
||Dealing with Inappropriate
Be sure to check the student's IEP for specific accommodations.
|Variations Submitted by ALEX Users: | <urn:uuid:011e79e9-75ae-46cc-80eb-576d7e92b2a7> | CC-MAIN-2014-15 | http://alex.state.al.us/lesson_view.php?id=6991 | s3://commoncrawl/crawl-data/CC-MAIN-2014-15/segments/1398223206647.11/warc/CC-MAIN-20140423032006-00482-ip-10-147-4-33.ec2.internal.warc.gz | en | 0.861583 | 1,139 | 4.71875 | 5 |
In this course, students will read theoretical material about language learning and language pedagogy as specifically related to children learning Spanish as a foreign language and put the readings into practice through participation in the Davidson SiDES (Spanish in Davidson Elementary School) program. Students will learn how to plan a curriculum, develop lesson plans, implement lessons, and assess their students' learning. Teaching in SiDES is required. Conducted in Spanish with readings in English and Spanish; counts toward the Major and Minor in Hispanic Studies.
Satisfies the Justice, Equality, and Community requirement.
SPA 260 or equivalent required. Students concurrently enrolled in SPA 260 are eligible. | <urn:uuid:5784d367-371a-483f-a734-d385097fb209> | CC-MAIN-2018-30 | https://www.davidson.edu/general-course-detail/?subj=SPA&cnum=311 | s3://commoncrawl/crawl-data/CC-MAIN-2018-30/segments/1531676591596.64/warc/CC-MAIN-20180720115631-20180720135631-00322.warc.gz | en | 0.940077 | 131 | 2.9375 | 3 |
• The longer you’re out of peanuts, the higher the yield is going to be when you come back to the crop.
Rotating with corn and cotton is an excellent way to improve peanut yields, said Mike Howell, Extension peanut specialist with Mississippi State University.
Howell was among the presenters at a production meeting for Arkansas’ growing numbers of peanut producers. Nearly 160 people from more than a dozen counties signed in for the meeting at Black River Technical College, put on by the University of Arkansas System Division of Agriculture.
“The longer we’re out of peanuts, the higher the yield is going to be when we come back to this peanut crop,” Howell said.
“Soybeans are not a real good rotation crop for peanuts. They’re just too similar in diseases and other things.”
Showing data from Georgia, Howell said the average yield for non-rotated peanuts was 2,840 pounds per acre. By contrast, a three-year rotation with two years of corn produced 4,268 pounds per acre, and a three-year rotation with cotton produced 4,229 pounds.
Two years with soybeans produced a yield of 3,684 pounds per acre.
Four-year rotations on irrigated land produced even more eye-popping results.
Rotating two years of cotton before the next peanut cycle produced 5,365 pounds per acre, compared with 4,201 pounds on non-irrigated fields.
Cotton, corn and peanut rotations had the second-highest yields, with irrigation producing average yields of 5,295 pounds per acre.
Dryland peanuts in the same rotation yielded 4,252 pounds per acre.
Growing nothing but peanuts had the lowest numbers: 3,636 pounds per acre on irrigated land, and 2,954 pounds per acre on non-irrigated land.
Harvest is more efficient when peanuts are planted flat rather than on rows, Howell said. When peanuts are inverted, two rows are being dug at one time and combined into a single windrow positioned in the middle of the two rows.
“When the peanuts are combined, you will end up picking up a large amount of soil to get the peanuts,” he said. “It doesn't pay to haul dirt to the buying point.”
Howell also provided growers with other technical information including the advantages of full tillage, where the land is disked, turned and field cultivated; reduced-tillage, which is disked and cultivated; and strip-till, a minimal tillage technique; weed and pest control tactics and the importance of soil testing. | <urn:uuid:a93c3fdb-7e3d-4f94-b92e-622bb5846caf> | CC-MAIN-2014-42 | http://southeastfarmpress.com/peanuts/peanut-production-101-rotation-key-bigger-yields | s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1413507442420.22/warc/CC-MAIN-20141017005722-00378-ip-10-16-133-185.ec2.internal.warc.gz | en | 0.940583 | 550 | 2.6875 | 3 |
Volume 3, Number 3—September 1997
Jail Fever (Epidemic Typhus) Outbreak in Burundi
We recently investigated a suspected outbreak of epidemic typhus in a jail in Burundi. We tested sera of nine patients by microimmunofluorescence for antibodies to Rickettsia prowazekii and Rickettsia typhi. We also amplified and sequenced from lice gene portions specific for two R. prowazekii proteins: the gene encoding for citrate synthase and the gene encoding for the rickettsial outer membrane protein. All patients exhibited antibodies specific for R. prowazekii. Specific gene sequences were amplified in two lice from one patient. The patients had typical clinical manifestations, and two died. Molecular techniques provided a convenient and reliable means of examining lice and confirming this outbreak. The jail-associated outbreak predates an extensive ongoing outbreak of louse-borne typhus in central eastern Africa after civil war and in refugee camps in Rwanda, Burundi (1), and Zaire.
Typhus group rickettsioses are distributed worldwide. Rickettsial typhus has two forms: endemic (murine) typhus and epidemic typhus. Endemic typhus is caused by R. typhi, usually transmitted to humans by the rat flea, Xenopsylla cheopis; epidemic typhus is caused by R. prowazekii, transmitted by the body louse, Pediculus humanus humanus (2). In the United States, R. prowazekii has also been found in a sylvatic cycle involving flying squirrels and their ectoparasites (3). Typhus group rickettsioses, especially epidemic typhus, are associated with wars and human disasters.
During World Wars I and II, typhus spread through North Africa, the Pacific Islands, and Europe, especially in German concentration camps. In North Africa, the epidemics involved mainly civilian populations. U.S. forces were protected by the first vaccine applied on a large scale, the Cox-type vaccine (4). Epidemic typhus began to decline at the end of World War II when DDT started to be used as an insecticide. Ethiopia, Rwanda, Nigeria, and Burundi were the main foci of louse-borne typhus in Africa in the 1970s. Ethiopia reported 1,931 cases in 1983 and 4,076 cases in 1984 (5), with a death rate of 3.8% (6). However, these data were difficult to interpret because serologic testing was usually performed with inadequate techniques, and epidemiologic data were unavailable.
Political instability in Eastern European and African countries has recently caused conflicts in regions where the risk for typhus outbreaks is very high. In Yugoslavia and Rwanda, older persons who contracted epidemic typhus as youths can develop recrudescent illness and become the source of resurgent epidemics if louse infestation becomes prevalent. Recently, an outbreak of typhus was suspected in a Burundi jail; we diagnosed epidemic typhus by amplifying and sequencing portions of the citrate synthase and the rOmpB genes of R. prowazekii in lice.
In a jail in N'Gozi, Burundi, a local nurse observed patients with abrupt fevers of up to 40°C in association with a body louse outbreak from December 1995 to January 1996. Typhus was suspected, and chloramphenicol was given orally or intravenously. Blood specimens were obtained from nine patients (all young black men), and sera were sent to Marseille for serologic testing. Two lice per patient were obtained from the clothes of Patients Four, Five, Seven, Eight, and Nine; clinical information was also obtained (Table).
Patients' sera were tested by microimmunofluorescence. Vero cellgrown rickettsia were purified (7) and placed on slides as spots. R. prowazekii Breinl strain and R. typhi Wilmington strain were used. Both antigens were placed on either side of the same slide to compare the serum reactivity with the two antigens. Sera were diluted from 1/32 to 1/4,096. Immunoglobulin G (IgG) antibodies were detected by gamma chain specific anti-human Ig (Bio Merieux, Marcy l'Etoile, France), and IgM was detected after IgG was removed by RF adsorbent (Behring) (7). The diagnostic cutoff for microimmunofluorescence in diagnosing rickettsiosis is 1/128 for IgG and 1/64 for IgM (7,8). All nine patients were positive for both antigens; however, titers were identical for both antigens in Patients Four and Eight. In the other patients, antibodies were higher for R. prowazekii than for R. typhi by one-to-five dilution for IgG. IgM antibodies were at the same level against both antigens in all patients (Table).
Lice were sent to Marseille and arrived dry; they were crushed, and DNA suitable for use as a template in PCR was extracted using QIAGEN columns (QIAamp Tissue Kit, QIAGEN, Hilden, Germany). Citrate synthase PCR amplification incorporated primers 120-M59 (CCGCAGGGTTGGTAACTGC) (9) and 120-508 (CCAAGTGATAAGAGGAGCTT) selected from the R. prowazekii ompB sequence (10). The citrate synthase amplicons were subjected to restriction fragment length polymorphism analysis using the enzyme AluI and were identical to that previously described for R. prowazekii (11). Sequence determinations were performed by using an automated laser fluorescent DNA sequencer as previously described (12). The citrate synthase and rOmpB sequences obtained from the lice had 100% homology with that of R. prowazekii strain Breinl. Of the 10 tested, two lice from the same patient (four) were positive.
Social conditions are critical factors influencing the reemergence of disease. Louse infestation occurs when cold weather, poor hygiene, and poverty are prevalent; these conditions have been present in refugee camps in Rwanda and Zaire recently (13,14). Louse infestation has also been found in several eastern European countries and in homeless persons in western Europe (15).
Epidemic typhus was suspected in a refugee camp in Goma, Zaire, in 1994, but the outbreak was unconfirmed (14). Typhus is usually exanthematic, and a careful clinical examination will find a rash in more than half of the cases. In the present series, clinical data were recorded retrospectively mainly on the basis of a nurse's report and are probably incomplete (Table). In an outbreak, looking for exanthema is critical for typhus suspicion. The typhus exanthema is frequently purpuric and is observed even on dark skin in 33% of cases (6). The other typical symptoms are neurologic signs including seizures, coma, and mental confusion, which gave the disease its name (ORIG: from the Greek word "typhos," which means smoke, cloud, stupor arising from fever). Neurologic involvement was noted in seven of the nine cases: symptoms included coma, seizures, mental confusion, and delirium. Rash was described in only two patients (Figure); splenomegaly in three patients; cough in three patients; dyspnea in three patients; and hypotension in four patients. Two patients died. The other patients recovered rapidly after receiving chloramphenicol. The prevalence of pulmonary symptoms is high in general as noticed here.
In situations like those observed in this jail, one can suspect either murine or epidemic typhus. Murine typhus is less severe. However, in poor hygienic conditions, rats are prevalent, and the risk exists for both diseases. Consequently, in such situations it is critical to discriminate between R. prowazekii and R. typhi infections because they do not have the same epidemic potential. Diagnosis is usually provided by microimmunofluorescence; in some cases antibody levels are sufficient to differentiate between the two diseases. IgG titers are usually different, but IgM titers are not. When, as in Patients Four and Eight, antibodies are at the same level, cross-adsorption, a tedious and expensive procedure requiring large amounts of antigens and serum (not available in our study ), can differentiate between the two diseases. The use of arthropod vectors for gene amplification and disease recognition has been reported (17). In a case of laboratory-acquired human typhus, diagnosis was confirmed by PCR (18). However, in the present work, we report for the first time the use of the louse in diagnosing epidemic typhus in the field.
The confirmation of a typhus outbreak in Burundi is of concern, given the relative political instability in this area of the world. A preliminary report from the World Health Organization discusses a current large outbreak in Burundi with an estimated 24,000 cases (1). It is uncertain if the outbreak we observed is related to the current epidemic, but our present work confirms continuing cycles of louse-borne typhus in Burundi. Delousing (14) is critical to typhus prevention. The treatment for typhus is simple and inexpensive: a single dose of 200 mg of doxycycline provides cure (19).
We stress the major risk for exanthematic typhus in central eastern Africa including Burundi, Zaire, and Rwanda and the importance of sending lice to reference laboratories to identify the pathogens when a typhus outbreak is observed. Molecular identification by PCR and sequencing offers a rapid, sensitive, and specific identification method for Rickettsia, even when epidemiologic investigations are undertaken.
- World Health Organization. A large outbreak of epidemic louse-borne typhus in Burundi. Wkly Epidemiol Rec. 1997;21:152–3.
- Azad AF. Relationship of vector biology and epidemiology of louse- and flea-borne rickettsioses. In: Walker DH, editor. Biology of rickettsial diseases. Boca Raton (FL): CRC Press; 1991. p. 51-61.
- McDade JE. Evidence of Rickettsia prowazekii infections in the United States. Am J Trop Med Hyg. 1980;29:277–83.
- Woodward TE. Rickettsial vaccines with emphasis on epidemic typhus. Initial report of an old vaccine trial. S Afr Med J. 1986;Suppl:73–6.
- World Health Organization. Louse-borne typhus, 1983-1984. Wkly Epidemiol Rec. 1986;7:49–50.
- Perine PL, Chandler BP, Krause DK, McCardle P, Awoke S, Habte-Gabr E, A clinico-epidemiological study of epidemic typhus in Africa. Clin Infect Dis. 1992;14:1149–58.
- Eremeeva ME, Balayeva NM, Raoult D. Serological response of patients suffering from primary and recrudescent typhus: comparison of complement fixation reaction, Weil-Felix test, microimmunofluorescence, and immunoblotting. Clin Diagn Lab Immunol. 1994;1:318–24.
- Ormsbee R, Peacock M, Philip R, Casper E, Plorde J, Gabre-Kidan T, Serologic diagnosis of epidemic typhus fever. Am J Epidemiol. 1977;105:261–71.
- Wood DO, Williamson LR, Winkler HH, Krause DC. Nucleotide sequence of the Rickettsia prowazekii citrate synthase gene. J Bacteriol. 1987;169:3564–72.
- Regnery RL, Spruill CL, Plikaytis BD. Genomic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol. 1991;173:1576–89.
- Carl M, Dobson ME, Ching WM, Dasch GA. Characterization of the gene encoding the protective paracrystalline-surface-layer protein of Rickettsia prowazekii: presence of a truncated identical homolog in Rickettsia typhi. Proc Natl Acad Sci U S A. 1990;87:8237–41.
- Joblet C, Roux C, Drancourt M, Gouvernet J, Raoult D. Identification of Bartonella (Rochalimaea) species among fastidious Gram-negative bacteria based on the partial sequence of the citrate-synthase gene. J Clin Microbiol. 1995;33:1879–83.
- World Health Organization. Global surveillance of rickettsial diseases: memorandum from a WHO meeting. Bull World Health Organ. 1993;71:293–6.
- World Health Organization. Epidemic typhus risk in Rwandan refugee camps. Wkly Epidemiol Rec. 1994;34:259.
- Stein A, Raoult D. Return of trench fever. Lancet. 1995;345:450–1.
- Raoult D, Dasch GA. Immunoblot cross-reactions among Rickettsia, Proteus spp. and Legionella spp. in patients with Mediterranean spotted fever. FEMS Immunol Med Microbiol. 1995;11:13–8.
- Azad AF, Sacci JB, Nelson WM, Dasch GA, Schmidtmann ET, Carl M. Genetic characterization and transovarial transmission of a typhus-like rickettsia found in cat fleas. Proc Natl Acad Sci U S A. 1992;89:43–6.
- Carl M, Tibbs CW, Dobson ME, Paparello SF, Dasch GA. Diagnosis of acute typhus infection using the polymerase chain reaction. Ann N Y Acad Sci. 1990;590:439–44.
- Perine PL, Krause DW, Awoke S, McDade JE. Single-dose doxycycline treatment of louse-borne relapsing fever and epidemic typhus. Lancet. 1974;2:742–4. | <urn:uuid:1d14378e-edf4-44b7-8dd7-1506dc4038f9> | CC-MAIN-2019-22 | https://wwwnc.cdc.gov/eid/article/3/3/97-0313_article | s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232257939.82/warc/CC-MAIN-20190525084658-20190525110658-00092.warc.gz | en | 0.9168 | 3,027 | 3.046875 | 3 |
William A. Dyrness, professor of theology and culture at Fuller Theological Seminary and visiting lecturer, invites his readers to walk through the hallowed halls of church history and understand the influence of visual art upon theology. His text, Visual Faith: Art, Theology, and Worship in Dialogue explores the dynamics of culture, generational expression and the interaction of art throughout Christian history.
During the time of the early church, visual art was the heartbeat of countless gatherings. “Once Christianity was recognized (by the Edict of Milan in 313), buildings were built specifically as churches, and they were adorned with mosaics. Moreover, artists were employed to shape furnishings for religious uses, both private and public.” However, during the Reformation, the church started to shift their attention to the Word of God and personal contemplation. This created an ideology of separation within Christian culture – those outside the walls of the church were no longer seen as equal, but a threat.
According to Dyrness, visual art was always present within the sanctuary and paired alongside theology; however, the Reformation caused Christians to view popular culture as a threat to the church, instead of a tool for the church. According to Dyrness:
By the time of the Reformation, fed by streams from medieval mysticism and the writings of people such as Thomas à Kempis, faith had become more specifically ‘personal’, consisting of an inward cleaving to Christ and his promises. This, of course, involved the application of the mind and did not require visual meditation.
John Calvin and Martin Luther’s personal preference towards solo scriptura, led to a theological view of cultural separatism and skepticism. Moreover, the Reformation marred the hearts of countless artisans and silenced their creativity.
The art culture was rebirthed in the early nineteenth century; however, this resurgence did not blur the lines between Christianity and popular culture but created more boxes of separation and segregation for artisans. According to Dyrness:
Artistic practice takes place in a created order that is given its own reality and structure even as it is open to the divine presence. Therefore, a complete understanding of art for the Christian must pay serious attention to the purposes and structures of God’s good creation, both as limitation and as potential for the Christian artist.
Christian artists, therefore, are still constrained to stay within the boundaries of biblical interpretation and theological expression. Dyrness discusses the conundrum of blending both worlds together and asserts that, “Clearly, the Christian church and Christian artists face an immense challenge, both to reach this generation with the gospel and equally important (and vitally related) to rediscover the imaginative richness of their heritage.” This is why the author believes that, “There is no way for the church to interact constructively with contemporary culture without being rooted firmly both in that culture and in the biblical and Christian tradition.” Therefore, one must understand the voice of culture and the theological constructs of the church in order to engage in purposeful conversation. Moreover, art must be the expression of the soul’s conviction – the soul’s connection to Christ.
Dyrness reveals that, “Art is becoming a cultural event, not unlike the rock or film festival. The artist, as a result, becomes a cultural icon, gracing T-shirts and coffee mugs.” Therefore, it is imperative for us to understand the value of artisans and the definition of their work.
This is why churches must utilize creative people to develop their social media strategies, organizational branding and their online presence. Too many pastors find offence in connecting the words marketing with ministry; however, if one does not believe in promoting their organization, they perpetuate the idea that art and Christianity should remain separate.
Judith Glasser revealed that, “Conversations are the social rituals that hold us together, the fabric of culture and society.” Art is part of the conversation. Dyrness warns readers in the very beginning of the text, “It is possible that we might actually win the battle of words but lose the battle of images. And losing the battle could well cost us this generation.” If churches want to be pinnacles of conversion, then they must first be hubs of conversation. Dryness challenges readers to create space for creativity within their organization and give people a glimpse of Christ through the use of visual media.
William A. Dyrness, Visual Faith: Art, Theology, and Worship in Dialogue (Grand Rapids, Mich.: Baker Academic, 2001),28.
Judith E. Glaser, Conversational Intelligence: How Great Leaders Build Trust and Get Extraordinary Results (Brookline, MA: Bibliomotion, Books + media, 2014), 14.
William A. Dyrness, Visual Faith: Art, Theology, and Worship in Dialogue (Grand Rapids, Mich.: Baker Academic, 2001),21. | <urn:uuid:5a90a12d-b6e1-437f-9fcf-e35ce4a3ccb2> | CC-MAIN-2019-35 | https://blogs.georgefox.edu/dminlgp/united-in-worship-bringing-back-the-arts/ | s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027323328.16/warc/CC-MAIN-20190825105643-20190825131643-00505.warc.gz | en | 0.952916 | 1,018 | 2.59375 | 3 |
Understanding The Impact Of Tech
Technology is the sum total of any methods, tools, techniques, systems, and procedures utilized in the creation of new products or services or in their realization, including scientific analysis. It may be used to refer to an entire field or applications in specific areas, such as information technology, computer science, engineering, or computer hardware. The use of technology is so pervasive that it has greatly affected every aspect of our lives, from how we live in cities and towns to how we communicate with each other over networks. In addition, many people are very unaware of how their technology interacts with the natural world. This has resulted in a need for a diversified education in technology to include both the physical and social impacts of technology on society.
In broad terms, tech is anything that enhances human performance through increased efficiency or effectiveness, whether these improvements come from advances in math or computer science. Often, tech refers to new scientific studies and technological innovations that enhance the human condition. Some examples include computers, cellular phones, airplanes, and medical technologies. The scope of tech means that it also encompasses a plethora of everyday activities, including transportation, entertainment, communications, information technology, art, and literature. In short, the definition of tech is ever expanding as new applications for technology emerge, making it an ever-changing and constantly growing field.
Technologists deal with issues ranging from education and societal developments to the natural environment, focusing mainly on the technological aspects of things rather than the applications. Because tech has such a huge impact on society, it’s important to consider what tech means to us, as individuals and as a society. A diversity of opinions about what tech means come into play as people continue to discuss and debate its definition. However, one thing is for certain: without tech, much of what we take for granted – from the practical aspects of everyday life to advances in science and in medicine – would not be possible. | <urn:uuid:15db7822-eb0a-4b7b-9b61-b7d10b177eb9> | CC-MAIN-2021-49 | https://wilsonvillebrewfest.com/index.php/2021/10/07/understanding-the-impact-of-tech/ | s3://commoncrawl/crawl-data/CC-MAIN-2021-49/segments/1637964358966.62/warc/CC-MAIN-20211130080511-20211130110511-00190.warc.gz | en | 0.958375 | 390 | 3.359375 | 3 |
The 3d printed orthotics are made with the use of 3d printing and scanning technology. 3d manufacturing is making these medical devices workable in almost all conditions. These orthotics are used to heal many of your body pains, treat your injuries, especially in the foot area, and improve your mobility in the long run. A few considerations are important to making these medically fitted devices, as explained below.
Key considerations while making 3d printed orthotics:
There are numerous things that you actually require to take care of and keep in your mind while making the 3d printed orthotics for a person or your patient. The main considerations include:
- Detailed health history:
Detailed health history of the patient is required while making these orthotics through 3d printing. This history will tell them about the origin and severity of the disease as well. This history will also include the other health-related issues a patient suffers from.
- Assessment of your medical condition:
Your doctor will take a deep look at your medical condition by assessing all the things needed for this 3d printing process to provide you with the perfect medical device. The medical expert will also measure your activity level.
- Measurement of your body (Height and Weight):
The perfect measurements of your body, such as height, weight, and many other factors, are required to make these medical devices smoothly. The exact information is needed to create the best size for your body.
- Predicting the future results:
The practitioner will then take a thorough scan of your body part and find future results based on your scan. You will know the time it will take to improve your health by getting rid of the disease.
Which specific materials are to be used for your orthotics?
The practitioner will then add personalization and specifications to your orthotics that are still to be made. It will enable them to find the materials that should be used to make the best mold for you.
- A 3D mold of your feet:
The practitioner will then scan the exact part of your body, such as your feet. You will see that the practitioner will try to get the exact mold and replica of your feet.
- Addressing the underlying biochemical issues, if any:
The medical expert will also highlight and address the underlying biochemical issues if the patient has them. All this is being done to provide you with the perfect treatment.
The compatibility of all the things must be assured. Make sure that the material your practitioner uses for your foot replacement is compatible with your body.
- Any side effects and undesirable consequences:
The last thing is to find whether you will have any side effects and undesirable consequences from these medical devices that best fit your feet.
The 3d printed orthotics are easy to create and build. All you need is to take the points mentioned above into your mind. These things and factors will help you to create a well-fitted medical replacement for your patient. So, try out these medical devices if you have foot-related issues. | <urn:uuid:a335e625-6bb5-4fa4-81d6-948b6cb18ec4> | CC-MAIN-2023-06 | https://www.geeksucks.com/technology/what-are-the-key-considerations-while-making-3d-printed-orthotics.htm | s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764500641.25/warc/CC-MAIN-20230207201702-20230207231702-00570.warc.gz | en | 0.946789 | 625 | 3.375 | 3 |
George Mateljan helps you cook with easy ideas for healthy foods. Sign up for his free healthy newsletter.
Environmental Working Group
The Environmental Working Group has done an amazing job providing the public with information about:
• Safety or dangers of of cosmetics/personal care products Skin Deep Database
• Safety or dangers of sun screen
• Pesticide residue on fruits and vegetables. Use the to choose the least toxic fruits and vegetables.
• Safe drinking water
• Farm subsidies
• Studies which demonstrate the transfer of toxins to children
Campaign for Safe Cosmetics
Learn the importance for choosing safe personal care products for yourself and your family.
This website provides in-depth pollution information for counties throughout the United States. Ever wonder how much air pollution you are or were exposed to? This web site gives you that information.
Environmental Health Perspectives
Environmental Health Perspectives online is a free monthly peer-reviewed research journal published by National Institutes of Health. It concentrates on the relationship between health and the environment. | <urn:uuid:f1409fdd-1425-4f96-b3f7-93fdaad08717> | CC-MAIN-2021-21 | https://www.idnatmed.com/links | s3://commoncrawl/crawl-data/CC-MAIN-2021-21/segments/1620243988796.88/warc/CC-MAIN-20210507150814-20210507180814-00042.warc.gz | en | 0.885272 | 206 | 2.625 | 3 |
Bulletin of Environmental Contamination and Toxicology
Springer-Verlag New York Inc.
First page number:
Last page number:
Cover is an important component of aquatic habitat and fisheries management. Fisheries biologists often try to improve habitats through the addition of natural and artificial material to improve cover diversity and complexity. Habitat-improvement programs range from submerging used Christmas trees to more complex programs using sophisticated artificial habitat modules. Used automobile tires have been employed in the large scale construction of reefs and fish attractors in marine environments and to a lesser extent in freshwater and have been recognized as a durable, inexpensive and long-lasting material which benefits fishery communities.
Recent studies by the U.S. Bureau of Reclamation have quantified the importance of tire reefs to enhancing freshwater canal fisheries in the southwestern United States. These studies have demonstrated that fishes and aquatic macroinvertebrates are attracted to these structures, increasing species diversity, densities and biomass where reefs are placed in canals. Potential benefits to fishermen are great in the form of recreational fishing. However, the use of tire reefs in aquatic environments which have relatively small volumes compared to marine or reservoir environments has raised water quality concerns. Effects of tires on water quality have not typically been studied in the past because of the obvious presence of fishes and other aquatic organisms that make use of tire reefs; the implication being that tires are inert and non-toxic.
