Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
 Community
1
PMCID
string
Sentences
string
ner
list
PMC11291490
The findings revealed that dusCD40L substantially upregulated duBAFF expression by four-fold (Fig. 2d).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "findings", "revealed", "that", "dusCD40L", "substantially"...
PMC8414691
The midbody association of SRCAP was also evaluated on isolated midbodies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "midbody", "association", "of", "SRCAP", "was", "also", "evaluated", "on", "iso...
PMC11462673
C Our center's sequencing data of T-ALL patients demonstrated a statistically higher expression of the LDB1 gene in patients with a high bone marrow tumor burden.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9848491
Because of the different outcomes of patients in the high-risk and low-risk groups, we performed GSEA to investigate possible differences between the high-risk and low-risk groups.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9776316
All cell lines in the study were tested for mycoplasma contamination and authenticated by STR profiling.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "cell", "lines", "in", "the", "study", "we...
PMC11240571
Furthermore, there has been a focus on the combination of radiotherapy (RT) and anti-PD-1/PD-L1 antibody therapy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "there", "has"...
PMC5417661
Despite many cancer drug innovations and clinical studies, the treatment of OC patients has not improved substantially over the last decade.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Despite", "m...
PMC10578720
Data presented as the mean ± SD, n=3, ns=p>0.05, **p<0.01, ***p<0.001, ****p<0.0001 (1-way ANOVA with Tukey post hoc test). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7841067
AKAP4 has been suggested to correlate with the development of different types of carcinoma.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "AKAP4", "has", "been", "suggested", "to", "correlate", "with", "...
PMC3888431
Redundant contigs were filtered out using cd-hit-est.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Redundant", "contigs", "were", "filtered", "out", "using", "cd-hit-est", "." ] } ]
PMC10421378
Inactivated, killed, or dead cells, which are unrecognizable using classical microbiological methods, also possess functional properties; however, live cells are more efficacious .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
The main cause of AA is believed to be the damage to the hematopoietic stem cells (HSC) by autoreactive cytotoxic T-lymphocytes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC9429973
He reports fatigue, weight loss, fever and heaviness in the left hypochondrium.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "He", "reports", "fatigue", ",", "weight", "loss", ",", "fever", ...
PMC11700340
The cytotoxicity exhibited a time-dependent pattern (cell cycle specific).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cytotoxicity", "exhibited", "a", "time-dependent", "pattern", "(", "cell", "cycle", ...
PMC9429973
Cladribine (2-chloro-2’-deoxyadenosine (2-CdA)), is a purine nucleoside antimetabolite analog, which resists degradation by adenosine deaminase and therefore accumulates to cytotoxic levels.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11591038
Conceivably, it seems reasonable to predict that HIF-1 activation may exert beneficial effects against AD by enhancing angiogenesis or augmenting cerebral blood flow.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC5600151
G2 PAMAM is able to complex with DNA, but the transfection efficiency is lower than G3–G5 .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "G2", "PAMAM", "is", "able", "to", "complex"...
PMC11786156
Many cells are in close contact with neighboring cells, suggesting frequent adhesion.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Many", "cells", "are", "in", "close", "contact", "with", "neighboring", ...
PMC9712534
A region that forms an ATP-lid structure in yeast TOP2 is underlined.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "region", "that", "forms", "an", "ATP-lid", "structure", "in", "yeast", ...
PMC11635087
The photochemical efficiency of photosystem II (PSII) in isolated chloroplasts was subsequently quantified using a Double-Modulation Fluorometer FL 3500 to determine the maximum quantum yield of PSII (Fv/Fm).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11476004
The alkaline comet test does not require an in vitro cell culture.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "alkaline", "comet", "test", "does", "not", "require", "an", "in", "...
PMC11419566
An emerging method for treating tumors is genetic therapy, which involves modifying and suppressing cancer genes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "An", "emerging", "method", "for", "treating", ...
PMC7917457
This discrepancy in transgene expression patterns between the two viruses may induce some differences in immune activation by these viruses.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "discrepancy", "in", ...