Little information on effects of tires on water quality is contained in the literature. Stone et al. (1975) demonstrated that tire exposure had no detrimental effects on two species of marine fish while results of Kellough's (1991) freshwater tests were inconclusive, but suggested that some factor in tire leachate was toxic to rainbow trout (Oncorhynchus mykiss). Nozaka et al. (1973) found no harmful substances leached from tire material soaked in fresh water.
Because there are few data on toxicity associated with tires, this became the focus of our study. Toxicity Identification Evaluation (TIE) procedures developed by the EPA (1991) were used to evaluate water quality impacted by tires.
Artificial habitats; Benthic organisms; Fisheries; Freshwater fishes; Macroinvertebrates; Water pollution; Water quality
Aquaculture and Fisheries | Biology | Environmental Engineering | Environmental Health and Protection | Environmental Indicators and Impact Assessment | Environmental Monitoring | Fresh Water Studies | Natural Resources Management and Policy | Terrestrial and Aquatic Ecology | Water Resource Management
Nelson, S. M.,
Hemphill, D. C.,
U.S. Bureau of Reclamation
Identification of tire leachate toxicants and a risk assessment of water quality effects using tire reefs in canals.
Bulletin of Environmental Contamination and Toxicology, 52
Available at: https://digitalscholarship.unlv.edu/water_pubs/99
Aquaculture and Fisheries Commons, Biology Commons, Environmental Engineering Commons, Environmental Health and Protection Commons, Environmental Indicators and Impact Assessment Commons, Environmental Monitoring Commons, Fresh Water Studies Commons, Natural Resources Management and Policy Commons, Terrestrial and Aquatic Ecology Commons, Water Resource Management Commons | <urn:uuid:c304d1cc-3b4d-4251-9ae0-a6fd04e06353> | CC-MAIN-2022-27 | https://digitalscholarship.unlv.edu/water_pubs/99/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656104542759.82/warc/CC-MAIN-20220705083545-20220705113545-00430.warc.gz | en | 0.904491 | 717 | 3.0625 | 3 |
High school biology
|Evolution||The process by which modern organisms have descended from ancient organisms over time|
|Common ancestor||An ancestor shared by two or more descendant species|
|Natural selection||Evolutionary mechanism in which individuals that are better suited to their environment survive and reproduce most successfully|
|Variation||Difference between traits in individuals of the same species|
|Adaptation||A trait that improves an organism's ability to survive and reproduce in an environment|
|Fitness||The ability of an organism to survive and reproduce|
|Artificial selection||Selective breeding of organisms to promote the appearance of desirable traits in offspring|
|Genetic drift||A mechanism of evolution in which allele frequencies of a population change over generations due to chance|
Darwin's theory of evolution
Charles Darwin developed a theory of evolution to explain the unity and diversity of life, based on the idea of shared common ancestors.
Darwin's theory was based on the mechanism of natural selection, which explains how populations can evolve in such a way that they become better suited to their environments over time.
Individuals have variations within their heritable traits. Some variations make an individual better suited to survive and reproduce in their environment.
If this continues over generations, these favorable adaptations (the heritable features that aid survival and reproduction) will become more and more common in the population.
The population will not only evolve (change in its genetic makeup and inherited traits), but will evolve in such a way that it becomes adapted, or better-suited, to its environment.
There are other types of selection, in addition to natural selection, that are out there in the world.
Artificial selection, also called "selective breeding”, is where humans select for desirable traits in agricultural products or animals, rather than leaving the species to evolve and change gradually without human interference, like in natural selection.
Dog breeding is a perfect example of how humans select for desirable or fashionable traits. Breeders deliberately mate parents with the hope of producing offspring with specific traits (such as color, size, ear shape, snout length, and so on).
Common mistakes and misconceptions
- Evolution is not the same as adaptation or natural selection. Natural selection is a mechanism, or cause, of evolution. Adaptations are physical or behavioral traits that make an organism better suited to its environment.
- Heritable variation comes from random mutations. Random mutations are the initial cause of new heritable traits. For example, a rabbit can't choose to have a different fur color. Rather, a genetic mutation causes a difference in fur color, which may help that rabbit hide better in its environment.
- Natural selection acts on existing heritable variation. Natural selection needs some starting material, and that starting material is heritable variation. For natural selection to act on a feature, there must already be variation, and that variation must be able to be passed on to offspring.
- Natural selection depends on the environment. Natural selection doesn't favor traits that are somehow inherently superior. Instead, it favors traits that are beneficial in a specific environment. Traits that are helpful in one environment might actually be harmful in another.
Want to join the conversation?
- What is the difference between natural and artificial selection(7 votes)
- The difference between the two is that natural selection happens naturally, but selective breeding only occurs when humans intervene. For this reason, selective breeding is sometimes called artificial selection.(8 votes)
- Hi, I'm not sure whether I'm correct or not.
This page gives the meaning of natural selection as an *"Evolutionary mechanism in which individuals that are better suited to their environment survive and reproduce most successfully".*
So in this case, doesn't it mean that natural selection doesn't have to lead to evolution. For example, people (in a population) living in a harsh condition should exercise to be stronger in order to fit the environment. However, their strength can not be inherited (their offsprings don't descend from them).
Therefore, in my opinion, the definition of natural selection and evolution should involve genetic matters. Otherwise, it is not reasonable to say that natural selection is the cause of evolution.(3 votes)
- For your specific case, natural selection can still be genetic. Yes, you can't always pass down behaviors. However, there still are genes that influence muscle function and how easy it is to exercise. For instance, ALS, the disease that rendered Stephen Hawking unable to move much of his body, is hypothesized to be partially genetic. Plus, there are genes that influence muscle strength, and "strongman" genes do exist. Even if behaviors will not be passed down, those with genes that promote muscle strength will survive and would be more likely to pass them down. They will build more strength faster, and will thus be more fit. There are so many genes in just a single organism alone, and only now are scientists discovering what all of them do. Thus, for a characteristic, it is likely that it may be genetically inherited (what degree the gene influences the characteristic, though, is still up for debate).
However, you are somewhat correct on your statement regarding natural selection being the cause of evolution: it is not the sole cause of it. There is also genetic drift and random mutations, which do not relate to the survival of the fittest.
Does this help?(4 votes)
- Is evolution why humans are the apex predators in every enviorment or is it that we have the most advanced brain?(3 votes)
- yeah, and we have more function because of hands and like thinking we arent the strongest creature by far but we innovate,(3 votes)
- How does natural variation affect evolution?(3 votes)
- Natural variation in a species affects evolution because when there is only one type of variation of a species, natural selection would be more difficult. If there was no natural variation, and some of the organisms survive and reproduce, since they have the same characteristics and no different variation in DNA the offspring would have the same characteristics as the parents.
So, in order for a species to evolve, only those that are stronger and better than the others can survive.
In conclusion, natural variation affects evolution because the more variation there is in a species, the more results in future generations. Sometimes, it does not matter though. Even if an organism had the same DNA as another, the better one (the one who gets the food, survives from predators, and gets enough necessities) will pass its "strength" to their offspring.(2 votes)
- What if there was a big mass extinction? Would the Earth still be the same before the mass extinction? Would you please explain this? Thank You!(3 votes)
- Mass extinctions pretty much always have a dramatic effect on life on Earth. A good example of this is the asteroid that killed off the dinosaurs. If that event had never happened, there might still be dinosaurs around, which would be kind of terrifying.
So yeah, mass extinctions definitely impact what happens later on.(3 votes)
- What is the difference between evolution and adaptation?(2 votes)
- Evolution evolves a population and usually happens on accident rather than on purpose, however, adaptation adapts members of a species to sudden changes in their environment.(2 votes)
- What if the species dies before natural selection takes place?(2 votes) | <urn:uuid:4d7f5808-8e94-4017-bce2-e9d43bf029b0> | CC-MAIN-2023-40 | https://en.khanacademy.org/science/high-school-biology/hs-evolution/hs-evolution-and-natural-selection/a/hs-evolution-and-natural-selection-review | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233510219.5/warc/CC-MAIN-20230926175325-20230926205325-00199.warc.gz | en | 0.944851 | 1,543 | 4.09375 | 4 |
Reduce Drift Potential
Follow these recommendations to minimize drift into peanut fields.
By Peter Dotray, Todd Baughman, James Grichar,
Soon, the spraying of postemergence herbicides to control weeds in production fields will be in full swing. The majority, if not all, of our peanut fields are in close proximity to either Roundup Ready cotton, corn or soybean fields as well as other crops, including small grains and horticultural crops.
Over the past few years, we have seen a number of peanut fields with damage due to Roundup (glyphosate) drift. Therefore, we thought that a list of things to consider to help minimize spray drift might be a timely reminder at this busy time of year.
1. Avoid spraying in windy conditions! High wind speed is the No. 1 cause of herbicide drift. When wind speed doubles, the horizontal distance spray droplets travel will also double.
Conversely, do not spray when winds are extremely calm because of potential herbicide movement due to temperature inversions (more information following).
2. Larger droplets reduce drift potential. The smaller the droplet, the longer the time it takes to travel from spray tips to the target (weeds or soil) and the farther it will drift. Larger and more uniform droplets reduce the potential for drift. The ideal droplet size is 400 to 800 microns.
Smaller droplets also evaporate faster, and herbicide efficacy will be reduced. Therefore, use a larger nozzle orifice size. Larger orifice nozzles with high delivery rates produce a thicker sheet of spray solution and larger droplets than nozzles with a small orifice size.
3. Increase the carrier volume. The driving force behind herbicide uptake into plant leaves is the concentration gradient. Increasing the carrier volume will decrease the water droplet concentration, minimizing the risk of drift damage.
Increasing the carrier volume may help improve the efficacy of some herbicides (e.g. Ignite), but decrease the activity of other herbicides (e.g. Roundup).
4. Decrease spray pressure. Increased spray pressure can cause the spray sheet to be thinner. This thinner sheet will break into smaller droplets than a thicker sheet produced at lower pressure.
5. Use drift reducing-type nozzles. Many nozzles on the market today that are designed to produce a higher percentage of large spray droplets and lower percentage of spray “fines.” Select nozzles that work best with your sprayer and production practice.
6. Consider using a drift retardant agent. There are several drift retardant products that can be added to spray mixtures to reduce the percentage of “fines” in herbicide applications.
Check labels and make sure that these products are compatible with the spray mixture. It is generally not recommended to use both reduction tips and retardant agents at the same time.
7. Lower your boom height. When the boom height is set too high, droplets must fall further, increasing the chances for drift. Setting the boom at the lowest possible height while maintaining proper spray overlap will reduce the risk from herbicide drift.
8. Spray during times of high humidity and low temperatures. Weather conditions can affect the potential for herbicide drift. The optimum conditions for low risk are higher humidity levels and lower temperatures. Droplet evaporation is most severe when conditions are hot and dry.
9. Avoid spraying during a temperature inversion. A temperature inversion occurs when a layer of warm air gets trapped between two layers of cooler air. Spray particles can get caught in the layer of warm air and move long distances.
10. Minimize potential of spray drift to come in contact with sensitive plants. Make applications when sensitive plants are not present, avoid applications near sensitive plants by using unsprayed buffer rows, and spray when the wind is moving away from sensitive plants. Use a shielded sprayer. Avoid aerial applications near sensitive areas.
Most herbicides will not volatilize (a conversion from the liquid state to a gaseous state), but all herbicides move by means of physical drift (the liquid state moving to non-target plants).
Be aware that over-the-top applications of Roundup in Roundup Ready crops have the potential to damage adjacent crops including peanut. Conversely, applications of Cadre, Pursuit, Cobra and 2,4-DB made to peanut can damage adjacent cotton fields.
Always carefully read and follow herbicide label instruction to maximize herbicide effectiveness and minimize herbicide movement to non-target plants. | <urn:uuid:8567f55a-0512-4cbd-abf6-134e56a0b8f6> | CC-MAIN-2014-23 | http://www.peanutgrower.com/Home/2009_JuneDrifts.html | s3://commoncrawl/crawl-data/CC-MAIN-2014-23/segments/1406510273012.22/warc/CC-MAIN-20140728011753-00042-ip-10-146-231-18.ec2.internal.warc.gz | en | 0.891041 | 942 | 2.640625 | 3 |
Come enjoy the Academy for free this Sunday, December 11.
Can extreme weather events be linked to climate change? Yes. Then, can specific events (Sandy, Nemo, the drought throughout Texas and the Midwest, etc.) be linked to the warming planet? Not yet, seemed to be the consensus at the annual AAAS meeting currently underway in Boston.
Four amazing and passionate scientists discussed different aspects of our changing world—wildlife, drought, storms and the tree-ring record—at a press conference titled, “Did Climate Change Cause Superstorm Sandy?”
Remember, these are scientists, not politicians (see more in Andy Revkin’s New York Times blog). They need evidence to see causal effect between one event and another. And for these recent storms and weather patterns, there just isn’t enough evidence. Yet.
But are these researchers glad that these events are focusing Americans’ attention (including the President in his recent State of the Union address) on climate change? Most definitely. Yes.
Here’s what they do know. Climate change is affecting the probability of storms like Sandy and Nemo. There is evidence that in our warming world, severe storms will happen more frequently.
Researchers understand that global warming and other human-related activities are affecting where animals live, move and mate, and when plants bloom.
Scientists also know that temperature increase is one factor in drought. Texas temperatures have risen steeply in just the past 15 years and drought has increased. And now Texans are talking about climate change, said John Nielsen-Gammon of Texas A&M University. The drought alone didn’t alarm them about climate change, but the decreased water supply has made people and politicians alike take notice.
And the speakers are hopeful and passionate that we’ll start doing something about these effects—reducing fuel emissions, restoring habitats, becoming more aware of climate change.
What do you know and feel? Share with us here.
Midwest drought image: cwwycoff1/Wikipedia | <urn:uuid:6f5ab746-6303-4ea1-b232-4877969b37d2> | CC-MAIN-2016-50 | http://www.calacademy.org/explore-science/extreme-weather-climate/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542655.88/warc/CC-MAIN-20161202170902-00284-ip-10-31-129-80.ec2.internal.warc.gz | en | 0.942239 | 420 | 3.21875 | 3 |
Origin of leachyleach + -y
(comparative more leachy, superlative most leachy)
- Permitting liquids to pass by percolation; not capable of retaining water; porous.
- Gravelly and sandy soils may be leachy.
Part or all of this entry has been imported from the 1913 edition of Webster's Dictionary, which is now free of copyright and hence in the public domain. The imported definitions may be significantly out of date, and any more recent senses may be completely missing.
leach +"Ž -y | <urn:uuid:686aa31e-c4b1-47c6-85b1-68a9a2d25eae> | CC-MAIN-2016-36 | http://www.yourdictionary.com/leachy | s3://commoncrawl/crawl-data/CC-MAIN-2016-36/segments/1471982952852.53/warc/CC-MAIN-20160823200912-00289-ip-10-153-172-175.ec2.internal.warc.gz | en | 0.886396 | 118 | 2.703125 | 3 |
I really loved the Brain Blitz presentations we did last week because they brought up a lot of questions I had never really thought of before. I was particularly struck by the question: How are personalities shown in and influenced in the brain?
There are many different ways we can evaluate and measure personality, and one is by examining where people put their attention and where they get their energy. C. G. Jung categorized this into two types, introversion and extroversion. Most psychologists believe that there is a spectrum between both categories in which most people fall into. People are more extraverted if the like to spend their time in the outer world of people and things, and more introverted if they like to spend their time in their own inner world of ideas and images.
Grodin and White (2015) investigated the parts of the brain that correspond with extraversion traits. They studied extraversion by dividing the personality dimension into two major types. “Agentic extroversion” is characterized by assertiveness, persistence, and achievement. People who are driven by the positive emotion of social warmth, friendliness, and affection, on the other hand, encompass “affiliative extroversion.” They used a personality questionnaire, structural magnetic resonance imaging, and voxel-based morphometry in attempt to find specific parts of the brain that correlate with these personality types.
Findings from this study indicated that extroverts (regardless of agentic or affiliative) have larger volumes of gray matter in the medial orbitofrontal cortex, regardless of age or gender. This area is believed to be associated with the upkeep of reward-guided decision making, goal-directed performance, and long-term social bonding. Grodin and White (2015) also found that male and female agentic extroverts, specifically, had a larger amount of gray matter left parahippocampal gyrus, left caudate, and left precentral gyrus. Males also showed increased volume in the right nucleus accumbens. The differences in parahippocampal gyrus are particularly interesting here, because this part of the brain is involved in learning and memory for reward.
I found these findings to be particularly interesting for a two reasons. Firstly, what could account for the gender differences between male and female brains? Is there something different about the functioning of the nucleus accumbens, allowing for this area to be larger in agentic extroverted males than agentic extroverted females? Secondly, these findings bring up a much larger question of “chicken-or-the-egg”/what came first. We know from brain plasticity that our behavior can, in fact, shape our brain. Are agentic extroverts naturally wired to feel more reward after social experiences than affiliative extroverts and introverts? Or, is this a part of the brain that has grown due to the agentic individual’s experience, resulting in a higher association between social experiences and reward?
Grodin, E., White, T. (2015). The neuroanatomical delineation of agentic and affiliative extraversion. Cognitive, Affective, & Behavioral Neuroscience. DOI: 10.3758/s13415-014-0331-6
The Myers-Briggs Foundation. Retrieved from http://www.myersbriggs.org/my-mbti-personality-type/mbti-basics/extraversion-or-introversion.htm. | <urn:uuid:451d9127-c5aa-4e12-a8d1-8e3013ccd29d> | CC-MAIN-2022-40 | https://psych-neuro.com/2015/03/03/uncovering-extroversion-in-the-brain/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030334644.42/warc/CC-MAIN-20220926020051-20220926050051-00041.warc.gz | en | 0.943676 | 721 | 3.1875 | 3 |
I was recently at a vacation spot where I overheard a conversation between a mother and her son. Both were in a playground area, and the youngster's disinterest was apparent. He slapped at the swings and moved them into lazy motion while complaining that his video time was being interrupted. The complaints were issued between bites of a cookie. His mother was trying to make him aware that being outside and playing on a sunny day was a good thing.
Things have changed. When I was a kid, we were expected to be outside. As a matter of fact, being kept inside was usually a punishment for some infraction. When we were not allowed outside because of poor behavior, our protests were of banshee caliber. Outside was where we wanted to be.
A good diet was another expectation. Snacks were those things we had after we ate a balanced meal. Fast food was a weekend venture if it was had at all. A healthy diet and exercise were things that didn't really require explanation. We did them naturally - especially given all the time outside.
Our children do not have to be ill at ease in a playground, yearning for video games and snack foods. We can be the difference makers, and one of the things we can do is introduce our children to a healthy diet as soon as possible.
Health Habits Start Early
Introduce your child to healthy eating while you are still pregnant. Infants can taste flavors in utero as well as through breast milk. Healthy choices during pregnancy and breastfeeding can help establish a foundation for a healthy diet at a later time.
When a baby is weaning and introduced to solid foods, a variety of exposure can help to minimize a toddler's refusal of foods. It also can help to enhance acceptance of trying new foods. Keep in mind that rich colored foods like butternut squash, sweet potatoes, carrots, broccoli and leafy greens have been shown to help build dense bones, good immunity and strong brains.
Allow children to self-regulate, also beginning at breastfeeding. A child's decision to end the meal permits them to control intake. Signs that an infant is satisfied include turning the head away, arching the back and showing interest in things other than feeding. To reinforce self-regulation, meals and healthy snacks should be served on a schedule.
Mild herbs and spices can be added to a child's food, as well, to introduce flavorful nuances. This doesn't mean that your baby will embrace everything that is offered — and that is to be expected Even favored foods sometimes are put on hiatus. You can also try changing the texture by mincing, mashing, dicing or pureeing. Sometimes the feel or look of a food puts a child off. So mix it up and see what happens.
If meal time becomes adventurous, then children will be more willing to try less familiar foods, and that’s a habit that can very well carry over into adulthood.** Read more on this topic:**** Raising a Normal Weight Child in an Overweight Society**
How My Daughter Raised a Normal Weight Child
How to Keep Your Child Physically Active — a Mother’s Advice
How My Family Eats and Plays Healthy — Advice from a Mom
How I Made My Child Eat Healthy — Practice, Patience, and Persistence
**Living larger than ever,**My Bariatric Lifisit me on MyBariatricLife.org, Flickr, Vimeo, Twitter, YouTube,StumbleUpon, ** Google+**
View my ** Borne Appétit recipe collection on Pinterest**
Natural Awakenings Magazine | <urn:uuid:09a09831-185c-4bf2-9654-941e2b6de8d2> | CC-MAIN-2019-51 | https://www.healthcentral.com/article/getting-your-child-to-eat-healthy | s3://commoncrawl/crawl-data/CC-MAIN-2019-51/segments/1575540504338.31/warc/CC-MAIN-20191208021121-20191208045121-00165.warc.gz | en | 0.979776 | 735 | 2.625 | 3 |
Chronic disease and race are intimately bound, generating persistent and sometimes hard-to-explain health care disparities. Race is a superficial and most often a misleading explanatory variable for a category of people. This concept was vividly demonstrated when Chris Hayes, host of MSNBC’s All In
, used a segment of his television show to ask, “What Will the White Community Do About ‘White Criminal Culture’’? (http://www.huffingtonpost.com/2013/07/31/cord-jefferson-chris-hayes-white-community_n_3680067.html
). Although Hayes’ segment turned out to be somewhat tongue-in-cheek, his message—that race is a disingenuous generalization to a population group—was not. However, in the field of epidemiology and health sciences, when we are often lacking access to more discrete measures that place individuals within the context of society and their communities, race is often our go-to variable, for better or worse. Furthermore, we are often left to use proxy measures, such as income, educational attainment, or zip code, for how people perceive disease and their subsequent behaviors. What we really need to know, however, is how particular groups of people think
about their disease, think
about their health, think
about their risks for complications, and think
about their future and what is possible for them.
Left with such proxy measures, the Centers for Disease Control and Prevention (CDC) describes health disparities and inequalities as representing differences in education and income, inadequate and unhealthy housing, exposure to unhealthy air quality, access to health care and preventive health services, and health outcomes (including both mortality and disease burden).
Centers for Disease Control and Prevention
CDC health disparities and inequalities report—United States, 2013.
One framework for understanding health care disparities is the social determinants of health model. The characteristics that comprise this model include factors associated with socioeconomic status, including education, income, health practices, and stress; factors associated with residential segregation, including impact on income, violence, and links to disease; and factors associated with medical care, including links to homicide, links to cancer mortality, and impact of segregation.
- Williams D.R.
- Jackson P.B.
Social sources of racial disparities in health.
Although these characteristics are somewhat closer to the mark, they still are dissatisfying because we run the risk of inaccurately assigning risk to a generic group of people based on a superficial feature such as race or income; however, delving deeper into how these characteristics may be quantified begins to help us think in terms of peoples’ lives and their unique experiences that increase their risk for poor health care outcomes.
Intrinsic Risk Factors That Emerge from Social Explanations for Poor Health Care Outcomes
Health care disparities seem to persist, despite attention on a grand scale from funders, investigators, and, to some extent, legislators. The Agency for Healthcare Research and Quality ascribes other causes to continuing health care disparities, including physician decision making and cultural and communication barriers. In describing the American-Indian community, Mitchell suggests that patient-level strategies for preventing and managing diabetes fail to address the fundamental causes and complexity of the disease.
Reframing diabetes in American Indian communities: a social determinants of health perspective.
Although she writes about an effort to reframe diabetes to understand it within the context of the American-Indian experience as “a product of and a response to unjust conditions and environments, rather than as a disease rooted solely in individual pathology and responsibility,” she could just as easily be describing the complexity of diabetes as a universal sociomedical condition.
Intrinsic, patient-centric factors have been suggested as militating against patient capabilities to incorporate diabetes prevention and management activities into individuals’ daily lives. These factors emerge from the context in which people live and may contribute to our understanding of persistent health care disparities. They include such factors as health literacy, health care fatalism, cognitive impairment, and depression. For example, a cross-sectional study of the most recent glycosylated hemoglobin level among 408 English- and Spanish-speaking adult patients with type 2 diabetes mellitus (T2DM) suggested that those patients with inadequate health literacy (on the basis of the short-form Test of Functional Health Literacy in Adults) were more likely to have poor glycemic control (adjusted odds ratio [OR], 2.03 [95% CI, 1.11–3.73]; P = 0.05) and to report having retinopathy (adjusted OR, 2.33 [95% CI, 1.19–4.57]; P = 0.01). Health literacy goes beyond a capability to describe health concepts to also include understanding these concepts.
Fatalism represents “a complex psychological cycle characterized by perceptions of hopelessness, worthlessness, meaninglessness, and social despair.”
An intervention to decrease cancer fatalism among rural elders.
Egede and Bonadonna explored the concept of fatalism in relation to diabetes self-management behavior in the United States, describing it as particularly relevant to African-American subjects and the African-American experience, linking the concept to existential angst as the universal experience of dread and despair from years of enslavement, economic impoverishment, and disenfranchisement, accompanied by nihilism. Using a validated instrument (the 12-item Diabetes Fatalism Scale
- Garcia A.A.
- Villagomez E.T.
- Brown S.A.
- et al.
The Starr County Diabetes Education Study Development of the Spanish-language diabetes knowledge questionnaire.
), Walker et al
- Walker R.J.
- Smalls B.L.
- Hernandez-Tejada M.A.
- et al.
Effect of diabetes fatalism on medication adherence and self-care behaviors in adults with diabetes.
discerned significant correlations between fatalism and medication adherence (r
= 0.24, P
< 0.001), diet (r
= 0.26, P
< 0.001), exercise (r
= –0.20, P
< 0.001), and blood sugar testing (r
= –0.19, P
Poverty and depression are closely correlated. The chronic stress that develops after long-term economic hardship and perceptions of bias and experiences of being socially disadvantaged is a mediator for depression among low-income populations,
- Mezuk B.
- Rafferty J.A.
- Kershaw K.N.
- et al.
Reconsidering the role of social disadvantage in physical and mental health: stressful life events, health behaviors, race, and depression.
- Everson S.A.
- Maty S.C.
- Lynch J.W.
- Kaplan G.A.
Epidemiologic evidence for the relation between socioeconomic status and depression, obesity, and diabetes.
- Delahanty L.M.
- Conroy M.B.
- Nathan D.M.
Psychological predictors of physical activity in the diabetes prevention program.
contributing to an increased number of depressive symptoms
- Grote N.K.
- Bledsoe S.E.
- Wellman J.
- Brown C.
Depression in African American and white women with low incomes: the role of chronic stress.
and reduced cognitive functioning.
- Evans G.W.
- Schamberg M.A.
Childhood poverty, chronic stress, and adult working memory.
- Crowe M.
- Sartori A.
- Clay O.J.
- et al.
Diabetes and cognitive decline: investigating the potential influence of factors related to health disparities.
Poverty represents an important risk factor in the social determinants framework for chronic disease, including obesity, diabetes, and cardiovascular disease. Depression commonly accompanies diabetes, resulting in reduced adherence to medications and increased risk for morbidity and mortality.
- Bogner H.R.
- Morales K.H.
- de Vries H.F.
- Cappola A.R.
Integrated management of type 2 diabetes mellitus and depression treatment to improve medication adherence: a randomized controlled trial.
Major depression among people with T2DM has been linked to a greater likelihood for initial hospitalization for ambulatory care–sensitive conditions (hazard ratio [HR], 1.41 [95% CI, 1.15–1.72]) and number of hospitalizations for ambulatory care–sensitive conditions (HR, 1.37 [95% CI, 1.12–1.68]).
- Davydow D.S.
- Katon W.J.
- Lin E.H.
- et al.
Depression and risk of hospitalizations for ambulatory care-sensitive conditions in patients with diabetes.
Depressed patients with T2DM have a significantly higher risk of a severe hypoglycemic episode compared with nondepressed patients with T2DM (hazard ratio, 1.42 [95% CI, 1.03–1.96]) and a greater number of hypoglycemic episodes (OR, 1.34 [95% CI, 1.03–1.74]).
- Katon W.J.
- Young B.A.
- Russo J.
- et al.
Association of depression with increased risk of severe hypoglycemic episodes in patients with diabetes.
With data from the National Social Life, Health and Aging Project, Wexler et al
- Wexler D.J.
- Porneala B.
- Chang Y.
- et al.
Diabetes differentially affects depression and self-rated health by age in the US.
identified a higher rate of depression among the youngest cohort of respondents with diabetes compared with those without diabetes.
We are learning more about the complex interplay between diabetes and depression, with a dysfunction in the hypothalamus-pituitary-adrenal axis, neurotrophins, and inflammatory mediators contributing to the development of a bidirectional relationship between depression and diabetes.
Depression and type 2 diabetes: inflammatory mechanisms of a psychoneuroendocrine co-morbidity.
If, indeed, evidence from the molecular sciences continues to mount, signifying a key biological link between diabetes and depression, as suggested by Stuart and Baune in Neuroscience & Biobehavioral Reviews
, we might eventually acquire the pharmacologic therapy with which to more efficiently manage this complex comorbidity. Until we move our understanding of the overlay between behavior and disease further, we are left with the very real problem of positively motivating people who are depressed to engage in healthy lifestyle behaviors that prevent or delay the diagnosis of diabetes, and reduce the risk for complications among people with diabetes. Similarly, we must also rely on our somewhat limited understanding of how to motivate and encourage patients with diabetes, regardless of whether they are also depressed, to engage in diabetes self-management activities by also considering the social context of their experiences.
In this DIABETES Update
The social context of disease and the intrinsic risk factors that contribute to health care disparities is the prism through which we examine T2DM in this Diabetes Update, entitled “Race, Risk, and Behaviors.” Clinicians in practice, health services researchers, clinical researchers, and pharmacotherapy researchers can benefit from this review, which includes an examination of a high-risk population and their perceptions of T2DM. This Diabetes Update includes papers by the lead authors which I have presented a quick overview of below.
Leonard Jack, Jr., PhD, MSC, director of the CDC’s Division of Community Health in the National Center for Chronic Disease Prevention and Health Promotion, and Leandris C. Liburd, PhD, MPH, MA, associate director for Minority Health and Health Equity at the CDC, are coauthors on an article describing how African-American subjects perceive T2DM. Their article, entitled, “Having Their Say: Patients’ Perspectives and the Clinical Management of Diabetes,”
- Jack Jr, L.
- Liburd L.C.
- Tucker P.
- Cockrell T.
Having their say: patients’ perspectives and the clinical management of diabetes.
has important implications for how clinicians can effectively engage with patients to increase the extent to which they participate in diabetes prevention behaviors and diabetes self-management activities. Sonjia Kenya, EdD, assistant professor of Family Medicine at the University of Miami Miller School of Medicine, reports on the observations from a team of community health workers regarding perceptions toward self-monitoring of blood glucose among Latino community members with T2DM. In “Glucometer Use and Glycemic Control Among Hispanics in South Florida,”
- Kenya S.
- Lebron C.
- Arrechea E.R.
- Li H.
Glucometer use and glycemic control among Hispanics in south Florida.
Dr. Kenya suggests that Latinos with T2DM in a particular geographical area have a limited understanding regarding the purpose of self-monitoring of blood glucose, which may be partially due to the limited availability of diabetes self-management education for low-income, minority patients. Janice M. Lopez, PharmD, at Bristol-Myers Squibb, uses data collected from a Web-based survey to describe the manner in which diabetes is conceptualized by subjects with diabetes, based on their ethnic group and how this concept changes with age. Despite the potential for response bias that comes with a survey conducted on the Web, in her article entitled “Characterization of Type 2 Diabetes Mellitus Burden by Age and Ethnic Groups Based on a Nationwide Survey,”
- Lopez J.M.
- Bailey R.A.
- Rupnow M.F.
- Annunziata K.
Characterization of type 2 diabetes mellitus burden by age and ethnic groups based on a nationwide survey.
Dr. Lopez offers a provocative conclusion that merits review—and understanding—by investigators and clinicians alike. This Diabetes Update also includes articles from Marcus Hompesch, MD (“Insulin Degludec Provides Similar Pharmacokinetic and Pharmacodynamic Responses in African American, Caucasian, and Hispanic/Latino Subjects With Type 2 Diabetes”
- Hompesch M.
- Morrow L.
- Watkins E.
- et al.
Insulin degludec provides similar pharmacokinetic and pharmacodynamic responses in African American, Caucasian, and Hispanic/Latino subjects with type 2 diabetes.
), and Vivien Fonseca, MD, chief, Section of Endocrinology at the Tulane University School of Medicine, who provides an overview of new pharmacologic tools for managing T2DM (“New Developments in Diabetes Management: Medications of the 21st Century”
New developments in diabetes management: medications of the 21st century.
© 2014 Elsevier HS Journals, Inc. Published by Elsevier Inc. All rights reserved. | <urn:uuid:1975bcc5-e4b1-4add-ad82-cde12445d48d> | CC-MAIN-2023-06 | https://www.clinicaltherapeutics.com/article/S0149-2918(14)00136-2/fulltext | s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764499831.97/warc/CC-MAIN-20230130232547-20230131022547-00312.warc.gz | en | 0.907722 | 3,200 | 3.640625 | 4 |
Sports people have one main priority, to get back to their sport.
My approach is:
- Diagnosis – work out what tissues are injured?
- Prognosis – what it the likely healing time?
- Treatment through muscle balancing, deep tissue manipulation and massage, electrotherapy, acupuncture
- Support – both emotional and practical
Causes of Sports Injuries
Impact: All sports involve movement. Sudden impact takes your nervous system by surprise. Develop resilience with practice or protect your body. Learn to give way. Martial arts teach people to soften and give with impact, absorb the energy. For instance, if you are running and trip or catch a pothole, completely yield to it. Tip: Learn to fall. A yoga teacher Andreas Wren, used to ask when teaching headstands, what is the worst that can happen? Practise it first.
Recovery: Sports place demands on blood sugar, glycogen metabolism, protein and fat synthesis. Plan your refuelling between activity. Mixing carbohydrates and proteins increases muscle glycogen stores. Eat both within 30 minutes of training then if possible every 30 minutes for 2 hours. For training aim for 1.5gm protein for each kg of body weight. Tip: try honey and oatcakes (with butter) for refuelling. Cashew nuts are good for endurance events. Cashews contain a higher proportion of carbohydrate 18g / 100g and good quality proteins
Conditioning: Footballers tend to suffer leg, groin and knee injuries. Yoga is a great way of conditioning. Cyclists suffer from short hip flexors especially psoas muscles. Runners suffer from IT band strain. The IT band is a long tendon from the outer thigh to the shin bone. Tip: remember your legs are designed to work in all directions not simply forwards and backwards. Try gripping a yoga block between your knees, squatting and move around as if you were skiing.
Repetition: Most sports affect one side of the body more than the other. Even running or cycling the same route can set up a bias. Think which side is dominant, if it is the right try thinking left, left left…to engage the left leg. Tip: practice club or racquet sports with the other hand to build muscle and brain co-ordination.
Footwear: we tend to pronate flat feet, or to supinate high arches. Wear good footwear. Tip: work on your one leg balance and grip your toes regularly when you are sitting.
Focus: A narrow focus often misses the wider picture. People and obstacles are coming at you from all directions. Let your mind detach and look at the big picture. Tip: un-focus your eyes and take in your surroundings.
Medication: all medication is a trade-off between benefit and risk. Less pain might lead to unwanted side effects. Tip: take only what you really need. | <urn:uuid:4729d39b-5c93-431a-bd59-4be29c971351> | CC-MAIN-2020-50 | https://www.johnperrott.com/treatments/sports-injury-treatment/ | s3://commoncrawl/crawl-data/CC-MAIN-2020-50/segments/1606141188947.19/warc/CC-MAIN-20201126200910-20201126230910-00031.warc.gz | en | 0.934341 | 595 | 2.90625 | 3 |
i have to pee
Once upon a time, there was a wicked witch grandmother. She had an enchanted mirror with evil powers. She was banished into the woods by the King. Soon enough, the mirror breaks into shards.
A few shards turned a wolf into an evil, monstrous one. The witch's granddaughter, Little Red, traverses the vile forest and goes through trials. The wolf follows Little Red to the grandmother's house. On the way, Little Red learns of the witch's evil deeds.
When she arrives, the wolf reveals that he ate the grandmother. A huntsman enters the scene to end the wolf. Instead, Little Red protects the wolf. The wolf crys glass shards and he is back to normal. Little Red keeps the wolf as her pet and they lived happily ever after.
Explore Our Articles and Examples
Try Our Other Websites!
Photos for Class
– Search for School-Safe, Creative Commons Photos (It Even Cites for You!
– Easily Make and Share Great-Looking Rubrics
– Create Custom Nursery Art | <urn:uuid:3a89a7de-7048-4177-96dd-aea36804c2d6> | CC-MAIN-2018-22 | http://www.storyboardthat.com/storyboards/plasticplant/the-shards | s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794863410.22/warc/CC-MAIN-20180520112233-20180520132233-00396.warc.gz | en | 0.931329 | 218 | 2.9375 | 3 |
How to Write Fairy Tales & Use Folklore 4-Week Online Workshop, Starts February 6th, 2023
Begins Monday, February 6th, 2023
Any questions about this class? Use the Chat Button (lower left) to talk with us.
Led by Cristina Slattery, a writer whose work has been published widely, including in The New York Times and The Wall Street Journal. Cristina holds graduate degrees from Middlebury College's Bread Loaf School of English and Fordham University's Graduate School of Education and has extensively researched and studied fairy tales and folklore in their varying forms.
This generative writing course is focused on Fairy Tales and Folklore, and we'll explore these ancient forms in depth and work to incorporate elements from oral traditions into your fiction. This class can be used as a starting point for a new project or to enhance an existing work-in-progress.
So, how can we better understand fairy tales and folklore and use both in our fiction? What can we learn from the fairy tale re-tellings that have become so popular in recent years both in fiction and film?
Maria Tatar, an author, professor, and expert on fairy tales, writes that “fairy tales…work their magic as they evolve, giving us both story and history.” Tatar explains that, for example, “Snow White can be found in nearly every place that stories are told, and she rarely has white skin.”
What are fairy tales though? Tatar writes that “death in childbirth, maternal malice, and child abandonment: it’s all part of the daily rhythm in the fairy tale universe.” She adds that “fairy tales do more than offer simple solutions to complex problems. They not only activate our sense of curiosity about what’s next but also lead us to think big about questions fundamental to the human condition.”
This course will allow writers to gain a clearer sense of the ancient fairy tale form and also analyze a fairy tale and one retelling in depth. Writing exercises will focus on elements that make fairy tales unique and also explore how to use folklore in fiction.
Another scholar, Claude Lecouteux, writes that “in addition to the scholarly mythology that was passed down by the ancient mythographers, there also exists an entire network of constantly evolving representations and folk beliefs. From this, an image emerges of a distinctive world in which elemental and supernatural beings are no longer denizens of a distant pantheon, but live in close proximity to humans – in the forests and mountains, beneath the stones, and so forth.”
- The writer will gain a deeper knowledge of the fairy tale form and the role of folklore in fiction.
- He or she will have analyzed one fairy tale and a retelling in detail and explored how to use elements that comprise the fairy tale form and/or aspects of folklore in his or her fiction.
- Playful exploration and experiment with fairy tale elements through generative writing exercises
- Supportive workshop and individually-provided instructor feedback on your work
ONLINE COURSE STRUCTURE:
Wet Ink, our dedicated online classroom, was designed specifically for writing classes. It is a private, easy to use, and highly interactive online platform. Learn more about it from this class demo.
The class is entirely asynchronous which means that there are no set meeting times and students work to their own schedules. Participants will be from different time zones, which allows for a wonderful diversity of voices. In addition to ongoing discussions, all craft materials, lectures, reading assignments, and writing prompts will be available in the Wet Ink classroom. Students will also post work and provide and receive feedback within the online environment.
Instructor: Cristina Slattery
Class size limited to 12 writers
Workshop starts February 6th, 2023
Course is fully ONLINE; students can work according to their own schedule within weekly deadlines. Once you have enrolled the instructor will send you a link to our online classroom, provided via Wet Ink.
Instructor Cristina Slattery has published a variety of non-fiction articles in magazines and on websites ranging from The New York Times to the Wall Street Journal. She is currently finalizing a fantasy novel for kids 10-12 and planning to send it out to agents soon. Her novel takes place in a world based on Central Europe in the Middle Ages and she has researched the fairy tales and folklore of different areas of Europe as part of the process of creating the novel. Cristina has an undergraduate degree with honors in her field from Harvard University and graduate degrees from Middlebury College's Bread Loaf School of English and Fordham University's Graduate School of Education. She has taught English at the high school and middle school levels in both the U.S. and in Spain. | <urn:uuid:a42f8245-df85-4e3b-a142-032f6c332c4e> | CC-MAIN-2022-49 | https://writingworkshops.com/products/how-to-write-fairy-tales-and-use-folklore-4-week-online-workshop | s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446710777.20/warc/CC-MAIN-20221130225142-20221201015142-00520.warc.gz | en | 0.950209 | 1,011 | 2.625 | 3 |
A cold wave (known in some regions as a cold snap, cold spell or Arctic Snap) is a weather phenomenon that is distinguished by a cooling of the air. Specifically, as used by the U.S. National Weather Service, a cold wave is a rapid fall in temperature within a 24-hour period requiring substantially increased protection to agriculture, industry, commerce, and social activities. The precise criteria for a cold wave are the rate at which the temperature falls, and the minimum to which it falls. This minimum temperature is dependent on the geographical region and time of year.
In the United States, a cold spell is defined as the national average high temperature dropping below 20 °F (−7 °C). A cold wave of sufficient magnitude and duration may be classified as a cold air outbreak (CAO).
A cold wave can cause death and injury to livestock and wildlife. Exposure to cold mandates greater caloric intake for all animals, including humans, and if a cold wave is accompanied by heavy and persistent snow, grazing animals may be unable to reach needed food and die of hypothermia or starvation. They often necessitate the purchase of foodstuffs to feed livestock at considerable cost to farmers.
Cold spells are associated with increased mortality rates in populations around the world. Both cold waves and heat waves cause deaths, though different groups of people may be susceptible to different weather events. More deaths occur during a cold wave than in a heat wave, though the mortality rate is higher in undeveloped regions of the world. Globally, more people die during hot weather than cold weather. Extreme winter cold often causes poorly insulated water pipelines and mains to freeze. Even some poorly protected indoor plumbing ruptures as water expands within them, causing much damage to property and costly insurance claims. Demand for electrical power and fuels rises dramatically during such times, even though the generation of electrical power may fail due to the freezing of water necessary for the generation of hydroelectricity. Some metals may become brittle at low temperatures. Motor vehicles may fail when antifreeze fails or motor oil gels, producing a failure of the transportation system.
Fires become even more of a hazard during extreme cold. Water mains may break and water supplies may become unreliable, making firefighting more difficult. The air during a cold wave is typically denser and thus contains more oxygen, so when air that a fire draws in becomes unusually cold it is likely to cause a more intense fire. However, snow may stop spreading of fires, especially wildfires.
Winter cold waves that are not considered cold in some areas, but cause temperatures significantly below average for an area, are also destructive. Areas with subtropical climates may recognize a cold wave at higher temperatures than other, colder areas of the globe. The cold wave may be recognized at barely freezing temperatures, as these are still unusually cold for the region, and plant and animal life will be less tolerant of such cold. The same winter temperatures that one associates with the norm for Colorado, Ohio, or Bavaria are catastrophic to crops in places like Florida, California, or parts of South America that grow fruit and vegetables in winter.
Cold waves that bring unexpected freezes and frosts during the growing season in mid-latitude zones can kill plants during the early and most vulnerable stages of growth, resulting in crop failure as plants are killed before they can be harvested economically. Such cold waves have caused famines. At times as deadly to plants as drought, cold waves can leave land in danger of later brush and forest fires that consume dead biomass. One extreme was the so-called Year Without a Summer of 1816, one of several years during the 1810s in which numerous crops failed during freakish summer cold snaps after volcanic eruptions that reduced incoming sunlight.
Recent research suggests a possible link between cold waves and extratropical cyclogenesis.
In some places, such as Siberia, extreme cold requires that fuel-powered machinery intended to be used occasionally must be run continually. Internal plumbing can be wrapped, and persons can often run water continuously through pipes. Energy conservation, difficult as it is in a cold wave, may require such measures as collecting people (especially the poor and elderly) in communal shelters. Even the homeless may be arrested and taken to shelters, only to be released when the hazard abates. Hospitals can prepare for the admission of victims of frostbite and hypothermia; schools and other public buildings can be converted into shelters.
People can stock up on food, water, and other necessities before a cold wave. Some may even choose to migrate to places of milder climates, at least during the winter. Suitable stocks of forage can be secured before cold waves for livestock, and livestock in vulnerable areas might be shipped from affected areas or even slaughtered. Smudge pots can bring smoke that prevents hard freezes on a farm or grove. Vulnerable crops may be sprayed with water that will paradoxically protect the plants by freezing and absorbing the cold from surrounding air.
Most people can dress appropriately and can layer their clothing should they need to go outside or should their heating fail. They can also stock candles, matches, flashlights, and portable fuel for cooking and wood for fireplaces or wood stoves, as necessary. However, caution should be taken as the use of charcoal fires for cooking or heating within an enclosed dwelling is extremely dangerous due to carbon monoxide poisoning. Adults must remain aware of the exposure that children and the elderly have to cold.
January 2021: Severe cold wave hit many regions in Eurasia, especially in the Iberian Peninsula, Central Asia, East Asia and Southeast Asia with some of the lowest temperatures in many years. In Spain, Clot del Tuc de la Llanca in Aragon in the Spanish Pyrenees recorded −34.1 °C in January 6. It was not only the new national lowest temperature record in Spain, 2 °C lower than the previous record in 1956, but also the lowest temperature in the whole Iberian Peninsula ever recorded. On the 9th of January another new record was attained with -35.6 °C in Vega de Liordes, in the Cantabrian mountains of Spain. The cold wave was concurrent with a historic snowstorm which covered Madrid under 50 to 60 cm of snow, the first time since 1971.
Novosibirsk reached a low of -41 °C. Beijing recorded a low of -19.6 °C which was the coldest since 1966. Seoul also recorded -18.6 °C in January 8 which was the tie record with 2001 and the coldest since 1986. Over 200 cm of snow fell in western Japan along the Japan Sea coast.
February 2019: Brought temperatures 10~15 degrees lower than the February average lows, and temperatures of −40 °C (−40 °F) degrees to many parts of Siberia again. Novosibirsk, the largest city in Asian Russia, lowered to −40.1 °C (−40.2 °F) on 2 February, just a fraction of a degree shy to its previous record in 1977.Krasnoyarsk also lowered to −41.3 °C (−42.3 °F) on 4 February, missing just 0.3 °C to its record in 2001.Irkutsk Oblast had also recorded very low temperatures, with Irkutsk hitting −37.7 °C (−35.9 °F) on 6 February, beating its previous record of 6 February,Bratsk has seen temperatures below −41.5 °C (−42.7 °F) on February 5, which is sometimes colder than cities like Yakutsk. 7 and 8 February was even more brutal, with Omsk as low as −39.0 °C (−38.2 °F), and a merciless record low −41.9 °C (−43.4 °F) in Novokuznetsk, just 0.3 °C short of the record low in 1969. Lowest temperature in the cold wave of −53.6 °C (−64.5 °F) was recorded in Vanavara The cold wave also lightly affected the Russian Far East and some parts North America. California experienced an unusually wet and cold February, where Los Angeles experienced its coldest February since 1962.
In late January, an extreme cold wave hit Canada and the midwest of the United States, bringing temperatures below −30.0 °C (−22.0 °F), with all-time record lows set in several cities. New York City had a low tempeature of 2 °F (-16 °C), the coldest reading in Central Park since February 14th, 2016, when the mercury dropped to -1 °F (-18 °C), the coldest sub-zero reading in New York City since January 19th, 1994.
Around Early December 2018, some slight cold waves attacked Central Russia and Kazakhstan, bringing temperatures several of degrees down from the average norm. Big cities like Novosibirsk, Krasnoyarsk, Omsk, Irkutsk, and Barnaul regions had experienced severe temperatures of minus tens of degrees. The cold wave dissipated on December 13~15, making it slightly warmer, but returned some time in Christmas, attacking Central Russia and Kazakhstan strongly again, before finally dissipating around New Year's Eve. Yerbogachen suffered the cruelest temperatures of −52.5 °C (−62.5 °F) on Christmas. This cold wave made December 2018 quite chilly for Siberia.
Late February and early–mid March 2018, Europe. Easterly winds created bitter conditions twice during early spring 2018. Snow fell during both events. Storm Emma, which affected southern areas of Great Britain, brought up to 50 centimetres (20 in) of snow. Overall, 93 people across Europe died; 27 deaths occurred in Poland and 17 in the UK.
Cold wave starting late December 2017 (December 24 respectively), North America. A persistent wave of temperature extremes, including a cold wave, took place in Canada and the northeastern and central areas of the United States from Northern Canada to Mississippi, with temperatures in much of Canada of around −29 °C (−20 °F) and as low as −39 °C (−38 °F) in New York state, and as high as 21 °C (70 °F) and 31 °C (88 °F) in Sandberg and Los Angeles, respectively, in California.
Cold wave of November 9–12, 2017. Record lows were broken from Minneapolis to DC as Arctic air swept through the areas.
January 2017 European cold wave – A cold wave hit Central and East Europe on January 5. The lowest temperature was −45.4 °C (−49.7 °F) degrees. The cold caused at least 60 deaths. There was also massive snowfall.
April 2017 - During the same year, low temperatures were recorded in Sarajevo from an unusual snowfall that hit the city disrupting the traffic since the 2012 cold wave.
February 2015 North American cold wave – During the second half of February 2015, temperature records were broken in both sides of the spectrum. Extreme warm records were broken in the western half of the United States and extreme cold records were broken in the eastern half. In addition to the extreme cold wave at its most brutal in the Great Lakes, Mid-Atlantic, and New England, snowfall was reported as far south as Tupelo, Mississippi; Huntsville, Alabama; and Shreveport, Louisiana. The cold wave became widespread and all the remaining mild conditions from the west were pushed into northern Mexico. The cold wave even extended well into early March, with a part of every U.S. state except Florida reporting a snow cover by March 1, 2015.
November 2014 North American cold wave – Between November 8 and November 23, a polar vortex similar to earlier in 2014 has a temporary comeback, delivering the 2014–15 winter season's first three significant winter storms in the United States. Snowfall records were confirmed all over the Midwest and the Northeast, especially around the Great Lakes. Buffalo, New York, was among the hardest hit in the unseasonably wintry November. In addition to not being Thanksgiving yet, autumn colors were in the mix along with the deep winter snow.
Early 2014 North American cold wave – On January 2–11, cold arctic air initially associated with a nor'easter invaded the central and eastern United States and Canada, east of the Rockies. Temperatures were even colder than the North Pole and the South Pole in many regions in the Upper Midwest and Canada. Temperatures reached as cold as −37 °F (−38 °C), and did not even get out of the negative double-digit temps in many places, including Chicago. The cold wave extended for a few more months, bringing a continuous pattern of record-low temperatures to most of the Central and upper eastern United States, before the pattern finally ended in early April.
December 2013 North American cold wave – On December 1, the weakening of the polar vortex resulted in the jet stream shifting southward, which allowed abnormally cold temperatures to intrude the Central United States. On December 6, a daily record snowfall of 0.1 inches (2.5 mm) was set in the Dallas–Fort Worth metroplex, breaking the old record of trace amounts of snow, set in 1950. The cold wave continued into December 10, before the temperatures returned to a more stable range.
United Kingdom March–April 2013 – The UK Spring 2013 cold wave was a prolonged spell of cold weather which brought with it very heavy snowfalls, the worst in March for 30 years and since 1947 in some places. There was also some very cold temperatures with England (CET) having its coldest March since 1883 with a mean monthly temperature of 2.7 °C (36.9 °F). This meant that March was colder than all three winter months December 2012, January and February 2013. The cold weather in March came after what was a relatively cold winter however nothing like 2010–11, 2009–10 or 2008–09.
Spring 2013 North American cold wave – Although the core winter of 2012–13 was fairly mild, both March and April were unusually cold across the Midwest, resulting in sharp temperature contrasts from March 2012 to March 2013 all over the United States and Canada. This late cold wave was unexpected because February and March 2013 were both forecasted to be even milder and more springlike than February and March 2012, but instead turned out with a near-average February and an unusually cold March. This same cold wave extended well into the month of April, as four notable winter storms impacted much of the northern United States, especially across Minnesota and the Dakotas. Minnesota experienced a rare May snowstorm as a result of this cold wave.