PMC11477621
H NMR (400 MHz, CDCl3) δ 8.07 (s, 1H), 7.77–7.71 (overlap, 2H), 7.26 (s, 1H), 7.16 (dd, J = 8.6, 5.8 Hz, 1H), 7.11–7.05 (overlap, 3H), 6.96 (dd, J = 4.0, 1.7 Hz, 1H), 6.54–6.47 (overlap, 2H), 6.16 (dd, J = 4.1, 2.6 Hz, 1H), 5.54 (s, 2H), 4.54 (t, J = 7.0 Hz, 2H), 3.22 (t, J = 7.0 Hz, 2H), 2.39 (s, 3H).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10170482
We previously thoroughly characterized collagen scaffolds and determined their structure, porosity, diffusivity, and viscoelastic properties.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "previously", "thoroughly", "characteri...
PMC10142392
The micelles showed high drug loading capacity, and 26% of the drug was released in simulated gastric fluid (SGF, pH 1.2) over 48 h, whereas the maximum drug release was 98% in simulated intestinal fluid (SIF, pH 7.4).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11448304
Lysine acetylation is one of the most extensive protein post-translational modifications (PTMs)), influencing multiple cellular processes, including transcription, metabolism, signal transduction, and protein function [11–13].
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11532793
Third, we consider whether the number of technical samples can be reduced without materially affecting the results.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Third", ",", "we", "consider", "whethe...
PMC10713411
The unpaired t-test was utilized to determine the mean value differences between two groups of data.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "unpaired", "t-test", "was", "utilized", "to", ...
PMC9429973
For the randomization portion, the primary endpoint is relapse-free survival; secondary outcomes include OS, minimal residual disease conversion, and improvement in quality of life.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Despite treatment efficacy, improvement in energy levels is not guaranteed and many patients’ lives are impacted by fatigue.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Despite", "treatment", "effi...
PMC10926885
The Immune Checkpoint Genes module of Sangerbox Online was then used to examine the link between NDE1 and several immune checkpoint genes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Immun...
PMC11789597
p‐values were calculated with unpaired two‐sided Student t‐test or one‐way ANOVA test.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "p‐values", "were", "calculated", "with", "unpaired", "two‐sided", "Student", "t‐test",...
PMC9503541
The cytotoxicity results were consistent with the scratch assay results, since the fractions were observed to effectively prevent A549 cancer cells from healing the wound.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "...
PMC11321678
Then these values were used to minus matched average reference cells log2(fold change).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Then", "these", "values", "were", "used", "to", "minus", "matche...
PMC9429973
We show that it acts via repression of HARAKIRI (HRK).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "show", "that", "it", "acts", "via", "repression", "of", "HARAKIRI", ...
PMC10607604
RPP30 was used as a housekeeping gene.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "RPP30", "was", "used", "as", "a", "housekeeping", "gene", "." ] } ]
PMC11754436
Other research has shown that miRNA-449a promoted OS cell apoptosis by downregulating Bcl2 expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Other", "research", "has", "shown", "that", "miRNA-449a", "promoted", ...
PMC9429973
Similar effects were also observed in ITP mice.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Similar", "effects", "were", "also", "observed", "in", "ITP", "mice", "." ] } ]
PMC10772747
By inhibiting PI3K, compounds in EBE can prevent the formation of PIP3 and the downstream activation of the PI3K-Akt pathway.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "inhibi...
PMC11752740
In the cancer group receiving the combined treatment for 48 h, NF-κB P65 gene expression dropped dramatically by approximately 91% compared to the control group.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7433824
Fortunately, there exist many preclinical and even clinical data that showed agents capable to enhance the antineoplastic of P4 analogs including MPA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fortuna...
PMC11527437
The identification of optimal TCRs to use and tumor antigens to target are key considerations for TCR-T. In this issue of the JCI, Bear and colleagues report on their use of in vitro assays to characterize four HLA-A*03:01– or HLA-A*11:01–restricted TCRs targeting the oncogenic KRAS G12V mutation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Compared to the MK-ITP group, gp130 was higher on Day 10 in the MK-ITP+IL-35 group (P=0.017).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compared", "to", "the", "MK-ITP",...