In July 2013, South America experienced the most intense cold wave in 13 years. Some coastal areas of Argentina and Uruguay had multiple days of nearly freezing temperatures, and snow fell throughout Southern Brazil, even being registered in Curitiba for the first time in 38 years.
Early 2012 European cold wave – As of February 11, 2012 at least 590 people died during a cold snap with temperatures falling below −35 °C (−31 °F) in some regions.Ukraine was the worst hit, with over 100 deaths related to the cold.
2011 New Zealand snowstorms- Caused by Antarctic storms moving upward, the whole country was affected briefly in July 2011, only for it to return even stronger in August for a prolonged period of time. Te Waipounamu/ The South Island was the hardest hit, although the generally more mild Te Ika-a-Maui/ The North Island was also affected to a large extent. Widespread and heavy snow fell in Wellington for the first time in twenty years, and in Auckland the first time since the 1930s. Despite blizzards, closures and multiple records broken, morale was up, and most Kiwis, especially children, weren't that bothered about the whole snow situation
Winter of 2010–11 in Great Britain and Ireland – This winter was referred to as The Big Freeze by national media in both United Kingdom and Ireland and it was the coldest winter in Britain for 31 years with an average temperature of 1.51 °C (34.72 °F). The UK had its coldest December ever, since records began in 1910, with a mean temperature of −1 °C (30.2 °F). It easily broke the previous record of 0.1 °C (32.18 °F), set in December 1981.
A cold wave affected much of the Deep South in the United States and Florida in January and February 2010.
The first snowfall began on 17 December 2009, before a respite over the Christmas period. The most severe snowy weather began on 5 January in North West England and west Scotland with temperatures hitting a low of −17.6 °C (0.3 °F) in Greater Manchester, England. The snow spread to Southern England on 6 January and by 7 January the United Kingdom was blanketed in snow, which was captured by NASA's Terra satellite. The thaw came a week later, as temperatures started to increase. The winter weather brought widespread transport disruption, school closures, power failures, the postponement of sporting events and 25 deaths. A low of −22.3 °C (−8.1 °F) was recorded in Altnaharra, Scotland on 8 January 2010. Overall it was the coldest winter since 1978–79, with a mean temperature of 1.5 °C (34.7 °F).
2009–10 European cold wave – At least ninety were confirmed dead after record low temperatures and heavy snowfall across Europe causes travel disruption to much of the continent including the British Isles, France, the Low Countries, Germany, Austria, Italy, Poland, the Baltic States, the Balkans, Ukraine and Russia. It was the coldest winter and longest cold spell for thirty years in the United Kingdom, whilst temperatures in the Italian Alpine peaks reached low to an extreme of −47 °C (−52.6 °F).
Early 2009 European Cold Wave – Early January gave most of Europe, especially in central and south very cold temperatures. Some places like Germany, France, Italy, Romania and Spain had record cold temperatures well below 0 °C (32 °F). Most of the places were covered in snow and ice which caused school closings and airport delays. Large cities like Paris, Madrid, Berlin and even Marseille saw very cold temperatures with much snow and ice in Northern Italy, most of Germany, in northern Portugal and even along the coasts of the Mediterranean. In early February another cold front brought heavy snowfall to much of Western Europe with the heaviest snow falling in France, Northern Italy, the Low Countries and the United Kingdom, where parts of Southern England had seen the worst snowfall in over eighteen years causing widespread travel disruption particularly around London.
2008 Alaska cold wave – In early February, Alaska experienced the coldest temperatures for eight years, with Fairbanks nearing −50 °F (−45.6 °C) and Chicken, Alaska bottoming out at −72 °F (−57.8 °C), a mere eight °F (4.4 °C) away from the record of −80 °F (−62.2 °C). The first half of January also brought unusual cold weather and heavy snow to widespread regions of China and the Middle East, snowfall was present in Baghdad for the first time since the 1910s.
2008 Greece cold wave February 16 - most significant cold wave that lasted three days after 2002 - On February 14 a massive high pressure system between Greenland and Scandinavia extended from Arctic Ocean to west Mediterranean accompanied by a massive low pressure system in Siberia resulting in a cold air mass in eastern Europe reaching Greece on February 16.The cold air that moved over Aegean sea caused lake effect snow dropping more than 40 cm of snow in Athens in Chaidari district west of downtown.Cold wave caused major disruption to the city and a lot of flights were cancelled due to bad weather conditions.
2007 Northern Hemisphere cold wave – All of Canada and most of the United States underwent a freeze after a two-week warming that took place in late March and early April. Crops froze, wind picked up, and snow drizzled much of the United States. Some parts of Europe also experienced unusual cold winter-like temperatures, during that time.
July 2007 Argentine winter storm – An interaction with an area of low pressure systems across Argentina during July 6, 7 and 8 of 2007, and the entry of a massive polar cold snap resulted in severe snowfalls and blizzards, and recorded temperatures below −32 °C (−26 °F). The cold snap advanced from the south towards the central zone of the country, continuing its displacement towards the north during Saturday, July 7. On Monday, July 9, the simultaneous presence of very cold air, gave place to the occurrence of snowfalls. This phenomenon left at least 23 people dead.
2005–06 European cold wave – Eastern Europe and Russia saw a very cold winter. Some of them saw their coldest on record or since the 1970s. Snow was in abundance in unusual places, such as in southern Spain and Northern Africa. All the winter months that season saw temperatures well below average across the continent.
2004–2005 Southern Europe cold wave – All areas of Southern Europe saw an unusually hard winter. This area saw an ice storm which have a 1 in 1000 chance of happening. This cold front caused snow in Algeria, which is extremely unusual. The south of Spain and Morocco also recorded freezing temperatures, and record freezing temperatures were observed in the north of Portugal and Spain.
2004 February cold wave in Greece on February 12th - coldest air mass to hit Greece in 21st century till today - a very cold air mass from north pole was pulled in eastern Europe because of a high pressure system in west Scandinavia extended to south Europe resulting in a low pressure system in the Balkans.The cold snap finally moved south hitting Greece and caused ' record low temperatures, frozen rain phenomenon, thundersnow in Athens, snowfall that blanketed Crete island, snow that fell even in the most southern place of Greece in Gavdos island.During midnight of February 13 temperature in Athens dropped so fast that resulted in a frozen rain that ice- capped all trees, followed by a rare thundersnow phenomenon dropping 25 cm of snow in central Athens and more than 50 cm in eastern suburbs. In the morning of February 13 was recorded the lowest temperature of 21st century in the center of Athens till today of -5 °C(23 °F) degrees(some meteorological stations east of downtown on higher altitude recorded -7 °C(19,4 °F) ) resulting in water supply disruption and residents had to activate boilers and water heaters in order to make the water running again .
2004 January cold outbreak, Northeast United States – New England was close to a record month when frequent Arctic fronts caused unusually cold weather. Boston had its coldest January since 1893 (19.7 °F, −6.8 °C), when it averaged 20.7 °F (−6.3 °C), and its lowest mean maximum at 27.2 °F (−2.7 °C). Virginia Beach had an unusually long period of below freezing weather. Some areas of northern New York saw 150 inches (3.81 m) of snow in a month. Many parts of the western and midwestern area of the country seen the effect as well.
2002 Cold wave in Greece January 4 - the first significant snowfall of 21st century in Athens,Greece occurred on January 4, lasted three days and caused major disruption to the city.The dense snowfall during midnight of January 5 left at least 15 cm of snow on the ground only in downtown, north suburbs had more than 50 cm !
20th-century cold waves (1901–2000)
July 2000 was one of the coldest months on record in South America. 4 streams of cold air pushed through the continent in a matter of 2 weeks, causing extremely low temperatures in many countries. Asunción registered -1 °C (31 °F), Buenos Aires (Ezeiza Airport) peaked at around -3 °C (27 °F), and in Brazil many cities recorded the lowest temperatures in many years. Curitiba had incredible 7 days of freezing temperatures, peaking at -4 °C (26 °F), and some areas of the southern states of Rio Grande do Sul and Santa Catarina reached almost -10 °C (14 °F). It also snowed heavily in these states. The cold front even reached the Amazon, with some cities in the southern part of the forest nearing temperatures of 10 °C (50 °F).
1997 Northern Plains cold air outbreak – Mid-January across the Northern U.S. was one of the windiest on record. With a low of around −40 °F (−40.0 °C) in some places, wind caused bitterly cold wind chills sometimes nearing −80 °F (−62.2 °C). Northern parts of North Dakota saw up to 90 inches (2.29 m) of snow. This was one of the most severe cold-air outbreaks of the 1990s.
1996 Great Midwest cold outbreak – Late January and early February was Northern Minnesota’s coldest short-term period on record. The record low of −60 °F (−51.1 °C) was recorded in Tower, Minnesota. Cities like Minneapolis experienced temperatures near −35 °F (−37.2 °C).
1995 White Earthquake in southern Chile – In August 1995 southern Chile was struck by a cold wave consisting of two successive cold fronts. Fodder scarcity caused a severe livestock starvation. Cows and sheep were also buried in snow. In parts of Tierra del Fuego up to 80% of the sheep died.
December 1995 Great Britain cold wave – On the 30th of December the United Kingdom recorded a record low of −27.2 °C (−17.0 °F) in Altnaharra in Scotland equalling the record set on February 11, 1895, and January 10, 1982.
1994 Northern US/Southern Canada cold outbreak – January 1994 was the coldest month ever recorded or since January 1977 or February 1934 over many parts of the northeast and north-central United States, plus adjacent southeastern Canada. Many overnight record lows were set. Cold outbreaks continued into February but the severity eased somewhat. Detroit, Michigan saw the city's coldest temperature since 1985.
December 1990 western United States – Extreme cold dropped down from Canada in the second half of December, causing record low temperatures up and down the West Coast, including one of California's most damaging freezes since 1949.
February 1989 featured a significant, week-long cold wave across the Western United States. Major cities affected by the cold stretched from Seattle, WA to as far south as Los Angeles, CA. Las Vegas set a record low for February with 16 °F (−8.9 °C) degrees on February 7, 1989.
January 1987 Southeast England snowfall – This was a notably cold winter month for the United Kingdom and snowy too, especially so for the southeast with a very heavy lake-effect type snow event that affected the areas of East Anglia, south-east England and London between 11 and 14 January. It was the heaviest snowfall since 1981/82.
March 1987 Greece cold wave - very rare cold air mass trapping phenomenon - The cold wave of March '87 lasted at least ten days in Athens and more in northern Greece according to weather reports and caused by a cold air mass that was trapped in the region of Greece after a high pressure system had been extended pushing trapped cold air from Russia.
Winter of 1985/86 in the United Kingdom – The cold weather started in November 1985 with the month being considerably below average, being the coldest since at least 1925. December 1985 was a milder month and January was close to average. February was the coldest month since February 1947 in United Kingdom and it became the 5th coldest February in the CET records dating back to 1659.
January 1985 US cold air outbreak – On January 21, 1985, it was so cold that President Ronald Reagan's inauguration took place in the Capitol Rotunda. In addition to the cold in Washington, D.C., Miami Beach recorded its only frost since records began, lasting for a full three hours. Several other Southern cities set all-time record cold.
January 1985 – January 1985 was the coldest January since 1979 in the United Kingdom with significantly below-average temperatures.
1985 Great Western cold air outbreak – February 1985 saw the contiguous U.S.'s second-coldest temperature of −69 °F (−56.1 °C) in Peter Sinks, Utah. About a month of severe cold affected a large part of the nation. 1985 became the fourth-coldest calendar year on record in the Pacific Northwest.
December 1983 Great Plains cold wave – The contiguous US had its coldest ever Christmas in 1983, except for the southwestern US. Severely cold winds blew in from Canada and about 70% of the month was colder than average. Many locations east of the Rockies broke December cold records on Christmas Eve. In addition to −23 °F (−30.6 °C) cold, the Sioux Falls area had 60 mph (97 km/h) winds bringing wind chills down to −70 °F (−56.7 °C). High temperatures did not even reach −10 °F (−23.3 °C) in northern Illinois during the days before Christmas. Temperatures dropped below 0 °F (−17.8 °C) on December 15 and remained there for over nine days at Sioux Falls. Minneapolis recorded an average temperature for the month of 3.7 °F (−15.7 °C), the coldest on record. In Chicago, a temperature of −23 °F (−30.6 °C) and 30 mph winds resulted in a wind chill of −82 °F (−63.3 °C) (−57 °F (−49.4 °C) under the new formula) on Christmas Eve.
January 1982 cold air outbreak – January 1982 was very cold. The 1981 AFC Championship Game, held in Cincinnati, was nicknamed the "Freezer Bowl" due to the −9 °F (−22.8 °C) temperature at kickoff and −59 °F (−50.6 °C) wind chill. The Sunday of the following week (January 17, 1982) is also known as Cold Sunday. Chicago's Midway and O'Hare airports record their all-time low temperatures of −26 °F (−32 °C). Milwaukee, Wisconsin recorded temperatures of −26 °F (−32 °C) on January 17, the lowest in 111 years there. Recorded temperature of −5 °F (−21 °C) in Atlanta and Jackson, Mississippi.
Winter of 1981/82 in the United Kingdom – This was a significantly colder than average winter. December started off very mild with temperatures up to 15 °C (59 °F), but it quickly became very cold and snowy. The night of the 12th–13th is particularly noted for its cold temperatures with many records broken. January 1982 was also a cold and snowy month with records being broken on the 10th in both England and Scotland. England recorded a record low of −26.1 °C (−15.0 °F) and down to −27.2 °C (−17.0 °F) in Braemar.
Cold wave of 1979 – widespread cold across the country. One of the largest Chicago snowstorms in history at the time, with 21 inches of snowfall in the two-day period, the 1979 Chicago Blizzard occurred during the cold wave in January.
Cold wave of early 1978 – Produced one of the coldest winters on record in all states east of the Rockies, except Maine.
Europe and Asia, winter of 1978-1979, caused by the Kara Sea 1978 anticyclone. Weather conditions typical for polar regions were detected in Moscow, Leningrad (St. Petersburg), and Sverdlovsk (Yekaterinburg), affecting logistics and the energy industry, and causing fires at the Beloyarskaya Nuclear powerplant. Freeze, but a lack of snow caused winter cereal crop failure throughout 1979.
Cold wave of January 1977. Greatest eastern US cold wave of the 20th century. The core of the cold air extended from New Hampshire to Florida and west to Iowa and Missouri. Ohio was at the very center of the cold air mass where every weather station there recorded its coldest month on record. Cincinnati recorded its lowest known temperature of −25 °F (−32 °C) dating back to 1820. The South Carolina state record temperature of −20 °F (−29 °C) was recorded during this cold wave near Long Creek. The wind chill in Minneapolis was −78 °F (−61 °C) on January 28, possibility the lowest ever recorded there up until that point. Snow fell in Miami and Homestead Florida, the farthest south snow was ever recorded in America. President Jimmy Carter walked in his inauguration parade in temperatures below freezing on January 20. Buffalo, New York was hit with its worst blizzard ever during the last week of January where near hurricane-force winds created whiteout conditions for three days. Temperatures in Buffalo were around 0 °F (−18 °C), wind chills recorded of −60 °F (−51 °C), and the blizzard paralyzed the city with snow drifts of up to 30 feet (9.1 m).
Late 1970s (1977, 1978, 1979) – In the last three years of the 1970s, almost all of the conterminous United States had at least one winter with a memorable cold wave, and the winter of 1978–79 was the coldest on record in the lower 48, with everywhere, except normally frigid upstate Maine, experiencing well below average temperatures.
July 1975 was a historic month in South America. One of the most intense cold waves of the century climbed through the continent, even crossing the Equator in the Amazon Forest. On July 16, snow fell heavily in Argentina, and on the following day in Paraguay and Southern Brazil. In Curitiba it snowed for around 3 hours, accumulating on the ground, even in the city center. The phenomenon was registered in 5 states, a very rare occurrence. In July 18, the temperature dropped even more. In the state of Paraná, the coffee crops were killed by an episode of black frost (it occurs when the plants' tissues freeze and die), and some cities recorded -10 °C (14 °F), among the lowest temperatures ever recorded in the country. The cold wave reached as far as 10°N before dissipating.<https://journals.ametsoc.org/view/journals/bams/57/12/1520-0477_1976_057_1435_ashcfp_2_0_co_2.xml>
Winter of 1968–69 in Central Asia – Central Asia and western Siberia saw by far their coldest winter on record in 1968–69, and in Central Asia also their wettest, producing record low temperature, severe blizzards and avalanches, numerous plant deaths and record spring flooding. The cold occasionally swept into East Asia, resulting in record snowstorms and cold in China and Japan.
1969 Northwest North American cold wave – December 1968 and January 1969 saw record cold and snow in the Pacific Northwest and Southern BC. Vancouver, BC recorded its coldest temperature on record of −23.3 °C (−9.9 °F) on January 23, 1969, and −18.3 °C (−0.9 °F) at the airport on December 29, 1968. Seattle recorded its snowiest winter on record with 67.5 inches (171 cm) for the season at Sea-Tac Airport.
1966 Western Canadian cold wave – January 1966 was the coldest January on record in the Yukon and the coldest since 1950 or 1936 in the Prairie Provinces, and the severe cold continued into March, when Winnipeg recorded its most severe winter snowstorm on record.
January 1963 cold wave in Mid-Western United States, as well as a brief-but-severe cold spell in the western United States.
1956 European cold wave – February 1956 was the coldest month of the twentieth century over large areas of Western Europe, with mean temperatures below 0 °C (32 °F) as far south as Marseilles being utterly unprecedented in records dating back into the eighteenth century.
Winter of 1954–1955 in East Asia – One of the coldest winters on record across China. Numerous major rivers and lakes froze over across southern China, including the Huai River, Han River, and Dongting Lake.
Between Late July and Early August 1955 the most intense cold wave ever recorded in Brazil was registered. It snowed heavily for over 24 hours in some cities of the south of the country, accumulating over 2 feet (60 cm) in the mountainous regions of Rio Grande do Sul and Santa Catarina states. The cold air reached the Amazon and even crossed the Equator, which is extremely rare. Temperatures plummeted to -10 °C (14 °F) in Bom Jesus, Rio Grande do Sul, and -2 °C (29 °F) in São Paulo (negative temperatures were never again recorded in the city).
1950 Northwest North American cold wave – January 1950 saw unprecedented cold and snowfall in the Pacific Northwest, with normally mild Seattle and Portland, Oregon both falling below 0 °F (−17.8 °C) and receiving extremely heavy snow that disrupted transport and schooling as it could not be removed easily. Western Canada saw by far its coldest month on record, leading to severe damage to fruit crops in the Okanagan Valley, the freezing of Okanagan Lake for the only time since 1862, and Calgary's only month where temperatures remained below 32 °F (0 °C) throughout. Vancouver, British Columbia had an average temperature of −6.3 °C (20.7 °F), compared to the average 4.1 °C (39.4 °F).
January 1949 Western United States cold wave – The winter of 1948–49 was the coldest since 1891 over the Western United States and saw record snowfall, ice storms as far south as Texas, and constant disruptions to surface transport, along with large losses in livestock and crops. Coldest winter was recorded in many places in California, Nevada, Idaho and Washington state. The cold was also accompanied by severe blizzards which isolated Wyoming ranches and paralyzed the Great Basin region. The U.S. Army ran "Operation Hay Lift" in the region to bring food and hay by plane to isolated ranches in the region. Las Vegas Nevada got a record 16.7 in (420 mm) of snowfall during the month of January. Snow fell in both San Diego and Los Angeles on three days in January 1949. All-time record low of 0 °F in San Antonio, Texas.
February 1947 saw the coldest temperature on record in Canada, at -62.8 °C at Snag, Yukon.
Winter of 1941–42 in Eastern Europe – The winter of 1941–42 was the coldest of the twentieth century in most of Eastern Europe (e.g. Moscow) and was the last of a succession of abnormally cold winters there that affected the course of World War II.
January 1940 Southern United States cold wave – Late January saw record-breaking cold and snow across the Southern United States. It was the coldest month there since February 1899.
1937 Western United States cold wave – January 1937 was the coldest month on record in the West and saw snowfall as far south as the hot desert city of Yuma, Arizona for one of only two occasions on record. California and Nevada saw their lowest temperatures on record: −45 °F (−42.8 °C) at Boca on January 20 and −50 °F (−45.6 °C) at San Jacinto on January 8.
1936 North American cold wave – The cold wave of 1936 was the only cold wave of the 1930s to severely impact the United States east of the hundredth meridian. One of the coldest winters in the Great Plains on record. Low temperatures dropped below −50 °F (−46 °C) in Malta, Montana on four separate days and most of Montana averaged 20 degrees below normal for the entire month of February Parshall, North Dakota hit −60 °F (−51 °C) on February 15, still a record. Langdon, North Dakota remained below 0 °F (−18 °C) for 41 straight days from January 11 to February 20, the longest stretch in recorded history for the U.S. outside of Alaska. The cold wave was followed by one of the hottest summers on record, the 1936 North American heat wave.
February 1934 Cold Wave in New England and Eastern Canada – Longest period of cold weather ever experienced to this point. Average temperatures in upper New England and Eastern Canada were around zero degrees Fahrenheit for most of the month. Lake Ontario was reportedly completely frozen over. Temperatures reached above freezing only on one day in Burlington, VT in February.
1933 Western United States cold wave – The winter of 1932–33 was the second- or third-coldest on record in most of the West (the coldest on record in Arizona) and saw record cold temperatures in Seneca, Oregon (-54 °F/-48 °C), Moran, Wyoming (-66 °F/-54 °C) and Seminole, Texas (-23 °F/-31 °F) between February 7 and 10, when sixty deaths were blamed on extreme cold and ice storms.
Major cold outbreaks affected California in January, February and December. Up to two inches of snow fell across the Los Angeles Basin on January 15, and two inches of snow was officially recorded at the Downtown Los Angeles Weather Bureau Office. Snow also fell in San Francisco on three days in December 1932.
A cold wave gripped the western United States in January 1930. Two inches of snow fell in Palm Springs, CA on January 11, one of only two times in the city's history that snow was ever observed.
Winter of 1917–1918 – The winter was very frigid across the East and created a heating fuel crisis equaled only in January 1977. Severe cold wave in December 1917 and January 1918 in northeast. December 30 set a number of record lows at the time in New York City (−13 °F, −25 °C) and Boston (−15 °F, −26 °C). Under ideal conditions for radiational cooling, including fresh snow cover and mostly clear skies, the morning of December 30, 1917 was exceptionally cold also in parts of Virginia and West Virginia, with all-time record cold temperatures (that stand until nowadays) recorded in many cities, including −37 °F (−38 °C) at Lewisburg (West Virginia state record), −34 °F (−37 °C) at White Sulphur Springs, West Virginia, −25 °F (−32 °C) at Bluefield, West Virginia, and −27 °F (−33 °C) at Blacksburg and Burkes Garden, Virginia. January 1918 also brought persistent well below average temperatures for many parts of the East and Midwest, with another shot of very cold air in early February (New York City Central Park's high of only 4 °F (−16 °C) on February 5 is a monthly record, while Michigan's Houghton Lake reached a low of −48 °F (−44 °C) on February 1). The Ohio River froze solidly along its entire length.
This cold wave occurred not only in America but also East Asia. In Seoul, the weather is warm in early December 1917, But the temperature wasn't increased higher (32 °F, 0 °C) next to starting cold wave in December 15 ~ January 9. In addition, the temperature was recorded lower (14 °F, −10 °C) in December 15 ~ 31. The cold wave especially stronger in December 26 ~ 27 and the lowest temperature in December 26 was recorded (0.32 °F, −17.60 °C), highest temperature (9.86 °F, −12.30 °C).(That day Incheon was recorded highest temperature (9.14 °F, −12.70 °C), this is 3rd lower highest temperature in whole winter.) Also, the lowest temperature in December 27 was recorded (−4.72 °F, −20.40 °C), this temperature is 2nd lower temperature in December Seoul. (The lowest is (−9.58 °F, −23.10 °C) on December 31, 1927. Furthermore, this is the lowest temperature in Seoul.) Cold wave was leading to January 1918, and the cold wave is rather than more stronger. Then the lowest temperature in January 3 was recorded (−7.24 °F, −21.80 °C). The temperature was a little warming next to January 14. But the weather is still cold, and the temperature was recorded lower (14 °F, −10 °C) until January 28. Leading to February, this cold wave was finished. Seoul was recorded the average temperature (21.74 °F, −5.70 °C) in December 1917,(This is lowest average in December. and this average temperature was also recorded December 1944.) and recorded the average temperature (18.5 °F, −7.5 °C) in January 1918, 6th lower in January.
The cold wave was more stronger in North Korea, and the lowest temperature in Pyeongyang was recorded (−11.74 °F, −24.30 °C) in December 1917. Also, the average temperature was recorded (12.56 °F, −10.80 °C).)
Winter of 1916–1917 – the "extended winter" (October to March) of 1916–17 was the coldest on record in the West and Midwest.
February 1895 United States Cold Wave (Great Freeze) – Damaged citrus crops in Florida. A snowstorm produced unprecedented snowfall amounts along the Gulf Coast, including 22 inches (56 cm) in Houston, TX. Snow fell as far south as Tampico, Mexico, the lowest latitude in North America that snow has been recorded at sea level.
1893 East Asia Cold Wave – Produced snow in Hong Kong and South China, and freezing temperatures into tropical latitudes.
1893 Eastern United States Cold Wave.
1888 US cold wave – A severe cold wave that passed through the Pacific Northwest. It led to a blizzard for the northern Plains and upper Mississippi valley where many children were trapped in schoolhouses where they froze to death.
January 1859: January 10 – coldest single daytime temperatures ever recorded experienced in New York City and in New England areas. Montreal recorded temperature of −43.6 °F (−42.0 °C) at 7 am, some 15 °F (8.3 °C) degrees lower than modern Montreal record of −29 °F (−34 °C) in 1933. Toronto recorded −27 °F (−33 °C) on the same day. At the University of Vermont in Burlington, −31.5 °F (−35.3 °C) was recorded at 7 am and −26 °F (−32 °C) at 2 pm. In Woodstock, Vermont a temperature of −45 °F (−43 °C) was recorded. Harvard College recorded −4.5 °F (−20.3 °C) at 2 pm and −18 °F (−28 °C) the next morning of January 11, the lowest known temperature reading recorded in Boston. Nantucket Island measured −12 °F (−24 °C), 6 °F (3.3 °C) colder than the modern known record. In New York City, recorded temperatures did not go above 0 °F (−18 °C). In Brooklyn Heights, a recorded reading of −9 °F (−23 °C) at noon and in Eramus Hall in Brooklyn recorded a high of −3.7 °F (−19.8 °C) at 7 am and −8 °F (−22 °C) at 9 pm that night. Union Hall in Jamaica Queens recorded −12 °F (−24 °C) at midnight between January 10 and 11. In White Plains, there were readings of −13 °F (−25 °C) at 7 am, −10 °F (−23 °C) at 2 pm, and −15 °F (−26 °C) at 9 pm.
New England Cold wave of 1857. January 1857 was the coldest month ever recorded in New England. Average month temperatures of 16.7 °F (−8.5 °C) in New Haven, 16.8 °F (−8.4 °C) in Boston, and 19.6 °F (−6.9 °C) in New York City remain coldest months on record in those cities. The worst of the cold descended on New England on January 22 with January 23 being one of the coldest days known in the region. In Bath, Maine a temperature reading of −52 °F (−47 °C) and in Franconia, New Hampshire −51 °F (−46 °C) were recorded. In Norwich, Vermont −44 °F (−42 °C) was recorded. Boston suburbs of Malden and West Newton recorded −30 °F (−34 °C) overnight. Boston temperatures for January 23 never rose above 0 °F (−18 °C) all day and Nantucket Island was connected to the mainland by ice. In New York City, Erasmus Hall in Brooklyn reached a high of 0 °F during the day and the Hudson River froze over solidly enough for people to walk across to Hoboken.
Eastern cold wave of January and February 1835. First of three historic U.S. cold waves to hit during the 19th century (1835, 1857, 1899). In January, mercury thermometers froze throughout the Northeast. Mercury froze at −40 °F (−40 °C) in Bangor and Bath, Maine and Montpelier and White River, Vermont. In Connecticut, Hartford hit −27 °F (−33 °C) and New Haven −23 °F (−31 °C), and in Massachusetts, Williamstown hit −30 °F (−34 °C) and Pittsfield −32 °F (−36 °C), all low temperature marks that have never been matched since. In February, Savannah, Georgia the temperature hit 0 °F (−18 °C), 8 °F (4.4 °C) colder than would be reached during the 1899 cold wave later in the century and Charleston South Carolina hit 2 °F (−17 °C). | <urn:uuid:66687768-45d8-4fb9-933f-88228f2e09df> | CC-MAIN-2023-06 | https://db0nus869y26v.cloudfront.net/en/Cold_wave | s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764499954.21/warc/CC-MAIN-20230202003408-20230202033408-00742.warc.gz | en | 0.961004 | 10,779 | 4.125 | 4 |
How political parties are registered
Political parties are vital to a healthy democracy. The Commission maintains the registers of political parties – one for Great Britain and one for Northern Ireland. To register, political parties must show that they are set up to be able to meet the obligations of electoral law. And, so that voters can mark their ballot paper with confidence, parties cannot have names, descriptions or emblems that are offensive, misleading or confusing.
Did you know?
Did you know?
- Parties can only be registered if party candidates will be put up to contest elections. Otherwise, candidates can stand as independents and they don’t need to register a political party to stand for election
- Once registered, a party’s name, description and emblem can appear on the ballot paper alongside the name of its candidate
- Once registered a party has legal responsibilities under electoral law, such as reporting financial data to the Commission
- If we refuse a party’s application, we tell the party why and the party can re-apply
- Applications to register a party can be submitted online – our guidance will help with the process
- We aim to reach a decision on registration applications as soon as possible. We assess all applications carefully against the legal tests
To register a party we need:
- a completed application form and a fee of £150
- a copy of the party’s constitution, setting out its structure and organisation
- a copy of the party’s financial scheme, showing that it has the processes in place to comply with electoral finance laws
- details of at least two officers, who must fill the roles of registered leader, treasurer and nominating officer
The registration process
- The Commission is responsible for registering political parties and an application to register must be submitted to the Commission to be assessed against the statutory tests
- The party’s structure, organisation and financial processes must be in place and must show the party can comply with electoral law
- Registration is not automatic. The Commission assesses whether the party’s application and identity marks meet the criteria set out in electoral law, as well as legal obligations under equality laws
- As part of this assessment process, we publish the party’s identity marks so members of the public can comment on them. Views can be submitted on this page of our website
- The Commission will also assess whether the party’s constitution is consistent with electoral law and its financial scheme has been adopted and shows the party has the processes in place to comply with electoral finance law
- There are different legal tests for names, descriptions and emblems. For example, for party names we look at whether the name is too long, is offensive or obscene, could mislead voters or hinder instructions on voting, or is likely to confuse a voter
- To be registered, as a minimum, we must decide that the application was complete, the constitution and financial scheme were compliant and the party name met the legal tests
- Once the assessment process is complete and all public comments considered, the decision whether to register a party is taken by the Director of Regulation. In Scotland, the decision is taken by the Head of the Electoral Commission – Scotland.
- If the party registration application is approved, the publically available register of political parties is updated with the details. The party must follow the political finance rules that ensure integrity and transparency in the system. We provide guidance that can help the party meet its responsibilities, and the party can also contact us with questions
- If the party registration application is rejected, the Commission will inform the applicant of the reasons for the rejection. The applicants can re-apply and we will work with them to overcome registration difficulties, and enable them to be registered. A new application fee is likely to be needed for a new application. | <urn:uuid:45156429-04b4-4260-abe6-4ad38fbb7e1f> | CC-MAIN-2024-10 | https://www.electoralcommission.org.uk/political-registration-and-regulation/political-party-registration/how-political-parties-are-registered | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947473598.4/warc/CC-MAIN-20240221234056-20240222024056-00755.warc.gz | en | 0.946161 | 772 | 2.515625 | 3 |
Basics:Ferns are non flowering plants that grow everywhere except really hot deserts or really cold regions. There are approximately 10,000 species worldwide. Most ferns grow in damp, shady areas so the best place to find them are along streams or in cracks of rocks and cliffs. Ferns are among the oldest plants on earth and go way back to about 350,million years.
Structure of a fern:The leaves of ferns are fairly large and have pointy tips. Each leaf of a fern is termed a megaphyll and has a branched system of veins. Some say that megaphylls evolved by the formation of webbing between many separate branches growing close together, Most ferns have leaves commonly called fronds. These fronds are compound, meaning each leaf is divided into several leaflets. The frond grows as its coiled tip (fiddlehead) unfurls. The leaves may grow directly from a prostrate stem or can have upright stems many meters tall. The leaf can only live about one or two years. Ferns have well developed stems and roots as well. The stem stores food that the plant needs to grow. A fern will continue growing as long as the stem stays alive. The stem can grow upright above the ground, horizontally along the ground, or even underground. The stem can live for 100 years or more. The roots anchor the stem to the ground and absorb water and nutrients. The root can live about the same as the stem.
Life cycle of a fern: After a fern spore settles in a favorable place, it develops into a small, heart shaped gametophyte that sustains itself by photosynthesis. Most ferns are homosporous; each gametophyte has both male and female sex organs, but the archegonia and antheridia usually mature at different times, assuring cross-fertilization between gametophytes. Fern sperm, like this of club mosses and horsetails, use a flagellum swim through moisture from antheridia to eggs in the archegonia and then fertilize the egg. A sex attractant secreted by archegonia helps direct the sperm. A fertilized egg develops into a new sporophyte, and the young plant grows out from an archegonium of its parent, the gametophyte. The spots on the underside of reproductive leaves (sporophylls) are called sori. Each is a is a cluster of sporangia, which release the spores that give rise to gametophyes. *The Life cycle of a fern was taken from : Biology, Adisson Wesley, Third Edition.Copyright 1987, 1990, 1993 by The Benjamin/Cummings Publishing Company, Inc. | <urn:uuid:23a5d95e-fa10-4174-8ba7-1705ed34a652> | CC-MAIN-2017-39 | http://mrosbiologypage.tripod.com/Background.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-39/segments/1505818686465.34/warc/CC-MAIN-20170920052220-20170920072220-00501.warc.gz | en | 0.94982 | 573 | 3.96875 | 4 |
Share this article:
Asymmetric Multi-Processing (AMP) vs. Symmetric Multi-Processing (SMP)
It is becoming common for embedded designs to incorporate more than one CPU – maybe multiple cores on a chip or multiple chips on a board or any combination of these. Indeed, it has been suggested that it will soon be the norm to build systems that way.
The use of multiple cores has spawned various technologies and, of course, much terminology and jargon. When new technical terms and acronyms appear, there is inevitable misuse and misunderstanding. This seems to be the case with AMP and SMP, so maybe I can set the record straight …
AMP stands for Asymmetric Multi-Processing; SMP means Symmetric Multi-Processing. These terms are not at all transparent. In seeking a means to clarify, I thought I would check Wikipedia and looked up “AMP”. From the disambiguation page, I found the relevant article. Well, I say “relevant”, but it really does not cover the topic as we see it today. It talks about historical uses of multiple CPUs and dismisses it to history. So, I will try to advance definitions:
An AMP system:
- multiple CPUs
- each of which may be a different architecture [but can be the same]
- each has its own address space
- each may or may not run an OS [and the OSes need not be the same]
- some kind of communication facility between the CPUs is provided
An SMP system:
- multiple CPUs
- each of which has the same architecture
- CPUs share memory space [or, at least, some of it]
- normally an OS is used and this is a single instance that runs on all the CPUs, dividing work between them
- some kind of communication facility between the CPUs is provided [and this is normally shared memory]
Typically, SMP is used when an embedded application simply needs more CPU power to manage its workload, in much the way that multi-core CPUs are used in desktop computers.
AMP is most likely to be used when different CPU architectures are optimal for specific activities – like a DSP and an MCU. In an AMP system, there is the opportunity to deploy a different OS on each core – e.g. Nucleus and Android/Linux – as befits the required functionality.
Read more from Colin on SciTech Connect:
Using a Memory Management Unit (MMU)
OS Influence on Power Consumption
Vintage Multi-core – the IPC
Thanks for the Memory
Embedded Optimization: Small or Fast?
C, C++ and the Family Tree
Colin’s most recent publication, Embedded Software: The Works is available now on the Elsevier Store.
Save 30% on his book and other Newnes Press and embedded systems books. Use discount code “STC3014″ at checkout.
About the Author
You can read more about Colin and his work on embedded systems at The Colin Walls Blog at Mentor Graphics here. Connect with Colin online here:
Computing functionality is ubiquitous. Today this logic is built into almost any machine you can think of, from home electronics and appliances to motor vehicles, and it governs the infrastructures we depend on daily — telecommunication, public utilities, transportation. Maintaining it all and driving it forward are professionals and researchers in computer science, across disciplines including:
- Computer Architecture and Computer Organization and Design
- Data Management, Big Data, Data Warehousing, Data Mining, and Business Intelligence (BI)
- Human Computer Interaction (HCI), User Experience (UX), User Interface (UI), Interaction Design and Usability
- Artificial intelligence (AI) | <urn:uuid:43d2dedc-d63f-4aca-af57-59e825695a9f> | CC-MAIN-2018-22 | http://scitechconnect.elsevier.com/asymmetric-multi-processing-amp-vs-symmetric-multi-processing-smp/ | s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794868132.80/warc/CC-MAIN-20180527072151-20180527092151-00434.warc.gz | en | 0.918487 | 786 | 3.203125 | 3 |
They were a secret airborne force that worked undercover during World War II. Those that were discovered were shotor eaten by falcons.
A London auction this month has revived memories of the Second World War's animal heroes, including pigeons that flew dangerous missions to bring messages from behind enemy lines.
Several pigeon portraits from the collection of wartime bird-breeder Jack Lovell are included in the "Gentleman's Library" sale, an eclectic array of items being offered at Bonhams auction house January 15.
Lovell was approached by British intelligence services in 1939 to provide birds for covert operations. The avian unit, overseen by military intelligence, was housed in secret pigeon lofts in the coastal city of Dover.
Pigeons' homing instinct makes them excellent messengers. More than 200,000 served with British forces during the war. Thousands were placed in containers fitted with parachutes and dropped by British bombers behind enemy lines, where they were picked up by Resistance fighters or sympathetic locals and used to send messages back to England.
Other pigeons worked as double agents, fitted with tags identical to those worn by Nazi-owned pigeons in the hope they would be given coded messages before returning to British code-breaking headquarters in Bletchley Park, near London.
"When it came to the D-Day landings, a lot of soldiers were sent off with a pigeon, which they kept under their coats, because there was complete radio silence," Bonhams spokesperson Charlotte Wood said Friday.
It was dangerous work. The Germans deployed falcons to pick off the British birds. Domestic predators were also a threat.
Thirty-two pigeons were awarded the Dickin medal, Britain's highest award for animal valor. They include an American bird named GI Joe, credited with flying 20 miles (32 kilometers) in 20 minutes with a message that stopped U.S. planes bombing an Italian town occupied by British troops.
The portraits at Bonhams, painted in the late 19th and early 20th centuries, depict champion racing pigeons owned by Jule Janssen, a Belgian breeder whose birds were the ancestors of Lovell's wartime flock. They are estimated to sell for between 600 and 1,400 U.S. dollars each.
The sale also includes a silver candlestick inscribed to Jet, a German shepherd awarded the Dickin medal for finding survivors in the rubble of bombed London buildings.
Bonhams said the auction features "a wide range of typical accessories for a gentleman's library," including furniture, bronzes, busts, lamps, walking canes, and humidors.
Other items set to go under the hammer: a tiger skin rug with mounted head; a Boy Scout hat once owned by the movement's founder, Robert Baden-Powell; a pair of glass cucumber straighteners and a lock of hair belonging to Catherine Parr, sixth wife of Henry VIII.
Bonhams director Robert Bleasdale said the items were intended to reflect a sense of "comfort, nostalgia, the unusual, fun."
"It's more of a gentleman's indulgence, really," he said.
Free Email News Updates
Sign up for our Inside National Geographic newsletter. Every two weeks we'll send you our top stories and pictures (see sample). | <urn:uuid:b739d65a-94f1-40b3-b3bf-1a83a7d616bb> | CC-MAIN-2015-35 | http://news.nationalgeographic.com/news/2008/01/080107-AP-britain-ani.html | s3://commoncrawl/crawl-data/CC-MAIN-2015-35/segments/1440646313806.98/warc/CC-MAIN-20150827033153-00310-ip-10-171-96-226.ec2.internal.warc.gz | en | 0.970482 | 674 | 3.0625 | 3 |
In this era, public transportation uses renewable energy as it is more cost-effective and environmentally friendly. The existence of renewable energy sources is a great help for the transport sector. Through the renewable energy sources, vehicles have the option instead of using fuel sources that can damage our planet. Any transport using renewable energy is also called as green vehicle.
Public vehicles using renewable energy can help in preserving our planet against global warming. It is because these vehicles do not emit smoke that can add to the air pollution and eventually damage the ozone layer. That is why utilizing renewable energy in running your vehicle is a good start of keeping good quality air.
Apparently, global warming is the main reason why car manufacturers are developing vehicles suitable of using alternative fuels such as the electric cars. However, in one way or another, electric vehicles also emit little pollution depending on the source of electricity used in charging the battery of the car. Keep in mind that electricity is derived from power plants that are using coal and other environment-damaging fuels.
Nevertheless, the emissions of electric car are cleaner as compared to the traditional gas engines. Likewise, it is also necessary to choose energy source in recharging the batteries that is run by renewable energy. You can use battery pack made of lithium-manganese as it is proven to be reliable and safe. Nevertheless, vehicles using renewable energy have some drawbacks in terms of speed and acceleration.
On the other hand, most public transportation operators are switching to renewable energy in moving people to different destinations. The renewable energy reduces carbon emissions and oil dependency. Apparently, there are vehicles that can be charged using sunlight. In fact, there are large parking garages installing solar canopies and charging stations that can be used by electric vehicles.
Moreover, if public transportation will use the renewable energy the emission of harmful chemicals will be reduced thus decreasing health issues. Once the harmful chemical release is reduced the air will become cleaner and healthier. Otherwise, if public transportation will not use renewable energy it will emit carbon and nitrogen oxides that will drastically affect the environment.
In addition, operators of public transportation vehicles are switching to renewable energy because they want to save big amount of money for the gasoline expenses. However, if you are planning to use electric vehicle you should prepare big amount of money for the battery packs. Nevertheless, it is worth the cost because you can really save money in the long run. Although the electric bill may increase but it is still cheaper as compared to the gasoline prices. Likewise, the maintenance of electric vehicles is simpler and cheaper.
Operators of public transportation should do research about the renewable energy sources available in their area. It is important to compare and understand how each energy source works so that it will be easier to choose the one that will benefit you the most. Renewable energy comes in different forms depending on the feasibility of the region you are living in. The good news is that the government is giving tax incentives to those people using electric vehicle driven by renewable energy.
Indeed, using renewable energy can meet all the electricity demands not only in the transportation sector. Utilizing the alternative energy sources prudently can provide power to anything. The renewable energy is a cleaner and safe form of energy but make sure to set up back up system so that you will be prepared once the energy is not available. On the other hand, since the source of renewable energy is unlimited some people are unable to utilize the required energy thus ending up with surplus that they can sell to the power company.
The money that you can save from the gasoline expenses can be used in buying other things. Obviously, the price of gasoline will continue to increase as time goes that is why it is necessary to decide switching to electrical vehicle that uses renewable energy. The money that you will save from your utility bill will do good favor to your household budget. Aiming to use clean energy requires protecting and preserving the sources of renewable energy.
Although the source of renewable energy is unlimited but if people will not be smart in using it, time will come that the sources will become scarce. Likewise, using the renewable energy for public transportation seems like a cycle. Since the vehicle is not producing toxic smoke most likely the air in the atmosphere is clean and at the same time the source for wind energy is sustainable. This also holds true with solar and hydro energy sources.
Keeping the environment clean and safe is not only beneficial to people. In the same manner, protecting the renewable energy sources is also beneficial to the economy especially the transportation sector. | <urn:uuid:08bae608-52d3-42a8-aaf3-44e4c9e7c818> | CC-MAIN-2015-11 | http://sustainableenergysystemz.com/public-transportation-uses-renewable-energy-is-it-beneficial/4317/ | s3://commoncrawl/crawl-data/CC-MAIN-2015-11/segments/1424936468536.58/warc/CC-MAIN-20150226074108-00010-ip-10-28-5-156.ec2.internal.warc.gz | en | 0.949166 | 909 | 3.640625 | 4 |
Have you ever asked yourself “how does a generator produce electricity?” Generators are an alternative means of producing electricity as a power supply. It provides converted electrical energy that can power similar appliances like the electricity from thermal and hydropower sources, solar energy, power stations, wind turbines, and geothermal energy. The output energy of a generator depends on the type of generator and the energy capacity.
Interestingly, the different parts of a generator play a significant role in conducting electricity. Here is a summary of how generators produce electricity and the generator’s parts that assist this process.
The Process Of Producing Electricity.
Electric generators generate electrical energy supplied directly to homes or can be used to power batteries. This process works on the principle of electromagnetic induction discovered by Michael Faraday in the 1800s.
Electric generators use mechanical energy, capturing the motive power and converting it to electrical energy through a magnetic field with a series of insulated coils of wires that form a stator surrounding the electromagnetic shaft (rotor). A motion in the rotor produces a flow of electric current in each wire coil, creating an electrical conductor. The total current present in each wire coil forms a large current of energy directed through copper wires used to power external systems.
In addition, the output energy from the generator depends on the starting energy capacity (watts) of the electric generator.
Typical Parts Of A Generator
Different parts of a generator play a significant role in conducting electricity. Parts like the engine, alternator/voltage regulator, fuel system, and lubricating systems are necessary accessories that make a generator work.
The generator engine produces the energy, converting fuel into usable energy. In addition, it is the powerhouse of the generator that makes all other parts work and determines how much electricity can be generated.
- Alternator/ Voltage regulator
The alternator consists of the Armature (rotor and stator), which are the moving and stationary parts that help convert mechanical energy to electrical energy. In addition, the alternator generates an electrical current.
- Fuel System
Generators are powered by fuel systems that store fuel and pump it to the appropriate sections. The fuel system is the primary energy source, consisting of the fuel filter, fuel tank, fuel pipe, fuel injector, and fuel pump.
- Temperature regulation and Lubricating Systems
A generator uses temperature regulators like the fan and coolant that regulates heating while at work. Also, the exhaust system acts as a combustion system that converts fuel. Finally, the lubricating system ensures that the generator is adequately oiled, keeping the engine in good condition.
Are You In Need Of An Electric Generator?
If you reside or work in an environment where local electricity is not constant, you might need an electric generator from Ace Power Products. We have various reliable types of generators and will undoubtedly meet your demands. You can easily place an order online or Contact us today! | <urn:uuid:db4268fb-0bc9-4842-8231-980286f961c5> | CC-MAIN-2022-27 | https://acepowerproducts.us/how-does-a-generator-produce-electricity/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656104496688.78/warc/CC-MAIN-20220704202455-20220704232455-00239.warc.gz | en | 0.889353 | 597 | 4.15625 | 4 |
Using oceanographic observation data obtained globally from satellite, ship, and ocean float sources, we are able to forecast ocean currents from the ocean surface to the seabed. These types of forecast data are already being used by petroleum tankers and deep-sea fishing boats owned by private companies.
By combining the variations in atmospheric and ocean data, we are able to forecast short-term climate variations such as El Nino, La Nina, and the Indian Ocean dipole (IOD). We provide public disclosure of information regarding prospective warm winters/ cold summers in response to climate variation in the form of seasonal forecasts.
We have developed a system for “Chemical Weather Forecast System” whereby we can predict how atmospheric pollutants such as photochemical oxidants will be transported globally. We have been operating this system since 2006. The daily forecasting result is distributed to the public via our homepage. The effect of transboundary transport of pollutants is taken into account. | <urn:uuid:006cdf4b-c0a8-403c-b70d-bda0c209387d> | CC-MAIN-2015-27 | http://www.jamstec.go.jp/apl/e/contribution/ | s3://commoncrawl/crawl-data/CC-MAIN-2015-27/segments/1435375094924.48/warc/CC-MAIN-20150627031814-00045-ip-10-179-60-89.ec2.internal.warc.gz | en | 0.930877 | 194 | 2.765625 | 3 |
The white Bird of Paradise is also known as the crane flower or the Nicolai. The Bird of Paradise flower comes in many colors and looks like a bird in flight, thus the name. They grow well outdoors in the warmer climates of California and Florida, but make a lovely indoor houseplant as well. They do not tolerate temperatures below 24 F. This plant will grow to heights of 3 to 5 feet.
Plant your white Bird of Paradise in fertile soil and allow for good drainage. The upper portion of the root ball should be even with the soil line in the pot.
The white Bird of Paradise needs partial sun for full blooms and a good height. Although they will grow in full sun, the blooms and plant will be smaller.
During the first six months, the soil needs proper moisture--do not allow it to become too dry or too soggy. During the warm summer months, water it regularly. During the winter months, allow the soil to become almost dry between watering.
Fertilize the white Bird of Paradise every three months during the warm growing season. Organic fertilizers or commercial products can be used. The plant will not bloom until it is a few years old, but a healthy older plant can have many blooming each year and the blooms, when cut for floral arrangements, last up to two weeks.
Avoid letting dead leaves and blooms stay on the plant. Remove them to discourage growth of fungus and to keep the beautiful appearance of this tropical plant.
Pests and Disease
Pests are usually not a problem with the white Bird of Paradise plant. If you do encounter problems with caterpillars, aphids, scales or leaf spot disease, commercial products will easily rid the plant of the problems. | <urn:uuid:51d65dd5-45ce-485f-bfd9-0d299a59c5bd> | CC-MAIN-2017-51 | https://www.ehow.com/way_5880577_white-bird-paradise-plant-care.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-51/segments/1512948588294.67/warc/CC-MAIN-20171216162441-20171216184441-00129.warc.gz | en | 0.932457 | 357 | 2.671875 | 3 |
The total amount of heat generated by this circuit is
where Vcc is the 12 Volts from the power supply and
IRes is the current through the load resistor (R2).
This current is controlled by the input signal Vin.
Some of that heat is generated by the transistor WTrans,
the rest by the load resistors WRes.
If Vin = 0 there is no power dissipated and no heat generated.
If Vin = Vcc/2 (6V),
WTrans is about equal to WRes.
As Vin approaches Vcc, WRes rises and WTrans falls.
Clearly we want to operate in the region where Vin > Vcc/2, so that most of the heat generated is generated by the load resistors.
If the base resistance R1 is 0, the circuit is quite independent of the
transistor's gain. This graph was generated for Rbase = 0, Rload = 25. If Vin is around 10 V, then the transistor dissipates about 1 W, and the heating resistor about 4 W. | <urn:uuid:4df77620-507b-4ba1-a6cd-c25e5ad6f51d> | CC-MAIN-2018-26 | http://njsas.org/projects/tidal_forces/01/circuits/temp_control.html | s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267863206.9/warc/CC-MAIN-20180619212507-20180619232507-00514.warc.gz | en | 0.92344 | 220 | 3.28125 | 3 |
Leprosy: a suspected diagnosis in a non-endemic area. Case series and literature review
Leprosy (Hansen’s disease) is a chronic granulomatous condition caused by Mycobacterium leprae, a microorganism that affects the skin and Schwann’s cells. Making a diagnosis of this condition is difficult in non-endemic areas because of low clinical suspicion. During the 2012-2019 time period, three cases of Hansen’s disease were diagnosed and treated in the ID service of Dos de Mayo Hospital. The average time history of the disease was 4 years. Patients started their condition with the appearance of pruriginous papular lesions affecting specific body regions, progressing to generalized nodular lesions. Paresthesia and tactile, thermal, pain, and vibratory hypoesthesia were found. These manifestations later progressed to anesthesia. Diagnosis was made through bacilloscopy in lymphatic fluid and skin node biopsy. Clinical features for each patient are also described. We emphasize the importance of clinical suspicion for diagnosing this unattended disease in non-endemic areas. | <urn:uuid:137587e4-6e49-4ad2-aa0e-4c307bb6b91e> | CC-MAIN-2023-14 | https://amp.cmp.org.pe/index.php/AMP/article/view/910 | s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296949035.66/warc/CC-MAIN-20230329213541-20230330003541-00691.warc.gz | en | 0.940804 | 238 | 2.765625 | 3 |
Hip replacements can be described in terms of how the components are fixed to the pelvis and thigh bone (Cemented or Uncemented) and by the materials that make up the part of the artificial joint that articulates (Bearing Surface). Hip resurfacing is a different type of hip replacement.
Cemented Hip Replacement
These use bone cement to anchor the components to bone and do not rely on bone growing in to the components to fix them securely.