PMC11676169
Forty hours after transfection, cells were lysed in modified NETN lysis buffer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Forty", "hours", "after", "transfection", ",", "cells", "were", "lysed", ...
PMC9917080
An increase in the time of incubation of cortical astrocytes with So (from 0.5 μg/mL to 5 μg/mL) up to 48 h did not cause a significant induction of apoptosis—at early and late stages of apoptosis, no more than 10% of cells were registered.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11266100
Tao and colleagues characterized the luciferase-expressing 4T1 cell line transfected with vectors in a female BALB/c mice model by conducting a 6-week study of primary tumor growth and metastasis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "...
PMC9429973
Among AML cases, the blasts of 32 patients (39%) were CD9+.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Among", "AML", "cases", ",", "the", "blasts", "o...
PMC7090062
As shown in Fig. 2a, b, qRT-PCR analysis confirmed that the miR-30a level was higher in the miR-30a mimic transfected group compared with those in the NC group, and also that the miR-30a inhibitor effectively inhibited miR-30a expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Second course was delivered to 57% of these patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Second", "course", "was", "delivered", "to", "57", "%", "of", "these", "patients", "." ...
PMC6442998
de Waal et al. identified cancer-cytotoxic modulators of PDE3A by predictive chemogenomics and demonstrated in HeLa cells that the strong viability reduction observed in cancer cell lines with the non-catalytic inhibitor DNMDP, was induced by an original neomorphic interaction between PDE3A and the protein Schlafen 12 (SLFN12) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Results: To evaluate if CDK7 inhibition suppresses glycolysis we assessed control and treated cells during a glycolysis stress test with Seahorse analyzer using extracellular acidification rate (ECAR) as a measure of glycolytic activity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11297139
ARID1A undergoes phase separation at EWS/FLI1-bound enhancers and forms condensates, which compartmentalize BAF complex subunits, leading to chromatin remodeling and transcriptional activation of oncogenes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11786767
However, it remains unclear whether specific lipids are involved in forming the perichromosomal layer or if lipid-specific metabolism affects chromosome segregation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",...
PMC9429973
Results: Twenty-four pediatric (age 1-17 y) and 5 young adult (age 18-30 y) ALL patients and 10 LL patients (age 1-30 y) received ≥1 DARA dose.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6442998
After drug treatments, cell medium was removed and 1ml of HCl 0.1M was added.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "drug", "treatments", ",", "cell", "medium", ...
PMC9429973
RUX initiation dosage was ≥20 mg twice/daily (bid) for approximately 50% of patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "RUX", "initiation", "dosage", "was", "≥20", "mg", ...
PMC11126803
This is because these two cell lines not only represent the low and high expression of LncRNA-SERB, but also the gene ESR2, which is closely related to LncRNA-SERB, also shows low and high expression in these two cell lines (Fig. S6A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11585254
Coelenterazine-h was added to each well (final concentration 1 μM) in phenol red-free DMEM containing 20 mM HEPES and incubated while covered at room temperature for 5 minutes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6901583
Quantitative real-time PCR (qRT-PCR) was performed as previously described.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Quantitative", "real-time", "PCR", "(", "qRT-PCR", ")", "was", "performed", "as", "pr...
PMC9429973
This PDX is very aggressive, and mice die from disease by 20 weeks.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "PDX", "is", "very", "aggressive", ",", "and", "mice", ...
PMC11569208
Top hits from the high-throughput screen were validated in 786-0 cells using a similar protocol.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Top", "hits", "from", "the",...
PMC4485648
It can also diminish transcription and protein level of the HIF-1 target, CA IX, which protects tumor cells from hypoxia-induced pH imbalance and facilitates their migration/invasion.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11352746
An analysis of 45 publications utilizing IncuCyte systems revealed trends in the experimental conditions, including the choice of well plate, cell density, neuron type, correlative experiments, microscopy techniques, and imaging duration.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11295144
To test whether these receptors can induce the adhesion of GABAergic terminals, the HEK293 cell line or control HEK293 cells were transiently transfected with GFP and co-cultured with the medium spiny neurons (Figure 2A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "...