Uncemented Hip Replacement
The components are press-fitted into the bone very securely and the patients own bone then grows into the components to create a permanent bond. This bond is very solid and very rarely breaks down.
The ball can be made of a number of materials including metal (Cobalt Chromium), ceramic or Oxinium. The socket liner can be made up of plastic* (polyethylene) or ceramic.
Bearing surfaces (ball-liner) possible are as follows:
-metal – plastic
-ceramic – plastic
-ceramic – ceramic
-oxinium – plastic (Verilast)
*we use XLPE (highly cross-linked polyethylene)
This is a type of hip replacement that looks very different to a normal hip replacement and has the following features:
-large diameter ball that covers the existing head without a stem and therefore preserves bone
For further information on Total Hip Replacement please click here to read an article written by Mr Sood. | <urn:uuid:9428debd-d86e-4e67-8323-0166faea0f13> | CC-MAIN-2018-47 | https://www.hipandkneesurgery.co.uk/conditions/hip-conditions/hip-replacement/ | s3://commoncrawl/crawl-data/CC-MAIN-2018-47/segments/1542039743968.63/warc/CC-MAIN-20181118052443-20181118074443-00383.warc.gz | en | 0.911966 | 302 | 2.921875 | 3 |
Discipline: Ecology Environmental and Earth Sciences
Shaquetta Johnson - Jackson State University
Co-Author(s): Thomas Harmon and Angel Fernandez Bou, University of California, Merced, CA
Atta cephalotes is a common leaf cutter ant (LCA) species dominating the Neotropics. LCA employ a complex foraging system to furnish their fungal gardens with vegetation. The fungi are essential for development of the ants’ larvae and their own sustenance. While serving the colony, LCA foraging and fungi cultivation also significantly impacts carbon cycling in the Neotropics, and potentially beyond. Research has focused on events associated with the ants foraging behavior, including reasons for the ants “hitchhikíng” on larger ants’ leaf fragments and the rhythmic foraging behavior. The primary focus of this project was to establish the vegetation input to the Atta colony and how rainfall influences their daily foraging patterns. Understanding the characteristics and amounts of vegetation entering the nests will help to establish how efficient the Atta must be to successfully furnish their fungal gardens, and what the potential carbon emissions are from those nests. By testing a fairly new method, we were able to establish ratios of vegetation collected at many trails at a nesting site of La Selva Biological Station, Costa Rica, with respect to rainfall. In order to calculate the average amount of vegetation collected at a single nesting site, we measured the velocity of ants, dry weight of vegetation, and day versus night foraging and established a formula representing the total vegetation collected over a particular time period with and without rainfall. Velocity measurements of the Atta cephalotes were compared utilizing histograms and a Tukey test revealed a significant difference with and without rainfall (p = 0.015). The dry weight of the vegetation over several days were also compared, but no significant difference between the dry mass was observed. Day versus night foraging was compared utilizing quartiles and line graphs to demonstrate the peaks of activity in a 24 hour cycle. Using the vegetation dry weight and ant velocity measurements, we estimated that the ants were carrying approximately 43 kg/month of vegetation to their nest. Future research involves understanding the effects of rainfall on foraging behavior and vegetation collection in more detail, developing an annual estimate (testing for seasonal variations), and connecting vegetation inputs with carbon dioxide emissions from the nest.
Funder Acknowledgement(s): I would like to thank my family, peers, and professor/advisor Terrence Wright at Jackson State University for supporting my endeavors to pursue an intense, biological research experience. I would also like to thank my research partner, REU students, and La Selva staff and community for their encouragement and genuine company throughout my time at the station. In particular, I would like to thank my mentor, Thomas Harmon, and his graduate student, Angel Fernandez-Bou, for their guidance and for challenging me to gain more knowledge while performing my research project. Last but certainly not least, I would like to thank the Organization for Tropical Studies for this experience of a lifetime, NSF, and LSAMP for providing the funding for this experience.
Faculty Advisor: Thomas Harmon, firstname.lastname@example.org
Role: I participated in the actual field study of taking measurements of the velocity of the ants, analyzing the data from the overnight sampling videos of the ants foraging activity, and assisting with measuring CO2 fluxes in the soil to determine the relevance of input versus output at the testing site. | <urn:uuid:b27666f9-0a3a-45ce-abf2-c107e1f974cc> | CC-MAIN-2022-33 | https://emerging-researchers.org/projects/12641/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571056.58/warc/CC-MAIN-20220809155137-20220809185137-00503.warc.gz | en | 0.947552 | 717 | 3.15625 | 3 |
You should know the difference between a glass and a cup whether you're drinking wine, coffee, or soda. Glasses come in a wider range of shapes and sizes than cups, and while both are used to store liquids, the former is often thinner. You should know that styrofoam is a carcinogenic substance and that hand-blown glasses are a better alternative for your health if you prefer plastic or glass containers.
Double-Paned Glasses Have a Reduced Profile
Double-walled glasses, which are produced of borosilicate glass due to the material's great thermal shock resistance, are a common sight among glass drinkware. These goggles are not only sturdy, but they also resist breaking and scratches. They may be cleaned in the dishwasher without risking damage to your precious kitchen or living room furniture.
When you want your coffee to linger longer, a double-walled glass mug is the way to go. Similarly, it does an excellent job of maintaining both the temperature and the cold of your coffee. If you have a lot of coffee to drink, this is especially crucial because coffee loses its warmth quickly. Because of its superior ability to retain temperature, a double-walled glass mug is the ideal vessel in which to enjoy your morning brew.
Liquids are also well-insulated by double-walled glasses. Fingertip burns can be avoided by using a double-walled glass coffee cup instead of a single-walled plastic or metal one.
Polypropylene Water Glasses Prolong the Refreshing Effects of a Drink
A new variety of plastic cups is capable of maintaining the temperature of your drink for much longer. With the strength of glass and the portability of plastic, these modern materials are a win-win. Moreover, they may be recycled and reused.
Acrylic, polycarbonate, and Styrofoam are just a few examples of the many plastics available. Acrylic is lauded for its see-through nature, resilience to the sun's rays, and tensile strength. Polycarbonate, like steel, is tough and long-lasting.
In addition to the material, plastic drinkware also benefits from a variety of other advantages. Insulated plastic glasses are available to prevent drinks from warming up too quickly. They may be used over and over, are non-breakable, and are far more practical than glass.
If you take good care of your plastic cups, you can use them for many years to come. Use a professional dishwasher with a high temperature setting and dry the plasticware completely before stacking. Consider purchasing a dehumidifier to aid with condensation management.
Styrofoam Has been Linked to an Increased Risk of Cancer
Styrofoam, a type of plastic foam frequently used, has been linked to cancer and has been prohibited in a number of US towns. Styrene is the main component of Styrofoam. There is a risk of this chemical seeping into our water supply and eating materials. Kidney and liver illnesses, as well as other immunological issues, have been linked to it.
Styrofoam does not break down in the environment like other materials. While being heated, it deteriorates into smaller fragments, releasing poisonous compounds into the air and water. For this reason, the product has been outright prohibited in a number of municipalities.
Styrofoam includes the carcinogenic chemical benzene. The International Agency for Research on Cancer (IARC) has identified benzene as a human carcinogen. Moreover, the chemical formaldehyde, which is employed as a preservative in labs, is also present in styrofoam.
Animal studies have connected exposure to Styrofoam, a carcinogenic substance, to the development of malignant tumors. Researchers have also shown that those who are exposed to high levels of styrene are more likely to get cancer.
Glasses Made by Hand Have More Character
It's recommended that wine drinkers invest in high-quality, hand-blown glasses. Craftspeople devote themselves emotionally to their work. Hand-blown glass, with proper care, may endure forever.
Compared to mass-produced glass, the thickness of glass made by hand decreases as it cools. This lessens the potential for damage. Each item is made with meticulous care using with the finest materials. It also prevents any pollution from entering the ecosystem.
There is a huge range of hand-blown glassware to choose from. They are cheaper than machine-made glasses as well. Hand-blown Margarita glasses are a lovely complement to any set of drinking glasses.
Lighter and thinner, hand-blown glass is another perk. Because of this, it is easier to hold and less likely to shatter.
Several experts in the field favor thin glass. The wine's flavor and fragrance are improved by this addition. Moreover, the flavor is less likely to be altered. The thin material is very easy to sip from because of its rounded corners. | <urn:uuid:413c0fcb-546c-4a44-880d-e33b26b3c164> | CC-MAIN-2023-50 | https://www.woodenearth.com/blogs/info/difference-between-glass-and-cup | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679103558.93/warc/CC-MAIN-20231211045204-20231211075204-00898.warc.gz | en | 0.95398 | 1,019 | 2.703125 | 3 |
The Polytelis genus includes three parakeet species with long tails. They are endemic to Australia.
Polytelis are medium sized parrots about 34-46 cm long - the long tail constitute about half of the total length.
Polytelis literally translates to "magnificent" which is very descriptive for these beautiful parrots.
Some breeders have noticed Polytelis may become overweight if they do not get plenty of exercise, so a large aviary is recommended.
- Regent Parrot : Aase Nygaard
Species & Subspecies
- Polytelis alexandrae (Gould, 1863) - Princess Parrot
- Polytelis anthopeplus (Lear, 1831) - Regent Parrot
- Polytelis anthopeplus anthopeplus (Lear, 1831)
- Polytelis anthopeplus monarchoides (Schodde, 1993)
- Polytelis swainsonii (Desmarest, 1826) - Superb Parrot | <urn:uuid:ade08d6e-b28a-42df-ac4b-2c0c4b6779d4> | CC-MAIN-2019-35 | http://parrots.lars-bodin.dk/?page_id=3461 | s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027315750.62/warc/CC-MAIN-20190821022901-20190821044901-00044.warc.gz | en | 0.771834 | 211 | 2.53125 | 3 |
Africa is the most populous and the only black continent. Despite the delayed development in the continent, Africa is an interesting continent to visit and in it abounds lots of talents. There are lots of known and interesting information but there are much more unknown African facts about Africa that are worth mentioning. Answers Africa brings you the 10 facts about Africa including geography facts, fun facts and Africa travel facts that will definitely interest you.
10. Second Largest Continent
Africa is the second largest continent in the world. The second largest in both land mass and population. It covers about a fifth of the earth’s total land area. The land mass is about 30.2 million km² (11.7 million sq mi) and this includes adjacent islands, it covers six percent of the Earth’s total surface area.
See Also: What is Africa Known For?
9. Africa Was Once Joined To Other Continents
One interesting fact about Africa that is truly amazing is that long before humans were around (the early Mesozoic Era), Africa was joined to the other continents in a massive continent called Pangaea. Over millions of years, this huge continent broke apart shaping the world landscape as we know it today in what has been referred to the continental drift. This was at first a speculation and was first put proposed by Abraham Ortelius in 1596. Later on, the concept was independently (and more fully) developed in 1912 by Alfred Wegener and the theory of continental drift was superseded by the theory of plate tectonics, which builds upon the previous continental drift and better explains the former concept.
See Also: 10 Interesting Facts about South Africa
8. Hippos Kill More People in Africa Than Lion and Crocodile
The African hippopotamus is unbelievably responsible for more human deaths in Africa than any other large animal. Male hippos make it a point of duty to actively defend their territories which often times run alongside the river banks. Female hippos are known to become quite protective and aggressive most especially if they anticipate any form of threats towards their babies, which would normally stay in the water while the mother hippo feeds on the river banks. Hippos have well-structured jaws in which up to 20-inch canine teeth are installed.
7. The Lowest Point in Africa is Lake Assal
The lowest point in Africa is Lake Assal which is located in central-eastern Djibouti at the western end of Gulf of Tadjoura in the Tadjoura Region, touching Dikhil Region, at the top of the Great Rift Valley. The crater lake lies 155 meters below sea level. This water body also takes the third position for lowest land depression on Earth following the Dead Sea and Sea of Galilee. The level of saltiness in the lake is so high becoming 10 times more concentrated than that of the sea. Assal is the world’s largest salt reserve, which is presently exploited under four concessions awarded in 2002 at the southeast end of the lake.
6. Africa is The Home of the Human Species
Another interesting fact about Africa is that according to information provided by the Human Origins, early humans first migrated out of Africa into Asia probably between 2 million and 1.8 million years ago. They entered Europe somewhat later, between 1.5 million and 1 million years. Species of modern humans populated many parts of the world much later. For instance, people first came to Australia probably within the past 60,000 years and to the Americas within the past 30,000 years or so. The beginnings of agriculture and the rise of the first civilizations occurred within the past 12,000 years.
5. Africa’s Sahara is the World’s Largest Desert
The world’s largest non-polar desert, the Sahara, is located in the northern part of Africa. The Sahara has a surface area of 9 million square kilometres (3.5 million square miles), and it stands as the largest non-polar desert in the world.
See Also: 10 Interesting Facts about Nigeria
4. Africa Makes up 15% of The World’s Population and origin To A Quarter of Languages
Africa makes up about 15% of the world’s population, providing home to about 1 billion people. Because of the population explosion and the low life expectancy rate in Africa, a large percentage of Africa’s population are less than 30 years old. The continent’s diversity fully supports over 1,500 different languages which represent a quarter of the world’s languages which are spoken only in Africa.
3. Africa is Home To The Largest Known Mammal
The world’s largest living land animal, the African elephant, which can weigh between 6 and 7 tons is found in Africa. Males African elephants stand 3.2–4.0 m (10–13 ft) tall at the shoulder while their female counterparts stand 2.2–2.6 m (7–9 ft) tall. African elephants are mostly found in Eastern, Southern and West Africa.
2. The Nile is the Longest River in The World
The Nile is the longest river in the world measuring about 6,670 km (4,160 miles) in length although the Nile is usually associated with Egypt, only 22% of the Nile’s course runs through Egypt the rest flows through Tanzania, Burundi, Rwanda, the Democratic Republic of the Congo, Kenya, Uganda, South Sudan, Ethiopia, Sudan. The banks of river Nile saw the origin of the oldest civilizations in the world.
1. Africa’s Lake Victoria is One of The Wonders of The World
One last surprising fact about Africa is that the continent is blessed with many natural wonders and amazing tourist destinations of which the Lake Victoria is one of them. It forms the largest lake in Africa and the second-largest freshwater lake in the world, covering an area of 26,830 square miles (69,490 square kilometres) but it also contains the largest sheet of falling water in the world in terms of area. | <urn:uuid:704d8b3d-e105-4340-9166-cfaa8aa0b936> | CC-MAIN-2021-04 | https://answersafrica.com/10-interesting-facts-about-africa.html | s3://commoncrawl/crawl-data/CC-MAIN-2021-04/segments/1610703537796.45/warc/CC-MAIN-20210123094754-20210123124754-00179.warc.gz | en | 0.948822 | 1,242 | 2.890625 | 3 |
Collecting Mania: Fountain Pens
Throughout the first half of the 20th century, these innovative and elegant instruments were the letter writer's preferred tool. Although fountain pens - writing instruments designed to carry their own supply of ink - had existed in principle since the early 18th century, early models tended to spit blobs of ink onto vital documents. It wasn't until 1884 that Lewis Edson Waterman developed the first practical fountain pen by making parallel fissures in the channel that carried ink from the pen's well to nib, or writing tip. These innovations inspired a minor revolution in written communications - rather than being tethered to a desk and ink bottle, now writers could communicate from wherever they might be.
From about 1900 until the 1950's, fountain pens were omnipresent. Advancements by Waterman, Parker, and others led to the manufacture of a wide variety of styles, colors, and models to appeal to just about every taste.
While all fountain pens contain an internal reservoir for ink, the evolution and refinement of the filling system proved to be one of the most competitive areas in the industry. The reservoirs in the earliest fountain pens had to be filled using an eyedropper, but by 1915 most had switched to a self-filling flexible rubber or latex ink sac. Devices for filling the sacs varied widely; among the most popular were the button, lever, matchstick, and coin fillers.
Values for vintage fountain pens vary wildly. While real bargains are rare, a specialized pen show offers collectors the opportunity to study the workmanship and design of fine vintage pens, question experts, and analyze prices.
Most enthusiasts begin collecting by buying names they recognize. However, pens manufactured by major companies tend to be more valuable than comparable pens by less-known firms, so some collectors develop an affection for rare pens designed by more obscure firms, such as Swan, Security, Boston, and Conklin.
Colorful or decorative pens are the most collectible, and the addition of inlay, precious stones, or rare metals enhances the beauty and increases the value of a pen. Size also affects price: If a particular model was produced in various sizes, the larger ones tend to command the highest prices. An artful combination of size, decoration, color, and shape - along with quality workmanship - will set a fine pen apart from an ordinary one. Also, if the pen marked an important technological development, such as a new filler system, the value can increase significantly.
Any restorations should be identified and explained by the dealer, for as with other antiques and collectibles, the less restoration, the higher the value. It seems extremely strange that in an era where virtually all of the various aspects of writing have been turned into ASCII characters on a screen that there would still be a market for something as old fashioned and outdated as a writer's fountain pen. It is a testament to the high level of craftsmanship, the elevated aesthetic value of the calligraphy which can be produced with them and the nostalgic value of these wonderful pens that they still maintain a very strong appeal to collectors of all ages. | <urn:uuid:c0b17d7e-99ec-43ef-91f1-21aa0880551d> | CC-MAIN-2018-09 | https://hubpages.com/games-hobbies/Collecting-Mania-Fountain-Pens | s3://commoncrawl/crawl-data/CC-MAIN-2018-09/segments/1518891808539.63/warc/CC-MAIN-20180217224905-20180218004905-00491.warc.gz | en | 0.959075 | 635 | 3 | 3 |
Gamma Ray Astronomy Author : E.L. Chupp Publisher : Springer Science & Business Media Total Pages : 336 Release : 2012-12-06 ISBN 10 : 9789401014960 ISBN 13 : 9401014965 Language : EN, FR, DE, ES & NL GET BOOK Gamma Ray Astronomy Book Description: Observation of discrete energy electromagnetic emissions from celestial objects in the radio, IR, optical, lN, and X-ray spectral regions has dramatically advanced our know ledge in the field of astrophysics. It is expected that identification of nuclear 'Y-ray line emissions from any cosmic source would also prove to be a powerful new tool for probing the Universe. Since the publication of Morrison's work in 1958, many experiments were carried out searching for evidence of 'Y-ray lines from cosmic sources, however with little success. Only a few positive experimental results have been reported, in spite of an expenditure of considerable effort by many people: in particular, the possible Galactic Center emission line (473 to 530keV) and 'Y-ray lines at several energies (e. g. , 0. 5 MeV and 2. 2 MeV) associated with large solar flares. Both of these observations are unconfirmed by indepen dent observations (ca. 1975). The high energy 'Y-rays (>30MeV) from the Galactic Center are at least partly due to the decay of 1[0 mesons, which are of unique energy (67. 5 MeV) in the 1[0 rest frame only. The reasons for the limited amount of data avail able in this field, even though early theoretical predictions were very optimistic regarding fluxes of nuclear lines, are that experimental efforts are plagued with high backgrounds and low fluxes, and that development of instruments with telescopic properties in the energy range of interest is difficult. | <urn:uuid:2e13b172-8894-4f5e-be3a-5c0a211dc42b> | CC-MAIN-2021-49 | https://printisdeadbook.com/pdf/gamma-ray-astronomy | s3://commoncrawl/crawl-data/CC-MAIN-2021-49/segments/1637964362923.11/warc/CC-MAIN-20211204003045-20211204033045-00094.warc.gz | en | 0.917005 | 374 | 2.640625 | 3 |
These photographs of Teddy Roosevelt were discovered in the course of filing materials in the historian’s office at Gaines Town Hall. No information is recorded on the backs of them. Accompanying notes indicate they were donated by Dan Hatch. Although Theodore Roosevelt never spoke in our township, folks from Gaines made sure to see him speak in Albion, which he did on three separate occasions. He spoke there on Oct. 26, 1898, Oct. 31, 1900, and Nov. 1, 1910. The question is, on which occasion were these photos taken? This is where history starts to look like detective work.
These snapshots were most likely taken with a Kodak Brownie camera. The Brownie was the first mass marketed camera for the general public, and was introduced in February 1900. Therefore, these photos were not taken of Roosevelt as candidate for New York State governor in 1898. Any photographs of that speech would have been taken by a professional photographer. These photos are either of Roosevelt as governor, or as former president. The photographs produced by the first Brownie camera were about 2″x2″. In 1901, the No. 2 Brownie was released, which produced snapshots about 2″x3″. Since the above photos are elongated and not square, they were probably taken during Roosevelt’s 1910 visit.
Roosevelt spoke from a platform constructed in front of the County Clerk’s Office. The top photo shows more of this building than the others. It also clearly shows the gable of what is now the Presbyterian church’s dining room in the background. All of the photos show people gathered on the northern steps of the Clerk’s Office.
Since the bottom third of these images show a sea of hats, it seems the photographer must have held his camera over his head to take pictures, hoping he would get some good shots. It also appears he jockeyed himself among the crowd in order to get closer, as can be gaged by the proximity to the platform and changing position of the hats in the foreground. It is also interesting to note the presence of feathered hats — even though women could not vote, they were there as well.
Subscribers to the Orleans American learned of Roosevelt’s visit the week before with the following front page ad.
Roosevelt was campaigning for the Republican gubernatorial candidate, Henry Stimson. The Orleans American clearly supported the Republican cause. In the Nov. 3, 1910 edition, the headline reported that Col. Roosevelt was “Enthusiastically Received By the Thousands — Splendid and Telling Speeches.” Two lengthy articles described his visit and work for the Republican party in New York. Counter-intuitively, the Orleans Republican rejoiced over the Democrat victory of John Dix as governor. In the Nov. 2, 1910 edition, buried in the middle of the paper, they described Roosevelt’s visit in three sentences, concluding with, “Col. Roosevelt gave one of his characteristic talks.”
https://www.townofgaines.org/wp-content/uploads/2018/03/logo.png00histedithttps://www.townofgaines.org/wp-content/uploads/2018/03/logo.pnghistedit2018-09-04 11:47:502018-09-04 12:31:23Going to see Colonel Roosevelt | <urn:uuid:65a0b609-581f-4f57-9cbb-fd0bc7dd7234> | CC-MAIN-2019-09 | https://www.townofgaines.org/going-to-see-colonel-roosevelt/ | s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247508363.74/warc/CC-MAIN-20190221193026-20190221215026-00216.warc.gz | en | 0.976862 | 701 | 2.625 | 3 |
Dr. Sugata Mitra
In 1999, Sugata Mitra and his colleagues dug a hole in a wall bordering an urban slum in New Delhi, installed an Internet-connected PC and left it there, with a hidden camera filming the area. What they saw: kids from the slum playing with the computer and, in the process, learning how to use it -- then teaching each other. These famed “Hole in the Wall” experiments demonstrated that, in the absence of supervision and formal teaching, children can teach themselves and each other -- if they’re motivated by curiosity. Mitra, now a professor of educational technology at Newcastle University, called it "minimally invasive education."
Mitra thinks self-organized learning will shape the future of education. At TED2013, he made a bold TED Prize wish: Help me build a School in the Cloud where children can explore and learn on their own -- and teach one another -- using resources from the worldwide cloud.
The School in the Cloud now includes seven physical locations -- five in India and two in the UK. At the same time, the School in the Cloud online platform lets students participate anywhere, with partner learning labs and programs in countries like Colombia. Pakistan and Greece. In 2016, Mitra held the first School in the Cloud conference in India. He shared that more than 16,000 SOLE sessions had taken place so far, with kids all around the world dipping their toes in this new education model. | <urn:uuid:a63bec74-8f08-4d95-96d0-83d3029a990d> | CC-MAIN-2023-40 | https://summit.canamedtechalliance.com/speaker/dr-sugata-mitra/ | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233510149.21/warc/CC-MAIN-20230926043538-20230926073538-00778.warc.gz | en | 0.948758 | 302 | 3.125 | 3 |
Huanglongbing (HLB) or “greening” disease of citrus is caused by phloem-limited, uncultured bacteria in the genus “Candidatus Liberibacter”. HLB is one of the most destructive diseases of citrus worldwide and is considered so dangerous to a U.S. citrus production that the USDA has listed “Ca. Liberibacter species” as a Select Agent. HLB is spread by the Asian citrus psyllid, Diaphorina citri, which was intercepted 40 times by APHIS/PPQ at U.S. ports between 1985 and 1998, became established in Florida by 1998, and more recently in Texas (1). HLB was first detected in the United States near Miami, FL during August 2005, and to date has been confirmed to have spread to 12 Florida counties. In addition to citrus, Murraya paniculata (orange jasmine) is a preferred host of D. citri, and retail trade in this ornamental shrub is strongly implicated in the distribution of D. citri (1). M. paniculata is reported to be a cryptic or largely asymptomatic host of “Ca. Liberibacter” (4), but another report concludes that the bacteria cannot replicate in M. paniculata (2). The epidemiological significance of murraya as a host for the HLB pathogen is therefore unclear. We report here the transmission of “Ca. Liberibacter asiaticus” from M. paniculata to citrus. Two M. paniculata plants, suspected of harboring “Ca. Liberibacter” because of their proximity to HLB-infected citrus and infested with D. citri, were removed from the field, treated with insecticide, and transferred to a quarantine facility. Both plants tested positive for “Ca. Liberibacter” by nested PCR using primers OI1 and OI2 (3) as the first set and primers CGO3F (RGG GAA AGA TTT TAT TGG AG) and CGO5R (GAA AAT AYC ATC TCT GAT ATC GT) as the second set. Two, young, sweet orange plants (Citrus sinensis) grown and maintained in psyllid-free greenhouses in Gainesville, FL were infected by dodder (Cuscuta pentagona) grown from seed. After the dodder had become well established on the orange plants, the orange plants were moved adjacent to the two murraya plants and the dodder from the citrus was draped over the murraya. Coinfection of murraya by dodder occurred within a few days. Sixty days later, both murraya plants, both sweet orange plants, and the connecting dodder all repeatedly tested positive for “Ca. Liberibacter” by nested PCR. Beginning 2 weeks later, the orange plants tested positive by standard PCR using primer set OI1 and OI2 or CGO3F and CGO5R, but remained without typical greening symptoms. Sequencing of the PCR products confirmed amplification of “Ca. L. asiaticus” DNA. We conclude that M. paniculata can serve as an infection source of a Select Agent since it can host the HLB pathogen for at least 2 months and the HLB pathogen can be transmitted to sweet orange during this time.