PMC9429973
Aims: The aim of the work was to study hematopoietic niche in MM patients with different treatment outcome.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aims", ":", "The", "aim", "...
PMC10999934
Table 1The key characteristics of the datasets in this study.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Table", "1The", "key", "characteristics", "of", "the", "datasets", "in", "this", "study", ...
PMC11672142
In this work, we synthesize the dual chelator deferasirox N-ethyleneamine triapine (DefNEtTrp) and explore its Fe(III) complexation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "this", "wor...
PMC11650848
Genotype analysis performed by allele quantification (AQ).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Genotype", "analysis", "performed", "by", "allele", "quantification", "(", "AQ", ")", "." ] } ]
PMC6642070
3p53/β-enolase axis mediates statin-induced lactate production (a) Dose effect (48 h) and (b) time-course (10 μM) of fluvastatin on the protein levels of p53 and β-enolase in A-204 cells and C2C12 myotubes. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9031474
Muzigadial (26) exhibited three-to-five-fold higher activities than polygodial (2).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Muzigadial", "(", "26", ")", "exhibited", "three-to-five-fold", "higher", "...
PMC11632064
As an alternative approach, we silenced PLK1 in MeWo and A-375 cells (Fig 4H).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O" ], "tokens": [ "As", "an", "alternative", "approach",...
PMC11495567
The identity of NCI-H23 cells was confirmed by DNA fingerprinting, and the presence of the KRAS mutation was confirmed by localized sequencing, with NCI-H23 cells possessing a point mutation in codon 246 of the p53 gene alongside the expression of PDGF A and B chains.
[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLin...
PMC9780037
Their conjunction holds valuable promise in improving drug stability, and consequently, their performance, as the ionic liquids can also improve thermal and chemical stability of nanoparticles .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11683130
As mentioned earlier, many members of the serpin family are expressed in the skin, which play a an important role in regulating epidermal barrier and maintain skin homeostasis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
F. Haddad, H. Kantarjian, N. Short, F. Ravandi, N. Jain, W. Macaron, T. Kadia, Y. Alvarado, N. Daver, G. Borthakur, C. DiNardo, M. Konopleva, W. Wierda, J. Jacob, E. Roy, C. Loiselle, A. Milton, J. Rivera, R. Garris, E. Jabbour Leukemia, The University of Texas MD Anderson Cancer Center, Houston, United States of America Background: Blinatumomab (Blina) and inotuzumab ozogamicin (INO) improve the outcomes of patients (pts) with relapsed/refractory B-cell acute lymphoblastic leukemia (B-ALL).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11252033
CryZ exhibits enzymatic activity, particularly acting as NADPH dependent quinone reductase.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CryZ", "exhibits", "enzymatic", "activity", ",", "particularly", "acting", "as", ...
PMC10723784
Previous studies have also suggested the potential of cannabinoids in clinical therapies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Previous", "studies", "have", "also", "suggested", "the", "potential", "of", "ca...
PMC11774747
However, one study also highlighted a potential risk of cytokine release syndrome (CRS), evidenced by significantly elevated levels of human-specific IFN-γ and IL-6 in the serum of mice (92).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7039683
Raw ATAC-seq reads were trimmed using Trimmomatic (v 0.38) (Bolger et al., 2014) (parameter: ILLUMINACLIP:NexteraPE-PE.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:5) and mapped to either the danRer7, hg19 or mm10 reference genome using Bowtie 2 (Langmead and Salzberg, 2012) (default parameters).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8345486
Anticancer activities of adenine nucleoside modifications with metalla bis(dicarbollides) were evaluated using ovarian carcinoma cell lines that differed in cisplatin sensitivity, ranging from high sensitivity to high refractoriness: sensitive (A2780 and OVCAR-3) > moderately resistant (A2780cis) > resistant (A2780cisR and SKOV-3) > highly resistant (A2780cisKB).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11453346
A. Odermatt: None.
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "A.", "Odermatt", ":", "None", "." ] } ]
PMC9429973
Aims: In our study we try to assess the influence of different types of immunosuppressive regimens on recovery of the CMV-specific CD8+ T cells in patients after allo-HSCT.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11469524
As oftentimes not all nodes can be measured and perturbed, in STASNet we solve the underdetermined situation threefold: (i) we only fit entries of R that were measured, (ii) we utilize prior knowledge by using a literature-derived starting network (i.e., a binary representation of r), with which we symbolically fill the entries of r and (iii) we apply gaussian elimination to derive identifiable combinations of r. The parameters of the model are the entries of r and p, termed local response coefficients, and perturbation coefficients, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11627398
Meanwhile, the AUC of ROC curves for SLC31A1 and LIAS genes were higher than 0.7 in two cohorts, suggesting that these two genes had acceptable diagnostic performances .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC3915447
In both pathways, an apoptotic death stimulus results in the activation of caspases, the major executioners of this process, either directly or via activation of the mitochondrial death program (16, 17).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8978939
Its coding sequence spans three exons and encodes a 213-amino acid protein (pVHL) widely expressed in human tissues (4, 6).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC2614415
Confirmation of increased mRNA by QRT-PCR.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Confirmation", "of", "increased", "mRNA", "by", "QRT-PCR", "." ] } ]
PMC11422150
The hind limb’s motor function was assessed using the Basso mouse locomotor scale (BMS) and the Basso–Beattie–Bresnahan (BBB) score.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
The ratio of CD3/CD34 infused cells, the neutrophil-to-lymphocyte (NLR), lymphocyte-to-monocyte (LMR) and fibrinogen to albumin (FTA) ratios at the onset of GI-GVHD were analyzed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9454852
However, this feature could be utilized as a therapeutic target by further increasing the ER stress .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "this", "feature", "could", ...
PMC11767817
It was reported that MK-2206, by decreasing the expression levels of GRP78 protein, might affect curcumin-mediated GRP78 induction, which finally led to Akt activity decreasing in human nasopharyngeal carcinoma cells .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11746948
It has been reported that GPX4-R152H mutation is associated with SSMD due to a partial loss of GPX4 function, but this variant is less prone to degradation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10772747
It is essential to identify target compounds and understand their mechanisms of action in inhibiting cancer cell growth (Poornima et al., 2016).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11323699
and treated with vehicle (n = 9), olaparib alone (50 mg/kg, per os, daily for 2 weeks, n = 20) or sequentially with olaparib (50 mg/kg, per os, daily for 2 weeks) followed by TAX2 (30 to 100 mg/kg, IV, 3 times weekly for 4 weeks) (n = 8 per TAX2 dosing).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9910796
This cassette bears the following relevant elements: E. coli lacI repressor coding gene under the control of the U104L early/late viral promoter, a beta-glucuronidase gene under the control of the strong late viral p72.4 promoter and finally, the inducible p72 derived promoter p72I*. The inducible cassette was PCR amplified using high fidelity Q5 polymerase (New England Biolabs) and oligonucleotides AH339 (5’-CGGTACCCGGGGATCGCGGCCGCTCGACGGATTTTAATTAGATTTGTG) and AH340 (5’-CGACTCTAGAGGATCTTAATTAATTGTTATCCGCTCACAATTTATATAATG) and plasmid pE199Li as a template.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Lemzo is an anti-CD47 antibody with red blood cell–sparing properties.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Lemzo", "is", "an", "anti-CD47", "antibody", "with", "red", "blood", "cell", ...
PMC11267830
The arrow indicates the plot of custom primers used to detect exon skipping.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "arrow", "indicates", "the", "plot", "of", "custom", "primers", ...
PMC11001582
This ECM signature appears to be driven, at least in part, by TGF-β1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "ECM", "signature", "appears", "to", "be", "driven",...
PMC11377827
Lentiviral sgRNA inserts were amplified in a two-step PCR (with Illumina adaptors added on the second PCR).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Lentiviral", "sgRNA", "inserts", ...