References: (1) S. E. Halbert and K. L. Manjunath. Florida Entomol. 87:330, 2004. (2) T. H. Hung et al. J. Phytopathol. 148:321, 2000. (3) S. Jagoueix et al. Mol. Cell Probes 10:43, 1996. (4) T. Li and C. Ke. Acta Phytophylacica Sin. 29:31, 2002. | <urn:uuid:6a5709ee-42b2-45ab-9a66-196f2f60c112> | CC-MAIN-2014-10 | http://www.apsnet.org/publications/plantdisease/2007/February/Pages/91_2_227.2.aspx | s3://commoncrawl/crawl-data/CC-MAIN-2014-10/segments/1393999673147/warc/CC-MAIN-20140305060753-00069-ip-10-183-142-35.ec2.internal.warc.gz | en | 0.941908 | 830 | 2.984375 | 3 |
Eucalyptus macrorhyncha or 'red stringybark' is a tree of around 15 metres but often smaller on poorer soils to which this species is well adapted. It occurs mainly in forest on the inland slopes of the great dividing range in new South Wales and Victoria. Can withstand periods of low rainfall.
Click on Map to Enlarge Image
Notes on Maps.
Generally, the concentrated clusters of markers represent the geographical range where this species occurs naturally. Outlying markers and geographically disassociated markers represent observations of the species in cultivation and/or recorded in herbaria etc.
These maps are provided by, and are used with the permission of, Australia’s Virtual Herbarium (AVH) | <urn:uuid:eef9456e-e73c-441a-97a8-b310e001b9ac> | CC-MAIN-2020-05 | https://eranurseries.com.au/eucalyptus-macrorhyncha | s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579251696046.73/warc/CC-MAIN-20200127081933-20200127111933-00135.warc.gz | en | 0.896962 | 150 | 3.5 | 4 |
The genus Vacinnium contains evergreen to deciduous shrubs and trees with ornamental foliage, flowers, and fruit. Leaves are leathery and alternate. Deciduous species provide striking autumn color. Berries are edible. Vacinnium species have wide distribution from arctic to tropical regions in a variety of habitats including heath, moorland, bogs, and woodland. Flowers of distinctly urn, bell, or cylindrical shapes appear in spring and summer.
Noteworthy CharacteristicsSome species are grown primarily for their edible blueberries or cranberries.
CareAcidic, peaty or sandy, moist but well-drained soils in full sun or partial shade. Minimal pruning.
PropagationSow seed in autumn; take wood cuttings in summer.
ProblemsCaterpillars, scale insects, gray mold, galls, dieback, crown and root rot, powdery mildew, and rust. | <urn:uuid:2a0480ed-8f01-4235-bc10-645abd7b95f4> | CC-MAIN-2019-18 | https://www.finegardening.com/genus/vacinnium | s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578721441.77/warc/CC-MAIN-20190425114058-20190425135627-00047.warc.gz | en | 0.877873 | 199 | 3.515625 | 4 |
Not what you want?
...Or search again using:
1. Other similar-meaning words.
2. Fewer words or just one word.
Buy a Heaven calligraphy wall scroll here!
Start your custom "Heaven" project by clicking the button next to your favorite "Heaven" title below...
Quick links to words on this page...
| 1. Heaven / Sky
2. Grace from Heaven / Grace from God
3. Voice of Heaven / Voices from Heaven
4. Oneness of Heaven and Humanity
5. Blessed by Heaven
6. Destiny Determined by Heaven
7. Heaven and Earth
8. Kingdom of Heaven
9. One Family Under Heaven
10. Angel / Messenger of Heaven
|11. Heaven Rewards Hard Work|
12. Heaven Blesses the Diligent
13. God in the glorious center of Heaven
14. Grace from Heaven...
15. Archangel / Arch Angel
16. Blue Sky
This is the character which means "heaven" or "sky" in Chinese, Japanese Kanji, and old Korean Hanja.
Context of how this character is used determines if you are talking about heaven or the sky above (often they are the same concept anyway).
When combined with other characters, words like "today" and "tomorrow" are created. While sometimes the character for "sun" is used to mean "day", often "sky" represents "day" in Asian languages.
Example: "this sky" = "today", "next sky" = "tomorrow" in modern Chinese and Japanese (they also use "sun" in the same way - but the use of the "sun" character in words like today and tomorrow feels more ancient).
In Chinese culture, regardless of which religion, it's almost always assumed that God (and any other deities) live up above in the sky. This is probably how the idea of heaven being associated with this character began.
The equation goes something like this: God's domain is the sky, thus, the sky is heaven.
Note: As a single character, this is a little ambiguous, so you might want to choose our Kingdom of Heaven selection instead.
This is the deepest way to say "Heaven's Grace" or "God's Grace" in Chinese.
The first character means Heaven or sky (referring in this case to the domain of God).
The second character means grace, blessings, benevolence, favor / favour, acts of kindness, merits, or beneficial influence.
This title can also be defined as:
Blessings of Heaven, Favor of the Emperor, Divination's luckiest day, or blessings of nature. Note: When you see "Emperor" above, keep in mind that the Emperor, like the Pope is theoretically chosen by God, or seen as an emissary or conduit of God in ancient Asian culture. It would only be read that way in certain context such as, "The Emperor, in his mercy, bestowed upon him Heaven's Grace and the prisoner was set free".
Note: Technically, this is a Japanese word too (pronounced "ten-on"), but it's rarely-used in Japan anymore. Therefore this title is best if your audience is Chinese.
This title can be translated as either "voice of heaven" or "voices from heaven".
The first two characters mean heaven.
The third character is a possessive article (kind of like making heaven into heaven's).
The last character means voice, but can also mean sound.
Note: This can be pronounced in Korean, but it's not a commonly-used term.
This title represents the oneness of heaven and humanity. It conveys the idea that man is an integral part of nature.
You can also read this as "heaven and man in unity", or "nature and man in unity". The "man" is really "people" or "humans" and is not gender-specific in Chinese.
This means "Heaven's Blessing", "Blessings from Heaven", or "Blessed by Heaven" in Japanese Kanji.
Depending on the context in which this is used, it can also mean, "gift of nature", or even, "natural resources" (as in Heaven or God bestowed things like oil, iron, gold, and other natural resources upon mankind).
This is a way to express destiny in a slightly religious way. Literally this means "Heaven's Wish" or "Heaven's Desire" with the idea of fate and destiny being derived as well. It suggests that your destiny comes from God / Heaven and that your path has already been chosen by a higher power.
My Japanese dictionary defines this word as "divine will" or "providence" but it also holds the meaning of "the will of the emperor". Therefore I don't suggest this phrase if your audience is Japanese - it feels a little strange in Japanese anyway.
This is "Heaven and Earth" in Chinese, Japanese Kanji, and old Korean Hanja. This title is used for many different contexts. It can be a general term, but also used by Buddhists and in other religions.
This can also be used to refer to the universe, all of nature, the top and bottom, realm of life, or sphere of existence.
This is the very Christian way to refer to the "Kingdom of Heaven" in Chinese, old Korean and Japanese. This is also the translation for "paradise".
The first character means "Heaven". The second character means "kingdom", but in modern times has been extended to mean "country" (but no one will translate this particular character combination as "Heaven Country"). This is the ancient version of this word, as in modern times (after WWII) the second character was simplified in mainland China and Japan.
This is the same meaning and pronunciation as our other entry for "Kingdom of Heaven" but the second character was simplified in Japan and mainland China to this version. Choose the appearance that you like best (they will be somewhat universally understood - as most people are aware of this simplification in places where they still use all traditional characters - such as Taiwan and Hong Kong). You can consider the other version to be the "ancient version".
This proverb can also be translated as "The whole world is one family". It is used to mean that all humans are related under heaven.
The first two characters can be translated as "the world", "whole country", "descended from heaven", "earth under heaven", "the public" or "the ruling power".
The second two characters can mean "one family", "a household", "one's folks", "a house" or "a home". Usually this is read as "a family".
Note: This proverb can be understood in Japanese, though not commonly used.
This is the meaning of Angel in Chinese, Japanese Kanji, and old Korean Hanja.
The first character means heaven. The second means messenger. Together it makes sense that we are talking about angels as Heaven's Messengers.
If you are an "Angel Junkie", this may be the wall scroll for you.
I also think it's a great choice if your name happens to be Angel.
See Also... Angel
This inspirational Chinese proverb can be translated a few ways:
Heaven will not disappoint the person who tries.
If you try hard, you're bound to succeed eventually.
Heaven rewards diligent work.
Sincere/heartful effort reaps the grace of Heaven.
This can be interpreted a few different ways:
God blesses those who work hard.
It is the way of Heaven to smile on the diligent.
God will reward those that are worthy.
Heaven blesses those who are diligent.
Whichever translation you like, a scroll like this on your wall may serve as a reminder to work hard because your diligence will pay off both in this life and the next.
Note: This can be pronounced in Korean, but it's not a commonly-used term.
This is a phrase that was submitted by a customer. I do not have information on the origin of this phrase.
The first two characters act to create a word that means "divine", "God's", or "The Spirit's".
The last two Kanji mean grace, favor, favour, blessing, or benefit.
This is the title Archangel in Chinese characters, Japanese Kanji, and old Korean Hanja.
The first character means big or great (in this case, it means "arch").
The second means heaven (or sky).
The last means messenger.
The second and third characters together make the title for angel, which is literally "Heaven's Messenger".
This title would be understood as "The Chief of all Angels", or "The Great Angel". Some might even say it's the boss of Angels.
See Also... Angel
This is a poetic way to express "sky" in Chinese and Japanese Kanji.
It's like saying, "The blue dome of heaven", or a way to say "blue sky" within a poem.
Your Price: $87.88
Your Price: $78.88
The scroll that I am holding in this picture is a "medium size"
4-character wall scroll.
As you can see, it is a great size to hang on your wall.
(We also offer custom wall scrolls in larger sizes)
Professional calligraphers are getting to be hard to find these days.
Instead of drawing characters by hand, the new generation in China merely type roman letters into their computer keyboards and pick the character that they want from a list that pops up.
There is some fear that true Chinese calligraphy may become a lost art in the coming years. Many art institutes in China are now promoting calligraphy programs in hopes of keeping this unique form of art alive.
Even with the teachings of a top-ranked calligrapher in China, my calligraphy will never be good enough to sell. I will leave that to the experts.
The same calligrapher who gave me those lessons also attracted a crowd of thousands and a TV crew as he created characters over 6-feet high. He happens to be ranked as one of the top 100 calligraphers in all of China. He is also one of very few that would actually attempt such a feat.
If your search is not successful, just post your request on our forum, and we'll be happy to do research or translation for any reasonable request.
Successful Chinese Character and Japanese Kanji calligraphy searches within the last few hours...
A New Chapter in Life|
|Death Before Dishonor|
|Monkey Stealing Peaches|
With so many searches, we had to upgrade to our own Linux server.
Of course, only one in 500 searches results in a purchase - Hey buy a wall scroll!!!
The following table is only helpful for those studying Chinese (or Japanese), and perhaps helps search engines to find this page when someone enters Romanized Chinese or Japanese
|Romaji(Romanized Japanese)||Various forms of Romanized Chinese|
|Heaven / Sky||天|
|Grace from Heaven / Grace from God||天恩|
|Voice of Heaven / Voices from Heaven||天堂之音|
|n/a||tiān táng zhī yīn|
tian tang zhi yin
t`ien t`ang chih yin
|tian1 tang2 zhi1 yin1|
tien tang chih yin
|Oneness of Heaven and Humanity||天人合一|
|n/a||tiān rén hé yī|
tian ren he yi
t`ien jen ho i
|tian1 ren2 he2 yi1|
tien jen ho i
|Blessed by Heaven||天恵|
|Destiny Determined by Heaven||天意|
|Heaven and Earth||天地|
|Kingdom of Heaven||天国|
|Kingdom of Heaven||天国|
|One Family Under Heaven||天下一家|
|tiān xià yī jiā|
tian xia yi jia
t`ien hsia i chia
|tian1 xia4 yi1 jia1|
tien hsia i chia
|Angel / Messenger of Heaven||天使|
|Heaven Rewards Hard Work||皇天不负苦心人|
|n/a||huáng tiān bù fù kǔ xīn rén|
huang tian bu fu ku xin ren
huang t`ien pu fu k`u hsin jen
|huang2 tian1 bu4 fu4 ku3 xin1 ren2|
huang tien pu fu ku hsin jen
|Heaven Blesses the Diligent||天道酬勤|
|n/a||tiān dào chóu qín|
tian dao chou qin
t`ien tao ch`ou ch`in
|tian1 dao4 chou2 qin2|
tien tao chou chin
|God in the glorious center of Heaven||天之御中主神|
|n/a||tiān zhī yù zhōng zhǔ shén|
tian zhi yu zhong zhu shen
t`ien chih yü chung chu shen
|tian1 zhi1 yu4 zhong1 zhu3 shen2|
tien chih yü chung chu shen
|Grace from Heaven|
Grace from God
|神の恩恵||kami no on kei|
|Archangel / Arch Angel||大天使|
|dai ten shi |
|dà tiān shǐ|
da tian shi
ta t`ien shih
|da4 tian1 shi3|
ta tien shih
Some people may refer to this entry as Heaven Kanji, Heaven Characters, Heaven in Mandarin Chinese, Heaven Characters, Heaven in Chinese Writing, Heaven in Japanese Writing, Heaven in Asian Writing, Heaven Ideograms, Chinese Heaven symbols, Heaven Hieroglyphics, Heaven Glyphs, Heaven in Chinese Letters, Heaven Hanzi, Heaven in Japanese Kanji, Heaven Pictograms, Heaven in the Chinese Written-Language, or Heaven in the Japanese Written-Language.
Did you like this? Share it:Share via email with a friend
This page of heaven Chinese calligraphy dictionary search results was generated in 0.0839 seconds. | <urn:uuid:0ad6e22b-6959-41d6-8731-0413059eebd1> | CC-MAIN-2014-42 | http://www.orientaloutpost.com/shufa.php?q=heaven | s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1414119648384.20/warc/CC-MAIN-20141024030048-00032-ip-10-16-133-185.ec2.internal.warc.gz | en | 0.891005 | 3,158 | 2.671875 | 3 |
Assignment 1. 2D video game
Purpose: learn some basics of interactive 2D graphics
Program a version of the breakout video game.
A two-dimensional paddle game, using mouse input. A ball bounces according to gravity. The paddle should be curved or “sticky” to control the bounce trajectory.
There will be several round objects slowly falling from the sky. Balls can hit them causing point to be added and they disappear and return to the top. Once 10 objects have hit the ground the game is over.
The rate of fall increases over time.
Add vivid color effects when an object is hit. Score increases as objects are hit. The program should print the score at the end to standard output.
- A single compilable file using glut and openGL.
- There should a main.cpp, and other classes (containing the bulk of the game).
- For delivery purposes place these above the main part of the progam.
- External documentation: - a half page user manual should be provided.Also,write a paragraph describing the ball-paddle interaction.
Marks will be given for
- Programming style
clarity, structure, good naming, comments.
- The quality of the user interface and the visual interest of the game.
Due: 16 Sept by email (email@example.com) | <urn:uuid:36a69c87-0832-4414-a5ef-8cce83c58efd> | CC-MAIN-2016-18 | http://ccom.unh.edu/vislab/GraphicsCourse/Assgt1.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-18/segments/1461860128071.22/warc/CC-MAIN-20160428161528-00072-ip-10-239-7-51.ec2.internal.warc.gz | en | 0.8387 | 285 | 3.859375 | 4 |
Saint Simeon, Bishop of Tver was descended from the Polotsk princes. He was the seventh bishop of Polotsk and the first bishop of the Tver diocese. The saint’s cathedra was first at Polotsk, but hostile attacks and conflicts with the Lithuanian princes, and the murder of the Polotsk prince (his relative) in 1263, compelled him to move to Tver (Prince Yaroslav Yaroslavich had become Great Prince of Russia, and he chose Tver as his ruling city).
St Simeon was well-disposed and kind to the down-trodden and destitute, attentive to the monastic and priestly orders, and a zealous defender of truth.
The Nikonov Chronicle relates that this holy bishop was “knowledgeable about medicine, and well versed in the books of Holy Scripture; he was a teacher, a virtuous man, concerned for the needy, widows and orphans, a defender of the down-trodden and deliverer of the oppressed.”
History preserves for us a conversation of St Simeon with Prince Constantine of Polotsk who, wishing to make a jest about his court, asked the saint at supper: “Where shall the courts be in that world?” Simeon answered, “Those courts shall also be where the prince is.”
The prince did not care for this, and he said, “A court might judge unjustly, and take bribes, or torture people, and is it I who do the harm?” The bishop explained to him, “If a prince is good and God-fearing, and is concerned for the people, and loves truth and he appoints good, God-fearing, intelligent and truth-loving men to his council, that prince shall be in Paradise and his court with him. If, however, a prince is without the fear of God, and is not concerned for Christians and does not think of orphans and widows, and if he appoints wicked counselors who lack integrity in order to bring him money, that prince shall be in Hell and his court with him.”
St Simeon died on February 3, 1289. | <urn:uuid:f65cc11c-4232-4197-a4ff-09391385a176> | CC-MAIN-2015-11 | http://oca.org/saints/lives/2014/02/03/100420-st-simeon-the-bishop-of-polotsk-and-tver | s3://commoncrawl/crawl-data/CC-MAIN-2015-11/segments/1424936463108.89/warc/CC-MAIN-20150226074103-00141-ip-10-28-5-156.ec2.internal.warc.gz | en | 0.982634 | 463 | 2.640625 | 3 |
We are searching data for your request:
Upon completion, a link will appear to access the found materials.
The plant transplant procedure is no less important than timely watering, care, proper lighting and temperature control.
Transplanting an orchid is a major stress on the plant. The bulky roots of the flower are greatly affected by this procedure. Growth stops, the orchid begins to ache. The transplant can be performed no more than once every three years. Only in case of critical need it can be performed unscheduled.
Life cycle in September, October and November
The autumn months are an important period in the life of an orchid. In September, the plant should be brought into the house, and an external examination should be carefully conducted for the presence of pests. Preparatory work for the winter consists in reducing fertilizing and lowering the temperature in the room.
Important! The temperature regime directly depends on the type of flower.
The preparation of some plant species for flowering begins in October. There are varieties on the market that in the middle of autumn go into a “dormant period” and shed all the greens. If this is not a consequence of illness and pest infestation, you should not worry.
At the end of autumn, feeding and watering the flower stops. In November, daylight hours should be increased due to additional lighting.
Can the plant be moved around this time of year?
Orchid refers to plants that respond positively to transplanting during the dormant period. For this species, these are all autumn months and April. A sleeping flower needs a new substrate for painless wintering. Before carrying out a transplant, it is necessary to study the possible options for its implementation and the nuances that may arise in this case.
You can transplant an orchid into a new container in different ways:
- Planting a plant on a block. The root system is attached, for example, to a brick with any convenient rope. Moss, which completely covers the roots and block, will help prevent the root system from drying out.
- Block transplantation under artificially created greenhouse conditions with a high level of humidity will bring the procedure closer to natural growing conditions.
- Flower transfer can be carried out without replacing the soil. Fresh substrate is added only around the edges of the pot. This is useful if only an increase in seeding capacity is required.
- In the conditions of an apartment, a classic transplant is considered more suitable. The roots inside the pot do not dry out quickly at normal indoor humidity levels.
How to choose a pot and soil?
Large pots are unacceptable for this species. The optimal ratio of height to width is 1/1. An extensive root system requires a free arrangement in a container.
Attention! The best option is a plastic transparent pot with frequently located drainage holes.
Not all growers like transparent pots. If the required capacity is not in harmony with the general interior, then it can be put in another larger pot. The voids are filled with any decorative material - pebbles, wood chips.
Experienced florists recommend opting for a special soildesigned for orchids. If there is no trust in purchased soil mixtures, then you can prepare it yourself. The optimal proportion is 1: 1: 1: 1: 1: 1:
- chopped pine bark;
- fern root;
- finely chopped walnut shell;
- expanded clay.
A lack of one of these ingredients can lead to unhealthy flower growth. Regardless of the soil chosen, before planting it should be spilled with boiling water or a weak solution of manganese.
Preparing for transplant
When transplanting, you must remember the basic rules:
- The presence of drainage holes in the tank for the timely outflow of moisture.
- Ensuring continuous air circulation inside the container.
- Removing the roots during transplantation should be painless.
- Maintaining the required temperature is an important aspect of flower health.
The quality of future transplantation work directly depends on the competently conducted preparation. You will need the following tools and materials:
- Pruner or good sharp scissors.
- Disinfectant for instrument processing.
- Charcoal for the treatment of cuts and wounds. It is allowed to use activated carbon, which can be purchased at a regular pharmacy.
- Pine bark and perlite.
- Transplant capacity. Be sure to carry out disinfecting procedures before starting work, for example, treat with a solution of potassium permanganate.
Important! A new pot is taken 2-3 cm larger than the previous one.
Step-by-step instructions for the procedure at home
The plant transplant process is carried out in a specific sequence. Care must be taken at this stage to avoid damaging the root system.
Removing from the pot
Before removing the flower, you need to knead the container to facilitate the process. You should pay attention to the root system, it is removed as carefully as possible. If the roots cannot be reached without damage, it is recommended to cut them off with scissors.
Pruning should only be done with a very sharp and sterile instrument.
Before transplanting into new soil, all remnants of the old should be removed. The roots are straightened and cleaned of the adhering substrate. This can be done with water. Flushing the root system with warm water will not only cleanse it, but also wash off all possible pests.
On a note. If harmful parasites are detected, the root system is treated with any fungicidal preparation.
Trimming roots, leaves
A careful examination of the root processes at this stage will help protect the orchid from future diseases and pests. All damaged areas of the root system are subject to pruning. These can be rotten or dried out parts. Cutting points are processed with charcoal or activated carbon. You can enhance the effect with the help of special antibacterial drugs.
At this stage, you should pay attention to the leaves, all yellowed or diseased ones are cut off. All lower leaves and empty bulbs are also subject to removal.
A solution of succinic acid will help the plant to painlessly transfer the transplant. It is prepared as follows: 1 tablet of the drug is diluted in a liter of warm boiled water. The root system is processed within 30-40 minutes. The drug: improves immunity, stimulates root growth, accelerates the healing of wounds and sections obtained during transplantation.
Be sure to dry the plant before moving it to a new pot. The flower is laid out on a newspaper and left for 8-10 hours in a dry and warm place.
Placement in a new container
A new, previously prepared transparent container is filled 1/3 with any drainage material. Prepared soil mixture is poured on top with a thin layer.
Attention! The presence of a drainage layer is a prerequisite for a healthy root system. Excessive moisture is extremely detrimental to orchid roots.
The dried flower is placed in the pot as carefully as possible. The earth is added gradually and evenly distributed among all roots.
To achieve soil compaction is possible simply by knocking on the walls of the pot.
Long root shoots can be left outside the pot. This method is used to obtain additional moisture.
Orchid transplant video:
It is not recommended to water the plant immediately after transplanting. The first moisturizing is carried out only after 6-7 days. Watering is best done through the roots. For this purpose, the pot is placed in a special tray with boiled warm water for 20-30 minutes. The procedure is repeated after 10-12 days.
Watering should be combined with spraying from a fine atomizer. To maintain the orchid, after 30 days it must be fed with special complex fertilizers.
Fertilizer must contain minerals, organics and nitrogen.
Will it bloom?
An arrow with a peduncle most often does not appear immediately. After transplanting, yellowing of the leaves and a painful appearance are observed. Orchid transplant, performed according to the rules, will allow you to achieve flowering in 20-30 days.
Attention! If a plant was transplanted that has not bloomed for a long time, then a stressful situation will provoke the formation of new peduncles.
Possible problems and difficulties
It is very easy to harm an orchid during transplantation; a mistake made by negligence can lead not only to a flower's disease, but also to its subsequent death. Inexperienced growers most often do not follow these rules:
- For planting orchids, it is recommended to use transparent plastic containers.
- Only a special substrate is suitable for a flower. You cannot use a universal primer.
- Follow the transplant instructions step by step.
- Compliance with the transplant time is the key to the health of the flower.
The plant does not grow in the transport substrate. This is the reason for the recommendation after purchasing an orchid to urgently transplant it. Correctly carried out work will eliminate problems in the future.
Not only a timely and competent transplant will help to grow a beautiful flower, but also the subsequent care of the plant. Compliance with all the rules will turn a complex transplant event into an interesting process. As a gratitude, the orchid will delight its owner with lush flowering and will be an excellent decoration for any interior. | <urn:uuid:66bf1468-4f1f-4331-a4ae-b44b61f3823f> | CC-MAIN-2022-21 | https://au.stopsbs.net/6387-when-to-transplant-an-orchid-and-is-it-possible-in-th.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652662577757.82/warc/CC-MAIN-20220524233716-20220525023716-00056.warc.gz | en | 0.923949 | 1,963 | 2.8125 | 3 |
Send the link below via email or IMCopy
Present to your audienceStart remote presentation
- Invited audience members will follow you as you navigate and present
- People invited to a presentation do not need a Prezi account
- This link expires 10 minutes after you close the presentation
- A maximum of 30 users can follow your presentation
- Learn more about this feature in our knowledge base article
Do you really want to delete this prezi?
Neither you, nor the coeditors you shared it with will be able to recover it again.
Make your likes visible on Facebook?
You can change this under Settings & Account at any time.
4.04 Atomic Theory
Transcript of 4.04 Atomic Theory
J.J. Thomson's father had always planned for him to be an engineer, but when the time came, an apprenticeship at an engineering firm couldn't be found. So, Thomson was sent to Trinity college at Cambridge to study mathematics and the physical sciences on a small scholarship. This was one of the first steps that led him to his study of the atom.
Were there experiences in his life that led to his interest in science and the study of the atom?
J.J. Thomson's whole idea of how the atom is set up with the Plum-pudding model was disproven. Because, instead of negatively charged electrons embedded in a blob of positively charged matter, like plum pudding, the atom has an electron cloud surrounding a nucleus with neutrons and protons. But his discovery of the electron in the first place is present in the modern atomic model.
Which contributions are present in the modern atomic model and which were eventually disproven?
J.J. Thomson's work and the Plum-Pudding atomic model is something that helped advance the past atomic models. It made a higher stepping stone for future models. And his discovery of the electron was a very important discovery.
Defend his work on the atom and its contribution to the modern atomic model.
4.04 Atomic Theory | <urn:uuid:ceeec05e-6c82-482b-8bfa-c6153071f284> | CC-MAIN-2017-17 | https://prezi.com/hoims685kvmx/404-atomic-theory/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917118477.15/warc/CC-MAIN-20170423031158-00324-ip-10-145-167-34.ec2.internal.warc.gz | en | 0.944065 | 413 | 2.671875 | 3 |
The most famous case of consumption was in 1892 in Rhode Island. Ms. Mercy Lena Brown.
The Brown family had already lost two members of the family. Mercy’s mother, Mary, and sister’ Mary Olive died of consumption in 1888. Her brother got sick in 1890 and in 1891 Mercy got sick. She died on January 17, 1892.
Mercy’s father George worried about his only son’s failing health. (he’d been sick for 2 years)
On March 17, 1892 George led a mob of fellow farmers and townsfolk to the Brown’s graves. George was convinced a vampire was the cause for all his family’s suffering.
When mercy’s mother and sister were exhumed the mob agreed their bodies had decomposed sufficiently. But Mercy’s body wasn’t, she’d been in a crypt for a few months, -until the ground thawed enough to bury her.
Her body was cut open. Her heart and liver were still full of blood. It was decided that Mercy was a vampire (although the term vampire wasn’t used at that time, she was undead).
Her heart was burned to ash then given to her ill brother in hopes it would cure him, or break the curse that Mercy had placed on him. It didn’t work, Edwin died two months later.
A newpaper article about Mercy Brown was found in Bram Stoker’s notes for Dracula. It’s believed Stoker’s Lucy was based on Mercy Brown. | <urn:uuid:b29f7907-b7c9-4043-a677-cbcbfdeee387> | CC-MAIN-2017-34 | https://mariwells.wordpress.com/2014/03/05/mercy-brown-and-consumption/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886102819.58/warc/CC-MAIN-20170817013033-20170817033033-00051.warc.gz | en | 0.991435 | 331 | 2.734375 | 3 |
Origin of segmentation cavity
Words nearby segmentation cavity
How to use segmentation cavity in a sentence
Some have speculated that cessation of CPR decreases pressure in the chest cavity, allowing blood to return to the heart.Real Life Lazarus: When Patients Rise From the Dead|Sandeep Jauhar|August 21, 2014|DAILY BEAST
The force of the two reacting spreads the foam through the chest cavity, hardening to apply pressure to any bleed sites.
Injuries within the chest cavity may not be readily visible to medics, and are difficult to compress, King said.
Take a “cavity bomb,” for example: explosives hidden in rolls of fat, between butt cheeks.Man’s Airport Strip Meant to Highlight Intrusive and Ineffective TSA Security|Winston Ross|May 9, 2012|DAILY BEAST
Heaven help us the first time a would-be suicide bomber is caught with explosives hidden in a body cavity.
There appears a rude attempt to picture the mouth cavity and to show those interesting accessories, the teeth.Children's Ways|James Sully
In addition, chylous and chyloid exudates are occasionally met, particularly in the peritoneal cavity.A Manual of Clinical Diagnosis|James Campbell Todd
In this specimen the tubular cavity of the stalactite is still open.
All about the cavity in the sand lay stones big and little, timbers, stakes, loops of rope.Mushroom Town|Oliver Onions
They were carried up to the top of the tree, and disappeared, still fighting, within the cavity.The Devil-Tree of El Dorado|Frank Aubrey | <urn:uuid:fdeb5690-bebc-49fe-8a9a-4c66885c1fa0> | CC-MAIN-2021-31 | https://www.dictionary.com/browse/segmentation-cavity | s3://commoncrawl/crawl-data/CC-MAIN-2021-31/segments/1627046152168.38/warc/CC-MAIN-20210727010203-20210727040203-00267.warc.gz | en | 0.871725 | 351 | 2.984375 | 3 |
Lusaka is the capital and largest city of Zambia. Lusaka is a commercial centre as well as centre of government, and the four main highways of Zambia radiate north, south, east and west from it. Zambia is in Southern Africa, east of Angola. The climate is tropical, modified by altitude and the rainy season (October to April). The official language is English. Bemba and Njanja are the other most commonly understood languages. The main religions are Christianity, indigenous beliefs, Hinduism and Islam. The Zambian economy has historically been based on the copper mining industry. Output of copper had declined over a period of 30 years due to lack of investment, low copper prices, and uncertainty over privatisation. However following privatisation of the industry, copper production has rebounded. The Zambian government is pursuing an economic diversification programme to reduce the economy's reliance on the copper industry. Expatriate business dress is typically conservative in the form of a lightweight suit or equivalent. The security risk for expatriates in Zambia is medium. Risks include petty and opportunistic theft, violent crime, including armed robbery and carjacking. The currency of Zambia is the Zambian Kwacha (ZMW). ATMs are available in Lusaka and some major towns but may not accept all cards. Major credit cards are increasingly accepted by larger shops, hotels, restaurants and tour operators. Medical facilities are poor, especially in rural areas. Emergency services are limited. There have been a cholera outbreaks reported. The HIV prevalence rate is very high. The population of Lusaka is 2.5 Million (2016 est.), while the inflation rate is 22.2% (2016 est.).
Cost Of Living
The cost of living for expatriates in In Lusaka, the cost of each basket, based on local prices, compared to the international average, is categorized follows (Exact cost of living percentages only available in personalised reports): Lusaka as at 1 April 2016 is average in comparison to other places in the world. 1) Alcohol (where available) & Tobacco: Very Low 2) Clothing: Low 3) Communication: High 4) Education: Very Low 5) Furniture & Appliances: Low 6) Groceries: Low 7) Healthcare: Very Low 8) Household Accommodation: Very High 9) Miscellaneous: Very Low 10) Personal Care: Very Low 11) Recreation & Culture: Low 12) Restaurants Meals Out and Hotels: Low 13) Transport: Average Lusaka is for example -43.5% cheaper than Yokohama for groceries, -8.1% cheaper for household costs than Saint Helier, and 21.3% more expensive for transport costs than Amman. The hardship premium for Lusaka for an expat from Israel, is for example 0%, i.e. host location (Lusaka) premium of 30% minus home (Israel) location premium of 30%. Lusaka is ranked as a high degree of hardship location. Want to know more about cost of living, hardship or expat pay in Lusaka? Register subscribe to your home location and Lusaka and run your personalised reports. | <urn:uuid:0059d4e2-7333-4a62-a4d8-435860e2cd70> | CC-MAIN-2016-22 | http://www.xpatulator.com/cost-of-living-review/Zambia-Lusaka_227.cfm | s3://commoncrawl/crawl-data/CC-MAIN-2016-22/segments/1464049275836.20/warc/CC-MAIN-20160524002115-00017-ip-10-185-217-139.ec2.internal.warc.gz | en | 0.931636 | 658 | 2.6875 | 3 |
From what height must a block of ice dropped into a well so that 5% of it may melt. Given both ice&water at 0C L=80 CAL/G ,J=4.2J/cal, g=980cm/s.
Asked by Pawan chhipa | 23rd Nov, 2012, 05:12: PM
at the height , the object possess= mgh=pot energy
just before reaching the ground that fully converts to kinetic energy.
On touching the ground, that energy converts to heat and due to that heat certain portion of it converts to water.
mgh=Jm'L.....say m' amount of ice melts.
h=1.68m on putting the values.
Answered by | 29th Nov, 2012, 04:23: PM
Kindly Sign up for a personalised experience
- Ask Study Doubts
- Sample Papers
- Past Year Papers
- Textbook Solutions
Verify mobile number
Enter the OTP sent to your number | <urn:uuid:4dec503d-d330-4f41-97fb-e00b9012de60> | CC-MAIN-2021-31 | https://www.topperlearning.com/answer/from-what-height-must-a-block-of-ice-dropped-into-a-well-so-that-5-of-it-may-melt-given-both-ice-water-at-0c-l-80-cal-g-j-42j-cal-g-980cm-s/ut1cekss | s3://commoncrawl/crawl-data/CC-MAIN-2021-31/segments/1627046153491.18/warc/CC-MAIN-20210727202227-20210727232227-00710.warc.gz | en | 0.843265 | 214 | 2.6875 | 3 |
EVOLUTION IN EUROPE
EVOLUTION IN EUROPE; Refugee Ships Leave for Albania
Published: July 13, 1990
BRINDISI, Italy, July 12— Ships from three nations sailed today to a rendezvous off Albania in a sea lift of more than 4,500 Albanians seeking to escape their homeland, Europe's last haven for hard-line Communists.
The three nations, France, Italy and West Germany, sent five ships to ferry the refugees 85 miles across the Adriatic from Durazzo, Albania, to the southern Italian port of Brindisi, a voyage of five to seven hours.
The exodus, was expected to ease a two-week crisis created by Albanians storming foreign embassies in Tirana seeking asylum. Some braved police gunfire. Others scrambled over embassy-compound walls or crashed through them in trucks.
The embassies have been struggling to feed and shelter the Albanians, many of them young people.
''They will all arrive tomorrow,'' said Franco LoParco, president of the Italian Red Cross in Brindisi.
A Foreign Ministry spokesman said the ships would meet off Durazzo but further details would be withheld at the request of the Albanian Government.
The Italian news agency ANSA said Albania did not want the ships to dock and that those seeking asylum would be transferred from shore to the foreign vessels by Albanian boats.
Two Greek-owned ferries, chartered by the West German Government, arrived at Durazzo this afternoon, a spokesman for the ship owner said.
Together the two vessels can carry 1,900 passengers.
Two Italian ships were bound for Albania from Venice and Brindisi and a French-chartered ship set sail for Albania from Greece.
Most of the arrivals will be given coffee and croissants and then put on three trains headed for West Germany.
West German diplomats in Brindisi said 3,200 Albanians who took refuge in their embassy in Tirana, Albania's capital, would make the sea crossing. | <urn:uuid:90733b7f-5921-4912-83db-4c9533bb336e> | CC-MAIN-2016-26 | http://www.nytimes.com/1990/07/13/world/evolution-in-europe-refugee-ships-leave-for-albania.html?src=pm | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398216.41/warc/CC-MAIN-20160624154958-00076-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.960138 | 415 | 2.546875 | 3 |
|The Chenoweth family by the Loutre Lick Springs marker|
of Boone's Lick Road.
The Boone's Lick Trail was a a 120-mile stretch of trail blazed by the famous pioneer Daniel Boone in 1799. When a salt lick was discovered along the Missouri River, Boone's sons, Nathan and Daniel Morgan, further developed the trail. Salt was essential for early settlers since they used it to cure meat, so the brothers made a business out of boiling out and selling the salt.
|Route of Boone's Lick Road|
It played a significant role in developing the state of Missouri; however, it is largely unknown by most of the residents of the state today. According to historian Ken Kamper, resident historian at the Daniel Boone Home and Boonesfield Village, "The Boone's Lick Trail was the only trail people were using going west until they got to the Oregon Trail and the Santa Fe Trail. It was a major corridor for 40 years."
|Family car trip on a dirt road in Kansas|
|Road trip through the mountains|
Today not much remains of the original trail aside from the granite road markers scattered across the state; most of the trail is now part of U.S. Highway 40. As sad as this might sound for most historical sites, a group of Missourians actually wanted for it to be turned into a highway. In 1911, the Daughters of the American Revolution led crusaded for a national highway to be built along the existing trails. In a sense, this trail gave birth to the highway system and became a part of the first highway in the United States.
View more of the Chenoweth family road trips in the Blanche Espy Chenoweth collection of the University of Houston Digital Library. | <urn:uuid:92e548df-2c73-44c9-9a7e-9a9ee254a59f> | CC-MAIN-2015-32 | http://uhdigitallibrary.blogspot.com/2013/08/trekking-boones-lick-trail.html | s3://commoncrawl/crawl-data/CC-MAIN-2015-32/segments/1438042987174.71/warc/CC-MAIN-20150728002307-00322-ip-10-236-191-2.ec2.internal.warc.gz | en | 0.967212 | 364 | 3.53125 | 4 |
Today we’re thrilled to announce a new collaboration that we hope will benefit science writers at all levels of experience, from students to veterans. With support from the Gordon and Betty Moore Foundation, CASW and The Open Notebook are partnering to produce a series of annotated stories aimed at shedding light on what makes some of the best science writing so outstanding.
A group of distinguished judges will select stories from among winners of major science-writing awards to be presented as “story diagrams,” or Storygrams. The Storygrams will be featured at TON, along with Q&A interviews with the stories’ authors.
Additionally, they’ll be featured at the soon-to-launch CASW Showcase website, which will republish additional selected award-winning science stories and provide community updates on award programs. Through the Storygrams, both TON and CASW hope to show how tough challenges in science journalism and communication can be surmounted as well as amplify the impact of these exceptional stories.
In the first annotation, coming next week, environmental and science journalist Tom Yulsman, a professor of journalism at the University of Colorado Boulder, dissects science journalist Cally Carswell’s award-winning 2013 High Country News story “The Tree Coroners.” TON and CASW look forward to bringing more Storygrams to the science journalism community soon.
Published May 26, 2016 | <urn:uuid:88742311-9683-4a89-a897-b43bf25ab45b> | CC-MAIN-2018-47 | http://www.casw.org/casw/announcement/ton-and-casw-launch-story-diagrams-series | s3://commoncrawl/crawl-data/CC-MAIN-2018-47/segments/1542039743247.22/warc/CC-MAIN-20181116235534-20181117021534-00099.warc.gz | en | 0.927883 | 295 | 2.515625 | 3 |
“Wanna see a puffin chick?” Peter asked me, smiling.
Peter Hodum, a visiting professor at the University of Puget Sound, was perched on a cliff about 100 dizzying feet above the surging Pacific Ocean. He was unfazed by the height, an adventurous biologist in a blue shirt the color of the sea below. On his head he wore a strange visor that made him look like an out-of-place video-gamer.
When I reached him, he put the visor over my eyes and slid a long flexible tube into a burrow in the soft earth. The infrared camera lens on the end of the tube sent a grainy image to a screen in the visor. In the burrow, a puffy chick hunkered against the far wall, a ghostly gray. I could distinctly make out its eyes and a pale dot on its beak, an egg tooth, used to break its shell.
“It’s just hatched,” Hodum said. “You’re one of the few people in the world ever to see a Tufted Puffin chick in its burrow.”
He was checking puffin burrows as part of the first multi-year study of the species in Washington State. Arguably the most charismatic and beautiful seabird on the west coast, the puffin is an icon of the Pacific Northwest, a symbol of the wild, rocky shore. Surprisingly, no one knows much about it.
“It’s woefully understudied,” Hodum said.
He would like to change that. Hodum and Scott Pearson, a research scientist for the Washington Department of Fish and Wildlife, initiated a study in 2005 in response to the feeling among seabird experts that puffins are disappearing in the state and along the west coast in general.
The heart of its range (see map) is along the coasts of Alaska and Russia, where its numbers remain strong. But perhaps because of its success in the North Pacific, or perhaps because the Atlantic Puffin receives much more attention, the disappearance of the Tufted Puffin on the west coast has gone largely unnoticed and unexplained.
Like Atlantic and Horned Puffins, the Tufted is a sweet-faced clown of the sea. It has a striking white face and massive orange beak, at once comical and irresistible. On land, it shuffles on big bright orange feet, semi-erect and waddling. Unlike its cousins, its plump body is all black, giving it a more demure and mature look. And the distinctive and incomparable tufts on each side of its head are unique in the puffin tribe. Corn-silk yellow, combed backward, they give the bird an endearing touch, like a long-haired, eccentric professor. One look and you’ll fall in love.
Hodum was drawn to study the puffin because it’s in trouble on the west coast, and because, as he put it, “I’m addicted to seabirds. Their lives are such mysteries to us.”
As I see it, his attention to the puffin is significant because he could easily have said, “I’m too busy.” In addition to teaching college students about ecology and conservation biology, he also leads a research and conservation project on the Juan Fernández Islands, 400 miles off the coast of Chile, where two bird species are listed as Critically Endangered and four are listed as Vulnerable. He is also a project leader and board member of Oikonos, a nonprofit organization that directs conservation projects in California, the North Pacific, Chile, New Zealand, Mexico, and Antarctica. But he makes time for puffins.
“There seems no doubt,” Hodum told me, as I admired the chick in its burrow, “that Tufted Puffins along the whole west coast in the U.S. have declined. We don’t know why yet.”
Rugged, remote, and raucous with seabirds, Tatoosh Island is one of the great wild places on the west coast. Located on the extreme northwestern tip of the continental United States, it’s separated from the Olympic Peninsula by half a mile of treacherous ocean currents and fierce tidal rips.
Its tall rocky cliffs and flat top give it the look of a fortress, and in fact, it is one of the last strongholds for puffins in Washington and the west coast. That’s why Hodum is here — that and the fact that the Makah Tribe owns the island. The Makah protect it as a sanctuary for marine wildlife and give scientists access for research.
When I spent a day with him recently, Hodum was monitoring 17 burrows on the southern end of Tatoosh. Several of them took him quite literally over the edge of the cliffs. The work is not for the faint of heart, especially when Glaucous-winged Gulls begin dive-bombing. But the scenery is unforgettable. Behind us to the south, the sea stacks off Cape Alava presented a stunning view of the wild coast, rising from the ocean like a row of dragon’s teeth.
Long-term seabird studies on Tatoosh began when Julia Parrish, a professor of ocean and fishery sciences at the University of Washington, launched a survey of Common Murres in 1990. When Hodum and Pearson began their study in 2005, with collaboration from Parrish, they found only five successful active puffin burrows. In subsequent years, they have had as many as 14 successful breeding pairs in the study area and an estimated 20 to 25 pairs on the entire island.
In the 1970s, biologists working on the island estimated that 150 to 200 puffin pairs nested here.
The decline has been mirrored throughout the state. Hodum and Pearson visited 34 locations where the birds were known to breed. They once even nested in busy Puget Sound. But no more.
“Nearly half the colonies have blinked out,” Hodum said.
And not just in Washington. “In Oregon, the Tufted Puffin has collapsed,” Roy Lowe told me. He’s the manager of the Oregon Coast National Wildlife Refuge Complex, a group of six coastline refuges. Surveys in 1988, he said, estimated about 5,000 puffins in the state. A 2008 survey found just 148.
In California, Tufted Puffins once numbered in the thousands, nesting as far south as the Channel Islands. Now, 80 remnant pairs hang on in the Farallon Islands west of San Francisco, their southern limit.
When Hodum finished checking his burrows, we sat on the cliffs at the southern end of the island. Several puffins were flying past us, circling along the cliff face. Many carried forage fish in their beaks for their young. With their chunky bodies and undersized wings, they churned past us in heavy, labored flight.
We talked about the future of Tufted Puffins in the lower United States.
“The long-term trend is downward,” he said, “and with these low numbers, it’s hard to feel confident.”
On steep, rocky islands and mainland cliffs from California to Alaska to Japan. Largest colonies are on the Aleutian Islands. Nests in burrows that are about three feet long.
Offshore throughout the North Pacific.
Small schooling fishes, including anchovy, capelin, and lanternfish, krill, squid, and bristleworms.
On the edge
Later we went to the only beach on the island, in a small cove on the north end. He was meeting Pearson so they could survey offshore rocks and islands by boat. Pigeon Guillemots swam on the calm waters. Hodum had kayaked to Tatoosh and left his kayak on the pebbled beach. After helping carry it to the water, I asked him why puffins are in trouble.
“On the west coast, tu-pus are on the edge of their distribution,” he said, referring to the species by the abbreviation used by bird banders (TUPU). “They may be sensitive to any number of factors in a complex ocean ecology.”
Possible natural causes of the decline include predation and harassment. Populations of gulls, eagles, and Peregrine Falcons have boomed on the Washington coast. The predators disturb puffins at their burrows and even take adult puffins.
More serious, though, is the possibility that the puffins are sending signals about changes in the ocean. Higher sea temperatures caused by global climate change have affected productivity and food availability. Hodum cited a 2003 study on Triangle Island, in British Columbia. Researchers found that puffins there were highly sensitive to variations in surface temperatures of the ocean. In years when ocean temperatures rose, reproductive success fell. The authors worry that global warming could spell the end of the birds in British Columbia.
Another huge problem could be ocean acidification. Since the industrial revolution, the oceans are growing more acidic, Hodum explained. “The situation on the west coast is especially acute, having to do with upwelling patterns on the continental shelf. This could have dramatic effects on ocean food chains.”
Scientists suspect that acidic ocean water may be responsible for a 2008 die-off of several billion oyster, clam, and shrimp larvae off Oregon. “There’s no doubt that carbon dioxide levels are going up off Tatoosh,” Hodum said, citing long-term ocean monitoring studies conducted from the island.
Other threats to the species, none of which are easy to fix, include oil spills, ingestion of plastic, bycatch in fishing nets, and predation by introduced rats, foxes, and other mammals.
In 2009, when I joined him on Tatoosh, the puffins were having a relatively good year. Of the 17 burrows that he checked, all but three were active, with chicks, eggs, or incubating parents. But hatching success has varied a lot from year to year: from 56 to 82 percent of all eggs laid annually. And fledging success in general has been low, exceeding 40 percent in only two years of the study. In contrast, Rhinoceros Auklets on the island have had much better reproductive outcomes over the same period.
Puffins “seem quite variable,” Hodum said. “Tu-pus down here are at the limit of their range and may be on the edge of making it. There’s no buffer for them.”
Of the 2.9 million Tufted Puffins worldwide, 77% breed in Alaska.
North America’s three puffins: the Tufted, Atlantic, and Horned.
Hodum paddled out of the cove in his kayak, on his way to meet Pearson. If the currents aren’t strong, he told me, he’d circle Tatoosh and count puffins.
I had been invited to stay on the island for several more days with researchers studying colonies of Common Murres. At night, we would also capture Leach’s Storm-Petrels in mist nets, and perhaps a Rhinoceros Auklet or two, and band them.
Every hour during the days, I counted puffins for Hodum. I sat on a column of rock that juts from the cliffs on the west side of the island. It offers a good angle for studying the sheer cliffs, stained white with murre droppings.
I counted puffins on the cliffs, in the water, and in the air. During the afternoons, several puffins rested on a steep rock in the sun. They were probably nonbreeding birds, looking for mates and prospecting for burrows. Other puffins rested on the water, and I could watch them dive. Awkward on land, straining in flight, they are agile and graceful underwater.
In the evenings, as the sun set over the ocean, I sat near them as they returned from the sea to their burrows. They circled close to the cliffs, making pass after pass, before landing. Backlit by the sun, their feet glowed orange, and I could see their blood vessels. In the late light of my last evening, a puffin landed close by. Head cocked, it looked at me with pale blue eyes that were circled by a line of bold orange. They struck me as among the most expressive eyes I’ve seen in birds.
Two long fish dangled from its beak. It lingered for a moment in the golden light, then scooted into its burrow, just a few feet from me. Puffins are usually quiet, but I realized that I could hear it murmuring to its chick, a low rumbling from the burrow, almost as if the earth itself was speaking.
Read our newsletter!
Sign up for our free e-newsletter to receive news, photos of birds, attracting and ID tips, and more delivered to your inbox.Sign Up for Free | <urn:uuid:4cd9d4c8-5baf-4ff7-ac85-481056d19859> | CC-MAIN-2023-23 | https://www.birdwatchingdaily.com/news/science/sea-change-for-puffins/ | s3://commoncrawl/crawl-data/CC-MAIN-2023-23/segments/1685224657144.94/warc/CC-MAIN-20230610062920-20230610092920-00536.warc.gz | en | 0.963116 | 2,803 | 3 | 3 |
Leesylvania State Park
Leesylvania State Park is located in the southeastern part of Prince William County, Virginia. The land was donated in 1978 by philanthropist Daniel K. Ludwig, and the park was dedicated in 1985 and opened full-time in 1992.
|Leesylvania State Park|
IUCN category V (protected landscape/seascape)
Leesylvania State Park
|Location||Prince William, Virginia, United States|
|Area||542 acres (219 ha)|
|Elevation||0 ft (0 m)|
|Operator||Virginia Department of Conservation and Recreation|
Leesylvania Archeological Site (44PW7)
|Nearest city||Dumfries, Virginia|
|Area||1.5 acres (0.61 ha)|
|NRHP reference #||84003565|
|Added to NRHP||September 13, 1984|
|Designated VLR||June 19, 1984|
Henry Lee II settled on the land from 1747 until his death in 1787. He and his wife had eight children at their home including Revolutionary War hero Henry "Light Horse Harry" Lee. He is also the grandfather to Civil War general Robert E. Lee. George Washington mentions visiting the Lee House three times in his diaries.
In 1825 the property was sold to Henry Fairfax, and later passed to John Fairfax in 1847. Fairfax later served as a staff aide to Confederate Lt. General James Longstreet. The site was Fairfax's boyhood home, and he returned to live on the property in late 1875, remaining there until his death in 1908. The land was also used as a small Confederate force and gun emplacement during the Civil War. The Freestone Point Confederate Battery was listed on the National Register of Historic Places in 1989. The battery engaged with vessels of the US Navy's Potomac Flotilla on September 25, 1861. There were no casualties on either side, but the Federal vessels withdrew at the conclusion of the fighting. (Ref: Official Records of the Union and Confederate Navies in The War of The Rebellion)
Today, only a small cornerstone of the Lee House remains. The house and its path were completely bulldozed in the 1950s to make way for a road. A restored chimney of the Fairfax House remains. Henry Lee II and his wife, along with Henry Fairfax and his third wife are buried on the property. The sites and the cemetery are accessible by trail. The Leesylvania Archeological Site was listed on the National Register of Historic Places in 1984.
- "Virginia Landmarks Register". Virginia Department of Historic Resources. Retrieved 5 June 2013.
- "Leesylvania State Park". Virginia Department of Conservation and Recreation. Retrieved 2012-05-06.
- "Leesylvania State Park". Northern Virginia Heritage. Retrieved 2012-05-06.
- "National Register Information System". National Register of Historic Places. National Park Service. July 9, 2010.
- (Staff). "Virginia Landmarks Register/National Register of Historic Places" (PDF). Virginia Department of Historic Resources. Retrieved December 17, 2016.
- "Leesylvania State Park". Prince William County Visitors Bureau. Retrieved 2012-05-06.
|Wikimedia Commons has media related to Leesylvania State Park.| | <urn:uuid:43fa30bf-cbcc-45f0-9312-34b052df55ba> | CC-MAIN-2022-40 | https://zims-en.kiwix.campusafrica.gos.orange.com/wikipedia_en_all_nopic/A/Leesylvania_State_Park | s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030334332.96/warc/CC-MAIN-20220925004536-20220925034536-00349.warc.gz | en | 0.938437 | 764 | 2.5625 | 3 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.